Pattern-formation mechanisms in motility mutants of Myxococcus xanthus

PubMed Central

Starruß, Jörn; Peruani, Fernando; Jakovljevic, Vladimir; Søgaard-Andersen, Lotte; Deutsch, Andreas; Bär, Markus

2012-01-01

Formation of spatial patterns of cells is a recurring theme in biology and often depends on regulated cell motility. Motility of the rod-shaped cells of the bacterium Myxococcus xanthus depends on two motility machineries, type IV pili (giving rise to S-motility) and the gliding motility apparatus (giving rise to A-motility). Cell motility is regulated by occasional reversals. Moving M. xanthus cells can organize into spreading colonies or spore-filled fruiting bodies, depending on their nutritional status. To ultimately understand these two pattern-formation processes and the contributions by the two motility machineries, as well as the cell reversal machinery, we analyse spatial self-organization in three M. xanthus strains: (i) a mutant that moves unidirectionally without reversing by the A-motility system only, (ii) a unidirectional mutant that is also equipped with the S-motility system, and (iii) the wild-type that, in addition to the two motility systems, occasionally reverses its direction of movement. The mutant moving by means of the A-engine illustrates that collective motion in the form of large moving clusters can arise in gliding bacteria owing to steric interactions of the rod-shaped cells, without the need of invoking any biochemical signal regulation. The two-engine strain mutant reveals that the same phenomenon emerges when both motility systems are present, and as long as cells exhibit unidirectional motion only. From the study of these two strains, we conclude that unidirectional cell motion induces the formation of large moving clusters at low and intermediate densities, while it results in vortex formation at very high densities. These findings are consistent with what is known from self-propelled rod models, which strongly suggests that the combined effect of self-propulsion and volume exclusion interactions is the pattern-formation mechanism leading to the observed phenomena. On the other hand, we learn that when cells occasionally reverse

Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

PubMed

Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

2002-07-26

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Data-driven modeling reveals cell behaviors controlling self-organization during Myxococcus xanthus development

PubMed Central

Cotter, Christopher R.; Schüttler, Heinz-Bernd; Igoshin, Oleg A.; Shimkets, Lawrence J.

2017-01-01

Collective cell movement is critical to the emergent properties of many multicellular systems, including microbial self-organization in biofilms, embryogenesis, wound healing, and cancer metastasis. However, even the best-studied systems lack a complete picture of how diverse physical and chemical cues act upon individual cells to ensure coordinated multicellular behavior. Known for its social developmental cycle, the bacterium Myxococcus xanthus uses coordinated movement to generate three-dimensional aggregates called fruiting bodies. Despite extensive progress in identifying genes controlling fruiting body development, cell behaviors and cell–cell communication mechanisms that mediate aggregation are largely unknown. We developed an approach to examine emergent behaviors that couples fluorescent cell tracking with data-driven models. A unique feature of this approach is the ability to identify cell behaviors affecting the observed aggregation dynamics without full knowledge of the underlying biological mechanisms. The fluorescent cell tracking revealed large deviations in the behavior of individual cells. Our modeling method indicated that decreased cell motility inside the aggregates, a biased walk toward aggregate centroids, and alignment among neighboring cells in a radial direction to the nearest aggregate are behaviors that enhance aggregation dynamics. Our modeling method also revealed that aggregation is generally robust to perturbations in these behaviors and identified possible compensatory mechanisms. The resulting approach of directly combining behavior quantification with data-driven simulations can be applied to more complex systems of collective cell movement without prior knowledge of the cellular machinery and behavioral cues. PMID:28533367

Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

PubMed

Cusick, John K; Hager, Elizabeth; Gill, Ronald E

2015-01-01

The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The lethal cargo of Myxococcus xanthus outer membrane vesicles.

PubMed

Berleman, James E; Allen, Simon; Danielewicz, Megan A; Remis, Jonathan P; Gorur, Amita; Cunha, Jack; Hadi, Masood Z; Zusman, David R; Northen, Trent R; Witkowska, H Ewa; Auer, Manfred

2014-01-01

Myxococcus xanthus is a bacterial micro-predator known for hunting other microbes in a wolf pack-like manner. Outer membrane vesicles (OMVs) are produced in large quantities by M. xanthus and have a highly organized structure in the extracellular milieu, sometimes occurring in chains that link neighboring cells within a biofilm. OMVs may be a vehicle for mediating wolf pack activity by delivering hydrolytic enzymes and antibiotics aimed at killing prey microbes. Here, both the protein and small molecule cargo of the OMV and membrane fractions of M. xanthus were characterized and compared. Our analysis indicates a number of proteins that are OMV-specific or OMV-enriched, including several with putative hydrolytic function. Secondary metabolite profiling of OMVs identifies 16 molecules, many associated with antibiotic activities. Several hydrolytic enzyme homologs were identified, including the protein encoded by MXAN_3564 (mepA), an M36 protease homolog. Genetic disruption of mepA leads to a significant reduction in extracellular protease activity suggesting MepA is part of the long-predicted (yet to date undetermined) extracellular protease suite of M. xanthus.

Myxococcus xanthus Developmental Cell Fate Production: Heterogeneous Accumulation of Developmental Regulatory Proteins and Reexamination of the Role of MazF in Developmental Lysis

PubMed Central

Lee, Bongsoo; Holkenbrink, Carina; Treuner-Lange, Anke

2012-01-01

Myxococcus xanthus undergoes a starvation-induced multicellular developmental program during which cells partition into three known fates: (i) aggregation into fruiting bodies followed by differentiation into spores, (ii) lysis, or (iii) differentiation into nonaggregating persister-like cells, termed peripheral rods. As a first step to characterize cell fate segregation, we enumerated total, aggregating, and nonaggregating cells throughout the developmental program. We demonstrate that both cell lysis and cell aggregation begin with similar timing at approximately 24 h after induction of development. Examination of several known regulatory proteins in the separated aggregated and nonaggregated cell fractions revealed previously unknown heterogeneity in the accumulation patterns of proteins involved in type IV pilus (T4P)-mediated motility (PilC and PilA) and regulation of development (MrpC, FruA, and C-signal). As part of our characterization of the cell lysis fate, we set out to investigate the unorthodox MazF-MrpC toxin-antitoxin system which was previously proposed to induce programmed cell death (PCD). We demonstrate that deletion of mazF in two different wild-type M. xanthus laboratory strains does not significantly reduce developmental cell lysis, suggesting that MazF's role in promoting PCD is an adaption to the mutant background strain used previously. PMID:22493014

Earthquake-like dynamics in Myxococcus xanthus social motility

PubMed Central

Gibiansky, Maxsim L.; Hu, Wei; Dahmen, Karin A.; Shi, Wenyuan; Wong, Gerard C. L.

2013-01-01

Myxococcus xanthus is a bacterium capable of complex social organization. Its characteristic social (“S”)-motility mechanism is mediated by type IV pili (TFP), linear actuator appendages that propel the bacterium along a surface. TFP are known to bind to secreted exopolysaccharides (EPS), but it is unclear how M. xanthus manages to use the TFP-EPS technology common to many bacteria to achieve its unique coordinated multicellular movements. We examine M. xanthus S-motility, using high-resolution particle-tracking algorithms, and observe aperiodic stick–slip movements. We show that they are not due to chemotaxis, but are instead consistent with a constant TFP-generated force interacting with EPS, which functions both as a glue and as a lubricant. These movements are quantitatively homologous to the dynamics of earthquakes and other crackling noise systems. These systems exhibit critical behavior, which is characterized by a statistical hierarchy of discrete “avalanche” motions described by a power law distribution. The measured critical exponents from M. xanthus are consistent with mean field theoretical models and with other crackling noise systems, and the measured Lyapunov exponent suggests the existence of highly branched EPS. Such molecular architectures, which are common for efficient lubricants but rare in bacterial EPS, may be necessary for S-motility: We show that the TFP of leading “locomotive” cells initiate the collective motion of follower cells, indicating that lubricating EPS may alleviate the force generation requirements on the lead cell and thus make S-motility possible. PMID:23341622

Mechanism for Collective Cell Alignment in Myxococcus xanthus Bacteria

PubMed Central

Balagam, Rajesh; Igoshin, Oleg A.

2015-01-01

Myxococcus xanthus cells self-organize into aligned groups, clusters, at various stages of their lifecycle. Formation of these clusters is crucial for the complex dynamic multi-cellular behavior of these bacteria. However, the mechanism underlying the cell alignment and clustering is not fully understood. Motivated by studies of clustering in self-propelled rods, we hypothesized that M. xanthus cells can align and form clusters through pure mechanical interactions among cells and between cells and substrate. We test this hypothesis using an agent-based simulation framework in which each agent is based on the biophysical model of an individual M. xanthus cell. We show that model agents, under realistic cell flexibility values, can align and form cell clusters but only when periodic reversals of cell directions are suppressed. However, by extending our model to introduce the observed ability of cells to deposit and follow slime trails, we show that effective trail-following leads to clusters in reversing cells. Furthermore, we conclude that mechanical cell alignment combined with slime-trail-following is sufficient to explain the distinct clustering behaviors observed for wild-type and non-reversing M. xanthus mutants in recent experiments. Our results are robust to variation in model parameters, match the experimentally observed trends and can be applied to understand surface motility patterns of other bacterial species. PMID:26308508

Fatty Acids of Myxococcus xanthus

PubMed Central

Ware, Judith C.; Dworkin, Martin

1973-01-01

Fatty acids were extracted from saponified vegetative cells and myxospores of Myxococcus xanthus and examined as the methyl esters by gas-liquid chromatography. The acids consisted mainly of C14 to C17 species. Branched acids predominated, and iso-pentadecanoic acid constituted half or more of the mixture. The other leading component (11–28%) was found to be 11-n-hexadecenoic acid. Among the unsaturated acids were two diunsaturated ones, an n-hexadecadienoic acid and an iso-heptadecadienoic acid. No significant differences between the fatty acid compositions of the vegetative cells and myxospores could be detected. The fatty acid composition of M. xanthus was found to be markedly similar to that of Stigmatella aurantiaca. It is suggested that a fatty acid pattern consisting of a large proportion of iso-branched C15 and C17 acids and a substantial amount of an n-16:1 acid is characteristic of myxobacteria. PMID:4197903

Mechanism of cell alignment in groups of Myxococcus xanthus bacteria

NASA Astrophysics Data System (ADS)

Balgam, Rajesh; Igoshin, Oleg

2015-03-01

Myxococcus xanthus is a model for studying self-organization in bacteria. These flexible cylindrical bacteria move along. In groups, M. xanthus cells align themselves into dynamic cell clusters but the mechanism underlying their formation is unknown. It has been shown that steric interactions can cause alignment in self-propelled hard rods but it is not clear how flexibility and reversals affect the alignment and cluster formation. We have investigated cell alignment process using our biophysical model of M. xanthus cell in an agent-based simulation framework under realistic cell flexibility values. We observed that flexible model cells can form aligned cell clusters when reversals are suppressed but these clusters disappeared when reversals frequency becomes similar to the observed value. However, M. xanthus cells follow slime (polysaccharide gel like material) trails left by other cells and we show that implementing this into our model rescues cell clustering for reversing cells. Our results show that slime following along with periodic cell reversals act as positive feedback to reinforce existing slime trails and recruit more cells. Furthermore, we have observed that mechanical cell alignment combined with slime following is sufficient to explain the distinct clustering patterns of reversing and non-reversing cells as observed in recent experiments. This work is supported by NSF MCB 0845919 and 1411780.

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage.

PubMed

Dey, Arup; Vassallo, Christopher N; Conklin, Austin C; Pathak, Darshankumar T; Troselj, Vera; Wall, Daniel

2016-01-19

Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large "polyploid prophage," Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population "addicted" to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their siblings, and in part, this is

Sibling Rivalry in Myxococcus xanthus Is Mediated by Kin Recognition and a Polyploid Prophage

PubMed Central

Dey, Arup; Vassallo, Christopher N.; Conklin, Austin C.; Pathak, Darshankumar T.; Troselj, Vera

2016-01-01

ABSTRACT Myxobacteria form complex social communities that elicit multicellular behaviors. One such behavior is kin recognition, in which cells identify siblings via their polymorphic TraA cell surface receptor, to transiently fuse outer membranes and exchange their contents. In addition, outer membrane exchange (OME) regulates behaviors, such as inhibition of wild-type Myxococcus xanthus (DK1622) from swarming. Here we monitored the fate of motile cells and surprisingly found they were killed by nonmotile siblings. The kill phenotype required OME (i.e., was TraA dependent). The genetic basis of killing was traced to ancestral strains used to construct DK1622. Specifically, the kill phenotype mapped to a large “polyploid prophage,” Mx alpha. Sensitive strains contained a 200-kb deletion that removed two of three Mx alpha units. To explain these results, we suggest that Mx alpha expresses a toxin-antitoxin cassette that uses the OME machinery of M. xanthus to transfer a toxin that makes the population “addicted” to Mx alpha. Thus, siblings that lost Mx alpha units (no immunity) are killed by cells that harbor the element. To test this, an Mx alpha-harboring laboratory strain was engineered (by traA allele swap) to recognize a closely related species, Myxococcus fulvus. As a result, M. fulvus, which lacks Mx alpha, was killed. These TraA-mediated antagonisms provide an explanation for how kin recognition specificity might have evolved in myxobacteria. That is, recognition specificity is determined by polymorphisms in traA, which we hypothesize were selected for because OME with non-kin leads to lethal outcomes. IMPORTANCE The transition from single cell to multicellular life is considered a major evolutionary event. Myxobacteria have successfully made this transition. For example, in response to starvation, individual cells aggregate into multicellular fruiting bodies wherein cells differentiate into spores. To build fruits, cells need to recognize their

Rhizobial galactoglucan determines the predatory pattern of Myxococcus xanthus and protects Sinorhizobium meliloti from predation

PubMed Central

Pérez, Juana; Jiménez-Zurdo, José I.; Martínez-Abarca, Francisco; Millán, Vicenta; Shimkets, Lawrence J.; Muñoz-Dorado, José

2014-01-01

Summary Myxococcus xanthus is a social bacterium that preys on prokaryotic and eukaryotic microorganisms. Co-culture of M. xanthus with reference laboratory strains and field isolates of the legume symbiont Sinorhizobium meliloti revealed two different predatory patterns that resemble frontal and wolfpack attacks. Use of mutants impaired in the two types of M. xanthus surface motility (A or adventurous and S or social motility) and a csgA mutant, which is unable to form macroscopic travelling waves known as ripples, has demonstrated that both motility systems but not rippling are required for efficient predation. To avoid frontal attack and reduce killing rates, rhizobial cells require a functional expR gene. ExpR regulates expression of genes involved in a variety of functions. The use of S. meliloti mutants impaired in several of these functions revealed that the exopolysaccharide galactoglucan (EPS II) is the major determinant of the M. xanthus predatory pattern. The data also suggest that this biopolymer confers an ecological advantage to rhizobial survival in soil, which may have broad environmental implications. PMID:24707988

Bacterial communities in the fruit bodies of ground basidiomycetes

NASA Astrophysics Data System (ADS)

Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

2015-06-01

Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

Fruit body formation on silkworm by Cordyceps militaris

USDA-ARS?s Scientific Manuscript database

Injection inoculation protocols for fruit body formation of Cordyceps militaris were investigated to improve the incidence of infection in the silkworm species Bombyx mori. Injection, with suspensions of C. militaris hyphal bodies into living silkworm pupae, was used to test for fruit body productio...

A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis.

PubMed

Burchard, R P; Dworkin, M

1966-03-01

Burchard, Robert P. (University of Minnesota, Minneapolis), and M. Dworkin. A bacteriophage for Myxococcus xanthus: isolation, characterization and relation of infectivity to host morphogenesis. J. Bacteriol. 91:1305-1313. 1966.-A bacteriophage (MX-1) infecting Myxococcus xanthus FB(t) has been isolated from cow dung. The bacteriophage particle is approximately 175 mmu long. A tail about 100 mmu in length is encased in a contractile sheath and terminates in a tail plate. The head is polyhedral with a width of about 75 mmu. The nucleic acid of the bacteriophage is deoxyribonucleic acid and has a guanine plus cytosine content of 55.5%. The bacteriophage requires 10(-3)m Ca(++) and 10(-2)m monovalent cation for optimal adsorption. Grown on vegetative cells of M. xanthus FB(t) at 30 C in 2% Casitone medium, the bacteriophage has a latent period of 120 min and a burst size of approximately 100. Host range studies indicate that three strains of M. xanthus including a morphogenetic mutant are sensitive to the bacteriophage, whereas M. fulvus, Cytophaga, Sporocytophaga myxococcoides, and a fourth strain of M. xanthus are not. Of the two cellular forms characteristic of the Myxococcus life cycle, the bacteriophage infect only the vegetative cells; they do not adsorb to microcysts. Ability to adsorb bacteriophage is lost between 65 and 75 min after initiation of the relatively synchronous conversion of vegetative cells to microcysts. The bacteriophage does not adsorb to spheroplasts. After the appearance of visible morphogenesis and before the loss of bacteriophage receptor sites, addition of bacteriophage results in the formation of microcysts which give rise to infective centers only upon germination. The possibility that the infected microcysts are harboring intact bacteriophages has been eliminated.

Purification and Properties of Myxococcus xanthus C-Factor, an Intercellular Signaling Protein

NASA Astrophysics Data System (ADS)

Kim, Seung K.; Kaiser, Dale

1990-05-01

C-factor, a Myxococcus xanthus protein that restores the developmental defects of a class of nonautonomous mutants resulting from mutation of the csgA gene, has been purified approximately 1000-fold from starved wild-type cells. The monomeric form of C-factor is a single polypeptide with a molecular mass of 17 kDa that can be solubilized by detergent from membrane components. Characterization by gel filtration and denaturing gel electrophoresis suggests that biologically active C-factor is a dimer composed of two 17-kDa monomers. Antibodies against a form of the M. xanthus csgA gene product overexpressed in Escherichia coli react with purified C-factor.

Myxobacteria Fruiting Body Formation

NASA Astrophysics Data System (ADS)

Jiang, Yi

2006-03-01

Myxobacteria are social bacteria that swarm and glide on surfaces, and feed cooperatively. When starved, tens of thousands of cells change their movement pattern from outward spreading to inward concentration; they form aggregates that become fruiting bodies, inside which cells differentiate into nonmotile, environmentally resistant spores. Traditionally, cell aggregation has been considered to imply chemotaxis, a long-range cell interaction mediated by diffusing chemicals. However, myxobacteria aggregation is the consequence of direct cell-contact interactions. I will review our recent efforts in modeling the fruiting body formation of Myxobacteria, using lattice gas cellular automata models that are based on local cell-cell contact signaling. These models have reproduced the individual phases in Myxobacteria development such as the rippling, streaming, early aggregation and the final sporulation; the models can be unified to simulate the whole developmental process of Myxobacteria.

Identification of Major Enzymes Involved in the Synthesis of Diadenosine Tetraphosphate and/or Adenosine Tetraphosphate in Myxococcus xanthus.

PubMed

Kimura, Yoshio; Tanaka, Chihiro; Oka, Manami

2018-07-01

Myxococcus xanthus generates diadenosine tetraphosphates (Ap 4 A) and diadenosine pentaphosphates (Ap 5 A) under various stress conditions. M. xanthus lysyl-tRNA synthetase (LysS) efficiently synthesizes Ap 4 A from ATP, Ap 5 A from ATP and adenosine tetraphosphate (Ap 4 ), and Ap 4 from ATP and triphosphate. To identify other M. xanthus enzymes that can catalyze Ap 4 A and Ap 4 synthesis, 15 M. xanthus aminoacyl-tRNA synthetases (aaRSs), four acyl-CoA synthetases (Acys), three acetyl-CoA synthetases (Aces), phosphoglycerate kinase (Pgk), and adenylate kinase (Adk) were expressed in Escherichia coli and examined for Ap 4 A or Ap 4 synthetase activity using ATP or ATP and triphosphate as substrates. Among the tested enzymes, LysS had the highest Ap 4 A synthetase activity. AlaRS, SerRS, and LeuRS1 showed high ADP synthetase activity with ATP as a substrate in the presence of pyrophosphatase, and also demonstrated the ability to produce Ap 4 from ATP and triphosphate in the absence of pyrophosphatase. Ap 4 formation by AlaRS, SerRS, and LeuRS1 was approximately 4- to 13-fold higher compared with that of Ap 4 A, suggesting that these enzymes prefer triphosphate over ATP as a substrate in the second reaction. Some of the recombinant M. xanthus Acys and Aces also synthesized Ap 4 from ATP and triphosphate. However, Pgk was capable of catalyzing the production of Ap 4 from ATP and 3-phosphoglycerate in the presence of Mg 2+ and did not require triphosphate, suggesting that this enzyme is mainly responsible for Ap 4 synthesis in M. xanthus.

Genes Expressed During Fruiting Body Formation of Agrocybe cylindracea

PubMed Central

Shim, Sung Mi; Kim, Sang Beom; Kim, Hey Young; Rho, Hyun-Su; Lee, Hyun Sook; Lee, Min Woong; Lee, U Youn; Im, Kyung Hoan

2006-01-01

Agrocybe cylindracea, an edible mushroom belonging to Bolbitiaceae, Agaricales, is widely used as invaluable medicinal material in the oriental countries. This study was initiated to find the genes expressed during the fruiting body formation of A. cylindracea. The cDNAs expressed differentially during fruiting body morphogenesis of A. cylindracea were isolated through subtractive hybridization between vegetative mycelia and fruiting bodies. The cDNAs expressed in the fruiting body morphogenesis of A. cylindracea were cloned and twenty genes were identified. Eleven were homologous to genes of known functions, three were homologous to genes in other organism without any function known. Six were completely novel genes specific to A. cylindracea so far examined. Some genes with known functions were a pleurotolysin, a self-assembling poreforming cytolysins; Aa-Pri1 and Pir2p, specifically induced genes during fruiting initiation of other mushroom, Agrocybe aegerita; an amino acid permease; a cytochrome P450; a MADS-box gene; a peptidylprolyl isomerase; and a serine proteinase. For other clones, no clear function was annotated so far. We believe the first report of the differentially expressed genes in fruiting process of A. cylindracea will be great helps for further research. PMID:24039501

Myxococcus xanthus induces actinorhodin overproduction and aerial mycelium formation by Streptomyces coelicolor

PubMed Central

Pérez, Juana; Muñoz‐Dorado, José; Braña, Alfredo F.; Shimkets, Lawrence J.; Sevillano, Laura; Santamaría, Ramón I.

