Pattern-formation mechanisms in motility mutants of Myxococcus xanthus

PubMed Central

Starruß, Jörn; Peruani, Fernando; Jakovljevic, Vladimir; Søgaard-Andersen, Lotte; Deutsch, Andreas; Bär, Markus

2012-01-01

Formation of spatial patterns of cells is a recurring theme in biology and often depends on regulated cell motility. Motility of the rod-shaped cells of the bacterium Myxococcus xanthus depends on two motility machineries, type IV pili (giving rise to S-motility) and the gliding motility apparatus (giving rise to A-motility). Cell motility is regulated by occasional reversals. Moving M. xanthus cells can organize into spreading colonies or spore-filled fruiting bodies, depending on their nutritional status. To ultimately understand these two pattern-formation processes and the contributions by the two motility machineries, as well as the cell reversal machinery, we analyse spatial self-organization in three M. xanthus strains: (i) a mutant that moves unidirectionally without reversing by the A-motility system only, (ii) a unidirectional mutant that is also equipped with the S-motility system, and (iii) the wild-type that, in addition to the two motility systems, occasionally reverses its direction of movement. The mutant moving by means of the A-engine illustrates that collective motion in the form of large moving clusters can arise in gliding bacteria owing to steric interactions of the rod-shaped cells, without the need of invoking any biochemical signal regulation. The two-engine strain mutant reveals that the same phenomenon emerges when both motility systems are present, and as long as cells exhibit unidirectional motion only. From the study of these two strains, we conclude that unidirectional cell motion induces the formation of large moving clusters at low and intermediate densities, while it results in vortex formation at very high densities. These findings are consistent with what is known from self-propelled rod models, which strongly suggests that the combined effect of self-propulsion and volume exclusion interactions is the pattern-formation mechanism leading to the observed phenomena. On the other hand, we learn that when cells occasionally reverse

Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development

PubMed Central

Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2003-01-01

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development. PMID:12754229

Describing Myxococcus xanthus Aggregation Using Ostwald Ripening Equations for Thin Liquid Films

PubMed Central

Bahar, Fatmagül; Pratt-Szeliga, Philip C.; Angus, Stuart; Guo, Jiaye; Welch, Roy D.

2014-01-01

When starved, a swarm of millions of Myxococcus xanthus cells coordinate their movement from outward swarming to inward coalescence. The cells then execute a synchronous program of multicellular development, arranging themselves into dome shaped aggregates. Over the course of development, about half of the initial aggregates disappear, while others persist and mature into fruiting bodies. This work seeks to develop a quantitative model for aggregation that accurately simulates which will disappear and which will persist. We analyzed time-lapse movies of M. xanthus development, modeled aggregation using the equations that describe Ostwald ripening of droplets in thin liquid films, and predicted the disappearance and persistence of aggregates with an average accuracy of 85%. We then experimentally validated a prediction that is fundamental to this model by tracking individual fluorescent cells as they moved between aggregates and demonstrating that cell movement towards and away from aggregates correlates with aggregate disappearance. Describing development through this model may limit the number and type of molecular genetic signals needed to complete M. xanthus development, and it provides numerous additional testable predictions. PMID:25231319

A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis.

PubMed

Burchard, R P; Dworkin, M

1966-03-01

Burchard, Robert P. (University of Minnesota, Minneapolis), and M. Dworkin. A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis. J. Bacteriol. 91:1305-1313. 1966.-A bacteriophage (MX-1) infecting Myxococcus xanthus FB(t) has been isolated from cow dung. The bacteriophage particle is approximately 175 mmu long. A tail about 100 mmu in length is encased in a contractile sheath and terminates in a tail plate. The head is polyhedral with a width of about 75 mmu. The nucleic acid of the bacteriophage is deoxyribonucleic acid and has a guanine plus cytosine content of 55.5%. The bacteriophage requires 10(-3)m Ca(++) and 10(-2)m monovalent cation for optimal adsorption. Grown on vegetative cells of M. xanthus FB(t) at 30 C in 2% Casitone medium, the bacteriophage has a latent period of 120 min and a burst size of approximately 100. Host range studies indicate that three strains of M. xanthus including a morphogenetic mutant are sensitive to the bacteriophage, whereas M. fulvus, Cytophaga, Sporocytophaga myxococcoides, and a fourth strain of M. xanthus are not. Of the two cellular forms characteristic of the Myxococcus life cycle, the bacteriophage infect only the vegetative cells; they do not adsorb to microcysts. Ability to adsorb bacteriophage is lost between 65 and 75 min after initiation of the relatively synchronous conversion of vegetative cells to microcysts. The bacteriophage does not adsorb to spheroplasts. After the appearance of visible morphogenesis and before the loss of bacteriophage receptor sites, addition of bacteriophage results in the formation of microcysts which give rise to infective centers only upon germination. The possibility that the infected microcysts are harboring intact bacteriophages has been eliminated.

Fatty Acid Oxidation Is Required for Myxococcus xanthus Development.

PubMed

Bullock, Hannah A; Shen, Huifeng; Boynton, Tye O; Shimkets, Lawrence J

2018-05-15

Myxococcus xanthus cells produce lipid bodies containing triacylglycerides during fruiting body development. Fatty acid β-oxidation is the most energy-efficient pathway for lipid body catabolism. In this study, we used mutants in fadJ (MXAN_5371 and MXAN_6987) and fadI (MXAN_5372) homologs to examine whether β-oxidation serves an essential developmental function. These mutants contained more lipid bodies than the wild-type strain DK1622 and 2-fold more flavin adenine dinucleotide (FAD), consistent with the reduced consumption of fatty acids by β-oxidation. The β-oxidation pathway mutants exhibited differences in fruiting body morphogenesis and produced spores with thinner coats and a greater susceptibility to thermal stress and UV radiation. The MXAN_5372/5371 operon is upregulated in sporulating cells, and its expression could not be detected in csgA , fruA , or mrpC mutants. Lipid bodies were found to persist in mature spores of DK1622 and wild strain DK851, suggesting that the roles of lipid bodies and β-oxidation may extend to spore germination. IMPORTANCE Lipid bodies act as a reserve of triacylglycerides for use when other sources of carbon and energy become scarce. β-Oxidation is essential for the efficient metabolism of fatty acids associated with triacylglycerides. Indeed, the disruption of genes in this pathway has been associated with severe disorders in animals and plants. Myxococcus xanthus , a model organism for the study of development, is ideal for investigating the complex effects of altered lipid metabolism on cell physiology. Here, we show that β-oxidation is used to consume fatty acids associated with lipid bodies and that the disruption of the β-oxidation pathway is detrimental to multicellular morphogenesis and spore formation. Copyright © 2018 American Society for Microbiology.

Purification and Properties of Myxococcus xanthus C-Factor, an Intercellular Signaling Protein

NASA Astrophysics Data System (ADS)

Kim, Seung K.; Kaiser, Dale

1990-05-01

C-factor, a Myxococcus xanthus protein that restores the developmental defects of a class of nonautonomous mutants resulting from mutation of the csgA gene, has been purified approximately 1000-fold from starved wild-type cells. The monomeric form of C-factor is a single polypeptide with a molecular mass of 17 kDa that can be solubilized by detergent from membrane components. Characterization by gel filtration and denaturing gel electrophoresis suggests that biologically active C-factor is a dimer composed of two 17-kDa monomers. Antibodies against a form of the M. xanthus csgA gene product overexpressed in Escherichia coli react with purified C-factor.

Identification of Major Enzymes Involved in the Synthesis of Diadenosine Tetraphosphate and/or Adenosine Tetraphosphate in Myxococcus xanthus.

PubMed

Kimura, Yoshio; Tanaka, Chihiro; Oka, Manami

2018-07-01

Myxococcus xanthus generates diadenosine tetraphosphates (Ap 4 A) and diadenosine pentaphosphates (Ap 5 A) under various stress conditions. M. xanthus lysyl-tRNA synthetase (LysS) efficiently synthesizes Ap 4 A from ATP, Ap 5 A from ATP and adenosine tetraphosphate (Ap 4 ), and Ap 4 from ATP and triphosphate. To identify other M. xanthus enzymes that can catalyze Ap 4 A and Ap 4 synthesis, 15 M. xanthus aminoacyl-tRNA synthetases (aaRSs), four acyl-CoA synthetases (Acys), three acetyl-CoA synthetases (Aces), phosphoglycerate kinase (Pgk), and adenylate kinase (Adk) were expressed in Escherichia coli and examined for Ap 4 A or Ap 4 synthetase activity using ATP or ATP and triphosphate as substrates. Among the tested enzymes, LysS had the highest Ap 4 A synthetase activity. AlaRS, SerRS, and LeuRS1 showed high ADP synthetase activity with ATP as a substrate in the presence of pyrophosphatase, and also demonstrated the ability to produce Ap 4 from ATP and triphosphate in the absence of pyrophosphatase. Ap 4 formation by AlaRS, SerRS, and LeuRS1 was approximately 4- to 13-fold higher compared with that of Ap 4 A, suggesting that these enzymes prefer triphosphate over ATP as a substrate in the second reaction. Some of the recombinant M. xanthus Acys and Aces also synthesized Ap 4 from ATP and triphosphate. However, Pgk was capable of catalyzing the production of Ap 4 from ATP and 3-phosphoglycerate in the presence of Mg 2+ and did not require triphosphate, suggesting that this enzyme is mainly responsible for Ap 4 synthesis in M. xanthus.

The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

PubMed

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

Myxococcus xanthus induces actinorhodin overproduction and aerial mycelium formation by Streptomyces coelicolor

PubMed Central

Pérez, Juana; Muñoz‐Dorado, José; Braña, Alfredo F.; Shimkets, Lawrence J.; Sevillano, Laura; Santamaría, Ramón I.

2011-01-01

Summary Interaction of the predatory myxobacterium Myxococcus xanthus with the non‐motile, antibiotic producer Streptomyces coelicolor was examined using a variety of experimental approaches. Myxococcus xanthus cells prey on S. coelicolor, forming streams of ordered cells that lyse the S. coelicolor hyphae in the contact area between the two colonies. The interaction increases actinorhodin production by S. coelicolor up to 20‐fold and triggers aerial mycelium production. Other bacteria are also able to induce these processes in S. coelicolor though to a lesser extent. These studies offer new clues about the expression of genes that remain silent or are expressed at low level in axenic cultures and open the possibility of overproducing compounds of biotechnological interest by using potent inducers synthesized by other bacteria. PMID:21342463

Myxococcus xanthus Gliding Motors Are Elastically Coupled to the Substrate as Predicted by the Focal Adhesion Model of Gliding Motility

PubMed Central

Balagam, Rajesh; Litwin, Douglas B.; Czerwinski, Fabian; Sun, Mingzhai; Kaplan, Heidi B.; Shaevitz, Joshua W.; Igoshin, Oleg A.

2014-01-01

Myxococcus xanthus is a model organism for studying bacterial social behaviors due to its ability to form complex multi-cellular structures. Knowledge of M. xanthus surface gliding motility and the mechanisms that coordinated it are critically important to our understanding of collective cell behaviors. Although the mechanism of gliding motility is still under investigation, recent experiments suggest that there are two possible mechanisms underlying force production for cell motility: the focal adhesion mechanism and the helical rotor mechanism, which differ in the biophysics of the cell–substrate interactions. Whereas the focal adhesion model predicts an elastic coupling, the helical rotor model predicts a viscous coupling. Using a combination of computational modeling, imaging, and force microscopy, we find evidence for elastic coupling in support of the focal adhesion model. Using a biophysical model of the M. xanthus cell, we investigated how the mechanical interactions between cells are affected by interactions with the substrate. Comparison of modeling results with experimental data for cell-cell collision events pointed to a strong, elastic attachment between the cell and substrate. These results are robust to variations in the mechanical and geometrical parameters of the model. We then directly measured the motor-substrate coupling by monitoring the motion of optically trapped beads and find that motor velocity decreases exponentially with opposing load. At high loads, motor velocity approaches zero velocity asymptotically and motors remain bound to beads indicating a strong, elastic attachment. PMID:24810164

Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

PubMed

Cusick, John K; Hager, Elizabeth; Gill, Ronald E

2015-01-01

The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

LC-MS/MS profiling-based secondary metabolite screening of Myxococcus xanthus.

PubMed

Kim, Jiyoung; Choi, Jung Nam; Kim, Pil; Sok, Dai-Eun; Nam, Soo-Wan; Lee, Choong Hwan

2009-01-01

Myxobacteria, Gram-negative soil bacteria, are a well-known producer of bioactive secondary metabolites. Therefore, this study presents a methodological approach for the high-throughput screening of secondary metabolites from 4 wild-type Myxococcus xanthus strains. First, electrospray ionization mass spectrometry (ESI-MS) was performed using extracellular crude extracts. As a result, 22 metabolite peaks were detected, and the metabolite profiling was then conducted using the m/z value, retention time, and MS/MS fragmentation pattern analyses. Among the peaks, one unknown compound peak was identified as analogous to the myxalamid A, B, and C series. An analysis of the tandem mass spectrometric fragmentation patterns and HR-MS identified myxalamid K as a new compound derived from M. xanthus. In conclusion, LC-MS/MS-based chemical screening of diverse secondary metabolites would appear to be an effective approach for discovering unknown microbial secondary metabolites.

Identification and characterization of the Myxococcus xanthus bsgA gene product.

PubMed Central

Gill, R E; Bornemann, M C

1988-01-01

The bsgA mutants of Myxococcus xanthus are blocked at a very early stage of the developmental program. They fail to produce fruiting bodies or to sporulate under normal conditions but can be rescued by extracellular complementation in mixtures with wild-type cells. A bsgA-lacZ gene fusion was constructed and expressed in Escherichia coli. The resulting fusion protein, which has beta-galactosidase enzyme activity, was partially purified by affinity chromatography and preparative polyacrylamide gel electrophoresis. The protein was used to immunize mice, which produced a hybridoma secreting monoclonal antibody that was specific for the bsgA gene product. The monoclonal antibody was used in Western blot (immunoblot) experiments to determine the apparent cellular location of the bsgA protein in M. xanthus and to compare the level of this protein at various times in the Myxococcus life cycle. Images PMID:2846515

The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

PubMed Central

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

Quantifying Aggregation Dynamics during Myxococcus xanthus Development▿†

PubMed Central

Zhang, Haiyang; Angus, Stuart; Tran, Michael; Xie, Chunyan; Igoshin, Oleg A.; Welch, Roy D.

2011-01-01

Under starvation conditions, a swarm of Myxococcus xanthus cells will undergo development, a multicellular process culminating in the formation of many aggregates called fruiting bodies, each of which contains up to 100,000 spores. The mechanics of symmetry breaking and the self-organization of cells into fruiting bodies is an active area of research. Here we use microcinematography and automated image processing to quantify several transient features of developmental dynamics. An analysis of experimental data indicates that aggregation reaches its steady state in a highly nonmonotonic fashion. The number of aggregates rapidly peaks at a value 2- to 3-fold higher than the final value and then decreases before reaching a steady state. The time dependence of aggregate size is also nonmonotonic, but to a lesser extent: average aggregate size increases from the onset of aggregation to between 10 and 15 h and then gradually decreases thereafter. During this process, the distribution of aggregates transitions from a nearly random state early in development to a more ordered state later in development. A comparison of experimental results to a mathematical model based on the traffic jam hypothesis indicates that the model fails to reproduce these dynamic features of aggregation, even though it accurately describes its final outcome. The dynamic features of M. xanthus aggregation uncovered in this study impose severe constraints on its underlying mechanisms. PMID:21784940

Cell Alignment Required in Differentiation of Myxococcus xanthus

NASA Astrophysics Data System (ADS)

Kim, Seung K.; Kaiser, Dale

1990-08-01

During fruiting body morphogenesis of Myxococcus xanthus, cell movement is required for transmission of C-factor, a short range intercellular signaling protein necessary for sporulation and developmental gene expression. Nonmotile cells fail to sporulate and to express C-factor-dependent genes, but both defects were rescued by a simple manipulation of cell position that oriented the cells in aligned, parallel groups. A similar pattern of aligned cells normally results from coordinated recruitment of wild-type cells into multicellular aggregates, which later form mature fruiting bodies. It is proposed that directed cell movement establishes critical contacts between adjacent cells, which are required for efficient intercellular C-factor transmission.

Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production

PubMed Central

Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B.; Igoshin, Oleg A.

2016-01-01

Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher’s equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase–a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics. PMID:27362260

Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

PubMed

Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A

2016-06-01

Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

Social complementation and growth advantages promote socially defective bacterial isolates.

PubMed

Kraemer, Susanne A; Velicer, Gregory J

2014-04-22

Social interactions among diverse individuals that encounter one another in nature have often been studied among animals but rarely among microbes. For example, the evolutionary forces that determine natural frequencies of bacteria that express cooperative behaviours at low levels remain poorly understood. Natural isolates of the soil bacterium Myxococcus xanthus sampled from the same fruiting body often vary in social phenotypes, such as group swarming and multicellular development. Here, we tested whether genotypes highly proficient at swarming or development might promote the persistence of less socially proficient genotypes from the same fruiting body. Fast-swarming strains complemented slower isolates, allowing the latter to keep pace with faster strains in mixed groups. During development, one low-sporulating strain was antagonized by high sporulators, whereas others with severe developmental defects had those defects partially complemented by high-sporulating strains. Despite declining in frequency overall during competition experiments spanning multiple cycles of development, developmentally defective strains exhibited advantages during the growth phases of competitions. These results suggest that microbes with low-sociality phenotypes often benefit from interacting with more socially proficient strains. Such complementation may combine with advantages at other traits to increase equilibrium frequencies of low-sociality genotypes in natural populations.

Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

PubMed

Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

2017-08-16

The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

Enzymatic characterization of a class II lysyl-tRNA synthetase, LysS, from Myxococcus xanthus.

PubMed

Oka, Manami; Takegawa, Kaoru; Kimura, Yoshio

2015-08-01

Lysyl-tRNA synthetases efficiently produce diadenosine tetraphosphate (Ap4A) from lysyl-AMP with ATP in the absence of tRNA. We characterized recombinant class II lysyl-tRNA synthetase (LysS) from Myxococcus xanthus and found that it is monomeric and requires Mn(2+) for the synthesis of Ap4A. Surprisingly, Zn(2+) inhibited enzyme activity in the presence of Mn(2+). When incubated with ATP, Mn(2+), lysine, and inorganic pyrophosphatase, LysS first produced Ap4A and ADP, then converted Ap4A to diadenosine triphosphate (Ap3A), and finally converted Ap3A to ADP, the end product of the reaction. Recombinant LysS retained Ap4A synthase activity without lysine addition. Additionally, when incubated with Ap4A (minus pyrophosphatase), LysS converted Ap4A mainly ATP and AMP, or ADP in the presence or absence of lysine, respectively. These results demonstrate that M. xanthus LysS has different enzymatic properties from class II lysyl-tRNA synthetases previously reported. Copyright © 2015 Elsevier Inc. All rights reserved.

Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

PubMed

Jung, Sunyo; Back, Kyoungwhan

2005-05-01

We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

High concentrations of intracellular Ap4A and/or Ap5A in developing Myxococcus xanthus cells inhibit sporulation.

PubMed

Kimura, Yoshio; Tanaka, Chihiro; Sasaki, Katsuho; Sasaki, Masashi

2017-01-01

Diadenosine polyphosphates (ApnA) are thought to act as signalling molecules regulating stress responses and biofilm formation in prokaryotes. However, ApnA function in Myxococcus xanthus remains unknown. Here, we investigated the role of ApnA in M. xanthus, using the wild-type and ApnA hydrolase (apaH) mutant strains exposed to various stress conditions. In both wild-type and apaH mutant cells cultured on starvation medium (CF agar), the levels of intracellular diadenosine tetraphosphate (Ap4A) and pentaphosphate (Ap5A) increased several fold during the first 16 h of development and decreased gradually thereafter. The levels of Ap4A and Ap5A in the apaH mutant were about 5- and 11-fold higher than those in the wild-type strain at 16 h, respectively. ApnA hydrolase activity of the wild-type strain increased 1.5-fold during the first 8 h of development, and it then gradually decreased. The apaH mutant formed spores 1-2 days after the wild-type strain did, and the yield of viable spores was 5.5 % of that in the wild-type strain 5 days after inoculation onto CF agar. These results suggest the possibility that high intracellular levels of Ap4A and/or Ap5A may inhibit M. xanthus sporulation at the early stage of development and that the bacteria reduce intracellular Ap4A and Ap5A accumulation through ApnA hydrolase activity.

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development

PubMed Central

Rajagopalan, Ramya

2017-01-01

ABSTRACT Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI, a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT. We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and Dev

The guanosine nucleotide (p)ppGpp initiates development and A-factor production in myxococcus xanthus.

PubMed

Harris, B Z; Kaiser, D; Singer, M

1998-04-01

Guanosine 3'-di-5'-(tri)di-phosphate nucleotides [(p)ppGpp], synthesized in response to amino acid limitation, induce early gene expression leading to multicellular fruiting body formation in Myxococcus xanthus. A mutant (DK527) that fails to accumulate (p)ppGpp in response to starvation was found to be blocked in development prior to aggregation. By use of a series of developmentally regulated Tn5lac transcriptional fusion reporters, the time of developmental arrest in DK527 was narrowed to within the few hours of development, the period of starvation recognition. The mutant is also defective in the production of A-factor, an early extracellular cell-density signal. The relA gene from Escherichia coli, which encodes a ribosome-dependent (p)ppGpp synthetase, rescues this mutant. We also demonstrate that inactivation of the M. xanthus relA homolog blocks development and the accumulation of (p)ppGpp. Moreover, the wild-type allele of Myxococcus relA rescues DK527. These observations support a model in which accumulation of (p)ppGpp, in response to starvation, initiates the program of fruiting body development, including the production of A-factor.

Profiling the outer membrane proteome during growth and development of the social bacterium Myxococcus xanthus by selective biotinylation and analyses of outer membrane vesicles.

PubMed

Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner

2010-10-01

Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.

Enzymatic characteristics of an ApaH-like phosphatase, PrpA, and a diadenosine tetraphosphate hydrolase, ApaH, from Myxococcus xanthus.

PubMed

Sasaki, Masashi; Takegawa, Kaoru; Kimura, Yoshio

2014-09-17

We characterized the activities of the Myxococcus xanthus ApaH-like phosphatases PrpA and ApaH, which share homologies with both phosphoprotein phosphatases and diadenosine tetraphosphate (Ap4A) hydrolases. PrpA exhibited a phosphatase activity towards p-nitrophenyl phosphate (pNPP), tyrosine phosphopeptide and tyrosine-phosphorylated protein, and a weak hydrolase activity towards ApnA and ATP. In the presence of Mn(2+), PrpA hydrolyzed Ap4A into AMP and ATP, whereas in the presence of Co(2+) PrpA hydrolyzed Ap4A into two molecules of ADP. ApaH exhibited high phosphatase activity towards pNPP, and hydrolase activity towards ApnA and ATP. Mn(2+) was required for ApaH-mediated pNPP dephosphorylation and ATP hydrolysis, whereas Co(2+) was required for ApnA hydrolysis. Thus, PrpA and ApaH may function mainly as a tyrosine protein phosphatase and an ApnA hydrolase, respectively. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

The Myxococcus xanthus Spore Cuticula Protein C Is a Fragment of FibA, an Extracellular Metalloprotease Produced Exclusively in Aggregated Cells

PubMed Central

Lee, Bongsoo; Mann, Petra; Grover, Vidhi; Treuner-Lange, Anke; Kahnt, Jörg; Higgs, Penelope I.

2011-01-01

Myxococcus xanthus is a soil bacterium with a complex life cycle involving distinct cell fates, including production of environmentally resistant spores to withstand periods of nutrient limitation. Spores are surrounded by an apparently self-assembling cuticula containing at least Proteins S and C; the gene encoding Protein C is unknown. During analyses of cell heterogeneity in M. xanthus, we observed that Protein C accumulated exclusively in cells found in aggregates. Using mass spectrometry analysis of Protein C either isolated from spore cuticula or immunoprecipitated from aggregated cells, we demonstrate that Protein C is actually a proteolytic fragment of the previously identified but functionally elusive zinc metalloprotease, FibA. Subpopulation specific FibA accumulation is not due to transcriptional regulation suggesting post-transcriptional regulation mechanisms mediate its heterogeneous accumulation patterns. PMID:22174937

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

PubMed

Rajagopalan, Ramya; Kroos, Lee

2017-05-15

Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Myxococcus xanthus Swarms Are Driven by Growth and Regulated by a Pacemaker ▿

PubMed Central

Kaiser, Dale; Warrick, Hans

2011-01-01

The principal social activity of Myxococcus xanthus is to organize a dynamic multicellular structure, known as a swarm. Although its cell density is high, the swarm can grow and expand rapidly. Within the swarm, the individual rod-shaped cells are constantly moving, transiently interacting with one another, and independently reversing their gliding direction. Periodic reversal is, in fact, essential for creating a swarm, and the reversal frequency controls the rate of swarm expansion. Chemotaxis toward nutrient has been thought to drive swarming, but here the nature of swarm growth and the impact of genetic deletions of members of the Frz family of proteins suggest otherwise. We find that three cytoplasmic Frz proteins, FrzCD, FrzF, and FrzE, constitute a cyclic pathway that sets the reversal frequency. Within each cell these three proteins appear to be connected in a negative-feedback loop that produces oscillations whose frequencies are finely tuned by methylation and by phosphorylation. This oscillator, in turn, drives MglAB, a small G-protein switch, to oscillate between its GTP- and GDP-bound states that ultimately determine when the cell moves forward or backward. The periodic reversal of interacting rod-shaped cells promotes their alignment. Swarm organization ensures that each cell can move without blocking the movement of others. PMID:21856842

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage.

PubMed

Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel

2016-01-19

Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage

PubMed Central

Dey, Arup; Vassallo, Christopher N.; Conklin, Austin C.; Pathak, Darshankumar T.; Troselj, Vera

2016-01-01

ABSTRACT Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large “polyploid prophage,” Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population “addicted” to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. IMPORTANCE The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their

Two-Component Signal Transduction Systems That Regulate the Temporal and Spatial Expression of Myxococcus xanthus Sporulation Genes.

PubMed

Sarwar, Zaara; Garza, Anthony G

2016-02-01

When starved for nutrients, Myxococcus xanthus produces a biofilm that contains a mat of rod-shaped cells, known as peripheral rods, and aerial structures called fruiting bodies, which house thousands of dormant and stress-resistant spherical spores. Because rod-shaped cells differentiate into spherical, stress-resistant spores and spore differentiation occurs only in nascent fruiting bodies, many genes and multiple levels of regulation are required. Over the past 2 decades, many regulators of the temporal and spatial expression of M. xanthus sporulation genes have been uncovered. Of these sporulation gene regulators, two-component signal transduction circuits, which typically contain a histidine kinase sensor protein and a transcriptional regulator known as response regulator, are among the best characterized. In this review, we discuss prototypical two-component systems (Nla6S/Nla6 and Nla28S/Nla28) that regulate an early, preaggregation phase of sporulation gene expression during fruiting body development. We also discuss orphan response regulators (ActB and FruA) that regulate a later phase of sporulation gene expression, which begins during the aggregation stage of fruiting body development. In addition, we summarize the research on a complex two-component system (Esp) that is important for the spatial regulation of sporulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Laboratory measurements of biomarkers and individual performances in Chironomus xanthus to evaluate pesticide contamination of sediments in a river of southeastern Brazil.

PubMed

Printes, Liane Biehl; Fernandes, Marisa Narciso; Espíndola, Evaldo Luiz Gaeta

2011-03-01

This study aimed at evaluating biomarkers, individual and population responses in the native Chironomus xanthus to assess the toxicity of pesticide-contaminated sediments from the Monjolinho River (Southeast Brazil). We measured cholinesterase (ChE) and glutathione S-transferase activities (GST), as biomarkers and survival, individual growth and adult emergence, as individual performances. There was no response of the ChE activity and a tendency to decreased GST activity in contaminated sites, but this was generally not statistically significant. Therefore, there was no association of the biomarker responses with exposure to sediment containing pesticides. In contrast, ash free dry mass was significantly increased and male emergence was decreased in C. xanthus exposed to the same sediments. In conclusion, the selected biomarkers were not sensitive and specific enough to detect and anticipate effects of pesticide contamination at the levels measured in the study area. Nevertheless, individual performances alterations pointed to potential pollution problems and possible ecological consequences. Copyright © 2010 Elsevier Inc. All rights reserved.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

PubMed Central

Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

2012-01-01

Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

A Dynamic Response Regulator Protein Modulates G-Protein–Dependent Polarity in the Bacterium Myxococcus xanthus

PubMed Central

Zhang, Yong; Guzzo, Mathilde; Ducret, Adrien; Li, Yue-Zhong; Mignot, Tâm

2012-01-01

Migrating cells employ sophisticated signal transduction systems to respond to their environment and polarize towards attractant sources. Bacterial cells also regulate their polarity dynamically to reverse their direction of movement. In Myxococcus xanthus, a GTP-bound Ras-like G-protein, MglA, activates the motility machineries at the leading cell pole. Reversals are provoked by pole-to-pole switching of MglA, which is under the control of a chemosensory-like signal transduction cascade (Frz). It was previously known that the asymmetric localization of MglA at one cell pole is regulated by MglB, a GTPase Activating Protein (GAP). In this process, MglB specifically localizes at the opposite lagging cell pole and blocks MglA localization at that pole. However, how MglA is targeted to the leading pole and how Frz activity switches the localizations of MglA and MglB synchronously remained unknown. Here, we show that MglA requires RomR, a previously known response regulator protein, to localize to the leading cell pole efficiently. Specifically, RomR-MglA and RomR-MglB complexes are formed and act complementarily to establish the polarity axis, segregating MglA and MglB to opposite cell poles. Finally, we present evidence that Frz signaling may regulate MglA localization through RomR, suggesting that RomR constitutes a link between the Frz-signaling and MglAB polarity modules. Thus, in Myxococcus xanthus, a response regulator protein governs the localization of a small G-protein, adding further insight to the polarization mechanism and suggesting that motility regulation evolved by recruiting and combining existing signaling modules of diverse origins. PMID:22916026

Data-driven modeling reveals cell behaviors controlling self-organization during Myxococcus xanthus development

PubMed Central

Cotter, Christopher R.; Schüttler, Heinz-Bernd; Igoshin, Oleg A.; Shimkets, Lawrence J.

2017-01-01

Collective cell movement is critical to the emergent properties of many multicellular systems, including microbial self-organization in biofilms, embryogenesis, wound healing, and cancer metastasis. However, even the best-studied systems lack a complete picture of how diverse physical and chemical cues act upon individual cells to ensure coordinated multicellular behavior. Known for its social developmental cycle, the bacterium Myxococcus xanthus uses coordinated movement to generate three-dimensional aggregates called fruiting bodies. Despite extensive progress in identifying genes controlling fruiting body development, cell behaviors and cell–cell communication mechanisms that mediate aggregation are largely unknown. We developed an approach to examine emergent behaviors that couples fluorescent cell tracking with data-driven models. A unique feature of this approach is the ability to identify cell behaviors affecting the observed aggregation dynamics without full knowledge of the underlying biological mechanisms. The fluorescent cell tracking revealed large deviations in the behavior of individual cells. Our modeling method indicated that decreased cell motility inside the aggregates, a biased walk toward aggregate centroids, and alignment among neighboring cells in a radial direction to the nearest aggregate are behaviors that enhance aggregation dynamics. Our modeling method also revealed that aggregation is generally robust to perturbations in these behaviors and identified possible compensatory mechanisms. The resulting approach of directly combining behavior quantification with data-driven simulations can be applied to more complex systems of collective cell movement without prior knowledge of the cellular machinery and behavioral cues. PMID:28533367

Specificity in Sociality: Mice and Prairie Voles Exhibit Different Patterns of Peer Affiliation

PubMed Central

Beery, Annaliese K.; Christensen, Jennifer D; Lee, Nicole S.; Blandino, Katrina L.

2018-01-01

Social behavior is often described as a unified concept, but highly social (group-living) species exhibit distinct social structures and may make different social decisions. Prairie voles (Microtus ochrogaster) are socially monogamous rodents that often reside in extended family groups, and exhibit robust preferences for familiar social partners (same- and opposite-sex) during extended choice tests, although short-term preferences are not known. Mice (Mus musculus) are gregarious and colonial, but in brief laboratory tests of social preference they typically prefer social novelty. This preference for novel vs. familiar peers may represent a species-specific difference in social decision-making between mice and prairie voles. However, the tests used to measure preferences in each species differ markedly in duration and degree of contact, such that the behaviors cannot be directly compared. We assessed whether social preferences for novelty or familiarity differed between mice and prairie voles of both sexes when assessed with matching protocols: the sociability/social preference test (SPT) typically used in mice (short, no direct contact), and the partner preference test (PPT) used in voles (long, direct contact). A subset of voles also underwent a PPT using barriers (long, no direct contact). In the short SPT, behavior did not differ between species. In the longer test, pronounced partner preferences emerged in prairie voles, but mice exhibited no social preferences and rarely huddled. No sex differences were evident in either test. Direct physical contact was required for partner preferences in huddling time in voles, but preference for the partner chamber was evident with or without contact. Both prairie voles and mice are social, but they exhibit important differences in the specificity and extent of their social behavior. While mice are often used to study social approach and other behaviors, voles are a more suitable species for the study of selective social

Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

PubMed Central

2010-01-01

Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate. Conclusions These results suggest

Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

PubMed Central

Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

2012-01-01

Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

Project EAGLE (Early Academic Gifted Learning Experience): A Program for Gifted and Talented Students (Grades K-3)--Kindergarten Activity Booklets: Xanthus; Zhack; and Activity Pages H-Z.

ERIC Educational Resources Information Center

Merkoski, Kay

Three activity booklets are presented for implementing Project EAGLE, an enrichment program for gifted and talented kindergarten children. The first activity booklet contains a poem by J. D. Evans titled "In Search of the Xanthus," which describes the search for an imaginary beast that leaves an "X" on the spot where it used to be. The second…

Effects of site-directed mutagenesis of mglA on motility and swarming of Myxococcus xanthus

PubMed Central

2010-01-01

Background The mglA gene from the bacterium Myxococcus xanthus encodes a 22kDa protein related to the Ras superfamily of monomeric GTPases. MglA is required for the normal function of A-motility (adventurous), S-motility (social), fruiting body morphogenesis, and sporulation. MglA and its homologs differ from all eukaryotic and other prokaryotic GTPases because they have a threonine (Thr78) in place of the highly conserved aspartate residue of the consensus PM3 (phosphate-magnesium binding) region. To identify residues critical for MglA function or potential protein interactions, and explore the function of Thr78, the phenotypes of 18 mglA mutants were characterized. Results Nine mutants, with mutations predicted to alter residues that bind the guanine base or coordinate magnesium, did not produce detectable MglA. As expected, these mutants were mot- dev- because MglA is essential for these processes. Of the remaining nine mutants, seven showed a wild-type distribution pattern for MglA but fell into two categories with regard to function. Five of the seven mutants exhibited mild phenotypes, but two mutants, T78D and P80A, abolished motility and development. The localization pattern of MglA was abolished in two mutants that were mot- spo- and dev-. These two mutants were predicted to alter surface residues at Asp52 and Thr54, which suggests that these residues are critical for proper localization and may define a protein interaction site. Improving the consensus match with Ras at Thr78 abolished function of MglA. Only the conservative serine substitution was tolerated at this position. Merodiploid constructs revealed that a subset of alleles, including mglAD52A, were dominant and also illustrated that changing the balance of MglA and its co-transcribed partner, MglB, affects A-motility. Conclusion Our results suggest that GTP binding is critical for stability of MglA because MglA does not accumulate in mutants that cannot bind GTP. The threonine in PM3 of Mgl

Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

PubMed Central

Yoder-Himes, Deborah R.; Kroos, Lee

2006-01-01

The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

The groEL2 gene, but not groEL1, is required for biosynthesis of the secondary metabolite myxovirescin in Myxococcus xanthus DK1622.

PubMed

Wang, Yan; Li, Xi; Zhang, Wenyan; Zhou, Xiuwen; Li, Yue-zhong

2014-03-01

Myxococcus xanthus DK1622 possesses two copies of the groEL gene: groEL1, which participates in development, and groEL2, which is involved in the predatory ability of cells. In this study, we determined that the groEL2 gene is required for the biosynthesis of the secondary metabolite myxovirescin (TA), which plays essential roles in predation. The groEL2-knockout mutant strain was defective in producing a zone of inhibition and displayed decreased killing ability against Escherichia coli, while the groEL1-knockout mutant strain exhibited little difference from the wild-type strain DK1622. HPLC revealed that deletion of the groEL2 gene blocked the production of TA, which was present in the groEL1-knockout mutant. The addition of exogenous TA rescued the inhibition and killing abilities of the groEL2-knockout mutant against E. coli. Analysis of GroEL domain-swapping mutants indicated that the C-terminal equatorial domain of GroEL2 was essential for TA production, while the N-terminal equatorial or apical domains of GroEL2 were not sufficient to rescue TA production of the groEL2 knockout.

Uncovering the Mystery of Gliding Motility in the Myxobacteria

PubMed Central

Nan, Beiyan; Zusman, David R.

2012-01-01

Bacterial gliding motility is the smooth movement of cells on solid surfaces unaided by flagella or pili. Many diverse groups of bacteria exhibit gliding, but the mechanism of gliding motility has remained a mystery since it was first observed more than a century ago. Recent studies on the motility of Myxococcus xanthus, a soil myxobacterium, suggest a likely mechanism for gliding in this organism. About forty M. xanthus genes were shown to be involved in gliding motility, and some of their protein products were labeled and localized within cells. These studies suggest that gliding motility in M. xanthus involves large multiprotein structural complexes, regulatory proteins, and cytoskeletal filaments. In this review, we summarize recent experiments that provide the basis for this emerging view of M. xanthus motility. We also discuss alternative models for gliding. PMID:21910630

Conservation of ornamental stone by Myxococcus xanthus-induced carbonate biomineralization.

PubMed

Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

2003-04-01

Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO(3) polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone.

Conservation of Ornamental Stone by Myxococcus xanthus-Induced Carbonate Biomineralization

PubMed Central

Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

2003-01-01

Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO3 polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone. PMID:12676699

A genetic screen in Myxococcus xanthus identifies mutants that uncouple outer membrane exchange from a downstream cellular response.

PubMed

Dey, Arup; Wall, Daniel

2014-12-01

Upon physical contact with sibling cells, myxobacteria transiently fuse their outer membranes (OMs) and exchange OM proteins and lipids. From previous work, TraA and TraB were identified to be essential factors for OM exchange (OME) in donor and recipient cells. To define the genetic complexity of OME, we carried out a comprehensive forward genetic screen. The screen was based on the observation that Myxococcus xanthus nonmotile cells, by a Tra-dependent mechanism, block swarm expansion of motile cells when mixed. Thus, mutants defective in OME or a downstream responsive pathway were readily identified as escape flares from mixed inocula seeded on agar. This screen was surprisingly powerful, as we found >50 mutants defective in OME. Importantly, all of the mutations mapped to the traAB operon, suggesting that there may be few, if any, proteins besides TraA and TraB directly required for OME. We also found a second and phenotypically different class of mutants that exhibited wild-type OME but were defective in a responsive pathway. This pathway is postulated to control inner membrane homeostasis by covalently attaching amino acids to phospholipids. The identified proteins are homologous to the Staphylococcus aureus MprF protein, which is involved in membrane adaptation and antibiotic resistance. Interestingly, we also found that a small number of nonmotile cells were sufficient to block the swarming behavior of a large gliding-proficient population. This result suggests that an OME-derived signal could be amplified from a few nonmotile producers to act on many responder cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

PubMed

López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

2004-07-09

The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

Gliding Motility Revisited: How Do the Myxobacteria Move without Flagella?

PubMed Central

Mauriello, Emilia M. F.; Mignot, Tâm; Yang, Zhaomin; Zusman, David R.

2010-01-01

Summary: In bacteria, motility is important for a wide variety of biological functions such as virulence, fruiting body formation, and biofilm formation. While most bacteria move by using specialized appendages, usually external or periplasmic flagella, some bacteria use other mechanisms for their movements that are less well characterized. These mechanisms do not always exhibit obvious motility structures. Myxococcus xanthus is a motile bacterium that does not produce flagella but glides slowly over solid surfaces. How M. xanthus moves has remained a puzzle that has challenged microbiologists for over 50 years. Fortunately, recent advances in the analysis of motility mutants, bioinformatics, and protein localization have revealed likely mechanisms for the two M. xanthus motility systems. These results are summarized in this review. PMID:20508248

Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

PubMed

Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

2000-10-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

Socioemotional characteristics of elementary school children identified as exhibiting social leadership qualities.

PubMed

Scharf, Miri; Mayseless, Ofra

2009-03-01

Elementary school teachers identified characteristics in 4 major socioemotional domains associated with children's social leadership: self-perception, social anxiety, attachment orientation with peers, and interpersonal goals and skills in close friendships. Participants were 260 4th- and 5th-grade students (126 boys, 134 girls) from 10 classes in a school in northern Israel. Social leadership skills were associated with positive self-perceptions in various domains, low social anxiety, secure orientation to peers, higher levels of relationship-maintenance goal, lower levels of revenge goal in close friendships, and-unexpectedly-lower levels of accommodation as a strategy to solve conflicts with a friend. Positive self-concept and attachment security were indirectly associated with leadership qualities through their significant association with prosocial orientation skills. The authors discuss these findings as reflecting an internalization of positive model of self and positive model of others in children who exhibit social leadership qualities. The authors also discuss implications of these qualities for school and class ecology, as well as the importance of culture.

Spore formation in Myxococcus xanthus is tied to cytoskeleton functions and polysaccharide spore coat deposition

PubMed Central

Müller, Frank D.; Schink, Christian W.; Hoiczyk, Egbert; Cserti, Emöke; Higgs, Penelope I.

2011-01-01

Summary Myxococcus xanthus is a Gram-negative bacterium that differentiates into environmentally resistant spores. Spore differentiation involves septation-independent remodelling of the rod-shaped vegetative cell into a spherical spore and deposition of a thick and compact spore coat outside of the outer membrane. Our analyses suggest that spore coat polysaccharides are exported to the cell surface by the Exo outer membrane polysaccharide export/polysaccharide co-polymerase 2a (OPX/PCP-2a) machinery. Conversion of the capsule-like polysaccharide layer into a compact spore coat layer requires the Nfs proteins which likely form a complex in the cell envelope. Mutants in either nfs, exo, or two other genetic loci encoding homologs of polysaccharide synthesis enzymes, fail to complete morphogenesis from rods to spherical spores and instead produce a transient state of deformed cell morphology before reversion into typical rods. We additionally provide evidence that the cell cytoskeletal protein, MreB, plays an important role in rod to spore morphogenesis and for spore outgrowth. These studies provide evidence that this novel gram-negative differentiation process is tied to cytoskeleton functions and polysaccharide spore coat deposition. PMID:22188356

Outside-in assembly pathway of the type IV pilus system in Myxococcus xanthus.

PubMed

Friedrich, Carmen; Bulyha, Iryna; Søgaard-Andersen, Lotte

2014-01-01

Type IV pili (T4P) are ubiquitous bacterial cell surface structures that undergo cycles of extension, adhesion, and retraction. T4P function depends on a highly conserved envelope-spanning macromolecular machinery consisting of 10 proteins that localizes polarly in Myxococcus xanthus. Using this localization, we investigated the entire T4P machinery assembly pathway by systematically profiling the stability of all and the localization of eight of these proteins in the absence of other T4P machinery proteins as well as by mapping direct protein-protein interactions. Our experiments uncovered a sequential, outside-in pathway starting with the outer membrane (OM) PilQ secretin ring. PilQ recruits a subcomplex consisting of the inner membrane (IM) lipoprotein PilP and the integral IM proteins PilN and PilO by direct interaction with the periplasmic domain of PilP. The PilP/PilN/PilO subcomplex recruits the cytoplasmic PilM protein, by direct interaction between PilN and PilM, and the integral IM protein PilC. The PilB/PilT ATPases that power extension/retraction localize independently of other T4P machinery proteins. Thus, assembly of the T4P machinery initiates with formation of the OM secretin ring and continues inwards over the periplasm and IM to the cytoplasm.

Coupling of protein localization and cell movements by a dynamically localized response regulator in Myxococcus xanthus

PubMed Central

Leonardy, Simone; Freymark, Gerald; Hebener, Sabrina; Ellehauge, Eva; Søgaard-Andersen, Lotte

2007-01-01

Myxococcus xanthus cells harbor two motility machineries, type IV pili (Tfp) and the A-engine. During reversals, the two machineries switch polarity synchronously. We present a mechanism that synchronizes this polarity switching. We identify the required for motility response regulator (RomR) as essential for A-motility. RomR localizes in a bipolar, asymmetric pattern with a large cluster at the lagging cell pole. The large RomR cluster relocates to the new lagging pole in parallel with cell reversals. Dynamic RomR localization is essential for cell reversals, suggesting that RomR relocalization induces the polarity switching of the A-engine. The analysis of RomR mutants shows that the output domain targets RomR to the poles and the receiver domain is essential for dynamic localization. The small GTPase MglA establishes correct RomR polarity, and the Frz two-component system regulates dynamic RomR localization. FrzS localizes with Tfp at the leading pole and relocates in an Frz-dependent manner to the opposite pole during reversals; FrzS and RomR localize and oscillate independently. The Frz system synchronizes these oscillations and thus the synchronous polarity switching of the motility machineries. PMID:17932488

Mice lacking a functional NMDA receptor exhibit social subordination in a group-housed environment.

PubMed

Ujita, Waka; Kohyama-Koganeya, Ayako; Endo, Nozomi; Saito, Toki; Oyama, Hiroshi

2018-01-01

Social dominance, in which an individual asserts control over others or benefits most after social conflict, has an influence on social behaviour. However, the mechanisms mediating social dominance remain unclear. Social dominance within social groups determines the distribution of rewards such as food and access to mating partners, which can act as reinforcers. In this study, we used the water competition test to determine whether mice were dominant or subordinate. It has been previously reported that mice heterozygous for a missense mutation in Grin1 (Grin1 Rgsc174 ) showed altered social behaviour, with increased locomotor activity, novelty seeking and anxiety. However, social dominance in these mice has not been previously investigated. We subjected Grin1 Rgsc174/+ mice to the water competition test using IntelliCage and observed that Grin1 influences competitive dominance. We found that Grin1 Rgsc174/+ mice exhibited social subordination characterised by decreased corner visit frequency and occupancy time at the beginning of the task. However, Grin1 Rgsc174/+ mice retained increased basal activity and exploring behaviour under a group-housed environment. Our findings suggested that Grin1 plays an important role in determining social dominance. © 2017 Federation of European Biochemical Societies.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

A Versatile Class of Cell Surface Directional Motors Gives Rise to Gliding Motility and Sporulation in Myxococcus xanthus

PubMed Central

Wartel, Morgane; Czerwinski, Fabian; Le Gall, Anne-Valérie; Mauriello, Emilia M. F.; Bergam, Ptissam; Brun, Yves V.; Shaevitz, Joshua; Mignot, Tâm

2013-01-01

Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex) to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories. PMID:24339744

Directional reversals enable Myxococcus xanthus cells to produce collective one-dimensional streams during fruiting-body formation

PubMed Central

Thutupalli, Shashi; Sun, Mingzhai; Bunyak, Filiz; Palaniappan, Kannappan; Shaevitz, Joshua W.

2015-01-01

The formation of a collectively moving group benefits individuals within a population in a variety of ways. The surface-dwelling bacterium Myxococcus xanthus forms dynamic collective groups both to feed on prey and to aggregate during times of starvation. The latter behaviour, termed fruiting-body formation, involves a complex, coordinated series of density changes that ultimately lead to three-dimensional aggregates comprising hundreds of thousands of cells and spores. How a loose, two-dimensional sheet of motile cells produces a fixed aggregate has remained a mystery as current models of aggregation are either inconsistent with experimental data or ultimately predict unstable structures that do not remain fixed in space. Here, we use high-resolution microscopy and computer vision software to spatio-temporally track the motion of thousands of individuals during the initial stages of fruiting-body formation. We find that cells undergo a phase transition from exploratory flocking, in which unstable cell groups move rapidly and coherently over long distances, to a reversal-mediated localization into one-dimensional growing streams that are inherently stable in space. These observations identify a new phase of active collective behaviour and answer a long-standing open question in Myxococcus development by describing how motile cell groups can remain statistically fixed in a spatial location. PMID:26246416

Light-induced carotenogenesis in Myxococcus xanthus: evidence that CarS acts as an anti-repressor of CarA.