2011-01-01

Summary Interaction of the predatory myxobacterium Myxococcus xanthus with the non‐motile, antibiotic producer Streptomyces coelicolor was examined using a variety of experimental approaches. Myxococcus xanthus cells prey on S. coelicolor, forming streams of ordered cells that lyse the S. coelicolor hyphae in the contact area between the two colonies. The interaction increases actinorhodin production by S. coelicolor up to 20‐fold and triggers aerial mycelium production. Other bacteria are also able to induce these processes in S. coelicolor though to a lesser extent. These studies offer new clues about the expression of genes that remain silent or are expressed at low level in axenic cultures and open the possibility of overproducing compounds of biotechnological interest by using potent inducers synthesized by other bacteria. PMID:21342463

LC-MS/MS profiling-based secondary metabolite screening of Myxococcus xanthus.

PubMed

Kim, Jiyoung; Choi, Jung Nam; Kim, Pil; Sok, Dai-Eun; Nam, Soo-Wan; Lee, Choong Hwan

2009-01-01

Myxobacteria, Gram-negative soil bacteria, are a well-known producer of bioactive secondary metabolites. Therefore, this study presents a methodological approach for the high-throughput screening of secondary metabolites from 4 wild-type Myxococcus xanthus strains. First, electrospray ionization mass spectrometry (ESI-MS) was performed using extracellular crude extracts. As a result, 22 metabolite peaks were detected, and the metabolite profiling was then conducted using the m/z value, retention time, and MS/MS fragmentation pattern analyses. Among the peaks, one unknown compound peak was identified as analogous to the myxalamid A, B, and C series. An analysis of the tandem mass spectrometric fragmentation patterns and HR-MS identified myxalamid K as a new compound derived from M. xanthus. In conclusion, LC-MS/MS-based chemical screening of diverse secondary metabolites would appear to be an effective approach for discovering unknown microbial secondary metabolites.

Exopolysaccharide microchannels direct bacterial motility and organize multicellular behavior

DOE PAGES

Berleman, James E.; Zemla, Marcin; Remis, Jonathan P.; ...

2016-05-06

The myxobacteria are a family of soil bacteria that form biofilms of complex architecture, aligned multilayered swarms or fruiting body structures that are simple or branched aggregates containing myxospores. Here, we examined the structural role of matrix exopolysaccharide (EPS) in the organization of these surface-dwelling bacterial cells. Using time-lapse light and fluorescence microscopy, as well as transmission electron microscopy and focused ion beam/scanning electron microscopy (FIB/SEM) electron microscopy, we found that Myxococcus xanthus cell organization in biofilms is dependent on the formation of EPS microchannels. Cells are highly organized within the three-dimensional structure of EPS microchannels that are required formore » cell alignment and advancement on surfaces. Mutants lacking EPS showed a lack of cell orientation and poor colony migration. Purified, cell-free EPS retains a channel-like structure, and can complement EPS - mutant motility defects. In addition, EPS provides the cooperative structure for fruiting body formation in both the simple mounds of M. xanthus and the complex, tree-like structures of Chondromyces crocatus. We furthermore investigated the possibility that EPS impacts community structure as a shared resource facilitating cooperative migration among closely related isolates of M. xanthus.« less

Gliding Motility Revisited: How Do the Myxobacteria Move without Flagella?

PubMed Central

Mauriello, Emilia M. F.; Mignot, Tâm; Yang, Zhaomin; Zusman, David R.

2010-01-01

Summary: In bacteria, motility is important for a wide variety of biological functions such as virulence, fruiting body formation, and biofilm formation. While most bacteria move by using specialized appendages, usually external or periplasmic flagella, some bacteria use other mechanisms for their movements that are less well characterized. These mechanisms do not always exhibit obvious motility structures. Myxococcus xanthus is a motile bacterium that does not produce flagella but glides slowly over solid surfaces. How M. xanthus moves has remained a puzzle that has challenged microbiologists for over 50 years. Fortunately, recent advances in the analysis of motility mutants, bioinformatics, and protein localization have revealed likely mechanisms for the two M. xanthus motility systems. These results are summarized in this review. PMID:20508248

Nanoscale visualization and characterization of Myxococcus xanthus cells with atomic force microscopy

PubMed Central

Pelling, Andrew E.; Li, Yinuo; Shi, Wenyuan; Gimzewski, James K.

2005-01-01

Multicellular microbial communities are the predominant form of existence for microorganisms in nature. As one of the most primitive social organisms, Myxococcus xanthus has been an ideal model bacterium for studying intercellular interaction and multicellular organization. Through previous genetic and EM studies, various extracellular appendages and matrix components have been found to be involved in the social behavior of M. xanthus, but none of them was directly visualized and analyzed under native conditions. Here, we used atomic force microscopy (AFM) imaging and in vivo force spectroscopy to characterize these cellular structures under native conditions. AFM imaging revealed morphological details on the extracellular ultrastructures at an unprecedented resolution, and in vivo force spectroscopy of live cells in fluid allowed us to nanomechanically characterize extracellular polymeric substances. The findings provide the basis for AFM as a useful tool for investigating microbial-surface ultrastructures and nanomechanical properties under native conditions. PMID:15840722

Exopolysaccharide-Independent Social Motility of Myxococcus xanthus

PubMed Central

Hu, Wei; Hossain, Muhaiminu; Lux, Renate; Wang, Jing; Yang, Zhe; Li, Yuezhong; Shi, Wenyuan

2011-01-01

Social motility (S motility), the coordinated movement of large cell groups on agar surfaces, of Myxococcus xanthus requires type IV pili (TFP) and exopolysaccharides (EPS). Previous models proposed that this behavior, which only occurred within cell groups, requires cycles of TFP extension and retraction triggered by the close interaction of TFP with EPS. However, the curious observation that M. xanthus can perform TFP-dependent motility at a single-cell level when placed onto polystyrene surfaces in a highly viscous medium containing 1% methylcellulose indicated that “S motility” is not limited to group movements. In an apparent further challenge of the previous findings for S motility, mutants defective in EPS production were found to perform TFP-dependent motility on polystyrene surface in methylcellulose-containing medium. By exploring the interactions between pilin and surface materials, we found that the binding of TFP onto polystyrene surfaces eliminated the requirement for EPS in EPS- cells and thus enabled TFP-dependent motility on a single cell level. However, the presence of a general anchoring surface in a viscous environment could not substitute for the role of cell surface EPS in group movement. Furthermore, EPS was found to serve as a self-produced anchoring substrate that can be shed onto surfaces to enable cells to conduct TFP-dependent motility regardless of surface properties. These results suggested that in certain environments, such as in methylcellulose solution, the cells could bypass the need for EPS to anchor their TPF and conduct single-cell S motility to promote exploratory movement of colonies over new specific surfaces. PMID:21245931

Fruiting bodies of the social amoeba Dictyostelium discoideum increase spore transport by Drosophila

PubMed Central

2014-01-01

Background Many microbial phenotypes are the product of cooperative interactions among cells, but their putative fitness benefits are often not well understood. In the cellular slime mold Dictyostelium discoideum, unicellular amoebae aggregate when starved and form multicellular fruiting bodies in which stress-resistant spores are held aloft by dead stalk cells. Fruiting bodies are thought to be adaptations for dispersing spores to new feeding sites, but this has not been directly tested. Here we experimentally test whether fruiting bodies increase the rate at which spores are acquired by passing invertebrates. Results Drosophila melanogaster accumulate spores on their surfaces more quickly when exposed to intact fruiting bodies than when exposed to fruiting bodies physically disrupted to dislodge spore masses from stalks. Flies also ingest and excrete spores that still express a red fluorescent protein marker. Conclusions Multicellular fruiting bodies created by D. discoideum increase the likelihood that invertebrates acquire spores that can then be transported to new feeding sites. These results thus support the long-hypothesized dispersal benefits of altruism in a model system for microbial cooperation. PMID:24884856

De novo transcriptomic analysis during Lentinula edodes fruiting body growth.

PubMed

Wang, Yingzhu; Zeng, Xianlu; Liu, Wenguang

2018-01-30

The fruiting body of Lentinula edodes is a popular edible mushroom, and extracts from the mycelium and the fruiting body of this species have diverse therapeutic potential. To gain insights into the molecular mechanisms underlying the fruiting body growth of L. edodes from the early bud stage (EBS), through the intermediate developing stage (IDS), to the fully developed stage (FDS), we performed de novo transcriptomic analysis using high-throughput Illumina RNA-sequencing. First, we generated three cDNA libraries representative of the three respective stages. We then obtained 38,933,148, 44,594,472, and 37,905,646 high-quality reads from the respective libraries and assembled the reads into 25,104 transcriptional contigs, containing 15,199 unigenes. We found that only 9331 of the unigenes had been annotated in the NCBI non-redundant protein database, and we functionally annotated 4758 of them through Gene Ontology (GO) analysis and 2921 of them through Clusters of Orthologous Groups of proteins (COGs) analysis. We also assigned 3995 unigenes to metabolic pathways by using the Kyoto Encyclopedia of Genes and Genomes (KEGG). We further identified 399 differentially expressed genes (DEGs) between EBS and IDS, 1428 between IDS and FDS, and 1830 between EBS and FDS, uncovering 769 DEGs in multiple metabolic and signaling pathways. Interestingly, there were a limited number of DEGs whose expression was dramatically associated with FDS. Finally, genes, whose expression was either highly up-regulated in FDS or remained at a high level during fruiting body growth, were annotated specifically in the pathways of purine metabolism, unsaturated fatty acid metabolism and meiosis, suggesting that these key molecular events were actively occurring in the fruiting body. Our work is the first high-throughput transcriptome study on the growth of L. edodes fruiting bodies, and the results uncovered candidate genes for future gene identification and utilization of this commercially and

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Combining high-throughput sequencing with fruit body surveys reveals contrasting life-history strategies in fungi

PubMed Central

Ovaskainen, Otso; Schigel, Dmitry; Ali-Kovero, Heini; Auvinen, Petri; Paulin, Lars; Nordén, Björn; Nordén, Jenni

2013-01-01

Before the recent revolution in molecular biology, field studies on fungal communities were mostly confined to fruit bodies, whereas mycelial interactions were studied in the laboratory. Here we combine high-throughput sequencing with a fruit body inventory to study simultaneously mycelial and fruit body occurrences in a community of fungi inhabiting dead wood of Norway spruce. We studied mycelial occurrence by extracting DNA from wood samples followed by 454-sequencing of the ITS1 and ITS2 regions and an automated procedure for species identification. In total, we detected 198 species as mycelia and 137 species as fruit bodies. The correlation between mycelial and fruit body occurrences was high for the majority of the species, suggesting that high-throughput sequencing can successfully characterize the dominating fungal communities, despite possible biases related to sampling, PCR, sequencing and molecular identification. We used the fruit body and molecular data to test hypothesized links between life history and population dynamic parameters. We show that the species that have on average a high mycelial abundance also have a high fruiting rate and produce large fruit bodies, leading to a positive feedback loop in their population dynamics. Earlier studies have shown that species with specialized resource requirements are rarely seen fruiting, for which reason they are often classified as red-listed. We show with the help of high-throughput sequencing that some of these species are more abundant as mycelium in wood than what could be expected from their occurrence as fruit bodies. PMID:23575372

Novel Developmental Genes, fruCD, of Myxococcus xanthus: Involvement of a Cell Division Protein in Multicellular Development

PubMed Central

Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2003-01-01

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development. PMID:12754229

Cooperation induces other cooperation: Fruiting bodies promote the evolution of macrocysts in Dictyostelium discoideum.

PubMed

Shibasaki, Shota; Shirokawa, Yuka; Shimada, Masakazu

2017-05-21

Biological studies of the evolution of cooperation are challenging because this process is vulnerable to cheating. Many mechanisms, including kin discrimination, spatial structure, or by-products of self-interested behaviors, can explain this evolution. Here we propose that the evolution of cooperation can be induced by other cooperation. To test this idea, we used a model organism Dictyostelium discoideum because it exhibits two cooperative dormant phases, the fruiting body and the macrocyst. In both phases, the same chemoattractant, cyclic AMP (cAMP), is used to collect cells. This common feature led us to hypothesize that the evolution of macrocyst formation would be induced by coexistence with fruiting bodies. Before forming a mathematical model, we confirmed that macrocysts coexisted with fruiting bodies, at least under laboratory conditions. Next, we analyzed our evolutionary game theory-based model to investigate whether coexistence with fruiting bodies would stabilize macrocyst formation. The model suggests that macrocyst formation represents an evolutionarily stable strategy and a global invader strategy under this coexistence, but is unstable if the model ignores the fruiting body formation. This result indicates that the evolution of macrocyst formation and maintenance is attributable to coexistence with fruiting bodies. Therefore, macrocyst evolution can be considered as an example of evolution of cooperation induced by other cooperation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Current progress on truffle submerged fermentation: a promising alternative to its fruiting bodies.

PubMed

Tang, Ya-Jie; Liu, Rui-Sang; Li, Hong-Mei

2015-03-01

Truffle (Tuber spp.), also known as "underground gold," is popular in various cuisines because of its unique and characteristic aroma. Currently, truffle fruiting bodies are mostly obtained from nature and semi-artificial cultivation. However, the former source is scarce, and the latter is time-consuming, usually taking 4 to 12 years before harvest of the fruiting body. The truffle submerged fermentation process was first developed in Tang's lab as an alternative to its fruiting bodies. To the best of our knowledge, most reports of truffle submerged fermentation come from Tang's group. This review examines the current state of the truffle submerged fermentation process. First, the strategy to optimize the truffle submerged fermentation process is summarized; the final conditions yielded not only the highest reported truffle biomass but also the highest production of extracellular and intracellular polysaccharides. Second, the comparison of metabolites produced by truffle fermentation and fruiting bodies is presented, and the former were superior to the latter. Third, metabolites (i.e., volatile organic compounds, equivalent umami concentration, and sterol) derived from truffle fermentation could be regulated by fermentation process optimization. These findings indicated that submerged fermentation of truffles can be used for commercial production of biomass and metabolites as a promising alternative to generating its fruiting bodies in bioreactor.

[Chemical study on fruiting bodies of Boletus vioaceo-fuscus].

PubMed

Ma, Bing-ji; Ruan, Yuan; Liu, Ji-kai

2007-09-01

To investigate the chemical constituents of Boletus vioaceo-fuscus. The compounds were isolated with column chromatography. The structures were determined by spectroscopic techniques. Six compounds were isolated from the fruiting bodies of Boletus vioaceo-fiuscus. They were identified as ergosta-5, 7, 22-triene-3beta-ol (1), dihydrofuran-2, 5-dione (2), (22E, 24R)-5alpha, 6alpha-epoxyergosta-8, 22-diene-3beta, 7alpha-diol (3), (22E, 24R)-5alpha, 6alpha-epoxyergosta-8 (14), 22-diene-3beta, 7alphadiol (4), cerebroside B (5) and adenosine (6), respectively. All the Compounds were obtained from the fruiting bodies of Boletus vioaceo-fiscus for the first time.

Isolation, Culture and Characterization of Hirsutella sinensis Mycelium from Caterpillar Fungus Fruiting Body

PubMed Central

Ko, Yun-Fei; Liau, Jian-Ching; Lee, Chien-Sheng; Chiu, Chen-Yaw; Martel, Jan; Lin, Chuan-Sheng; Tseng, Shun-Fu; Ojcius, David M.; Lu, Chia-Chen; Lai, Hsin-Chih; Young, John D.

2017-01-01

The caterpillar fungus Ophiocordyceps sinensis (previously called Cordyceps sinensis) has been used for centuries in Asia as a tonic to improve health and longevity. Recent studies show that O. sinensis produces a wide range of biological effects on cells, laboratory animals and humans, including anti-fatigue, anti-infection, anti-inflammatory, antioxidant, and anti-tumor activities. In view of the rarity of O. sinensis fruiting bodies in nature, cultivation of its anamorph mycelium represents a useful alternative for large-scale production. However, O. sinensis fruiting bodies harvested in nature harbor several fungal contaminants, a phenomenon that led to the isolation and characterization of a large number of incorrect mycelium strains. We report here the isolation of a mycelium from a fruiting body of O. sinensis and we identify the isolate as O. sinensis’ anamorph (also called Hirsutella sinensis) based on multi-locus sequence typing of several fungal genes (ITS, nrSSU, nrLSU, RPB1, RPB2, MCM7, β-tubulin, TEF-1α, and ATP6). The main characteristics of the isolated mycelium, including its optimal growth at low temperature (16°C) and its biochemical composition, are similar to that of O. sinensis fruiting bodies, indicating that the mycelium strain characterized here may be used as a substitute for the rare and expensive O. sinensis fruiting bodies found in nature. PMID:28046129

Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

PubMed

Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

2017-08-16

The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

PubMed

Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

2004-10-01

The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

Isolation and characterization of polysaccharides with the antitumor activity from Tuber fruiting bodies and fermentation system.

PubMed

Zhao, Wei; Wang, Xiao-Hua; Li, Hong-Mei; Wang, Shi-Hua; Chen, Tao; Yuan, Zhan-Peng; Tang, Ya-Jie

2014-03-01

Fifty-two polysaccharides were isolated from the fermentation systems of Tuber melanosporum, Tuber indicum, Tuber sinense, Tuber aestivum and the fruiting bodies of Tuber indicum, Tuber himalayense, Tuber sinense by elution with an activated carbon column. Polysaccharides from Tuber fermentation system exhibited relatively higher in vitro antitumor activity against HepG2, A549, HCT-116, SK-BR-3, and HL-60 cells than those from Tuber fruiting bodies. All polysaccharides were mainly composed of D-mannose, D-glucose, and D-galactose, which suggested that the polysaccharides from Tuber fruiting bodies and fermentation system have identical chemical compositions. The results of antitumor activity and structural identification indicated that the polysaccharide fractions could promote antitumor activity. Tuber polysaccharides from Tuber fermentation system exhibited relatively higher than that from Tuber fruiting bodies. These results confirm the potential of Tuber fermentation mycelia for use as an alternative resource for its fruiting bodies.

Changes in chemical components and cytotoxicity at different maturity stages of Pleurotus eryngii fruiting body.

PubMed

Cui, Fengjie; Li, Yunhong; Yang, Yan; Sun, Wenjing; Wu, Di; Ping, Lifeng

2014-12-31

The present study investigated the changes of the chemical components and cytotoxicity potency at 5 developmental stages of Pleurotus eryngii fruiting body. The carbohydrate and protein contents increased along the maturity of fruiting body while fat content decreased. By comparison, the polysaccharide-protein fractions had the highest antiproliferative effect on SGC-7901 and HepG-2 cells in vitro and increasing activity with growing maturity of P. eryngii fruiting body.The maturation process increased the protein content and acid property through the enhanced relative abundance of Asp, Thr, and Glu in polysaccharide-protein fractions. Further purification and electrophoresis identified that the polysaccharide-protein PEG-1with three subunits possibly was the target cytotoxical component. Our findings proved that mature fruiting body of P. eryngii containing these polysaccharide-proteins possessed highly nutritional values and therapeutical benefits.

Fruiting Body Formation of Cordyceps militaris from Multi-Ascospore Isolates and Their Single Ascospore Progeny Strains

PubMed Central

Shrestha, Bhushan; Han, Sang-Kuk; Sung, Jae-Mo

2012-01-01

Interest in commercial cultivation and product development of Cordyceps species has shown a recent increase. Due to its biochemical and pharmacological effects, Cordyceps militaris, commonly known as orange caterpillar fungus, is being investigated with great interest. Cultivation of C. militaris has been practiced on a large scale in order to fulfill a demand for scientific investigation and product development. Isolates of C. militaris can be easily established from both spores and tissue. For isolation of spores, ascospores released from mature stromata are trapped in sterile medium. Multi-ascospore isolates, as well as combinations of single ascospore strains, are used for production of fruiting bodies. Progeny ascospore strains can be isolated from artificial fruiting bodies, thus, the cycle of fruiting body production can be continued for a long period of time. In this study, we examined fruiting body production from multi-ascospore isolates and their progeny strains for three generations. F1 progeny strains generally produced a larger number of fruiting bodies, compared with their mother multi-ascospore isolates; however, F2 and F3 progeny strains produced fewer fruiting bodies. Optimum preservation conditions could help to increase the vitality of the progeny strains. In order to retain the fruiting ability of the strains, further testing of various methods of preservation and different methods for isolation should be performed. PMID:22870051

Direct accumulation pathway of radioactive cesium to fruit-bodies of edible mushroom from contaminated wood logs

NASA Astrophysics Data System (ADS)

Ohnuki, Toshihiko; Aiba, Yukitoshi; Sakamoto, Fuminori; Kozai, Naofumi; Niizato, Tadafumi; Sasaki, Yoshito

2016-07-01

This paper presents the accumulation process of radioactive Cs in edible mushrooms. We here first report the direct accumulation pathway of radioactive Cs from contaminated wood logs to the fruit-bodies of shiitake mushrooms through the basal portion of the stipe. In this pathway, radioactive Cs is not transported through the hyphae. This pathway results in a high accumulation of radioactive Cs in the fruit-body, more by the excess accumulation of radioactive Cs from the wood logs than that through the hyphae. We grew the fruit-bodies of Shiitake mushroom from radioactive-Cs-contaminated wood logs. The spatial distributions of radioactive Cs and Prussian blue as a tracer of interstitial water in the cross section of the wood log measured after the harvest of the fruit-body from the inoculated sawdust spawn area indicated that some fraction of the radioactive Cs and Prussian blue were transported directly to the basal portion of the stipe during the growth of the fruit-bodies.

Enzymatic characterization of a class II lysyl-tRNA synthetase, LysS, from Myxococcus xanthus.

PubMed

Oka, Manami; Takegawa, Kaoru; Kimura, Yoshio

2015-08-01

Lysyl-tRNA synthetases efficiently produce diadenosine tetraphosphate (Ap4A) from lysyl-AMP with ATP in the absence of tRNA. We characterized recombinant class II lysyl-tRNA synthetase (LysS) from Myxococcus xanthus and found that it is monomeric and requires Mn(2+) for the synthesis of Ap4A. Surprisingly, Zn(2+) inhibited enzyme activity in the presence of Mn(2+). When incubated with ATP, Mn(2+), lysine, and inorganic pyrophosphatase, LysS first produced Ap4A and ADP, then converted Ap4A to diadenosine triphosphate (Ap3A), and finally converted Ap3A to ADP, the end product of the reaction. Recombinant LysS retained Ap4A synthase activity without lysine addition. Additionally, when incubated with Ap4A (minus pyrophosphatase), LysS converted Ap4A mainly ATP and AMP, or ADP in the presence or absence of lysine, respectively. These results demonstrate that M. xanthus LysS has different enzymatic properties from class II lysyl-tRNA synthetases previously reported. Copyright © 2015 Elsevier Inc. All rights reserved.

Herbicidal and antioxidant responses of transgenic rice overexpressing Myxococcus xanthus protoporphyrinogen oxidase.

PubMed

Jung, Sunyo; Back, Kyoungwhan

2005-05-01

We analyzed the herbicidal and antioxidant defense responses of transgenic rice plants that overexpressed the Myxococcus xanthus protoporphyrinogen oxidase gene. Leaf squares of the wild-type incubated with oxyfluorfen were characterized by necrotic leaf lesions and increases in conductivity and malonyldialdehyde levels, whereas transgenic lines M4 and M7 did not show any change with up to 100 microM oxyfluorfen. The wild-type had decreased F(v)/F(m) and produced a high level of H(2)O(2) at 18 h after foliar application of oxyfluorfen, whereas transgenic lines M4 and M7 were unaffected. In response to oxyfluorfen, violaxanthin, beta-carotene, and chlorophylls (Chls) decreased in wild-type plants, whereas antheraxanthin and zeaxanthin increased. Only a slight decline in Chls was observed in transgenic lines at 48 h after oxyfluorfen treatment. Noticeable increases of cytosolic Cu/Zn-superoxide dismutase, peroxidase isozymes 1 and 2, and catalase were observed after at 48 h of oxyfluorfen treatment in the wild-type. Non-enzymatic antioxidants appeared to respond faster to oxyfluorfen-induced photodynamic stress than did enzymatic antioxidants. Protective responses for the detoxification of active oxygen species were induced to counteract photodynamic stress in oxyfluorfen-treated, wild-type plants. However, oxyfluorfen-treated, transgenic plants suffered less oxidative stress, confirming increased herbicidal resistance resulted from dual expression of M. xanthus Protox in chloroplasts and mitochondria.

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Ultrastructural study on dynamics of lipid bodies and plastids during ripening of chili pepper fruits.

PubMed

Liu, Lin

2013-03-01

Dynamics of lipid bodies and plastids in chili pepper fruits during ripening were investigated by means of transmission electron microscopy. Mesocarp of chili pepper fruits consists of collenchyma, normal parenchyma, and huge celled parenchyma. In mature green fruits, plastids contain numerous thylakoids that are well organized into grana in collenchyma, a strikingly huge amount of starch and irregularly organized thylakoids in normal parenchyma, and simple tubes rather than thylakoids in huge celled parenchyma. These morphological features suggest that plastids are chloroplasts in collenchyma, chloroamyloplasts in normal parenchyma, proplastids in huge celled parenchyma. As fruits ripen to red, plastids in all cell types convert to chromoplasts and, concomitantly, lipid bodies accumulate in both cytoplasm and chromoplasts. Cytosolic lipid bodies are lined up in a regular layer adjacent to plasma membrane. The cytosolic lipid body consists of a core surrounded by a membrane. The core is comprised of a more electron-dense central part enclosed by a slightly less electron-dense peripheral layer. Plastidial lipid bodies in collenchyma, normal parenchyma, and endodermis initiate as plastoglobuli, which in turn convert to rod-like structures. Therefore, plastidial lipid bodies are more dynamic than cytosolic lipid bodies. Both cytosolic and plastidial lipid bodies contain rich unsaturated lipids. Copyright © 2012 Elsevier Ltd. All rights reserved.

Selection of Sphingomonadaceae at the base of Laccaria proxima and Russula exalbicans fruiting bodies.

PubMed

Boersma, F G Hidde; Warmink, Jan A; Andreote, Fernando A; van Elsas, Jan Dirk

2009-04-01

The dense hyphal network directly underneath the fruiting bodies of ectomycorrhizal fungi might exert strong influences on the bacterial community of soil. Such fruiting bodies might serve as hot spots for bacterial activity, for instance by providing nutrients and colonization sites in soil. Here, we assessed the putative selection of specific members of the Sphingomonadaceae family at the bases of the fruiting bodies of the ectomycorrhizal fungi Laccaria proxima and Russula exalbicans in comparison to the adjacent bulk soil. To do so, we used a previously designed Sphingomonadaceae-specific PCR-denaturing gradient gel electrophoresis (DGGE) system and complemented this with analyses of sequences from a Sphingomonadaceae-specific clone library. The analyses showed clear selective effects of the fruiting bodies of both fungi on the Sphingomonadaceae community structures. The effect was especially prevalent with R. exalbicans. Strikingly, similar fungi sampled approximately 100 m apart showed similar DGGE patterns, while corresponding bulk soil-derived patterns differed from each other. However, the mycospheres of L. proxima and R. exalbicans still revealed divergent community structures, indicating that different fungi select for different members of the Sphingomonadaceae family. Excision of specific bands from the DGGE patterns, as well as analyses of the clone libraries generated from both habitats, revealed fruiting body-specific Sphingomonadaceae types. It further showed that major groups from the mycospheres of R. exalbicans and L. proxima did not cluster with known bacteria from the database, indicating new groups within the family of Sphingomonadaceae present in these environments.

High concentrations of intracellular Ap4A and/or Ap5A in developing Myxococcus xanthus cells inhibit sporulation.

PubMed

Kimura, Yoshio; Tanaka, Chihiro; Sasaki, Katsuho; Sasaki, Masashi

2017-01-01

Diadenosine polyphosphates (ApnA) are thought to act as signalling molecules regulating stress responses and biofilm formation in prokaryotes. However, ApnA function in Myxococcus xanthus remains unknown. Here, we investigated the role of ApnA in M. xanthus, using the wild-type and ApnA hydrolase (apaH) mutant strains exposed to various stress conditions. In both wild-type and apaH mutant cells cultured on starvation medium (CF agar), the levels of intracellular diadenosine tetraphosphate (Ap4A) and pentaphosphate (Ap5A) increased several fold during the first 16 h of development and decreased gradually thereafter. The levels of Ap4A and Ap5A in the apaH mutant were about 5- and 11-fold higher than those in the wild-type strain at 16 h, respectively. ApnA hydrolase activity of the wild-type strain increased 1.5-fold during the first 8 h of development, and it then gradually decreased. The apaH mutant formed spores 1-2 days after the wild-type strain did, and the yield of viable spores was 5.5 % of that in the wild-type strain 5 days after inoculation onto CF agar. These results suggest the possibility that high intracellular levels of Ap4A and/or Ap5A may inhibit M. xanthus sporulation at the early stage of development and that the bacteria reduce intracellular Ap4A and Ap5A accumulation through ApnA hydrolase activity.

A Jacalin-Related Lectin Regulated the Formation of Aerial Mycelium and Fruiting Body in Flammulina velutipes

PubMed Central

Lu, Yuan-Ping; Chen, Ren-Liang; Long, Ying; Li, Xiao; Jiang, Yu-Ji; Xie, Bao-Gui

2016-01-01

Flammulina velutipes, one of the most popular mushroom species in the world, has been recognized as a useful model system to study the biochemical and physiological aspects of the formation and elongation of fruit body. However, few reports have been published on the regulation of fruiting body formation in F. velutipes at the molecular level. In this study, a jacalin-related lectin gene from F. velutipes was characterized. The phylogenetic tree revealed that Fv-JRL1 clustered with other basidiomycete jacalin-like lectins. Moreover, the transcriptional pattern of the Fv-JRL1 gene in different developmental stages of F. velutipes implied that Fv-JRL1 could be important for formation of fruit body. Additionally, RNA interference (RNAi) and overexpression analyses provided powerful evidence that the lectin gene Fv-JRL1 from F. velutipes plays important roles in fruiting body formation. PMID:27916794

Fruit and vegetable intake, body mass index and waist circumference among young female students in Isfahan.

PubMed

Ghalaeh, Reihaneh Seyed; Gholi, Zahra; Bank, Sahar Saraf; Azadbakht, Leila

2012-01-01

Obesity is growing rapidly in our country. Nutrition is an important issue of obesity. The aim of this study was to determine the association between fruit and vegetable intake with the waist circumference and the body mass index (BMI) among young female university students. This cross-sectional study was conducted on 236 healthy female university students aged between 18 and 30 years old, who were selected randomly from the students of Isfahan University of Medical Sciences, Iran. A previously validated semi-quantitative food frequency questionnaire was used to assess the entire dietary component intake. Physical activity was assessed by daily recording of the physical activities. The prevalence of obesity, central adiposity and overweight was 1.7, 0.9 and 8.1%, respectively. The mean value of BMI and the waist circumference was 21.54 kg/m(2) and 70.37 cm, respectively. There was an inverse correlation between the fruit and vegetable intake and body weight (r = -0.1, P = 0.03) as well as BMI (r = -0.1, P = 0.04) and also there was an inverse correlation between the fruit intake and body weight (r = -0.1, P = 0.01) and BMI (r = -0.1, P = 0.01). There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with the waist circumference. There were significant correlations between fruit and also fruit and vegetable and body weight and BMI among female university students. There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with waist circumference.

Enhanced production of polysaccharides and triterpenoids in Ganoderma lucidum fruit bodies on induction with signal transduction during the fruiting stage

PubMed Central

Xie, Fan; Zhao, Lili

2018-01-01

Ganoderma lucidum is a medicinal mushroom that has been widely used in East Asia for the treatment of various diseases. The pharmacological activity of this fungus is primarily attributable to the polysaccharides and triterpenoids. In this study, to obtain the fruit bodies with improved content of active constituents, we examined the effect of salicylic acid (SA) and calcium ion on the biosynthesis of polysaccharides and triterpenoids by spraying the chemicals during the fruiting. To explore the underlying mechanisms for the variation, the transcripts of related genes involved in the polysaccharide and triterpenoid biosynthesis were measured. Results showed that Ca2+ had no effect on production of polysaccharides and triterpenoids, whereas SA increased triterpenoid content by 23.32%, compared to the control, but it had little influence on polysaccharide production. Interestingly, the combined induction increased polysaccharide and triterpenoid content by 9.02% and 13.61%, respectively, compared to the control. Under Ca2+ induction, the transcript of ugp gene in the polysaccharide biosynthetic pathway up-regulated in all three stages (mycelium, primordium, and fruit body), while pgm and gls gave no response in the mycelium and primordium stages, and up-regulated in the fruit body stage. Differently, six key triterpenoid biosynthetic genes including hmgr, hmgs, mvd, fps, sqs, and ls did not respond to the induction. In the case of SA and combined induction, pgm and ugp were up-regulated in all three stages, while gls showed an increased expression in the primordium stage and no response in other stages. The six triterpenoid biosynthetic genes were up-regulated in all three stages. The present study provides a useful approach to producing G. lucidum fruit bodies with high polysaccharide and triterpenoid content. This is important to the G. lucidum industry. PMID:29694432

Fruit and vegetable intake, body mass index and waist circumference among young female students in Isfahan

PubMed Central

Ghalaeh, Reihaneh Seyed; Gholi, Zahra; Bank, Sahar Saraf; Azadbakht, Leila

2012-01-01

Background: Obesity is growing rapidly in our country. Nutrition is an important issue of obesity. The aim of this study was to determine the association between fruit and vegetable intake with the waist circumference and the body mass index (BMI) among young female university students. Materials and Methods: This cross-sectional study was conducted on 236 healthy female university students aged between 18 and 30 years old, who were selected randomly from the students of Isfahan University of Medical Sciences, Iran. A previously validated semi-quantitative food frequency questionnaire was used to assess the entire dietary component intake. Physical activity was assessed by daily recording of the physical activities. Findings: The prevalence of obesity, central adiposity and overweight was 1.7, 0.9 and 8.1%, respectively. The mean value of BMI and the waist circumference was 21.54 kg/m2 and 70.37 cm, respectively. There was an inverse correlation between the fruit and vegetable intake and body weight (r = -0.1, P = 0.03) as well as BMI (r = -0.1, P = 0.04) and also there was an inverse correlation between the fruit intake and body weight (r = -0.1, P = 0.01) and BMI (r = -0.1, P = 0.01). There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with the waist circumference. Conclusion: There were significant correlations between fruit and also fruit and vegetable and body weight and BMI among female university students. There was no significant correlation between fruit and vegetable as well as fruit or vegetable separately with waist circumference. PMID:23555132

Myxococcus xanthus Gliding Motors Are Elastically Coupled to the Substrate as Predicted by the Focal Adhesion Model of Gliding Motility

PubMed Central

Balagam, Rajesh; Litwin, Douglas B.; Czerwinski, Fabian; Sun, Mingzhai; Kaplan, Heidi B.; Shaevitz, Joshua W.; Igoshin, Oleg A.

2014-01-01

Myxococcus xanthus is a model organism for studying bacterial social behaviors due to its ability to form complex multi-cellular structures. Knowledge of M. xanthus surface gliding motility and the mechanisms that coordinated it are critically important to our understanding of collective cell behaviors. Although the mechanism of gliding motility is still under investigation, recent experiments suggest that there are two possible mechanisms underlying force production for cell motility: the focal adhesion mechanism and the helical rotor mechanism, which differ in the biophysics of the cell–substrate interactions. Whereas the focal adhesion model predicts an elastic coupling, the helical rotor model predicts a viscous coupling. Using a combination of computational modeling, imaging, and force microscopy, we find evidence for elastic coupling in support of the focal adhesion model. Using a biophysical model of the M. xanthus cell, we investigated how the mechanical interactions between cells are affected by interactions with the substrate. Comparison of modeling results with experimental data for cell-cell collision events pointed to a strong, elastic attachment between the cell and substrate. These results are robust to variations in the mechanical and geometrical parameters of the model. We then directly measured the motor-substrate coupling by monitoring the motion of optically trapped beads and find that motor velocity decreases exponentially with opposing load. At high loads, motor velocity approaches zero velocity asymptotically and motors remain bound to beads indicating a strong, elastic attachment. PMID:24810164

The Myxococcus xanthus Spore Cuticula Protein C Is a Fragment of FibA, an Extracellular Metalloprotease Produced Exclusively in Aggregated Cells

PubMed Central

Lee, Bongsoo; Mann, Petra; Grover, Vidhi; Treuner-Lange, Anke; Kahnt, Jörg; Higgs, Penelope I.

2011-01-01

Myxococcus xanthus is a soil bacterium with a complex life cycle involving distinct cell fates, including production of environmentally resistant spores to withstand periods of nutrient limitation. Spores are surrounded by an apparently self-assembling cuticula containing at least Proteins S and C; the gene encoding Protein C is unknown. During analyses of cell heterogeneity in M. xanthus, we observed that Protein C accumulated exclusively in cells found in aggregates. Using mass spectrometry analysis of Protein C either isolated from spore cuticula or immunoprecipitated from aggregated cells, we demonstrate that Protein C is actually a proteolytic fragment of the previously identified but functionally elusive zinc metalloprotease, FibA. Subpopulation specific FibA accumulation is not due to transcriptional regulation suggesting post-transcriptional regulation mechanisms mediate its heterogeneous accumulation patterns. PMID:22174937

Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.

PubMed Central

Kalos, M; Zissler, J

1990-01-01

The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982

Mechanism of Glucose Regulates the Fruiting Body Formation in the Beech Culinary-Medicinal Mushroom, Hypsizygus marmoreus (Agaricomycetes).

PubMed

Zhang, Jin-Jing; Chen, Hui; Xie, Min-Ying; Chen, Ming-Jie; Hao, Hai-Bo; Wang, Hong; Feng, Zhi-Yong

2017-01-01

To understand the fruiting process of Hypsizygus marmoreus, a synthetic liquid medium (SLM) was optimized to induce fruiting body initiation. Dependent on the SLM, the effect of a monofactor (glucose) on the fruiting bodies of H. marmoreus was studied at different concentrations (10 and 40 g/L). Primordia appeared approximately 10 days earlier in low-glucose media (LGM) than in high-glucose media (HGM), whereas mature fruiting bodies formed on mushrooms approximately 7 days earlier and more primordia developed into mature fruiting bodies when cultured in HGM. In addition, the morphogenesis of the primordia was clustered in HGM, which was different than what was observed in LGM. Furthermore, differentially expressed genes (DEGs) that encoded various proteins involved in cell structure, general metabolism, signal transduction, and transcription and translation were analyzed by transcriptome sequencing. Six DEGs were detected by quantitative reverse-transcriptase polymerase chain reaction, and the results were consistent with the altered patterns of gene expression revealed by the transcriptome. This study not only identifies new candidate genes involved in the development of H. marmoreus but also provides a new research platform for studying the development of other edible mushrooms.

The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

PubMed

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

New insights from an old mutant: SPADIX4 governs fruiting body development but not hyphal fusion in Sordaria macrospora.

PubMed

Teichert, Ines; Lutomski, Miriam; Märker, Ramona; Nowrousian, Minou; Kück, Ulrich

2017-02-01

During the sexual life cycle of filamentous fungi, multicellular fruiting bodies are generated for the dispersal of spores. The filamentous ascomycete Sordaria macrospora has a long history as a model system for studying fruiting body formation, and two collections of sterile mutants have been generated. However, for most of these mutants, the underlying genetic defect remains unknown. Here, we investigated the mutant spadix (spd) that was generated by X-ray mutagenesis in the 1950s and terminates sexual development after the formation of pre-fruiting bodies (protoperithecia). We sequenced the spd genome and found a 22 kb deletion affecting four genes, which we termed spd1-4. Generation of deletion strains revealed that only spd4 is required for fruiting body formation. Although sterility in S. macrospora is often coupled with a vegetative hyphal fusion defect, Δspd4 was still capable of fusion. This feature distinguishes SPD4 from many other regulators of sexual development. Remarkably, GFP-tagged SPD4 accumulated in the nuclei of vegetative hyphae and fruiting body initials, the ascogonial coils, but not in sterile tissue from the developing protoperithecium. Our results point to SPD4 as a specific determinant of fruiting body formation. Research on SPD4 will, therefore, contribute to understanding cellular reprogramming during initiation of sexual development in fungi.

Genetic dissection of fruiting body-related traits using quantitative trait loci mapping in Lentinula edodes.

PubMed

Gong, Wen-Bing; Li, Lei; Zhou, Yan; Bian, Yin-Bing; Kwan, Hoi-Shan; Cheung, Man-Kit; Xiao, Yang

2016-06-01

To provide a better understanding of the genetic architecture of fruiting body formation of Lentinula edodes, quantitative trait loci (QTLs) mapping was employed to uncover the loci underlying seven fruiting body-related traits (FBRTs). An improved L. edodes genetic linkage map, comprising 572 markers on 12 linkage groups with a total map length of 983.7 cM, was constructed by integrating 82 genomic sequence-based insertion-deletion (InDel) markers into a previously published map. We then detected a total of 62 QTLs for seven target traits across two segregating testcross populations, with individual QTLs contributing 5.5 %-30.2 % of the phenotypic variation. Fifty-three out of the 62 QTLs were clustered in six QTL hotspots, suggesting the existence of main genomic regions regulating the morphological characteristics of fruiting bodies in L. edodes. A stable QTL hotspot on MLG2, containing QTLs for all investigated traits, was identified in both testcross populations. QTLs for related traits were frequently co-located on the linkage groups, demonstrating the genetic basis for phenotypic correlation of traits. Meta-QTL (mQTL) analysis was performed and identified 16 mQTLs with refined positions and narrow confidence intervals (CIs). Nine genes, including those encoding MAP kinase, blue-light photoreceptor, riboflavin-aldehyde-forming enzyme and cyclopropane-fatty-acyl-phospholipid synthase, and cytochrome P450s, were likely to be candidate genes controlling the shape of fruiting bodies. The study has improved our understanding of the genetic architecture of fruiting body formation in L. edodes. To our knowledge, this is the first genome-wide QTL detection of FBRTs in L. edodes. The improved genetic map, InDel markers and QTL hotspot regions revealed here will assist considerably in the conduct of future genetic and breeding studies of L. edodes.

The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

PubMed Central

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea

DOE PAGES

Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai; ...

2015-10-28

We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less

Strand-Specific RNA-Seq Analyses of Fruiting Body Development in Coprinopsis cinerea

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muraguchi, Hajime; Umezawa, Kiwamu; Niikura, Mai

We report that the basidiomycete fungus Coprinopsis cinerea is an important model system for multicellular development. Fruiting bodies of C. cinerea are typical mushrooms, which can be produced synchronously on defined media in the laboratory. To investigate the transcriptome in detail during fruiting body development, high-throughput sequencing (RNA-seq) was performed using cDNA libraries strand-specifically constructed from 13 points (stages/tissues) with two biological replicates. The reads were aligned to 14,245 predicted transcripts, and counted for forward and reverse transcripts. Differentially expressed genes (DEGs) between two adjacent points and between vegetative mycelium and each point were detected by Tag Count Comparison (TCC).more » To validate RNA-seq data, expression levels of selected genes were compared using RPKM values in RNA-seq data and qRT-PCR data, and DEGs detected in microarray data were examined in MA plots of RNA-seq data by TCC. We discuss events deduced from GO analysis of DEGs. In addition, we uncovered both transcription factor candidates and antisense transcripts that are likely to be involved in developmental regulation for fruiting.« less

[Study on variation of main ingredients from spores and fruiting bodies of Ganoderma lucidum].