PubMed

Whitworth, D E; Hodgson, D A

2001-11-01

In the bacterium Myxococcus xanthus, carotenoids are produced in response to illumination, as a result of expression of the crt carotenoid biosynthesis genes. The majority of crt genes are clustered in the crtEBDC operon, which is repressed in the dark by CarA. Genetic data suggest that, in the light, CarS is synthesized and achieves activation of the crtEBDC operon by removing the repressive action of CarA. As CarS contains no known DNA-binding motif, the relief of CarA-mediated repression was postulated to result from a direct interaction between these two proteins. Use of the yeast two-hybrid system demonstrated direct interaction between CarA and CarS. The two-hybrid system also implied that CarA and, possibly, CarS are capable of homodimerization. Direct evidence for CarS anti-repressor action was provided in vitro. A glutathione S-transferase (GST)-CarA protein fusion was shown to bind specifically to a palindromic operator sequence within the crtEBDC promoter. CarA was prevented from binding to its operator, and prebound CarA was removed by the addition of purified CarS. CarS is therefore an anti-repressor.

Comparative genomics of transport proteins in developmental bacteria: Myxococcus xanthus and Streptomyces coelicolor

PubMed Central

2013-01-01

Background Two of the largest fully sequenced prokaryotic genomes are those of the actinobacterium, Streptomyces coelicolor (Sco), and the δ-proteobacterium, Myxococcus xanthus (Mxa), both differentiating, sporulating, antibiotic producing, soil microbes. Although the genomes of Sco and Mxa are the same size (~9 Mbp), Sco has 10% more genes that are on average 10% smaller than those in Mxa. Results Surprisingly, Sco has 93% more identifiable transport proteins than Mxa. This is because Sco has amplified several specific types of its transport protein genes, while Mxa has done so to a much lesser extent. Amplification is substrate- and family-specific. For example, Sco but not Mxa has amplified its voltage-gated ion channels but not its aquaporins and mechano-sensitive channels. Sco but not Mxa has also amplified drug efflux pumps of the DHA2 Family of the Major Facilitator Superfamily (MFS) (49 versus 6), amino acid transporters of the APC Family (17 versus 2), ABC-type sugar transport proteins (85 versus 6), and organic anion transporters of several families. Sco has not amplified most other types of transporters. Mxa has selectively amplified one family of macrolid exporters relative to Sco (16 versus 1), consistent with the observation that Mxa makes more macrolids than does Sco. Conclusions Except for electron transport carriers, there is a poor correlation between the types of transporters found in these two organisms, suggesting that their solutions to differentiative and metabolic needs evolved independently. A number of unexpected and surprising observations are presented, and predictions are made regarding the physiological functions of recognizable transporters as well as the existence of yet to be discovered transport systems in these two important model organisms and their relatives. The results provide insight into the evolutionary processes by which two dissimilar prokaryotes evolved complexity, particularly through selective chromosomal gene

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Myxospore Coat Synthesis in Myxococcus xanthus: In Vivo Incorporation of Acetate and Glycine

PubMed Central

Filer, D.; White, D.; Kindler, S. H.; Rosenberg, E.

1977-01-01

Myxospore coat synthesis in Myxococcus xanthus was studied by incorporation of [14C]acetate into intermediates in the biosynthesis of coat polysaccharide and into acid-insoluble material during vegetative growth and after glycerol induction of myxospores. During short labeling periods at 27°C, the radioactivity was shown to be located primarily in N-acetyl groups rather than sugar moieties. Two hours after glycerol induction, the pools of N-acetylglucosamine 6-phosphate and uridine 5′-diphosphate-N-acetylgalactosamine (UDPGalNAc) plus uridine 5′-diphosphate-N-glucosamine increased about twofold and were labeled at twice the rate measured for vegetative cells. The increased rate of synthesis of UDPGalNAc and its precursors could be correlated with increased enzyme activities measured in vitro. Controlled acid hydrolysis revealed that the galactosamine portion of the myxospore coat was N-acetylated. After glycerol induction, the incorporation of acetate into acid-insoluble material increased threefold. This enhanced incorporation was sensitive to neither penicillin nor d-cycloserine. In contrast, bacitracin inhibited the incorporation of [14C]acetate into acid-insoluble material more effectively 2 h after myxospore induction than during vegetative growth. Chloramphenicol added to cells 90 min after induction blocked further increase in the rate of [14C]acetate incorporation. Since the myxospore coat contains glycine, polymer synthesis was also measured by chloramphenicol-insensitive [14C]glycine incorporation into acid-insoluble material. Although protein synthesis decreased after glycerol induction, glycine incorporation increased. Two hours after induction, glycine incorporation was only 75% inhibited by chloramphenicol and rifampin. The chloramphenicol-insensitive rate of incorporation of [14C]glycine increased during the first hour after myxospore induction and reached a peak rate after 2 to 3 h. The chloramphenicol-resistant incorporation of [14C

Socially Isolated Mice Exhibit a Blunted Homeostatic Sleep Response to Acute Sleep Deprivation Compared to Socially Paired Mice

PubMed Central

Kaushal, Navita; Nair, Deepti; Gozal, David; Ramesh, Vijay

2012-01-01

Sleep is an important physiological process underlying maintenance of physical, mental and emotional health. Consequently, sleep deprivation (SD) is associated with adverse consequences and increases the risk for anxiety, immune, and cognitive disorders. SD is characterized by increased energy expenditure responses and sleep rebound upon recovery that are regulated by homeostatic processes, which in turn are influenced by stress. Since all previous studies on SD were conducted in a setting of social isolation, the impact of the social contextual setting is unknown. Therefore, we used a relatively stress-free SD paradigm in mice to assess the impact of social isolation on sleep, wakefulness and delta electroencephalogram (EEG) power during non-rapid eye movement (NREM) sleep. Paired or isolated C57BL/6J adult chronically-implanted male mice were exposed to SD for 6 hours and telemetric polygraphic recordings were conducted, including 18 hours recovery. Recovery from SD in the paired group showed a significant decrease in wake and significant increase in NREM sleep and rapid eye movement (REM), and a similar, albeit less robust response occurred in the isolated mice. Delta power during NREM sleep was increased in both groups immediately following SD, but paired mice exhibited significantly higher delta power throughout the dark period. The increase in body temperature and gross motor activity observed during the SD procedure was decreased during the dark period. In both open field and elevated plus maze tests, socially isolated mice showed significantly higher anxiety than paired mice. The homeostatic processes altered by SD are differentially affected in paired and isolated mice, suggesting that the social context of isolation stress may adversely affect the quantity and quality of sleep in mice. PMID:22498175

Seeking the "museum of the future": Public exhibitions of science, industry, and the social, 1910-1940.

PubMed

Charles, Loïc; Giraud, Yann

2018-06-01

Using as case studies the initiatives developed by two museum curators, the Belgian bibliographer Paul Otlet (1868-1944) and the Austrian social scientist Otto Neurath (1882-1945), and their subsequent collaboration with an extended network of scientists, philanthropists, artists, and social activists, this article provides a portrait of the general movement toward the creation of a new form of museum: the "museum of the future," as Neurath labeled it. This museum would be able to enlighten the people by showing the nature of modern industrial civilization. The promoters of the "museum of the future" intended to reform museum practices by organizing exhibitions of social facts, but also by integrating several dimensions - architecture, commerce, entertainment, pedagogy, and science and technology - to create a holistic frame to address their audience. However, the effortlessly circulating museum Neurath and Otlet envisioned stood in sharp contrast to the many, often immaterial, boundaries they encountered in their attempt to implement their vision. Ever-growing nationalism, the professionalization of social science, and the increasing commercialization of scientific vulgarization are some of the factors that help explain their failure.

Social insect genomes exhibit dramatic evolution in gene composition and regulation while preserving regulatory features linked to sociality

PubMed Central

Simola, Daniel F.; Wissler, Lothar; Donahue, Greg; Waterhouse, Robert M.; Helmkampf, Martin; Roux, Julien; Nygaard, Sanne; Glastad, Karl M.; Hagen, Darren E.; Viljakainen, Lumi; Reese, Justin T.; Hunt, Brendan G.; Graur, Dan; Elhaik, Eran; Kriventseva, Evgenia V.; Wen, Jiayu; Parker, Brian J.; Cash, Elizabeth; Privman, Eyal; Childers, Christopher P.; Muñoz-Torres, Monica C.; Boomsma, Jacobus J.; Bornberg-Bauer, Erich; Currie, Cameron R.; Elsik, Christine G.; Suen, Garret; Goodisman, Michael A.D.; Keller, Laurent; Liebig, Jürgen; Rawls, Alan; Reinberg, Danny; Smith, Chris D.; Smith, Chris R.; Tsutsui, Neil; Wurm, Yannick; Zdobnov, Evgeny M.; Berger, Shelley L.; Gadau, Jürgen

2013-01-01

Genomes of eusocial insects code for dramatic examples of phenotypic plasticity and social organization. We compared the genomes of seven ants, the honeybee, and various solitary insects to examine whether eusocial lineages share distinct features of genomic organization. Each ant lineage contains ∼4000 novel genes, but only 64 of these genes are conserved among all seven ants. Many gene families have been expanded in ants, notably those involved in chemical communication (e.g., desaturases and odorant receptors). Alignment of the ant genomes revealed reduced purifying selection compared with Drosophila without significantly reduced synteny. Correspondingly, ant genomes exhibit dramatic divergence of noncoding regulatory elements; however, extant conserved regions are enriched for novel noncoding RNAs and transcription factor–binding sites. Comparison of orthologous gene promoters between eusocial and solitary species revealed significant regulatory evolution in both cis (e.g., Creb) and trans (e.g., fork head) for nearly 2000 genes, many of which exhibit phenotypic plasticity. Our results emphasize that genomic changes can occur remarkably fast in ants, because two recently diverged leaf-cutter ant species exhibit faster accumulation of species-specific genes and greater divergence in regulatory elements compared with other ants or Drosophila. Thus, while the “socio-genomes” of ants and the honeybee are broadly characterized by a pervasive pattern of divergence in gene composition and regulation, they preserve lineage-specific regulatory features linked to eusociality. We propose that changes in gene regulation played a key role in the origins of insect eusociality, whereas changes in gene composition were more relevant for lineage-specific eusocial adaptations. PMID:23636946

Effects of a Peer Competition-based Mobile Learning Approach on Students' Affective Domain Exhibition in Social Studies Courses

ERIC Educational Resources Information Center

Hwang, Gwo-Jen; Chang, Shao-Chen

2016-01-01

One of the important and challenging objectives of social studies courses is to promote students' affective domain exhibition, including learning interest, positive attitudes and local culture identity. In this paper, a location-aware mobile learning approach was proposed based on a competition strategy for conducting local cultural activities in…

Fatty acids from membrane lipids become incorporated into lipid bodies during Myxococcus xanthus differentiation.

PubMed

Bhat, Swapna; Boynton, Tye O; Pham, Dan; Shimkets, Lawrence J

2014-01-01

Myxococcus xanthus responds to amino acid limitation by producing fruiting bodies containing dormant spores. During development, cells produce triacylglycerides in lipid bodies that become consumed during spore maturation. As the cells are starved to induce development, the production of triglycerides represents a counterintuitive metabolic switch. In this paper, lipid bodies were quantified in wild-type strain DK1622 and 33 developmental mutants at the cellular level by measuring the cross sectional area of the cell stained with the lipophilic dye Nile red. We provide five lines of evidence that triacylglycerides are derived from membrane phospholipids as cells shorten in length and then differentiate into myxospores. First, in wild type cells, lipid bodies appear early in development and their size increases concurrent with an 87% decline in membrane surface area. Second, developmental mutants blocked at different stages of shortening and differentiation accumulated lipid bodies proportionate with their cell length with a Pearson's correlation coefficient of 0.76. Third, peripheral rods, developing cells that do not produce lipid bodies, fail to shorten. Fourth, genes for fatty acid synthesis are down-regulated while genes for fatty acid degradation are up regulated. Finally, direct movement of fatty acids from membrane lipids in growing cells to lipid bodies in developing cells was observed by pulse labeling cells with palmitate. Recycling of lipids released by Programmed Cell Death appears not to be necessary for lipid body production as a fadL mutant was defective in fatty acid uptake but proficient in lipid body production. The lipid body regulon involves many developmental genes that are not specifically involved in fatty acid synthesis or degradation. MazF RNA interferase and its target, enhancer-binding protein Nla6, appear to negatively regulate cell shortening and TAG accumulation whereas most cell-cell signals activate these processes.

Designing Art Exhibitions in an Educational Virtual World

ERIC Educational Resources Information Center

Julian, June; Crooks, Julian

2011-01-01

Demonstrating the multiple features of the Cerulean Gallery in Second Life, this research report showcases several exemplar exhibits created by students, artists, and museums. Located in The Educational Media Center, a Second Life teaching and social space, the Cerulean Gallery exhibits functioned as case studies that tested its effectiveness as…

Strategies for Human-Automaton Resource Entity Deployment (SHARED)

DTIC Science & Technology

2003-12-01

year 2004; however, the termination of MICA will render the status of this task as incomplete. 3.4 CPPP Development SOW-II.C.3.3.2 (c) Biomimicry of...Social Foraging for Cooperative Search/Engagement. Statement: The following aspects of biomimicry of social foraging will be studied in the...are studied extensively. The focus are on biomimicry of several organisms including two kinds of bacteria (M. xanthus and E. Coli) and one kind of

In depth analysis of the mechanism of action of metal-dependent sigma factors: characterization of CorE2 from Myxococcus xanthus

PubMed Central

Marcos-Torres, Francisco Javier; Pérez, Juana; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2016-01-01

Extracytoplasmic function sigma factors represent the third pillar of signal-transduction mechanisms in bacteria. The variety of stimuli they recognize and mechanisms of action they use have allowed their classification into more than 50 groups. We have characterized CorE2 from Myxococcus xanthus, which belongs to group ECF44 and upregulates the expression of two genes when it is activated by cadmium and zinc. Sigma factors of this group contain a Cys-rich domain (CRD) at the C terminus which is essential for detecting metals. Point mutations at the six Cys residues of the CRD have revealed the contribution of each residue to CorE2 activity. Some of them are essential, while others are either dispensable or their mutations only slightly affect the activity of the protein. However, importantly, mutation of Cys174 completely shifts the specificity of CorE2 from cadmium to copper, indicating that the Cys arrangement of the CRD determines the metal specificity. Moreover, the conserved CxC motif located between the σ2 domain and the σ4.2 region has also been found to be essential for activity. The results presented here contribute to our understanding of the mechanism of action of metal-dependent sigma factors and help to define new common features of the members of this group of regulators. PMID:26951374

BACHD rats expressing full-length mutant huntingtin exhibit differences in social behavior compared to wild-type littermates

PubMed Central

Manfré, Giuseppe; Novati, Arianna; Faccini, Ilaria; Rossetti, Andrea C.; Bosch, Kari; Molteni, Raffaella; Riva, Marco A.; Van der Harst, Johanneke E.; Homberg, Judith R.

2018-01-01

Background Huntington disease (HD) is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT) with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype. Objective This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT) rats at different ages, using two different measures of sociability. Methods Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF) to the observed behavioral alterations. Results In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats

Social anxiety disorder exhibit impaired networks involved in self and theory of mind processing.

PubMed

Cui, Qian; Vanman, Eric J; Long, Zhiliang; Pang, Yajing; Chen, Yuyan; Wang, Yifeng; Duan, Xujun; Chen, Heng; Gong, Qiyong; Zhang, Wei; Chen, Huafu

2017-08-01

Most previous studies regarding social anxiety disorder (SAD) have focused on the role of emotional dysfunction, while impairments in self- and theory of mind (ToM)-processing have relatively been neglected. This study utilised functional connectivity density (FCD), resting-state functional connectivity (RSFC) and discriminant analyses to investigate impairments in self- and ToM-related networks in patients with SAD. Patients with SAD exhibited decreased long-range FCD in the right rostral anterior cingulate cortex (rACC) and decreased short-range FCD in the right superior temporal gyrus (STG)-key nodes involved in self- and ToM-processing, respectively. Decreased RSFC of the right rACC and STG with widespread frontal, temporal, posteromedial, sensorimotor, and somatosensory, regions was also observed in patients with SAD. Altered RSFC between the right rACC and bilateral superior frontal gyrus, between the right rACC and right middle frontal gyrus, and within the right STG itself provided the greatest contribution to individual diagnoses of SAD, with an accuracy of 84.5%. These results suggest that a lack of cognitive inhibition on emotional self-referential processing as well as impairments in social information integration may play critical roles in the pathomechanism of SAD and highlight the importance of recognising such features in the diagnosis and treatment of SAD. © The Author (2017). Published by Oxford University Press.

DifA, a methyl-accepting chemoreceptor protein-like sensory protein, uses a novel signaling mechanism to regulate exopolysaccharide production in Myxococcus xanthus.

PubMed

Xu, Qian; Black, Wesley P; Nascimi, Heidi M; Yang, Zhaomin

2011-02-01

DifA is a methyl-accepting chemotaxis protein (MCP)-like sensory transducer that regulates exopolysaccharide (EPS) production in Myxococcus xanthus. Here mutational analysis and molecular biology were used to probe the signaling mechanisms of DifA in EPS regulation. We first identified the start codon of DifA experimentally; this identification extended the N terminus of DifA for 45 amino acids (aa) from the previous bioinformatics prediction. This extension helped to address the outstanding question of how DifA receives input signals from type 4 pili without a prominent periplasmic domain. The results suggest that DifA uses its N-terminus extension to sense an upstream signal in EPS regulation. We suggest that the perception of the input signal by DifA is mediated by protein-protein interactions with upstream components. Subsequent signal transmission likely involves transmembrane signaling instead of direct intramolecular interactions between the input and the output modules in the cytoplasm. The basic functional unit of DifA for signal transduction is likely dimeric as mutational alteration of the predicted dimeric interface of DifA significantly affected EPS production. Deletions of 14-aa segments in the C terminus suggest that the newly defined flexible bundle subdomain in MCPs is likely critical for DifA function because shortening of this bundle can lead to constitutively active mutations.

Gabrb3 gene deficient mice exhibit impaired social and exploratory behaviors, deficits in non-selective attention and hypoplasia of cerebellar vermal lobules: a potential model of autism spectrum disorder

PubMed Central

DeLorey, Timothy M.; Sahbaie, Peyman; Hashemi, Ezzat; Homanics, Gregg E.; Clark, J. David

2009-01-01

Objective GABAA receptors play an important regulatory role in the developmental events leading to the formation of complex neuronal networks and to the behaviors they govern. The primary aim of this study was to assess whether gabrb3 gene deficient (gabrb3-/-) mice exhibit abnormal social behavior, a core deficit associated with autism spectrum disorder. Methods Social and exploratory behaviors along with non-selective attention were assessed in gabrb3-/-, littermates (gabrb3+/+) and progenitor strains, C57BL/6J and 129/SvJ. In addition, semi-quantitative assessments of the size of cerebellar vermal lobules were performed on gabrb3+/+ and gabrb3-/- mice. Results Relative to controls, gabrb3-/- mice exhibited significant deficits in activities related to social behavior including sociability, social novelty and nesting. In addition, gabrb3-/- mice also exhibited differences in exploratory behavior compared to controls, as well as reductions in the frequency and duration of rearing episodes, suggested as being an index of non-selective attention. Gabrb3-/- mice also displayed significant hypoplasia of the cerebellar vermis compared to gabrb3+/+ mice. Conclusions The observed behavioral deficits, especially regarding social behaviors, strengthens the face validity of the gabrb3 gene deficient mouse as being a model of autism spectrum disorder. PMID:17983671

The Science of Museums: Tapping the Social Sciences to Make Exhibits Fathomable and Fun.

ERIC Educational Resources Information Center

Raloff, Janet

1998-01-01

The most successful science-and-technology center exhibits owe as much to the evaluation of visitor reactions as they do to budgets and planning. Explores different types of visitor-evaluation studies and shares examples of successful exhibit designs built upon visitor evaluations, including children's physics exhibits and jellyfish as living art.…

Cell rejuvenation and social behaviors promoted by LPS exchange in myxobacteria.

PubMed

Vassallo, Christopher; Pathak, Darshankumar T; Cao, Pengbo; Zuckerman, David M; Hoiczyk, Egbert; Wall, Daniel

2015-06-02

Bacterial cells in their native environments must cope with factors that compromise the integrity of the cell. The mechanisms of coping with damage in a social or multicellular context are poorly understood. Here we investigated how a model social bacterium, Myxococcus xanthus, approaches this problem. We focused on the social behavior of outer membrane exchange (OME), in which cells transiently fuse and exchange their outer membrane (OM) contents. This behavior requires TraA, a homophilic cell surface receptor that identifies kin based on similarities in a polymorphic region, and the TraB cohort protein. As observed by electron microscopy, TraAB overexpression catalyzed a prefusion OM junction between cells. We then showed that damage sustained by the OM of one population was repaired by OME with a healthy population. Specifically, LPS mutants that were defective in motility and sporulation were rescued by OME with healthy donors. In addition, a mutant with a conditional lethal mutation in lpxC, an essential gene required for lipid A biosynthesis, was rescued by Tra-dependent interactions with a healthy population. Furthermore, lpxC cells with damaged OMs, which were more susceptible to antibiotics, had resistance conferred to them by OME with healthy donors. We also show that OME has beneficial fitness consequences to all cells. Here, in merged populations of damaged and healthy cells, OME catalyzed a dilution of OM damage, increasing developmental sporulation outcomes of the combined population by allowing it to reach a threshold density. We propose that OME is a mechanism that myxobacteria use to overcome cell damage and to transition to a multicellular organism.

Men without a sense of smell exhibit a strongly reduced number of sexual relationships, women exhibit reduced partnership security - a reanalysis of previously published data.

PubMed

Croy, Ilona; Bojanowski, Viola; Hummel, Thomas

2013-02-01

Olfactory function influences social behavior. For instance, olfaction seems to play a key role in mate choice and helps detecting emotions in other people. In a previous study, we showed that people who were born without a sense of smell exhibit enhanced social insecurity. Based on the comments to this article we decided to have a closer look to whether the absence of the sense of smell affects men and women differently. Under this focus questionnaire data of 32 patients, diagnosed with isolated congenital anosmia (10 men, 22 women) and 36 age-matched healthy controls (15 men, 21 women) was reanalyzed. In result, men and women without a sense of smell reported enhanced social insecurity, but with different consequences: Men who were born without a sense of smell exhibit a strongly reduced number of sexual relationships and women are affected such that they feel less secure about their partner. This emphasizes the importance of the sense of smell for intimate relationships. Copyright © 2012 Elsevier B.V. All rights reserved.

Drosophila mutants of the autism candidate gene neurobeachin (rugose) exhibit neuro-developmental disorders, aberrant synaptic properties, altered locomotion, and impaired adult social behavior and activity patterns.

PubMed

Wise, Alexandria; Tenezaca, Luis; Fernandez, Robert W; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F; Venkatesh, Tadmiri

2015-01-01

Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions, and hyperactivity. ASD exhibits a strong genetic component with underlying multigene interactions. Candidate gene studies have shown that the neurobeachin (NBEA) gene is disrupted in human patients with idiopathic autism ( Castermans et al., 2003 ). The NBEA gene spans the common fragile site FRA 13A and encodes a signal scaffold protein ( Savelyeva et al., 2006 ). In mice, NBEA has been shown to be involved in the trafficking and function of a specific subset of synaptic vesicles. ( Medrihan et al., 2009 ; Savelyeva et al., 2006 ). Rugose (rg) is the Drosophila homolog of the mammalian and human NBEA. Our previous genetic and molecular analyses have shown that rg encodes an A kinase anchor protein (DAKAP 550), which interacts with components of the epidermal growth factor receptor or EGFR and Notch-mediated signaling pathways, facilitating cross talk between these and other pathways ( Shamloula et al., 2002 ). We now present functional data from studies on the larval neuromuscular junction that reveal abnormal synaptic architecture and physiology. In addition, adult rg loss-of-function mutants exhibit defective social interactions, impaired habituation, aberrant locomotion, and hyperactivity. These results demonstrate that Drosophila NBEA (rg) mutants exhibit phenotypic characteristics reminiscent of human ASD and thus could serve as a genetic model for studying ASDs.

Socioemotional Characteristics of Elementary School Children Identified as Exhibiting Social Leadership Qualities

ERIC Educational Resources Information Center

Scharf, Miri; Mayseless, Ofra

2009-01-01

Elementary school teachers identified characteristics in 4 major socioemotional domains associated with children's social leadership: self-perception, social anxiety, attachment orientation with peers, and interpersonal goals and skills in close friendships. Participants were 260 4th- and 5th-grade students (126 boys, 134 girls) from 10 classes in…

The medial prefrontal cortex exhibits money illusion

PubMed Central

Weber, Bernd; Rangel, Antonio; Wibral, Matthias; Falk, Armin

2009-01-01

Behavioral economists have proposed that money illusion, which is a deviation from rationality in which individuals engage in nominal evaluation, can explain a wide range of important economic and social phenomena. This proposition stands in sharp contrast to the standard economic assumption of rationality that requires individuals to judge the value of money only on the basis of the bundle of goods that it can buy—its real value—and not on the basis of the actual amount of currency—its nominal value. We used fMRI to investigate whether the brain's reward circuitry exhibits money illusion. Subjects received prizes in 2 different experimental conditions that were identical in real economic terms, but differed in nominal terms. Thus, in the absence of money illusion there should be no differences in activation in reward-related brain areas. In contrast, we found that areas of the ventromedial prefrontal cortex (vmPFC), which have been previously associated with the processing of anticipatory and experienced rewards, and the valuation of goods, exhibited money illusion. We also found that the amount of money illusion exhibited by the vmPFC was correlated with the amount of money illusion exhibited in the evaluation of economic transactions. PMID:19307555

The Particular Aspects of Science Museum Exhibits That Encourage Students' Engagement

NASA Astrophysics Data System (ADS)

Shaby, Neta; Assaraf, Orit Ben-Zvi; Tal, Tali

2017-06-01

This research explores learning in science museums through the most common activity in a science museum—interaction with exhibits. The goal of this study was to characterize the learning behaviors exhibited by students as they engage with interactive exhibits in order to draw insight regarding the design of the exhibits. In order to do so, we used a qualitative method of observation as well as the Visitor Engagement Framework (VEF) model, a visitor-based framework for assessing visitors' learning experiences with exhibits in a science center setting. The combined method produced a framework of nine learning behaviors exhibited during the visitors' interaction with the exhibits, grouped into three categories that reflect increasing levels of engagement and depth of the learning experience. Our research participants consisted of a total 1800 students aged 10-12 (4th, 5th, and 6th graders) who came to the museum with their class for a day visit. We observed nine exhibits, each visited by 200 students. Our observations revealed several design elements that contribute to engagement with exhibits in science museums. For example, exhibits that have familiar activation encourage visitors' interaction, exhibits that facilitate social interaction are more likely to increase engagement, and the highest levels of engagement can be found in exhibits that support large groups.

Cannabidiol exhibits anxiolytic but not antipsychotic property evaluated in the social interaction test.

PubMed

Almeida, Valéria; Levin, Raquel; Peres, Fernanda Fiel; Niigaki, Suzy T; Calzavara, Mariana B; Zuardi, Antônio W; Hallak, Jaime E; Crippa, José A; Abílio, Vanessa C

2013-03-05

Cannabidiol (CBD), a non-psychotomimetic compound of the Cannabis sativa, has been reported to have central therapeutic actions, such as antipsychotic and anxiolytic effects. We have recently reported that Spontaneously Hypertensive Rats (SHRs) present a deficit in social interaction that is ameliorated by atypical antipsychotics. In addition, SHRs present a hyperlocomotion that is reverted by typical and atypical antipsychotics, suggesting that this strain could be useful to study negative symptoms (modeled by a decrease in social interaction) and positive symptoms (modeled by hyperlocomotion) of schizophrenia as well as the effects of potential antipsychotics drugs. At the same time, an increase in social interaction in control animals similar to that induced by benzodiazepines is used to screen potential anxiolytic drugs. The aim of this study was to investigate the effects of CBD on social interaction presented by control animals (Wistar) and SHRs. The lowest dose of CBD (1mg/kg) increased passive and total social interaction of Wistar rats. However, the hyperlocomotion and the deficit in social interaction displayed by SHRs were not altered by any dose of CBD. Our results do not support an antipsychotic property of cannabidiol on symptoms-like behaviors in SHRs but reinforce the anxiolytic profile of this compound in control rats. Copyright © 2012 Elsevier Inc. All rights reserved.

Traveling Exhibitions: translating current science into effective science exhibitions

NASA Astrophysics Data System (ADS)

Dusenbery, P.; Morrow, C.; Harold, J.

The Space Science Institute (SSI) of Boulder, Colorado has recently developed two museum exhibits called the Space Weather Center and MarsQuest. It is currently planning to develop two other exhibitions called Cosmic Origins and InterActive Earth. Museum exhibitions provide research scientists the opportunity to engage in a number of activities that are vital to the success of earth and space outreach programs. The Space Weather Center was developed in partnership with various research missions at NASA's Goddard Space Flight Center. The focus of the presentation will be on the Institute's MarsQuest exhibition. This project is a 5000 square-foot, 2.5M, traveling exhibition that is now touring the country. The exhibit's 3-year tour is enabling millions of Americans to share in the excitement of the scientific exploration of Mars and learn more about their own planet in the process. The associated planetarium show and education program will also be described, with particular emphasis on workshops to orient host museum staff (e.g. museum educators and docents). The workshops make innovative connections between the exhibitions interactive experiences and lesson plans aligned with the National Science Education Standards. SSI is also developing an interactive web site called MarsQuest On-line. The linkage between the web site, education program and exhibit will be discussed. MarsQuest and SSI's other exhibitions are good models for actively involving scientists and their discoveries to help improve informal science education in the museum community and for forging a stronger connection between formal and informal education.

Social Media and Scientific Meetings: Education Exhibit "Likes" at the Radiological Society of North America Annual Meeting.

PubMed

Bunch, Paul M; Wortman, Jeremy R; Andriole, Katherine P

2016-03-01

Viewers of electronic education exhibits at the 2013 and 2014 Radiological Society of North America meetings had the opportunity to "like" exhibits, as one might "like" a Facebook or an Instagram post. The purposes of this study were (1) to evaluate for a relationship between exhibit popularity and receiving an award or RadioGraphics invitation, (2) to evaluate for a relationship between exhibit recognition and subsequent popularity, and (3) to quantify and compare the electronic education exhibit likes at the 2013 and the 2014 meetings. Exhibit likes were recorded at the midpoints and ends of both meetings. Data analyses were performed by means of one-way analysis of variance and chi-square tests. There were similar numbers of electronic education exhibits at the 2013 (1856) and 2014 (1793) meetings with no significant difference between meeting years in the number of exhibits chosen for awards (423 vs. 404, P = 0.88) or for RadioGraphics solicitation (190 vs. 169, P = 0.46). In both meeting years, there were statistically significant associations between initial and overall exhibit popularity and exhibit recognition, as well as between exhibit recognition and subsequent popularity. A 152% increase in total likes recorded was observed at the 2014 meeting as compared to the 2013 meeting (11074 vs. 4391, P < 0.0001). Popular exhibits were significantly more likely to receive awards and RadioGraphics invitations. Receiving an award or RadioGraphics invitation was associated with subsequent increased exhibit popularity. Significantly more likes were recorded at the 2014 Radiological Society of North America meeting than at the 2013 meeting. Copyright © 2015 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

Polistes metricus queens exhibit personality variation and behavioral syndromes

PubMed Central

Hyland, Trevor D; Izzo, Amanda S; McDermott, Donna R; Tibbetts, Elizabeth A; Pruitt, Jonathan N

2018-01-01

Abstract Consistent differences in behavior between individuals, otherwise known as animal personalities, have become a staple in behavioral ecology due to their ability to explain a wide range of phenomena. Social organisms are especially serviceable to animal personality techniques because they can be used to explore behavioral variation at both the individual and group level. Despite the success of personality research in social organisms generally, and social Hymenoptera in particular, social wasps (Vespidae) have received little to no attention in the personality literature. In the present study, we test Polistes metricus (Vespidae; Polistinae) paper wasp queens for the presence of repeatable variation in, and correlations (“behavioral syndromes”) between, several commonly used personality metrics: boldness, aggressiveness, exploration, and activity. Our results indicate that P. metricus queens exhibit personalities for all measured traits and correlations between different behavioral measures. Given that paper wasps have served as a model organism for a wide range of phenomena such as kin selection, dominance hierarchies, mate choice, facial recognition, social parasitism, and chemical recognition, we hope that our results will motivate researchers to explore whether, or to what degree, queen personality is important in their research programs. PMID:29492037

Collaborative virtual environments art exhibition

NASA Astrophysics Data System (ADS)

Dolinsky, Margaret; Anstey, Josephine; Pape, Dave E.; Aguilera, Julieta C.; Kostis, Helen-Nicole; Tsoupikova, Daria

2005-03-01

This panel presentation will exhibit artwork developed in CAVEs and discuss how art methodologies enhance the science of VR through collaboration, interaction and aesthetics. Artists and scientists work alongside one another to expand scientific research and artistic expression and are motivated by exhibiting collaborative virtual environments. Looking towards the arts, such as painting and sculpture, computer graphics captures a visual tradition. Virtual reality expands this tradition to not only what we face, but to what surrounds us and even what responds to our body and its gestures. Art making that once was isolated to the static frame and an optimal point of view is now out and about, in fully immersive mode within CAVEs. Art knowledge is a guide to how the aesthetics of 2D and 3D worlds affect, transform, and influence the social, intellectual and physical condition of the human body through attention to psychology, spiritual thinking, education, and cognition. The psychological interacts with the physical in the virtual in such a way that each facilitates, enhances and extends the other, culminating in a "go together" world. Attention to sharing art experience across high-speed networks introduces a dimension of liveliness and aliveness when we "become virtual" in real time with others.

[Influence of the social network on consumption in drug addicts exhibiting psychiatric comorbidity].

PubMed

Acier, D; Nadeau, L; Landry, M

2011-09-01

This research used a qualitative methodology and was conducted on a sample of 22 participants with concomitant substance-related and mental health disorders. Today, dual diagnosis patients represent the standard rather than the exception. Our objectives were to consider the elements and processes of the social network to explain variations in consumption of alcohol and drugs. The social network refers to all bonds established by patients, mainly family, couple, friends and therapist relationships. The 22 patients have used a specialized addiction treatment in Montreal (Canada). A focused qualitative interview was conducted with each participant using an audionumeric recording. The analysis follows the method of the mixed approach of Miles and Huberman, which combines the objectives of the grounded theory and the ethnography. All the interviews were transcribed then coded and analyzed with QSR N' Vivo 2.0. The method uses an iterative process making a constant return between verbatim and codes. The qualitative analyses present patients' perceptions on the increases and reductions in alcohol and drug consumption. Family network refers to participants where the family is named as supporting a decrease in drug consumption: couple network refers to intimate relations supporting a decrease in consumption. Mutual help network refers to alcoholics anonymous (AA) or other self-help groups. Several verbatim have been included. We propose strategies for the substance abuse treatment centers based on: (1) the paradox influence of the social network and the importance of clinical evaluation of patients of social networks; (2) emotions management, especially negative feelings, which include training of feeling, recognizing and naming, ability to the express and communicate to others; (3) importance of groups of mutual aid providing periods of sharing, validating individual experiences and pushing away loneliness; (4) function of social support of the clinical professionals as

20 CFR 498.208 - Exchange of witness lists, witness statements and exhibits.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Exchange of witness lists, witness statements and exhibits. 498.208 Section 498.208 Employees' Benefits SOCIAL SECURITY ADMINISTRATION CIVIL MONETARY PENALTIES, ASSESSMENTS AND RECOMMENDED EXCLUSIONS § 498.208 Exchange of witness lists, witness...

Atrophy in distinct corticolimbic networks in frontotemporal dementia relates to social impairments measured using the Social Impairment Rating Scale

PubMed Central

Bickart, Kevin C; Brickhouse, Michael; Negreira, Alyson; Sapolsky, Daisy

2015-01-01

Patients with frontotemporal dementia (FTD) often exhibit prominent, early and progressive impairments in social behaviour. We developed the Social Impairment Rating Scale (SIRS), rated by a clinician after a structured interview, which grades the types and severity of social behavioural symptoms in seven domains. In 20 FTD patients, we used the SIRS to study the anatomic basis of social impairments. In support of hypotheses generated from a prior study of healthy adults, we found that the relative magnitude of brain atrophy in three partially dissociable corticolimbic networks anchored in the amygdala predicted the severity of distinct social impairments measured using the SIRS. Patients with the greatest atrophy in a mesolimbic, reward-related (affiliation) network exhibited the most severe socioemotional detachment, whereas patients with the greatest atrophy in an interoceptive, pain-related (aversion) network exhibited the most severe lack of social apprehension. Patients with the greatest atrophy in a perceptual network exhibited the most severe lack of awareness or understanding of others’ social and emotional behaviour. Our findings underscore observations that FTD is associated with heterogeneous social symptoms that can be understood in a refined manner by measuring impairments in component processes subserved by dissociable neural networks. Furthermore, these findings support the validity of the SIRS as an instrument to measure the social symptoms of patients with FTD. Ultimately, we hope it will be useful as a longitudinal outcome measure in natural history studies and in clinical trials of putative interventions to improve social functioning. PMID:24133285

Communicating Science through Exhibitions

NASA Astrophysics Data System (ADS)

Dusenbery, P.; Harold, J.; Morrow, C.

It is critically important for the public to better understand the scientific process. Museum exhibitions are an important part of informal science education that can effectively reach public audiences as well as school groups. They provide an important gateway for the public to learn about compelling scientific endeavors. There are many ways for scientists to help develop science exhibitions. The Space Science Institute (SSI) is a national leader in producing traveling science exhibitions and their associated educational programming (i.e. interactive websites, educator workshops, public talks, instructional materials). Two of its exhibitions, Space Weather Center and MarsQuest, are currently on tour. Another exhibition, Alien Earths, is in development. The Space Weather Center was developed in partnership with various research missions at NASA's Goddard Space Flight Center. MarsQuest is a 5000 square-foot traveling exhibition. The exhibit's second 3-year tour began this January at the Detroit Science Center. It is enabling millions of Americans to share in the excitement of the scientific exploration of Mars and to learn more about their own planet in the process. The 3,000 square-foot traveling exhibition, called Alien Earths, will bring origins-related research and discoveries to students and the American public. Alien Earths has four interrelated exhibit areas: Our Place in Space, Star Birth, PlanetQuest, and Search for Life. Exhibit visitors will explore the awesome events surrounding the birth of stars and planets; they will join scientists in the hunt for planets outside our solar system including those that may be in ``habitable zones'' around other stars; and finally they will be able to learn about how scientists are looking for signs of life beyond Earth. Besides the exhibits, SSI is also developing interactive web sites based on exhibit themes. New technologies are transforming the Web from a static medium to an interactive environment with tremendous

"Moving in My World": From School PE to Participants-Centered Art Exhibitions

ERIC Educational Resources Information Center

Azzarito, Laura

2016-01-01

To address persistent health and physical activity issues, listening to the opinions and needs of a diverse population should be at the forefront of a social justice agenda. This article examines how a participant-centered photo exhibition, as the culmination of a two-year-long visual participatory research project, provided a site of public…

New Hurricane Exhibit

NASA Image and Video Library

2007-08-29

A new exhibit in StenniSphere depicting NASA's role in hurricane prediction and research and SSC's role in helping the region recover from Hurricane Katrina. The cyclone-shaped exhibit focuses on the effects of the Aug. 29, 2005 storm and outlines how NASA is working to improve weather forecasting. Through photos, 3-D models and digital animations, the exhibit tells the story of what happened inside the storm and how NASA's scientific research can increase the accuracy of hurricane tracking and modeling.

New Hurricane Exhibit

NASA Technical Reports Server (NTRS)

2007-01-01

A new exhibit in StenniSphere depicting NASA's role in hurricane prediction and research and SSC's role in helping the region recover from Hurricane Katrina. The cyclone-shaped exhibit focuses on the effects of the Aug. 29, 2005 storm and outlines how NASA is working to improve weather forecasting. Through photos, 3-D models and digital animations, the exhibit tells the story of what happened inside the storm and how NASA's scientific research can increase the accuracy of hurricane tracking and modeling.

Multiscale Model of Swarming Bacteria

NASA Astrophysics Data System (ADS)

Alber, Mark

2011-03-01

Many bacteria can rapidly traverse surfaces from which they are extracting nutrient for growth. They generate flat, spreading colonies, called swarms because they resemble swarms of insects. In the beginning of the talk, swarms of the M. xanthus will be described in detail. Individual M. xanthus cells are elongated; they always move in the direction of their long axis; and they are in constant motion, repeatedly touching each other. As a cell glides, the slime capsule of a cell interacts with the bare agar surface, non-oriented slime which arises from the surface contact with the slime capsule, or oriented slime trails. Remarkably, cells regularly reverse their gliding directions. In this talk a detailed cell- and behavior-based computational model of M. xanthus swarming will be used to demonstrate that reversals of gliding direction and cell bending are essential for swarming and that specific reversal frequencies result in optimal swarming rate of the whole population. This suggests that the circuit regulating reversals evolved to its current sensitivity under selection for growth achieved by swarming.

Museum Exhibition on Testing and Measurement: Scientific Principles, Social Impact of Testing, and Dialogue with the Public

ERIC Educational Resources Information Center

Allalouf, Avi; Alderoqui-Pinus, Diana

2012-01-01

This article deals with a pioneering project currently being developed, namely, the Exhibition on Testing and Measurement. This interactive traveling exhibition will be presented in science museums in Israel, the United States, and other countries. It has been conceived as an innovative means of familiarizing the public with educational…

Improving Social Initiations in Young Children with Autism Using Reinforcers with Embedded Social Interactions

ERIC Educational Resources Information Center

Koegel, Robert L.; Vernon, Ty W.; Koegel, Lynn K.

2009-01-01

Children with autism often exhibit low levels of social engagement, decreased levels of eye contact, and low social affect. However, both the literature and our direct clinical observations suggest that some components of intervention procedures may result in improvement in child-initiated social areas. Using an ABAB research design with three…

Creating Learning Experiences that Promote Informal Science Education: Designing Conservation-Focused Interactive Zoo Exhibits through Action Research

NASA Astrophysics Data System (ADS)

Kalenda, Peter

Research on exhibit design over the past twenty years has started to identify many different methods to increase the learning that occurs in informal education environments. This study utilized relevant research on exhibit design to create and study the effectiveness of a mobile interactive exhibit at the Seneca Park Zoo that promotes socialization, engagement in science, and conservation-related practices among guests. This study will serve as one component of a major redesign project at the Seneca Park Zoo for their Rocky Coasts exhibit. This action research study targeted the following question, "How can interactive exhibits be designed to promote socialization, engagement in science, and real-world conservation-related practices (RCPs) among zoo guests?" Specific research questions included: 1. In what ways did guests engage with the exhibit? 2. In what ways were guests impacted by the exhibit? a) What evidence exists, if any, of guests learning science content from the exhibit? b) What evidence exists, if any, of guests being emotionally affected by the exhibit? c) What evidence exists, if any, of guests changing their RCPs after visiting the exhibit? Data were collected through zoo guest surveys completed by zoo guests comparing multiple exhibits, interviews with guests before and after they used the prototype exhibit, observations and audio recordings of guests using the prototype exhibit, and follow-up phone interviews with guests who volunteered to participate. Data were analyzed collaboratively with members of the zoo's exhibit Redesign Team using grounded theory qualitative data analysis techniques to find patterns and trends among data. Initial findings from data analysis were used to develop shifts in the exhibit in order to increase visitor engagement and learning. This process continued for two full action research spirals, which resulted in three iterations of the prototype exhibit. The overall findings of this study highlight the ways in which

Visitors Center Exhibits

NASA Technical Reports Server (NTRS)

1997-01-01

A child enjoys building his own LEGO model at a play table which was included in the exhibit 'Travel in Space' World Show. The exhibit consisted of 21 displays designed to teach children about flight and space travel from the Wright brothers to future generations of space vehicles.

Social and Non-Social Behavioral Inhibition in Preschool-Age Children: Differential Associations with Parent-Reports of Temperament and Anxiety

PubMed Central

Dyson, Margaret W.; Klein, Daniel N.; Olino, Thomas M.; Dougherty, Lea R.; Durbin, C. Emily

2012-01-01

Behavioral inhibition (BI) has generally been treated as a unitary construct and assessed by combining ratings of fear, vigilance, and avoidance to both novel social and non-social stimuli. However, there is evidence suggesting that BI in social contexts is not correlated with BI in non-social contexts. The present study examined the distinction between social and non-social BI in a community sample of 559 preschool-age children using a laboratory assessment of child temperament, a diagnostic interview, and parent-completed questionnaires. Social and non-social BI were not significantly correlated and exhibited distinct patterns of associations with parent reports of temperament and anxiety symptoms. This study suggests that BI is heterogeneous, and that distinguishing between different forms of BI may help account for the variation in trajectories and outcomes exhibited by high BI children. PMID:21479511

Application of an imaging system to a museum exhibition for developing interactive exhibitions

NASA Astrophysics Data System (ADS)

Miyata, Kimiyoshi; Inoue, Yuka; Takiguchi, Takahiro; Tsumura, Norimichi; Nakaguchi, Toshiya; Miyake, Yoichi

2009-10-01

In the National Museum of Japanese History, 215,759 artifacts are stored and used for research and exhibitions. In museums, due to the limitation of space in the galleries, a guidance system is required to satisfy visitors' needs and to enhance their understanding of the artifacts. We introduce one exhibition using imaging technology to improve visitors' understanding of a kimono (traditional Japanese clothing) exhibition. In the imaging technology introduced, one data projector, one display with touch panel interface, and magnifiers were used as exhibition tools together with a real kimono. The validity of this exhibition method was confirmed by results from a visitors' interview survey. Second, to further develop the interactive guidance system, an augmented reality system that consisted of cooperation between the projector and a digital video camera was also examined. A white paper board in the observer's hand was used as a projection screen and also as an interface to control the images projected on the board. The basic performance of the proposed system was confirmed; however continuous development was necessary for applying the system to actual exhibitions.

GAL3 receptor KO mice exhibit an anxiety-like phenotype

PubMed Central

Brunner, Susanne M.; Farzi, Aitak; Locker, Felix; Holub, Barbara S.; Drexel, Meinrad; Reichmann, Florian; Lang, Andreas A.; Mayr, Johannes A.; Vilches, Jorge J.; Navarro, Xavier; Lang, Roland; Sperk, Günther; Holzer, Peter; Kofler, Barbara

2014-01-01

The neuropeptide galanin (GAL) is widely distributed in the central and peripheral nervous systems. It is a modulator of various physiological and pathological processes, and it mediates its effects via three G protein-coupled receptors (GAL1–3 receptors). A role for GAL as a modulator of mood and anxiety was suggested, because GAL and its receptors are highly expressed in limbic brain structures of rodents. In recent years, numerous studies of animal models have suggested an involvement of GAL and GAL1 and GAL2 receptors in anxiety- and depression-related behavior. However, to date, there is sparse literature implicating GAL3 receptors in behavioral functions. Therefore, we studied the behavior of GAL3 receptor-deficient (GAL3-KO) mice to elucidate whether GAL3 receptors are involved in mediating behavior-associated actions of GAL. The GAL3-KO mouse line exhibited normal breeding and physical development. In addition to behavioral tests, phenotypic characterization included analysis of hematology, amino acid profiles, metabolism, and sudomotor function. In contrast to WT littermates, male GAL3-KO mice exhibited an anxiety-like phenotype in the elevated plus maze, open field, and light/dark box tests, and they were less socially affiliated than WT animals to a stranger mouse in a social interaction test. In conclusion, our data suggest involvement of GAL3 receptors in GAL-mediated effects on mood, anxiety, and behavior, making it a possible target for alternative treatment strategies for mood disorders. PMID:24782539

Physical Activity into Socialization: A Movement-Based Social Skills Program for Children with Autism Spectrum Disorder

ERIC Educational Resources Information Center

Lee, Jihyun; Vargo, Kristina K.