PubMed

Li, Jing-Jing; Hu, Xiao-Qin; Zhang, Xin-Feng; Liu, Jing-Jing; Cao, Long-Shu

2014-11-01

To reveal the quality variation of polysaccharides, triterpenoids and proteins in spores and fruiting bodies of Ganoderma lucidum from producing areas, different varieties, harvesting parts and periods, and wall-breaking treatments. Spores and fruiting bodies from varieties of Longzhi No. 1 and Hunong No. 1 were collected as test samples, together with wall-broken spores sold in domestic main producing areas. The anthrone-sulfuric acid colorimetric method was used to determine the content of total polysaccharides. The vanillin-glacial acetic acid-perchloric acid colorimetric method was used to determine the content of total triterpenoids. The Lowry method was used to determine the content of total proteins. The content ranges of total polysaccharides, total triterpenoids, and total proteins from 6 domestic main producing areas were 0.40% - 2.25%, 1.36%-3.15% and 0.74% -1.91% respectively. The content ranges of total polysaccharides, triterpenoids, and proteins in the fruiting bodies from 2 varieties cultured in Zhejiang were 0.25% -1.42%, 0.44% -1.42% and 1.82% -3.67% respectively. In addition, the ranges of samples from wall-unbroken spores were 0.41% - 0.91%, 0.09% - 0.12%, 0.78% - 0.90% respectively and wall-broken spores are 1.03% - 2.25%, 1.89% - 3.15%, 0.96% - 1.04% respectively. There are significant differences in the contents of main chemical ingredients of wall-broken G. lucidum spores saled in the markets. The samples from Zhejiang contain high content of total polysaccharides and triterpenoids, and samples from Fujian contains more proteins. Between the 2 major varieties cultured in Zhejiang, Longzhi No. 1 contains higher content of triterpenoids, but Hunong No. 1 has more polysaccharides. Contents of triterpenoids and polysaccharides from wall-broken spores are much higher than those of fruiting bodies. The stipes from fruiting bodies contains more polysaccharides than those of the pileus, while the triterpenoids contents are higher in the pileus than

Meroterpenoids from the fruiting bodies of Ganoderma theaecolum.

PubMed

Luo, Qi; Tu, Zheng-Chao; Yang, Zhu-Liang; Cheng, Yong-Xian

2018-03-01

A series of new terminal cyclohexane-type meroterpenoids, ganotheaecoloids A-N (1-6, 8-13, 15, and 16), along with three known ones (7, 14, and 17), were isolated from the dried fruiting bodies of Ganoderma theaecolum. Their chemical structures were identified by using spectroscopic data and computational methods. Biological activity of all the new meroterpenoids against COX-2 was evaluated in vitro, only ganotheaecoloid J (11) was found to have COX-2 inhibitory activity with IC 50 value of 9.96μM. Copyright © 2018 Elsevier B.V. All rights reserved.

Optimization of extraction of polysaccharides from fruiting body of Cordyceps militaris (L.) link using response surface methodology

NASA Astrophysics Data System (ADS)

Nguyen, Hoang Chinh; Thi, Dinh Huynh Mong; Pham, Dinh Chuong

2018-04-01

Polysaccharides from fruiting body of Cordyceps militaris (L.) Link possess various pharmaceutical activities. In this study, polysaccharides from the fruiting body of C. militaris were extracted with different solvents. Of those solvents tested, distilled water was identified as the most efficient solvent for the extraction, resulting in a significant increase in polysaccharides yield. Response surface methodology was then used to optimize the extraction conditions and establish a reliable mathematical model for prediction. A maximum polysaccharides yield of 11.07% was reached at a ratio of water to raw material of 23.2:1 mL/g, an extraction time of 76 min, and a temperature of 93.6°C. This study indicates that the obtained optimal extraction conditions are an efficient method for extraction of polysaccharides from the fruiting body of C. militaris.

Two new isobenzofuranone derivatives from the fruiting bodies of Hericium erinaceus.

PubMed

Li, Jing; Wang, Xu-Li; Li, Guang; Xu, Ping-Sheng; Xu, Kang-Ping; Tan, Gui-Shan

2017-11-01

Two new isobenzofuranone derivatives erinaceolactones G and H (1 and 2) were isolated from the ethanolic extract of fruiting bodies of Hericium erinaceus. Their structures were characterized on the basis of spectroscopic evidences. Compound 2 was suggested to be racemic by specific rotation, which was resolved by chiral HPLC into enantiomers.

Laboratory measurements of biomarkers and individual performances in Chironomus xanthus to evaluate pesticide contamination of sediments in a river of southeastern Brazil.

PubMed

Printes, Liane Biehl; Fernandes, Marisa Narciso; Espíndola, Evaldo Luiz Gaeta

2011-03-01

This study aimed at evaluating biomarkers, individual and population responses in the native Chironomus xanthus to assess the toxicity of pesticide-contaminated sediments from the Monjolinho River (Southeast Brazil). We measured cholinesterase (ChE) and glutathione S-transferase activities (GST), as biomarkers and survival, individual growth and adult emergence, as individual performances. There was no response of the ChE activity and a tendency to decreased GST activity in contaminated sites, but this was generally not statistically significant. Therefore, there was no association of the biomarker responses with exposure to sediment containing pesticides. In contrast, ash free dry mass was significantly increased and male emergence was decreased in C. xanthus exposed to the same sediments. In conclusion, the selected biomarkers were not sensitive and specific enough to detect and anticipate effects of pesticide contamination at the levels measured in the study area. Nevertheless, individual performances alterations pointed to potential pollution problems and possible ecological consequences. Copyright © 2010 Elsevier Inc. All rights reserved.

Ergothioneine Contents in Fruiting Bodies and Their Enhancement in Mycelial Cultures by the Addition of Methionine

PubMed Central

Lee, Wi Young; Ahn, Jin Kwon; Ka, Kang-Hyeon

2009-01-01

The levels of ergothioneine (ERG), which have been shown to act as an excellent antioxidant, were determined in both fruiting bodies and mycelia of various mushroom species. We found that ERG accumulated at different levels in fruiting bodies of mushrooms and showed up to a 92.3-fold difference between mushrooms. We also found that ERG accumulated at higher levels in mycelia than in fruiting bodies of economically important mushroom species such as Ganoderma neo-japonicum, G. applanatum and Paecilomyces tenuipes. The addition of 2 mM methionine (Met) to mycelial culture medium increased the ERG contents in most mushroom species tested, indicating that Met is a good additive to enhance the ERG levels in a variety of mushroom species. Taking these results into consideration, we suggest that the addition of Met to the mycelial culture medium is an efficient way to enhance the antioxidant properties in economically important mushroom species. PMID:23983506

Transcriptome Analysis and Its Application in Identifying Genes Associated with Fruiting Body Development in Basidiomycete Hypsizygus marmoreus

PubMed Central

Chen, Hui; Zhao, Mingwen; Shi, Liang; Chen, Mingjie; Wang, Hong; Feng, Zhiyong

2015-01-01

To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M), mycelial pigmentation (H-V), primordium (H-P) and fruiting body (H-F) stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06%) unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), and Eukaryotic Orthologous Group (KOG) databases. Differentially expressed genes (DEGs) from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis. PMID:25837428

Evaluation of different agricultural wastes for the production of fruiting bodies and bioactive compounds by medicinal mushroom Cordyceps militaris.

PubMed

Lin, Qunying; Long, Liangkun; Wu, Liangliang; Zhang, Fenglun; Wu, Shuling; Zhang, Weiming; Sun, Xiaoming

2017-08-01

In commercial production of Cordyceps militaris (a famous Chinese medicine), cereal grains are usually utilized as cultivation substrates. This study aimed to evaluate the efficiency of agricultural wastes as substitute materials in the low-cost production of C. militaris. Cottonseed shells (CS), corn cob particles (CCP), Italian poplar sawdusts (IPS) and substrates spent by Flammulina velutipes (SS) were employed to cultivate C. militaris, using rice medium as control. CS and CCP were suitable for fruit body formation of C. militaris, with yields of 22 and 20 g per bottle respectively. Fruit bodies grown on CCP showed the highest levels of cordycepin and adenosine, up to 9.45 and 5.86 mg g -1 respectively. The content of d-mannitol in fruit bodies obtained on CS was 120 mg g -1 (80% of the control group), followed by that on CCP, 100 mg g -1 . Fruit bodies cultivated on CCP displayed a high crude polysaccharide level of 26.9 mg g -1 , which was the closest to that of the control group (34.5 mg g -1 ). CS and CCP are effective substrates for the production of fruit bodies and bioactive compounds by C. militaris. This study provides a new approach to decreasing the cost of C. militaris cultivation and dealing with these agricultural wastes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

PubMed Central

2013-01-01

Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes

Isolation and Characterization of Bioactive Metabolites from Fruiting Bodies and Mycelial Culture of Ganoderma oerstedii (Higher Basidiomycetes) from Mexico.

PubMed

Mendoza, Guillermo; Suárez-Medellín, Jorge; Espinoza, César; Ramos-Ligonio, Angel; Fernández, José J; Norte, Manuel; Trigos, Ángel

2015-01-01

Various species of the genus Ganoderma have been used for centuries according to oriental tradition as a source of medicines and nutrients. A chemical study of the fruiting bodies and mycelial culture of G. oerstedii was carried out with the idea of isolating and characterizing active natural components present to make use of their potential pharmaceutical application in Mexico. The fruiting bodies and mycelial culture of G. oesrtedii were lyophylized and extracted one after the other with hexane, chloroform, and methanol. Following this process, each substance was extracted separately by using column chromatography. From fruiting bodies eight metabolites, five sterols (ergosta-7,22-dien-3β-ol, ergosterol peroxide, ergosterol, cerevisterol, and ergosta-7,22-dien-3-one) as well as three terpene compounds (ganodermanondiol, ganoderic acid Sz, and ganoderitriol M) were obtained from fruiting bodies. From the mycelial culture three metabolites, two sterols (ergosterol and cerevisterol), and a new terpene compound (ganoderic acetate from the acid) were obtained. These structures were established based on a spectroscopic analysis mainly using nuclear magnetic resonance and a comparison with data already established.

Interplay between type IV pili activity and exopolysaccharides secretion controls motility patterns in single cells of Myxococcus xanthus

PubMed Central

Hu, Wei; Gibiansky, Maxsim L.; Wang, Jing; Wang, Chuandong; Lux, Renate; Li, Yuezhong; Wong, Gerard C. L.; Shi, Wenyuan

2016-01-01

Myxococcus xanthus performs coordinated social motility of cell groups through the extension and retraction of type IV pili (TFP) on solid surfaces, which requires both TFP and exopolysaccharides (EPS). By submerging cells in a liquid medium containing 1% methylcellulose, M. xanthus TFP-driven motility was induced in isolated cells and independently of EPS. We measured and analyzed the movements of cells using community tracking algorithms, which combine single-cell resolution with statistics from large sample populations. Cells without significant multi-cellular social interactions have surprisingly complex behaviors: EPS− cells exhibited a pronounced increase in the tendency to stand vertically and moved with qualitatively different characteristics than other cells. A decrease in the EPS secretion of cells correlates with a higher instantaneous velocity, but with lower directional persistence in trajectories. Moreover, EPS− cells do not adhere to the surface as strongly as wild-type and EPS overproducing cells, and display a greater tendency to have large deviations between the direction of movement and the cell axis, with cell velocity showing only minimal dependence on the direction of movement. The emerging picture is that EPS does not simply provide rheological resistance to a single mechanism but rather that the availability of EPS impacts motility pattern. PMID:26821939

Translocation of mercury from substrate to fruit bodies of Panellus stipticus, Psilocybe cubensis, Schizophyllum commune and Stropharia rugosoannulata on oat flakes.

PubMed

Gabriel, Jiří; Švec, Karel; Kolihová, Dana; Tlustoš, Pavel; Száková, Jiřina

2016-03-01

The cultivation and fructification of 15 saprotrophic and wood-rotting fungal strains were tested on three various semi-natural medium. The formation of fruit bodies was observed for Panellus stipticus, Psilocybe cubensis, Schizophyllum commune and Stropharia rugosoannulata in the frame of 1-2 months. Mercury translocation from the substrate to the fruit bodies was then followed in oat flakes medium. Translocation was followed for treatments of 0, 1.25, 2.5, 5, 10 and 20ppm Hg in the substrate. All four fungi formed fruit bodies in almost all replicates. The fruit body yield varied from 0.5 to 15.3g dry weight. The highest bioconcentration factor (BCF) of 2.99 was found for P. cubensis at 1.25ppm Hg. The BCF decreased with increasing Hg concentration in the substrate: 2.49, 0, 2.38, 1.71 and 1.82 for P. stipticus; 3.00, 2.78, 2.48, 1.81 and 2.15 for P. cubensis; 2.47, 1.81, 1.78, 1.07 and 0.96 for S. commune; and 1.96, 1.84, 1.21, 1.71 and 0.96 for S. rugosoannulata. The Hg contents in the fruit bodies reflected the Hg contents in the substrate; the highest contents in the fruit bodies were found in P. cubensis (43.08±7.36ppm Hg) and P. stipticus (36.42±3.39ppm). Copyright © 2015 Elsevier Inc. All rights reserved.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Allopatric integrations selectively change host transcriptomes, leading to varied expression efficiencies of exotic genes in Myxococcus xanthus.

PubMed

Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong

2015-07-22

Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.

Two new compounds from the fruiting bodies of Ganoderma philippii.

PubMed

Yang, Shuang; Ma, Qing-Yun; Kong, Fan-Dong; Xie, Qing-Yi; Huang, Sheng-Zhuo; Zhou, Li-Man; Dai, Hao-Fu; Yu, Zhi-Fang; Zhao, You-Xing

2018-03-01

Two new compounds, philippin (1) and 3β,9α,14α-trihydroxy-(22E,24R)-ergost-22-en-7-one (2), were isolated from the fruiting bodies of Ganoderma philippii. Their structures were elucidated on the basis of the spectroscopic technologies, including 1D and 2D NMR as well as MS. The bioassay of inhibitory activity against acetylcholinesterase (AChE) showed compound 1 exhibited weak inhibitory activity against AChE.

Effects of Illumination Pattern during Cultivation of Fruiting Body and Bioactive Compound Production by the Caterpillar Medicinal Mushroom, Cordyceps militaris (Ascomycetes).

PubMed

Wu, Chiu-Yeh; Liang, Zeng-Chin; Tseng, Chin-Yin; Hu, Shu-Hui

2016-01-01

We investigated the effects of light intensity in the 3 cultivation stages separately-the mycelium colonization stage, the primordial initiation stage, and the fruiting stage (in order)-on fruiting body and bioactive compound production by Cordyceps militaris. In the mycelium colonization stage, rice substrates were incubated in a spawn running room at 23°C. During the primordial initiation stage, C. militaris was grown at 18°C and illuminated 12 hours/day. In the fruiting stage the temperature was 23°C, with illumination provided 12 hours/day. The highest fruiting body yield and biological efficiency were 4.06 g dry weight/bottle and 86.83%, respectively, under 1750 ± 250 lux during the second and third stages. The cordycepin content was highest during the second and third stages under 1250 ± 250 lux. The mannitol and polysaccharide contents were highest under 1250 ± 250 and 1750 ± 250 lux during the primordial initiation stage and the fruiting stage, respectively. Thus, with controlled lighting, C. militaris can be cultivated in rice-water medium to increase fruiting body yield and bioactive compound production.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Effects of site-directed mutagenesis of mglA on motility and swarming of Myxococcus xanthus

PubMed Central

2010-01-01

Background The mglA gene from the bacterium Myxococcus xanthus encodes a 22kDa protein related to the Ras superfamily of monomeric GTPases. MglA is required for the normal function of A-motility (adventurous), S-motility (social), fruiting body morphogenesis, and sporulation. MglA and its homologs differ from all eukaryotic and other prokaryotic GTPases because they have a threonine (Thr78) in place of the highly conserved aspartate residue of the consensus PM3 (phosphate-magnesium binding) region. To identify residues critical for MglA function or potential protein interactions, and explore the function of Thr78, the phenotypes of 18 mglA mutants were characterized. Results Nine mutants, with mutations predicted to alter residues that bind the guanine base or coordinate magnesium, did not produce detectable MglA. As expected, these mutants were mot- dev- because MglA is essential for these processes. Of the remaining nine mutants, seven showed a wild-type distribution pattern for MglA but fell into two categories with regard to function. Five of the seven mutants exhibited mild phenotypes, but two mutants, T78D and P80A, abolished motility and development. The localization pattern of MglA was abolished in two mutants that were mot- spo- and dev-. These two mutants were predicted to alter surface residues at Asp52 and Thr54, which suggests that these residues are critical for proper localization and may define a protein interaction site. Improving the consensus match with Ras at Thr78 abolished function of MglA. Only the conservative serine substitution was tolerated at this position. Merodiploid constructs revealed that a subset of alleles, including mglAD52A, were dominant and also illustrated that changing the balance of MglA and its co-transcribed partner, MglB, affects A-motility. Conclusion Our results suggest that GTP binding is critical for stability of MglA because MglA does not accumulate in mutants that cannot bind GTP. The threonine in PM3 of Mgl

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Long-Distance Translocation of Protein during Morphogenesis of the Fruiting Body in the Filamentous Fungus, Agaricus bisporus

PubMed Central

Woolston, Benjamin M.; Schlagnhaufer, Carl; Wilkinson, Jack; Larsen, Jeffrey; Shi, Zhixin; Mayer, Kimberly M.; Walters, Donald S.; Curtis, Wayne R.; Romaine, C. Peter

2011-01-01

Commercial cultivation of the mushroom fungus, Agaricus bisporus, utilizes a substrate consisting of a lower layer of compost and upper layer of peat. Typically, the two layers are seeded with individual mycelial inoculants representing a single genotype of A. bisporus. Studies aimed at examining the potential of this fungal species as a heterologous protein expression system have revealed unexpected contributions of the mycelial inoculants in the morphogenesis of the fruiting body. These contributions were elucidated using a dual-inoculant method whereby the two layers were differientially inoculated with transgenic β-glucuronidase (GUS) and wild-type (WT) lines. Surprisingly, use of a transgenic GUS line in the lower substrate and a WT line in the upper substrate yielded fruiting bodies expressing GUS activity while lacking the GUS transgene. Results of PCR and RT-PCR analyses for the GUS transgene and RNA transcript, respectively, suggested translocation of the GUS protein from the transgenic mycelium colonizing the lower layer into the fruiting body that developed exclusively from WT mycelium colonizing the upper layer. Effective translocation of the GUS protein depended on the use of a transgenic line in the lower layer in which the GUS gene was controlled by a vegetative mycelium-active promoter (laccase 2 and β-actin), rather than a fruiting body-active promoter (hydrophobin A). GUS-expressing fruiting bodies lacking the GUS gene had a bonafide WT genotype, confirmed by the absence of stably inherited GUS and hygromycin phosphotransferase selectable marker activities in their derived basidiospores and mycelial tissue cultures. Differientially inoculating the two substrate layers with individual lines carrying the GUS gene controlled by different tissue-preferred promoters resulted in up to a ∼3.5-fold increase in GUS activity over that obtained with a single inoculant. Our findings support the existence of a previously undescribed phenomenon of long

Association between fruit juice consumption and self-reported body mass index among adult Canadians.

PubMed

Akhtar-Danesh, N; Dehghan, M

2010-04-01

The prevalence of obesity and being overweight is rising among adult Canadians and diet is recognised as one of the main causes of obesity. The consumption of fruit and vegetables is shown to be protective against obesity and being overweight but little is known about the association of fruit juice consumption and obesity and being overweight. The present study aimed to investigate the association between fruit juice consumption and self-reported body mass index (BMI) among adult Canadians. This analysis is based on the Canadian Community Health Survey, Cycle 3.1. A regression method was used to assess the association of fruit juice consumption with self-reported BMI in 18-64-year-old Canadians who had been adjusted for sex, age, total household income, education, self-rated health, and daily energy expenditure. Because the analysis is based on a cross-sectional dataset, it does not imply a cause and effect relationship. Almost 38.6% of adult Canadians reported a fruit juice intake of 0.5-1.4 times per day and 18.2% consumed fruit juice more than 1.5 times per day. Participants with normal weight were likely to consume more fruit juice than obese individuals. Regression analysis showed a negative association between fruit juice consumption and BMI after adjusting for age, sex, education, marital status, income, total fruit and vegetable intake, daily energy expenditure, and self-rated health. On average, for each daily serving of fruit juice, a -0.22 unit (95% confidence interval = -0.33 to -0.11) decrease in BMI was observed. The results obtained showed a moderate negative association between fruit juice intake and BMI, which may suggest that a moderate daily consumption of fruit juice is associated with normal weight status.

Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

PubMed Central

Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

2012-01-01

Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

A Dynamic Response Regulator Protein Modulates G-Protein–Dependent Polarity in the Bacterium Myxococcus xanthus

PubMed Central

Zhang, Yong; Guzzo, Mathilde; Ducret, Adrien; Li, Yue-Zhong; Mignot, Tâm

2012-01-01

Migrating cells employ sophisticated signal transduction systems to respond to their environment and polarize towards attractant sources. Bacterial cells also regulate their polarity dynamically to reverse their direction of movement. In Myxococcus xanthus, a GTP-bound Ras-like G-protein, MglA, activates the motility machineries at the leading cell pole. Reversals are provoked by pole-to-pole switching of MglA, which is under the control of a chemosensory-like signal transduction cascade (Frz). It was previously known that the asymmetric localization of MglA at one cell pole is regulated by MglB, a GTPase Activating Protein (GAP). In this process, MglB specifically localizes at the opposite lagging cell pole and blocks MglA localization at that pole. However, how MglA is targeted to the leading pole and how Frz activity switches the localizations of MglA and MglB synchronously remained unknown. Here, we show that MglA requires RomR, a previously known response regulator protein, to localize to the leading cell pole efficiently. Specifically, RomR-MglA and RomR-MglB complexes are formed and act complementarily to establish the polarity axis, segregating MglA and MglB to opposite cell poles. Finally, we present evidence that Frz signaling may regulate MglA localization through RomR, suggesting that RomR constitutes a link between the Frz-signaling and MglAB polarity modules. Thus, in Myxococcus xanthus, a response regulator protein governs the localization of a small G-protein, adding further insight to the polarization mechanism and suggesting that motility regulation evolved by recruiting and combining existing signaling modules of diverse origins. PMID:22916026

A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

PubMed

Kück, Ulrich

2005-10-01

Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

Effect of light quality on development of fruiting bodies of Panus fragilis

Treesearch

Orson K. Miller; John G. Palmer

1977-01-01

Under a system that permits mass screening of mycelia within bands of the visible spectrum, fruit bodies initiated and developed in two light bands (387-400nm and 425-430nm) in axenic culture. Either or both of these light bands will trigger fruitbody initiation at as low an energy level as 0.2 K (1 K = 1,000 microwatts/cm2). Maturation of sporocarp and hymenium...

A Fruiting Body Tissue Method for Efficient Agrobacterium-Mediated Transformation of Agaricus bisporus

PubMed Central

Chen, Xi; Stone, Michelle; Schlagnhaufer, Carl; Romaine, C. Peter

2000-01-01

We describe a modified Agrobacterium-mediated method for the efficient transformation of Agaricus bisporus. Salient features of this procedure include cocultivation of Agrobacterium and fruiting body gill tissue and use of a vector with a homologous promoter. This method offers new prospects for the genetic manipulation of this commercially important mushroom species. PMID:11010906

Evaluation of the potential use of probiotic strain Lactobacillus plantarum 299v in lactic fermentation of button mushroom fruiting bodies.

PubMed

Jabłońska-Ryś, Ewa; Sławińska, Aneta; Radzki, Wojciech; Gustaw, Waldemar

2016-01-01

The available literature does not provide data on the application of probiotic strains in mushroom processing. The aim of the study was to evaluate the potential to use the L. plantarum 299v strain with documented probiotic properties in the process of lactic fermentation of button mushroom fruiting bodies (Agaricus bisporus). Fresh button mushroom fruiting bodies and cultures of lactic acid bacteria L. plantarum Ib and a probiotic strain L. plantarum 299v were the material analysed. Sensory evaluation was performed with a 5-point scale, an instrumental method of colour measurement based on the CIA L*a*b* scale, total phenolic compounds were determined with the Folin method, antioxidant properties were assayed with the DPPH radical test, and reducing power was determined using the FRAP method. After a week-long lactic fermentation, the pH value in the samples declined to a level of 3.6 (L. plantarum Ib) and 3.75 (L. plantarum 299v); these values persisted or decreased slightly during the period of maturation of the fermented samples under refrigeration. Fermented mushrooms were assigned high grades in the organoleptic evaluation. The colour analysis revealed significant changes in the values of the L*a*b* parameters in the fermented product, in comparison with fresh mushrooms. Blanching contributed to a significant decrease in the content of total phenolic compounds in the mushroom fruiting bodies and to a decline in antioxidant activity. Mushrooms fermented with the probiotic strain were characterised by higher phenolic compound content and higher antioxidant activity. L. plantarum 299v strain with documented probiotic properties can be applied in fermentation of button mushroom fruiting bodies. Products obtained with the use of both strains were characterised by good sensory properties. The type of strain used in the lactic fermentation of mushroom fruiting bodies had an effect on the phenolic compound content and antioxidant properties of the final product.

Ethanol concentration in food and body condition affect foraging behavior in Egyptian fruit bats ( Rousettus aegyptiacus)

NASA Astrophysics Data System (ADS)

Sánchez, Francisco; Korine, Carmi; Kotler, Burt P.; Pinshow, Berry

2008-06-01

Ethanol occurs in fleshy fruit as a result of sugar fermentation by both microorganisms and the plant itself; its concentration [EtOH] increases as fruit ripens. At low concentrations, ethanol is a nutrient, whereas at high concentrations, it is toxic. We hypothesized that the effects of ethanol on the foraging behavior of frugivorous vertebrates depend on its concentration in food and the body condition of the forager. We predicted that ethanol stimulates food consumption when its concentration is similar to that found in ripe fruit, whereas [EtOH] below or above that of ripe fruit has either no effect, or else deters foragers, respectively. Moreover, we expected that the amount of food ingested on a particular day of feeding influences the toxic effects of ethanol on a forager, and consequently shapes its feeding decisions on the following day. We therefore predicted that for a food-restricted forager, ethanol-rich food is of lower value than ethanol-free food. We used Egyptian fruit bats ( Rousettus aegyptiacus) as a model to test our hypotheses, and found that ethanol did not increase the value of food for the bats. High [EtOH] reduced the value of food for well-fed bats. However, for food-restricted bats, there was no difference between the value of ethanol-rich and ethanol-free food. Thus, microorganisms, via their production of ethanol, may affect the patterns of feeding of seed-dispersing frugivores. However, these patterns could be modified by the body condition of the animals because they might trade-off the costs of intoxication against the value of nutrients acquired.

The control of fruiting body formation in the ascomycete Sordaria macrospora Auersw. by arginine and biotin: a two-factor analysis.

PubMed

Molowitz, R; Bahn, M; Hock, B

1976-01-01

Fruiting body formation of Sordaria macrospora Auersw. is controlled by L-arginine and biotin when the fungus is grown on a synthetic nutrient medium containing optimal concentrations of fructose, KNO3, KH2PO4, MgSO4, and ZnSO4. Arginine and biotin operate in very low concentrations which exclude unspecific nutrient effects. In spite of the complicated interactions of arginine and biotin which are shown qualitatively (Figs. 3 and 4a) and quantitatively (Figs. 2 and 4b), the following conclusions are reached: 1. In the absence of biotin, the development of Sordaria macrospora is blocked at the stage of small protoperithecia. The external addition of biotin (optimal concentration: 3-12 μg/l) allows the formation of fertile fruiting bodies. This effect cannot be imitated by arginine. The biotin effect is discussed in connection with stimulated RNA synthesis.-2. The developmental velocity is influenced by the external addition of arginine. Without arginine but at permissible biotin concentrations, the total life cycle takes about 10 days, in the presence of arginine (1 mM), however, about 6 days.-3. The hyphal density, as well as the total number of fruiting bodies being produced, is controlled in a similar manner by biotin and arginine. The induction of fruiting body formation obviously takes place after the transgression of a critical hyphal density.

Lanostane-type triterpenoids from the fruiting body of Ganoderma calidophilum.

PubMed

Huang, Sheng-Zhuo; Ma, Qing-Yun; Kong, Fan-Dong; Guo, Zhi-Kai; Cai, Cai-Hong; Hu, Li-Li; Zhou, Li-Man; Wang, Qi; Dai, Hao-Fu; Mei, Wen-Li; Zhao, You-Xing

2017-11-01

To search for active anti-cancer constituents in the fruiting body of Ganoderma calidophilum, we have successfully isolated four previously undescribed spiro-lactone lanostane triterpenoids (spiroganocalitones A-D), two previously undescribed lanostanoids (ganodecalones A and B) together with twenty-three known ones. The structures of the six previously undescribed compounds were elucidated based on 1D, 2D-NMR, and HRMS analyses. Ganoderone A showed moderate cytotoxic activity against K562, BEL7402, and SGC790 cell lines with IC 50 values of 7.62, 6.28, and 3.55 μM, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

A novel polyketide biosynthesis gene cluster is involved in fruiting body morphogenesis in the filamentous fungi Sordaria macrospora and Neurospora crassa.

PubMed

Nowrousian, Minou

2009-04-01

During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.

An evaluation system for characterization of polysaccharides from the fruiting body of Hericium erinaceus and identification of its commercial product.

PubMed

Wu, Ding-Tao; Li, Wen-Zhi; Chen, Jun; Zhong, Qian-Xia; Ju, Yao-Jun; Zhao, Jing; Bzhelyansky, Anton; Li, Shao-Ping

2015-06-25

An evaluation system including colorimetric assay with iodine and potassium iodide, HPSEC-MALLS-RID analysis, GC-MS analysis, and saccharide mapping based on PACE analysis was proposed for the identification and discrimination of commercial product of Hericium erinaceus based on the chemical characters of polysaccharides in H. erinaceus fruiting body collected from different regions of China. The results showed that the molecular weights, the compositional monosaccharides and the glycosidic linkages of polysaccharides in H. erinaceus collected from different regions of China were similar, respectively. However, polysaccharides in the widely consumed product of H. erinaceus in China were significantly different from those of H. erinaceus fruiting body. The implications from these results were found to be beneficial to improve the quality control of polysaccharides from the H. erinaceus fruiting body, and suggest that the proposed evaluation system could be used as a routine approach for the quality control of polysaccharides in other edible and medicinal mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Three new isobenzofuranone derivatives from the fruiting bodies of Hericium erinaceus.

PubMed

Wang, Xu-Li; Gao, Jie; Li, Jing; Long, Hong-Ping; Xu, Ping-Sheng; Xu, Kang-Ping; Tan, Gui-Shan

2017-02-01

Three new isobenzofuranone derivatives erinaceolactones D-F (1-3), together with four known ones (4-7), were isolated from the fruiting bodies of Hericium erinaceus. Their structures were determined on the basis of comprehensive spectroscopic analyses including UV, 1D, 2D NMR and HR-TOF-MS. The absolute configuration of erinaceolactone D (1) and erinaceolactone E (2) were assigned by comparing their specific rotation with those of analogs in literatures. The four known compounds were isomers with each other and were isolated simultaneously for the first time.

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development

PubMed Central

Rajagopalan, Ramya

2017-01-01

ABSTRACT Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI, a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT. We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and Dev

Comparative transcriptomics of Pleurotus eryngii reveals blue-light regulation of carbohydrate-active enzymes (CAZymes) expression at primordium differentiated into fruiting body stage.

PubMed

Xie, Chunliang; Gong, Wenbing; Zhu, Zuohua; Yan, Li; Hu, Zhenxiu; Peng, Yuande

2018-05-01

Blue light is an important environmental factor which could induce mushroom primordium differentiation and fruiting body development. However, the mechanisms of Pleurotus eryngii primordium differentiation and development induced by blue light are still unclear. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of renewable lignocelluloses to provide carbohydrates for fungal growth, development and reproduction. In the present research, the expression profiles of genes were measured by comparison between the Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation and dark using high-throughput sequencing approach. After assembly and compared to the Pleurotus eryngii reference genome, 11,343 unigenes were identified. 539 differentially expressed genes including white collar 2 type of transcription factor gene, A mating type protein gene, MAP kinase gene, oxidative phosphorylation associated genes, CAZymes genes and other metabolism related genes were identified during primordium differentiated into fruiting body stage after blue light stimulation. KEGG results showed that carbon metabolism, glycolysis/gluconeogenesis and biosynthesis of amino acids pathways were affected during blue light inducing primordia formation. Most importantly, 319 differentially expressed CAZymes participated in carbon metabolism were identified. The expression patterns of six representative CAZymes and laccase genes were further confirmed by qRT-PCR. Enzyme activity results indicated that the activities of CAZymes and laccase were affected in primordium differentiated into fruiting body under blue light stimulation. In conclusion, the comprehensive transcriptome and CAZymes of Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation were obtained. The biological insights gained from this integrative system represent a valuable resource for future genomic studies on this

Antioxidant properties of fruiting bodies, mycelia, and fermented products of the culinary-medicinal king oyster mushroom, Pleurotus eryngii (higher Basidiomycetes), with high ergothioneine content.

PubMed

Liang, Chih-Hung; Ho, Kung-Jui; Huang, Ling-Yi; Tsai, Ching-Hsuan; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom Pleurotus eryngii is known to contain ergothioneine, and its products, including fruiting bodies, mycelia, and solid-state fermented products (adlay and buckwheat), were prepared to study their antioxidant properties. Fruiting bodies, regular and Hi-Ergo mycelia, and fermented products contained 2.05, 1.68, 5.76, 0.79-0.80 mg/g of ergothioneine, respectively. On the basis of the results obtained, P. eryngii products had effective antioxidant activity, reducing power, and scavenging ability on 1,1-diphenyl-2-picrylhydrazyl radicals and chelating ability on ferrous ions. Hi-Ergo mycelia was the most effective in the first 3 antioxidant properties in addition to its ergothioneine content. In addition, fruiting bodies were more effective in all antioxidant properties than regular mycelia. For ethanolic and hot water extracts from mycelia and fruiting bodies, the correlation coefficients between total phenol contents and each antioxidant attribute were 0.483-0.921. Overall, P. eryngii products with high amounts of ergothioneine could be used beneficially as a functional food.

Myxobacteria, Polarity, and Multicellular Morphogenesis

PubMed Central

Kaiser, Dale; Robinson, Mark; Kroos, Lee

2010-01-01

Myxobacteria are renowned for the ability to sporulate within fruiting bodies whose shapes are species-specific. The capacity to build those multicellular structures arises from the ability of M. xanthus to organize high cell-density swarms, in which the cells tend to be aligned with each other while constantly in motion. The intrinsic polarity of rod-shaped cells lays the foundation, and each cell uses two polar engines for gliding on surfaces. It sprouts retractile type IV pili from the leading cell pole and secretes capsular polysaccharide through nozzles from the trailing pole. Regularly periodic reversal of the gliding direction was found to be required for swarming. Those reversals are generated by a G-protein switch which is driven by a sharply tuned oscillator. Starvation induces fruiting body development, and systematic reductions in the reversal frequency are necessary for the cells to aggregate rather than continue to swarm. Developmental gene expression is regulated by a network that is connected to the suppression of reversals. PMID:20610548

Rat medium-term multi-organ carcinogenesis bioassay of Agaricus blazei Murrill fruit-body extract.

PubMed

Doi, Yuko; Furukawa, Fumio; Suguro, Mayuko; Ito, Hikaru; Imai, Norio; Nabae, Kyoko; Toda, Yosuke; Inatomi, Satoshi; Kinugasa, Satomi; Kobayashi, Hitoshi

2010-01-01

The modifying potential of Agaricus blazei Murrill fruit-body extract (ABFE) on tumor development was investigated in a medium-term multi-organ carcinogenesis bioassay. Male 6-week-old F344 rats were treated with N-nitrosodiethylamine (DEN), N-methyl-N-nitrosourea (MNU), 1,2-dimethylhydrazine dihydrochloride (DMH), N-butyl-N-(hydroxybutyl)-nitrosamine (BBN), and diisopropanolnitrosamine (DHPN) for initiation (DMBDD treatment). After a 1-week withdrawal period, the animals received distilled water (vehicle control) or ABFE A, gamma-amino butyric acid (GABA) at 0.8 mg/kg, ABFE B (GABA level of 3.0mg/kg) or ABFE C (GABA level of 12.0mg/kg) by gavage for 24 weeks. There were no effects of ABFE on survival rate, general condition, body weight, food and water consumption, and organ weights. The multiplicity of large intestinal nodules, smaller than 2mm was significantly increased in the ABFE C group with DMBDD treatment. However, there were no significantly inter-group differences in incidences of hyperplastic or neoplastic lesions in colon or other organs, or in immunohistochemically identified preneoplastic lesions in the liver. In conclusion, A. blazei Murrill fruit-body extract, even at a GABA level up to 12 mg/kg, did not exert modifying potential in the present medium-term multi-organ carcinogenesis bioassay in male F344 rats (DMBDD method). Copyright 2009 Elsevier Ltd. All rights reserved.

[Correlations between the characters of the mycelium vegetative growth and the formation of the fruiting body of Ganoderma luciderm].

PubMed

Wang, Shu-fang; He, Xiu-feng; He, Hui-xia; Zhu, Ping

2006-01-01

To select a proper Ganoderma luciderm strain for the fruiting body production. The strains were cultivated on the agar media and in the liquid media, respectively. Then the strains were inoculated onto the solid medium made from agricultural products (such as wheat bran, corn powder, wood meal, etc.) and cultured for a certain period. Strains, which were easier to produce polyporic tissues at the vegetative growth stage, would be more quickly to form fruiting body with high quality and yield of the spores. Appearance of the polyporic tissues at the mycelium vegetative growth stage could be used as a marker for the strain selection for the G. luciderm substituted cultivation.

Project EAGLE (Early Academic Gifted Learning Experience): A Program for Gifted and Talented Students (Grades K-3)--Kindergarten Activity Booklets: Xanthus; Zhack; and Activity Pages H-Z.

ERIC Educational Resources Information Center

Merkoski, Kay

Three activity booklets are presented for implementing Project EAGLE, an enrichment program for gifted and talented kindergarten children. The first activity booklet contains a poem by J. D. Evans titled "In Search of the Xanthus," which describes the search for an imaginary beast that leaves an "X" on the spot where it used to be. The second…

Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

PubMed

Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

2015-10-01

In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

New isoindolinones from the fruiting bodies of Hericium erinaceum.

PubMed

Wang, Xu-Li; Xu, Kang-Ping; Long, Hong-Ping; Zou, Hui; Cao, Xiao-Zheng; Zhang, Kai; Hu, Jian-Zhong; He, Shu-Jin; Zhu, Gang-Zhi; He, Xiao-Ai; Xu, Ping-Sheng; Tan, Gui-Shan

2016-06-01

Hericium erinaceus is a well-known medicinal and edible mushroom, which is considered as a potential source to obtain antitumor candidates. In this work, five new isoindolinones, named erinaceolactams A-E (1-5), along with five known compounds (6-10), were isolated from 70% ethanol extract of the fruiting bodies of H. erinaceus. The structures of new compounds were validated by HRESIMS and 1D, 2D NMR. It's worth mentioning that there are two pairs of isomers included in the new compounds. Moreover, their cytotoxicity against metastatic human hepatocellular carcinoma cell lines SMMC-7221 and MHCC-97H were evaluated. The results showed that compounds 6 and 7 exhibited promising inhibitory potency against the growth of two cell lines. Copyright © 2016 Elsevier B.V. All rights reserved.

The control of fruiting body formation in the ascomycete Sordaria macrospora Auersw. by regulation of hyphal development : An analysis based on scanning electron and light microscopic observations.

PubMed

Hock, B; Bahn, M; Walk, R A; Nitschke, U

1978-01-01

The morphological effects of biotin and L-arginine on fruiting body formation of the ascomycete Sordaria macrospora are investigated by scanning electron and light microscopy. Biotin is recognized as an elongation factor and arginine as a branching factor in vegetative and reproductive hyphae. In the absence of exogenous biotin, development is blocked after the ascogonium-core hypha stage of protoperithecial morphogenesis, whereas linear growth of the myceliar front is maintained. The addition of exogenous arginine to a biotin deficient culture induces the formation of numerous side branches even in the older mycelium. Fruiting body formation, however, remains blocked at the protoperithecial stage as before, because of the inability of the side branches to elongate. When biotin and arginine are administered simultaneously, a most vigorous branching and growth are induced in the older mycelium, accompanied by a rapid and maximal formation of fruiting bodies. The results are summarized in a model of the exogenous control of hyphal morphogenesis. The model is designed to explain the relationship between fruiting and hyphal density as well as the edge effect on fruiting body formation.

New lanostane-type triterpenoids from the fruiting body of Ganoderma hainanense.

PubMed

Li, Wei; Lou, Lan-Lan; Zhu, Jian-Yong; Zhang, Jun-Sheng; Liang, An-An; Bao, Jing-Mei; Tang, Gui-Hua; Yin, Sheng

2016-12-01

Five new lanostane-type triterpenoids, ganoderenses A-E (1-5), two new lanostane nor-triterpenoids, ganoderenses F and G (6 and 7), along with 13 known analogues (8-20) were isolated from the fruiting body of Ganoderma hainanense. Their structures were determined by combined chemical and spectral methods, and the absolute configurations of compounds 1 and 13 were confirmed by single crystal X-ray diffraction. All compounds were evaluated for inhibitory activity against thioredoxin reductase (TrxR), a potential target for cancer chemotherapy with redox balance and antioxidant functions, but were inactive. Copyright © 2016 Elsevier B.V. All rights reserved.

Removal of Emulsified Oil from Water by Fruiting Bodies of Macro-Fungus (Auricularia polytricha)

PubMed Central

Yang, Xunan; Guo, Mengting; Wu, Yinghai; Wu, Qunhe; Zhang, Renduo

2014-01-01

The aim of this study was to investigate the feasibility of utilizing the fruiting bodies of a jelly macro-fungus Auricularia polytricha as adsorbents to remove emulsified oil from water. The effects of several factors, including temperature, initial pH, agitation speed, and adsorbent dosage, were taken into account. Results showed that the optimized conditions for adsorption of A. polytricha were a temperature of 35°C, pH of 7.5, and agitation speed of 100 rpm. The adsorption kinetics were characterized by the pseudo-first order model, which showed the adsorption to be a fast physical process. The Langmuir-Freundlich isotherm described the adsorption very well and predicted the maximum adsorption capacity of 398 mg g−1, under optimized conditions. As illustrated by scanning electron micrographs, the oil particles were adsorbed onto the hairs covering the bottom surface and could be desorbed by normal temperature volatilization. The material could be used as an emulsified oil adsorbent at least three times, retaining more than 95% of the maximum adsorption capacity. The results demonstrated that the fruiting bodies of A. polytricha can be a useful adsorbent to remove emulsified oil from water. PMID:24743498

Increased intake of fruits and vegetables in overweight subjects: effects on body weight, body composition, metabolic risk factors and dietary intake.

PubMed

Järvi, A; Karlström, B; Vessby, B; Becker, W

2016-05-28

A diet rich in fruits and vegetables has been associated with several health benefits. However, the effects on body weight (BW) and metabolic markers are not fully known. The present study investigated the effects of increased intake of fruits and vegetables in overweight and obese men and women on dietary habits, anthropometry and metabolic control. In a 16-week controlled intervention, thirty-four men and thirty-four women aged 35-65 years (BMI>27 kg/m2) were randomised to an intervention (IN) or a reference (RG) group. All participants received general dietary advice, and subjects in the IN group received fruits and vegetables for free, of which ≥500 g had to be eaten daily. BW, waist circumference (WC), sagittal abdominal diameter (SAD), plasma insulin, blood glucose, glycated Hb (HbA1c), serum lipids, blood pressure, plasminogen activator inhibitor-1 activity, urinary isoprostane (iso-8-PGF 2α) and serum carotenoids were measured. Diet was assessed using 3-d weighed food records. In all, thirty subjects in the IN group and thirty-two in the RG group completed the intervention. Intake of fruits and vegetables doubled in the IN group, whereas intake of fruits increased in the RG group. Serum α- and β-carotene concentrations and intakes of folate and vitamin C increased significantly in the IN group. Energy intake, BW, WC and SAD decreased significantly in both groups. Supine systolic blood pressure decreased significantly in the IN group, with no between-group differences. No significant changes were observed for other metabolic markers. Provision of fruits and vegetables led to substantially increased intakes, with subsequent favourable changes in anthropometry and insulin levels, which tended to be more pronounced in the IN group. The observed improvements may, in combination with improved nutritional markers, have health benefits in the long term.

Development and growth of fruit bodies and crops of the button mushroom, Agaricus bisporus.

PubMed

Straatsma, Gerben; Sonnenberg, Anton S M; van Griensven, Leo J L D

2013-10-01

We studied the appearance of fruit body primordia, the growth of individual fruit bodies and the development of the consecutive flushes of the crop. Relative growth, measured as cap expansion, was not constant. It started extremely rapidly, and slowed down to an exponential rate with diameter doubling of 1.7 d until fruit bodies showed maturation by veil breaking. Initially many outgrowing primordia were arrested, indicating nutritional competition. After reaching 10 mm diameter, no growth arrest occurred; all growing individuals, whether relatively large or small, showed an exponential increase of both cap diameter and biomass, until veil breaking. Biomass doubled in 0.8 d. Exponential growth indicates the absence of competition. Apparently there exist differential nutritional requirements for early growth and for later, continuing growth. Flushing was studied applying different picking sizes. An ordinary flushing pattern occurred at an immature picking size of 8 mm diameter (picking mushrooms once a day with a diameter above 8 mm). The smallest picking size yielded the highest number of mushrooms picked, confirming the competition and arrested growth of outgrowing primordia: competition seems less if outgrowing primordia are removed early. The flush duration (i.e. between the first and last picking moments) was not affected by picking size. At small picking size, the subsequent flushes were not fully separated in time but overlapped. Within 2 d after picking the first individuals of the first flush, primordia for the second flush started outgrowth. Our work supports the view that the acquisition of nutrients by the mycelium is demand rather than supply driven. For formation and early outgrowth of primordia, indications were found for an alternation of local and global control, at least in the casing layer. All these data combined, we postulate that flushing is the consequence of the depletion of some unknown specific nutrition required by outgrowing

Antioxidant, Anti-Inflammatory, and Antitumor Activities of Cultured Mycelia and Fruiting Bodies of the Elm Oyster Mushroom, Hypsizygus ulmarius (Agaricomycetes).

PubMed

Greeshma, Panavalappil; Ravikumar, Korattuvalappil S; Neethu, Mangalathmelathil N; Pandey, Meera; Zuhara, Karattuthodi Fathimathu; Janardhanan, Kainoor K

2016-01-01

Ethanoic extracts from the fruiting bodies and mycelia of the elm oyster mushroom, Hypsizygus ulmarius, were evaluated for their antioxidant, anti-inflammatory, and antitumor properties. Ethnolic extracts of fruiting body and mycelia showed 88%, 85%, 71%, and 85%, 65%, 70% 2,2-diphenyl-1-picrylhydrazyl, hydroxyl (DPPH) and 2,2'-azinobis (3-ethyl benzothiazolin-6-sulfonic acid) (ABTS) radical-scavenging activities, respectively, at a concentration of 1000 µg/mL. The anti-inflammatory activity was determined using carrageenan- and formalin- induced paw edema models. Diclofenac was used as the standard drug. In both models, the mycelia extract showed higher activity than the fruiting body extract. The antitumor effect of the extracts against Dalton's Lymphoma Ascites cell-line-induced tumors showed significant antitumor activity. Mycochemical analysis confirmed the presence of many pharmacologically active compounds such as phenol, alkaloids, proteins, tannins, and polysaccharides. Among these, polysaccharides and phenolic compounds were present at a higher concentration in both extracts. These compounds might be largely responsible for the mushroom's medicinal properties. The results of this study indicate that H. ulmarius possesses significant antioxidant, anti-inflammatory, and antitumor properties.

Glutathione S-transferase 4 is a putative DIF-binding protein that regulates the size of fruiting bodies in Dictyostelium discoideum.

PubMed

Kuwayama, Hidekazu; Kikuchi, Haruhisa; Oshima, Yoshiteru; Kubohara, Yuzuru

2016-12-01

In the development of the cellular slime mold Dictyostelium discoideum , two chlorinated compounds, the differentiation-inducing factors DIF-1 and DIF-2, play important roles in the regulation of both cell differentiation and chemotactic cell movement. However, the receptors of DIFs and the components of DIF signaling systems have not previously been elucidated. To identify the receptors for DIF-1 and DIF-2, we here performed DIF-conjugated affinity gel chromatography and liquid chromatography-tandem mass spectrometry and identified the glutathione S-transferase GST4 as a major DIF-binding protein. Knockout and overexpression mutants of gst4 ( gst4 - and gst4 OE , respectively) formed fruiting bodies, but the fruiting bodies of gst4 - cells were smaller than those of wild-type Ax2 cells, and those of gst4 OE cells were larger than those of Ax2 cells. Both chemotaxis regulation and in vitro stalk cell formation by DIFs in the gst4 mutants were similar to those of Ax2 cells. These results suggest that GST4 is a DIF-binding protein that regulates the sizes of cell aggregates and fruiting bodies in D. discoideum .

Bioactive formulations prepared from fruiting bodies and submerged culture mycelia of the Brazilian edible mushroom Pleurotus ostreatoroseus Singer.

PubMed

Corrêa, Rúbia Carvalho Gomes; de Souza, Aloisio Henrique Pereira; Calhelha, Ricardo C; Barros, Lillian; Glamoclija, Jasmina; Sokovic, Marina; Peralta, Rosane Marina; Bracht, Adelar; Ferreira, Isabel C F R

2015-07-01

Pleurotus ostreatoroseus is a Brazilian edible mushroom whose chemical characterization and bioactivity still remain underexplored. In this study, the hydrophilic and lipophilic compounds as well as the antioxidant, anti-inflammatory and antimicrobial activities of formulations (ethanol extracts) prepared with its fruiting bodies and submerged culture mycelia were compared. The bioactive formulations contain at least five free sugars, four organic acids, four phenolic compounds and two tocopherols. The fruiting body-based formulation revealed higher reducing power, DPPH scavenging activity, β-carotene bleaching inhibition and lipid peroxidation inhibition in brain homogenates than the mycelium-based preparation, as well as higher anti-inflammatory and antimicrobial activities. The absence of hepatotoxicity was confirmed in porcine liver primary cells. These functional responses can be related to the levels of bioactive components including phenolic acids, organic acids and tocopherols.

Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

PubMed Central

Yoder-Himes, Deborah R.; Kroos, Lee

2006-01-01

The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

PubMed

Rajagopalan, Ramya; Kroos, Lee

2017-05-15

Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

Two new triterpenoids from fruiting bodies of fungus Ganoderma lucidum.

PubMed

Zhao, Zhen-Zhu; Yin, Rong-Hua; Chen, He-Ping; Feng, Tao; Li, Zheng-Hui; Dong, Ze-Jun; Cui, Bao-Kai; Liu, Ji-Kai

2015-01-01

Two new triterpenoids, (24E)-9α,11α-epoxy-3β-hydroxylanosta-7,24-dien-26-al (1) and (22Z,24Z)-13-hydroxy-3-oxo-14(13 → 12)abeo-lanosta-8,22,24-trien-26,23-olide (2) were isolated from dried fruiting bodies of fungus Ganoderma lucidum. The structures of these two new compounds were elucidated on the basis of extensive spectroscopic analyses. Compound 1 possessed a lanostane skeleton, while compound 2 was based on a rare 14 (13 → 12)abeo-lanostane skeleton with a 26,23-olide moiety. Both of them were evaluated for their antifungal and cytotoxic activities. Neither of them displayed obvious inhibition on Candida albicans and five human cancer cell lines.

A MADS Box Protein Interacts with a Mating-Type Protein and Is Required for Fruiting Body Development in the Homothallic Ascomycete Sordaria macrospora

PubMed Central

Nolting, Nicole; Pöggeler, Stefanie

2006-01-01

MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Δmcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development. PMID:16835449

A MADS box protein interacts with a mating-type protein and is required for fruiting body development in the homothallic ascomycete Sordaria macrospora.

PubMed

Nolting, Nicole; Pöggeler, Stefanie

2006-07-01

MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Deltamcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development.

Division of Labor in Biofilms: the Ecology of Cell Differentiation.

PubMed

van Gestel, Jordi; Vlamakis, Hera; Kolter, Roberto

2015-04-01

The dense aggregation of cells on a surface, as seen in biofilms, inevitably results in both environmental and cellular heterogeneity. For example, nutrient gradients can trigger cells to differentiate into various phenotypic states. Not only do cells adapt physiologically to the local environmental conditions, but they also differentiate into cell types that interact with each other. This allows for task differentiation and, hence, the division of labor. In this article, we focus on cell differentiation and the division of labor in three bacterial species: Myxococcus xanthus, Bacillus subtilis, and Pseudomonas aeruginosa. During biofilm formation each of these species differentiates into distinct cell types, in some cases leading to cooperative interactions. The division of labor and the cooperative interactions between cell types are assumed to yield an emergent ecological benefit. Yet in most cases the ecological benefits have yet to be elucidated. A notable exception is M. xanthus, in which cell differentiation within fruiting bodies facilitates the dispersal of spores. We argue that the ecological benefits of the division of labor might best be understood when we consider the dynamic nature of both biofilm formation and degradation.

Conservation of ornamental stone by Myxococcus xanthus-induced carbonate biomineralization.

PubMed

Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

2003-04-01

Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO(3) polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone.

Conservation of Ornamental Stone by Myxococcus xanthus-Induced Carbonate Biomineralization

PubMed Central

Rodriguez-Navarro, Carlos; Rodriguez-Gallego, Manuel; Ben Chekroun, Koutar; Gonzalez-Muñoz, Maria Teresa

2003-01-01

Increasing environmental pollution in urban areas has been endangering the survival of carbonate stones in monuments and statuary for many decades. Numerous conservation treatments have been applied for the protection and consolidation of these works of art. Most of them, however, either release dangerous gases during curing or show very little efficacy. Bacterially induced carbonate mineralization has been proposed as a novel and environmentally friendly strategy for the conservation of deteriorated ornamental stone. However, the method appeared to display insufficient consolidation and plugging of pores. Here we report that Myxococcus xanthus-induced calcium carbonate precipitation efficiently protects and consolidates porous ornamental limestone. The newly formed carbonate cements calcite grains by depositing on the walls of the pores without plugging them. Sonication tests demonstrate that these new carbonate crystals are strongly attached to the substratum, mostly due to epitaxial growth on preexisting calcite grains. The new crystals are more stress resistant than the calcite grains of the original stone because they are organic-inorganic composites. Variations in the phosphate concentrations of the culture medium lead to changes in local pH and bacterial productivity. These affect the structure of the new cement and the type of precipitated CaCO3 polymorph (vaterite or calcite). The manipulation of culture medium composition creates new ways of controlling bacterial biomineralization that in the future could be applied to the conservation of ornamental stone. PMID:12676699

The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

PubMed

Masloff, S; Pöggeler, S; Kück, U

1999-05-01

During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.

Heat and light stresses affect metabolite production in the fruit body of the medicinal mushroom Cordyceps militaris.

PubMed

Jiaojiao, Zhang; Fen, Wang; Kuanbo, Liu; Qing, Liu; Ying, Yang; Caihong, Dong

2018-05-01

Cordyceps militaris is a highly valued edible and medicinal fungus due to its production of various metabolites, including adenosine, cordycepin, N 6 -(2-hydroxyethyl)-adenosine, and carotenoids. The contents of these metabolites are indicative of the quality of commercially available fruit body of this fungus. In this work, the effects of environmental abiotic factors, including heat and light stresses, on the fruit body growth and metabolite production in C. militaris were evaluated during the late growth stage. The optimal growth temperature of C. militaris was 20 °C. It was found that a heat stress of 25 °C for 5-20 days during the late growth stage significantly promoted cordycepin and carotenoid production without affecting the biological efficiency. Light stress at 6000 lx for 5-20 days during the late growth stage significantly promoted cordycepin production but decreased the carotenoid content. Both heat and light stresses promoted N 6 -(2-hydroxyethyl)-adenosine production. In addition, gene expression analysis showed that there were simultaneous increases in the expression of genes encoding a metal-dependent phosphohydrolase (CCM_04437) and ATP phosphoribosyltransferase (CCM_04438) that are involved in the cordycepin biosynthesis pathway, which was consistent with the accumulation of cordycepin during heat stress for 5-20 days. A positive weak correlation between the cordycepin and adenosine contents was observed with a Pearson correlation coefficient of 0.338 (P < 0.05). The results presented herein provide a new strategy for the production of a superior quality fruit body of C. militaris and contribute to further elucidation of the effects of abiotic stress on metabolite accumulation in fungi.

The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

PubMed Central

Masloff, S; Pöggeler, S; Kück, U

1999-01-01

During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes. PMID:10224253

Paradoxical Effects of Fruit on Obesity

PubMed Central

Sharma, Satya P.; Chung, Hea J.; Kim, Hyeon J.; Hong, Seong T.

2016-01-01

Obesity is exponentially increasing regardless of its preventable characteristics. The current measures for preventing obesity have failed to address the severity and prevalence of obesity, so alternative approaches based on nutritional and diet changes are attracting attention for the treatment of obesity. Fruit contains large amounts of simple sugars (glucose, fructose, sucrose, etc.), which are well known to induce obesity. Thus, considering the amount of simple sugars found in fruit, it is reasonable to expect that their consumption should contribute to obesity rather than weight reduction. However, epidemiological research has consistently shown that most types of fruit have anti-obesity effects. Thus, due to their anti-obesity effects as well as their vitamin and mineral contents, health organizations are suggesting the consumption of fruit for weight reduction purposes. These contradictory characteristics of fruit with respect to human body weight management motivated us to study previous research to understand the contribution of different types of fruit to weight management. In this review article, we analyze and discuss the relationships between fruit and their anti-obesity effects based on numerous possible underlying mechanisms, and we conclude that each type of fruit has different effects on body weight. PMID:27754404

Metabolic Profiles and Free Radical Scavenging Activity of Cordyceps bassiana Fruiting Bodies According to Developmental Stage

PubMed Central

Hyun, Sun-Hee; Lee, Seok-Young; Sung, Gi-Ho; Kim, Seong Hwan; Choi, Hyung-Kyoon

2013-01-01

The metabolic profiles of Cordyceps bassiana according to fruiting body developmental stage were investigated using gas chromatography-mass spectrometry. We were able to detect 62 metabolites, including 48 metabolites from 70% methanol extracts and 14 metabolites from 100% n-hexane extracts. These metabolites were classified as alcohols, amino acids, organic acids, phosphoric acids, purine nucleosides and bases, sugars, saturated fatty acids, unsaturated fatty acids, or fatty amides. Significant changes in metabolite levels were found according to developmental stage. Relative levels of amino acids, purine nucleosides, and sugars were higher in development stage 3 than in the other stages. Among the amino acids, valine, isoleucine, lysine, histidine, glutamine, and aspartic acid, which are associated with ABC transporters and aminoacyl-tRNA biosynthesis, also showed higher levels in stage 3 samples. The free radical scavenging activities, which were significantly higher in stage 3 than in the other stages, showed a positive correlation with purine nucleoside metabolites such as adenosine, guanosine, and inosine. These results not only show metabolic profiles, but also suggest the metabolic pathways associated with fruiting body development stages in cultivated C. bassiana. PMID:24058459

The Truffle Microbiome: Species and Geography Effects on Bacteria Associated with Fruiting Bodies of Hypogeous Pezizales.

PubMed

Benucci, Gian Maria Niccolò; Bonito, Gregory M

2016-07-01

Fungi that produce their fruiting bodies underground within the soil profile are known commonly as truffles. Truffle fruiting bodies harbor a diverse but poorly understood microbial community of bacteria, yeasts, and filamentous fungi. In this study, we used next-generation 454 amplicon pyrosequencing of the V1 and V4 region of the bacterial 16S ribosomal DNA (rDNA) in order to characterize and compare effects of truffle species and geographic origin on the truffle microbiome. We compared truffle microbiomes of the glebal tissue for eight truffle species belonging to four distinct genera within the Pezizales: Tuber, Terfezia, Leucangium, and Kalapuya. The bacterial community within truffles was dominated by Proteobacteria, Bacterioides, Actinobacteria, and Firmicutes. Bacterial richness within truffles was quite low overall, with between 2-23 operational taxonomic units (OTUs). Notably, we found a single Bradyrhizobium OTU to be dominant within truffle species belonging to the genus Tuber, irrespective of geographic origin, but not in other truffle genera sampled. This study offers relevant insights into the truffle microbiome and raises questions concerning the recruitment and function of these fungal-associated bacteria consortia.

Metallic elements (Ca, Hg, Fe, K, Mg, Mn, Na, Zn) in the fruiting bodies of Boletus badius.

PubMed

Kojta, Anna K; Falandysz, Jerzy

2016-06-01

The aim of this study was to investigate and compare the levels of eight metallic elements in the fruiting bodies of Bay Bolete (Boletus badius; current name Imleria badia) collected from ten sites in Poland to understand better the value of this popular mushroom as an organic food. Bay Bolete fruiting bodies were collected from the forest area near the towns and villages of Kętrzyn, Poniatowa, Bydgoszcz, Pelplin, Włocławek, Żuromin, Chełmno, Ełk and Wilków communities, as well as in the Augustów Primeval Forest. Elements such as Ca, Fe, K, Mg, Mn, Na and Zn were analyzed by inductively coupled plasma atomic emission spectroscopy (ICP-OES), and mercury by cold vapor atomic absorption spectrometry (CV-AAS). This made it possible to assess the nutritional value of the mushroom, as well as possible toxicological risks associated with its consumption. The results were subjected to statistical analysis (Kruskal-Wallis test, cluster analysis, principal component analysis). Copyright © 2016 Elsevier Ltd. All rights reserved.

Operator design and mechanism for CarA repressor-mediated down-regulation of the photoinducible carB operon in Myxococcus xanthus.

PubMed

López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat

2004-07-09

The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.

Cyathane diterpenoids and nitrogenous terphenyl derivative from the fruiting bodies of basidiomycete Phellodon niger.

PubMed

Fang, Sheng-Tao; Zhang, Ling; Li, Zheng-Hui; Li, Bo; Liu, Ji-Kai

2010-09-01

Two new cyathane-type diterpenoids, nigernin A and B (1, 2), one new nitrogenous terphenyl derivative, phellodonin (3), together with three known compounds, 2',3'-diacetoxy-3,4,5',6',4''-pentahydroxy-p-terphenyl, grifolin, and 4-O-methylgrifolic acid, were isolated from the fruiting bodies of basidiomycete Phellodon niger. The structures of these new compounds were elucidated by spectroscopic methods and comparison with the data of known compounds in the literature. All these compounds were isolated from this fungus for the first time.

A new nortriterpenoid and an ergostane-type steroid from the fruiting bodies of the fungus Ganoderma resinaceum.

PubMed

Chen, Xian-Qiang; Chen, Ling-Xiao; Li, Shao-Ping; Zhao, Jing

2017-12-01

One new expoxy nortriterpenoid (1) and one new ergostane-type steroid (2), together with seven known steroids (3-9), were obtained from the fruiting bodies of the fungus Ganoderma resinaceum. The new compounds were elucidated on the basis of extensive spectroscopic data (MS, NMR, IR, and UV) and the known compounds were identified by comparing spectroscopic data with those reported in literature.

Comparative study of metals accumulation in cultured in vitro mycelium and naturally grown fruiting bodies of Boletus badius and Cantharellus cibarius.