2017-01-01

Children with autism spectrum disorder (ASD) often exhibit deficits in social-communicative behaviors. Given the increased prevalence of children with ASD, programs designed to teach social-communicative behaviors are necessary. This article introduces a movement-based program that embeds social-skill components to improve the motor skills and…

Exopolysaccharide microchannels direct bacterial motility and organize multicellular behavior

DOE PAGES

Berleman, James E.; Zemla, Marcin; Remis, Jonathan P.; ...

2016-05-06

The myxobacteria are a family of soil bacteria that form biofilms of complex architecture, aligned multilayered swarms or fruiting body structures that are simple or branched aggregates containing myxospores. Here, we examined the structural role of matrix exopolysaccharide (EPS) in the organization of these surface-dwelling bacterial cells. Using time-lapse light and fluorescence microscopy, as well as transmission electron microscopy and focused ion beam/scanning electron microscopy (FIB/SEM) electron microscopy, we found that Myxococcus xanthus cell organization in biofilms is dependent on the formation of EPS microchannels. Cells are highly organized within the three-dimensional structure of EPS microchannels that are required formore » cell alignment and advancement on surfaces. Mutants lacking EPS showed a lack of cell orientation and poor colony migration. Purified, cell-free EPS retains a channel-like structure, and can complement EPS - mutant motility defects. In addition, EPS provides the cooperative structure for fruiting body formation in both the simple mounds of M. xanthus and the complex, tree-like structures of Chondromyces crocatus. We furthermore investigated the possibility that EPS impacts community structure as a shared resource facilitating cooperative migration among closely related isolates of M. xanthus.« less

Early-Life Social Isolation Influences Mouse Ultrasonic Vocalizations during Male-Male Social Encounters.

PubMed

Keesom, Sarah M; Finton, Caitlyn J; Sell, Gabrielle L; Hurley, Laura M

2017-01-01

Early-life social isolation has profound effects on adult social competence. This is often expressed as increased aggression or inappropriate displays of courtship-related behaviors. The social incompetence exhibited by isolated animals could be in part due to an altered ability to participate in communicatory exchanges. House mice (Mus musculus) present an excellent model for exploring this idea, because social isolation has a well-established influence on their social behavior, and mice engage in communication via multiple sensory modalities. Here, we tested the prediction that social isolation during early life would influence ultrasonic vocalizations (USVs) emitted by adult male mice during same-sex social encounters. Starting at three weeks of age, male mice were housed individually or in social groups of four males for five weeks, after which they were placed in one of three types of paired social encounters. Pair types consisted of: two individually housed males, two socially housed males, or an individually housed and a socially housed male ("mixed" pairs). Vocal behavior (USVs) and non-vocal behaviors were recorded from these 15-minute social interactions. Pairs of mice consisting of at least one individually housed male emitted more and longer USVs, with a greater proportional use of USVs containing frequency jumps and 50-kHz components. Individually housed males in the mixed social pairs exhibited increased levels of mounting behavior towards the socially housed males. Mounting in these pairs was positively correlated with increased number and duration of USVs as well as increased proportional use of spectrally more complex USVs. These findings demonstrate that USVs are part of the suite of social behaviors influenced by early-life social isolation, and suggest that altered vocal communication following isolation reflects reduced social competence.

Early-Life Social Isolation Influences Mouse Ultrasonic Vocalizations during Male-Male Social Encounters

PubMed Central

Finton, Caitlyn J.; Sell, Gabrielle L.; Hurley, Laura M.

2017-01-01

Early-life social isolation has profound effects on adult social competence. This is often expressed as increased aggression or inappropriate displays of courtship-related behaviors. The social incompetence exhibited by isolated animals could be in part due to an altered ability to participate in communicatory exchanges. House mice (Mus musculus) present an excellent model for exploring this idea, because social isolation has a well-established influence on their social behavior, and mice engage in communication via multiple sensory modalities. Here, we tested the prediction that social isolation during early life would influence ultrasonic vocalizations (USVs) emitted by adult male mice during same-sex social encounters. Starting at three weeks of age, male mice were housed individually or in social groups of four males for five weeks, after which they were placed in one of three types of paired social encounters. Pair types consisted of: two individually housed males, two socially housed males, or an individually housed and a socially housed male (“mixed” pairs). Vocal behavior (USVs) and non-vocal behaviors were recorded from these 15-minute social interactions. Pairs of mice consisting of at least one individually housed male emitted more and longer USVs, with a greater proportional use of USVs containing frequency jumps and 50-kHz components. Individually housed males in the mixed social pairs exhibited increased levels of mounting behavior towards the socially housed males. Mounting in these pairs was positively correlated with increased number and duration of USVs as well as increased proportional use of spectrally more complex USVs. These findings demonstrate that USVs are part of the suite of social behaviors influenced by early-life social isolation, and suggest that altered vocal communication following isolation reflects reduced social competence. PMID:28056078

Social Networks and Cooperation in Hunter-Gatherers

PubMed Central

Apicella, Coren L.; Marlowe, Frank W.; Fowler, James H.; Christakis, Nicholas A.

2011-01-01

Social networks exhibit striking structural regularities1,2, and theory and evidence suggest that they may have played a role in the development of large-scale cooperation in humans3–7. Here, we characterize the social networks of the Hadza, an evolutionarily relevant population of hunter-gatherers8. We show that Hadza networks exhibit important properties also seen in modernized networks, including a skewed degree distribution, degree assortativity, transitivity, reciprocity, geographic decay, and homophily. Moreover, we demonstrate that Hadza camps exhibit high between-group and low within-group variation in public goods game donations. Network ties are also more likely between people who give the same amount, and the similarity in cooperative behaviour extends up to two degrees of separation. Finally, social distance appears to be as important as genetic relatedness and physical proximity in explaining assortativity in cooperation. Our results suggest that certain elements of social network structure may have been present at an early point in human history; that early humans may have formed ties with both kin and non-kin based, in part, on their tendency to cooperate; and that social networks may have contributed to the emergence of cooperation. PMID:22281599

Inuit Perspectives on Arctic Environmental Change': A Traveling Exhibition

NASA Astrophysics Data System (ADS)

Sheffield, E. M.; Hakala, J. S.; Gearheard, S.

2006-12-01

The Inuit of Nunavut, Canada, have an intimate relationship with their surroundings. As a culture that relies on knowledge of sea ice, snow, and weather conditions for success in hunting, fishing, and healthy wellbeing, Inuit have observed and studied environmental patterns for generations. An ongoing study into their traditional knowledge and their observations of environmental change is being conducted by researcher Dr. Shari Gearheard, who has worked with Inuit communities in Nunavut for over a decade. The results of the research have been published in scientific journals, and to communicate the results to a broader audience, Dr. Gearheard designed an interactive CD-ROM displaying photographs, maps, and interview videos of Inuit Elders' perspectives on the changes they have witnessed. Receiving immediate popularity since its release in 2004, copies of `When the Weather is Uggianaqtuq: Inuit Observations of Environmental Change' have been distributed worldwide, to indigenous peoples, social science and climate change researchers, teachers, students, and the general public. To further disseminate the information contained on the CD-ROM, the National Snow and Ice Data Center and the Museum of Natural History, both of the University of Colorado, are partnering to create an exhibition which will open at the Museum during the International Polar Year in April 2008. The exhibit, tentatively titled `Inuit Perspectives on Arctic Environmental Change,' will feature photographs, graphics, and text in both English and Inuktitut describing environmental change in the North. The goals are to make the information and interpretation contained on the CD-ROM available and more accessible to a broad audience and to raise awareness about Arctic climate change and the important contribution of Inuit knowledge. Following exhibition at the Museum, the exhibit will travel throughout the United States, Alaska, and Nunavut, through a network of museums, schools, libraries, tribal

Are the components of social reciprocity transdiagnostic across pediatric neurodevelopmental disorders? Evidence for common and disorder-specific social impairments.

PubMed

Sturm, Alexandra; Rozenman, Michelle; Chang, Susanna; McGough, James J; McCracken, James T; Piacentini, John C

2018-06-01

Deficits in social communication are a core feature of autism spectrum disorder (ASD), yet significant social problems have been observed in youth with many neurodevelopmental disorders. In this preliminary investigation, we aimed to explore whether domains of social reciprocity (i.e., social communication, social cognition, social awareness, social motivation, and restricted and repetitive behaviors) represent transdiagnostic traits. These domains were compared across youth ages 7-17 with obsessive-compulsive disorder (OCD; N = 32), tic disorders (TD; N = 20), severe mood dysregulation (N = 33) and autism spectrum disorder (N = 35). While the ASD group was rated by parents as exhibiting the greatest social reciprocity deficits across domains, a high proportion of youth with severe mood dysregulation also exhibited pronounced deficits in social communication, cognition, and awareness. The ASD and severe mood dysregulation groups demonstrated comparable scores on the social awareness domain. In contrast, social motivation and restricted and repetitive behaviors did not appear to be transdiagnostic domains in severe mood dysregulation, OCD, or TD groups. The present work provides preliminary support that social awareness, and to a lesser extent social communication and cognition, may represent features of social reciprocity that are transdiagnostic across ASD and severe mood dysregulation. Copyright © 2018 Elsevier B.V. All rights reserved.

Binary logistic regression-Instrument for assessing museum indoor air impact on exhibits.

PubMed

Bucur, Elena; Danet, Andrei Florin; Lehr, Carol Blaziu; Lehr, Elena; Nita-Lazar, Mihai

2017-04-01

This paper presents a new way to assess the environmental impact on historical artifacts using binary logistic regression. The prediction of the impact on the exhibits during certain pollution scenarios (environmental impact) was calculated by a mathematical model based on the binary logistic regression; it allows the identification of those environmental parameters from a multitude of possible parameters with a significant impact on exhibitions and ranks them according to their severity effect. Air quality (NO 2 , SO 2 , O 3 and PM 2.5 ) and microclimate parameters (temperature, humidity) monitoring data from a case study conducted within exhibition and storage spaces of the Romanian National Aviation Museum Bucharest have been used for developing and validating the binary logistic regression method and the mathematical model. The logistic regression analysis was used on 794 data combinations (715 to develop of the model and 79 to validate it) by a Statistical Package for Social Sciences (SPSS 20.0). The results from the binary logistic regression analysis demonstrated that from six parameters taken into consideration, four of them present a significant effect upon exhibits in the following order: O 3 >PM 2.5 >NO 2 >humidity followed at a significant distance by the effects of SO 2 and temperature. The mathematical model, developed in this study, correctly predicted 95.1 % of the cumulated effect of the environmental parameters upon the exhibits. Moreover, this model could also be used in the decisional process regarding the preventive preservation measures that should be implemented within the exhibition space. The paper presents a new way to assess the environmental impact on historical artifacts using binary logistic regression. The mathematical model developed on the environmental parameters analyzed by the binary logistic regression method could be useful in a decision-making process establishing the best measures for pollution reduction and preventive

29 CFR 2200.70 - Exhibits.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH REVIEW COMMISSION RULES OF PROCEDURE Hearings... separate file designated for rejected exhibits. (e) Return of physical exhibits. A party may on motion request the return of a physical exhibit within 30 days after expiration of the time for filing a petition...

32 CFR 705.24 - Exhibits.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 5 2011-07-01 2011-07-01 false Exhibits. 705.24 Section 705.24 National Defense... inform the public of the Navy's mission and operations. (2) To disseminate technical and scientific... Exhibit Center is to support local Navy recruiters. Requests for exhibits for community relations events...

32 CFR 705.24 - Exhibits.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 5 2010-07-01 2010-07-01 false Exhibits. 705.24 Section 705.24 National Defense... inform the public of the Navy's mission and operations. (2) To disseminate technical and scientific... Exhibit Center is to support local Navy recruiters. Requests for exhibits for community relations events...

Gaze perception in social anxiety and social anxiety disorder

PubMed Central

Schulze, Lars; Renneberg, Babette; Lobmaier, Janek S.

2013-01-01

Clinical observations suggest abnormal gaze perception to be an important indicator of social anxiety disorder (SAD). Experimental research has yet paid relatively little attention to the study of gaze perception in SAD. In this article we first discuss gaze perception in healthy human beings before reviewing self-referential and threat-related biases of gaze perception in clinical and non-clinical socially anxious samples. Relative to controls, socially anxious individuals exhibit an enhanced self-directed perception of gaze directions and demonstrate a pronounced fear of direct eye contact, though findings are less consistent regarding the avoidance of mutual gaze in SAD. Prospects for future research and clinical implications are discussed. PMID:24379776

Adolescent Social Defeat Induced Alterations in Social Behavior and Cognitive Flexibility in Adult Mice: Effects of Developmental Stage and Social Condition

PubMed Central

Zhang, Fan; Yuan, Sanna; Shao, Feng; Wang, Weiwen

2016-01-01

Negative social experiences during adolescence increase the risk of psychiatric disorders in adulthood. Using “resident-intruder” stress, the present study aimed to investigate the effects of adolescent social defeat on emotional and cognitive symptoms associated with psychiatric disorders during adulthood and the effects of the developmental stage and social condition on this process. In Experiment 1, animals were exposed to social defeat or manipulation for 10 days during early adolescence (EA, postnatal days [PND] 28–37), late adolescence (LA, PND 38–47), and adulthood (ADULT, PND 70–79) and then singly housed until the behavioral tests. Behaviors, including social avoidance of the defeat context and cortically mediated cognitive flexibility in an attentional set-shifting task (AST), were assessed during the week following stress or after 6 weeks during adulthood. We determined that social defeat induced significant and continuous social avoidance across age groups at both time points. The mice that experienced social defeat during adulthood exhibited short-term impairments in reversal learning (RL) on the AST that dissipated after 6 weeks. In contrast, social defeat during EA but not LA induced a delayed deficit in extra-dimensional set-shifting (EDS) in adulthood but not during adolescence. In Experiment 2, we further examined the effects of social condition (isolation or social housing after stress) on the alterations induced by social defeat during EA in adult mice. The adult mice that had experienced stress during EA exhibited social avoidance similar to the avoidance identified in Experiment 1 regardless of the isolation or social housing after the stress. However, social housing after the stress ameliorated the cognitive flexibility deficits induced by early adolescent social defeat in the adult mice, and the social condition had no effect on cognitive function. These findings suggest that the effects of social defeat on emotion and cognitive

7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 14 2012-01-01 2012-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 14 2013-01-01 2013-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 14 2014-01-01 2014-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 14 2010-01-01 2009-01-01 true Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 14 2011-01-01 2011-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

Limited social plasticity in the socially polymorphic sweat bee Lasioglossum calceatum.

PubMed

Davison, P J; Field, J

2018-01-01

Eusociality is characterised by a reproductive division of labour, where some individuals forgo direct reproduction to instead help raise kin. Socially polymorphic sweat bees are ideal models for addressing the mechanisms underlying the transition from solitary living to eusociality, because different individuals in the same species can express either eusocial or solitary behaviour. A key question is whether alternative social phenotypes represent environmentally induced plasticity or predominantly genetic differentiation between populations. In this paper, we focus on the sweat bee Lasioglossum calceatum , in which northern or high-altitude populations are solitary, whereas more southern or low-altitude populations are typically eusocial. To test whether social phenotype responds to local environmental cues, we transplanted adult females from a solitary, northern population, to a southern site where native bees are typically eusocial. Nearly all native nests were eusocial, with foundresses producing small first brood (B1) females that became workers. In contrast, nine out of ten nests initiated by transplanted bees were solitary, producing female offspring that were the same size as the foundress and entered directly into hibernation. Only one of these ten nests became eusocial. Social phenotype was unlikely to be related to temperature experienced by nest foundresses when provisioning B1 offspring, or by B1 emergence time, both previously implicated in social plasticity seen in two other socially polymorphic sweat bees. Our results suggest that social polymorphism in L. calceatum predominantly reflects genetic differentiation between populations, and that plasticity is in the process of being lost by bees in northern populations. Phenotypic plasticity is thought to play a key role in the early stages of the transition from solitary to eusocial behaviour, but may then be lost if environmental conditions become less variable. Socially polymorphic sweat bees exhibit

San Rafael Schools Exhibit.

ERIC Educational Resources Information Center

San Rafael City Schools, CA.

The San Rafael City Schools' exhibit which was displayed at the 1983 Marin County Fair (California) is described. The exhibit, entitled "Education - A Real Winner," consisted of 12 display panels illustrating the following aspects of the school system: (1) early history from 1861; (2) present board and administration; (3) present schools…

Interconnected Cavernous Structure of Bacterial Fruiting Bodies

DOE PAGES

Harvey, Cameron W.; Du, Huijing; Xu, Zhiliang; ...

2012-12-27

The formation of spore-filled fruiting bodies by myxobacteria is a fascinating case of multicelular self-organization by bacteria. The organization of Myxococcus xanthus into fruiting bodies has long been studied not only as an important example of collective motion of bacteria, but also as a simplified model for developmental morphogenesis. Sporulation within the nascent fruiting body requires signaling between moving cells in order that the rod-shaped self-propelled cells differentiate into spores at the appropriate time. Probing the three-dimensional structure of myxobacteria fruiting bodies has previously presented a challenge due to Imitations at different imaging methods. A new technique using Infrared Opticalmore » Coherence Tomography (OCT) revealed previously unknown details of the Internal structure of M. xanthus fruiting bodies consisting of interconnected pockets of relative nigh and low spore density regions. Here, to make sense of the experimentally observed structure, modeling and computer simulations were used to test a hypothesized mechanism that could produce high density pockets of spores. The mechanism consists of self-propelled cells aligning with each other and signaling by end-to-end contact to coordinate the process of differentiation resulting in a pattern of clusters observed in the experiment. The Integration of novel OCT experimental techniques with computational simulations can provide new insight Into the mechanisms that can give rise to the pattern formation seen In other biological systems such as dlctyostelids, social amoeba known to form multicellular aggregates observed as slugs under starvation conditions.« less

Understanding Social Contagion in Adoption Processes Using Dynamic Social Networks.

PubMed

Herrera, Mauricio; Armelini, Guillermo; Salvaj, Erica

2015-01-01

There are many studies in the marketing and diffusion literature of the conditions in which social contagion affects adoption processes. Yet most of these studies assume that social interactions do not change over time, even though actors in social networks exhibit different likelihoods of being influenced across the diffusion period. Rooted in physics and epidemiology theories, this study proposes a Susceptible Infectious Susceptible (SIS) model to assess the role of social contagion in adoption processes, which takes changes in social dynamics over time into account. To study the adoption over a span of ten years, the authors used detailed data sets from a community of consumers and determined the importance of social contagion, as well as how the interplay of social and non-social influences from outside the community drives adoption processes. Although social contagion matters for diffusion, it is less relevant in shaping adoption when the study also includes social dynamics among members of the community. This finding is relevant for managers and entrepreneurs who trust in word-of-mouth marketing campaigns whose effect may be overestimated if marketers fail to acknowledge variations in social interactions.

Understanding Social Contagion in Adoption Processes Using Dynamic Social Networks

PubMed Central

2015-01-01

There are many studies in the marketing and diffusion literature of the conditions in which social contagion affects adoption processes. Yet most of these studies assume that social interactions do not change over time, even though actors in social networks exhibit different likelihoods of being influenced across the diffusion period. Rooted in physics and epidemiology theories, this study proposes a Susceptible Infectious Susceptible (SIS) model to assess the role of social contagion in adoption processes, which takes changes in social dynamics over time into account. To study the adoption over a span of ten years, the authors used detailed data sets from a community of consumers and determined the importance of social contagion, as well as how the interplay of social and non-social influences from outside the community drives adoption processes. Although social contagion matters for diffusion, it is less relevant in shaping adoption when the study also includes social dynamics among members of the community. This finding is relevant for managers and entrepreneurs who trust in word-of-mouth marketing campaigns whose effect may be overestimated if marketers fail to acknowledge variations in social interactions. PMID:26505473

Physiological stress response to loss of social influence and threats to masculinity.

PubMed

Taylor, Catherine J

2014-02-01

Social influence is an important component of contemporary conceptualizations of masculinity in the U.S. Men who fail to achieve masculinity by maintaining social influence in the presence of other men may be at risk of stigmatization. As such, men should be especially likely to exhibit a stress response to loss of social influence in the presence of other men. This study assesses whether men who lose social influence exhibit more of a stress response than men who gain social influence, using data collected in a laboratory setting where participants were randomly assigned into four-person groups of varying sex compositions. The groups were videotaped working on two problem-solving tasks. Independent raters assessed change in social influence using a well-validated measure borrowed from experimental work in the Status Characteristics Theory tradition. Cortisol is used as a measure of stress response because it is known to increase in response to loss of social esteem. Results show that young men who lose social influence while working with other young men exhibit cortisol response. In contrast women do not exhibit cortisol response to loss of social influence, nor do men working with women. Results are consistent with the hypothesis that loss of social influence in men may be associated with a physiological stress response because maintaining social influence is very important to men while in the presence of other men. This physiological response to loss of social influence underscores the importance to men of achieving masculinity through gaining and maintaining social influence, and avoiding the stigma associated with the failure to do so. Copyright © 2013 Elsevier Ltd. All rights reserved.

Starship 2040 Exhibit

NASA Technical Reports Server (NTRS)

2002-01-01

This photograph shows onlookers viewing displays within the Starship 2040 exhibit on display at Joe Davis Stadium in Huntsville, Alabama. Developed by the Space Transportation Directorate at Marshall Space Flight Center (MSFC), the Starship 2040 exhibit is housed in a 48-ft (14.6-m) tractor and trailer rig, permitting it to travel around the Nation, demonstrating NASA's vision of what commercial spaceflight might be like 40 years from now. All the irnovations suggested aboard the exhibit (automated vehicle health monitoring systems, high-energy propulsion drive, navigational aids, and emergency and safety systems) are based on concepts and technologies now being studied at NASA Centers and partner institutions around the Nation. NASA is the Nation's premier agency for development of the space transportation system, including future-generation reusable launch vehicles. Such systems, the keys to a 'real' Starship 2040, require revolutionary advances in critical aerospace technologies, from thermal, magnetic, chemical, and propellantless propulsion systems to new energy sources such as space solar power or antimatter propulsion. These and other advances are now being studied, developed, and tested at NASA field centers and partner institutions all over the Nation.

Physiological adaptation to recurrent social stress of extraversion.

PubMed

Lu, Wei; Wang, Zhenhong

2017-02-01

The present studies examined the influence of extraversion on physiological reactivity, recovery, and physiological habituation-sensitization to repeated social stressors. In Study 1, subjective and physiological data were collected from 97 college students who were categorized as high (n = 51) and low (n = 46) on extraversion (NEO-FFI) across five laboratory stages: baseline, stress 1, poststress 1, stress 2, and poststress 2. Results indicated high extraversion (HE) participants exhibited relative lesser heart rate (HR) reactivity and respiratory sinus arrhythmia (RSA) withdrawals to, and more complete HR and RSA recovery after the first social stress, and also exhibited relative lesser HR reactivity to the second social stress. When repeatedly exposed to a social stressor, HE participants showed pronounced systolic blood pressure (SBP) adaptation, low extraversion (LE) participants displayed diastolic blood pressure (DBP) sensitization. In Study 2, data were collected from another 78 participants (HE: n = 40, LE: n = 38) across the same laboratory stages with speech performance videotaped. After controlling for the speech styles, Study 2 found the same HR response and SBP/DBP adaptation pattern across extraversion groups to social stress as Study 1 but not RSA reactivity. These findings suggest extraverts exhibit more adaptive physiological reactivity to recurrent social stressors, which thus might benefit their health. © 2016 Society for Psychophysiological Research.

Nonsocially housed rats (Ratus norvegicus) seek social interactions and social novelty more than socially housed counterparts.

PubMed

Templer, Victoria L; Wise, Taylor B; Dayaw, Katrina Isabel T; Dayaw, Judith Nicole T

2018-04-23

Sociability is the act or quality of social interaction and can be quantified by determining the number and duration of interactions with conspecifics. The purpose of this study was to examine the extent to which sustained social contact, as achieved by constant social living conditions, influenced social behavior. Beginning in juvenility, 19 male Long-Evans rats were housed in enriched environments, with half living socially in a large group and half living individually. After several months in these housing conditions, rats were tested on a sociality test and a social novelty preference test. Nonsocially housed rats exhibited more social behavior than socially housed rats. In the sociality test, nonsocially housed rats engaged with an unfamiliar rat more than socially housed rats. Similarly, in the social novelty test, nonsocially housed rats visited a novel stranger more than the now-familiar rat (from the sociality test) as compared with the socially housed rats. It is unlikely that general anxiety factors can account for between-groups social effects, as there were no group differences in behavior on the elevated zero maze and open field test. Furthermore, socially and nonsocially housed rats were matched in spontaneous object exploration and novelty preference in a novel object recognition test, eliminating the possibility that general exploratory behavior or novelty preference accounted for group differences in the sociability tasks. These results suggest that lack of social interaction in nonsocially housed rats may be more powerful for social motivation than the consistent opportunity for social contact afforded by social living conditions. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Starship 2040 Exhibit

NASA Technical Reports Server (NTRS)

2002-01-01

This photograph shows Justin Varnadore, son of a Marshall TV employee, at the controls of one of the many displays within the Starship 2040 exhibit on display at Joe Davis Stadium in Huntsville, Alabama. Developed by the Space Transportation Directorate at Marshall Space Flight Center (MSFC), the Starship 2040 exhibit is housed in a 48-ft (14.6-m) tractor and trailer rig, permitting it to travel around the Nation, demonstrating NASA's vision of what commercial spaceflight might be like 40 years from now. All the irnovations suggested aboard the exhibit (automated vehicle health monitoring systems, high-energy propulsion drive, navigational aids, and emergency and safety systems) are based on concepts and technologies now being studied at NASA Centers and partner institutions around the Nation. NASA is the Nation's premier agency for development of the space transportation system, including future-generation reusable launch vehicles. Such systems, the keys to a 'real' Starship 2040, require revolutionary advances in critical aerospace technologies, from thermal, magnetic, chemical, and propellantless propulsion systems to new energy sources such as space solar power or antimatter propulsion. These and other advances are now being studied, developed, and tested at NASA field centers and partner institutions all over the Nation.

Extraversion and cardiovascular responses to recurrent social stress: Effect of stress intensity.

PubMed

Lü, Wei; Xing, Wanying; Hughes, Brian M; Wang, Zhenhong

2017-10-28

The present study sought to establish whether the effects of extraversion on cardiovascular responses to recurrent social stress are contingent on stress intensity. A 2×5×1 mixed-factorial experiment was conducted, with social stress intensity as a between-subject variable, study phase as a within-subject variable, extraversion as a continuous independent variable, and cardiovascular parameter (HR, SBP, DBP, or RSA) as a dependent variable. Extraversion (NEO-FFI), subjective stress, and physiological stress were measured in 166 undergraduate students randomly assigned to undergo moderate (n=82) or high-intensity (n=84) social stress (a public speaking task with different levels of social evaluation). All participants underwent continuous physiological monitoring while facing two consecutive stress exposures distributed across five laboratory phases: baseline, stress exposure 1, post-stress 1, stress exposure 2, post-stress 2. Results indicated that under moderate-intensity social stress, participants higher on extraversion exhibited lesser HR reactivity to stress than participants lower on extraversion, while under high-intensity social stress, they exhibited greater HR, SBP, DBP and RSA reactivity. Under both moderate- and high-intensity social stress, participants higher on extraversion exhibited pronounced SBP and DBP response adaptation to repeated stress, and showed either better degree of HR recovery or greater amount of SBP and DBP recovery after stress. These findings suggest that individuals higher on extraversion exhibit physiological flexibility to cope with social challenges and benefit from adaptive cardiovascular responses. Copyright © 2017 Elsevier B.V. All rights reserved.

Exhibiting Lives

ERIC Educational Resources Information Center

Golden, Deborah; Elbaz-Luwisch, Freema

2007-01-01

This paper examines some of the dilemmas that accompany the emergence of the personal voice in scholarly work, by taking a close, grounded look at the way in which these unfolded in a specific academic course. As part of the course, entitled "A cultural approach to the life cycle", students were asked to participate in a group exhibition in which…

Aggression and prosocial behaviors in social conflicts mediating the influence of cold social intelligence and affective empathy on children's social preference.

PubMed

Carreras, M R; Braza, P; Muñoz, J M; Braza, F; Azurmendi, A; Pascual-Sagastizabal, E; Cardas, J; Sánchez-Martín, J R

2014-08-01

This study proposes a model in which aggressive and prosocial behaviors exhibited in social conflicts mediate the influence of empathy and social intelligence to children's social preference by same-sex peers. Data were obtained from kindergarten to the end of the first grade. The sample yielded 117 Spanish children (64 girls and 53 boys) with a mean age of 62.8 months (SD = 3.3) at the beginning of the study. For boys, affective empathy contributed to boys' social preference through a decrease in physical aggression as responses to social conflict. For girls, affective empathy had an indirect effect on girls' preference by increasing assistance to others in their conflicts. No mediating effect in the contribution of social intelligence on girls' social preference was detected. Our results suggest that, only for girls, cold social intelligence can promote both indirect aggression (coercive strategic that do not leave social preference, at least at these ages) and behaviors that lead social preference (such as prosocial behaviors). © 2014 Scandinavian Psychological Associations and John Wiley & Sons Ltd.

Museum Exhibitions: Optimizing Development Using Evaluation

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.

2002-12-01

The Space Science Institute (SSI) of Boulder, Colorado, has recently developed two museum exhibits called the Space Weather Center and MarsQuest. It is currently planning to develop a third exhibit called InterActive Earth. The Space Weather Center was developed in partnership with various research missions at NASA's Goddard Space Flight Center. The development of these exhibitions included a comprehensive evaluation plan. I will report on the important role evaluation plays in exhibit design and development using MarsQuest and InterActive Earth as models. The centerpiece of SSI's Mars Education Program is the 5,000-square-foot traveling exhibition, MarsQuest: Exploring the Red Planet, which was developed with support from the National Science Foundation (NSF), NASA, and several corporate donors. The MarsQuest exhibit is nearing the end of a highly successful, fully-booked three-year tour. The Institute plans to send an enhanced and updated MarsQuest on a second three-year tour and is also developing Destination: Mars, a mini-version of MarsQuest designed for smaller venues. They are designed to inspire and empower participants to extend the excitement and science content of the exhibitions into classrooms and museum-based education programs in an ongoing fashion. The centerpiece of the InterActive Earth project is a traveling exhibit that will cover about 4,000 square feet. The major goal of the proposed exhibit is to introduce students and the public to the complexity of the interconnections in the Earth system, and thereby, to inspire them to better understand planet Earth. Evaluation must be an integral part of the exhibition development process. For MarsQuest, a 3-phase evaluation (front end, formative and summative) was conducted by Randi Korn and Associates in close association with the development team. Sampling procedures for all three evaluation phases ensured the participation of all audiences, including family groups, students, and adults. Each phase of

Early social-emotional development in blind infants.

PubMed

Tröster, H; Brambring, M

1992-01-01

In order to study the impact of blindness on social and emotional development during the first year of life, the level of social-emotional development was compared in blind and sighted 9- and 12-month-old infants. The five 9-month-old and the 17 12-month-old blind infants were completely blind from birth and exhibited no further serious disabilities. Social-emotional development was assessed with a scale from the Bielefeld Developmental Test for Blind Infants and Preschoolers containing three subscales on emotions, social interaction and impulse control. Compared to non-disabled infants, blind infants exhibited a more limited repertoire of facial expressions and less responsiveness. They less frequently attempted to initiate contact with their mothers (self-initiated interactions) or comply with simple requests and prohibitions than sighted infants. These differences in the social-emotional development of blind and sighted infants are traced back to the effects of blindness on the mother-child interaction. The lack of visual perception appears to impede particularly the acquisition of a dialogue concept.

Science Fiction Exhibits as STEM Gateways

NASA Astrophysics Data System (ADS)

Robie, Samantha

Women continue to hold less than a quarter of all STEM jobs in the United States, prompting many museums to develop programs and exhibits with the express goal of interesting young girls in scientific fields. At the same time, a number of recent museum exhibits have harnessed the popularity of pop culture and science fiction in order to interest general audiences in STEM subject matter, as well as using the exhibits as springboards to expand or shift mission goals and focus. Because science fiction appears to be successful at raising interest in STEM fields, it may be an effective way to garner the interest of young girls in STEM in particular. This research seeks to describe the ways in which museums are currently using science fiction exhibits to interest young girls in STEM fields and careers. Research focused on four institutions across the country hosting three separate exhibits, and included staff interviews and content analysis of exhibit descriptions, promotional materials, a summative evaluation and supplementary exhibit productions. In some ways, science fiction exhibits do serve young girls, primarily through the inclusion of female role models, staff awareness, and prototype testing to ensure interactives are attractive to girls as well as to boys. However, STEM appears to be underutilized, which may be partly due to a concern within the field that the outcome of targeting a specific gender could be construed as "stereotyping".

Evolution of individual versus social learning on social networks

PubMed Central

Tamura, Kohei; Kobayashi, Yutaka; Ihara, Yasuo

2015-01-01

A number of studies have investigated the roles played by individual and social learning in cultural phenomena and the relative advantages of the two learning strategies in variable environments. Because social learning involves the acquisition of behaviours from others, its utility depends on the availability of ‘cultural models’ exhibiting adaptive behaviours. This indicates that social networks play an essential role in the evolution of learning. However, possible effects of social structure on the evolution of learning have not been fully explored. Here, we develop a mathematical model to explore the evolutionary dynamics of learning strategies on social networks. We first derive the condition under which social learners (SLs) are selectively favoured over individual learners in a broad range of social network. We then obtain an analytical approximation of the long-term average frequency of SLs in homogeneous networks, from which we specify the condition, in terms of three relatedness measures, for social structure to facilitate the long-term evolution of social learning. Finally, we evaluate our approximation by Monte Carlo simulations in complete graphs, regular random graphs and scale-free networks. We formally show that whether social structure favours the evolution of social learning is determined by the relative magnitudes of two effects of social structure: localization in competition, by which competition between learning strategies is evaded, and localization in cultural transmission, which slows down the spread of adaptive traits. In addition, our estimates of the relatedness measures suggest that social structure disfavours the evolution of social learning when selection is weak. PMID:25631568

Promoting Intensive Socialization of Mildly Retarded Within an Institution.

ERIC Educational Resources Information Center

Graebner, Oliver E.; And Others

Eight papers report on the project at Austin State School, funded by a Hospital Improvement (HIP) grant, which used a multidisciplinary team to implement socialization programs for institutionalized mildly retarded persons exhibiting socially inept behavior. Two papers consider social rehabilitation and the task of trying to move residents out…

The Combined Use of Video Modeling and Social Stories in Teaching Social Skills for Individuals with Intellectual Disability

ERIC Educational Resources Information Center

Gül, Seray Olçay

2016-01-01

There are many studies in the literature in which individuals with intellectual disabilities exhibit social skills deficits and which show the need for teaching these skills systematically. This study aims to investigate the effects of an intervention package of consisting computer-presented video modeling and Social Stories on individuals with…

Reaching the Public through Traveling Exhibitions

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.; Harold, J. B.; Morrow, C. A.

2004-11-01

The Space Science Institute (SSI) of Boulder, Colorado has recently developed two museum exhibits called Alien Earths and MarsQuest. It has just started to develop another exhibit called Giant Planets. These exhibitions provide research scientists the opportunity to engage in a number of activities that are vital to the success of these major outreach programs. Alien Earths was developed in partnership with various research missions. The focus of the presentation will be on MarsQuest and Giant Planets. MarsQuest is a 5000 square-foot, \\$3M, traveling exhibition that is now touring the country. The exhibit's second 3-year tour will enable millions of Americans to share in the excitement of the scientific exploration of Mars and learn more about their own planet in the process. The associated planetarium show and education program will also be described, with particular emphasis on workshops to orient museum staff (e.g. museum educators and docents) and workshops for master educators near host museums and science centers. The workshops make innovative connections between the exhibition's interactive experiences and lesson plans aligned with the National Science Education Standards. These exhibit programs are good models for actively involving scientists and their discoveries to help improve informal science education in the museum community and for forging a stronger connection between formal and informal education. The presentation will also discuss how Giant Planets, a proposed 3500 square-foot traveling exhibition on the mysteries and discoveries of the outer planets, will be able to take advantage of the connections and resources that have been developed by the MarsQuest project.

Beyond Behaviour: Is Social Anxiety Low in Williams Syndrome?

ERIC Educational Resources Information Center

Dodd, Helen F.; Schniering, Carolyn A.; Porter, Melanie A.

2009-01-01

Individuals with Williams syndrome (WS) exhibit striking social behaviour that may be indicative of abnormally low social anxiety. The present research aimed to determine whether social anxiety is unusually low in WS and to replicate previous findings of increased generalised anxiety in WS using both parent and self report. Fifteen individuals…

Engaged Learning and Youth Interest in STEM Careers: A Science Museum Exhibit on Air Pollution and Urban Sustainability

NASA Astrophysics Data System (ADS)

Stuart, A. L.

2012-12-01

Enrollments in science, technology, engineering, and mathematics (STEM) curricula currently lag workforce needs. Participation of women and minorities in STEM careers also remains low despite efforts to improve their representation in these fields. We discuss the development and evaluation of a science museum exhibit aimed at stimulating interest of middle school children (particularly girls) in STEM careers. The exhibit was designed to teach science, while addressing two factors identified as limiting the interest of girls in STEM fields — perceived lack of social relevance and lack of female role models. Further, it was designed to apply best practices in science education, including inquiry-based learning and interdisciplinary content. The exhibit was developed through collaboration between students and faculty researchers at the University of South Florida and science education and evaluation specialists at the Museum of Science and Industry of Tampa. A few stages of formative and summative assessment, including focus group discussions, visitor observation, and surveys were used to evaluate the effectiveness of the exhibit to educational project goals. The installed exhibit is focused on teaching content related to interactions between air pollution, urban design, and human health. The approximately 25 square foot exhibit space involves four different types of components. A three-dimensional model of a city, with underlying dynamic computer simulations, allows visitors to interactively explore relationships between city design, air pollution and exposures. A computer game, with quiz questions requiring user decisions on personal to community behavior, provides visual feedback regarding impacts on air pollution. Traditional panels with graphics and text, including results of current research, display integrative scientific content with open-ended questions to stimulate discussion. Finally, personal profiles highlight the diverse family, work, and social lives

Online Exhibits & Concept Maps

NASA Astrophysics Data System (ADS)

Douma, M.

2009-12-01

Presenting the complexity of geosciences to the public via the Internet poses a number of challenges. For example, utilizing various - and sometimes redundant - Web 2.0 tools can quickly devour limited time. Do you tweet? Do you write press releases? Do you create an exhibit or concept map? The presentation will provide participants with a context for utilizing Web 2.0 tools by briefly highlighting methods of online scientific communication across several dimensions. It will address issues of: * breadth and depth (e.g. from narrow topics to well-rounded views), * presentation methods (e.g. from text to multimedia, from momentary to enduring), * sources and audiences (e.g. for experts or for the public, content developed by producers to that developed by users), * content display (e.g. from linear to non-linear, from instructive to entertaining), * barriers to entry (e.g. from an incumbent advantage to neophyte accessible, from amateur to professional), * cost and reach (e.g. from cheap to expensive), and * impact (e.g. the amount learned, from anonymity to brand awareness). Against this backdrop, the presentation will provide an overview of two methods of online information dissemination, exhibits and concept maps, using the WebExhibits online museum (www.webexhibits.org) and SpicyNodes information visualization tool (www.spicynodes.org) as examples, with tips on how geoscientists can use either to communicate their science. Richly interactive online exhibits can serve to engage a large audience, appeal to visitors with multiple learning styles, prompt exploration and discovery, and present a topic’s breadth and depth. WebExhibits, which was among the first online museums, delivers interactive information, virtual experiments, and hands-on activities to the public. While large, multidisciplinary exhibits on topics like “Color Vision and Art” or “Calendars Through the Ages” require teams of scholars, user interface experts, professional writers and editors

Evolution of individual versus social learning on social networks.

PubMed

Tamura, Kohei; Kobayashi, Yutaka; Ihara, Yasuo

2015-03-06

A number of studies have investigated the roles played by individual and social learning in cultural phenomena and the relative advantages of the two learning strategies in variable environments. Because social learning involves the acquisition of behaviours from others, its utility depends on the availability of 'cultural models' exhibiting adaptive behaviours. This indicates that social networks play an essential role in the evolution of learning. However, possible effects of social structure on the evolution of learning have not been fully explored. Here, we develop a mathematical model to explore the evolutionary dynamics of learning strategies on social networks. We first derive the condition under which social learners (SLs) are selectively favoured over individual learners in a broad range of social network. We then obtain an analytical approximation of the long-term average frequency of SLs in homogeneous networks, from which we specify the condition, in terms of three relatedness measures, for social structure to facilitate the long-term evolution of social learning. Finally, we evaluate our approximation by Monte Carlo simulations in complete graphs, regular random graphs and scale-free networks. We formally show that whether social structure favours the evolution of social learning is determined by the relative magnitudes of two effects of social structure: localization in competition, by which competition between learning strategies is evaded, and localization in cultural transmission, which slows down the spread of adaptive traits. In addition, our estimates of the relatedness measures suggest that social structure disfavours the evolution of social learning when selection is weak. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

Superconductive microstrip exhibiting negative differential resistivity

DOEpatents

Huebener, R.P.; Gallus, D.E.

1975-10-28

A device capable of exhibiting negative differential electrical resistivity over a range of values of current and voltage is formed by vapor- depositing a thin layer of a material capable of exhibiting superconductivity on an insulating substrate, establishing electrical connections at opposite ends of the deposited strip, and cooling the alloy into its superconducting range. The device will exhibit negative differential resistivity when biased in the current- induced resistive state.

Exhibitions in Sight

ERIC Educational Resources Information Center

Wasserman, Burton

1977-01-01

Today, few artists make serving vessels on a monumental scale. Here artists compete in this unique area of specialization prompted by the Campbell Museum in Camden, New Jersey, which is dedicated to collecting and exhibiting the very best in soup tureens. (Author/RK)

Unexpected Acceptance? Patients with Social Anxiety Disorder Manifest their Social Expectancy in ERPs During Social Feedback Processing.

PubMed

Cao, Jianqin; Gu, Ruolei; Bi, Xuejing; Zhu, Xiangru; Wu, Haiyan

2015-01-01

Previous studies on social anxiety have demonstrated negative-expectancy bias in social contexts. In this study, we used a paradigm that employed self-relevant positive or negative social feedback, in order to test whether this negative expectancy manifests in event-related potentials (ERPs) during social evaluation among socially anxious individuals. Behavioral data revealed that individuals with social anxiety disorder (SAD) showed more negative expectancy of peer acceptance both in the experiment and in daily life than did the healthy control participants. Regarding ERP results, we found a overally larger P2 for positive social feedback and also a group main effect, such that the P2 was smaller in SAD group. SAD participants demonstrated a larger feedback-related negativity (FRN) to positive feedback than to negative feedback. In addition, SAD participants showed a more positive ΔFRN (ΔFRN = negative - positive). Furthermore, acceptance expectancy in daily life correlated negatively with ΔFRN amplitude, while the Interaction Anxiousness Scale (IAS) score correlated positively with the ΔFRN amplitude. Finally, the acceptance expectancy in daily life fully mediated the relationship between the IAS and ΔFRN. These results indicated that both groups could differentiate between positive and negative social feedback in the early stage of social feedback processing (reflected on the P2). However, the SAD group exhibited a larger FRN to positive social feedback than to negative social feedback, demonstrating their dysfunction in the late stage of social feedback processing. In our opinion, such dysfunction is due to their greater negative social feedback expectancy.

Unexpected Acceptance? Patients with Social Anxiety Disorder Manifest their Social Expectancy in ERPs During Social Feedback Processing

PubMed Central

Cao, Jianqin; Gu, Ruolei; Bi, Xuejing; Zhu, Xiangru; Wu, Haiyan

2015-01-01

Previous studies on social anxiety have demonstrated negative-expectancy bias in social contexts. In this study, we used a paradigm that employed self-relevant positive or negative social feedback, in order to test whether this negative expectancy manifests in event-related potentials (ERPs) during social evaluation among socially anxious individuals. Behavioral data revealed that individuals with social anxiety disorder (SAD) showed more negative expectancy of peer acceptance both in the experiment and in daily life than did the healthy control participants. Regarding ERP results, we found a overally larger P2 for positive social feedback and also a group main effect, such that the P2 was smaller in SAD group. SAD participants demonstrated a larger feedback-related negativity (FRN) to positive feedback than to negative feedback. In addition, SAD participants showed a more positive ΔFRN (ΔFRN = negative – positive). Furthermore, acceptance expectancy in daily life correlated negatively with ΔFRN amplitude, while the Interaction Anxiousness Scale (IAS) score correlated positively with the ΔFRN amplitude. Finally, the acceptance expectancy in daily life fully mediated the relationship between the IAS and ΔFRN. These results indicated that both groups could differentiate between positive and negative social feedback in the early stage of social feedback processing (reflected on the P2). However, the SAD group exhibited a larger FRN to positive social feedback than to negative social feedback, demonstrating their dysfunction in the late stage of social feedback processing. In our opinion, such dysfunction is due to their greater negative social feedback expectancy. PMID:26635659

Social memory engram in the hippocampus.

PubMed

Okuyama, Teruhiro

2018-04-01

Social memory is one of the crucial components of episodic memories. Gregarious animals living in societies utilize social memory to exhibit the appropriate social behaviors such as aggression, avoidance, cooperative behavior, and even mating behavior. However, the neural mechanisms underlying social memory in the hippocampus remains mysterious. Here, I review some evidence from work done in rodents and primates on the brain region(s) and circuits encoding and/or retrieving social memory, as well as a storage for social memory (i.e. social memory engram neurons). Based on our recent findings that neural ensemble in ventral CA1 sub-region of the hippocampus possesses social memory engram, I would discuss the neural network for social information processing in order to encode social memory; and its evolutionary conservation between rodents and human. Copyright © 2017 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

Tabula diptycha: Differential HIV knowledge, stigma, and intended behavioural outcomes amongst visitors at Vietnam's Pain and Hope exhibition

PubMed Central

Nambiar, Devaki; Nguyen, Mai Huong; Giang, Le Minh; Hirsch, Jennifer

2013-01-01

Stigma reduction efforts in Vietnam have been encumbered by contradictory and dynamic views of People Living With HIV (PLWH) and the epidemic over the past two decades. World AIDS Day 2010 saw the launch of Pain and Hope, a museum exhibition showcasing the lives and experiences of Vietnamese People Living with AIDS at the Vietnam Museum of Ethnology (VME). Between December 2010 and May 2011, a random sample of visitors completed exit surveys regarding attitudes towards the exhibition and Vietnamese living with HIV/AIDS. The survey sought to determine what kind of visitors the museum and exhibition attracted, and the stigma-related impacts of this kind of exposure and parasocial contact. Of 2,500 Vietnamese visitors randomly selected, 852 completed the computer surveys (response rate of 34.1%), 92.3% of whom had seen Pain and Hope. We found two sub-strata or types of visitors attending the exhibition, with varying demographic characteristics, HIV-related knowledge, some differences in stigma ideation, and clear differences in intended behaviours specifically attributable to the exhibition. Social desirability biases notwithstanding, there has emerged a diptych typology of visitors to the VME, for whom the experience of the exhibition is likely interacting with divergent prior knowledge, experiences, interests and motivations. PMID:22974183

Exhibition Spaces/Galleries.

ERIC Educational Resources Information Center

American School & University, 2003

2003-01-01

Presents educational exhibition space/galleries considered outstanding in a competition, which judged the most outstanding learning environments at educational institutions nationwide. Jurors spent two days reviewing projects, highlighting concepts and ideas that made them exceptional. For each citation, the article offers information on the firm,…

Social Factor and Victim-Offender Differences in Courtship Violence.

ERIC Educational Resources Information Center

Makepeace, James M.

1987-01-01

Explored social factor differences between respondents with and without courtship violence experience and between male offenders and female victims. Data from the Seven College Survey revealed that those with courtship violence experience exhibited relatively "problematic" social profiles. Especially significant were race; religion;…

Validation of the Social Exercise and Anxiety Measure (SEAM): Assessing fears, avoidance, and importance of social exercise

PubMed Central

Levinson, Cheri A.; Rodebaugh, Thomas L.; Menatti, Andrew R.; Weeks, Justin W.