PubMed

Reczyński, Witold; Muszyńska, Bożena; Opoka, Włodzimierz; Smalec, Agata; Sułkowska-Ziaja, Katarzyna; Malec, Mirosław

2013-06-01

Cantharellus cibarius Fr. (chanterelle) and Boletus badius Pers. (bay bolete) harvested from natural sites in Poland were used to derive in vitro cultures. The optimal medium composition for cultures was developed. Concentrations of the chosen elements (Zn, Cu, Fe, Mg, Ni, and Cd) in mycelium samples were measured by means of atomic absorption spectrometry. Fe concentration in the analyzed mushroom materials was in the range 215.4-680.3 μg/g dry weight. Mean values of Mg were respectively (in micrograms per gram dry weight) 541.8 for mycelium of C. cibarius cultured in vitro and 1,004.1 for C. cibarius fruiting bodies and 928.9 for the mycelium of B. badius cultured in vitro and 906.4 for B. badius fruiting bodies. The mean concentrations of Zn were 442.7 μg/g dry weight in mycelium from in vitro cultures of B. badius and 172.1 in B. badius fruiting bodies and 131.9 in the case of C. cibarius in mycelium from in vitro cultures and 95.5 for the C. cibarius fruiting bodies. Cu exhibited a reversal tendency, i.e., the element concentrations in naturally grown mushrooms were significantly higher (43.57 μg/g dry weight for C. cibarius and 43.54 μg/g for B. badius) than in cultured in vitro mycelium (12.47 μg/g for C. cibarius and 4.17 μg/g for B. badius). Ni was found in lowest concentrations ranging from 0.33 to 1.88 μg/g dry weight. Toxic metal Cd was found in relatively high concentrations in naturally grown species (0.79 μg/g dry weight-1.02). The lowest was the concentration of Cd in C. cibarius mycelium from in vitro culture-0.06 μg/g dry weight-a bit higher than it was in the B. badius mycelium (0.21 μg/g).

Quantitative determination of steroids in the fruiting bodies and submerged-cultured mycelia of Inonotus obliquus.

PubMed

Gao, Yuan; Xu, Hongyu; Lu, Zhenming; Xu, Zhenghong

2009-11-01

This study describes the method of quantitative determination of betulin, ergosterol, cholesterol, lanosterol, stigmasterol and sitosterol in the fruiting bodies and submerged-cultured mycelia of Inonotus obliquus. A high performance liquid chromatographic (HPLC) method was applied to separate these steroids. The procedure was carried out on a reversed-phase C, column, using a stepwise gradient of water-methanol as mobile phase with the following profile: 0-10 min, 10% water, 90% methanol; 10-40 min, 3% water, 97% methanol. The flow rate was 1.4 mL/min and the detection wavelength was 202 nm. The analysis was completed within 40 min. The results showed that this method has good reproducibility and satisfactory recoveries for the determination of steroids. The relative standard deviations of the peak areas were less than 2.94% (n = 5) for intraday assays. A good linear correlation was obtained in a range of 0.4-4.8 microg. The recoveries of betulin, ergosterol, cholesterol, lanosterol, stigmasterol, and sitosterol were 100.05%-100.72%, 99.31%-101.04%, 97.52%-101.63%, 96.61%-100.08%, 96.21%-100.76% and 100.04%-100.51%, respectively. This method can be applied to evaluate real samples, and it is rapid, accurate and suitable for the quantitative determination of steroids in the fruiting bodies and submerged-cultured mycelia of Inonotus obliquus.

Fruiting Body Formation in Volvariella volvacea Can Occur Independently of Its MAT-A-Controlled Bipolar Mating System, Enabling Homothallic and Heterothallic Life Cycles.

PubMed

Chen, Bingzhi; van Peer, Arend F; Yan, Junjie; Li, Xiao; Xie, Bin; Miao, Juan; Huang, Qianhui; Zhang, Lei; Wang, Wei; Fu, Junsheng; Zhang, Xiang; Zhang, Xiaoyin; Hu, Fengli; Kong, Qingfang; Sun, Xianyun; Zou, Feng; Zhang, Hanxing; Li, Shaojie; Xie, Baogui

2016-07-07

Volvariella volvacea is an important crop in Southeast Asia, but erratic fruiting presents a serious challenge for its production and breeding. Efforts to explain inconsistent fruiting have been complicated by the multinucleate nature, typical lack of clamp connections, and an incompletely identified sexual reproductive system. In this study, we addressed the life cycle of V. volvacea using whole genome sequencing, cloning of MAT loci, karyotyping of spores, and fruiting assays. Microscopy analysis of spores had previously indicated the possible coexistence of heterothallic and homothallic life cycles. Our analysis of the MAT loci showed that only MAT-A, and not MAT-B, controlled heterokaryotization. Thus, the heterothallic life cycle was bipolar. Karyotyping of single spore isolates (SSIs) using molecular markers supported the existence of heterokaryotic spores. However, most SSIs were clearly not heterokaryotic, yet contained structural variation (SV) markers relating to both alleles of both parents. Heterokaryons from crossed, self-sterile homokaryons could produce fruiting bodies, agreeing with bipolar heterothallism. Meanwhile, some SSIs with two different MAT-A loci also produced fruiting bodies, which supported secondary homothallism. Next, SSIs that clearly contained only one MAT-A locus (homothallism) were also able to fruit, demonstrating that self-fertile SSIs were not, per definition, secondary homothallic, and that a third life cycle or genetic mechanism must exist. Finally, recombination between SV markers was normal, yet 10 out of 24 SV markers showed 1:2 or 1:3 distributions in the spores, and large numbers of SSIs contained doubled SV markers. This indicated selfish genes, and possibly partial aneuploidy. Copyright © 2016 Chen et al.

The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Cebula, Patricia

2005-11-03

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Deltatap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora.

The gene for a lectin-like protein is transcriptionally activated during sexual development, but is not essential for fruiting body formation in the filamentous fungus Sordaria macrospora

PubMed Central

Nowrousian, Minou; Cebula, Patricia

2005-01-01

Background The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies called perithecia that protect the developing ascospores and ensure their proper discharge. In previous microarray analyses, several genes have been identified that are downregulated in sterile mutants compared to the wild type. Among these genes was tap1 (transcript associated with perithecial development), a gene encoding a putative lectin homolog. Results Analysis of tap1 transcript levels in the wild type under conditions allowing only vegetative growth compared to conditions that lead to fruiting body development showed that tap1 is not only downregulated in developmental mutants but is also upregulated in the wild type during fruiting body development. We have cloned and sequenced a 3.2 kb fragment of genomic DNA containing the tap1 open reading frame and adjoining sequences. The genomic region comprising tap1 is syntenic to its homologous region in the closely related filamentous fungus Neurospora crassa. To determine whether tap1 is involved in fruiting body development in S. macrospora, a knockout construct was generated in which the tap1 open reading frame was replaced by the hygromycin B resistance gene hph under the control of fungal regulatory regions. Transformation of the S. macrospora wild type with this construct resulted in a tap1 deletion strain where tap1 had been replaced by the hph cassette. The knockout strain displayed no phenotypic differences under conditions of vegetative growth and sexual development when compared to the wild type. Double mutants carrying the Δtap1 allele in several developmental mutant backgrounds were phenotypically similar to the corresponding developmental mutant strains. Conclusion The tap1 transcript is strongly upregulated during sexual development in S. macrospora; however, analysis of a tap1 knockout strain shows that tap1 is not essential for fruiting body formation in S. macrospora. PMID:16266439

Basidiospore and Protoplast Regeneration from Raised Fruiting Bodies of Pathogenic Ganoderma boninense.

PubMed

Govender, Nisha T; Mahmood, Maziah; Seman, Idris A; Mui-Yun, Wong

2016-08-26

Ganoderma boninense, a phytopathogenic white rot fungus had sought minimal genetic characterizations despite huge biotechnological potentials. Thus, efficient collection of fruiting body, basidiospore and protoplast of G. boninense is described. Matured basidiocarp raised under the glasshouse conditions yielded a total of 8.3 × 104 basidiospores/ml using the low speed centrifugation technique. Mycelium aged 3-day-old treated under an incubation period of 3 h in lysing enzyme from Trichoderma harzianum (10 mg/ml) suspended in osmotic stabilizer (0.6 M potassium chloride and 20 mM dipotassium phosphate buffer) yielded the highest number of viable protoplasts (8.9 × 106 single colonies) among all possible combinations tested (regeneration media, age of mycelium, osmotic stabilizer, digestive enzyme and incubation period).

Content of selected elements in Boletus badius fruiting bodies growing in extremely polluted wastes.

PubMed

Mleczek, Mirosław; Siwulski, Marek; Mikołajczak, Patrycja; Gąsecka, Monika; Sobieralski, Krzysztof; Szymańczyk, Mateusz; Goliński, Piotr

2015-01-01

The aim of the study was to analyse levels of 17 trace elements and 5 major minerals in 11 Boletus badius fruiting bodies able to grow in extremely polluted waste (flotation tailings) and polluted soil in southern Poland. The presented data widen the limited literature data about the abilities of wild-growing mushroom species to grow on heavily contaminated substrates. Content of elements in waste, soil and mushrooms was analysed by flame atomic absorption spectrometry (FAAS) and cold vapour atomic absorption spectrometry (CVAAS - Hg). The industrial areas differed greatly as regards the content of elements in flotation tailings and soil; therefore differences in Ag, Ba, Cd, Co, Fe, Mo, Ni, Pb, Ca, K, Mg, Na and P accumulation in mushrooms were observed. The highest contents of elements in mushrooms were observed for: As, Al, Cu and Zn (86 ± 28, 549 ± 116, 341 ± 59 and 506 ± 40 mg kg(-1) dry matter, respectively). Calculated bioconcentration factor (BCF) values were higher than 1 for Al (15.1-16.9), Fe (10.6-24.4) and Hg (10.2-16.4) only. The main value of the presented results is the fact that one of the common wild-growing mushroom species was able to grow on flotation tailings containing over 22 g kg(-1) of As and, additionally, effective accumulation of other elements was observed. In view of the high content of the majority of analysed elements in fruiting bodies, edible mushrooms from such polluted areas are nonconsumable.

The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.

PubMed

Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

2014-01-01

Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.

Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

PubMed

Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

2012-01-01

Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

Relationships between selenium and mercury in the fruiting bodies of some mushrooms growing in Poland

NASA Astrophysics Data System (ADS)

Falandysz, J.; Kubotal, R.; Kunito, T.; Bielawski, L.; Brzostowski, A.; Gucia, M.; Jedrusiak, A.; Lipka, K.; Tanabe, S.

2003-05-01

The relationships between concentrations of total selenium and mercury were investigated for the whole fruiting bodies, caps and/or stalks of King bolete (Boletus edulis), Brown birch scaber stalk (Leccinum scabrum), Parasol mushroom (Macrolepiota procera), Poison pax (Paxillus involutus) and Fly agaric (Amatiita niuscaria) collected from the various sites in Poland. The mushroom species examined varied largely due to the contents and proportions between the total selenium and mercury concentrations, what seems to indicate on species-dependent strategy of co-uptake and accumulation of these elements.

Whole-body kinematics of a fruit bat reveal the influence of wing inertia on body accelerations.

PubMed

Iriarte-Díaz, José; Riskin, Daniel K; Willis, David J; Breuer, Kenneth S; Swartz, Sharon M

2011-05-01

The center of mass (COM) of a flying animal accelerates through space because of aerodynamic and gravitational forces. For vertebrates, changes in the position of a landmark on the body have been widely used to estimate net aerodynamic forces. The flapping of relatively massive wings, however, might induce inertial forces that cause markers on the body to move independently of the COM, thus making them unreliable indicators of aerodynamic force. We used high-speed three-dimensional kinematics from wind tunnel flights of four lesser dog-faced fruit bats, Cynopterus brachyotis, at speeds ranging from 2.4 to 7.8 m s(-1) to construct a time-varying model of the mass distribution of the bats and to estimate changes in the position of their COM through time. We compared accelerations calculated by markers on the trunk with accelerations calculated from the estimated COM and we found significant inertial effects on both horizontal and vertical accelerations. We discuss the effect of these inertial accelerations on the long-held idea that, during slow flights, bats accelerate their COM forward during 'tip-reversal upstrokes', whereby the distal portion of the wing moves upward and backward with respect to still air. This idea has been supported by the observation that markers placed on the body accelerate forward during tip-reversal upstrokes. As in previously published studies, we observed that markers on the trunk accelerated forward during the tip-reversal upstrokes. When removing inertial effects, however, we found that the COM accelerated forward primarily during the downstroke. These results highlight the crucial importance of the incorporation of inertial effects of wing motion in the analysis of flapping flight.

Molecular cloning and characterization of two genes for the biotin carboxylase and carboxyltransferase subunits of acetyl coenzyme A carboxylase in Myxococcus xanthus.

PubMed

Kimura, Y; Miyake, R; Tokumasu, Y; Sato, M

2000-10-01

We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar to biotin carboxylase subunits of acetyl-CoA and propionyl-CoA carboxylases and of pyruvate carboxylase. The putative motifs for ATP binding, CO(2) fixation, and biotin binding were found in AccA. The accB gene was located upstream of the accA gene, and they formed a two-gene operon. The protein (AccB) encoded by the accB gene showed high degrees of sequence similarity with carboxyltransferase subunits of acetyl-CoA and propionyl-CoA carboxylases and of methylmalonyl-CoA decarboxylase. Carboxybiotin-binding and acyl-CoA-binding domains, which are conserved in several carboxyltransferase subunits of acyl-CoA carboxylases, were found in AccB. An accA disruption mutant showed a reduced growth rate and reduced acetyl-CoA carboxylase activity compared with the wild-type strain. Western blot analysis indicated that the product of the accA gene was a biotinylated protein that was expressed during the exponential growth phase. Based on these results, we propose that this M. xanthus acetyl-CoA carboxylase consists of two subunits, which are encoded by the accB and accA genes, and occupies a position between prokaryotic and eukaryotic acetyl-CoA carboxylases in terms of evolution.

Myxococcus xanthus Swarms Are Driven by Growth and Regulated by a Pacemaker ▿

PubMed Central

Kaiser, Dale; Warrick, Hans

2011-01-01

The principal social activity of Myxococcus xanthus is to organize a dynamic multicellular structure, known as a swarm. Although its cell density is high, the swarm can grow and expand rapidly. Within the swarm, the individual rod-shaped cells are constantly moving, transiently interacting with one another, and independently reversing their gliding direction. Periodic reversal is, in fact, essential for creating a swarm, and the reversal frequency controls the rate of swarm expansion. Chemotaxis toward nutrient has been thought to drive swarming, but here the nature of swarm growth and the impact of genetic deletions of members of the Frz family of proteins suggest otherwise. We find that three cytoplasmic Frz proteins, FrzCD, FrzF, and FrzE, constitute a cyclic pathway that sets the reversal frequency. Within each cell these three proteins appear to be connected in a negative-feedback loop that produces oscillations whose frequencies are finely tuned by methylation and by phosphorylation. This oscillator, in turn, drives MglAB, a small G-protein switch, to oscillate between its GTP- and GDP-bound states that ultimately determine when the cell moves forward or backward. The periodic reversal of interacting rod-shaped cells promotes their alignment. Swarm organization ensures that each cell can move without blocking the movement of others. PMID:21856842

Social complementation and growth advantages promote socially defective bacterial isolates.

PubMed

Kraemer, Susanne A; Velicer, Gregory J

2014-04-22

Social interactions among diverse individuals that encounter one another in nature have often been studied among animals but rarely among microbes. For example, the evolutionary forces that determine natural frequencies of bacteria that express cooperative behaviours at low levels remain poorly understood. Natural isolates of the soil bacterium Myxococcus xanthus sampled from the same fruiting body often vary in social phenotypes, such as group swarming and multicellular development. Here, we tested whether genotypes highly proficient at swarming or development might promote the persistence of less socially proficient genotypes from the same fruiting body. Fast-swarming strains complemented slower isolates, allowing the latter to keep pace with faster strains in mixed groups. During development, one low-sporulating strain was antagonized by high sporulators, whereas others with severe developmental defects had those defects partially complemented by high-sporulating strains. Despite declining in frequency overall during competition experiments spanning multiple cycles of development, developmentally defective strains exhibited advantages during the growth phases of competitions. These results suggest that microbes with low-sociality phenotypes often benefit from interacting with more socially proficient strains. Such complementation may combine with advantages at other traits to increase equilibrium frequencies of low-sociality genotypes in natural populations.

Pantoea hericii sp. nov., Isolated from the Fruiting Bodies of Hericium erinaceus.

PubMed

Rong, Chengbo; Ma, Yuanwei; Wang, Shouxian; Liu, Yu; Chen, Sanfeng; Huang, Bin; Wang, Jing; Xu, Feng

2016-06-01

Three Gram-negative, facultatively anaerobic bacterial isolates were obtained from the fruiting bodies of the edible mushroom Hericium erinaceus showing symptoms of soft rot disease in Beijing, China. Sequences of partial 16S rRNA gene placed these isolates in the genus Pantoea. Multilocus sequence analysis based on the partial sequences of atpD, gyrB, infB and rpoB revealed P. eucalypti and P. anthophila as their closest phylogenetic relatives and indicated that these isolates constituted a possible novel species. DNA-DNA hybridization studies confirmed the classification of these isolates as a novel species and phenotypic tests allowed for differentiation from the closest phylogenetic neighbours. The name Pantoea hericii sp. nov. [Type strain LMG 28847(T) = CGMCC 1.15224(T) = JZB 2120024(T)] is proposed.

Isolation and purification of a polysaccharide from the caterpillar medicinal mushroom Cordyceps militaris (Ascomycetes) fruit bodies and its immunomodulation of RAW 264.7 macrophages.

PubMed

Zhu, Lina; Tang, Qingjiu; Zhou, Shuai; Liu, Yanfang; Zhang, Zhong; Gao, Xinhua; Wang, Shiping; Wang, Zhaolong

2014-01-01

A novel polysaccharide (CP2-S) was purified from Cordyceps militaris fruit bodies by hot water extraction, ethanol precipitation, DEAE-Sepharose Fast Flow and Sephacryl S-400 high-resolution chromatography. The polysaccharide had a molecular weight of 5.938 × 10(6) g/mol and was mainly composed of glucose. CP2-S had carbohydrate content estimated to be 100% using the phenol-sulfuric acid method. Immunostimulating experiments in vitro indicated that CP2-S could stimulate nitric oxide production, phagocytosis, respiratory burst activity, and secretion of interleukin-1β and interleukin-2 of macrophages, suggesting that this water-soluble polysaccharide from the fruit body of C. militaris is a natural immunostimulating polysaccharide with potential for further application.

Carbohydrate changes during growth and fruiting in Pleurotus ostreatus.

PubMed

Zhou, Shuai; Ma, Fuying; Zhang, Xiaoyu; Zhang, Jingsong

2016-01-01

The carbohydrate distribution in mushrooms is reported changing greatly in its different regions during growth and fruiting. In this study, the carbohydrate distribution in the compost and fruiting bodies of Pleurotus ostreatus was analysed. Sugar, polyol, polysaccharide, and chitin content during different growth phases and in different regions of the mushroom were determined. Results indicate that trehalose, mannitol, and glucose were first accumulated in the compost and then decreased during differentiation and growth of fruiting bodies. Meanwhile, trehalose, mannitol, and glucose also accumulated in the fruiting bodies and primarily distributed in the stipe, base, and pileus region, respectively. Polysaccharides mainly accumulated within the pileus and stipe regions, and chitin was mainly observed in the base region. These findings provide insights into carbohydrate function and utilisation during mushroom growth. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Lucidumol D, a new lanostane-type triterpene from fruiting bodies of Reishi (Ganoderma lingzhi).

PubMed

Satria, Dedi; Amen, Yhiya; Niwa, Yasuharu; Ashour, Ahmed; Allam, Ahmed E; Shimizu, Kuniyoshi

2018-02-19

A new lanostane-type triterpenoid, lucidumol D (1) was isolated from the fruiting bodies of Ganoderma lingzhi. Its structure was elucidated on the basis of extensive 1D- and 2D-NMR studies as well as mass spectrometry. The cytotoxicity of lucidumol D against proliferation of several cancer cells were assayed by using MTT method and the obtained result suggested selective anti-proliferative and cytotoxic effects against MCF-7, HepG2, HeLa, Caco-2, and HCT-116. In comparison to lucidumol C (2) isolated previously by our group, the structure-activity relationship indicated that carbonyl function at C-11 is necessary to enhance the cytotoxicity.

Purification, chemical modification and immunostimulating activity of polysaccharides from Tremella aurantialba fruit bodies*

PubMed Central

Du, Xiu-ju; Zhang, Jing-song; Yang, Yan; Tang, Qing-jiu; Jia, Wei; Pan, Ying-jie

2010-01-01

Ultrafiltration and a series of chromatographic steps were used to isolate and purify polysaccharides from Tremella aurantialba fruit bodies. Three crude fractions (TAP50w, TAP10–50w, and TAP1–10w), five semi-purified fractions (TAPA–TAPE), and one purified fraction (TAPA1) were obtained. A sulfated derivative of TAPA1 (TAPA1-s) was prepared by chemical modification. The immunostimulating activity of the polysaccharide fractions in vitro was determined using the mouse spleen lymphocyte proliferation assay. Of the three crude fractions tested, cell proliferation rates were increased most by TAP50w. Furthermore, TAPA1-s was markedly more stimulatory than TAPA1, indicating that sulfonation was an effective way to enhance the immunostimulating activity of polysaccharide. PMID:20506575

Spore formation in Myxococcus xanthus is tied to cytoskeleton functions and polysaccharide spore coat deposition

PubMed Central

Müller, Frank D.; Schink, Christian W.; Hoiczyk, Egbert; Cserti, Emöke; Higgs, Penelope I.

2011-01-01

Summary Myxococcus xanthus is a Gram-negative bacterium that differentiates into environmentally resistant spores. Spore differentiation involves septation-independent remodelling of the rod-shaped vegetative cell into a spherical spore and deposition of a thick and compact spore coat outside of the outer membrane. Our analyses suggest that spore coat polysaccharides are exported to the cell surface by the Exo outer membrane polysaccharide export/polysaccharide co-polymerase 2a (OPX/PCP-2a) machinery. Conversion of the capsule-like polysaccharide layer into a compact spore coat layer requires the Nfs proteins which likely form a complex in the cell envelope. Mutants in either nfs, exo, or two other genetic loci encoding homologs of polysaccharide synthesis enzymes, fail to complete morphogenesis from rods to spherical spores and instead produce a transient state of deformed cell morphology before reversion into typical rods. We additionally provide evidence that the cell cytoskeletal protein, MreB, plays an important role in rod to spore morphogenesis and for spore outgrowth. These studies provide evidence that this novel gram-negative differentiation process is tied to cytoskeleton functions and polysaccharide spore coat deposition. PMID:22188356

Content of selected elements and low-molecular-weight organic acids in fruiting bodies of edible mushroom Boletus badius (Fr.) Fr. from unpolluted and polluted areas.