2012-01-01

In two studies (N = 416; N = 118) examining responses from undergraduates, we developed the Social Exercise and Anxiety Measure (SEAM) and tested its factorial, convergent, and divergent validity. Our results demonstrate that the SEAM exhibits an excellent three factor structure consisting of the following subscales: Social Exercise Self-efficacy, Gym Avoidance, and Exercise Importance. In both studies, Social Exercise Self-efficacy correlated negatively and Gym Avoidance correlated positively with social interaction anxiety, fear of scrutiny, and fear of negative evaluation. Exercise Importance correlated positively with frequency of exercise and frequency of public exercise. Implications for the mental and physical health of individuals with high levels of social anxiety are discussed. PMID:24244069

Exhibitions in Sight.

ERIC Educational Resources Information Center

Wasserman, Burton

1978-01-01

Early in the eighteenth century, Pompeii was discovered, a city that had been hidden for sixteen centuries by volcanic lava. There is a traveling exhibition of the sculptures, friezes, mosaics, and paintings being shown around the United States. Described is the history and contents of "Pompeii--A.D. 79." (RK)

Engagement In Climate Change Awareness Through Art Exhibitions

NASA Astrophysics Data System (ADS)

Burko, D.

2016-12-01

Artists such as myself can influence the public discourse on climate change through compelling imagery transcending data and language. I will speak specifically to how I communicate scientific research to diverse populations by making those issues personal, visceral, and actionable.I began integrating scientific visual data into my aesthetic practice ten years ago by first utilizing archival evidence in the form of repeats, geological charts of recessional lines, graphs, symbols and Landsat maps. I continue to develop visual strategies delivering information on an emotional/non-verbal level. In the past 4 years, I have added the most dramatic layer to my creative process: bearing witness. I've been to the three largest ice fields in the world: Greenland, Antarctica and Argentina's Patagonia, observing the unprecedented pace of glacial melt. The emotional significance of actually being there as an artist is immense. Those expeditions impact my practice, leading to exhibitions that open a dialog with an audience not initially interested in science. In the past 5 years my work has appeared in 6 solo and 19 group exhibits all devoted to the environment. I make myself present in universities, museums and galleries to explain what the images are about. I require universities to include a public component: an all-college lecture or panel where the geography/environmental/sociology/geology departments participate with broad student involvement. I believe that such endeavors are worthwhile and can be models for further efforts to educate an unsuspecting audience. Artists can bridge the gap communicating to a public of art appreciators, nonscientists - how easy it is to understand geology and global warming. This social engagement can even inspire and result in attitudinal changes. A viewer's initial emotional response to my large paintings and photographs evolves into comprehension as a dialog about their content is revealed. By sharing my personal story about my

Arctic Forecasts Available from Polar Bear Exhibit as an Example of Formal/Informal Collaboration

NASA Astrophysics Data System (ADS)

Landis, C. E.; Cervenec, J.

2012-12-01

A subset of the general population enjoys and frequents informal education venues, offering an opportunity for lifelong learning that also enhances and supports formal education efforts. The Byrd Polar Research Center (BPRC) at The Ohio State University collaborated with the Columbus Zoo & Aquarium (CZA) in the development of their Polar Frontier exhibit, from its initial planning to the Grand Opening of the exhibit, through the present. Of course, the addition to the Zoo of polar bears and Arctic fox in the Polar Frontier has been very popular, with almost a 7% increase in visitors in 2010 when the exhibit opened. The CZA and BPRC are now investigating ways to increase the climate literacy impact of the exhibit, and to increase engagement with the topics through follow-on activities. For example, individuals or classes anywhere in the world can check forecasts from the Polar Weather and Research Forecasting model and compare them to observed conditions-- allowing deep investigation into changes in the Arctic. In addition, opportunities exist to adapt the Zoo School experience (affecting several Central Ohio school districts) and/or to enable regular participation through social media such as Facebook, Twitter, and other forms of digital communication. BPRC's sustained engagement with the CZA is an example of a trusted and meaningful partnership where open dialogue exists about providing the best learning experience for visitors. This presentation will share some of the lessons learned from this unique partnership, and strategies that are adopted to move it forward.

Promoting social behavior with oxytocin in high-functioning autism spectrum disorders

PubMed Central

Andari, Elissar; Duhamel, Jean-René; Zalla, Tiziana; Herbrecht, Evelyn; Leboyer, Marion; Sirigu, Angela

2010-01-01

Social adaptation requires specific cognitive and emotional competences. Individuals with high-functioning autism or with Asperger syndrome cannot understand or engage in social situations despite preserved intellectual abilities. Recently, it has been suggested that oxytocin, a hormone known to promote mother-infant bonds, may be implicated in the social deficit of autism. We investigated the behavioral effects of oxytocin in 13 subjects with autism. In a simulated ball game where participants interacted with fictitious partners, we found that after oxytocin inhalation, patients exhibited stronger interactions with the most socially cooperative partner and reported enhanced feelings of trust and preference. Also, during free viewing of pictures of faces, oxytocin selectively increased patients’ gazing time on the socially informative region of the face, namely the eyes. Thus, under oxytocin, patients respond more strongly to others and exhibit more appropriate social behavior and affect, suggesting a therapeutic potential of oxytocin through its action on a core dimension of autism. PMID:20160081

Promoting social behavior with oxytocin in high-functioning autism spectrum disorders.

PubMed

Andari, Elissar; Duhamel, Jean-René; Zalla, Tiziana; Herbrecht, Evelyn; Leboyer, Marion; Sirigu, Angela

2010-03-02

Social adaptation requires specific cognitive and emotional competences. Individuals with high-functioning autism or with Asperger syndrome cannot understand or engage in social situations despite preserved intellectual abilities. Recently, it has been suggested that oxytocin, a hormone known to promote mother-infant bonds, may be implicated in the social deficit of autism. We investigated the behavioral effects of oxytocin in 13 subjects with autism. In a simulated ball game where participants interacted with fictitious partners, we found that after oxytocin inhalation, patients exhibited stronger interactions with the most socially cooperative partner and reported enhanced feelings of trust and preference. Also, during free viewing of pictures of faces, oxytocin selectively increased patients' gazing time on the socially informative region of the face, namely the eyes. Thus, under oxytocin, patients respond more strongly to others and exhibit more appropriate social behavior and affect, suggesting a therapeutic potential of oxytocin through its action on a core dimension of autism.

An Exhibit for Touching.

ERIC Educational Resources Information Center

Hunt, Susan

1979-01-01

An exhibit designed for visually handicapped persons presented by the Kalamazoo (Michigan) Institute of Art included bronze sculptures and oil paintings from the institute's permanent collection. (CL)

Social Discounting under Risk.

PubMed

Jin, Jia; Pei, Guanxiong; Ma, Qingguo

2017-01-01

As a measure of how prosocial behavior depends on social distance, social discounting is defined as the decrease in generosity between the decision maker and the recipient as the social distance increases. While risk is a ubiquitous part of modern life, there is limited research on the relationship between risk and prosocial behavior. In the present experiment, we empirically test whether risk has an influence on social discounting. We use the choice titration procedure to examine this effect. Our data show that independent of risk, participants are less eager to forego money and exhibit more selfishness toward a specific person when the social distance increases; these findings are reflected in the hyperbolic model. Interestingly, risk influences the shape of the social discounting function, which is reflected in the notable different discount rates. Individuals who make decisions under risk yield a smaller discount rate than those who make decisions without risk, i.e., under risk subjects reduce less their generosity as a function of the social distance. Furthermore, this distinct type of generosity occurs typically among individuals with 10-distance recipients but not with the closest- and furthest-social-distance recipients.

Starship 2040 Exhibit

NASA Technical Reports Server (NTRS)

2002-01-01

This photograph shows the Starship 2040 on display at Joe Davis Stadium in Huntsville, Alabama. Developed by the Space Transportation Directorate at Marshall Space Flight Center (MSFC), the Starship 2040 exhibit is housed in a 48-ft (14.6-m) tractor and trailer rig, permitting it to travel around the Nation, demonstrating NASA's vision of what commercial spaceflight might be like 40 years from now. All the irnovations suggested aboard the exhibit (automated vehicle health monitoring systems, high-energy propulsion drive, navigational aids, and emergency and safety systems) are based on concepts and technologies now being studied at NASA Centers and partner institutions around the Nation. NASA is the Nation's premier agency for development of the space transportation system, including future-generation reusable launch vehicles. Such systems, the keys to a 'real' Starship 2040, require revolutionary advances in critical aerospace technologies, from thermal, magnetic, chemical, and propellantless propulsion systems to new energy sources such as space solar power or antimatter propulsion. These and other advances are now being studied, developed, and tested at NASA field centers and partner institutions all over the Nation.

Brief report: Do children with autism gather information from social contexts to aid their word learning?

PubMed

Jing, Wei; Fang, Junming

2014-06-01

Typically developing (TD) infants could capitalize on social eye gaze and social contexts to aid word learning. Although children with autism disorder (AD) are known to exhibit atypicality in word learning via social eye gaze, their ability to utilize social contexts for word learning is not well understood. We investigated whether verbal AD children exhibit word learning ability via social contextual cues by late childhood. We found that AD children, unlike TD controls, failed to infer the speaker’s referential intention through information gathered from the social context. This suggests that TD children can learn words in diverse social pragmatic contexts in as early as toddlerhood whereas AD children are still unable to do so by late childhood.

The exploration of the exhibition informatization

NASA Astrophysics Data System (ADS)

Zhang, Jiankang

2017-06-01

The construction and management of exhibition informatization is the main task and choke point during the process of Chinese exhibition industry’s transformation and promotion. There are three key points expected to realize a breakthrough during the construction of Chinese exhibition informatization, and the three aspects respectively are adopting service outsourcing to construct and maintain the database, adopting advanced chest card technology to collect various kinds of information, developing statistics analysis to maintain good cutomer relations. The success of Chinese exhibition informatization mainly calls for mature suppliers who can provide construction and maintenance of database, the proven technology, a sense of data security, advanced chest card technology, the ability of data mining and analysis and the ability to improve the exhibition service basing on the commercial information got from the data analysis. Several data security measures are expected to apply during the process of system developing, including the measures of the terminal data security, the internet data security, the media data security, the storage data security and the application data security. The informatization of this process is based on the chest card designing. At present, there are several types of chest card technology: bar code chest card; two-dimension code card; magnetic stripe chest card; smart-chip chest card. The information got from the exhibition data will help the organizers to make relevant service strategies, quantify the accumulated indexes of the customers, and improve the level of the customer’s satisfaction and loyalty, what’s more, the information can also provide more additional services like the commercial trips, VIP ceremonial reception.

Children's Art Exhibit

ERIC Educational Resources Information Center

Roselle, Marsha L.

1973-01-01

Within the past ten years, a sufficient number of specialists in art education have been added to the faculty of the Iowa City Community Schools to relieve the classroom teacher of the responsibility of teaching elementary art classes. The resultant improvement in the quality of the elementary art program led to the creation of the exhibit series.…

The Prevalence of Social Maladjustment among School-Age Children.

ERIC Educational Resources Information Center

McGhee, Ron L.; Short, Rick Jay

1991-01-01

Investigated prevalence of social maladjustment among students in two rural/suburban school systems. Results from 249 elementary and secondary school teachers indicated that the percentage of students reported as exhibiting characteristics of social maladjustment was sufficiently high to indicate that services beyond special education may be…

Exercise dependence, social physique anxiety, and social support in experienced and inexperienced bodybuilders and weightlifters

PubMed Central

Hurst, R.; Hale, B.; Smith, D.; Collins, D.

2000-01-01

Objectives—To investigate psychological correlates of exercise dependence in experienced and inexperienced bodybuilders and weightlifters. Secondary objectives included measuring social physique anxiety, bodybuilding identity, and social support among bodybuilders and weightlifters. Methods—Thirty five experienced bodybuilders, 31 inexperienced bodybuilders, and 23 weightlifters completed the bodybuilding dependence scale, a bodybuilding version of the athletic identity measurement scale, the social physique anxiety scale, and an adapted version of the social support survey-clinical form. Results—A between subjects multivariate analysis of variance was calculated on the scores of the three groups of lifters for the four questionnaires. Univariate F tests and follow up tests indicated that experienced bodybuilders scored significantly higher than inexperienced bodybuilders and weightlifters on bodybuilding dependence (p<0.001), social identity and exclusivity subscales of bodybuilding identity (p<0.001), and social support scales (p<.001), and significantly lower on social physique anxiety (p<0.001). Conclusion—Experienced bodybuilders exhibit more exercise dependence, show greater social support behaviour, and experience less social physique anxiety than inexperienced bodybuilders and weightlifters. Key Words: bodybuilding; exercise dependence; social physical anxiety; social support; athletic identity PMID:11131230

Operationalizing the social-ecological systems framework to assess sustainability.

PubMed

Leslie, Heather M; Basurto, Xavier; Nenadovic, Mateja; Sievanen, Leila; Cavanaugh, Kyle C; Cota-Nieto, Juan José; Erisman, Brad E; Finkbeiner, Elena; Hinojosa-Arango, Gustavo; Moreno-Báez, Marcia; Nagavarapu, Sriniketh; Reddy, Sheila M W; Sánchez-Rodríguez, Alexandra; Siegel, Katherine; Ulibarria-Valenzuela, José Juan; Weaver, Amy Hudson; Aburto-Oropeza, Octavio

2015-05-12

Environmental governance is more effective when the scales of ecological processes are well matched with the human institutions charged with managing human-environment interactions. The social-ecological systems (SESs) framework provides guidance on how to assess the social and ecological dimensions that contribute to sustainable resource use and management, but rarely if ever has been operationalized for multiple localities in a spatially explicit, quantitative manner. Here, we use the case of small-scale fisheries in Baja California Sur, Mexico, to identify distinct SES regions and test key aspects of coupled SESs theory. Regions that exhibit greater potential for social-ecological sustainability in one dimension do not necessarily exhibit it in others, highlighting the importance of integrative, coupled system analyses when implementing spatial planning and other ecosystem-based strategies.

Polymeric surfaces exhibiting photocatalytic activity and controlled anisotropic wettability

NASA Astrophysics Data System (ADS)

Anastasiadis, Spiros H.; Frysali, Melani A.; Papoutsakis, Lampros; Kenanakis, George; Stratakis, Emmanuel; Vamvakaki, Maria; Mountrichas, Grigoris; Pispas, Stergios

2015-03-01

In this work we focus on surfaces, which exhibit controlled, switchable wettability in response to one or more external stimuli as well as photocatalytic activity. For this we are inspired from nature to produce surfaces with a dual-scale hierarchical roughness and combine them with the appropriate inorganic and/or polymer coating. The combination of the hierarchical surface with a ZnO coating and a pH- or temperature-responsive polymer results in efficient photo-active properties as well as reversible superhydrophobic / superhydrophilic surfaces. Furthermore, we fabricate surfaces with unidirectional wettability variation. Overall, such complex surfaces require advanced design, combining hierarchically structured surfaces with suitable polymeric materials. Acknowledgment: This research was partially supported by the European Union (European Social Fund, ESF) and Greek national funds through the ``ARISTEIA II'' Action (SMART-SURF) of the Operational Programme ``Education and Lifelong Learning,'' NSRF 2007-2013, via the General Secretariat for Research & Technology, Ministry of Education and Religious Affairs, Greece.

The Effects of CW-Related Chemicals on Social Behavior and Performance

DTIC Science & Technology

1988-08-15

fellows and to form social groups, is characteristic of most primate species, including man. The ubiquity of primate societies makes the study of nonhuman...several possible social organizations, man is much more flexible in terms of the kinds of social organization exhibited in his societies . Thus...8217 daughters, etc. and their infant offspring form a social unit. Each matriarchical unit has a social rank within the hierarchy of matria-chies such

Using Comparative Planetology in Exhibit Development

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.; Harold, J. B.; Morrow, C. A.

2004-12-01

It is critically important for the public to better understand the scientific process. Museum exhibitions are an important part of informal science education that can effectively reach public audiences as well as school groups. They provide an important gateway for the public to learn about compelling scientific endeavors. The Space Science Institute (SSI) is a national leader in producing traveling science exhibitions and their associated educational programming (i.e. interactive websites, educator workshops, public talks, instructional materials). The focus of this presentation will be on three of its exhibit projects: MarsQuest (currently on tour), Alien Earths (in fabrication), and Giant Planets (in development). MarsQuest is enabling millions of Americans to share in the excitement of the scientific exploration of Mars and to learn more about their own planet in the process. Alien Earths will bring origins-related research and discoveries to students and the American public. It has four interrelated exhibit areas: Our Place in Space, Star Birth, PlanetQuest, and Search for Life. Exhibit visitors will explore the awesome events surrounding the birth of stars and planets; they will join scientists in the hunt for planets outside our solar system including those that may be in "habitable zones" around other stars; and finally they will be able to learn about how scientists are looking for signs of life beyond Earth. Giant Planets: Exploring the Outer Solar System will take advantage of the excitement generated by the Cassini mission and bring planetary and origins research and discoveries to students and the public. It will be organized around four thematic areas: Our Solar System; Colossal Worlds; Moons, Rings, and Fields; and Make Space for Kids. Giant Planets will open in 2007. This talk will focus on the importance of making Earth comparisons in the conceptual design of each exhibit and will show several examples of how these comparisons were manifested in

Temporary and Travelling Exhibitions. Museums and Monuments, X.

ERIC Educational Resources Information Center

Daifuku, Hiroshi; And Others

The permanent exhibition, the most typical form of museum exhibition, has failed to attract repeated visitation, since visitors quickly become familiar with the objects shown. The temporary exhibition evolved as a result for the need of repeated visitation. The temporary exhibition, set up for a period of one to six months, introduces fresh…

Communicating Complex Sciences by Means of Exhibitions

NASA Astrophysics Data System (ADS)

Schneider, S.

2011-12-01

Earth Sciences will have to take over the leading role in global sustainable policy and in discussions about climate change. Efforts to raise attention within the politically responsible communities as well as in the public are getting more and more support by executive and advisory boards all over the world. But how can you successfully communicate complex sciences? For example, to start communication about climate change, the first step is to encourage people to be concerned about climate change. After that, one has to start thinking about how to present data and how to include the presented data into an unprejudiced context. Therefore, the communication toolbox offers various methods to reach diverse audiences. The R&D programme GEOTECHNOLOGIEN conducts roving exhibitions as one of its most successful communication tools. With roving exhibitions GEOTECHNOLOGIEN is able to get in touch with different audiences at once. The main purpose and theme of these exhibitions is to convey the everyday means of climate change to the visitors. It is within the responsibility of science to communicate the effects of a phenomenon like climate change as well as the impact of research results to the everyday life of people. Currently, a GEOTECHNOLOGIEN roving exhibition on remote sensing with satellites deals with various issues of environmental research, including a chapter on climate change. By following the 3M-concept (Meaning - Memorable - Moving), exhibitions allow to connect the visitors daily environment and personal experiences with the presented issues and objects. Therefore, hands-on exhibits, exciting multimedia effects and high-tech artefacts have to be combined with interpretive text elements to highlight the daily significance of the scientific topics and the exhibition theme respectively. To create such an exhibition, strong conceptual planning has to be conducted. This includes the specification of stern financial as well as time wise milestones. In addition

Encountering Nanotechnology in an Interactive Exhibition

ERIC Educational Resources Information Center

Murriello, Sandra E.; Knobel, Marcelo

2008-01-01

This article offers findings from a learning sciences-informed evaluation of a nanoscience and nanotechnology exhibition called Nano-Aventura (NanoAdventure), based on four interactive-collaborative games and two narrated videos. This traveling exhibition was developed in Brazil by the Museu Exploratorio de Ciencias for children and teenagers…

Anticipatory processing in social anxiety: Investigation using attentional control theory.

PubMed

Sluis, Rachel A; Boschen, Mark J; Neumann, David L; Murphy, Karen

2017-12-01

Cognitive models of social anxiety disorder (SAD) emphasize anticipatory processing as a prominent maintaining factor occurring before social-evaluative events. While anticipatory processing is a maladaptive process, the cognitive mechanisms that underlie ineffective control of attention are still unclear. The present study tested predictions derived from attentional control theory in a sample of undergraduate students high and low on social anxiety symptoms. Participants were randomly assigned to either engage in anticipatory processing prior to a threat of a speech task or a control condition with no social evaluative threat. After completing a series of questionnaires, participants performed pro-saccades and antisaccades in response to peripherally presented facial expressions presented in either single-task or mixed-task blocks. Correct antisaccade latencies were longer than correct pro-saccade latencies in-line with attentional control theory. High socially anxious individuals who anticipated did not exhibit impairment on the inhibition and shifting functions compared to high socially anxious individuals who did not anticipate or low socially anxious individuals in either the anticipatory or control condition. Low socially anxious individuals who anticipated exhibited shorter antisaccade latencies and a switch benefit compared to low socially anxious individuals in the control condition. The study used an analogue sample; however findings from analogue samples are generally consistent with clinical samples. The findings suggest that social threat induced anticipatory processing facilitates executive functioning for low socially anxious individuals when anticipating a social-evaluative situation. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Social contagion theory: examining dynamic social networks and human behavior

PubMed Central

Christakis, Nicholas A.; Fowler, James H.

2013-01-01

Here, we review the research we have conducted on social contagion. We describe the methods we have employed (and the assumptions they have entailed) to examine several datasets with complementary strengths and weaknesses, including the Framingham Heart Study, the National Longitudinal Study of Adolescent Health, and other observational and experimental datasets that we and others have collected. We describe the regularities that led us to propose that human social networks may exhibit a ‘three degrees of influence’ property, and we review statistical approaches we have used to characterize interpersonal influence with respect to phenomena as diverse as obesity, smoking, cooperation, and happiness. We do not claim that this work is the final word, but we do believe that it provides some novel, informative, and stimulating evidence regarding social contagion in longitudinally followed networks. Along with other scholars, we are working to develop new methods for identifying causal effects using social network data, and we believe that this area is ripe for statistical development as current methods have known and often unavoidable limitations. PMID:22711416

Memory and Mourning: An Exhibit History

ERIC Educational Resources Information Center

Eberle, Scott G.

2005-01-01

Mounted by the Strong Museum in Rochester, New York, in 1993, and traveling nationally thereafter, the exhibit Memory and Mourning provided historical and contemporary perspectives to help museum guests explore their own reactions to loss and grief. In the process the exhibit's development team encountered a range of philosophical, historical,…

18 CFR 50.7 - Applications: exhibits.

Code of Federal Regulations, 2014 CFR

2014-04-01

... elements or matters contained in the exhibit. (a) Exhibit A—Articles of incorporation and bylaws. If the applicant is not an individual, a conformed copy of its articles of incorporation and bylaws, or other... following information: (i) Number of circuits, with identification as to whether the circuit is overhead or...

18 CFR 50.7 - Applications: exhibits.

Code of Federal Regulations, 2012 CFR

2012-04-01

... elements or matters contained in the exhibit. (a) Exhibit A—Articles of incorporation and bylaws. If the applicant is not an individual, a conformed copy of its articles of incorporation and bylaws, or other... following information: (i) Number of circuits, with identification as to whether the circuit is overhead or...

18 CFR 50.7 - Applications: exhibits.

Code of Federal Regulations, 2013 CFR

2013-04-01

... elements or matters contained in the exhibit. (a) Exhibit A—Articles of incorporation and bylaws. If the applicant is not an individual, a conformed copy of its articles of incorporation and bylaws, or other... following information: (i) Number of circuits, with identification as to whether the circuit is overhead or...

Reconfiguration and Search of Social Networks

PubMed Central

Zhang, Lianming; Peng, Aoyuan

2013-01-01

Social networks tend to exhibit some topological characteristics different from regular networks and random networks, such as shorter average path length and higher clustering coefficient, and the node degree of the majority of social networks obeys exponential distribution. Based on the topological characteristics of the real social networks, a new network model which suits to portray the structure of social networks was proposed, and the characteristic parameters of the model were calculated. To find out the relationship between two people in the social network, and using the local information of the social network and the parallel mechanism, a hybrid search strategy based on k-walker random and a high degree was proposed. Simulation results show that the strategy can significantly reduce the average number of search steps, so as to effectively improve the search speed and efficiency. PMID:24574861

Speech Presentation Cues Moderate Frontal EEG Asymmetry in Socially Withdrawn Young Adults

ERIC Educational Resources Information Center

Cole, Claire; Zapp, Daniel J.; Nelson, S. Katherine; Perez-Edgar, Koraly

2012-01-01

Socially withdrawn individuals display solitary behavior across wide contexts with both unfamiliar and familiar peers. This tendency to withdraw may be driven by either past or anticipated negative social encounters. In addition, socially withdrawn individuals often exhibit right frontal electroencephalogram (EEG) asymmetry at baseline and when…

Modular and hierarchical structure of social contact networks

NASA Astrophysics Data System (ADS)

Ge, Yuanzheng; Song, Zhichao; Qiu, Xiaogang; Song, Hongbin; Wang, Yong

2013-10-01

Social contact networks exhibit overlapping qualities of communities, hierarchical structure and spatial-correlated nature. We propose a mixing pattern of modular and growing hierarchical structures to reconstruct social contact networks by using an individual’s geospatial distribution information in the real world. The hierarchical structure of social contact networks is defined based on the spatial distance between individuals, and edges among individuals are added in turn from the modular layer to the highest layer. It is a gradual process to construct the hierarchical structure: from the basic modular model up to the global network. The proposed model not only shows hierarchically increasing degree distribution and large clustering coefficients in communities, but also exhibits spatial clustering features of individual distributions. As an evaluation of the method, we reconstruct a hierarchical contact network based on the investigation data of a university. Transmission experiments of influenza H1N1 are carried out on the generated social contact networks, and results show that the constructed network is efficient to reproduce the dynamic process of an outbreak and evaluate interventions. The reproduced spread process exhibits that the spatial clustering of infection is accordant with the clustering of network topology. Moreover, the effect of individual topological character on the spread of influenza is analyzed, and the experiment results indicate that the spread is limited by individual daily contact patterns and local clustering topology rather than individual degree.

Social Behavior, Prolactin and the Immune Response

DTIC Science & Technology

1989-04-01

an ubiquitous characteristic of primate societies , including man’s. While social behavior and organization confer definite advantages on primate...groups, is characteristic of most primate species, including man. The ubiquity of primate societies makes the study of nonhuman primate groups of...organizations, man is much more flexible in terms of the kinds of social organization exhibited in his societies . Thus, generalizations from studies of

Oxytocin receptor and Mecp2 308/Y knockout mice exhibit altered expression of autism-related social behaviors.

PubMed

Pobbe, Roger L H; Pearson, Brandon L; Blanchard, D Caroline; Blanchard, Robert J

2012-12-05

The development of tasks measuring behaviors specific to the three major symptom categories for autism makes it possible to differentiate mouse models of autism spectrum disorders (ASD) in terms of changes in these specific categories. Prior studies indicate that BTBR T+tf/J mice, the strain that has been evaluated most extensively, show autism-relevant changes in all three symptom categories; reciprocal social interactions; communication; and repetitive, ritualized behaviors. This report reviews the behaviors of oxytocin receptor (Oxtr) and Mecp2(308/Y) wild-type (WT) and knockout (KO) mice, in a number of tests specifically designed to provide information on behaviors that may show functional parallels to the core symptoms of ASD. Oxtr KO mice show robust decreases in reciprocal social interactions, and reduced levels of communication, but no changes in repetitive, ritualized behaviors; whereas Mecp2(308/Y) KO mice show a slight but consistent enhancement of social behavior and communication, and no changes in repetitive, ritualized behaviors. This data base, although small, strongly indicates that mouse models can sort the diagnostic symptoms of autism, and suggests that biological and physiological analyses of these strains may be capable of providing differential information on the brain systems involved in particular symptoms of this disorder. Profiles of behavioral changes in other mouse models of ASD should provide additional specificity in the search for biomarkers associated with particular ASD symptoms and symptom clusters. Copyright © 2012 Elsevier Inc. All rights reserved.

Social instability stress in adolescent male rats reduces social interaction and social recognition performance and increases oxytocin receptor binding.

PubMed

Hodges, Travis E; Baumbach, Jennet L; Marcolin, Marina L; Bredewold, Remco; Veenema, Alexa H; McCormick, Cheryl M

2017-09-17

Social experiences in adolescence are essential for displaying context-appropriate social behaviors in adulthood. We previously found that adult male rats that underwent social instability stress (SS) in adolescence had reduced social interactions with unfamiliar peers compared with non-stressed controls (CTL). Here we determined whether SS altered social recognition and social reward and brain oxytocin and vasopressin receptor density in adolescence. We confirmed that SS rats spent less time interacting with unfamiliar peers than did CTL rats (p=0.006). Furthermore, CTL rats showed a preference for novel over familiar conspecifics in a social recognition test whereas SS rats did not, which may reflect reduced recognition, impaired memory, or reduced preference for novelty in SS rats. The reward value of social interactions was not affected by SS based on conditioned place preference tests and based on the greater time SS rats spent investigating stimulus rats than did CTL rats when the stimulus rat was behind wire mesh (p=0.03). Finally, oxytocin receptor binding density was higher in the dorsal lateral septum and nucleus accumbens shell in SS rats compared with CTL rats (p=0.02, p=0.01, respectively). No effect of SS was found for vasopressin 1a receptor binding density in any of the brain regions analyzed. We discuss the extent to which the differences in social behavior exhibited after social instability in adolescence involve changes in social salience and social competency, and the possibility that changes in oxytocin signaling in the brain underlie the differences in social behavior. Copyright © 2017 IBRO. Published by Elsevier Ltd. All rights reserved.

Sex differences in science museum exhibit attraction

NASA Astrophysics Data System (ADS)

Arámbula Greenfield, Teresa

This study examines the relative attraction of hands-on, interactive science museum exhibits for females and males. Studies have demonstrated that such exhibits can be effective learning experiences for children, with both academic and affective benefits. Other studies have shown that girls and boys do not always experience the same science-related educational opportunities and that, even when they do, they do not necessarily receive the same benefits from them. These early differences can lead to more serious educational and professional disparities later in life. As interactive museum exhibits represent a science experience that is-readily available to both girls and boys, the question arose as to whether they were being used similarly by the two groups as well as by adult women and men. It was found that both girls and boys used all types of exhibits, but that girls were more likely than boys to use puzzles and exhibits focusing on the human body; boys were more likely than girls to use computers and exhibits illustrating physical science principles. However, this was less true of children accompanied by adults (parents) than it was of unaccompanied children on school field trips who roamed the museum more freely.Received: 16 February 1994; Revised: 3 February 1995;

3xTgAD mice exhibit altered behavior and elevated Aβ after chronic mild social stress

PubMed Central

Rothman, Sarah M.; Herdener, Nathan; Camandola, Simonetta; Texel, Sarah J.; Mughal, Mohamed R.; Cong, Wei-Na; Martin, Bronwen; Mattson, Mark P

2014-01-01

Chronic stress may be a risk factor for developing Alzheimer’s disease (AD), but most studies of the effects of stress in models of AD utilize acute adverse stressors of questionable clinical relevance. The goal of this work was to determine how chronic psychosocial stress affects behavioral and pathological outcomes in an animal model of AD, and to elucidate underlying mechanisms. A triple-transgenic mouse model of AD (3xTgAD mice) and nontransgenic control mice were used to test for an affect of chronic mild social stress on blood glucose, plasma glucocorticoids, plasma insulin, anxiety and hippocampal Aβ, ptau and BDNF levels. Despite the fact that both control and 3xTgAD mice experienced rises in corticosterone during episodes of mild social stress, at the end of the 6 week stress period 3xTgAD mice displayed increased anxiety, elevated levels of Aβ oligomers and intraneuronal Aβ, and decreased BDNF levels, whereas control mice did not. Findings suggest 3xTgAD mice are more vulnerable than control mice to chronic psychosocial stress, and that such chronic stress exacerbates Aβ accumulation and impairs neurotrophic signaling. PMID:21855175

Role of Social Performance in Predicting Learning Problems: Prediction of Risk Using Logistic Regression Analysis

ERIC Educational Resources Information Center

Del Prette, Zilda Aparecida Pereira; Prette, Almir Del; De Oliveira, Lael Almeida; Gresham, Frank M.; Vance, Michael J.

2012-01-01

Social skills are specific behaviors that individuals exhibit in order to successfully complete social tasks whereas social competence represents judgments by significant others that these social tasks have been successfully accomplished. The present investigation identified the best sociobehavioral predictors obtained from different raters…

Motivations for Social Media Use and Impact on Political Participation in China: A Cognitive and Communication Mediation Approach.

PubMed

Chen, Zhuo; Chan, Michael

2017-02-01

Integrating uses and gratifications theory and the cognitive/communication mediation model: this study examines Chinese students' use of social media and subsequent impact on political participation. An integrative framework is proposed where media use, political expression, and political cognitions (efficacy and knowledge) play important mediating roles between audience motivations and participation. Structural equation analyses showed support for the integrated model. Guidance and social utility motivations exhibited different indirect effects on online and offline participation through social media news, discussion, and political efficacy. Entertainment motivations exhibited no direct or indirect effects. Contrary to expectations and previous literature, surveillance motivations exhibited negative direct and indirect effects on offline participation, which may be attributed to the particular Chinese social and political context. Implications of the findings are discussed.

Impact of different aspects of social participation and social capital on smoking cessation among daily smokers: a longitudinal study

PubMed Central

Lindstrom, M; Isacsson, S; Elmstahl, S

2003-01-01

Objective: To investigate differences in different aspects of social participation and social capital among baseline daily smokers that had remained daily smokers, become intermittent smokers, or stopped smoking at one year follow up. Design/setting/participants/measurements: 12 507 individuals, aged 45–69 years, interviewed at baseline between 1992 and 1994 and at a one year follow up were investigated in this longitudinal study. The three groups of baseline daily smokers were compared to the reference population (baseline intermittent smokers and non-smokers) according to different aspects of social participation and social capital. A multivariate logistic regression model was used to assess differences in different aspects of social participation and social capital. Results: The baseline daily smokers that remained daily smokers at the one year follow up had significantly increased odds ratios of non-participation in study circles in other places than at work, meeting of organisations other than unions, theatre/cinema, arts exhibition, church, sports events, large gatherings of relatives, and private parties compared to the reference population. The baseline daily smokers that had become intermittent smokers at the one year follow up had significantly increased odds ratios of non-participation in church services. The baseline daily smokers that had stopped smoking had increased odds ratios of non-participation in having attended a meeting of organisations other than labour unions during the past year, having been to a theatre or cinema, and of having visited an arts exhibition during the past year. All three categories of baseline daily smokers had significantly decreased odds ratios of non-participation in night club/entertainment. Conclusions: The baseline daily smokers that had remained daily smokers at the one year follow up had particularly high rates of non-participation compared to the reference population in both activities specifically related to

Aggression Norms in the Classroom Social Network: Contexts of Aggressive Behavior and Social Preference in Middle Childhood.

PubMed

Jackson, Daisy R; Cappella, Elise; Neal, Jennifer Watling

2015-12-01

In a cross-sectional sample of African-American 2nd-4th grade students (N = 681), we examine the moderating effects of classroom overt and relational aggression norms on peers' social acceptance of classmates who exhibit overt and relational aggression in urban schools. Extending theory and research on classroom norms, we integrate social network data to adjust aggression norms based on children's direct and indirect connections in the classroom. Results of multilevel models indicate that network-based classroom aggression norms moderated relations between children's aggressive behavior and their social preference. Specifically, children benefited socially when their form of aggressive behavior fit with what was normative in the classroom social context. The moderating effect of classroom aggression norms was stronger for the association between overt aggression and social preference than relational aggression and social preference. Relationally aggressive youth were socially preferred by peers regardless of the classroom norm, although this positive association was magnified in classrooms with higher levels of relational aggression. Future research focused on aggression norms within classroom social networks are discussed and implications for school prevention efforts are considered.

Social Skills and Social Acceptance in Children with Anxiety Disorders.

PubMed

Scharfstein, Lindsay A; Beidel, Deborah C

2015-01-01

Whereas much is known about the deficits in social behaviors and social competence in youth with social anxiety disorder (SAD), less is known about those characteristics among youth with generalized anxiety disorder (GAD). This study aimed to better elucidate the social repertoire and peer acceptance of youth with SAD and youth with GAD, relative to normal control (NC) youth. The sample consisted of 58 primarily Caucasian children, ages 6 to 13 years: 20 SAD (12 female), 18 GAD (12 female), and 20 NC (9 female). Diagnoses were based on Anxiety Disorders Interview Schedule for DSM-IV: Children and Parent Versions interviews. A multimodal assessment strategy included parent and child reports, observer ratings of social performance, computer-based analysis of vocal qualities of speech, and peer ratings of likeability and friendship potential. Whereas self- and parental report did not differentiate the two diagnostic groups, differences on observable behaviors were apparent. Children with SAD exhibited anxious speech patterns, extended speech latencies, a paucity of speech, few spontaneous vocalizations, and ineffective social responses; they were perceived by peers as less likeable and socially desirable. Children with GAD had typical speech patterns and were well liked by their peers but displayed fewer spontaneous comments and questions than NC children. Parent and child reports are less sensitive to what could be important differences in social skill between youth with SAD and GAD. Direct observations, computer-based measures of speech quality, and peer ratings identify specific group differences, suggesting the need for a comprehensive evaluation to inform treatment planning.

Differentiating emotions across contexts: comparing adults with and without social anxiety disorder using random, social interaction, and daily experience sampling.

PubMed

Kashdan, Todd B; Farmer, Antonina S

2014-06-01

The ability to recognize and label emotional experiences has been associated with well-being and adaptive functioning. This skill is particularly important in social situations, as emotions provide information about the state of relationships and help guide interpersonal decisions, such as whether to disclose personal information. Given the interpersonal difficulties linked to social anxiety disorder (SAD), deficient negative emotion differentiation may contribute to impairment in this population. We hypothesized that people with SAD would exhibit less negative emotion differentiation in daily life, and these differences would translate to impairment in social functioning. We recruited 43 people diagnosed with generalized SAD and 43 healthy adults to describe the emotions they experienced over 14 days. Participants received palmtop computers for responding to random prompts and describing naturalistic social interactions; to complete end-of-day diary entries, they used a secure online website. We calculated intraclass correlation coefficients to capture the degree of differentiation of negative and positive emotions for each context (random moments, face-to-face social interactions, and end-of-day reflections). Compared to healthy controls, the SAD group exhibited less negative (but not positive) emotion differentiation during random prompts, social interactions, and (at trend level) end-of-day assessments. These differences could not be explained by emotion intensity or variability over the 14 days, or to comorbid depression or anxiety disorders. Our findings suggest that people with generalized SAD have deficits in clarifying specific negative emotions felt at a given point of time. These deficits may contribute to difficulties with effective emotion regulation and healthy social relationship functioning.

Differentiating Emotions Across Contexts: Comparing Adults with and without Social Anxiety Disorder Using Random, Social Interaction, and Daily Experience Sampling

PubMed Central

Kashdan, Todd B.; Farmer, Antonina S.

2014-01-01

The ability to recognize and label emotional experiences has been associated with well-being and adaptive functioning. This skill is particularly important in social situations, as emotions provide information about the state of relationships and help guide interpersonal decisions, such as whether to disclose personal information. Given the interpersonal difficulties linked to social anxiety disorder (SAD), deficient negative emotion differentiation may contribute to impairment in this population. We hypothesized that people with SAD would exhibit less negative emotion differentiation in daily life, and these differences would translate to impairment in social functioning. We recruited 43 people diagnosed with generalized SAD and 43 healthy adults to describe the emotions they experienced over 14 days. Participants received palmtop computers for responding to random prompts and describing naturalistic social interactions; to complete end-of-day diary entries, they used a secure online website. We calculated intraclass correlation coefficients to capture the degree of differentiation of negative and positive emotions for each context (random moments, face-to-face social interactions, and end-of-day reflections). Compared to healthy controls, the SAD group exhibited less negative (but not positive) emotion differentiation during random prompts, social interactions, and (at trend level) end-of-day assessments. These differences could not be explained by emotion intensity or variability over the 14 days, or to comorbid depression or anxiety disorders. Our findings suggest that people with generalized SAD have deficits in clarifying specific negative emotions felt at a given point of time. These deficits may contribute to difficulties with effective emotion regulation and healthy social relationship functioning. PMID:24512246

75 FR 3862 - Photography in Public Exhibit Space

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-25

... exhibit cases for displaying the Charters and other NAE documents to provide better clarity for viewing... documents from damaging exposure to light sources. NARA used filters in earlier exhibit cases. Although... exhibit lighting at its source to remove all ultraviolet and high energy visible light. One commenter...

Evolving nonapeptide mechanisms of gregariousness and social diversity in birds.

PubMed

Goodson, James L; Kelly, Aubrey M; Kingsbury, Marcy A

2012-03-01

Of the major vertebrate taxa, Class Aves is the most extensively studied in relation to the evolution of social systems and behavior, largely because birds exhibit an incomparable balance of tractability, diversity, and cognitive complexity. In addition, like humans, most bird species are socially monogamous, exhibit biparental care, and conduct most of their social interactions through auditory and visual modalities. These qualities make birds attractive as research subjects, and also make them valuable for comparative studies of neuroendocrine mechanisms. This value has become increasingly apparent as more and more evidence shows that social behavior circuits of the basal forebrain and midbrain are deeply conserved (from an evolutionary perspective), and particularly similar in birds and mammals. Among the strongest similarities are the basic structures and functions of avian and mammalian nonapeptide systems, which include mesotocin (MT) and arginine vasotocin (VT) systems in birds, and the homologous oxytocin (OT) and vasopressin (VP) systems, respectively, in mammals. We here summarize these basic properties, and then describe a research program that has leveraged the social diversity of estrildid finches to gain insights into the nonapeptide mechanisms of grouping, a behavioral dimension that is not experimentally tractable in most other taxa. These studies have used five monogamous, biparental finch species that exhibit group sizes ranging from territorial male-female pairs to large flocks containing hundreds or thousands of birds. The results provide novel insights into the history of nonapeptide functions in amniote vertebrates, and yield remarkable clarity on the nonapeptide biology of dinosaurs and ancient mammals. This article is part of a Special Issue entitled Oxytocin, Vasopressin, and Social Behavior. Copyright © 2012 Elsevier Inc. All rights reserved.

Considering High-Tech Exhibits?

ERIC Educational Resources Information Center

Routman, Emily

1994-01-01

Discusses a variety of high-tech exhibit media used in The Living World, an educational facility operated by The Saint Louis Zoo. Considers the strengths and weaknesses of holograms, video, animatronics, video-equipped microscopes, and computer interactives. Computer interactives are treated with special attention. (LZ)

Pro-sociality and strategic reasoning in economic decisions

PubMed Central

Arruñada, Benito; Casari, Marco; Pancotto, Francesca

2015-01-01

We study the relationship between pro-social preferences and strategic reasoning. These aspects are typically studied separately but little is known about their joint distribution. In an experiment, for each participant we elicit individual concerns toward pro-sociality—inequality aversion and efficiency—as well as the number of steps of reasoning through a guessing game. We report that self-regarding and pro-social participants exhibit similar levels of strategic reasoning, which supports the view that pro-sociality and strategic reasoning can be studied independently. PMID:26074799

A Salamander Tale: Effective Exhibits and Attitude Change

ERIC Educational Resources Information Center

Rollins, Jeffrey; Watson, Sunnie Lee

2017-01-01

Little information exists regarding intention behind the design and development of Extension outreach and educational exhibits. An evaluation of response to the exhibit "A Salamander Tale" indicates that the methods used to develop the exhibit resulted in an effective way to present information to an adult audience. Survey questions were…

Asia: A Guide to Traveling Exhibitions and Displays.

ERIC Educational Resources Information Center

ASIA Society, New York, NY.

The resource guide provides information on sources of exhibitions and materials for display which depict the peoples and culture of Asia. The major portion of the booklet represents one of the original Asia Society's exhibitions. The first section suggests several organizations which offer traveling exhibitions. Under each organization the kinds…

Sustained Attention and Social Competence in Typically Developing Preschool-Aged Children

ERIC Educational Resources Information Center

Murphy, Laura M. Bennett; Laurie-Rose, Cynthia; Brinkman, Tara M.; McNamara, Kelly A.

2007-01-01

The current study examines the relationship between sustained attention and social competence in preschool children. While studies demonstrate that children with attention deficit hyperactivity disorder (ADHD) exhibit poor social competence, less is known about typically developing children. Since children with ADHD have associated behavior…

Enhancer binding proteins act as hetero-oligomers and link secondary metabolite production to myxococcal development, motility, and predation.

PubMed

Volz, Carsten; Kegler, Carsten; Müller, Rolf

2012-11-21

Motile predatory Myxobacteria are producers of multiple secondary metabolites and, on starvation, undergo concerted cellular differentiation to form multicellular fruiting bodies. These abilities demand myxobacterial genomes to encode sophisticated regulatory networks that are not satisfactorily understood. Here, we present two bacterial enhancer binding proteins (bEBPs) encoded in Myxococcus xanthus acting as direct regulators of secondary metabolites intriguingly exhibiting activating and inhibitory effects. Elucidation of a regulon for each bEBP enabled us to unravel their role in myxococcal development, predation, and motility. Interestingly, both bEBPs are able to interact by forming a hetero-oligomeric complex. Our findings represent an alternative mode of operation of bEBPs, which are currently thought to enhance promoter activity by acting as homo-oligomers. Furthermore, a direct link between secondary metabolite gene expression and predation, motility, and cellular development could be shown for the first time. Copyright © 2012 Elsevier Ltd. All rights reserved.

Poster exhibitions at national conferences: education or farce?

PubMed

Salzl, Gabriele; Gölder, Stefan; Timmer, Antje; Marienhagen, Jörg; Schölmerich, Jürgen; Grossmann, Johannes

2008-02-01

The so-called poster exhibition is an established element of medical meetings which often receives little attention. The aim of this study was to analyze the organization, acceptance and value of poster exhibitions. Interview based study conducted during the annual meeting of a German specialist medical conference. A total of 247 attendees, poster authors and "poster chairpersons" were interviewed. Attendance at poster exhibitions was documented, the poster review and award process analyzed, and abstracts assessed for redundancy of presentation. Participation in poster exhibitions was very low. Despite this, their scientific value was esteemed high by young authors and the poster chairpersons. Almost a third (29.4%) of posters had been displayed at other meetings. Several attendees (55.4%) and poster presenters (49.1%) say they would welcome the opportunity for personal one-on-one discussion at the poster in addition to poster viewing. The option of additional personal discussion with the poster presenter may lead to an increase of the rather modest participation of attendees at poster exhibitions. Poster exhibitions are of value in particular for young scientists and poster chairpersons.

77 FR 31909 - Culturally Significant Objects Imported for Exhibition

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-30

... exhibition ``50th Anniversary Remembrance of the Tragedy at Orly,'' imported from abroad by the High Museum of Art for temporary exhibition within the United States, is of cultural significance. The object is... exhibition or display of the exhibit object at the High Museum of Art in Atlanta, Georgia from on or about...

Trajectories of Social Anxiety in Children: Influence of Child Cortisol Reactivity and Parental Social Anxiety.

PubMed

Poole, Kristie L; Van Lieshout, Ryan J; McHolm, Angela E; Cunningham, Charles E; Schmidt, Louis A

2017-12-19

Few studies have examined the interactive effect of intra- and extra-individual vulnerability factors on the trajectory of social anxiety in children. In this study, we examined the joint influence of familial vulnerability (i.e., parental social anxiety) and child biological stress vulnerability (i.e., cortisol reactivity) on trajectories of social anxiety. Children (N = 112 (57 males), M age  = 8.14 years, S.D. = 2.25) were followed over three visits spanning approximately three years. Parental social anxiety was assessed using the Social Phobia and Anxiety Inventory, children's behavior and salivary cortisol reactivity were measured in response to a speech task, and children's social anxiety was assessed at all three visits using the Screen for Child Related Emotional Disorders (SCARED; Parent-report). A growth curve analysis was used to examine trajectories of child social anxiety as predicted by children's cortisol reactivity and parental social anxiety, adjusting for covariates. We found a significant interaction between parental social anxiety and child cortisol reactivity in predicting child social anxiety across time. Having a socially anxious parent coupled with heightened cortisol reactivity predicted the highest levels of child social anxiety, with scores that remained above clinically significant levels for social anxiety across all visits. Children with familial risk for social anxiety and who also exhibit high stress-reactivity appear to be at risk for persistent, clinically significant social anxiety. This highlights the importance of considering the interaction between both biological and contextual factors when considering the development, maintenance, and treatment of social anxiety in children across time.

Proceedings of the 4th International Conference and Exhibition: World Congress on Superconductivity, Volume 2

NASA Technical Reports Server (NTRS)

Krishen, Kumar (Editor); Burnham, Calvin (Editor)

1995-01-01

This document contains papers presented at the 4th International Conference Exhibition: World Congress on Superconductivity held June 27-July 1, 1994 in Orlando, Florida. These documents encompass research, technology, applications, funding, political, and social aspects of superconductivity. The areas covered included: high-temperature materials; thin films; C-60 based superconductors; persistent magnetic fields and shielding; fabrication methodology; space applications; physical applications; performance characterization; device applications; weak link effects and flux motion; accelerator technology; superconductivity energy; storage; future research and development directions; medical applications; granular superconductors; wire fabrication technology; computer applications; technical and commercial challenges; and power and energy applications.

Social Entrepreneurship: Profit as a Means, Not an End. Digest Number 98-7.

ERIC Educational Resources Information Center

Schuyler, Gwyer

In the nonprofit sector, greater attention is being focused on individuals who have a vision for social change and financial resources to support their ideas. These social entrepreneurs exhibit all the skills of successful businesspeople and a powerful desire for social change. Others have described them as follows: (1) pathbreakers with a…

A visitor study approach to INGV exhibition at Genova Science Festival 2011

NASA Astrophysics Data System (ADS)

Nave, R.; D'Addezio, G.; Carosi, A.

2012-04-01

The Istituto Nazionale di Geofisica e Vulcanologia (INGV) is one of the largest European scientific institution dealing with Earth Sciences research and seismic and volcanic surveillance. We organizes every year intense educational and outreach activities focalizing in particular on causes of earthquakes and volcanic eruptions and how to behave properly and deal with these events. This approach derived from the consciousness on the social role of a correct information on natural hazards and on the awareness that preparedness is the best way to live with and to mitigate natural hazard. The Genova Science Festival, held since 2003, is the most remarkable among the Italian Science Communication events and for or the 2011 edition, the INGV realized an exibition called COME E' PROFONDO IL MARE, la geofisica in acqua (HOW DEEP THE SEA IS, geophysics in water). The exhibition shows and explains the main geodinamic processes trough interactive exhibits and colorful panels exploring events as earthquakes, volcanic eruption and tsunami, their impact on our territory. In order to approach a visitor study related to this scientific educational path we elaborated questionnaires designed for students, for teacher and for general public. We have chosen this survey instrument for its advantage to get a wide variety of information and quantitative data. In developing the questionnaire three main aspects were taken in account: its shortness, clarity in the questions, and answers structure able to grade different indicator of visitor opinion and exhibition impact. That will also allow us to combine indicators scores during data elaboration phase. The questionnaire goes through all the section of the educational path, trying to have a feedback on the proposed layout and its efficacy. The Science Festival lasted 2 weeks and was visited by about 8000 people. During the event were handed out and recollected about 300 questionnaires that allows us to make a reliable assessment on the

32 CFR 705.26 - Exhibit availability report.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 5 2010-07-01 2010-07-01 false Exhibit availability report. 705.26 Section 705.26 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS PUBLIC AFFAIRS REGULATIONS § 705.26 Exhibit availability report. (a) A center...

Alan Bean Art Exhibit

NASA Image and Video Library

2009-07-19

NASA Apollo 12 Astronaut and Artist Alan Bean gives remarks at the opening of the exhibit "Alan Bean: Painting Apollo, First Artist on Another World" at the National Air and Space Museum, Monday, July 20, 2009 in Washington. The show opening coincided with the 40th anniversary celebration of Apollo. Photo Credit: (NASA/Bill Ingalls)

[Energy education exhibits for Insights El Paso Science Museum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shubinski, R.

The grant in question, DE-FG03-94ER75954, was awarded to Insights El Paso Science Museum to build key exhibits. These exhibits helped the Museum fulfill its mission to ``promote curiosity and stimulate interest by exploratory, entertaining, exciting, and participatory learning in a broad range of scientific disciplines to persons of all ages regionally and internationally.`` There are several current Board of Directors members who also were Board members during the grant period and who helped construct some of the exhibits. Through speaking with them and reviewing minutes of Board meetings during 1994, it has been determined that seven of the ten proposedmore » exhibits were constructed, with an eighth exhibit constructed as an alternative. Photos of seven of the exhibits and preliminary sketches of some are attached. Following is a list of the constructed exhibits: Hot or Cold, Give and Take, Conduction, Convection, Sources of Energy, Wind Generator, Solar Tracker, and Perpetual Motion.« less

Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

PubMed

Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

2012-09-28

Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

19 CFR 212.11 - Net worth exhibit.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Net worth exhibit. 212.11 Section 212.11 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Information Required From Applicants § 212.11 Net worth exhibit...

32 CFR 705.25 - Navy Exhibit Center.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 5 2010-07-01 2010-07-01 false Navy Exhibit Center. 705.25 Section 705.25 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS PUBLIC AFFAIRS REGULATIONS § 705.25 Navy Exhibit Center. (a) The center is a...

Stressful life events, motives for Internet use, and social support among digital kids.

PubMed

Leung, Louis

2007-04-01

This study presents the interrelationships between stressful life events, motives for Internet use, social support, and the use of the Internet among a sample of adolescents and children aged 8 to 18 (N = 717). The results show that stressful life events are significantly associated with the consumption of the Internet for mood management (such as entertainment and information seeking) and social compensation (such as recognition gaining and relationship maintenance) motives. Secondly, the more children and adolescents exhibit high levels of social support, either online or offline, the less they find stressful life events upsetting. Thirdly, as individuals exhibit greater ability to personally access different types of social support to meet their needs, their motivations for Internet use are characteristically more allied to mood-management and social-compensation. This study reasserts that the mental and physical impact of stressful life events are in fact buffered by one's degree of social support and Internet use, particular examples of which are entertainment and relationship maintenance, and positive coping strategies, which temporarily reduce stress and anxiety.

Social Cognition in Williams Syndrome: Face Tuning

PubMed Central

Pavlova, Marina A.; Heiz, Julie; Sokolov, Alexander N.; Barisnikov, Koviljka

2016-01-01

Many neurological, neurodevelopmental, neuropsychiatric, and psychosomatic disorders are characterized by impairments in visual social cognition, body language reading, and facial assessment of a social counterpart. Yet a wealth of research indicates that individuals with Williams syndrome exhibit remarkable concern for social stimuli and face fascination. Here individuals with Williams syndrome were presented with a set of Face-n-Food images composed of food ingredients and in different degree resembling a face (slightly bordering on the Giuseppe Arcimboldo style). The primary advantage of these images is that single components do not explicitly trigger face-specific processing, whereas in face images commonly used for investigating face perception (such as photographs or depictions), the mere occurrence of typical cues already implicates face presence. In a spontaneous recognition task, participants were shown a set of images in a predetermined order from the least to most resembling a face. Strikingly, individuals with Williams syndrome exhibited profound deficits in recognition of the Face-n-Food images as a face: they did not report seeing a face on the images, which typically developing controls effortlessly recognized as a face, and gave overall fewer face responses. This suggests atypical face tuning in Williams syndrome. The outcome is discussed in the light of a general pattern of social cognition in Williams syndrome and brain mechanisms underpinning face processing. PMID:27531986

Social Cognition in Williams Syndrome: Face Tuning.

PubMed

Pavlova, Marina A; Heiz, Julie; Sokolov, Alexander N; Barisnikov, Koviljka

2016-01-01

Many neurological, neurodevelopmental, neuropsychiatric, and psychosomatic disorders are characterized by impairments in visual social cognition, body language reading, and facial assessment of a social counterpart. Yet a wealth of research indicates that individuals with Williams syndrome exhibit remarkable concern for social stimuli and face fascination. Here individuals with Williams syndrome were presented with a set of Face-n-Food images composed of food ingredients and in different degree resembling a face (slightly bordering on the Giuseppe Arcimboldo style). The primary advantage of these images is that single components do not explicitly trigger face-specific processing, whereas in face images commonly used for investigating face perception (such as photographs or depictions), the mere occurrence of typical cues already implicates face presence. In a spontaneous recognition task, participants were shown a set of images in a predetermined order from the least to most resembling a face. Strikingly, individuals with Williams syndrome exhibited profound deficits in recognition of the Face-n-Food images as a face: they did not report seeing a face on the images, which typically developing controls effortlessly recognized as a face, and gave overall fewer face responses. This suggests atypical face tuning in Williams syndrome. The outcome is discussed in the light of a general pattern of social cognition in Williams syndrome and brain mechanisms underpinning face processing.

Alan Bean Art Exhibit

NASA Image and Video Library

2009-07-19

Former NASA Astronaut and U.S. Senator John Glenn is seen at the opening of the exhibit "Alan Bean: Painting Apollo, First Artist on Another World" at the National Air and Space Museum, Monday, July 20, 2009 in Washington. The show opening coincided with the 40th anniversary celebration of Apollo. Photo Credit: (NASA/Carla Cioffi)

Animals Remember Previous Facial Expressions that Specific Humans Have Exhibited.

PubMed

Proops, Leanne; Grounds, Kate; Smith, Amy Victoria; McComb, Karen

2018-05-07

For humans, facial expressions are important social signals, and how we perceive specific individuals may be influenced by subtle emotional cues that they have given us in past encounters. A wide range of animal species are also capable of discriminating the emotions of others through facial expressions [1-5], and it is clear that remembering emotional experiences with specific individuals could have clear benefits for social bonding and aggression avoidance when these individuals are encountered again. Although there is evidence that non-human animals are capable of remembering the identity of individuals who have directly harmed them [6, 7], it is not known whether animals can form lasting memories of specific individuals simply by observing subtle emotional expressions that they exhibit on their faces. Here we conducted controlled experiments in which domestic horses were presented with a photograph of an angry or happy human face and several hours later saw the person who had given the expression in a neutral state. Short-term exposure to the facial expression was enough to generate clear differences in subsequent responses to that individual (but not to a different mismatched person), consistent with the past angry expression having been perceived negatively and the happy expression positively. Both humans were blind to the photograph that the horses had seen. Our results provide clear evidence that some non-human animals can effectively eavesdrop on the emotional state cues that humans reveal on a moment-to-moment basis, using their memory of these to guide future interactions with particular individuals. Copyright © 2018 Elsevier Ltd. All rights reserved.

Modeling rises and falls in money addicted social hierarchies

NASA Astrophysics Data System (ADS)

Dybiec, Bartłomiej; Mitarai, Namiko; Sneppen, Kim

2014-08-01

The emergence of large communities is inherently associated with the creation of social structures. Connections between individuals are indispensable for cooperative action of agents building social groups. Moreover, social groups usually evolve and their structure changes over time. Consequently, an underlying network connecting individuals is not static, reflecting an ongoing adaptation to new conditions. The evolution of social connections is influenced by the relative position (hierarchy) of individuals building the system as well as by the availability of resources. We explore this aspect of human ambition by modeling the interplay of social networking and an uneven distribution of external resources. The model naturally generates social hierarchies. Remarkably, this social structure exhibits a rise-and-fall behavior. A well pronounced quasi-periodic dynamics, which is closely associated with the dissipation of resources that are needed to sustain the social links, is revealed.

Overexpression of the NR2A subunit in the forebrain impairs long-term social recognition and non-social olfactory memory.

PubMed

Jacobs, S A; Tsien, J Z

2014-04-01

Animals must recognize and remember conspecifics and potential mates, and distinguish these animals from potential heterospecific competitors and predators. Despite its necessity, aged animals are known to exhibit impaired social recognition memory. As the brain ages, the ratio of NR2A:NR2B in the brain increases over time and has been postulated to underlie the cognitive decline observed during the aging process. Here, we test the hypothesis that an increased NR2A:NR2B subunit ratio underlies long-term social recognition memory. Using transgenic overexpression of NR2A in the forebrain regions, we investigated the ability of these mice to learn and remember male and female conspecifics, mice of another strain and animals of another rodent species, the rat. Furthermore, due to the importance of olfaction in social recognition, we tested the olfactory memory in the NR2A transgenic mice. Our series of behavioral experiments revealed significant impairments in the NR2A transgenic mice in long-term social memory of both male and female conspecifics. Additionally, the NR2A transgenic mice are unable to recognize mice of another strain or rats. The NR2A transgenic mice also exhibited long-term memory impairments in the olfactory recognition task. Taken together, our results provide evidence that an increased NR2A:NR2B ratio in the forebrain leads to reduced long-term memory function, including the ethologically important memories such as social recognition and olfactory memory.

Social percolation models

NASA Astrophysics Data System (ADS)

Solomon, Sorin; Weisbuch, Gerard; de Arcangelis, Lucilla; Jan, Naeem; Stauffer, Dietrich

2000-03-01

We here relate the occurrence of extreme market shares, close to either 0 or 100%, in the media industry to a percolation phenomenon across the social network of customers. We further discuss the possibility of observing self-organized criticality when customers and cinema producers adjust their preferences and the quality of the produced films according to previous experience. Comprehensive computer simulations on square lattices do indeed exhibit self-organized criticality towards the usual percolation threshold and related scaling behaviour.

Early Predictors of Impaired Social Functioning in Male Rhesus Macaques (Macaca mulatta)

PubMed Central

Del Rosso, Laura A.; Seil, Shannon K.; Calonder, Laura A.; Madrid, Jesus E.; Bone, Kyle J.; Sherr, Elliott H.; Garner, Joseph P.; Capitanio, John P.; Parker, Karen J.

2016-01-01

Autism spectrum disorder (ASD) is characterized by social cognition impairments but its basic disease mechanisms remain poorly understood. Progress has been impeded by the absence of animal models that manifest behavioral phenotypes relevant to ASD. Rhesus monkeys are an ideal model organism to address this barrier to progress. Like humans, rhesus monkeys are highly social, possess complex social cognition abilities, and exhibit pronounced individual differences in social functioning. Moreover, we have previously shown that Low-Social (LS) vs. High-Social (HS) adult male monkeys exhibit lower social motivation and poorer social skills. It is not known, however, when these social deficits first emerge. The goals of this study were to test whether juvenile LS and HS monkeys differed as infants in their ability to process social information, and whether infant social abilities predicted later social classification (i.e., LS vs. HS), in order to facilitate earlier identification of monkeys at risk for poor social outcomes. Social classification was determined for N = 25 LS and N = 25 HS male monkeys that were 1–4 years of age. As part of a colony-wide assessment, these monkeys had previously undergone, as infants, tests of face recognition memory and the ability to respond appropriately to conspecific social signals. Monkeys later identified as LS vs. HS showed impairments in recognizing familiar vs. novel faces and in the species-typical adaptive ability to gaze avert to scenes of conspecific aggression. Additionally, multivariate logistic regression using infant social ability measures perfectly predicted later social classification of all N = 50 monkeys. These findings suggest that an early capacity to process important social information may account for differences in rhesus monkeys’ motivation and competence to establish and maintain social relationships later in life. Further development of this model will facilitate identification of novel biological targets

The Eugenides Foundation Interactive Exhibition of Science and Technology

NASA Astrophysics Data System (ADS)

Kontogiannis, Ioannis

2010-01-01

The Interactive Exhibition of Science and Technology is installed in an area of 1200 m2 at the Eugenides Foundation. 65 interactive exhibits, designed by the "Cites des Science et de l' Industrie" are organised in themes, stimulate the visitors' mind and provoke scientific thinking. Parallel activities take place inside the exhibition, such as live science demonstrations, performed by young scientists. Extra material such as news bulletins (short news, science comics and portraits), educational paths and treasure-hunting based games, all available online as well, are prepared on a monthly basis and provided along with the visit to the exhibition. Through these exhibits and activities, scientific facts are made simple and easy to comprehend using modern presentation tools. We present details on how this exhibition acts complementary to the science education provided by schools, making it a highly sophisticated educational tool.

Against the Odds Exhibition Opens

MedlinePlus

... the National Institutes of Health in Bethesda, Md. Photo courtesy of Bill Branson NIH Director Dr. Elias ... addresses visitors to the opening of the exhibition. Photo courtesy of Bill Branson Brothers Niko and Theo ...

Social Competence Intervention for Youth with Asperger Syndrome and High-Functioning Autism: An Initial Investigation

ERIC Educational Resources Information Center

Stichter, Janine P.; Herzog, Melissa J.; Visovsky, Karen; Schmidt, Carla; Randolph, Jena; Schultz, Tia; Gage, Nicholas

2010-01-01

Individuals with high functioning autism (HFA) or Asperger Syndrome (AS) exhibit difficulties in the knowledge or correct performance of social skills. This subgroup's social difficulties appear to be associated with deficits in three social cognition processes: theory of mind, emotion recognition and executive functioning. The current study…

Evolutionary Dynamics of Influenza A Viruses in US Exhibition Swine

PubMed Central

Nelson, Martha I.; Wentworth, David E.; Das, Suman R.; Sreevatsan, Srinand; Killian, Mary L.; Nolting, Jacqueline M.; Slemons, Richard D.; Bowman, Andrew S.

2016-01-01

The role of exhibition swine in influenza A virus transmission was recently demonstrated by >300 infections with influenza A(H3N2) variant viruses among individuals who attended agricultural fairs. Through active influenza A virus surveillance in US exhibition swine and whole-genome sequencing of 380 isolates, we demonstrate that exhibition swine are actively involved in the evolution of influenza A viruses, including zoonotic strains. First, frequent introduction of influenza A viruses from commercial swine populations provides new genetic diversity in exhibition pigs each year locally. Second, genomic reassortment between viruses cocirculating in exhibition swine increases viral diversity. Third, viral migration between exhibition swine in neighboring states demonstrates that movements of exhibition pigs contributes to the spread of genetic diversity. The unexpected frequency of viral exchange between commercial and exhibition swine raises questions about the understudied interface between these populations. Overall, the complexity of viral evolution in exhibition swine indicates that novel viruses are likely to continually reemerge, presenting threats to humans. PMID:26243317

Social status drives social relationships in groups of unrelated female rhesus macaques

PubMed Central

Snyder-Mackler, Noah; Kohn, Jordan N.; Barreiro, Luis B.; Johnson, Zachary P.; Wilson, Mark E.; Tung, Jenny

2015-01-01

Strong social relationships confer health and fitness benefits in a number of species, motivating the need to understand the processes through which they arise. In female cercopithecine primates, both kinship and dominance rank are thought to influence rates of affiliative behaviour and social partner preference. Teasing apart the relative importance of these factors has been challenging, however, as female kin often occupy similar positions in the dominance hierarchy. Here, we isolated the specific effects of rank on social relationships in female rhesus macaques by analysing grooming patterns in 18 social groups that did not contain close relatives, and in which dominance ranks were experimentally randomized. We found that grooming was asymmetrically directed towards higher-ranking females and that grooming bouts temporarily decreased the likelihood of aggression between grooming partners, supporting the idea that grooming is associated with social tolerance. Even in the absence of kin, females formed the strongest grooming relationships with females adjacent to them in rank, a pattern that was strongest for the highest-ranking females. Using simulations, we show that three rules for allocating grooming based on dominance rank recapitulated most of the relationships we observed. Finally, we evaluated whether a female's tendency to engage in grooming behaviour was stable across time and social setting. We found that one measure, the rate of grooming females provided to others (but not the rate of grooming females received), exhibited modest stability after accounting for the primary effect of dominance rank. Together, our findings indicate that dominance rank has strong effects on social relationships in the absence of kin, suggesting the importance of considering social status and social connectedness jointly when investigating their health and fitness consequences. PMID:26769983

Social status drives social relationships in groups of unrelated female rhesus macaques.

PubMed

Snyder-Mackler, Noah; Kohn, Jordan N; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Tung, Jenny

2016-01-01

Strong social relationships confer health and fitness benefits in a number of species, motivating the need to understand the processes through which they arise. In female cercopithecine primates, both kinship and dominance rank are thought to influence rates of affiliative behaviour and social partner preference. Teasing apart the relative importance of these factors has been challenging, however, as female kin often occupy similar positions in the dominance hierarchy. Here, we isolated the specific effects of rank on social relationships in female rhesus macaques by analysing grooming patterns in 18 social groups that did not contain close relatives, and in which dominance ranks were experimentally randomized. We found that grooming was asymmetrically directed towards higher-ranking females and that grooming bouts temporarily decreased the likelihood of aggression between grooming partners, supporting the idea that grooming is associated with social tolerance. Even in the absence of kin, females formed the strongest grooming relationships with females adjacent to them in rank, a pattern that was strongest for the highest-ranking females. Using simulations, we show that three rules for allocating grooming based on dominance rank recapitulated most of the relationships we observed. Finally, we evaluated whether a female's tendency to engage in grooming behaviour was stable across time and social setting. We found that one measure, the rate of grooming females provided to others (but not the rate of grooming females received), exhibited modest stability after accounting for the primary effect of dominance rank. Together, our findings indicate that dominance rank has strong effects on social relationships in the absence of kin, suggesting the importance of considering social status and social connectedness jointly when investigating their health and fitness consequences.

Black Holes Traveling Exhibition: This Time, It's Personal.

NASA Astrophysics Data System (ADS)

Dussault, Mary E.; Braswell, E. L.; Sunbury, S.; Wasser, M.; Gould, R. R.

2012-01-01

How can you make a topic as abstract as black holes seem relevant to the life of the average museum visitor? In 2009, the Harvard-Smithsonian Center for Astrophysics developed a 2500 square foot interactive museum exhibition, "Black Holes: Space Warps & Time Twists,” with funding from the National Science Foundation and NASA. The exhibition has been visited by more than a quarter million museum-goers, and is about to open in its sixth venue at the Reuben H. Fleet Science Center in San Diego, California. We have found that encouraging visitors to adopt a custom black hole explorer's identity can help to make the science of black holes more accessible and meaningful. The Black Holes exhibition uses networked exhibit technology that serves to personalize the visitor experience, to support learning over time including beyond the gallery, and to provide a rich quantitative source of embedded evaluation data. Visitors entering the exhibition create their own bar-coded "Black Holes Explorer's Card” which they use throughout the exhibition to collect and record images, movies, their own predictions and conclusions, and other black hole artifacts. This digital database of personal discoveries grows as visitors navigate through the gallery, and an automated web-content authoring system creates a personalized online journal of their experience that they can access once they get home. We report here on new intriguing results gathered from data generated by 112,000 visitors across five different venues. For example, an initial review of the data reveals correlations between visitors’ black hole explorer identity choices and their engagement with the exhibition. We will also discuss correlations between learning gains and personalization.

LH responses to single doses of exogenous GnRH by social Mashona mole-rats: a continuum of socially induced infertility in the family Bathyergidae.

PubMed Central

Bennett, N C; Faulkes, C G; Spinks, A C

1997-01-01

The Mashona mole-rat, Cryptomys darlingi, exhibits an extreme reproductive division of labour. Reproduction in the colony is restricted to a single breeding pair. The non-reproductive male and female colony members are restrained from sexual activity by being familiar and related to one another and the reproductive animals. Circulating basal concentrations of luteinizing hormone (LH) as well as LH levels measured in response to a single exogenous gonadotropin releasing hormone (GnRH) challenge are not significantly different between the reproductive and non-reproductive groups of either sex. Socially induced infertility in both non-reproductive males and females does not result from a reduced pituitary secretion of LH or decreased sensitivity to hypothalamic GnRH, but rather appears to result from an inhibition of reproductive behaviour in these obligate outbreeders. The African mole-rats exhibit a continuum of socially induced infertility with differing social species inhabiting regions of varying degrees of aridity. In this continuum a transition from a predominantly behavioural repression in a social mesic-adapted species through to complete physiological suppression lacking incest avoidance in an arid-adapted eusocial species occurs in this endemic African family of rodents. PMID:9263467

LH responses to single doses of exogenous GnRH by social Mashona mole-rats: a continuum of socially induced infertility in the family Bathyergidae.

PubMed

Bennett, N C; Faulkes, C G; Spinks, A C

1997-07-22

The Mashona mole-rat, Cryptomys darlingi, exhibits an extreme reproductive division of labour. Reproduction in the colony is restricted to a single breeding pair. The non-reproductive male and female colony members are restrained from sexual activity by being familiar and related to one another and the reproductive animals. Circulating basal concentrations of luteinizing hormone (LH) as well as LH levels measured in response to a single exogenous gonadotropin releasing hormone (GnRH) challenge are not significantly different between the reproductive and non-reproductive groups of either sex. Socially induced infertility in both non-reproductive males and females does not result from a reduced pituitary secretion of LH or decreased sensitivity to hypothalamic GnRH, but rather appears to result from an inhibition of reproductive behaviour in these obligate outbreeders. The African mole-rats exhibit a continuum of socially induced infertility with differing social species inhabiting regions of varying degrees of aridity. In this continuum a transition from a predominantly behavioural repression in a social mesic-adapted species through to complete physiological suppression lacking incest avoidance in an arid-adapted eusocial species occurs in this endemic African family of rodents.

Proceedings of the 4th International Conference and Exhibition: World Congress on Superconductivity, volume 1

NASA Technical Reports Server (NTRS)

Krishen, Kumar (Editor); Burnham, Calvin (Editor)

1995-01-01

The papers presented at the 4th International Conference Exhibition: World Congress on Superconductivity held at the Marriott Orlando World Center, Orlando, Florida, are contained in this document and encompass the research, technology, applications, funding, political, and social aspects of superconductivity. Specifically, the areas covered included: high-temperature materials; thin films; C-60 based superconductors; persistent magnetic fields and shielding; fabrication methodology; space applications; physical applications; performance characterization; device applications; weak link effects and flux motion; accelerator technology; superconductivity energy; storage; future research and development directions; medical applications; granular superconductors; wire fabrication technology; computer applications; technical and commercial challenges, and power and energy applications.

Neural markers of social and monetary rewards in children with Attention-Deficit/Hyperactivity Disorder and Autism Spectrum Disorder

PubMed Central

Gonzalez-Gadea, Maria Luz; Sigman, Mariano; Rattazzi, Alexia; Lavin, Claudio; Rivera-Rei, Alvaro; Marino, Julian; Manes, Facundo; Ibanez, Agustin

2016-01-01

Recent theories of decision making propose a shared value-related brain mechanism for encoding monetary and social rewards. We tested this model in children with Attention-Deficit/Hyperactivity Disorder (ADHD), children with Autism Spectrum Disorder (ASD) and control children. We monitored participants’ brain dynamics using high density-electroencephalography while they played a monetary and social reward tasks. Control children exhibited a feedback Error-Related Negativity (fERN) modulation and Anterior Cingulate Cortex (ACC) source activation during both tasks. Remarkably, although cooperation resulted in greater losses for the participants, the betrayal options generated greater fERN responses. ADHD subjects exhibited an absence of fERN modulation and reduced ACC activation during both tasks. ASD subjects exhibited normal fERN modulation during monetary choices and inverted fERN/ACC responses in social options than did controls. These results suggest that in neurotypicals, monetary losses and observed disloyal social decisions induced similar activity in the brain value system. In ADHD children, difficulties in reward processing affected early brain signatures of monetary and social decisions. Conversely, ASD children showed intact neural markers of value-related monetary mechanisms, but no brain modulation by prosociality in the social task. These results offer insight into the typical and atypical developments of neural correlates of monetary and social reward processing. PMID:27464551

Neural markers of social and monetary rewards in children with Attention-Deficit/Hyperactivity Disorder and Autism Spectrum Disorder.

PubMed

Gonzalez-Gadea, Maria Luz; Sigman, Mariano; Rattazzi, Alexia; Lavin, Claudio; Rivera-Rei, Alvaro; Marino, Julian; Manes, Facundo; Ibanez, Agustin

2016-07-28

Recent theories of decision making propose a shared value-related brain mechanism for encoding monetary and social rewards. We tested this model in children with Attention-Deficit/Hyperactivity Disorder (ADHD), children with Autism Spectrum Disorder (ASD) and control children. We monitored participants' brain dynamics using high density-electroencephalography while they played a monetary and social reward tasks. Control children exhibited a feedback Error-Related Negativity (fERN) modulation and Anterior Cingulate Cortex (ACC) source activation during both tasks. Remarkably, although cooperation resulted in greater losses for the participants, the betrayal options generated greater fERN responses. ADHD subjects exhibited an absence of fERN modulation and reduced ACC activation during both tasks. ASD subjects exhibited normal fERN modulation during monetary choices and inverted fERN/ACC responses in social options than did controls. These results suggest that in neurotypicals, monetary losses and observed disloyal social decisions induced similar activity in the brain value system. In ADHD children, difficulties in reward processing affected early brain signatures of monetary and social decisions. Conversely, ASD children showed intact neural markers of value-related monetary mechanisms, but no brain modulation by prosociality in the social task. These results offer insight into the typical and atypical developments of neural correlates of monetary and social reward processing.

Voluntary exercise increases resilience to social defeat stress in Syrian hamsters.

PubMed

Kingston, Rody C; Smith, Michael; Lacey, Tiara; Edwards, Malcolm; Best, Janae N; Markham, Chris M

2018-05-01

Exposure to social stressors can cause profound changes in an individual's well-being and can be an underlying factor in the etiology of a variety of psychopathologies, such as post-traumatic stress disorder (PTSD). In Syrian hamsters, a single social defeat experience results in behavioral changes collectively known as conditioned defeat (CD), and includes an abolishment of territorial aggression and the emergence of high levels of defensive behaviors. In contrast, voluntary exercise has been shown to promote stress resilience and can also have anxiolytic-like effects. Although several studies have investigated the resilience-inducing effects of voluntary exercise after exposure to physical stressors, such as restraint and electric shock, few studies have examined whether exercise can impart resilience in response to ethologically-based stressors, such as social defeat. In Experiment 1, we tested the hypothesis that voluntary exercise can have anxiolytic-like effects in socially defeated hamsters. In the elevated plus maze, the exercise group exhibited a significant reduction in risk assessment, a commonly used index of anxiety, compared to the no-exercise group. In the open-field test, animals in the exercise group exhibited a significant reduction in locomotor behavior and rearing, also an indication of an anxiolytic-like effect of exercise. In Experiment 2, we examined whether exercise can reverse the defeat-induced potentiation of defensive behaviors using the CD model. Socially defeated hamsters in the exercise group exhibited significantly lower levels of defensive/submissive behaviors compared to the no-exercise group upon exposure to the resident aggressor. Taken together, these results are among the first to suggest that voluntary exercise may promote resilience to social defeat stress in Syrian hamsters. Copyright © 2018 Elsevier Inc. All rights reserved.

AWEA WINDPOWER 2019 Conference & Exhibition

Science.gov Websites

than go through menu items. Book a Booth Learn Exhibit Sponsor Register AWEA Wind Power May 20-23 2019 . Book Your Booth Sponsor Sponsoring AWEA WINDPOWER 2019 gives you the opportunity to broadcast your

Hierarchical sequencing of online social graphs

NASA Astrophysics Data System (ADS)

Andjelković, Miroslav; Tadić, Bosiljka; Maletić, Slobodan; Rajković, Milan

2015-10-01

In online communications, patterns of conduct of individual actors and use of emotions in the process can lead to a complex social graph exhibiting multilayered structure and mesoscopic communities. Using simplicial complexes representation of graphs, we investigate in-depth topology of the online social network constructed from MySpace dialogs which exhibits original community structure. A simulation of emotion spreading in this network leads to the identification of two emotion-propagating layers. Three topological measures are introduced, referred to as the structure vectors, which quantify graph's architecture at different dimension levels. Notably, structures emerging through shared links, triangles and tetrahedral faces, frequently occur and range from tree-like to maximal 5-cliques and their respective complexes. On the other hand, the structures which spread only negative or only positive emotion messages appear to have much simpler topology consisting of links and triangles. The node's structure vector represents the number of simplices at each topology level in which the node resides and the total number of such simplices determines what we define as the node's topological dimension. The presented results suggest that the node's topological dimension provides a suitable measure of the social capital which measures the actor's ability to act as a broker in compact communities, the so called Simmelian brokerage. We also generalize the results to a wider class of computer-generated networks. Investigating components of the node's vector over network layers reveals that same nodes develop different socio-emotional relations and that the influential nodes build social capital by combining their connections in different layers.

An intra-amygdala circuit specifically regulates social fear learning

PubMed Central

Twining, Robert C.; Vantrease, Jaime E.; Love, Skyelar; Padival, Mallika; Rosenkranz, J. Amiel

2016-01-01

Adaptive social behavior requires transmission and reception of salient social information. Impairment of this reciprocity is a cardinal symptom of autism. The amygdala is a critical mediator of social behavior and is implicated in social symptoms of autism. Here we found that a specific amygdala circuit, from the lateral nucleus to the medial nucleus (LA-MeA), is required for using social cues to learn about environmental cues that signal imminent threats. Disruption of the LA-MeA circuit impaired valuation of these environmental cues and subsequent ability to use this cue to guide behavior. Rats with impaired social guidance of behavior due to knockout of Nrxn1, an analog to autism-associated genes (NRXN), exhibited marked LA-MeA deficits. Chemogenetic activation of this circuit reversed these impaired social behaviors. These findings identify an amygdala circuit required to guide emotional responses to socially significant cues and identify a novel exploratory target for disorders associated with social impairments. PMID:28114293

African Past: Migrant Present. A Guide to the Exhibition.

ERIC Educational Resources Information Center

Twining, Mary Arnold; Roark-Calnek, Sue

This exhibit guide describes an exhibition of African folk arts produced by seasonal migrant farmworkers in western New York State. Workers come from the American South, Haiti, Puerto Rico, and Jamaica. The exhibition pieces were collected through the BOCES Geneseo Migrant Center's Folk Arts Program and Creative Artists Migrant Program Services…

78 FR 7849 - Culturally Significant Objects Imported for Exhibition

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-04

... Century,'' imported from abroad for temporary exhibition within the United States, are of cultural... also determine that the exhibition or display of the exhibit objects at The Yale Center for British Art..., Bureau of Educational and Cultural Affairs, Department of State. [FR Doc. 2013-02401 Filed 2-1-13; 8:45...

Social isolation and brain development in the ant Camponotus floridanus.

PubMed

Seid, Marc A; Junge, Erich

2016-06-01

Social interactions play a key role in the healthy development of social animals and are most pronounced in species with complex social networks. When developing offspring do not receive proper social interaction, they show developmental impairments. This effect is well documented in mammalian species but controversial in social insects. It has been hypothesized that the enlargement of the mushroom bodies, responsible for learning and memory, observed in social insects is needed for maintaining the large social networks and/or task allocation. This study examines the impact of social isolation on the development of mushroom bodies of the ant Camponotus floridanus. Ants raised in isolation were shown to exhibit impairment in the growth of the mushroom bodies as well as behavioral differences when compared to ants raised in social groups. These results indicate that social interaction is necessary for the proper development of C. floridanus mushroom bodies.

Social isolation and brain development in the ant Camponotus floridanus

NASA Astrophysics Data System (ADS)

Seid, Marc A.; Junge, Erich

2016-06-01

Social interactions play a key role in the healthy development of social animals and are most pronounced in species with complex social networks. When developing offspring do not receive proper social interaction, they show developmental impairments. This effect is well documented in mammalian species but controversial in social insects. It has been hypothesized that the enlargement of the mushroom bodies, responsible for learning and memory, observed in social insects is needed for maintaining the large social networks and/or task allocation. This study examines the impact of social isolation on the development of mushroom bodies of the ant Camponotus floridanus. Ants raised in isolation were shown to exhibit impairment in the growth of the mushroom bodies as well as behavioral differences when compared to ants raised in social groups. These results indicate that social interaction is necessary for the proper development of C. floridanus mushroom bodies.

Epigenetic influence of social experiences across the lifespan.

PubMed

Champagne, Frances A

2010-05-01

The critical role of social interactions in driving phenotypic variation has long been inferred from the association between early social deprivation and adverse neurodevelopmental outcomes. Recent evidence has implicated molecular pathways involved in the regulation of gene expression as one possible route through which these long-term outcomes are achieved. These epigenetic effects, though not exclusive to social experiences, may be a mechanism through which the quality of the social environment becomes embedded at a biological level. Moreover, there is increasing evidence for the transgenerational impact of these early experiences mediated through changes in social and reproductive behavior exhibited in adulthood. In this review, recent studies which highlight the epigenetic effects of parent-offspring, peer and adult social interactions both with and across generations will be discussed and the implications of this research for understanding the developmental origins of individual differences in brain and behavior will be explored.

Hippocampus lesions induced deficits in social and spatial recognition in Octodon degus.

PubMed

Uekita, Tomoko; Okanoya, Kazuo

2011-06-01

Previous studies of rodents reported that the hippocampus plays an important role in social behavior as well as spatial behavior. However, there are inconsistencies between reports of the effects of hippocampal lesions on social behavior. The present study sought to clarify the aspects of social behavior in which the hippocampus plays a role in the degu, Octodon degus, a social rodent. We examined the effects of hippocampal lesions on social behavior in the degu using familiar and novel partners. When placed in a familiar environment with a familiar partner after surgery, sham operation control (S.Cont) degus exhibited affinitive behavior longer compared with hippocampal lesioned (HPC) degus. In a novel environment, S.Cont degus exhibited longer aggressive behavior toward novel partners, and longer affinitive behavior with familiar partners compared with HPC degus. HPC degus did not show evidence of differentiation in social behavior, regardless of partner's novelty. The results of an anxiety test confirmed that these findings could not be attributed to changes in emotional state. We conducted an object-recognition test with the same subjects. HPC degus showed an impairment in spatial recognition but not object recognition. Taken together, these results suggest that the degu hippocampus plays an important role not only in spatial recognition but also social recognition. The changes in social behavior resulting from hippocampal lesions were interpreted as due to an impairment of social recognition rather than an impairment in novelty detection. Copyright © 2011 Elsevier B.V. All rights reserved.

Environment construction and bottleneck breakthrough in the improvement of wisdom exhibition

NASA Astrophysics Data System (ADS)

Zhang, Jiankang

2017-08-01

Wisdom exhibition is an inexorable trend in convention and exhibition industry in China. Information technology must be utilized by exhibition industry to achieve intelligent application and wisdom management, breaking the limitation of time as well as space, which raise the quality of exhibition service and level of operation to a totally new standard. Accordingly, exhibition industry should optimize mobile internet, a fundamental technology platform, during the advancing process of wisdom exhibition and consummate the combination among three plates including wisdom connection of information, wisdom exhibition environment and wisdom application of technology. Besides, the industry should realize the wisdom of external environment including wisdom of exhibition city, exhibition place, exhibition resource deal etc and break through bottle-neck in construction of wisdom exhibition industry, which includes construction of big data center, development of Mobile Internet application platform, promotion of information construction, innovative design of application scenarios.

Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿

PubMed Central

Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.

2010-01-01

New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

Online Cultural Heritage Exhibitions: A Survey of Strategic Issues

ERIC Educational Resources Information Center

Liew, Chern Li

2006-01-01

Purpose: This paper seeks to report findings from a study that looked at a range of strategic issues faced in the development, management and maintenance of online cultural heritage exhibitions. The study examined exhibitions from different types of cultural agencies and asked questions about whether, for instance, the exhibitions are part of the…

76 FR 68808 - Culturally Significant Objects Imported for Exhibition

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-07

... also determine that the exhibition or display of the exhibit objects at the Onassis Cultural Center... Century AD,'' imported from abroad for temporary exhibition within the United States, are of cultural... Cultural Affairs, Department of State. [FR Doc. 2011-28805 Filed 11-4-11; 8:45 am] BILLING CODE 4710-05-P ...

Cosmic Origins: A Traveling Science Exhibit and Education Program

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.; Morrow, C. A.; Harold, J.

2003-12-01

The Space Science Institute of Boulder, Colorado, is developing a 3,000 square-foot traveling exhibition, called Cosmic Origins, which will bring origins-related research and discoveries to students and the American public. Cosmic Origins will have three interrelated exhibit areas: Star Formation, Planet Quest, and Search for Life. Exhibit visitors will explore the awesome events surrounding the birth of stars and planets; they will join scientists in the hunt for planets outside our solar system including those that may be in "habitable zones" around other stars; and finally they will be able to learn about the wide range of conditions for life on Earth and how scientists are looking for signs of life beyond Earth. Visitors will also learn about the tools scientists' use, such as space-based and ground-based telescopes, to improve our understanding of the cosmos. Exhibit content will address age-old questions that form the basis of NASA's Origins and Astrobiology programs: Where did we come from? Are we alone? In addition to the exhibit, our project will include workshops for educators and docents at host sites, as well as a public Web site that will use a virtual rendering of exhibit content. The exhibit's size will permit it to visit medium sized museums in underserved regions of the country. It will begin its 3-year tour to 9 host museums and science centers in early 2005. A second 3-year tour is also planned for 2008. The Association of Science-Technology Centers (ASTC) will manage the exhibit's national tour. Current partners in the Cosmic Origins project include ASTC, the Denver Museum of Nature and Science, Lawrence Hall of Science, NASA Astrobiology Institute, NASA missions (e.g. PlanetQuest, SIRTF, and Kepler), New York Hall of Science, the SETI Institute, and the Space Telescope Science Institute. The exhibition is supported by grants from NSF and NASA. This report will focus on the Planet Quest part of the exhibition.

Translating land use science to a museum exhibit.

PubMed

Arce-Nazario, Javier A

2016-01-01

For land use science to engage the general public it must successfully translate its concepts and conclusions and make them public outside of traditional scientific venues. Here we explore science-art exhibits, which blend artistic presentations with specific scientific data or themes, as a possible effective way of communicating scientific information and disrupting misconceptions. We describe the process of producing a science-art exhibit on remote sensing and Puerto Rican landscape history from 1937 to the present, sited at a rural Puerto Rican community museum, and examine the visitor experience and educational outcomes of the museum exhibit through analysis of survey data. The exhibit project engaged undergraduate students from a variety of academic backgrounds, introduced land use science concepts to the public in an engaging format, and was effective at reshaping visitors' misconceptions of Puerto Rico's landscape change history.

Myxococcus CsgA, Drosophila Sniffer, and human HSD10 are cardiolipin phospholipases

PubMed Central

Boynton, Tye O'Hara; Shimkets, Lawrence Joseph

2015-01-01

Myxococcus xanthus development requires CsgA, a member of the short-chain alcohol dehydrogenase (SCAD) family of proteins. We show that CsgA and SocA, a protein that can replace CsgA function in vivo, oxidize the 2′-OH glycerol moiety on cardiolipin and phosphatidylglycerol to produce diacylglycerol (DAG), dihydroxyacetone, and orthophosphate. A lipid extract enriched in DAGs from wild-type cells initiates development and lipid body production in a csgA mutant to bypass the mutational block. This novel phospholipase C-like reaction is widespread. SCADs that prevent neurodegenerative disorders, such as Drosophila Sniffer and human HSD10, oxidize cardiolipin with similar kinetic parameters. HSD10 exhibits a strong preference for cardiolipin with oxidized fatty acids. This activity is inhibited in the presence of the amyloid β peptide. Three HSD10 variants associated with neurodegenerative disorders are inactive with cardiolipin. We suggest that HSD10 protects humans from reactive oxygen species by removing damaged cardiolipin before it induces apoptosis. PMID:26338420

The Local Fair Exhibit--Still A Valuable Public Relations Tool

ERIC Educational Resources Information Center

Smith, Roswell H., Jr.

1977-01-01

Agricultural exhibits at fairs inform the public about the activities of vocational agriculture programs and Future Farmers of America chapters and are important in gaining public support for vocational agriculture. This article describes some elements involved in a fair exhibit: the exhibit committee, the exhibit design, and the use of color and…

Progranulin haploinsufficiency causes biphasic social dominance abnormalities in the tube test.

PubMed

Arrant, A E; Filiano, A J; Warmus, B A; Hall, A M; Roberson, E D

2016-07-01

Loss-of-function mutations in progranulin (GRN) are a major autosomal dominant cause of frontotemporal dementia (FTD), a neurodegenerative disorder in which social behavior is disrupted. Progranulin-insufficient mice, both Grn(+/-) and Grn(-/-) , are used as models of FTD due to GRN mutations, with Grn(+/-) mice mimicking the progranulin haploinsufficiency of FTD patients with GRN mutations. Grn(+/-) mice have increased social dominance in the tube test at 6 months of age, although this phenotype has not been reported in Grn(-/-) mice. In this study, we investigated how the tube test phenotype of progranulin-insufficient mice changes with age, determined its robustness under several testing conditions, and explored the associated cellular mechanisms. We observed biphasic social dominance abnormalities in Grn(+/-) mice: at 6-8 months, Grn(+/-) mice were more dominant than wild-type littermates, while after 9 months of age, Grn(+/-) mice were less dominant. In contrast, Grn(-/-) mice did not exhibit abnormal social dominance, suggesting that progranulin haploinsufficiency has distinct effects from complete progranulin deficiency. The biphasic tube test phenotype of Grn(+/-) mice was associated with abnormal cellular signaling and neuronal morphology in the amygdala and prefrontal cortex. At 6-9 months, Grn(+/-) mice exhibited increased mTORC2/Akt signaling in the amygdala and enhanced dendritic arbors in the basomedial amygdala, and at 9-16 months Grn(+/-) mice exhibited diminished basal dendritic arbors in the prelimbic cortex. These data show a progressive change in tube test dominance in Grn(+/-) mice and highlight potential underlying mechanisms by which progranulin insufficiency may disrupt social behavior. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

Art exhibit focuses on African astronomy

NASA Astrophysics Data System (ADS)

Showstack, Randy

2012-07-01

Connections between Africans and astronomy are the focus of a new exhibition in the National Museum of African Art in Washington, D. C. "African Cosmos: Stellar Arts," which includes artwork, cultural items, and scientific displays from ancient to contemporary times, is the first major exhibit "that brings together arts and science focused on Africa's contribution to keen observations of the heavens over time," curator Christine Mullen Kreamer said at a 20 June news briefing. Among the exhibit's nearly 100 objects are an ancient Egyptian mummy board that includes a representation of the sky goddess Nut, sculptures by the Dogon people of Mali depicting figures in relation to the cosmos, a video that uses data from two square degrees of the Hubble Space Telescope Cosmic Evolution Survey, and a nearly floor-to-ceiling "Rainbow Serpent" constructed of plastic containers by Benin artist Hazoume. An untitled acrylic painting (Figure 1) by South African Gavin Jantjes evokes a myth of the Khoi San people of southern Africa, as it portrays a girl throwing evening fire embers into the night sky, where they remained as the Milky Way.

Unlocking Resources: Self-Guided Student Explorations of Science Museum and Aquarium Exhibits

NASA Astrophysics Data System (ADS)

Kirkby, K. C.; Phipps, M.; Hamilton, P.

2010-12-01

Remarkably few undergraduate programs take full advantage of the rich resources provided by science museums, aquariums and other informal science education institutions. This is not surprising considering the logistical hurdles of class trips, but an even more fundamental barrier is that these institutions’ exhibit text seldom explicitly convey their information at a level suitable for undergraduate curriculum. Traditionally, this left the burden of interpretation on individual instructors, who rarely have the time to undertake it. To overcome these hurdles, the University of Minnesota has partnered with the Science Museum of Minnesota and Underwater Adventures Aquarium to test the efficacy of self-guided student explorations in revealing the rich data encoded in museum and aquarium exhibits. An initial module at the Science Museum of Minnesota focused on interpreting animal designs, specifically exploring how differences in dinosaur skeletal features reflected variations in the animals’ lifestyles. Students learn to interpret diet and lifestyle not only from characteristics of the skull and teeth, but also from variations in vertebrae and rib design or the relative proportion of limb elements. A follow-up module, based on exhibits at Underwater Adventures Aquarium focuses on interpreting energy flow through ecosystems from the behavior of living organisms. Students explore the information on lifestyle and diet that is encoded in a sturgeon’s ceaseless glide or a muskellunge’s poised stillness. These modules proved to be immensely popular with students. In classes with up to 500 students, half to two-thirds of the students volunteered to complete the modules, despite the additional expense and distances of up to 13 miles between the University and partner institutions. More importantly, quantitative assessment with pre-instruction and post-instruction surveys demonstrate that these ungraded, self-guided explorations match or exceed the efficacy of

7 CFR Exhibit C to Subpart C of... - Checklist of Visual Exhibits and Documentation for RRH, RCH, and LH Proposals

Code of Federal Regulations, 2010 CFR

2010-01-01

... RRH, RCH, and LH Proposals C Exhibit C to Subpart C of Part 1924 Agriculture Regulations of the... REPAIR Planning and Performing Site Development Work Pt. 1924, Subpt. C, Exh. C Exhibit C to Subpart C of... the required information will be sufficient. C. Property Survey Map. A current survey map of the...

Social and Behavioral Characteristics of Chinese Only Children and Its Research Concern.

ERIC Educational Resources Information Center

Chen, Jie-Qi; Goldsmith, Lynn T.

This study reviews the literature on the social and behavioral characteristics of only children in China. Of 16 studies that reported differences in the characteristics of only and non-only children, only 2 indicated that only children exhibited more socially desirable behaviors than did non-only children. The remaining studies reported that,…

Science Museum Exhibits' Summative Evaluation with Knowledge Hierarchy Method

ERIC Educational Resources Information Center

Yasar, Erkan; Gurel, Cem

2016-01-01

It is aimed in this research to measure via knowledge hierarchy the things regarding exhibit themes learned by the visitors of the exhibits and compare them with the purpose that the exhibits are designed for, thereby realizing a summative evaluation of the exhibits by knowledge hierarchy method. The research has been conducted in a children's…

Alcohol use and policy formation: an evolving social problem.

PubMed

Levine, Amir

2012-01-01

This article explores the evolutionary course that the social problem of alcohol use has taken in the United States since the Colonial Era. This article utilizes a range of theoretical models to analyze the evolving nature of alcohol use from an unrecognized to a perceived social problem. The models used include critical constructionism (Heiner, 2002), top-down policy model (Dye, 2001) and Mauss'(1975) understanding of social problems and movements. These theoretical constructs exhibit the relative nature of alcohol use as a social problem in regards to a specific time, place, and social context as well as the powerful and influential role that social elites have in defining alcohol asa social problem. Studies regarding the development of alcohol policy formation are discussed to illuminate the different powers, constituents, and factors that play a role in alcohol policy formation.Finally, implications for future study are discussed [corrected].

18 CFR 157.14 - Exhibits.

Code of Federal Regulations, 2013 CFR

2013-04-01

...) Exhibit G—Flow diagrams showing daily design capacity and reflecting operation with and without proposed facilities added. A flow diagram showing daily design capacity and reflecting operating conditions with only existing facilities in operation. A second flow diagram showing daily design capacity and reflecting...

18 CFR 157.14 - Exhibits.

Code of Federal Regulations, 2012 CFR

2012-04-01

...) Exhibit G—Flow diagrams showing daily design capacity and reflecting operation with and without proposed facilities added. A flow diagram showing daily design capacity and reflecting operating conditions with only existing facilities in operation. A second flow diagram showing daily design capacity and reflecting...

18 CFR 157.14 - Exhibits.

Code of Federal Regulations, 2010 CFR

2010-04-01

...) Exhibit G—Flow diagrams showing daily design capacity and reflecting operation with and without proposed facilities added. A flow diagram showing daily design capacity and reflecting operating conditions with only existing facilities in operation. A second flow diagram showing daily design capacity and reflecting...

18 CFR 157.14 - Exhibits.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) Exhibit G—Flow diagrams showing daily design capacity and reflecting operation with and without proposed facilities added. A flow diagram showing daily design capacity and reflecting operating conditions with only existing facilities in operation. A second flow diagram showing daily design capacity and reflecting...

18 CFR 157.14 - Exhibits.

Code of Federal Regulations, 2014 CFR

2014-04-01

...) Exhibit G—Flow diagrams showing daily design capacity and reflecting operation with and without proposed facilities added. A flow diagram showing daily design capacity and reflecting operating conditions with only existing facilities in operation. A second flow diagram showing daily design capacity and reflecting...

Social reasoning abilities in preterm and full-term children aged 5-7years.

PubMed

Lejeune, Fleur; Réveillon, Morgane; Monnier, Maryline; Hüppi, Petra S; Borradori Tolsa, Cristina; Barisnikov, Koviljka

2016-12-01

Literature has evidenced behavioral and socio-emotional problems in preterm children, as well as long-term difficulties to establish and maintain social relationships in preterm population. Several studies have shown relations between behavior and social reasoning abilities in typically developing children and adults. The present study aimed to investigate the social understanding and social reasoning abilities in preterm children aged between 5 and 7years in comparison to their full-term peers. A social resolution task (SRT) was used to assess abilities to judge, identify and reason about others' behavior in relation to conventional and moral rules knowledge. 102 preterm children and 88 full-term children were included in the study. Compared with their full-term peers, preterm children exhibited difficulties to understand and reason about inappropriate social behavior, particularly for situations related to the transgression of conventional rules. They used more irrelevant information and exhibited less social awareness when reasoning about the transgression of social rules. The only significant predictor for global SRT and social reasoning scores was the mental processing composite of the K-ABC, but the part of the variance of the SRT that could be explained by the general cognitive abilities was relatively small. Preterm children demonstrated poorer social knowledge and social reasoning abilities compared with full-term children at early school age. Improving such abilities may reduce behavioral difficulties and peer relationship problems often described in the preterm population. These findings emphasize the need to early identify children at risk for impaired social development. Copyright © 2016. Published by Elsevier Ireland Ltd.

The appeal of the devil's eye: social evaluation affects social attention.

PubMed

Carraro, Luciana; Dalmaso, Mario; Castelli, Luigi; Galfano, Giovanni; Bobbio, Andrea; Mantovani, Gabriele

2017-02-01

Humans typically exhibit a tendency to follow the gaze of conspecifics, a social attention behaviour known as gaze cueing. Here, we addressed whether episodically learned social knowledge about the behaviours performed by the individual bearing the gaze can influence this phenomenon. In a learning phase, different faces were systematically associated with either positive or negative behaviours. The same faces were then used as stimuli in a gaze-cueing task. The results showed that faces associated with antisocial norm-violating behaviours triggered stronger gaze-cueing effects as compared to faces associated with sociable behaviours. Importantly, this was especially evident for participants who perceived the presented norm-violating behaviours as far more negative as compared to positive behaviours. These findings suggest that reflexive attentional responses can be affected by our appraisal of the valence of the behaviours of individuals around us.

An Astrobiology Microbes Exhibit and Education Module

NASA Technical Reports Server (NTRS)

Lindstrom, Marilyn M.; Allen, Jaclyn S.; Stocco, Karen; Tobola, Kay; Olendzenski, Lorraine

2001-01-01

Telling the story of NASA-sponsored scientific research to the public in exhibits is best done by partnerships of scientists and museum professionals. Likewise, preparing classroom activities and training teachers to use them should be done by teams of teachers and scientists. Here we describe how we used such partnerships to develop a new astrobiology augmentation to the Microbes! traveling exhibit and a companion education module. "Additional information is contained in the original extended abstract."

International Space Station exhibit

NASA Technical Reports Server (NTRS)

2000-01-01

The International Space Station (ISS) exhibit in StenniSphere at John C. Stennis Space Center in Hancock County, Miss., gives visitors an up-close look at the largest international peacetime project in history. Step inside a module of the ISS and glimpse how astronauts will live and work in space. Currently, 16 countries contribute resources and hardware to the ISS. When complete, the orbiting research facility will be larger than a football field.

Ecological Networks and Neighborhood Social Organization1

PubMed Central

Browning, Christopher R.; Calder, Catherine A.; Soller, Brian; Jackson, Aubrey L.; Dirlam, Jonathan

2017-01-01

Drawing on the social disorganization tradition and the social ecological perspective of Jane Jacobs, the authors hypothesize that neighborhoods composed of residents who intersect in space more frequently as a result of routine activities will exhibit higher levels of collective efficacy, intergenerational closure, and social network interaction and exchange. They develop this approach employing the concept of ecological networks—two-mode networks that indirectly link residents through spatial overlap in routine activities. Using data from the Los Angeles Family and Neighborhood Survey, they find evidence that econetwork extensity (the average proportion of households in the neighborhood to which a given household is tied through any location) and intensity (the degree to which household dyads are characterized by ties through multiple locations) are positively related to changes in social organization between 2000–2001 and 2006–2008. These findings demonstrate the relevance of econetwork characteristics—heretofore neglected in research on urban neighborhoods—for consequential dimensions of neighborhood social organization. PMID:29379218

A working model for the assessment of disruptions in social behavior among aged rats: the role of sex differences, social recognition, and sensorimotor processes

PubMed Central

Perkins, Amy E.; Doremus-Fitzwater, Tamara L.; Spencer, Robert L.; Varlinskaya, Elena I.; Conti, Melissa M.; Bishop, Chris; Deak, Terrence

2016-01-01

Aging results in a natural decline in social behavior, yet little is known about the processes underlying these changes. Engaging in positive social interaction is associated with many health benefits, including reduced stress reactivity, and may serve as a potential buffer against adverse consequences of aging. The goal of these studies was to establish a tractable model for the assessment of social behavior deficits associated with late aging. Thus, in Exp. 1, 1.5-, 3-, and 18-month-old male Fischer 344 (F344) rats were assessed for object investigation, and social interaction with a same-aged partner (novel/familiar), or a different-aged partner, thereby establishing working parameters for studies that followed. Results revealed that 18-month-old males exhibited reductions in social investigation and social contact behavior, with this age-related decline not influenced by familiarity or age of the social partner. Subsequently, Exp. 2 extended assessment of social behavior to both male and female F344 rats at multiple ages (3, 9, 18, and 24 months), after which a series of sensorimotor performance tests were conducted. In this study, both males and females exhibited late aging-related reductions in social interactions, but these changes were more pronounced in females. Additionally, sensorimotor performance was shown to be impaired in 24-month-olds, but not 18-month-olds, with this deficit more evident in males. Finally, Exp. 3 examined whether aging-related inflammation could account for declines in social behavior during late aging by administering naproxen (0, 7, 14, and 28 mg/kg; s.c.)—a non-steroidal anti-inflammatory drug—to 18-month-old females. Results from this study revealed that social behavior was unaffected by acute or repeated (6 days) naproxen, suggesting that aging-related social deficits in females may not be a consequence of a general aging-related inflammation and/or malaise. Together, these findings demonstrate that aging-related declines

A working model for the assessment of disruptions in social behavior among aged rats: The role of sex differences, social recognition, and sensorimotor processes.

PubMed

Perkins, Amy E; Doremus-Fitzwater, Tamara L; Spencer, Robert L; Varlinskaya, Elena I; Conti, Melissa M; Bishop, Christopher; Deak, Terrence

2016-04-01

Aging results in a natural decline in social behavior, yet little is known about the processes underlying these changes. Engaging in positive social interaction is associated with many health benefits, including reduced stress reactivity, and may serve as a potential buffer against adverse consequences of aging. The goal of these studies was to establish a tractable model for the assessment of social behavior deficits associated with late aging. Thus, in Exp. 1, 1.5-, 3-, and 18-month-old male Fischer 344 (F344) rats were assessed for object investigation, and social interaction with a same-aged partner (novel/familiar), or a different-aged partner, thereby establishing working parameters for studies that followed. Results revealed that 18-month-old males exhibited reductions in social investigation and social contact behavior, with this age-related decline not influenced by familiarity or age of the social partner. Subsequently, Exp. 2 extended assessment of social behavior to both male and female F344 rats at multiple ages (3, 9, 18, and 24 months), after which a series of sensorimotor performance tests were conducted. In this study, both males and females exhibited late aging-related reductions in social interactions, but these changes were more pronounced in females. Additionally, sensorimotor performance was shown to be impaired in 24-month-olds, but not 18-month-olds, with this deficit more evident in males. Finally, Exp. 3 examined whether aging-related inflammation could account for declines in social behavior during late aging by administering naproxen (0, 7, 14, and 28 mg/kg; s.c.)-a non-steroidal anti-inflammatory drug-to 18-month-old females. Results from this study revealed that social behavior was unaffected by acute or repeated (6 days) naproxen, suggesting that aging-related social deficits in females may not be a consequence of a general aging-related inflammation and/or malaise. Together, these findings demonstrate that aging-related declines in

Molecular monitoring of the microbial dynamics occurring on historical limestone buildings during and after the in situ application of different bio-consolidation treatments

PubMed Central

Ettenauer, Jörg; Piñar, Guadalupe; Sterflinger, Katja; Gonzalez-Muñoz, Maria Teresa; Jroundi, Fadwa

2011-01-01

Microbially Induced Carbonate Precipitation is proposed as an environmentally friendly method to protect decayed ornamental stone and introduced in the field of preservation of Cultural Heritage. Recent conservation studies performed under laboratory conditions on non-sterile calcarenite stones have successfully reported on the application of a suitable nutritional solution, inoculated and non-inoculated with Myxococcus xanthus, as a bioconsolidation treatment. Furthermore, this procedure has been applied in situ, very recently, to selected historical buildings in Granada, Spain. For the first time, we evaluate the efficiency and risks of the in situ application of the above mentioned treatments onto two historical buildings in Granada. The evaluation consists of a detailed investigation of the micro-biota actively growing during the seven days of the treatments – short-term monitoring and of that remaining on the stones after six and twelve months of the application – long-term monitoring. A molecular strategy, including DNA extraction, PCR amplification of 16S rRNA sequences, construction of clone libraries and fingerprinting by DGGE (Denaturing Gradient Gel Electrophoresis) analysis followed by sequencing was used to gain insight into the microbial diversity present on the differentially treated stones. The monitoring of M. xanthus was performed by PCR using species-specific primers. Similar dynamics were triggered on both buildings by the application of the nutritional solution (inoculated or non-inoculated). 16S rDNA sequencing revealed the dominant occurrence of members belonging to the Firmicutes and Proteobacteria during the seven days of the treatment, whereas after one year the order Bacillales of the phylum Firmicutes was the predominantly detected microorganisms. M. xanthus could be detected only during the seven days of the treatment. The treatments seem to activate no dangerous microorganisms and furthermore, to select the remainder of a

Ecotoxicological risks of calcium nitrate exposure to freshwater tropical organisms: Laboratory and field experiments.

PubMed

Sueitt, A P E; Yamada-Ferraz, T M; Oliveira, A F; Botta, C M R; Fadini, P S; Nascimento, M R L; Faria, B M; Mozeto, A A

2015-07-01

This study aimed to analyze laboratory and field data to assess the ecotoxicological risks of calcium nitrate exposure to freshwater tropical biota. Short-term laboratorial tests resulted in estimated EC₅₀ values of 76.72 (67.32-86.12)mg N-NO₃₋ L(-1) for C. silvestrii and 296.46 (277.16-315.76) mg N-NO₃₋ L(-1) for C. xanthus. Long-term laboratorial tests generated IC₂₅ values of 5.05 (4.35-5.75) and 28.73 (26.30-31.15) mg N-NO₃₋ L(-1) for C. silvestrii and C. xanthus, respectively. The results from in situ mesocosm experiments performed in the Ibirité reservoir (a tropical eutrophic urban water body located in SE Brazil) indicated that C. silvestrii and C. xanthus were not under severe deleterious acute impact due to the treatment because the higher nitrate concentrations determined were 5.2 mg N-NO₃₋ L(-1) (t=24 h; sediment-water interface) and 17.5 mg N-NO₃₋ L(-1) (t=600 h; interstitial water). However, an abrupt decrease in the densities of Cyanophyceae members and other benthic taxa was observed. In summary, the present work contributes greatly to the toxicity data linked to two taxonomically distinct organisms that have never been screened for calcium nitrate sensitivity. Furthermore, considering the problem of the management and restoration of eutrophic environments, our study reports a comprehensive field assessment that allows the elucidation of the possible toxic impacts caused by the addition of calcium nitrate (a remediation technique) on aquatic and benthic organisms as well as the implications on the aquatic ecosystem as a whole, which may greatly allow expanding the current knowledgebase on the topic. Copyright © 2015 Elsevier Inc. All rights reserved.

Bacterial Polymertropism, the Response to Strain-Induced Alignment of Polymers

NASA Astrophysics Data System (ADS)

Lemon, David J.

In nature, bacteria often live in surface-associated communities known as biofilms. Biofilm-forming bacteria deposit a layer of polysaccharide on the surfaces they inhabit; hence, polysaccharide is their immediate environment on any surface. In this study, we examined how the physical characteristics of polysaccharide substrates influence the behavior of the biofilm-forming bacterium Myxococcus xanthus. M. xanthus colonies, and indeed those of the majority of biofilm-forming species tested, respond to the compression-induced deformation of polysaccharide substrates by preferentially spreading across the surface perpendicular to the axis of compression. This response is conserved across multiple distantly related phyla and is found in species with an array of distinct motility apparatuses.The birefringence and small angle X-ray scattering patterns of compressed polysaccharide substrates indicate that the directed surface movements of these bacteria consistently match the orientation of the long axes of aligned and tightly packed polysaccharide fibers in compressed substrates. Therefore, we refer to this behavior as polymertropism to denote that the directed movements are a response to the physical arrangement of the change in packing and alignment of the polymers in the substrate. In addition to altering the colony morphology we find the behavior of groups of cells, called flares, is also affected in several species resulting in increased flare speed, duration, and displacement on compressed gel substrates.We suggest that polymertropism, which requires a downward-facing motility apparatus in M. xanthus, may be responsible for the observed tendency of bacterial cells to follow trails of extruded and presumably aligned polysaccharides, which their neighbors secrete and deposit on the substrate as they move across it. Polymertropism may also play a role in the organization of bacteria in a biofilm, as the iterative process of polysaccharide trail deposition and

Bringing Planetary Science to the Public through Traveling Exhibitions

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.

2001-11-01

The Space Science Institute (SSI) of Boulder, Colorado has recently developed two museum exhibits called the Space Weather Center and MarsQuest. It is currently planning to develop another exhibit called Gas Giants. These exhibitions provide research scientists the opportunity to engage in a number of activities that are vital to the success of these major outreach programs. The Space Weather Center was developed in partnership with various research missions at NASA's Goddard Space Flight Center. The focus of the presentation will be on MarsQuest and Gas Giants. MarsQuest is a 5000 square-foot, 3M, traveling exhibition that is now touring the country. The exhibit's 3-year tour will enable millions of Americans to share in the excitement of the scientific exploration of Mars and learn more about their own planet in the process. The associated planetarium show and education program will also be described, with particular emphasis on workshops to orient museum staff (e.g. museum educators and docents) and workshops for master educators near host museums and science centers. The workshops make innovative connections between the exhibitions interactive experiences and lesson plans aligned with the National Science Education Standards. These exhibit programs are good models for actively involving scientists and their discoveries to help improve informal science education in the museum community and for forging a stronger connection between formal and informal education. The presentation will also discuss how Gas Giants, a proposed 4000 square-foot traveling exhibition on the mysteries and discoveries of the outer planets, will be able to take advantage of the connections and resources that have been developed by the MarsQuest project.

Leverage Between the Buffering Effect and the Bystander Effect in Social Networking.

PubMed

Chiu, Yu-Ping; Chang, Shu-Chen

2015-08-01

This study examined encouraged and inhibited social feedback behaviors based on the theories of the buffering effect and the bystander effect. A system program was used to collect personal data and social feedback from a Facebook data set to test the research model. The results revealed that the buffering effect induced a positive relationship between social network size and feedback gained from friends when people's social network size was under a certain cognitive constraint. For people with a social network size that exceeds this cognitive constraint, the bystander effect may occur, in which having more friends may inhibit social feedback. In this study, two social psychological theories were applied to explain social feedback behavior on Facebook, and it was determined that social network size and social feedback exhibited no consistent linear relationship.

Social motor coordination during adult-child interactions.

PubMed

Pfeiffer, Rita; Wallace, Mark; Lense, Miriam

2018-05-04

Social motor coordination (SMC) pertains to the timing of contingent movements during social interactions and is of high relevance for successful social and musical interactions. Semi-automated, objective methods are increasingly being used to analyze SMC, though it is unclear if these methods are feasible in naturalistic settings with young children. The purpose of the current preliminary study was to explore SMC in adult-child dyads during semi-structured social interactions. Thirteen dyads (mean age of children = 36 months) participated in a predictable turn-taking task from a social communication assessment, and a semi-automated frame-difference approach was used to capture movement activity. Relative timing and activity approaches revealed that, while there is some evidence of co-occurring movement, the dyad predominantly exhibited patterns of responsive movement activity (e.g., turn taking or alternating movement) consistent with the activity's structure. Future work may extend these approaches to social musical interactions in order to examine movement coordination and prosocial behavior during joint music-making activities with young children. © 2018 New York Academy of Sciences.

Volunteerism: Social Network Dynamics and Education

PubMed Central

Ajrouch, Kristine J.; Antonucci, Toni C.; Webster, Noah J.

2016-01-01

Objectives . We examine how changes in social networks influence volunteerism through bridging (diversity) and bonding (spending time) mechanisms. We further investigate whether social network change substitutes or amplifies the effects of education on volunteerism. Methods . Data (n = 543) are drawn from a two-wave survey of Social Relations and Health over the Life Course (SRHLC). Zero-inflated negative binomial regressions were conducted to test competing hypotheses about how changes in social network characteristics alone and in conjunction with education level predict likelihood and frequency of volunteering. Results . Changes in social networks were associated with volunteerism: as the proportion of family members decreased and the average number of network members living within a one-hour drive increased over time, participants reported higher odds of volunteering. The substitution hypothesis was supported: social networks that exhibited more geographic proximity and greater contact frequency over-time compensated for lower levels of education to predict volunteering more hours. Discussion . The dynamic role of social networks and the ways in which they may work through bridging and bonding to influence both likelihood and frequency of volunteering are discussed. The potential benefits of volunteerism in light of longer life expectancies and smaller families are also considered. PMID:25512570

A Content-Oriented Model for Science Exhibit Engineering

ERIC Educational Resources Information Center

Achiam, Marianne Foss

2013-01-01

Recently, science museums have begun to review their educational purposes and redesign their pedagogies. At the most basic level, this entails accounting for the performance of individual exhibits, and indeed, in some cases, research indicates shortcomings in exhibit design: While often successful in prompting visitors to carry out intended…

Using Museum Exhibits: An Innovation in Experiential Learning

ERIC Educational Resources Information Center

Das, Satarupa

2015-01-01

Museum exhibits can be a tool in experiential learning. While instructors have documented various methods of experiential learning, they have not sufficiently explored such learning from museum exhibits. Museum researchers, however, have long found a satisfying cognitive component to museum visits. This paper narrates the author's design to…

A social network analysis of social cohesion in a constructed pride: implications for ex situ reintroduction of the African lion (Panthera leo).

PubMed

Abell, Jackie; Kirzinger, Morgan W B; Gordon, Yvonne; Kirk, Jacqui; Kokeŝ, Rae; Lynas, Kirsty; Mandinyenya, Bob; Youldon, David

2013-01-01

Animal conservation practices include the grouping of captive related and unrelated individuals to form a social structure which is characteristic of that species in the wild. In response to the rapid decline of wild African lion (Panthera leo) populations, an array of conservational strategies have been adopted. Ex situ reintroduction of the African lion requires the construction of socially cohesive pride structures prior to wild release. This pilot study adopted a social network theory approach to quantitatively assess a captive pride's social structure and the relationships between individuals within them. Group composition (who is present in a group) and social interaction data (social licking, greeting, play) was observed and recorded to assess social cohesion within a released semi-wild pride. UCINET and SOCPROG software was utilised to represent and analyse these social networks. Results indicate that the pride is socially cohesive, does not exhibit random associations, and the role of socially influential keystone individuals is important for maintaining social bondedness within a lion pride. These results are potentially informative for the structure of lion prides, in captivity and in the wild, and could have implications for captive and wild-founder reintroductions.

A Social Network Analysis of Social Cohesion in a Constructed Pride: Implications for Ex Situ Reintroduction of the African Lion (Panthera leo)

PubMed Central

Abell, Jackie; Kirzinger, Morgan W. B.; Gordon, Yvonne; Kirk, Jacqui; Kokeŝ, Rae; Lynas, Kirsty; Mandinyenya, Bob; Youldon, David

2013-01-01

Animal conservation practices include the grouping of captive related and unrelated individuals to form a social structure which is characteristic of that species in the wild. In response to the rapid decline of wild African lion (Panthera leo) populations, an array of conservational strategies have been adopted. Ex situ reintroduction of the African lion requires the construction of socially cohesive pride structures prior to wild release. This pilot study adopted a social network theory approach to quantitatively assess a captive pride’s social structure and the relationships between individuals within them. Group composition (who is present in a group) and social interaction data (social licking, greeting, play) was observed and recorded to assess social cohesion within a released semi-wild pride. UCINET and SOCPROG software was utilised to represent and analyse these social networks. Results indicate that the pride is socially cohesive, does not exhibit random associations, and the role of socially influential keystone individuals is important for maintaining social bondedness within a lion pride. These results are potentially informative for the structure of lion prides, in captivity and in the wild, and could have implications for captive and wild-founder reintroductions. PMID:24376544

Pattern of brain activation during social cognitive tasks is related to social competence in siblings discordant for schizophrenia.

PubMed

Villarreal, Mirta F; Drucaroff, Lucas J; Goldschmidt, Micaela G; de Achával, Delfina; Costanzo, Elsa Y; Castro, Mariana N; Ladrón-de-Guevara, M Soledad; Busatto Filho, Geraldo; Nemeroff, Charles B; Guinjoan, Salvador M

2014-09-01

Measures of social competence are closely related to actual community functioning in patients with schizophrenia. However, the neurobiological mechanisms underlying competence in schizophrenia are not fully understood. We hypothesized that social deficits in schizophrenia are explained, at least in part, by abnormally lateralized patterns of brain activation in response to tasks engaging social cognition, as compared to healthy individuals. We predicted such patterns would be partly heritable, and therefore affected in patients' nonpsychotic siblings as well. We used a functional magnetic resonance image paradigm to characterize brain activation induced by theory of mind tasks, and two tests of social competence, the Test of Adaptive Behavior in Schizophrenia (TABS), and the Social Skills Performance Assessment (SSPA) in siblings discordant for schizophrenia and comparable healthy controls (n = 14 per group). Healthy individuals showed the strongest correlation between social competence and activation of right hemisphere structures involved in social cognitive processing, whereas in patients, the correlation pattern was lateralized to left hemisphere areas. Unaffected siblings of patients exhibited a pattern intermediate between the other groups. These results support the hypothesis that schizophrenia may be characterized by an abnormal functioning of nondominant hemisphere structures involved in the processing of socially salient information. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Development of Validated Museum Exhibits. Final Report.

ERIC Educational Resources Information Center

Nicol, Elizabeth H.

Exhibit development, as conceived in this report, is an evolutionary process, drawing the museum visitor into the collaborative venture of testing and improving the exhibits. The findings of contemporary learning research were put to work in the arrangement of activities and specimens that engaged children through self-instructional sequences. The…

Autonomous Learning from a Social Cognitive Perspective

ERIC Educational Resources Information Center

Ponton, Michael K.; Rhea, Nancy E.

2006-01-01

The current perspective of autonomous learning defines it as the agentive exhibition of resourcefulness, initiative, and persistence in self-directed learning. As a form of human agency, it has been argued in the literature that this perspective should be consistent with Bandura's (1986) Social Cognitive Theory (SCT). The purpose of this article…

Interpersonal subtypes in social phobia: diagnostic and treatment implications.

PubMed

Cain, Nicole M; Pincus, Aaron L; Grosse Holtforth, Martin

2010-11-01

Interpersonal assessment may provide a clinically useful way to identify subtypes of social phobia. In this study, we examined evidence for interpersonal subtypes in a sample of 77 socially phobic outpatients. A cluster analysis based on the dimensions of dominance and love on the Inventory of Interpersonal Problems-Circumplex Scales (Alden, Wiggins, & Pincus, 1990) found 2 interpersonal subtypes of socially phobic patients. These subtypes did not differ on pretreatment global symptom severity as measured by the Brief Symptom Inventory (Derogatis, 1993) or diagnostic comorbidity but did exhibit differential responses to outpatient psychotherapy. Overall, friendly-submissive social phobia patients had significantly lower scores on measures of social anxiety and significantly higher scores on measures of well-being and satisfaction at posttreatment than cold-submissive social phobia patients. We discuss the results in terms of interpersonal theory and the clinical relevance of assessment of interpersonal functioning prior to beginning psychotherapy with socially phobic patients.

A Critical Appraisal of State Level Science Exhibition

ERIC Educational Resources Information Center

Nath, Baiju K.

2007-01-01

Science exhibitions are really great opportunities to students as well as teachers to disseminate knowledge that they have, and to experience a variety of new inventions and innovations that also need wide dissemination. The great significance of exhibition is that it fosters acquisition of different process skills leading to the development of…

Ecological and social correlates of chimpanzee tool use.

PubMed

Sanz, Crickette M; Morgan, David B

2013-11-19

The emergence of technology has been suggested to coincide with scarcity of staple resources that led to innovations in the form of tool-assisted strategies to diversify or augment typical diets. We examined seasonal patterns of several types of tool use exhibited by a chimpanzee (Pan troglodytes) population residing in central Africa, to determine whether their technical skills provided access to fallback resources when preferred food items were scarce. Chimpanzees in the Goualougo Triangle exhibit a diverse repertoire of tool behaviours, many of which are exhibited throughout the year. Further, they have developed specific tool sets to overcome the issues of accessibility to particular food items. Our conclusion is that these chimpanzees use a sophisticated tool technology to cope with seasonal changes in relative food abundance and gain access to high-quality foods. Subgroup sizes were smaller in tool using contexts than other foraging contexts, suggesting that the size of the social group may not be as important in promoting complex tool traditions as the frequency and type of social interactions. Further, reports from other populations and species showed that tool use may occur more often in response to ecological opportunities and relative profitability of foraging techniques than scarcity of resources.

Ecological and social correlates of chimpanzee tool use

PubMed Central

Sanz, Crickette M.; Morgan, David B.

2013-01-01

The emergence of technology has been suggested to coincide with scarcity of staple resources that led to innovations in the form of tool-assisted strategies to diversify or augment typical diets. We examined seasonal patterns of several types of tool use exhibited by a chimpanzee (Pan troglodytes) population residing in central Africa, to determine whether their technical skills provided access to fallback resources when preferred food items were scarce. Chimpanzees in the Goualougo Triangle exhibit a diverse repertoire of tool behaviours, many of which are exhibited throughout the year. Further, they have developed specific tool sets to overcome the issues of accessibility to particular food items. Our conclusion is that these chimpanzees use a sophisticated tool technology to cope with seasonal changes in relative food abundance and gain access to high-quality foods. Subgroup sizes were smaller in tool using contexts than other foraging contexts, suggesting that the size of the social group may not be as important in promoting complex tool traditions as the frequency and type of social interactions. Further, reports from other populations and species showed that tool use may occur more often in response to ecological opportunities and relative profitability of foraging techniques than scarcity of resources. PMID:24101626

Organizational Social Effectiveness: An Annotated Bibliography

DTIC Science & Technology

2014-01-01

Results for two new tests . British Journal of Psychology , 101(3), 563-578. Emotional intelligence (EI) has received increasing attention as a...influence. Self-Monitoring Self-monitoring is a concept, related to impression management, that is largely discussed in the social psychology ...was further demonstrated by Phelps , Ramsden Zbylut, and Brunner (2009) in research which examined how the interpersonal skills exhibited by advisors

Gender, social class, and women's employment.

PubMed

McGinn, Kathleen L; Oh, Eunsil

2017-12-01

People in low-power positions, whether due to gender or class, tend to exhibit other-oriented rather than self-oriented behavior. Women's experiences at work and at home are shaped by social class, heightening identification with gender for relatively upper class women and identification with class for relatively lower class women, potentially mitigating, or even reversing, class-based differences documented in past research. Gender-class differences are reflected in women's employment beliefs and behaviors. Research integrating social class with gendered experiences in homes and workplaces deepens our understanding of the complex interplay between sources of power and status in society. Copyright © 2017 Elsevier Ltd. All rights reserved.

Morphine reduces social cohesion in rats.

PubMed

Panksepp, J; Najam, N; Soares, F

1979-08-01

The effect of low (1 mg/kg) doses of morphine on maintenance of physical proximity were evaluated in paired rats observed in a 4 square foot test arena. Morphine reliably reduced proximity maintenance time, and this was apparently not due to sedation, since the effect was unmodified by doses of amphetamine which substantially increased motor activity. The effects of naloxone were inconsistent on this measure of social motivation. In general, the results are consistent with the theoretical proposition that a brain neurochemical change which might lead to social attraction is the activation of endogenous opioid systems. When opiate activity is exogenously sustained, animals exhibit a subnormal tendency to be gregarious.

Cooperation prevails when individuals adjust their social ties.

PubMed

Santos, Francisco C; Pacheco, Jorge M; Lenaerts, Tom

2006-10-20

Conventional evolutionary game theory predicts that natural selection favours the selfish and strong even though cooperative interactions thrive at all levels of organization in living systems. Recent investigations demonstrated that a limiting factor for the evolution of cooperative interactions is the way in which they are organized, cooperators becoming evolutionarily competitive whenever individuals are constrained to interact with few others along the edges of networks with low average connectivity. Despite this insight, the conundrum of cooperation remains since recent empirical data shows that real networks exhibit typically high average connectivity and associated single-to-broad-scale heterogeneity. Here, a computational model is constructed in which individuals are able to self-organize both their strategy and their social ties throughout evolution, based exclusively on their self-interest. We show that the entangled evolution of individual strategy and network structure constitutes a key mechanism for the sustainability of cooperation in social networks. For a given average connectivity of the population, there is a critical value for the ratio W between the time scales associated with the evolution of strategy and of structure above which cooperators wipe out defectors. Moreover, the emerging social networks exhibit an overall heterogeneity that accounts very well for the diversity of patterns recently found in acquired data on social networks. Finally, heterogeneity is found to become maximal when W reaches its critical value. These results show that simple topological dynamics reflecting the individual capacity for self-organization of social ties can produce realistic networks of high average connectivity with associated single-to-broad-scale heterogeneity. On the other hand, they show that cooperation cannot evolve as a result of "social viscosity" alone in heterogeneous networks with high average connectivity, requiring the additional mechanism of

The social networks: new challenge or new addiction?

PubMed

Colucci, Annalisa

2016-09-01

The reality of Social networks provides a fascinating and enhancing opportunity to understand the issues and life dynamics of generations of pre-adolescents and adolescents; This study has matured over three years of work in the schools of Campania (southern Italy), observing all the provinces, with a predominance of those of the Neapolitan territory. It has been found that the language of the boys finds its maximal expression in using social media to share, exhibit, and tell their experience of living every day their daily lives, with a high probability of encountering very interesting pitfalls and dangers... because they are "children" of a period when to exhibit themselves is in accordance with current fashion. These dangers and pitfalls are amplified by simply sharing, and sharing this work with professionals has helped to better monitor some contexts and difficulties which have emerged with difficulty and have helped to shed light on more specific and authentic issues regarding this reality.

Improving Social Competence in Children with Autism Spectrum Disorders through a Combined-Strategy Group Intervention: A Pilot Study

ERIC Educational Resources Information Center

Sotelo, Marlene

2009-01-01

This applied dissertation investigated whether a combined-strategy group intervention improved social competence among children with autism spectrum disorders. Individuals with autism spectrum disorders exhibit deficits in social behaviors that may negatively impact all aspects of their lives. Social competence for individuals with autism spectrum…

34 CFR 101.74 - Exhibits.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 34 Education 1 2010-07-01 2010-07-01 false Exhibits. 101.74 Section 101.74 Education Regulations of the Offices of the Department of Education OFFICE FOR CIVIL RIGHTS, DEPARTMENT OF EDUCATION... objection thereto is filed prior to the hearing or unless good cause is shown at the hearing for failure to...

Relationship of follicle size and concentrations of estradiol among cows exhibiting or not exhibiting estrus during a fixed-time AI protocol

USDA-ARS?s Scientific Manuscript database

Cows exhibiting estrus near the time of fixed-time AI had greater pregnancy success than cows showing no estrus. The objective of this study was to determine the relationship between follicle size and peak estradiol concentration between cows that did or did not exhibit estrus during a fixed-time AI...

Perceptions of physical and social environment variables and self-efficacy as correlates of self-reported physical activity among adolescent girls.

PubMed

Motl, Robert W; Dishman, Rod K; Saunders, Ruth P; Dowda, Marsha; Pate, Russell R

2007-01-01

This cross-sectional study examined the direct and indirect effects of perceived equipment accessibility, neighborhood safety, and social support on self-reported physical activity among older adolescent girls. Adolescent girls (n = 1,655) who were in the 12th grade completed a battery of questionnaires that included self-report measures of the perceived physical environment, social support, barriers self-efficacy, and physical activity. Perceived neighborhood safety did not exhibit direct or indirect effects on self-reported physical activity. Perceived equipment accessibility exhibited an indirect effect on self-reported physical activity that was accounted for by barriers self-efficacy. Perceived social support exhibited direct and indirect effects on self-reported physical activity; the indirect effect was accounted for by barriers self-efficacy. The relationships were independent of parental education and body mass index (BMI). Perceived physical environmental factors indirectly influenced self-reported physical activity, and perceived social environmental factors both directly and indirectly influenced self-reported physical activity in this sample of older adolescent girls.

Brain sex differences and the organisation of juvenile social play behaviour.

PubMed

Auger, A P; Olesen, K M

2009-06-01

Juvenile social play behaviour is one of the earliest forms of non-mother directed social behaviour in rodents. Juvenile social play behaviour is sexually dimorphic, with males exhibiting higher levels compared to females, making it a useful model to study both social development and sexual differentiation of the brain. As with most sexually dimorphic behaviour, juvenile play behaviour is organised by neonatal steroid hormone exposure. The developmental organisation of juvenile play behaviour also appears to be influenced by the early maternal environment. This review will focus briefly on why and how rats play, some brain regions controlling play behaviour, and how neurotransmitters and the social environment converge within the developing brain to influence sexual differentiation of juvenile play behaviour.

Fundamental structures of dynamic social networks.

PubMed

Sekara, Vedran; Stopczynski, Arkadiusz; Lehmann, Sune

2016-09-06

Social systems are in a constant state of flux, with dynamics spanning from minute-by-minute changes to patterns present on the timescale of years. Accurate models of social dynamics are important for understanding the spreading of influence or diseases, formation of friendships, and the productivity of teams. Although there has been much progress on understanding complex networks over the past decade, little is known about the regularities governing the microdynamics of social networks. Here, we explore the dynamic social network of a densely-connected population of ∼1,000 individuals and their interactions in the network of real-world person-to-person proximity measured via Bluetooth, as well as their telecommunication networks, online social media contacts, geolocation, and demographic data. These high-resolution data allow us to observe social groups directly, rendering community detection unnecessary. Starting from 5-min time slices, we uncover dynamic social structures expressed on multiple timescales. On the hourly timescale, we find that gatherings are fluid, with members coming and going, but organized via a stable core of individuals. Each core represents a social context. Cores exhibit a pattern of recurring meetings across weeks and months, each with varying degrees of regularity. Taken together, these findings provide a powerful simplification of the social network, where cores represent fundamental structures expressed with strong temporal and spatial regularity. Using this framework, we explore the complex interplay between social and geospatial behavior, documenting how the formation of cores is preceded by coordination behavior in the communication networks and demonstrating that social behavior can be predicted with high precision.

Fundamental structures of dynamic social networks

PubMed Central

Sekara, Vedran; Stopczynski, Arkadiusz; Lehmann, Sune

2016-01-01

Social systems are in a constant state of flux, with dynamics spanning from minute-by-minute changes to patterns present on the timescale of years. Accurate models of social dynamics are important for understanding the spreading of influence or diseases, formation of friendships, and the productivity of teams. Although there has been much progress on understanding complex networks over the past decade, little is known about the regularities governing the microdynamics of social networks. Here, we explore the dynamic social network of a densely-connected population of ∼1,000 individuals and their interactions in the network of real-world person-to-person proximity measured via Bluetooth, as well as their telecommunication networks, online social media contacts, geolocation, and demographic data. These high-resolution data allow us to observe social groups directly, rendering community detection unnecessary. Starting from 5-min time slices, we uncover dynamic social structures expressed on multiple timescales. On the hourly timescale, we find that gatherings are fluid, with members coming and going, but organized via a stable core of individuals. Each core represents a social context. Cores exhibit a pattern of recurring meetings across weeks and months, each with varying degrees of regularity. Taken together, these findings provide a powerful simplification of the social network, where cores represent fundamental structures expressed with strong temporal and spatial regularity. Using this framework, we explore the complex interplay between social and geospatial behavior, documenting how the formation of cores is preceded by coordination behavior in the communication networks and demonstrating that social behavior can be predicted with high precision. PMID:27555584

Sexual function and behavior in social phobia.

PubMed

Bodinger, Liron; Hermesh, Haggai; Aizenberg, Dov; Valevski, Avi; Marom, Sofi; Shiloh, Roni; Gothelf, Doron; Zemishlany, Zvi; Weizman, Abraham

2002-10-01

Social phobia is a type of performance and interpersonal anxiety disorder and as such may be associated with sexual dysfunction and avoidance. The aim of the present study was to evaluate sexual function and behavior in patients with social phobia compared with mentally healthy subjects. Eighty subjects participated in the study: 40 consecutive, drug-free outpatients with social phobia (DSM-IV) attending an anxiety disorders clinic between November 1997 and April 1999 and 40 mentally normal controls. The Structured Clinical Interview for DSM-IV Axis I Disorders and the Liebowitz Social Anxiety Scale were used to quantitatively and qualitatively assess sexual function and behavior. Men with social phobia reported mainly moderate impairment in arousal, orgasm, sexual enjoyment, and subjective satisfaction domains. Women with social phobia reported severe impairment in desire, arousal, sexual activity, and subjective satisfaction. In addition, compared with controls, men with social phobia reported significantly more frequent paid sex (p < .05), and women with social phobia reported a significant paucity of sexual partners (p < .05). Patients with social phobia exhibit a wide range of sexual dysfunctions. Men have mainly performance problems, and women have a more pervasive disorder. Patients of both genders show difficulties in sexual interaction. It is important that clinicians be aware of this aspect of social phobia and initiate open discussions of sexual problems with patients.

Social Computing and the Attention Economy

NASA Astrophysics Data System (ADS)

Huberman, Bernardo A.

2013-04-01

Social computing focuses on the interaction between social behavior and information, especially on how the latter propagates across social networks and is consumed and transformed in the process. At the same time the ubiquity of information has left it devoid of much monetary value. The scarce, and therefore valuable, resource is now attention, and its allocation gives rise to an attention economy that determines how content is consumed and propagated. Since two major factors involved in getting attention are novelty and popularity, we analyze the role that both play in attracting attention to web content and how to prioritize them in order to maximize it. We also demonstrate that the relative performance of strategies based on prioritizing either popularity or novelty exhibit an abrupt change around a critical value of the novelty decay time, resembling a phase transition.

Cognitive, emotional and social markers of serial murdering.

PubMed

Angrilli, Alessandro; Sartori, Giuseppe; Donzella, Giovanna

2013-01-01

Although criminal psychopathy is starting to be relatively well described, our knowledge of the characteristics and scientific markers of serial murdering is still very poor. A serial killer who murdered more than five people, KT, was administered a battery of standardized tests aimed at measuring neuropsychological impairment and social/emotional cognition deficits. KT exhibited a striking dissociation between a high level of emotional detachment and a low score on the antisocial behavior scale on the Psychopathy Checklist-Revised (PCL-R). The Minnesota Multiphasic Personality Inventory-2 showed a normal pattern with the psychotic triad at borderline level. KT had a high intelligence score and showed almost no impairment in cognitive tests sensitive to frontal lobe dysfunction (Wisconsin Card Sorting Test, Theory of Mind, Tower of London, this latter evidenced a mild impairment in planning performance). In the tests on moral, emotional and social cognition, his patterns of response differed from matched controls and from past reports on criminal psychopaths as, unlike these individuals, KT exhibited normal recognition of fear and a relatively intact knowledge of moral rules but he was impaired in the recognition of anger, embarrassment and conventional social rules. The overall picture of KT suggests that serial killing may be closer to normality than psychopathy defined according to either the DSM IV or the PCL-R, and it would be characterized by a relatively spared moral cognition and selective deficits in social and emotional cognition domains.

Neonatal brainstem dysfunction risks infant social engagement

PubMed Central

Sopher, Koreen; Kurtzman, Lea; Galili, Giora; Feldman, Ruth; Kuint, Jacob

2013-01-01

The role of the brainstem in mediating social signaling in phylogenetic ancestral organisms has been demonstrated. Evidence for its involvement in social engagement in human infants may deepen the understanding of the evolutionary pathway of humans as social beings. In this longitudinal study, neonatal brainstem functioning was measured by auditory brainstem-evoked responses (ABRs) in 125 healthy neonates born prematurely before 35 weeks’ gestational age. At 4 months, infants were tested in a set of structured vignettes that required varying levels of social engagement and cardiac vagal tone was assessed. Data show that neonates with a disrupted I–V waveform, evident mostly by delayed wave V, exhibit shorter latencies to gaze averts in episodes involving direct face-to-face interactions but engage gaze as controls when interacting with masked agents or with agents whose faces are partly veiled by toys. Analysis of variance of infants’ social engagement with ABR, neonatal risk, maternal stress and cardiac vagal tone showed a main effect for ABR and an ABR by gestational age interaction. The integrity of brainstem transmission of sensory information during the final weeks of gestation may scaffold the development of social disengagement, thereby attesting to the brainstem's preserved evolutionary role in developing humans as social organisms prior to engaging in social encounters. PMID:22146141

The Effects of Participating in a Multi-Media Social Skills Intervention on the Social Functioning of Three Middle School Students with IEPs

ERIC Educational Resources Information Center

Geiger, Michael Damon, Jr.

2012-01-01

Students with emotional disturbance exhibit difficulty interpreting and responding appropriately to social situations occurring in the community, home, and school. Interactive multimedia instruction has advanced to the degree that it is possible to create learning environments that encourage active problem solving and knowledge construction. This…

External immunity in ant societies: sociality and colony size do not predict investment in antimicrobials

PubMed Central

Halawani, Omar; Pearson, Bria; Mathews, Stephanie; López-Uribe, Margarita M.; Dunn, Robert R.; Smith, Adrian A.

2018-01-01

Social insects live in dense groups with a high probability of disease transmission and have therefore faced strong pressures to develop defences against pathogens. For this reason, social insects have been hypothesized to invest in antimicrobial secretions as a mechanism of external immunity to prevent the spread of disease. However, empirical studies linking the evolution of sociality with increased investment in antimicrobials have been relatively few. Here we quantify the strength of antimicrobial secretions among 20 ant species that cover a broad spectrum of ant diversity and colony sizes. We extracted external compounds from ant workers to test whether they inhibited the growth of the bacterium Staphylococcus epidermidis. Because all ant species are highly social, we predicted that all species would exhibit some antimicrobial activity and that species that form the largest colonies would exhibit the strongest antimicrobial response. Our comparative approach revealed that strong surface antimicrobials are common to particular ant clades, but 40% of species exhibited no antimicrobial activity at all. We also found no correlation between antimicrobial activity and colony size. Rather than relying on antimicrobial secretions as external immunity to control pathogen spread, many ant species have probably developed alternative strategies to defend against disease pressure. PMID:29515850

The Use of Memories in Understanding Interactive Science and Technology Exhibits

NASA Astrophysics Data System (ADS)

Afonso, Ana S.; Gilbert, John K.

2006-10-01

Framed by a “personal constructivist” perspective, this study analyses visitors’ use of spontaneous memories in understanding different types of interactive exhibits, the nature and sources of the retrieved memories, and the way that visitors relate an exhibit analogically to memories of previous exhibits. One hundred and thirteen visitors (either alone or in groups) were observed during their interaction with exhibits and interviewed immediately afterwards. The majority of the retrieved memories were not used in understanding an exhibit; those memories used were mainly semantic and episodic in nature; and exhibits were mainly associated with memories by means of a superficial similarity between them. Suggestions for enhancing the formation of links between visitors’ memories and the understanding of an exhibit intended by the designer of it are made.

The Making of a Museum Exhibition.

ERIC Educational Resources Information Center

Bleecker, Samuel E.

1979-01-01

Discusses the preparation of the Reptile and Amphibian exhibition at the American Museum of Natural History. Various steps involved in developing the ten showcases in a six-year period are presented. (SA)

49 CFR 250.2 - Required exhibits.

Code of Federal Regulations, 2010 CFR

2010-10-01

...; number of units of locomotives, freight cars, and passenger cars owned and leased; principal commodities carried; and identification of the ten most important industries served. (6) As Exhibit 6, statement as to...

49 CFR 250.2 - Required exhibits.

Code of Federal Regulations, 2014 CFR

2014-10-01

...; number of units of locomotives, freight cars, and passenger cars owned and leased; principal commodities carried; and identification of the ten most important industries served. (6) As Exhibit 6, statement as to...

49 CFR 250.2 - Required exhibits.

Code of Federal Regulations, 2012 CFR

2012-10-01

...; number of units of locomotives, freight cars, and passenger cars owned and leased; principal commodities carried; and identification of the ten most important industries served. (6) As Exhibit 6, statement as to...

49 CFR 250.2 - Required exhibits.

Code of Federal Regulations, 2011 CFR

2011-10-01

...; number of units of locomotives, freight cars, and passenger cars owned and leased; principal commodities carried; and identification of the ten most important industries served. (6) As Exhibit 6, statement as to...

49 CFR 250.2 - Required exhibits.

Code of Federal Regulations, 2013 CFR

2013-10-01

...; number of units of locomotives, freight cars, and passenger cars owned and leased; principal commodities carried; and identification of the ten most important industries served. (6) As Exhibit 6, statement as to...

Wanting it Too Much: An Inverse Relation Between Social Motivation and Facial Emotion Recognition in Autism Spectrum Disorder

PubMed Central

Garman, Heather D.; Spaulding, Christine J.; Webb, Sara Jane; Mikami, Amori Yee; Morris, James P.

2016-01-01

This study examined social motivation and early-stage face perception as frameworks for understanding impairments in facial emotion recognition (FER) in a well-characterized sample of youth with autism spectrum disorders (ASD). Early-stage face perception (N170 event-related potential latency) was recorded while participants completed a standardized FER task, while social motivation was obtained via parent report. Participants with greater social motivation exhibited poorer FER, while those with shorter N170 latencies exhibited better FER for child angry faces stimuli. Social motivation partially mediated the relationship between a faster N170 and better FER. These effects were all robust to variations in IQ, age, and ASD severity. These findings augur against theories implicating social motivation as uniformly valuable for individuals with ASD, and augment models suggesting a close link between early-stage face perception, social motivation, and FER in this population. Broader implications for models and development of FER in ASD are discussed. PMID:26743637

Wanting it Too Much: An Inverse Relation Between Social Motivation and Facial Emotion Recognition in Autism Spectrum Disorder.

PubMed

Garman, Heather D; Spaulding, Christine J; Webb, Sara Jane; Mikami, Amori Yee; Morris, James P; Lerner, Matthew D

2016-12-01

This study examined social motivation and early-stage face perception as frameworks for understanding impairments in facial emotion recognition (FER) in a well-characterized sample of youth with autism spectrum disorders (ASD). Early-stage face perception (N170 event-related potential latency) was recorded while participants completed a standardized FER task, while social motivation was obtained via parent report. Participants with greater social motivation exhibited poorer FER, while those with shorter N170 latencies exhibited better FER for child angry faces stimuli. Social motivation partially mediated the relationship between a faster N170 and better FER. These effects were all robust to variations in IQ, age, and ASD severity. These findings augur against theories implicating social motivation as uniformly valuable for individuals with ASD, and augment models suggesting a close link between early-stage face perception, social motivation, and FER in this population. Broader implications for models and development of FER in ASD are discussed.

Physiological State Influences the Social Interactions of Two Honeybee Nest Mates

PubMed Central

Wright, Geraldine A.; Lillvis, Joshua L.; Bray, Helen J.; Mustard, Julie A.

2012-01-01

Physiological state profoundly influences the expression of the behaviour of individuals and can affect social interactions between animals. How physiological state influences food sharing and social behaviour in social insects is poorly understood. Here, we examined the social interactions and food sharing behaviour of honeybees with the aim of developing the honeybee as a model for understanding how an individual's state influences its social interactions. The state of individual honeybees was manipulated by either starving donor bees or feeding them sucrose or low doses of ethanol to examine how a change in hunger or inebriation state affected the social behaviours exhibited by two closely-related nestmates. Using a lab-based assay for measuring individual motor behaviour and social behaviour, we found that behaviours such as antennation, willingness to engage in trophallaxis, and mandible opening were affected by both hunger and ethanol intoxication. Inebriated bees were more likely to exhibit mandible opening, which may represent a form of aggression, than bees fed sucrose alone. However, intoxicated bees were as willing to engage in trophallaxis as the sucrose-fed bees. The effects of ethanol on social behaviors were dose-dependent, with higher doses of ethanol producing larger effects on behaviour. Hungry donor bees, on the other hand, were more likely to engage in begging for food and less likely to antennate and to display mandible opening. We also found that when nestmates received food from donors previously fed ethanol, they began to display evidence of inebriation, indicating that ethanol can be retained in the crop for several hours and that it can be transferred between honeybee nestmates during trophallaxis. PMID:22427864

Social class and prosocial behavior: current evidence, caveats, and questions.

PubMed

Piff, Paul K; Robinson, Angela R

2017-12-01

This review synthesizes research on social class and prosocial behavior. Individuals of lower social class display increased attention to others and greater sensitivity to others' welfare compared to individuals of higher social class, who exhibit more self-oriented patterns of social cognition. As a result, lower-class individuals are more likely to engage in other-beneficial prosocial behavior, whereas higher-class individuals are more prone to engage in self-beneficial behavior. Although the extant evidence indicates that higher social class standing may tend to undermine prosocial impulses, we propose that the effects of social class on prosocial behavior may also depend on three crucial factors: motivation, identity, and inequality. We discuss how and why these factors may moderate class differences in prosociality and offer promising lines of inquiry for future research. Copyright © 2017 Elsevier Ltd. All rights reserved.

36 CFR 1284.20 - Does NARA exhibit privately-owned material?

Code of Federal Regulations, 2011 CFR

2011-07-01

... exhibition cases or other necessary fixtures; and (3) NARA has resources (such as exhibit and security staff) available to produce the special exhibit. (c) The Director of Museum Programs (NWE), in conjunction with the...) The Director of Museum Programs or director of the pertinent Presidential library will inform the...

36 CFR 1284.20 - Does NARA exhibit privately-owned material?

Code of Federal Regulations, 2014 CFR

2014-07-01

... exhibition cases or other necessary fixtures; and (3) NARA has resources (such as exhibit and security staff) available to produce the special exhibit. (c) The Director of Museum Programs (NWE), in conjunction with the...) The Director of Museum Programs or director of the pertinent Presidential library will inform the...

36 CFR 1284.20 - Does NARA exhibit privately-owned material?

Code of Federal Regulations, 2010 CFR

2010-07-01

... exhibition cases or other necessary fixtures; and (3) NARA has resources (such as exhibit and security staff) available to produce the special exhibit. (c) The Director of Museum Programs (NWE), in conjunction with the...) The Director of Museum Programs or director of the pertinent Presidential library will inform the...

36 CFR 1284.20 - Does NARA exhibit privately-owned material?

Code of Federal Regulations, 2012 CFR

2012-07-01

... exhibition cases or other necessary fixtures; and (3) NARA has resources (such as exhibit and security staff) available to produce the special exhibit. (c) The Director of Museum Programs (NWE), in conjunction with the...) The Director of Museum Programs or director of the pertinent Presidential library will inform the...

Social anhedonia associated with poor evaluative processing but not with poor cognitive control.

PubMed

Martin, Elizabeth A; Kerns, John G

2010-07-30

Emotion researchers have distinguished between automatic vs. controlled processing of evaluative information. There is suggestive evidence that social anhedonia might be associated with problems in controlled evaluative processing. The current study examined whether college students with elevated social anhedonia would exhibit an increased processing effect on tasks involving either evaluative processing or cognitive control. On an evaluative processing task, affective primes and targets could be either congruent or incongruent and participants judged the valence of targets. On a cognitive control task, participants completed the color-naming Stroop task. Compared to control participants (n=47), people with elevated social anhedonia (n=27) exhibited an increased evaluative processing effect as they were slower and made more errors for incongruent than for congruent trials on the evaluative processing task. In contrast, there were no group differences on the Stroop task or on a semantic priming task. Overall, these results suggest that people with elevated social anhedonia might have problems with some aspects of evaluative processing. Copyright 2009 Elsevier Ltd. All rights reserved.

The Perceptions and Expectations Toward the Social Responsibility of Hospitals and Organizational Commitment of Nursing Staff.

PubMed

Hsieh, Sheng-Che; Chiu, Herng-Chia; Hsieh, Ya-Hui; Ho, Pei-Shen; Chen, Li-Chin; Chang, Wei-Chou

2016-09-01

The labor rights of medical workers in hospitals in Taiwan have been a key issue of discussion and controversy in recent years. Generally, poor work conditions and manpower shortages in hospitals have resulted in a vicious circle of severely overworked medical and healthcare staff and chronically low staffing and retention rates. This study employed corporate social responsibility as the conceptual framework of the social responsibility of hospitals to examine the perceptions and expectations of nurses toward the social responsibility practices of the hospital where they serve and to explore the relationship between these perceptions and organizational commitment (OC). The participants were all nurses who were employed by one medical group in southern Taiwan. Two hundred forty anonymous questionnaires, which included scales that were designed to measure the social responsibility of hospitals and OC, were distributed. Two hundred twenty-seven valid questionnaires were returned. Exploratory factor analysis was used to validate the dimension of the social responsibility of hospitals, and hierarchical multiregression analyses were used to verify the relationship between the perceptions of nurses with regard to the social responsibility practices of the hospital where nurses serve and OC. There were considerable differences between participants' perceptions and expectations toward the social responsibility of hospitals. The nurses with high perceptions toward the social responsibility practices of the hospital where they serve tended to have relatively high OC. Senior nurses who had high perceptions of the legal and rational, ethical, and economic dimensions of the social responsibility practices of the hospital where they serve exhibited relatively strong affective commitment. Nurses in junior positions who had high perceptions of the practices of ethical responsibilities exhibited relatively strong continuance commitment. Senior nurses who had high perceptions of the

Individual consistency and flexibility in human social information use.

PubMed

Toelch, Ulf; Bruce, Matthew J; Newson, Lesley; Richerson, Peter J; Reader, Simon M

2014-02-07

Copying others appears to be a cost-effective way of obtaining adaptive information, particularly when flexibly employed. However, adult humans differ considerably in their propensity to use information from others, even when this 'social information' is beneficial, raising the possibility that stable individual differences constrain flexibility in social information use. We used two dissimilar decision-making computer games to investigate whether individuals flexibly adjusted their use of social information to current conditions or whether they valued social information similarly in both games. Participants also completed established personality questionnaires. We found that participants demonstrated considerable flexibility, adjusting social information use to current conditions. In particular, individuals employed a 'copy-when-uncertain' social learning strategy, supporting a core, but untested, assumption of influential theoretical models of cultural transmission. Moreover, participants adjusted the amount invested in their decision based on the perceived reliability of personally gathered information combined with the available social information. However, despite this strategic flexibility, participants also exhibited consistent individual differences in their propensities to use and value social information. Moreover, individuals who favoured social information self-reported as more collectivist than others. We discuss the implications of our results for social information use and cultural transmission.

Adolescent chronic variable social stress influences exploratory behavior and nicotine responses in male, but not female, BALB/cJ mice.

PubMed

Caruso, M J; Reiss, D E; Caulfield, J I; Thomas, J L; Baker, A N; Cavigelli, S A; Kamens, H M

2018-04-01

Anxiety disorders and nicotine use are significant contributors to global morbidity and mortality as independent and comorbid diseases. Early-life stress, potentially via stress-induced hypothalamic-pituitary-adrenal axis (HPA) dysregulation, can exacerbate both. However, little is known about the factors that predispose individuals to the development of both anxiety disorders and nicotine use. Here, we examined the relationship between anxiety-like behaviors and nicotine responses following adolescent stress. Adolescent male and female BALB/cJ mice were exposed to either chronic variable social stress (CVSS) or control conditions. CVSS consisted of repeated cycles of social isolation and social reorganization. In adulthood, anxiety-like behavior and social avoidance were measured using the elevated plus-maze (EPM) and social approach-avoidance test, respectively. Nicotine responses were assessed with acute effects on body temperature, corticosterone production, locomotor activity, and voluntary oral nicotine consumption. Adolescent stress had sex-dependent effects on nicotine responses and exploratory behavior, but did not affect anxiety-like behavior or social avoidance in males or females. Adult CVSS males exhibited less exploratory behavior, as indicated by reduced exploratory locomotion in the EPM and social approach-avoidance test, compared to controls. Adolescent stress did not affect nicotine-induced hypothermia in either sex, but CVSS males exhibited augmented nicotine-induced locomotion during late adolescence and voluntarily consumed less nicotine during adulthood. Stress effects on male nicotine-induced locomotion were associated with individual differences in exploratory locomotion in the EPM and social approach-avoidance test. Relative to controls, adult CVSS males and females also exhibited reduced corticosterone levels at baseline and adult male CVSS mice exhibited increased corticosterone levels following an acute nicotine injection. Results

Africa: A Social Studies and Science Curriculum.

ERIC Educational Resources Information Center

Holboke, Kathy; And Others

This packet was designed to help teachers maximize a visit to a zoo's Africa exhibit. The packet provides two levels of activities, grades 3-5, and grades 6-8, for use before, during and after the visit. Activities are designed to enhance skills taught in science, social studies, language arts, reading, art, and math. A multi-grade background…

The role of exhibits in teacher workshops at science museums

NASA Astrophysics Data System (ADS)

Stein, Fred D.

Between 1986 and 1998, the Exploratorium Institute for Inquiry offered multi-week science institutes for elementary educators involving museum exhibit use during a three-day independent investigation on light and color. Many museums tend to underutilize exhibit use in their teacher education programs. This study addresses the question, "What are the contributions of exhibit use to teachers' learning of science content during a workshop at a science museum?" Data from workshops over three successive years was collected in the form of 13 case studies of participants' investigations. Pre- and post-testing of six participants showed a large (ES = 3.0 SD) and significant gain in their understanding of light and color concepts. The case studies were analyzed by coding each incident of exhibit use according to how the exhibit interaction might have helped the participant in his or her learning. Clusters of recurring themes emerged inductively from the coding process suggesting that the exhibits conferred both logistical and conceptual benefits. Logistically, the exhibits acted as "labor-saving" devices, saving participants time because they were always set up and ready to use, and saving the workshop facilitators time because facilitators could recommend that a participant visit an exhibit rather than spend time giving them individual attention or helping them construct their own investigation apparatus. Conceptually, the exhibits supported each aspect of the Piagetian conceptual change process---accommodation, assimilation, and disequilibrium. They supported accommodation of idea structures and the development of new ones by encouraging participants to ask and answer "What would happen if...?" questions which often generated ideas to explain the new experiences. They supported assimilation of experiences into recently developed idea structures or schemes (supporting and consolidating them) by providing opportunities for participants to ask and answer "Will it happen if

Parenting Styles and Children's Social Skills as Perceived by Jordanian Mothers of Preschool Children

ERIC Educational Resources Information Center

Abu Taleb, Tagreed Fathi

2013-01-01

This study examined the perceived parenting styles in a sample of Jordanian mothers and their perceptions of the social skills exhibited by their preschool children. The sample consisted of 802 ("N"=802) mothers who responded to a three-part questionnaire: demographic information, parenting styles, and social skills. The results of this…

Repairing Hubble Exhibit Reception

NASA Image and Video Library

2014-04-23

Individuals in attendance who had a hand in the development or servicing of the Hubble Space Telescope pose for a group photo at an event unveiling a new exhibit featuring Hubble's Corrective Optics Space Telescope Axial Replacement (COSTAR) and the WFPC2 on Wednesday, April 23, 2014 at the Smithsonian National Air and Space Museum in Washington, DC. COSTAR and WFPC2 were installed in Hubble during the first space shuttle servicing mission in 1993 and returned to Earth on the fifth and final servicing mission in 2009. Photo Credit: (NASA/Joel Kowsky)

Need for Social Approval: Impression Management or Self-Deception?

ERIC Educational Resources Information Center

Millham, Jim; Kellogg, Richard W.

1980-01-01

The self- and the other-deceptive components of social desirability responding were independent of each other, but positively and independently related to individual differences in need for approval score. Self-deceptive persons demonstrated diminished recall, while other-deceptive persons exhibited enhanced recall of negatively evaluative…

Volunteerism: Social Network Dynamics and Education.

PubMed

Ajrouch, Kristine J; Antonucci, Toni C; Webster, Noah J

2016-03-01

. We examine how changes in social networks influence volunteerism through bridging (diversity) and bonding (spending time) mechanisms. We further investigate whether social network change substitutes or amplifies the effects of education on volunteerism. . Data (n = 543) are drawn from a two-wave survey of Social Relations and Health over the Life Course (SRHLC). Zero-inflated negative binomial regressions were conducted to test competing hypotheses about how changes in social network characteristics alone and in conjunction with education level predict likelihood and frequency of volunteering. . Changes in social networks were associated with volunteerism: as the proportion of family members decreased and the average number of network members living within a one-hour drive increased over time, participants reported higher odds of volunteering. The substitution hypothesis was supported: social networks that exhibited more geographic proximity and greater contact frequency over-time compensated for lower levels of education to predict volunteering more hours. . The dynamic role of social networks and the ways in which they may work through bridging and bonding to influence both likelihood and frequency of volunteering are discussed. The potential benefits of volunteerism in light of longer life expectancies and smaller families are also considered. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The Inside Story of Science City: An Outdoor Public Science Exhibition.

ERIC Educational Resources Information Center

Cole, Peggy Ruth; Cutting, Jennifer McGregor

1996-01-01

Discusses and compares on-site and off-site exhibition development. Argues that the development and installation of museum exhibits for public urban spaces requires skill and experience that stretches beyond the expertise of a science-technology museum exhibition staff. Focuses on Science City, an outdoor exhibition created by the New York Hall of…

Biofilms formed by the archaeon Haloferax volcanii exhibit cellular differentiation and social motility, and facilitate horizontal gene transfer.

PubMed

Chimileski, Scott; Franklin, Michael J; Papke, R Thane

2014-08-14

Archaea share a similar microbial lifestyle with bacteria, and not surprisingly then, also exist within matrix-enclosed communities known as biofilms. Advances in biofilm biology have been made over decades for model bacterial species, and include characterizations of social behaviors and cellular differentiation during biofilm development. Like bacteria, archaea impact ecological and biogeochemical systems. However, the biology of archaeal biofilms is only now being explored. Here, we investigated the development, composition and dynamics of biofilms formed by the haloarchaeon Haloferax volcanii DS2. Biofilms were cultured in static liquid and visualized with fluorescent cell membrane dyes and by engineering cells to express green fluorescent protein (GFP). Analysis by confocal scanning laser microscopy showed that H. volcanii cells formed microcolonies within 24 h, which developed into larger clusters by 48 h and matured into flake-like towers often greater than 100 μm in height after 7 days. To visualize the extracellular matrix, biofilms formed by GFP-expressing cells were stained with concanavalin A, DAPI, Congo red and thioflavin T. Stains colocalized with larger cellular structures and indicated that the extracellular matrix may contain a combination of polysaccharides, extracellular DNA and amyloid protein. Following a switch to biofilm growth conditions, a sub-population of cells differentiated into chains of long rods sometimes exceeding 25 μm in length, compared to their planktonic disk-shaped morphology. Time-lapse photography of static liquid biofilms also revealed wave-like social motility. Finally, we quantified gene exchange between biofilm cells, and found that it was equivalent to the mating frequency of a classic filter-based experimental method. The developmental processes, functional properties and dynamics of H. volcanii biofilms provide insight on how haloarchaeal species might persist, interact and exchange DNA in natural communities. H

"That Is Not Very American": A Microethnographic Discourse Analysis of a Chinese ESL Learner's Appropriation of Cultural Values at an Art Exhibition

ERIC Educational Resources Information Center

Lee-Johnson, Yin Lam

2017-01-01

This article is based on part of the discourse data collected from a 5-month ethnographic study about how first-year learners of English as a second language (ESL) socially interact with their native-speaking peers in a college town in the U.S. Midwest. The data were collected from participant observation at an art exhibition at the research site.…

The Social Skills Problems of Victims of Bullying: Self, Peer and Teacher Perceptions

ERIC Educational Resources Information Center

Fox, Claire L.; Boulton, Michael J.

2005-01-01

Background: A small number of prior studies have found that victims of school bullying tend to exhibit poor social skills. Few of these have examined this issue from multiple perspectives, and there has been a focus on a restricted range of social skills. Aims: To determine the extent to which self, peers, and teachers regard victims as having…

Social networks and cooperation in hunter-gatherers.

PubMed

Apicella, Coren L; Marlowe, Frank W; Fowler, James H; Christakis, Nicholas A

2012-01-25

Social networks show striking structural regularities, and both theory and evidence suggest that networks may have facilitated the development of large-scale cooperation in humans. Here, we characterize the social networks of the Hadza, a population of hunter-gatherers in Tanzania. We show that Hadza networks have important properties also seen in modernized social networks, including a skewed degree distribution, degree assortativity, transitivity, reciprocity, geographic decay and homophily. We demonstrate that Hadza camps exhibit high between-group and low within-group variation in public goods game donations. Network ties are also more likely between people who give the same amount, and the similarity in cooperative behaviour extends up to two degrees of separation. Social distance appears to be as important as genetic relatedness and physical proximity in explaining assortativity in cooperation. Our results suggest that certain elements of social network structure may have been present at an early point in human history. Also, early humans may have formed ties with both kin and non-kin, based in part on their tendency to cooperate. Social networks may thus have contributed to the emergence of cooperation.

Identifying Childhood Characteristics that Underlie Pre-Morbid Risk for Substance Use Disorders: Socialization and Boldness

PubMed Central

Hicks, Brian M.; Iacono, William G.; McGue, Matt

2013-01-01

Utilizing a longitudinal twin study (N = 2510), we identified the child characteristics present prior to initiation of substance use that best predicted later substance use disorders. Two independent traits accounted for the majority of pre-morbid risk: socialization (conformity to rules and conventional values) and boldness (sociability and social assurance, stress resilience, and thrill seeking). Low socialization was associated with disruptive behavior disorders, parental externalizing disorders, and environmental adversity, and exhibited moderate genetic (.45) and shared environmental influences (.30). Boldness was highly heritable (.71) and associated with less internalizing distress and environmental adversity. Together, these traits exhibited robust associations with adolescent and young adult substance use disorders (R = .48 and .50, respectively), and incremental prediction over disruptive behavior disorders, parental externalizing disorders, and environmental adversity. Results were replicated in an independent sample. Socialization and boldness offer a novel conceptualization of underlying risk for substance use disorders that has the potential to improve prediction and theory with implications for basic research, prevention, and intervention. PMID:24280373

Endurance- and Resistance-Trained Men Exhibit Lower Cardiovascular Responses to Psychosocial Stress Than Untrained Men.

PubMed

Gröpel, Peter; Urner, Maren; Pruessner, Jens C; Quirin, Markus

2018-01-01

Evidence shows that regular physical exercise reduces physiological reactivity to psychosocial stress. However, previous research mainly focused on the effect of endurance exercise, with only a few studies looking at the effect of resistance exercise. The current study tested whether individuals who regularly participate in either endurance or resistance training differ from untrained individuals in adrenal and cardiovascular reactivity to psychosocial stress. Twelve endurance-trained men, 10 resistance-trained men, and 12 healthy but untrained men were exposed to a standardized psychosocial stressor, the Trier Social Stress Test. Measurements of heart rate, free salivary cortisol levels, and mood were obtained throughout the test and compared among the three groups. Overall, both endurance- and resistance-trained men had lower heart rate levels than untrained men, indicating higher cardiac performance of the trained groups. Trained men also exhibited lower heart rate responses to psychosocial stress compared with untrained men. There were no significant group differences in either cortisol responses or mood responses to the stressor. The heart rate results are consistent with previous studies indicating reduced cardiovascular reactivity to psychosocial stress in trained individuals. These findings suggest that long-term endurance and resistance trainings may be related to the same cardiovascular benefits, without exhibiting strong effects on the cortisol reactivity to stress.

Evaluating Education and Science in the KSC Visitor Complex Exhibits

NASA Technical Reports Server (NTRS)

Erickson, Lance K.

2000-01-01

The continuing development of exhibits at the Kennedy Space Center's Visitor Complex is an excellent opportunity for NASA personnel to promote science and provide insight into NASA programs and projects for the approximately 3 million visitors that come to KSC annually. Stated goals for the Visitor Complex, in fact, emphasize science awareness and recommend broadening the appeal of the displays and exhibits for all age groups. To this end, this summer project seeks to evaluate the science content of planned exhibits/displays in relation to these developing opportunities and identify specific areas for enhancement of existing or planned exhibits and displays. To help expand the educational and science content within the developing exhibits at the Visitor Complex, this project was structured to implement the goals of the Visitor Center Director. To accomplish this, the exhibits and displays planned for completion within the year underwent review and evaluation for science content and educational direction. Planning emphasis for the individual displays was directed at combining the elements of effective education with fundamental scientific integrity, within an appealing format.

Correlation between social proximity and mobility similarity.

PubMed

Fan, Chao; Liu, Yiding; Huang, Junming; Rong, Zhihai; Zhou, Tao

2017-09-20

Human behaviors exhibit ubiquitous correlations in many aspects, such as individual and collective levels, temporal and spatial dimensions, content, social and geographical layers. With rich Internet data of online behaviors becoming available, it attracts academic interests to explore human mobility similarity from the perspective of social network proximity. Existent analysis shows a strong correlation between online social proximity and offline mobility similarity, namely, mobile records between friends are significantly more similar than between strangers, and those between friends with common neighbors are even more similar. We argue the importance of the number and diversity of common friends, with a counter intuitive finding that the number of common friends has no positive impact on mobility similarity while the diversity plays a key role, disagreeing with previous studies. Our analysis provides a novel view for better understanding the coupling between human online and offline behaviors, and will help model and predict human behaviors based on social proximity.

Social cognition in patients at ultra-high risk for psychosis: What is the relation to social skills and functioning?

PubMed

Glenthøj, Louise B; Fagerlund, Birgitte; Hjorthøj, Carsten; Jepsen, Jens R M; Bak, Nikolaj; Kristensen, Tina D; Wenneberg, Christina; Krakauer, Kristine; Roberts, David L; Nordentoft, Merete

2016-09-01

Patients at ultra-high risk (UHR) for psychosis show significant impairments in functioning. It is essential to determine which factors influence functioning, as it may have implications for intervention strategies. This study examined whether social cognitive abilities and clinical symptoms are associated with functioning and social skills. The study included 65 UHR patients and 30 healthy controls. Social cognitive function, social skills, and a broad range of functioning measures were assessed. The UHR patients demonstrated significant decrements on The Awareness of Social Inferences Task total score (p = .046, d  = .51), and on the CANTAB emotion recognition task total percent correct (p = .023, d  = .54) displaying particular difficulties in negative affect recognition. The patients exhibited significant impairments in social skills measured with the High Risk Social Challenge (p˂.001, d  = 1.05). Aspects of emotion recognition were associated with role functioning and social skill performance. The level of attributional bias was associated with overall functioning, and theory of mind ability was associated with self-reported functioning. Negative symptoms were associated with all measures of functioning (p ≤ .05). Significant impairments in social cognition and social skills were found in UHR patients. The patients' social cognitive function was associated with overall functioning and social skills. Negative symptoms appear to play an important role for functioning. Research is needed to investigate how the relations between social cognition, social skills and functioning develop from the UHR state to the stage of manifest illness. Research into how deficits in social cognition and social skills can be ameliorated in UHR patients is warranted.

Social functioning in adults with neurofibromatosis type 1.

PubMed

Pride, Natalie A; Crawford, Hilda; Payne, Jonathan M; North, Kathryn N

2013-10-01

Neurofibromatosis type 1 (NF1) is a common single-gene disorder characterised by a diverse range of cutaneous, neurological and neoplastic manifestations. It is well recognised that children with NF1 have poor peer interactions and are at risk for deficits in social skills. Few studies, however, have examined social functioning in adults with NF1. We aimed to determine whether adults with NF1 are at greater risk for impairment in social skills and to identify potential risk factors for social skills deficits. We evaluated social skills in 62 adults with NF1 and 39 controls using self-report and observer-report measures of social behaviour. We demonstrate that adults with NF1 exhibit significantly less prosocial behaviour than controls. This deficit was associated with social processing abilities and was more evident in males. The frequency of antisocial behaviour was comparable between the two groups, however was significantly associated with behavioural regulation in the NF1 group. These findings suggest that poor social skills in individuals with NF1 are due to deficits in prosocial behaviour, rather than an increase in antisocial behaviour. This will aid the design of interventions aimed at improving social skills in individuals with NF1. Copyright © 2013 Elsevier Ltd. All rights reserved.

Social referencing and cat-human communication.

PubMed

Merola, I; Lazzaroni, M; Marshall-Pescini, S; Prato-Previde, E

2015-05-01

Cats' (Felis catus) communicative behaviour towards humans was explored using a social referencing paradigm in the presence of a potentially frightening object. One group of cats observed their owner delivering a positive emotional message, whereas another group received a negative emotional message. The aim was to evaluate whether cats use the emotional information provided by their owners about a novel/unfamiliar object to guide their own behaviour towards it. We assessed the presence of social referencing, in terms of referential looking towards the owner (defined as looking to the owner immediately before or after looking at the object), the behavioural regulation based on the owner's emotional (positive vs negative) message (vocal and facial), and the observational conditioning following the owner's actions towards the object. Most cats (79 %) exhibited referential looking between the owner and the object, and also to some extent changed their behaviour in line with the emotional message given by the owner. Results are discussed in relation to social referencing in other species (dogs in particular) and cats' social organization and domestication history.

75 FR 6079 - Culturally Significant Objects Imported for Exhibition

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-05

... DEPARTMENT OF STATE [PUBLIC NOTICE 6894] Culturally Significant Objects Imported for Exhibition Determinations: ``Compass and Rule: Architecture as Mathematical Practice in England, 1500-1750'' SUMMARY: Notice... objects to be included in the exhibition ``Compass and Rule: Architecture as Mathematical Practice in...

Nonverbal expressive behaviour in schizophrenia and social phobia.

PubMed

Del-Monte, Jonathan; Raffard, Stéphane; Salesse, Robin N; Marin, Ludovic; Schmidt, Richard C; Varlet, Manuel; Bardy, Benoît G; Philippe Boulenger, Jean; Christine Gély-Nargeot, Marie; Capdevielle, Delphine

2013-11-30

Expressive behaviour plays a crucial role in the success of social interactions. Abnormality of expressive behaviour has been reported in interpersonal interactions of patients suffering from schizophrenia and social phobia, two debilitating mental disorders with important social deficits. However, no study has compared the expressive behaviour in these two disorders. Thirty schizophrenia patients, 21 social phobia patients and 30 healthy controls were evaluated and compared on expressive, cognitive and clinical dimensions. Expressive behaviour was assessed using the Motor Affective subscale of the Motor-Affective-Social-Scale (MASS). Covariables include the Positive and Negative Syndrome Scale (PANSS), the anxiety level Liebowitz-Social-Anxiety-Scale (LSAS) and cognitive tasks. After controlling for depression, schizophrenia and social phobia patients both exhibited significantly fewer expressive behaviours compared to healthy controls. Moreover, our results showed specific signatures: schizophrenia patients performed fewer spontaneous gestures (hand gestures and smiles) whereas social phobia patients had an impaired ability to produce voluntary smiles in comparison to healthy controls. Interestingly, poor social functioning was significantly correlated with a decrease of expressive behaviour for schizophrenia patients. Expressive behaviour is impaired in different ways in social phobia and schizophrenia and is associated in schizophrenia with poorer social functioning. The Motor Affective subscale of the MASS is an interesting tool for assessing the dysfunction of interpersonal expressive behaviour in mental disorders. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Increased alcohol use after Hurricane Ike: The roles of perceived social cohesion and social control.

PubMed

Ma, Chenyi; Smith, Tony E

2017-10-01

Hurricane Ike, the third costliest hurricane in US history, made landfall in the Galveston Bay Area in September, 2008. Existing literature postulates that maladaptive behavior such as increased alcohol use is often exhibited by disaster survivors in coping with both disaster-related traumatic events and post-disaster stressful events. In addition, it has also been postulated that survivors' perceptions of social cohesion and social control can potentially serve to moderate such behavior. The purpose of this paper is to study such hypotheses for Hurricane Ike. In particular, we investigate the following four hypotheses: (H1) There is an increase of alcohol use by survivors of Hurricane Ike in the Galveston Bay Area; (H2) There are positive associations between both Ike-related trauma and post-Ike stress events and the increase in alcohol use; (H3) There are negative associations between both perceived social cohesion and social control and the increase in alcohol use following Ike; and finally that (H4) perceived social cohesion and social control serve to moderate the associations between both Ike-related trauma and post-Ike stress events and increased alcohol use after Ike. Using public use survey-weighted data from the Galveston Bay Recovery Study (GBRS) of Ike survivors (N = 658), we tested these hypotheses using logistic regressions controlling for other key socioeconomic variables. Our results confirm H1 and H2. Hypotheses H3 and H4 are partially confirmed with respect to social control, but show that (i) there is a positive association between perceived social cohesion and the increase in alcohol use following Ike, and that (ii) while perceived social cohesion and social control do moderate the association between post-Ike stress events and increased alcohol use, they have no effect on the association between Ike-related trauma and increased alcohol use. Copyright © 2017 Elsevier Ltd. All rights reserved.

An examination of psychopathology and daily impairment in adolescents with social anxiety disorder.

PubMed

Mesa, Franklin; Beidel, Deborah C; Bunnell, Brian E

2014-01-01

Although social anxiety disorder (SAD) is most often diagnosed during adolescence, few investigations have examined the clinical presentation and daily functional impairment of this disorder exclusively in adolescents. Prior studies have demonstrated that some clinical features of SAD in adolescents are unique relative to younger children with the condition. Furthermore, quality of sleep, a robust predictor of anxiety problems and daily stress, has not been examined in socially anxious adolescents. In this investigation, social behavior and sleep were closely examined in adolescents with SAD (n = 16) and normal control adolescents (NC; n = 14). Participants completed a self-report measure and an actigraphy assessment of sleep. Social functioning was assessed via a brief speech and a social interaction task, during which heart rate and skin conductance were measured. Additionally, participants completed a daily social activity journal for 1 week. No differences were observed in objective or subjective quality of sleep. Adolescents with SAD reported greater distress during the analogue social tasks relative to NC adolescents. During the speech task, adolescents with SAD exhibited a trend toward greater speech latency and spoke significantly less than NC adolescents. Additionally, SAD participants manifested greater skin conductance during the speech task. During the social interaction, adolescents with SAD required significantly more confederate prompts to stimulate interaction. Finally, adolescents with SAD reported more frequent anxiety-provoking situations in their daily lives, including answering questions in class, assertive communication, and interacting with a group. The findings suggest that, although adolescents with SAD may not exhibit daily impaired sleep, the group does experience specific behavioral and physiological difficulties in social contexts regularly. Social skills training may be a critical component in therapeutic approaches for this group.

Peer Tutoring and Social Dynamics in Higher Education

ERIC Educational Resources Information Center

Colvin, Janet W.

2007-01-01

Peer tutoring in Higher Education is being used with increasing frequency to aid in student learning, motivation, and empowerment. Although an extensive body of research documents the efficacy of such programs, it exhibits a surprising lack of awareness of the social dynamics involved. This study focuses on peer tutors and students as they…

TNF-α levels in cancer patients relate to social variables

PubMed Central

Marucha, Phillip T.; Crespin, Timothy R.; Shelby, Rebecca A.; Andersen, Barbara L.

2008-01-01

Tumor necrosis factor-α (TNF-α) is an important cytokine associated with tumor regression and increased survival time for cancer patients. Research evidence relates immune factors (e.g., natural killer (NK) cell counts, NK cell lysis, lymphocyte profile, and lymphocyte proliferation) to the frequency and quality of social relations among cancer patients. We hypothesized that disruptions in social relations would be associated with lower TNF-α responses, and conversely, that reports of positive changes in social relations correlate with stronger responses. A prospective design measured changes in social activity and relationship satisfaction with a partner in 44 breast cancer patients at the time of cancer diagnosis, and initial surgery and 12 months later. Results indicated that patients reporting increased social activities or satisfaction exhibited stronger stimulated TNF-α responses. This is the first study to link changes in patient social relations with a cancer-relevant immune variable. PMID:15890493

7 CFR Exhibit A to Subpart L of... - [Reserved

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 13 2010-01-01 2009-01-01 true [Reserved] A Exhibit A to Subpart L of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS... Funds Exhibit A to Subpart L of Part 1940 [Reserved] ...

Awareness of the Social Implications of Clothing in Relation to Fashion Awareness and Clothing Economic Practices.

ERIC Educational Resources Information Center

Horridge, Patricia; Richards, Mary Lynne

1986-01-01

The Sproles Consumer Interests and Priorities questionnaire was administered to 3,036 home economists. Awareness of social implications of clothing, correlated positively with fashion awareness and clothing economic practices. Results suggest that persons exhibiting substantial awareness of social importance of clothing also tend to evidence…

A phenomenological investigation of science center exhibition developers' expertise development

NASA Astrophysics Data System (ADS)

Young, Denise L.

The purpose of this study was to examine the exhibition developer role in the context of United States (U.S.) science centers, and more specifically, to investigate the way science center exhibition developers build their professional expertise. This research investigated how successfully practicing exhibition developers described their current practices, how they learned to be exhibition developers, and what factors were the most important to the developers in building their professional expertise. Qualitative data was gathered from 10 currently practicing exhibition developers from three science centers: the Exploratorium, San Francisco, California; the Field Museum, Chicago, Illinois; and the Science Museum of Minnesota, St. Paul, Minnesota. In-depth, semistructured interviews were used to collect the data. The study embraced aspects of the phenomenological tradition and sought to derive a holistic understanding of the position and how expertise was built for it. The data were methodically coded and organized into themes prior to analysis. The data analysis found that the position consisted of numerous and varied activities, but the developers' primary roles were advocating for the visitor, storytelling, and mediating information and ideas. They conducted these activities in the context of a team and relied on an established exhibition planning process to guide their work. Developers described a process of learning exhibition development that was experiential in nature. Learning through daily practice was key, though they also consulted with mentors and relied on visitor studies to gauge the effectiveness of their work. They were adept at integrating prior knowledge gained from many aspects of their lives into their practice. The developers described several internal factors that contributed to their expertise development including the desire to help others, a natural curiosity about the world, a commitment to learning, and the ability to accept critique. They

Emergence of hysteresis loop in social contagions on complex networks.

PubMed

Su, Zhen; Wang, Wei; Li, Lixiang; Xiao, Jinghua; Stanley, H Eugene

2017-07-21

Understanding the spreading mechanisms of social contagions in complex network systems has attracted much attention in the physics community. Here we propose a generalized threshold model to describe social contagions. Using extensive numerical simulations and theoretical analyses, we find that a hysteresis loop emerges in the system. Specifically, the steady state of the system is sensitive to the initial conditions of the dynamics of the system. In the steady state, the adoption size increases discontinuously with the transmission probability of information about social contagions, and trial size exhibits a non-monotonic pattern, i.e., it first increases discontinuously then decreases continuously. Finally we study social contagions on heterogeneous networks and find that network topology does not qualitatively affect our results.

Exhibits Recognition System for Combining Online Services and Offline Services

NASA Astrophysics Data System (ADS)

Ma, He; Liu, Jianbo; Zhang, Yuan; Wu, Xiaoyu

2017-10-01

In order to achieve a more convenient and accurate digital museum navigation, we have developed a real-time and online-to-offline museum exhibits recognition system using image recognition method based on deep learning. In this paper, the client and server of the system are separated and connected through the HTTP. Firstly, by using the client app in the Android mobile phone, the user can take pictures and upload them to the server. Secondly, the features of the picture are extracted using the deep learning network in the server. With the help of the features, the pictures user uploaded are classified with a well-trained SVM. Finally, the classification results are sent to the client and the detailed exhibition’s introduction corresponding to the classification results are shown in the client app. Experimental results demonstrate that the recognition accuracy is close to 100% and the computing time from the image uploading to the exhibit information show is less than 1S. By means of exhibition image recognition algorithm, our implemented exhibits recognition system can combine online detailed exhibition information to the user in the offline exhibition hall so as to achieve better digital navigation.

Multimodal audio guide for museums and exhibitions

NASA Astrophysics Data System (ADS)

Gebbensleben, Sandra; Dittmann, Jana; Vielhauer, Claus

2006-02-01

In our paper we introduce a new Audio Guide concept for exploring buildings, realms and exhibitions. Actual proposed solutions work in most cases with pre-defined devices, which users have to buy or borrow. These systems often go along with complex technical installations and require a great degree of user training for device handling. Furthermore, the activation of audio commentary related to the exhibition objects is typically based on additional components like infrared, radio frequency or GPS technology. Beside the necessity of installation of specific devices for user location, these approaches often only support automatic activation with no or limited user interaction. Therefore, elaboration of alternative concepts appears worthwhile. Motivated by these aspects, we introduce a new concept based on usage of the visitor's own mobile smart phone. The advantages in our approach are twofold: firstly the Audio Guide can be used in various places without any purchase and extensive installation of additional components in or around the exhibition object. Secondly, the visitors can experience the exhibition on individual tours only by uploading the Audio Guide at a single point of entry, the Audio Guide Service Counter, and keeping it on her or his personal device. Furthermore, since the user usually is quite familiar with the interface of her or his phone and can thus interact with the application device easily. Our technical concept makes use of two general ideas for location detection and activation. Firstly, we suggest an enhanced interactive number based activation by exploiting the visual capabilities of modern smart phones and secondly we outline an active digital audio watermarking approach, where information about objects are transmitted via an analog audio channel.

Oxytocin biases men but not women to restore social connections with individuals who socially exclude them

PubMed Central

Xu, Xiaolei; Yao, Shuxia; Xu, Lei; Geng, Yayuan; Zhao, Weihua; Ma, Xiaole; Kou, Juan; Luo, Ruixue; Kendrick, Keith M.

2017-01-01

We normally react to individuals who exclude us socially by either avoiding them or increasing our attempts to interact with them. The neuropeptide oxytocin can promote social bonds and reduce social conflict and we therefore investigated whether it facilitates more positive social responses towards individuals who exclude or include us. In a double-blind, placebo-controlled, between-subject design 77 healthy Chinese male and female participants received intranasal oxytocin (40 IU) or placebo before playing a modified virtual ball-tossing game with three fictitious partners who either showed exclusion, inclusion or neutral behavioral interactions with them. Results showed that both male and female subjects threw the ball more often to individuals who excluded rather than included them, although oxytocin did not alter this or awareness/feelings of exclusion or inclusion. However, when subjects returned a week later males, but not females, in the oxytocin group exhibited an increased liking for, and preference for playing again with, players who had previously excluded them. This oxytocin effect was positively associated with independent traits. Our findings suggest that in a collectivist culture oxytocin may promote the desire of males, but not females, with a stronger independent orientation to rebuild social connections with individuals who have previously excluded them. PMID:28079166

How Can Museum Exhibits Enhance Earthquake and Tsunami Hazard Resiliency?

NASA Astrophysics Data System (ADS)

Olds, S. E.

2015-12-01

Creating a natural disaster-ready community requires interoperating scientific, technical, and social systems. In addition to the technical elements that need to be in place, communities and individuals need to be prepared to react when a natural hazard event occurs. Natural hazard awareness and preparedness training and education often takes place through informal learning at science centers and formal k-12 education programs as well as through awareness raising via strategically placed informational tsunami warning signs and placards. Museums and science centers are influential in raising science literacy within a community, however can science centers enhance earthquake and tsunami resiliency by providing hazard science content and preparedness exhibits? Museum docents and informal educators are uniquely situated within the community. They are transmitters and translators of science information to broad audiences. Through interaction with the public, docents are well positioned to be informants of the knowledge beliefs, and feelings of science center visitors. They themselves are life-long learners, both constantly learning from the museum content around them and sharing this content with visitors. They are also members of a community where they live. In-depth interviews with museum informal educators and docents were conducted at a science center in coastal Pacific Northwest. This region has a potential to be struck by a great 9+ Mw earthquake and subsequent tsunami. During the interviews, docents described how they applied learning from natural hazard exhibits at a science visitor center to their daily lives. During the individual interviews, the museum docents described their awareness (knowledge, attitudes, and behaviors) of natural hazards where they live and work, the feelings evoked as they learned about their hazard vulnerability, the extent to which they applied this learning and awareness to their lives, such as creating an evacuation plan, whether

Do bowerbirds exhibit cultures?

PubMed

Madden, Joah R

2008-01-01

Definitions of what features constitute cultural behaviour, and hence define cultures are numerous. Many seem designed to describe those aspects of human behaviour which set us apart from other animals. A broad definition prescribing that the behaviour is: learned; learned socially; normative and collective is considered to apply to several species of great ape. In this paper, I review observations and experiments covering a suite of different behavioural characteristics displayed in members of the bowerbird family (Ptilonorhynchidae) and ask whether they fulfil these criteria. These include vocalisations, bower design, decoration use, bower orientation and display movements. Such a range of behaviours refutes the suggestion that these species are "one-trick ponies"--a criticism that is often levelled at claims for culture in non-primate species. I suggest that, despite a paucity of data in comparison with primate studies, it could be argued that bowerbirds may be considered to fulfil the same criteria on which we base our use of the term culture when applied to our close relatives, the great apes. If bowerbirds do have cultures, then their unusual natural history makes them a highly tractable system in which questions of social learning and culture can be tackled.

Identifying childhood characteristics that underlie premorbid risk for substance use disorders: socialization and boldness.

PubMed

Hicks, Brian M; Iacono, William G; McGue, Matt

2014-02-01

We utilized a longitudinal twin study (N = 2,510) to identify the child characteristics present prior to initiation of substance use that best predicted later substance use disorders. Two independent traits accounted for the majority of premorbid risk: socialization (conformity to rules and conventional values) and boldness (sociability and social assurance, stress resilience, and thrill seeking). Low socialization was associated with disruptive behavior disorders, parental externalizing disorders, and environmental adversity and exhibited moderate genetic (0.45) and shared environmental influences (0.30). Boldness was highly heritable (0.71) and associated with less internalizing distress and environmental adversity. In combination, these traits exhibited robust associations with adolescent and young adult substance use disorders (R = .48 and .50, respectively) and incremental prediction over disruptive behavior disorders, parental externalizing disorders, and environmental adversity. The results were replicated in an independent sample. Socialization and boldness offer a novel conceptualization of underlying risk for substance use disorders that has the potential to improve prediction and theory with implications for basic research, prevention, and intervention.

Compensatory deficits following rejection: the role of social anxiety in disrupting affiliative behavior.

PubMed

Mallott, Michael A; Maner, Jon K; DeWall, Nathan; Schmidt, Norman B

2009-01-01

Managing perceived or actual social rejection is an important facet of meeting basic needs for affiliation. Social anxiety disorder (SAD) is characterized by significant distress and debilitation relating to affiliation and recent work suggests higher levels of social anxiety symptoms may adversely affect responses to social rejection. This study examined emotional and behavioral responding to a social rejection stressor to explore whether social anxiety moderates the effects of social rejection on prosocial compensatory behaviors. Individuals (N=37) evaluated on social anxiety symptoms were assigned to either a social rejection condition or control condition. Consistent with expectation, rejection promoted renewed interest in connecting with sources of positive social interaction among participants low in social anxiety. Participants with higher levels of social anxiety, however, failed to react to rejection in a positive or prosocial manner and exhibited some evidence of negative social responses. Such differential compensatory responding could have important implications for the genesis, maintenance, and treatment of SAD.

76 FR 61472 - Culturally Significant Objects Imported for Exhibition

Federal Register 2010, 2011, 2012, 2013, 2014

2011-10-04

... DEPARTMENT OF STATE [Public Notice: 7634] Culturally Significant Objects Imported for Exhibition Determinations: ``The Game of Kings: Medieval Ivory Chessmen From the Isle of Lewis'' SUMMARY: Notice is hereby... objects to be included in the exhibition ``The Game of Kings: Medieval Ivory Chessmen from the Isle of...

14 CFR 77.59 - Subpoenas of witnesses and exhibits.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Section 77.59 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... for any witness or exhibit that he determines may be material and relevant to the issues of the... witnesses and exhibits, he shall advise the presiding officer far enough in advance that the presiding...

14 CFR 77.59 - Subpoenas of witnesses and exhibits.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Section 77.59 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... issue subpoenas for any witness or exhibit that he determines may be material and relevant to the issues... his necessary witnesses and exhibits, he shall advise the presiding officer far enough in advance that...

7 CFR Exhibit G to Subpart G of... - [Reserved

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 13 2011-01-01 2009-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

7 CFR Exhibit G to Subpart G of... - [Reserved

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 13 2012-01-01 2012-01-01 false [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

7 CFR Exhibit G to Subpart G of... - [Reserved

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 13 2013-01-01 2013-01-01 false [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

7 CFR Exhibit G to Subpart G of... - [Reserved

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 13 2014-01-01 2013-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

7 CFR Exhibits A-B to Subpart G... - [Reserved

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 12 2013-01-01 2013-01-01 false [Reserved] A Exhibits A-B to Subpart G to Part 1822 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS..., Procedures, and Authorizations Exhibits A-B to Subpart G to Part 1822 [Reserved] ...

7 CFR Exhibit G to Subpart G of... - [Reserved

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 13 2010-01-01 2009-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

46 CFR 169.805 - Exhibition of merchant mariner credentials.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Exhibition of merchant mariner credentials. 169.805 Section 169.805 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Operations § 169.805 Exhibition of merchant mariner credentials. Officers on any vessel...

46 CFR 169.805 - Exhibition of merchant mariner credentials.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 7 2011-10-01 2011-10-01 false Exhibition of merchant mariner credentials. 169.805 Section 169.805 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Operations § 169.805 Exhibition of merchant mariner credentials. Officers on any vessel...

Alien Earths: A Traveling Science Exhibit and Education Program

NASA Astrophysics Data System (ADS)

Dusenbery, P. B.; Morrow, C. A.; Harold, J.

2004-05-01

Where did we come from? Are we alone? These age-old questions form the basis of NASA's Origins Program, a series of missions spanning the next twenty years that will use a host of space- and ground-based observatories to understand the origin and development of galaxies, stars, planets, and the conditions necessary to support life. The Space Science Institute in Boulder, CO, is developing a 3,000 square-foot traveling exhibition, called Alien Earths, which will bring origins-related research and discoveries to students and the American public. Alien Earths will have four interrelated exhibit areas: Our Place in Space, Star Birth, PlanetQuest, and Search for Life. Exhibit visitors will explore the awesome events surrounding the birth of stars and planets; they will join scientists in the hunt for planets outside our solar system including those that may be in "habitable zones" around other stars; and finally they will be able to learn about the wide range of conditions for life on Earth and how scientists are looking for signs of life beyond Earth. Visitors will also learn about the tools scientists use, such as space-based and ground-based telescopes, to improve our understanding of the cosmos. The exhibit's size will permit it to visit medium sized museums in all regions of the country. It will begin its 3-year tour to 9 host museums and science centers in early 2005 at the Lawrence Hall of Science in Berkeley, California. The Association of Science-Technology Centers (ASTC) will manage the exhibit's national tour. In addition to the exhibit, the project includes workshops for educators and docents at host sites, as well as a public website that will use exhibit content to delve deeper into origins research. Current partners in the Alien Earths project include ASTC, Denver Museum of Nature and Science, Lawrence Hall of Science, NASA Astrobiology Institute, NASA missions (Navigator, SIRTF, and Kepler), the SETI Institute, and the Space Telescope Science Institute

"Coming out" in the age of social constructionism.

PubMed

Rust, P C

1997-01-01

Abstract This article examines sexual identity formation among 346 lesbian-identified and 60 bisexual-identified women. On average, bisexuals come out at later ages and exhibit less "stable" identity histories. However, variations in identity history among lesbians and bisexuals overshadow the differences between them and demonstrate that coming out is not a linear, goal-oriented, developmental process. Sexual identity formation must be reconceptualized as a process of describing one's social location within a changing social context. Changes in sexual identity are, therefore, expected of mature individuals as they maintain an accurate description of their position vis-à-vis other individuals, groups, and institutions.

Effects of chronic social defeat on social behaviors in adult female mandarin voles (Microtus mandarinus): Involvement of the oxytocin system in the nucleus accumbens.

PubMed

Wang, Limin; Hou, Wenjuan; He, Zhixiong; Yuan, Wei; Yang, Jinfeng; Yang, Yang; Jia, Rui; Zhu, Zhenxiang; Zhou, Yue; Tai, Fadao

2018-03-02

Chronic social defeat affects many aspects of behavior. Most previous studies have focused on effects on males and defeat during adolescence. The extents to which chronic social defeat can impact female social behavior in adulthood and the neural mechanisms of such effects are poorly understood. Using highly social and aggressive female mandarin voles (Microtus mandarinus), the present study found that chronic social defeat reduced social preference in adult females, and that the defeated voles exhibited a high level of freeze, self-grooming and defensive behavior, as well as reduced exploration, intimacy and aggression during social interactions. Furthermore, chronic social defeat reduced levels of oxytocin (OT) and OT receptors (OTR) in the shell region of the nucleus accumbens (NACC). Intra-NACC shell OT microinjections reversed alterations in social behavior induced by chronic social defeat, whereas injections of an OTR antagonist (OTR-A) blocked the effects of OT. Taken together, our data demonstrate that chronic social defeat suppresses measures of sociability, and that these effects are mediated by the action of OT on the OTR in the NACC. NACC OT may be a promising target to treat socio-emotional disorders induced by chronic social stress. Copyright © 2017 Elsevier Inc. All rights reserved.

Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

PubMed

McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

2014-05-01

Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

STEM promotion through museum exhibits on cardiac monitoring & cardiac rhythm management.

PubMed

Countryman, Jordan D; Dow, Douglas E

2014-01-01

Formal education in science, technology, engineering and math (STEM) does not successfully engage all of the students who have potential to become skilled in STEM activities and careers. Museum exhibits may be able to reach and engage a broader range of the public. STEM Exhibits that are both understandable and capture the imagination of viewers may contribute toward increased interest in STEM activities. One such topic for such an exhibit could be cardiac pacemakers and cardioverter defibrillators that sustain life. Although museums have existed for centuries, the available types of exhibit designs has dramatically increased in recent decades due to innovations in technology. Science and technology museums have especially taken advantage of the progression of exhibit design to developed new ways to communicate to their viewers. These novel presentation tools allow museums to more effectively convey to and engage viewers. This paper examines the techniques employed by museums in exhibits and considers the practices of several museums with exhibits related to cardiac monitoring (CM) and cardiac rhythm management (CRM).

The Nature of Exhibits About Acoustics in Science and Technology Centres

NASA Astrophysics Data System (ADS)

Afonso, Ana S.; Gilbert, John K.

2008-11-01

This is a study of the opportunities currently provided by interactive science and technology centres for visitors’ engagement in the field of acoustics. E-mails, requesting a description of exhibits on acoustics (sound and hearing) in use, were sent to members of staff of interactive science and technology centres around the world as well as to companies that design and sell exhibits. Eighty-seven descriptions of distinctive interactive exhibits were received and analysed. Results show that: there are few analogy-based exhibits concerning the more complex aspects of acoustics; narratives involving visitors’ everyday lives, that might provide continuity between and beyond the situations presented by exhibits, are not generally provided; science is emphasised at the expense of technology; the risks, benefits and ethical implications of relevant technological artefacts are rarely mentioned; the majority of the exhibits are concerned with the fields of fundamental acoustics, hearing, and psychoacoustics. It is suggested that interactive science and technology centres need to rethink the design of exhibits about acoustics if their mission includes some appreciation of this important branch of science and technology.

7 CFR Exhibit A to Subpart B of... - [Reserved

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 12 2010-01-01 2010-01-01 false [Reserved] A Exhibit A to Subpart B of Part 1900 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS... REGULATIONS GENERAL Adverse Decisions and Administrative Appeals Exhibit A to Subpart B of Part 1900 [Reserved] ...

7 CFR Exhibit C to Subpart N of... - [Reserved

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 13 2010-01-01 2009-01-01 true [Reserved] C Exhibit C to Subpart N of Part 1944 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) HOUSING Housing Preservation Grants Exhibit C to Subpart N of Part 1944...

27 CFR 7.42 - Exhibiting certificates to Government officials.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Exhibiting certificates to Government officials. 7.42 Section 7.42 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... certificate of label approval shall, upon demand exhibit such certificate to a duly authorized representative...

7 CFR Exhibit A to Subpart C of... - [Reserved

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 12 2010-01-01 2010-01-01 false [Reserved] A Exhibit A to Subpart C of Part 1924 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS... REGULATIONS CONSTRUCTION AND REPAIR Planning and Performing Site Development Work Exhibit A to Subpart C of...

7 CFR Exhibit C to Subpart N of... - [Reserved

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 13 2011-01-01 2009-01-01 true [Reserved] C Exhibit C to Subpart N of Part 1944 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) HOUSING Housing Preservation Grants Exhibit C to Subpart N of Part 1944...

7 CFR Exhibit C to Subpart N of... - [Reserved

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 13 2012-01-01 2012-01-01 false [Reserved] C Exhibit C to Subpart N of Part 1944 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) HOUSING Housing Preservation Grants Exhibit C to Subpart N of Part 1944...

Informing the Development of Science Exhibitions through Educational Research

ERIC Educational Resources Information Center

Laherto, Antti

2013-01-01

This paper calls for greater use of educational research in the development of science exhibitions. During the past few decades, museums and science centres throughout the world have placed increasing emphasis on their educational function. Although exhibitions are the primary means of promoting visitors' learning, educational research is not…

Individual consistency and flexibility in human social information use

PubMed Central

Toelch, Ulf; Bruce, Matthew J.; Newson, Lesley; Richerson, Peter J.; Reader, Simon M.

2014-01-01

Copying others appears to be a cost-effective way of obtaining adaptive information, particularly when flexibly employed. However, adult humans differ considerably in their propensity to use information from others, even when this ‘social information’ is beneficial, raising the possibility that stable individual differences constrain flexibility in social information use. We used two dissimilar decision-making computer games to investigate whether individuals flexibly adjusted their use of social information to current conditions or whether they valued social information similarly in both games. Participants also completed established personality questionnaires. We found that participants demonstrated considerable flexibility, adjusting social information use to current conditions. In particular, individuals employed a ‘copy-when-uncertain’ social learning strategy, supporting a core, but untested, assumption of influential theoretical models of cultural transmission. Moreover, participants adjusted the amount invested in their decision based on the perceived reliability of personally gathered information combined with the available social information. However, despite this strategic flexibility, participants also exhibited consistent individual differences in their propensities to use and value social information. Moreover, individuals who favoured social information self-reported as more collectivist than others. We discuss the implications of our results for social information use and cultural transmission. PMID:24352950

27 CFR 4.51 - Exhibiting certificates to Government officials.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Exhibiting certificates to Government officials. 4.51 Section 4.51 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... approval or a certificate of exemption shall, upon demand, exhibit such certificate to a duly authorized...

Agent-Based Models in Social Physics

NASA Astrophysics Data System (ADS)

Quang, Le Anh; Jung, Nam; Cho, Eun Sung; Choi, Jae Han; Lee, Jae Woo

2018-06-01

We review the agent-based models (ABM) on social physics including econophysics. The ABM consists of agent, system space, and external environment. The agent is autonomous and decides his/her behavior by interacting with the neighbors or the external environment with the rules of behavior. Agents are irrational because they have only limited information when they make decisions. They adapt using learning from past memories. Agents have various attributes and are heterogeneous. ABM is a non-equilibrium complex system that exhibits various emergence phenomena. The social complexity ABM describes human behavioral characteristics. In ABMs of econophysics, we introduce the Sugarscape model and the artificial market models. We review minority games and majority games in ABMs of game theory. Social flow ABM introduces crowding, evacuation, traffic congestion, and pedestrian dynamics. We also review ABM for opinion dynamics and voter model. We discuss features and advantages and disadvantages of Netlogo, Repast, Swarm, and Mason, which are representative platforms for implementing ABM.

Social play in bonobos (Pan paniscus) and chimpanzees (Pan troglodytes): Implications for natural social systems and interindividual relationships.

PubMed

Palagi, Elisabetta

2006-03-01

This study compares adult play behavior in the two Pan species in order to test the effects of phylogenetic closeness and the nature of social systems on play distribution. The social play (both with fertile and immature subjects) performed by adults did not differ between the two species. In contrast, in bonobos, play levels among fertile subjects were higher than in chimpanzees. Findings regarding levels of undecided conflicts (more frequent in bonobos) and formal submission displays (lacking in bonobos) confirm, in the two colonies under study, that bonobos exhibit "egalitarianism" more than chimpanzees. Some authors emphasized the importance of play-fighting for social assessment when relationships among individuals are not codified and structured according to rank-rules. Indeed, adult bonobos played more roughly than chimpanzees. Moreover, adult bonobos displayed the full play-face at a high frequency especially during rough play sessions, whereas in chimpanzees, the frequency of play signals was not affected by roughness of play. The frequency of social play among bonobo females was higher than in any other sex combinations, whereas no difference was found for chimpanzees. As a matter of fact, social play can be viewed as a balance between cooperation and competition. Among bonobo females, characterized by social competence and affiliation, social play might enhance their behavioral flexibility and increase their socially symmetrical relationships which, after all, are the basis for their egalitarian society. (c) 2005 Wiley-Liss, Inc.

Social media fingerprints of unemployment.

PubMed

Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

2015-01-01

Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets.

Social Media Fingerprints of Unemployment

PubMed Central

Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

2015-01-01

Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

The Invisible Universe: A Tactile and Braille Exhibit of Astronomical Images

NASA Astrophysics Data System (ADS)

Arcand, Kimberly; Lestition, K.; Watzke, M.; Steel, S.

2010-01-01

As part of the "From Earth to the Universe" (FETTU) project, a NASA-funded tactile exhibit for the visually impaired community was launched in July 2009 at the Martin Luther King Library in D.C. The exhibit is part of the global FETTU exhibit, a project of the International Year of Astronomy 2009. The science content of the exhibit includes explanations of our Sun, Eta Carinae, Crab Nebula, Whirlpool Galaxy, and the electromagnetic spectrum, and was adapted from the NASA-funded Braille/tactile book Touch the Invisible Sky. Multiple geographic locations and venue types have been targeted for the displays. The FETTU-tactile exhibit opens a wider door to experiencing and understanding astronomy, bridging a gap in learning. This exhibit is based upon work supported by the National Aeronautics and Space Administration under proposal 08-EPO08-0068 issued through the Science Mission Directorate.

18 CFR 50.7 - Applications: exhibits.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Applications: exhibits. 50.7 Section 50.7 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER THE FEDERAL POWER ACT APPLICATIONS FOR PERMITS TO SITE INTERSTATE...

18 CFR 50.7 - Applications: exhibits.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Applications: exhibits. 50.7 Section 50.7 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER THE FEDERAL POWER ACT APPLICATIONS FOR PERMITS TO SITE INTERSTATE...

18 CFR 153.8 - Required exhibits.

Code of Federal Regulations, 2013 CFR

2013-04-01

... Office of Energy Projects, 888 First Street, NE., Washington, DC 20426; (6) Exhibit E-1. If the LNG... Technical Information Service or the Commission's Office of Energy Projects, 888 First Street, NE....8 Section 153.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

18 CFR 153.8 - Required exhibits.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Office of Energy Projects, 888 First Street, NE., Washington, DC 20426; (6) Exhibit E-1. If the LNG... Technical Information Service or the Commission's Office of Energy Projects, 888 First Street, NE....8 Section 153.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

18 CFR 153.8 - Required exhibits.

Code of Federal Regulations, 2012 CFR

2012-04-01

... Office of Energy Projects, 888 First Street, NE., Washington, DC 20426; (6) Exhibit E-1. If the LNG... Technical Information Service or the Commission's Office of Energy Projects, 888 First Street, NE....8 Section 153.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

18 CFR 153.8 - Required exhibits.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Office of Energy Projects, 888 First Street, NE., Washington, DC 20426; (6) Exhibit E-1. If the LNG... Technical Information Service or the Commission's Office of Energy Projects, 888 First Street, NE....8 Section 153.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

18 CFR 153.8 - Required exhibits.

Code of Federal Regulations, 2014 CFR

2014-04-01

... Office of Energy Projects, 888 First Street, NE., Washington, DC 20426; (6) Exhibit E-1. If the LNG... Technical Information Service or the Commission's Office of Energy Projects, 888 First Street, NE....8 Section 153.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION...

Crime: social disorganization and relative deprivation.

PubMed

Kawachi, I; Kennedy, B P; Wilkinson, R G

1999-03-01

Crime is seldom considered as an outcome in public health research. Yet major theoretical and empirical developments in the field of criminology during the past 50 years suggest that the same social environmental factors which predict geographic variation in crime rates may also be relevant for explaining community variations in health and wellbeing. Understanding the causes of variability in crime across countries and across regions within a country will help us to solve one of the enduring puzzles in public health, viz. why some communities are healthier than others. The purpose of this paper is to present a conceptual framework for investigating the influence of the social context on community health, using crime as the indicator of collective wellbeing. We argue that two sets of societal characteristics influence the level of crime: the degree of relative deprivation in society (for instance, measured by the extent of income inequality), and the degree of cohesiveness in social relations among citizens (measured, for instance, by indicators of 'social capital' and 'collective efficacy'). We provided a test of our conceptual framework using state-level ecologic data on violent crimes and property crimes within the USA. Violent crimes (homicide, assault, robbery) were consistently associated with relative deprivation (income inequality) and indicators of low social capital. Among property crimes, burglary was also associated with deprivation and low social capital. Areas with high crime rates tend also to exhibit higher mortality rates from all causes, suggesting that crime and population health share the same social origins. Crime is thus a mirror of the quality of the social environment.

Oxytocin Genotype Moderates the Impact of Social Support on Psychiatric Distress in Alcohol-Dependent Patients.

PubMed

Love, Tiffany M; Cranford, James A; Burmeister, Margit; Wojnar, Marcin; Zucker, Robert A; J Brower, Kirk

2018-01-01

The social environment strongly influences individual mental health. Individuals with strong social support systems tend to experience higher levels of well-being, lower levels of psychological distress and exhibit fewer psychiatric symptoms. However, there is a significant degree of individual variability as to the extent to which social support is beneficial to overall mental health. From a neurobiological perspective, it is suggested that the social hormone, oxytocin, may moderate the favorable effects of social interaction. To explore this possibility, we evaluated oxytocin genotype, social support and psychological health in a group of individuals diagnosed with DSM-IV alcohol dependence. The associations between OXT genotype, social support and psychological health were analyzed in data from 269 adults diagnosed with DSM-IV alcohol dependence (25% female) admitted into residential treatment programs and outpatient centers in Warsaw, Poland. In line with past observations, we noted that psychiatric distress scores were negatively correlated with social support. Extending these observations, we uncovered a significant moderating effect of OXT genotype (rs2740210) on the relationship between social support and psychiatric distress. While G carriers displayed the predicted negative relationship between social support and psychiatric distress, T homozygotes failed to exhibit such a relationship. Genetically driven variation in oxytocin system functioning may influence the degree to which the beneficial effects of social support are felt in this population. These results have direct clinical relevance as enhancing social engagement to improve mental health may prove to be a less effective strategy in some patients owing to intrinsic factors. The associations between oxytocin genotype, social support, and psychological health were analyzed in data from 269 adults diagnosed with DSM-IV alcohol dependence. A significant moderating effect of OXT genotype (rs2740210) on

Role of CB2 receptors in social and aggressive behavior in male mice.

PubMed

Rodríguez-Arias, Marta; Navarrete, Francisco; Blanco-Gandia, M Carmen; Arenas, M Carmen; Aguilar, María A; Bartoll-Andrés, Adrián; Valverde, Olga; Miñarro, José; Manzanares, Jorge

2015-08-01

Male CB1KO mice exhibit stronger aggressive responses than wild-type mice. This study was designed to examine the role of cannabinoid CB2r in social and aggressive behavior. The social interaction test and resident-intruder paradigm were performed in mice lacking CB2r (CB2KO) and in wild-type (WT) littermates. The effects of the CB2r selective agonist JWH133 (1 and 2 mg/kg) on aggression were also evaluated in Oncins France 1 (OF1) mice. Gene expression analyses of monoamine oxidase-A (MAO-A), catechol-o-methyltransferase (COMT), 5-hydroxytryptamine transporter (5-HTT), and 5-HT1B receptor (5HT1Br) in the dorsal raphe nuclei (DR) and the amygdala (AMY) were carried out using real-time PCR. Group-housed CB2KO mice exhibited higher levels of aggression in the social interaction test and displayed more aggression than resident WT mice. Isolation increased aggressive behavior in WT mice but did not affect CB2KO animals; however, the latter mice exhibited higher levels of social interaction with their WT counterparts. MAO-A and 5-HTT gene expression was significantly higher in grouped CB2KO mice. The expression of 5HT1Br, COMT, and MAO-A in the AMY was more pronounced in CB2KO mice than in WT counterparts. Acute administration of the CB2 agonist JWH133 significantly reduced the level of aggression in aggressive isolated OF1 mice, an effect that decreased after pretreatment with the CB2 receptor antagonist AM630. Our results suggest that CB2r is implicated in social interaction and aggressive behavior and deserves further consideration as a potential new target for the management of aggression.

Science on a Sphere exhibit

NASA Image and Video Library

2009-03-31

Students from Xavier University Preparatory School in New Orleans view the newest exhibit at StenniSphere, the visitor center at NASA's John C. Stennis Space Center - Science on a Sphere, a 68-inch global presentation of planetary data. StenniSphere is only the third NASA visitor center to offer the computer system, which uses four projectors to display data on a globe and present a dynamic, revolving, animated view of Earth and other planets.

Science on a Sphere exhibit

NASA Technical Reports Server (NTRS)

2009-01-01

Students from Xavier University Preparatory School in New Orleans view the newest exhibit at StenniSphere, the visitor center at NASA's John C. Stennis Space Center - Science on a Sphere, a 68-inch global presentation of planetary data. StenniSphere is only the third NASA visitor center to offer the computer system, which uses four projectors to display data on a globe and present a dynamic, revolving, animated view of Earth and other planets.

Inbreeding and the evolution of sociality in arthropods

NASA Astrophysics Data System (ADS)

Tabadkani, Seyed Mohammad; Nozari, Jamasb; Lihoreau, Mathieu

2012-10-01

Animals have evolved strategies to optimally balance costs and benefits of inbreeding. In social species, these adaptations can have a considerable impact on the structure, the organization, and the functioning of groups. Here, we consider how selection for inbreeding avoidance fashions the social behavior of arthropods, a phylum exhibiting an unparalleled richness of social lifestyles. We first examine life histories and parental investment patterns determining whether individuals should actively avoid or prefer inbreeding. Next, we illustrate the diversity of inbreeding avoidance mechanisms in arthropods, from the dispersal of individuals to the rejection of kin during mate choice and the production of unisexual broods by females. Then, we address the particular case of haplodiploid insects. Finally, we discuss how inbreeding may drive and shape the evolution of arthropods societies along two theoretical pathways.

Effects of Heterogeneous Social Interactions on Flocking Dynamics

NASA Astrophysics Data System (ADS)

Miguel, M. Carmen; Parley, Jack T.; Pastor-Satorras, Romualdo

2018-02-01

Social relationships characterize the interactions that occur within social species and may have an important impact on collective animal motion. Here, we consider a variation of the standard Vicsek model for collective motion in which interactions are mediated by an empirically motivated scale-free topology that represents a heterogeneous pattern of social contacts. We observe that the degree of order of the model is strongly affected by network heterogeneity: more heterogeneous networks show a more resilient ordered state, while less heterogeneity leads to a more fragile ordered state that can be destroyed by sufficient external noise. Our results challenge the previously accepted equivalence between the static Vicsek model and the equilibrium X Y model on the network of connections, and point towards a possible equivalence with models exhibiting a different symmetry.

Inbreeding and the evolution of sociality in arthropods.

PubMed

Tabadkani, Seyed Mohammad; Nozari, Jamasb; Lihoreau, Mathieu

2012-10-01

Animals have evolved strategies to optimally balance costs and benefits of inbreeding. In social species, these adaptations can have a considerable impact on the structure, the organization, and the functioning of groups. Here, we consider how selection for inbreeding avoidance fashions the social behavior of arthropods, a phylum exhibiting an unparalleled richness of social lifestyles. We first examine life histories and parental investment patterns determining whether individuals should actively avoid or prefer inbreeding. Next, we illustrate the diversity of inbreeding avoidance mechanisms in arthropods, from the dispersal of individuals to the rejection of kin during mate choice and the production of unisexual broods by females. Then, we address the particular case of haplodiploid insects. Finally, we discuss how inbreeding may drive and shape the evolution of arthropods societies along two theoretical pathways.

Narcissism and Social Networking Behavior: A Meta-Analysis.

PubMed

Gnambs, Timo; Appel, Markus

2018-04-01

The increasing popularity of social networking sites (SNS) such as Facebook and Twitter has given rise to speculations that the intensity of using these platforms is associated with narcissistic tendencies. However, recent research on this issue has been all but conclusive. We present a three-level, random effects meta-analysis including 289 effect sizes from 57 studies (total N = 25,631) on the association between trait narcissism and social networking behavior. The meta-analysis identified a small to moderate effect of ρ = .17 (τ = .11), 95% CI [.13, .21], for grandiose narcissism that replicated across different social networking platforms, respondent characteristics, and time. Moderator analyses revealed pronounced cultural differences, with stronger associations in power-distant cultures. Moreover, social networking behaviors geared toward self-presentation and the number of SNS friends exhibited stronger effects than usage durations. Overall, the study not only supported but also refined the notion of a relationship between engaging in social networking sites and narcissistic personality traits. © 2017 Wiley Periodicals, Inc.

Division of Labor in Biofilms: the Ecology of Cell Differentiation.

PubMed

van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto

2015-04-01

The dense aggregation of cells on a surface, as seen in biofilms, inevitably results in both environmental and cellular heterogeneity. For example, nutrient gradients can trigger cells to differentiate into various phenotypic states. Not only do cells adapt physiologically to the local environmental conditions, but they also differentiate into cell types that interact with each other. This allows for task differentiation and, hence, the division of labor. In this article, we focus on cell differentiation and the division of labor in three bacterial species: Myxococcus xanthus, Bacillus subtilis, and Pseudomonas aeruginosa. During biofilm formation each of these species differentiates into distinct cell types, in some cases leading to cooperative interactions. The division of labor and the cooperative interactions between cell types are assumed to yield an emergent ecological benefit. Yet in most cases the ecological benefits have yet to be elucidated. A notable exception is M. xanthus, in which cell differentiation within fruiting bodies facilitates the dispersal of spores. We argue that the ecological benefits of the division of labor might best be understood when we consider the dynamic nature of both biofilm formation and degradation.

Outreach to Science Faculty and Students through Research Exhibitions

ERIC Educational Resources Information Center

Chan, Tina; Hebblethwaite, Chris

2014-01-01

Penfield Library at the State University of New York at Oswego (SUNY Oswego) has a gallery exhibit space near the front entrance that is used to showcase student-faculty research and art class projects. This article features the library's outreach efforts to science faculty and students through research exhibitions. The library held an exhibition…

Differences in electrosensory anatomy and social behavior in an area of sympatry between two species of mormyrid electric fishes.

PubMed

Carlson, Bruce A

2016-01-01

Sensory systems play a key role in social behavior by mediating the detection and analysis of communication signals. In mormyrid fishes, electric signals are processed within a dedicated sensory pathway, providing a unique opportunity to relate sensory biology to social behavior. Evolutionary changes within this pathway led to new perceptual abilities that have been linked to increased rates of signal evolution and species diversification in a lineage called 'clade A'. Previous field observations suggest that clade-A species tend to be solitary and territorial, whereas non-clade-A species tend to be clustered in high densities suggestive of schooling or shoaling. To explore behavioral differences between species in these lineages in greater detail, I studied population densities, social interactions, and electric signaling in two mormyrid species, Gnathonemus victoriae (clade A) and Petrocephalus degeni (non-clade A), from Lwamunda Swamp, Uganda. Petrocephalus degeni was found at higher population densities, but intraspecific diversity in electric signal waveform was greater in G. victoriae. In the laboratory, G. victoriae exhibited strong shelter-seeking behavior and competition for shelter, whereas P. degeni were more likely to abandon shelter in the presence of conspecifics as well as electric mimics of signaling conspecifics. In other words, P. degeni exhibited social affiliation whereas G. victoriae exhibited social competition. Further, P. degeni showed correlated electric signaling behavior whereas G. victoriae showed anti-correlated signaling behavior. These findings extend previous reports of social spacing, territoriality, and habitat preference among mormyrid species, suggesting that evolutionary divergence in electrosensory processing relates to differences in social behavior. © 2016. Published by The Company of Biologists Ltd.

Age-Related Developmental and Individual Differences in the Influence of Social and Non-social Distractors on Cognitive Performance.

PubMed

Tan, Patricia Z; Silk, Jennifer S; Dahl, Ronald E; Kronhaus, Dina; Ladouceur, Cecile D

2018-01-01

This study sought to examine age-related differences in the influences of social (neutral, emotional faces) and non-social/non-emotional (shapes) distractor stimuli in children, adolescents, and adults. To assess the degree to which distractor, or task-irrelevant, stimuli of varying social and emotional salience interfere with cognitive performance, children ( N = 12; 8-12y), adolescents ( N = 17; 13-17y), and adults ( N = 17; 18-52y) completed the Emotional Identification and Dynamic Faces (EIDF) task. This task included three types of dynamically-changing distractors: (1) neutral-social (neutral face changing into another face); (2) emotional-social (face changing from 0% emotional to 100% emotional); and (3) non-social/non-emotional (shapes changing from small to large) to index the influence of task-irrelevant social and emotional information on cognition. Results yielded no age-related differences in accuracy but showed an age-related linear reduction in correct reaction times across distractor conditions. An age-related effect in interference was observed, such that children and adults showed slower response times on correct trials with socially-salient distractors; whereas adolescents exhibited faster responses on trials with distractors that included faces rather than shapes. A secondary study goal was to explore individual differences in cognitive interference. Results suggested that regardless of age, low trait anxiety and high effortful control were associated with interference to angry faces. Implications for developmental differences in affective processing, notably the importance of considering the contexts in which purportedly irrelevant social and emotional information might impair, vs. improve cognitive control, are discussed.

The Use of Memories in Understanding Interactive Science and Technology Exhibits

ERIC Educational Resources Information Center

Afonso, Ana S.; Gilbert, John K.

2006-01-01

Framed by a "personal constructivist" perspective, this study analyses visitors' use of spontaneous memories in understanding different types of interactive exhibits, the nature and sources of the retrieved memories, and the way that visitors relate an exhibit analogically to memories of previous exhibits. One hundred and thirteen…

Personality structure and social style in macaques.

PubMed

Adams, Mark James; Majolo, Bonaventura; Ostner, Julia; Schülke, Oliver; De Marco, Arianna; Thierry, Bernard; Engelhardt, Antje; Widdig, Anja; Gerald, Melissa S; Weiss, Alexander

2015-08-01

Why regularities in personality can be described with particular dimensions is a basic question in differential psychology. Nonhuman primates can also be characterized in terms of personality structure. Comparative approaches can help reveal phylogenetic constraints and social and ecological patterns associated with the presence or absence of specific personality dimensions. We sought to determine how different personality structures are related to interspecific variation in social style. Specifically, we examined this question in 6 different species of macaques, because macaque social style is well characterized and can be categorized on a spectrum of despotic (Grade 1) versus tolerant (Grade 4) social styles. We derived personality structures from adjectival ratings of Japanese (Macaca fuscata; Grade 1), Assamese (M. assamensis; Grade 2), Barbary (M. sylvanus; Grade 3), Tonkean (M. tonkeana; Grade 4), and crested (M. nigra; Grade 4) macaques and compared these species with rhesus macaques (M. mulatta; Grade 1) whose personality was previously characterized. Using a nonparametric method, fuzzy set analysis, to identify commonalities in personality dimensions across species, we found that all but 1 species exhibited consistently defined Friendliness and Openness dimensions, but that similarities in personality dimensions capturing aggression and social competence reflect similarities in social styles. These findings suggest that social and phylogenetic relationships contribute to the origin, maintenance, and diversification of personality. (c) 2015 APA, all rights reserved.

Region-specific associations between sex, social status, and oxytocin receptor density in the brains of eusocial rodents.

PubMed

Mooney, S J; Coen, C W; Holmes, M M; Beery, A K

2015-09-10

Naturally occurring variations in neuropeptide receptor distributions in the brain contribute to numerous mammalian social behaviors. In naked mole-rats, which live in large social groups and exhibit remarkable reproductive skew, colony-related social behaviors vary with reproductive status. Here we examined whether variation in social status is associated with variations in the location and/or density of oxytocin binding in this species. Autoradiography was performed to assess forebrain oxytocin receptor (OTR) densities in breeding and non-breeding naked mole-rats of both sexes. Overall, males exhibited higher OTR binding in the medial amygdala in comparison to females. While there were no main effects of reproductive status in any region, a sex difference in OTR binding in the nucleus accumbens was mediated by status. Specifically, breeding males tended to have more OTR binding than breeding females in the nucleus accumbens, while no sex difference was observed in subordinates. These effects suggest that oxytocin may act in a sex- and region-specific way that corresponds to reproductive status and associated social behaviors. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

Interrelations Between Social-Emotional Behavior and Information Achievement of Head Start Children. Report Number 5.

ERIC Educational Resources Information Center

Noble, Marjorie; Hervey, Sarah D.

The purposes of this study were (1) to identify the social-emotional and information-achievement characteristics of 133 children enrolled in Head Start and (2) to explore the interrelationships found to exist between social-emotional behavior, as assessed by the teacher at the outset of the program, and the gains exhibited over the year in…

36 CFR § 1284.20 - Does NARA exhibit privately-owned material?

Code of Federal Regulations, 2013 CFR

2013-07-01

... exhibition cases or other necessary fixtures; and (3) NARA has resources (such as exhibit and security staff) available to produce the special exhibit. (c) The Director of Museum Programs (NWE), in conjunction with the...) The Director of Museum Programs or director of the pertinent Presidential library will inform the...

Modelling the Future: Exhibitions and the Materiality of Education

ERIC Educational Resources Information Center

Lawn, Martin, Ed.

2009-01-01

The role of World Exhibitions in the 19th and early 20th centuries was to confirm a relation between the nation state and modernity. As a display about industries, inventions and identities, the Exhibition, in a sense, put entire nations into an elevated, viewable space. It is a significant element in modernity as comparisons can be made, progress…

Data Collection Methods for Evaluating Museum Programs and Exhibitions

ERIC Educational Resources Information Center

Nelson, Amy Crack; Cohn, Sarah

2015-01-01

Museums often evaluate various aspects of their audiences' experiences, be it what they learn from a program or how they react to an exhibition. Each museum program or exhibition has its own set of goals, which can drive what an evaluator studies and how an evaluation evolves. When designing an evaluation, data collection methods are purposefully…

The Importance of Social Support on Glycemic Control in Low-Income Latinos with Type 2 Diabetes

ERIC Educational Resources Information Center

Rotberg, Britt; Junqueira, Yasmine; Gosdin, Lucas; Mejia, Roberto; Umpierrez, Guillermo E.

2016-01-01

Background: The U.S. Latino population exhibits poorer glycemic control than the white population, leading to more frequent health complications and greater disease severity. Social support has been shown a significant factor in health and well-being. Purpose: To determine the association between glycemic control and social support in patients…

7 CFR Exhibit C to Subpart B of... - Cooperative Agreement (Example)

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 14 2010-01-01 2009-01-01 true Cooperative Agreement (Example) C Exhibit C to Subpart B of Part 1955 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Exhibit C to Subpart B of Part 1955—Cooperative Agreement (Example) Editorial Note: Exhibit C is not...

Circulating Humorous Antitobacco Videos on Social Media.

PubMed

Lee, Moon J; Chen, Fannin

2017-03-01

We investigated whether exposure to same humorous antitobacco videos via different types of social media platforms and contexts (health vs. humor) influences individual's health risk perceptions, attitudes, and behavioral intents. An experiment with a 2 (social media types: YouTube and Facebook) × 2 (message contexts: health-focused and humor-focused contexts) factorial design was conducted. It was found that those who watched the humorous antitobacco videos on Facebook in the health-context exhibited a higher level of risk perception of smoking, less positive attitude toward smokers, and a higher level of intention to avoid smoking in the future than the participants who viewed the same videos on YouTube in the health-context or on Facebook in the humor-context. These findings provide useful practical guidelines in using social media for health communication/promotion. Humorous health promotion messages are best circulated on social networking sites such as Facebook accompanied by others' support for the given health topic (i.e., in health-contexts). Practical/theoretical implications and limitations of the study were further discussed in this article.

Does anxiety sensitivity predict symptoms of panic, depression, and social anxiety?

PubMed

Grant, DeMond M; Beck, J Gayle; Davila, Joanne

2007-09-01

This study examined whether the lower-order factors of the Anxiety Sensitivity Index (ASI) exhibited specificity in predicting symptoms of panic, depression, and social anxiety prospectively. This question was addressed using a sample of undergraduates stratified to represent low, medium, and high levels of anxiety sensitivity (AS). It was hypothesized that the physical concerns, mental concerns, and social concerns subscales of the ASI would predict increases in panic, depression, and social anxiety symptoms, respectively, one year later. Results found that the physical concerns subscale predicted increases in both panic and depressive symptoms. Neither the mental concerns nor the social concerns subscales predicted significant variance in any of the Time 2 symptoms. Theoretical implications of these data for AS are discussed.

Culture, types of social withdrawal, and children's beliefs: An integrative perspective.

PubMed

Chen, Xinyin

2015-06-01

Cultural norms and values provide guidance for children to judge and evaluate specific behavioural characteristics including shyness, unsociability, and social avoidance. The perceptions and attitudes of children, in turn, determine how they exhibit and regulate their behaviours and how they respond to peers' behaviours in social interactions. Investigation of children's beliefs across societies may shed some light on the processes in which culture is involved in shaping the display and developmental significance of different types of social withdrawal. To achieve a better understanding of the role of children's beliefs in mediating cultural influence on development, it will be important to examine how children's beliefs about withdrawn behaviours are associated with patterns of social interactions and relationships in various circumstances. © 2015 The British Psychological Society.

Defining and investigating social disparities in cancer: critical issues.

PubMed

Krieger, Nancy

2005-02-01

Research and action to address social disparities in cancer requires clarity about what constitutes and causes these persistent and onerous inequities in health. Currently, both scientific literature and government documents exhibit important disagreements, confused terminology, and considerable, if not deliberate, vagueness about the meaning of the phrase 'cancer disparities' and the related term 'social disparities in health.' This article accordingly reviews critical issues relevant to cohering understanding of what is meant by 'cancer disparities;' offers a definition premised on the causal contention that social disparities in health, by definition, arise from social inequity; and considers its implications for developing a multidisciplinary research agenda on social inequalities in cancer. Tackling this issue will require rigorous and critical frameworks, questions, and methods derived from multiple disciplines, and will necessarily involve epidemiologic, clinical, and intervention research, both quantitative and qualitative. At issue is making conscious research choices: about which types of disparities we study, in relation to which aspect of cancer, so as to improve the likelihood our research will help inform a society-wide discourse about the extent, origins of, and remedies for social injustices in cancer, thereby aiding efforts to eliminate social inequalities in health.

Childhood social withdrawal, interpersonal impairment, and young adult depression: a mediational model.

PubMed

Katz, Shaina J; Conway, Christopher C; Hammen, Constance L; Brennan, Patricia A; Najman, Jake M

2011-11-01

Building on interpersonal theories of depression, the current study sought to explore whether early childhood social withdrawal serves as a risk factor for depressive symptoms and diagnoses in young adulthood. The researchers hypothesized that social impairment at age 15 would mediate the association between social withdrawal at age 5 and depression by age 20. This mediational model was tested in a community sample of 702 Australian youth followed from mother's pregnancy to youth age 20. Structural equation modeling analyses found support for a model in which childhood social withdrawal predicted adolescent social impairment, which, in turn, predicted depression in young adulthood. Additionally, gender was found to moderate the relationship between adolescent social impairment and depression in early adulthood, with females exhibiting a stronger association between social functioning and depression at the symptom and diagnostic level. This study illuminates one potential pathway from early developing social difficulties to later depressive symptoms and disorders.

Childhood Social Withdrawal, Interpersonal Impairment, and Young Adult Depression: A Mediational Model

PubMed Central

Katz, Shaina J.; Conway, Christopher C.; Hammen, Constance L.; Brennan, Patricia A.; Najman, Jake M.

2012-01-01

Building on interpersonal theories of depression, the current study sought to explore whether early childhood social withdrawal serves as a risk factor for depressive symptoms and diagnoses in young adulthood. The researchers hypothesized that social impairment at age 15 would mediate the association between social withdrawal at age 5 and depression by age 20. This mediational model was tested in a community sample of 702 Australian youth followed from mother’s pregnancy to youth age 20. Structural equation modeling analyses found support for a model in which childhood social withdrawal predicted adolescent social impairment, which, in turn, predicted depression in young adulthood. Additionally, gender was found to moderate the relationship between adolescent social impairment and depression in early adulthood, with females exhibiting a stronger association between social functioning and depression at the symptom and diagnostic level. This study illuminates one potential pathway from early developing social difficulties to later depressive symptoms and disorders. PMID:21744059

Social media in otolaryngology-head and neck surgery.

PubMed

Oyewumi, Modupe; Lee, John; Vescan, Allan

2017-09-01

The objective of this study was to assess the current use of social media tools within Canadian otolaryngology-head and neck surgery (OHNS) programs and to assess the interest within these programs to integrate social media for networking, social, and educational programs. A prospective study from September 2013 to February 2014 was performed involving residents and faculty in Canadian OHNS programs. A 26-item questionnaire was created and sent to staff and resident physicians who met the study inclusion criteria using an online survey tool (http://surveymonkey.com). There were 101 respondents for a 10% response rate. More than half (58.4%) of respondents reported use of social media for personal and/or professional matters. Residents and junior faculty physicians 39 years and younger were more likely to have social media accounts and used them more frequently than their older counterparts. Among staff physicians, pediatric otolaryngologists had the highest rate of use, and otologists exhibited the lowest rate. Cellular phones were the most commonly used devices to access social media sites. Fewer than 35% of social media users failed to separate their personal and professional accounts. Although OHNS trainees and practicing physicians identified the potential benefits of social media tools in their specialty, most were unsure how to apply these tools to their practice. Ours is the first study to assess social media use in OHNS. Otolaryngologists are currently using social media; however, their application as a communication and educational tool in otolaryngology remains to be defined.

Organizational Effectiveness in Higher Education: Faculty Informal Structure as Social Capital

ERIC Educational Resources Information Center

Dose, Jennifer J.

2012-01-01

Higher education institutions encounter complex external environments, requiring increasing responsiveness and innovation. Research on social capital has demonstrated that highly connected employee relational networks are more creative, effective, and exhibit higher member satisfaction. The present study examines one college to demonstrate how…

Dominance relationships in Syrian hamsters modulate neuroendocrine and behavioral responses to social stress.

PubMed

Dulka, Brooke N; Koul-Tiwari, Richa; Grizzell, J Alex; Harvey, Marquinta L; Datta, Subimal; Cooper, Matthew A

2018-06-22

Stress is a well-known risk factor for psychopathology and rodent models of social defeat have strong face, etiological, construct and predictive validity for these conditions. Syrian hamsters are highly aggressive and territorial, but after an acute social defeat experience they become submissive and no longer defend their home territory, even from a smaller, non-aggressive intruder. This defeat-induced change in social behavior is called conditioned defeat (CD). We have shown that dominant hamsters show increased neural activity in the ventromedial prefrontal cortex (vmPFC) following social defeat stress and exhibit a reduced CD response at social interaction testing compared to subordinates. Although the vmPFC can inhibit the neuroendocrine stress response, it is unknown whether dominants and subordinates differ in stress-induced activity of the extended hypothalamic-pituitary-adrenal (HPA) axis. Here, we show that, following acute social defeat, dominants exhibit decreased submissive and defensive behavior compared to subordinates but do not differ from subordinates or social status controls (SSCs) in defeat-induced cortisol concentrations. Furthermore, both dominants and SSCs show greater corticotropin-releasing hormone (CRH) mRNA expression in the basolateral/central amygdala compared to subordinates, while there was no effect of social status on CRH mRNA expression in the paraventricular nucleus of the hypothalamus or bed nucleus of the stria terminalis. Overall, status-dependent differences in the CD response do not appear linked to changes in stress-induced cortisol concentrations or CRH gene expression, which is consistent with the view that stress resilience is not a lack of a physiological stress response but the addition of stress coping mechanisms. Lay summary Dominant hamsters show resistance to the behavioral effects of acute social defeat compared to subordinates, but it is unclear whether social status modulates the neuroendocrine stress response

Emotion Recognition and Social/Role Dysfunction in Non-Clinical Psychosis

PubMed Central

Pelletier, Andrea L.; Dean, Derek J.; Lunsford-Avery, Jessica R.; Smith, Ashley K.; Orr, Joseph M.; Gupta, Tina; Millman, Zachary B.; Mittal, Vijay A.

2013-01-01

As researchers continue to understand non-clinical psychosis (NCP- brief psychotic-like experiences occurring in 5–7% of the general population; van Os et al., 2009), it is becoming evident that functioning deficits and facial emotion recognition (FER) impairment characterize this phenomenon. However, the extent to which these domains are related remains unclear. Social/role functioning and FER were assessed in 65 adolescents/young adults exhibiting Low and High-NCP. Results indicate that FER and social/role functioning deficits were present in the High-NCP group, and that the domains were associated in this group alone. Taken together, findings suggest that a core emotive deficit is tied to broader social/role dysfunction in NCP. PMID:23182437

7 CFR Exhibit C to Subpart B of... - Cooperative Agreement (Example)

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 14 2012-01-01 2012-01-01 false Cooperative Agreement (Example) C Exhibit C to... Pt. 1955, Subpt. B, Note Exhibit C to Subpart B of Part 1955—Cooperative Agreement (Example) Editorial Note: Exhibit C is not published in the Code of Federal Regulations. It is available in any FmHA...

7 CFR Exhibit C to Subpart B of... - Cooperative Agreement (Example)

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 14 2011-01-01 2011-01-01 false Cooperative Agreement (Example) C Exhibit C to... Pt. 1955, Subpt. B, Note Exhibit C to Subpart B of Part 1955—Cooperative Agreement (Example) Editorial Note: Exhibit C is not published in the Code of Federal Regulations. It is available in any FmHA...

7 CFR Exhibit C to Subpart B of... - Cooperative Agreement (Example)

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 14 2014-01-01 2014-01-01 false Cooperative Agreement (Example) C Exhibit C to... Pt. 1955, Subpt. B, Note Exhibit C to Subpart B of Part 1955—Cooperative Agreement (Example) Editorial Note: Exhibit C is not published in the Code of Federal Regulations. It is available in any FmHA...

Social influences of error monitoring in adolescent girls.

PubMed

Barker, Tyson V; Troller-Renfree, Sonya V; Bowman, Lindsay C; Pine, Daniel S; Fox, Nathan A

2018-04-22

Adolescence is a developmental period characterized by increased social motivation and a heightened concern of peer evaluation. However, little research has examined social influences on neural functioning in adolescence. One psychophysiological measure of motivation, the error-related negativity (ERN), is an ERP following an error. In adults, the ERN is enhanced by contextual factors that influence motivation, such as social observation and evaluation. The current study examined relations among age and neural responses in social contexts in adolescence. Seventy-six adolescent girls (9-17 years old) completed a flanker task under two different conditions. In the social condition, adolescent girls were informed that two other adolescents would be observing and providing feedback about their performance. In the nonsocial condition, adolescent girls completed a flanker task alone and were told feedback was computer generated. Results revealed that younger adolescents exhibited a larger ERN in social contexts than nonsocial contexts. In contrast, there were no differences in the ERN between contexts among older adolescents. In addition, enhancements of the ERN in social contexts among younger adolescents diminished the relation between the ERN and age. These findings suggest that the ERN is sensitive to social contexts in early adolescence, and developmental changes in the ERN may be partially explained by contextual factors that influence motivation. © 2018 Society for Psychophysiological Research.

Common marmosets show social plasticity and group-level similarity in personality