PubMed

Mleczek, Mirosław; Magdziak, Zuzanna; Gąsecka, Monika; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Zalicka, Sylwia; Sobieralski, Krzysztof

2016-10-01

The aim of the study was to (i) investigate the potential of edible mushroom Boletus badius (Fr.) Fr. to accumulate 53 elements from unpolluted acidic sandy soil and polluted alkaline flotation tailing sites in Poland, (ii) to estimate the low-molecular-weight organic acid (LMWOA) profile and contents in fruit bodies, and finally (iii) to explore the possible relationship between elements and LMWOA content in mushrooms. The content of most elements in fruiting bodies collected from the flotation tailings was significantly higher than in mushrooms from the unpolluted soils. The occurrence of elements determined in fruiting bodies of B. badius has been varied (from 0.01 mg kg -1 for Eu, Lu, and Te up to 18,932 mg kg -1 for K). The results established the high importance of element contents in substrate. Among ten organic acids, nine have been found in wide range: from below 0.01 mg kg -1 for fumaric acid to 14.8 mg g -1 for lactic acid. Lactic and succinic acids were dominant in both areas, and citric acid was also in high content in polluted area. The correlation between element contents and the individual and total content of LMWOAs was confirmed.

Outside-in assembly pathway of the type IV pilus system in Myxococcus xanthus.

PubMed

Friedrich, Carmen; Bulyha, Iryna; Søgaard-Andersen, Lotte

2014-01-01

Type IV pili (T4P) are ubiquitous bacterial cell surface structures that undergo cycles of extension, adhesion, and retraction. T4P function depends on a highly conserved envelope-spanning macromolecular machinery consisting of 10 proteins that localizes polarly in Myxococcus xanthus. Using this localization, we investigated the entire T4P machinery assembly pathway by systematically profiling the stability of all and the localization of eight of these proteins in the absence of other T4P machinery proteins as well as by mapping direct protein-protein interactions. Our experiments uncovered a sequential, outside-in pathway starting with the outer membrane (OM) PilQ secretin ring. PilQ recruits a subcomplex consisting of the inner membrane (IM) lipoprotein PilP and the integral IM proteins PilN and PilO by direct interaction with the periplasmic domain of PilP. The PilP/PilN/PilO subcomplex recruits the cytoplasmic PilM protein, by direct interaction between PilN and PilM, and the integral IM protein PilC. The PilB/PilT ATPases that power extension/retraction localize independently of other T4P machinery proteins. Thus, assembly of the T4P machinery initiates with formation of the OM secretin ring and continues inwards over the periplasm and IM to the cytoplasm.

Anti-oxidant effects of kiwi fruit in vitro and in vivo.

PubMed

Iwasawa, Haruyo; Morita, Erika; Yui, Satoru; Yamazaki, Masatoshi

2011-01-01

We previously reported that kiwi fruit is rich in polyphenols and has immunostimulatory activity. Polyphenols are widely known for having anti-oxidant effects. We also revealed potential anti-oxidant effects of kiwi fruit in vivo by oral administration to mice. Here, we compared the anti-oxidant effects of kiwi fruit with those of other fruits in vitro. Then, we examined the inhibitory effects of kiwi fruit on oxidation in the human body. There are two varieties of kiwi fruit, green kiwi and gold kiwi. We also examined variation between these varieties. Comparison of the anti-oxidant effects in vitro demonstrated that kiwi fruit had stronger anti-oxidant effects than orange and grapefruit, which are rich in vitamin C; gold kiwi had the strongest anti-oxidant effects. Kiwi fruit inhibited oxidation of biological substances in the human body. In particular, kiwi fruit may inhibit early lipid oxidation. In this study, kiwi fruit had strong anti-oxidant effects and may prevent the development and deterioration of diseases caused by oxidative stress.

Nortriterpenoids from the Fruiting Bodies of the Mushroom Ganoderma resinaceum.

PubMed

Chen, Xian-Qiang; Chen, Ling-Xiao; Zhao, Jing; Tang, Yu-Ping; Li, Shao-Ping

2017-06-28

Ganoderma resinaceum is usually used as ethnomedicine for immune-regulation, hyperglycemia, and liver disease. To date, only a few chemical constituents have been reported from G . resinaceum . In this study, fifteen nortriterpenoids including six new nortriterpenoids ( 1 - 6 ) and nine known analogs ( 7 - 15 ), were separated and purified from the fruiting bodies of G . resinaceum . New compounds were identified as lucidone I ( 1 ), lucidone J ( 2 ), lucidone K ( 3 ), lucidone I ( 4 ), ganosineniol B ( 5 ), and ganosineniol C ( 6 ), based on analysis of extensive spectroscopic data (high resolution mass spectrometry (HRMS), nuclear magnetic resonance (NMR), infrared (IR), and ultraviolet (UV)). The known compounds were assigned as lucidone A ( 7 ), lucidone B ( 8 ), lucidone H ( 9 ), lucidone E ( 10 ), lucidone F ( 11 ), lucidone D ( 12 ), lucidone C ( 13 ), ganoderense F ( 14 ), and ganosineniol A ( 15 ), by comparing their spectroscopic data with those reported in the literature. Compounds 3 , 4 , and 7 - 13 were examined for α -glucosidase inhibitory activity and display no significant activity, but the finding may support that the side chain of ganoderma triterpenoids played an important role in α -glucosidase inhibitory activity.

Evolution of complex fruiting-body morphologies in homobasidiomycetes.

PubMed Central

Hibbett, David S; Binder, Manfred

2002-01-01

The fruiting bodies of homobasidiomycetes include some of the most complex forms that have evolved in the fungi, such as gilled mushrooms, bracket fungi and puffballs ('pileate-erect') forms. Homobasidiomycetes also include relatively simple crust-like 'resupinate' forms, however, which account for ca. 13-15% of the described species in the group. Resupinate homobasidiomycetes have been interpreted either as a paraphyletic grade of plesiomorphic forms or a polyphyletic assemblage of reduced forms. The former view suggests that morphological evolution in homobasidiomycetes has been marked by independent elaboration in many clades, whereas the latter view suggests that parallel simplification has been a common mode of evolution. To infer patterns of morphological evolution in homobasidiomycetes, we constructed phylogenetic trees from a dataset of 481 species and performed ancestral state reconstruction (ASR) using parsimony and maximum likelihood (ML) methods. ASR with both parsimony and ML implies that the ancestor of the homobasidiomycetes was resupinate, and that there have been multiple gains and losses of complex forms in the homobasidiomycetes. We also used ML to address whether there is an asymmetry in the rate of transformations between simple and complex forms. Models of morphological evolution inferred with ML indicate that the rate of transformations from simple to complex forms is about three to six times greater than the rate of transformations in the reverse direction. A null model of morphological evolution, in which there is no asymmetry in transformation rates, was rejected. These results suggest that there is a 'driven' trend towards the evolution of complex forms in homobasidiomycetes. PMID:12396494

A new cerebroside from the fruiting bodies of Hericium erinaceus and its applicability to cancer treatment.

PubMed

Lee, Seoung Rak; Jung, Kiwon; Noh, Hyung Jun; Park, Yong Joo; Lee, Hye Lim; Lee, Kang Ro; Kang, Ki Sung; Kim, Ki Hyun

2015-12-15

A new cerebroside, cerebroside E (1) was isolated from the fruiting bodies of Hericium erinaceus (Hericiaceae). The structure of 1 was elucidated by a combination of extensive spectroscopic analyses, including extensive 2D NMR, HR-MS, and chemical reactions. Compound 1 was evaluated for its applicability to medicinal use in several human diseases using cell-based assays. As a result, compound 1 attenuated cisplatin-induced nephrotoxicity in LLC-PK1 cells and exhibited a significant inhibitory effect on angiogenesis in HUVECs. These results collectively reflect the beneficial effects of compound 1 in cancer treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Coupling of protein localization and cell movements by a dynamically localized response regulator in Myxococcus xanthus

PubMed Central

Leonardy, Simone; Freymark, Gerald; Hebener, Sabrina; Ellehauge, Eva; Søgaard-Andersen, Lotte

2007-01-01

Myxococcus xanthus cells harbor two motility machineries, type IV pili (Tfp) and the A-engine. During reversals, the two machineries switch polarity synchronously. We present a mechanism that synchronizes this polarity switching. We identify the required for motility response regulator (RomR) as essential for A-motility. RomR localizes in a bipolar, asymmetric pattern with a large cluster at the lagging cell pole. The large RomR cluster relocates to the new lagging pole in parallel with cell reversals. Dynamic RomR localization is essential for cell reversals, suggesting that RomR relocalization induces the polarity switching of the A-engine. The analysis of RomR mutants shows that the output domain targets RomR to the poles and the receiver domain is essential for dynamic localization. The small GTPase MglA establishes correct RomR polarity, and the Frz two-component system regulates dynamic RomR localization. FrzS localizes with Tfp at the leading pole and relocates in an Frz-dependent manner to the opposite pole during reversals; FrzS and RomR localize and oscillate independently. The Frz system synchronizes these oscillations and thus the synchronous polarity switching of the motility machineries. PMID:17932488

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Optimization of fruit punch using mixture design.

PubMed

Kumar, S Bharath; Ravi, R; Saraswathi, G

2010-01-01

A highly acceptable dehydrated fruit punch was developed with selected fruits, namely lemon, orange, and mango, using a mixture design and optimization technique. The fruit juices were freeze dried, powdered, and used in the reconstitution studies. Fruit punches were prepared according to the experimental design combinations (total 10) based on a mixture design and then subjected to sensory evaluation for acceptability. Response surfaces of sensory attributes were also generated as a function of fruit juices. Analysis of data revealed that the fruit punch prepared using 66% of mango, 33% of orange, and 1% of lemon had highly desirable sensory scores for color (6.00), body (5.92), sweetness (5.68), and pleasantness (5.94). The aroma pattern of individual as well as combinations of fruit juices were also analyzed by electronic nose. The electronic nose could discriminate the aroma patterns of individual as well as fruit juice combinations by mixture design. The results provide information on the sensory quality of best fruit punch formulations liked by the consumer panel based on lemon, orange, and mango.

IDC2 and IDC3, two genes involved in cell non-autonomous signaling of fruiting body development in the model fungus Podospora anserina.

PubMed

Lalucque, Hervé; Malagnac, Fabienne; Green, Kimberly; Gautier, Valérie; Grognet, Pierre; Chan Ho Tong, Laetitia; Scott, Barry; Silar, Philippe

2017-01-15

Filamentous ascomycetes produce complex multicellular structures during sexual reproduction. Little is known about the genetic pathways enabling the construction of such structures. Here, with a combination of classical and reverse genetic methods, as well as genetic mosaic and graft analyses, we identify and provide evidence for key roles for two genes during the formation of perithecia, the sexual fruiting bodies, of the filamentous fungus Podospora anserina. Data indicate that the proteins coded by these two genes function cell-non-autonomously and that their activity depends upon conserved cysteines, making them good candidate for being involved in the transmission of a reactive oxygen species (ROS) signal generated by the PaNox1 NADPH oxidase inside the maturing fruiting body towards the PaMpk1 MAP kinase, which is located inside the underlying mycelium, in which nutrients are stored. These data provide important new insights to our understanding of how fungi build multicellular structures. Copyright © 2016 Elsevier Inc. All rights reserved.

The mitogen-activated protein kinase GlSlt2 regulates fungal growth, fruiting body development, cell wall integrity, oxidative stress and ganoderic acid biosynthesis in Ganoderma lucidum.

PubMed

Zhang, Guang; Sun, Zehua; Ren, Ang; Shi, Liang; Shi, Dengke; Li, Xiongbiao; Zhao, Mingwen

2017-07-01

The mitogen-activated protein kinases (MAPKs) are crucial signaling instruments in eukaryotes that play key roles in regulating fungal growth, development, and secondary metabolism and in adapting to the environment. In this study, we characterized an Slt2-type MAPK in Ganoderma lucidum, GlSlt2, which was transcriptionally induced during the primordium and fruiting body stages. RNA interference was used to examine the function of GlSlt2. Knockdown of GlSlt2 caused defects in growth and increased hyphal branching as well as hypersensitivity to cell wall-disturbing substances. Consistently, the chitin and β-1,3-d-glucan contents and the expression of cell wall biosynthesis genes were decreased and down-regulated, respectively, in GlSlt2 knockdown strains compared with those in the wild type (WT). In addition, no primordium or fruiting body could be observed in GlSlt2 knockdown strains. Furthermore, the intracellular reactive oxygen species (ROS) content and ganoderic acid biosynthesis also decreased in GlSlt2 knockdown strains. Addition of H 2 O 2 could recover the decreased ganoderic acid content in GlSlt2 knockdown strains, indicating that GlSlt2 might regulate ganoderic acid biosynthesis via the intracellular ROS level. Overall, GlSlt2 is involved in hyphal growth, fruiting body development, cell wall integrity, oxidative stress and ganoderic acid biosynthesis in G. lucidum. Copyright © 2017 Elsevier Inc. All rights reserved.

A Versatile Class of Cell Surface Directional Motors Gives Rise to Gliding Motility and Sporulation in Myxococcus xanthus

PubMed Central

Wartel, Morgane; Czerwinski, Fabian; Le Gall, Anne-Valérie; Mauriello, Emilia M. F.; Bergam, Ptissam; Brun, Yves V.; Shaevitz, Joshua; Mignot, Tâm

2013-01-01

Eukaryotic cells utilize an arsenal of processive transport systems to deliver macromolecules to specific subcellular sites. In prokaryotes, such transport mechanisms have only been shown to mediate gliding motility, a form of microbial surface translocation. Here, we show that the motility function of the Myxococcus xanthus Agl-Glt machinery results from the recent specialization of a versatile class of bacterial transporters. Specifically, we demonstrate that the Agl motility motor is modular and dissociates from the rest of the gliding machinery (the Glt complex) to bind the newly expressed Nfs complex, a close Glt paralogue, during sporulation. Following this association, the Agl system transports Nfs proteins directionally around the spore surface. Since the main spore coat polymer is secreted at discrete sites around the spore surface, its transport by Agl-Nfs ensures its distribution around the spore. Thus, the Agl-Glt/Nfs machineries may constitute a novel class of directional bacterial surface transporters that can be diversified to specific tasks depending on the cognate cargo and machinery-specific accessories. PMID:24339744

A novel core 1 O-linked glycan-specific binding lectin from the fruiting body of Hericium erinaceus.

PubMed

Kim, Seonghun

2018-02-01

Mucin-type O-glycans are involved in biological functions on the cell surface as well as the glycoproteins and can also be used as specific carbohydrate biomarkers of many diseases. In this study, I purified a novel core 1 O-linked glycan specific lectin, Hericium erinaceus lecin (HeL), from the fruiting body of the mushroom Hericium erinaceus, which is known as the natural source for a sialic acid-binding lectin. Upon optimization of the purification conditions, a sequence of ion exchange, affinity, ion exchange, and size-exclusion chromatography resulted in the highest yield and best quality of lectin without protease activity. The resulting purified HeL is an apparent hexameric protein with a subunit molecular weight of 15kDa, and a pI of 4.3. In hemagglutination inhibition assay, the purified lectin was only inhibited by glycoproteins containing mucin-type O-glycans and reacted weakly with Galβ(1,3)GalNAc. Glycan array analyses showed that HeL specifically interacts with core 1 O-linked glycans as well as extended O-glycan structures containing sialylation or fucosylation. The glycan binding specificity of HeL is comparable to that of peanut agglutinin for detection of a broader range of extended core 1 O-glycan structures. Taken together, these results provide an efficient and optimized procedure for the purification of HeL from the fruiting body of the mushroom Hericium erinaceus. Moreover, HeL represents a powerful tool for analyzing core 1 and extended core 1 O- glycan structures in diagnosis assays. Copyright © 2017 Elsevier B.V. All rights reserved.

Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

PubMed Central

Yun, Yeo Hong; Koo, Ja Sun

2015-01-01

Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

Autophagy-Associated Protein SmATG12 Is Required for Fruiting-Body Formation in the Filamentous Ascomycete Sordaria macrospora

PubMed Central

Werner, Antonia; Herzog, Britta; Frey, Stefan; Pöggeler, Stefanie

2016-01-01

In filamentous fungi, autophagy functions as a catabolic mechanism to overcome starvation and to control diverse developmental processes under normal nutritional conditions. Autophagy involves the formation of double-membrane vesicles, termed autophagosomes that engulf cellular components and bring about their degradation via fusion with vacuoles. Two ubiquitin-like (UBL) conjugation systems are essential for the expansion of the autophagosomal membrane: the UBL protein ATG8 is conjugated to the lipid phosphatidylethanolamine and the UBL protein ATG12 is coupled to ATG5. We recently showed that in the homothallic ascomycete Sordaria macrospora autophagy-related genes encoding components of the conjugation systems are required for fruiting-body development and/or are essential for viability. In the present work, we cloned and characterized the S. macrospora (Sm)atg12 gene. Two-hybrid analysis revealed that SmATG12 can interact with SmATG7 and SmATG3. To examine its role in S. macrospora, we replaced the open reading frame of Smatg12 with a hygromycin resistance cassette and generated a homokaryotic ΔSmatg12 knockout strain, which displayed slower vegetative growth under nutrient starvation conditions and was unable to form fruiting bodies. In the hyphae of S. macrospora EGFP-labeled SmATG12 was detected in the cytoplasm and as punctate structures presumed to be phagophores or phagophore assembly sites. Delivery of EGFP-labelled SmATG8 to the vacuole was entirely dependent on SmATG12. PMID:27309377

Autophagy-Associated Protein SmATG12 Is Required for Fruiting-Body Formation in the Filamentous Ascomycete Sordaria macrospora.

PubMed

Werner, Antonia; Herzog, Britta; Frey, Stefan; Pöggeler, Stefanie

2016-01-01

In filamentous fungi, autophagy functions as a catabolic mechanism to overcome starvation and to control diverse developmental processes under normal nutritional conditions. Autophagy involves the formation of double-membrane vesicles, termed autophagosomes that engulf cellular components and bring about their degradation via fusion with vacuoles. Two ubiquitin-like (UBL) conjugation systems are essential for the expansion of the autophagosomal membrane: the UBL protein ATG8 is conjugated to the lipid phosphatidylethanolamine and the UBL protein ATG12 is coupled to ATG5. We recently showed that in the homothallic ascomycete Sordaria macrospora autophagy-related genes encoding components of the conjugation systems are required for fruiting-body development and/or are essential for viability. In the present work, we cloned and characterized the S. macrospora (Sm)atg12 gene. Two-hybrid analysis revealed that SmATG12 can interact with SmATG7 and SmATG3. To examine its role in S. macrospora, we replaced the open reading frame of Smatg12 with a hygromycin resistance cassette and generated a homokaryotic ΔSmatg12 knockout strain, which displayed slower vegetative growth under nutrient starvation conditions and was unable to form fruiting bodies. In the hyphae of S. macrospora EGFP-labeled SmATG12 was detected in the cytoplasm and as punctate structures presumed to be phagophores or phagophore assembly sites. Delivery of EGFP-labelled SmATG8 to the vacuole was entirely dependent on SmATG12.

Structural investigation of a novel heteropolysaccharide from the fruiting bodies of Boletus edulis.

PubMed

Zhang, An-qiang; Liu, Ye; Xiao, Nan-nan; Zhang, Yang; Sun, Pei-long

2014-03-01

A novel water-soluble heteropolysaccharide, BEPF1, was isolated from the fruiting bodies of Boletus edulis with boiling water extraction and purified by Sephacryl S-300, with a molecular weight of 1.08×10(4)Da. Sugar composition of BEPF1 showed that it was composed of l-fucose, d-mannose, d-glucose and d-galactose in the ratio of 0.21:0.23:1.17:1.00. Methylation analysis together with (1)H, (13)C and 2D NMR spectroscopy established that BEPF1 was consisted of α-d-(1→6)-galactopyranan backbone with a terminal of α-l-fucosyl unit on O-2 of the 2-d-(2→6)-galactosyl units, β-d-(1→6)-4-O-Me-glucopyranan and β-d-(1→6)-glucopyranan backbone with a terminal β-d-glucosyl unit and it also contained a minor of 2,6-β-d-Mannopyranan residues. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Vitamin B12[c-lactone], a biologically inactive corrinoid compound, occurs in cultured and dried lion's mane mushroom (Hericium erinaceus) fruiting bodies.

PubMed

Teng, Fei; Bito, Tomohiro; Takenaka, Shigeo; Yabuta, Yukinori; Watanabe, Fumio

2014-02-19

This study determined the vitamin B12 content of the edible medicinal mushroom Hericium erinaceus, lion's mane mushroom fruiting body, using a microbiological assay based on Lactobacillus delbrueckii ATCC 7830. Trace levels (0.04-0.36 μg/100 g dry weight) of vitamin B12 were found in most of the dried mushroom samples, and two samples contained slightly higher levels (0.56 and 1.04 μg/100 g dry weight, respectively) of vitamin B12. We purified the corrinoid compounds from the extracts of dried lion's mane mushroom fruiting bodies using an immunoaffinity column and identified them as vitamin B12 or vitamin B12[c-lactone] (or both) based on LC/ESI-MS/MS chromatograms. This is the first report on an unnatural corrinoid, vitamin B12[c-lactone], occurring in foods. Vitamin B12[c-lactone] was simple to produce during incubation of authentic vitamin B12 and chloramine-T, an antimicrobial agent, at varying pH values (3.0-7.0) and was completely inactive in the vitamin B12-dependent bacteria that are generally used in vitamin B12 bioassays.

Prescribed burning in a Eucalyptus woodland suppresses fruiting of hypogeous fungi, an important food source for mammals.

PubMed

Trappe, James M; Nicholls, A O; Claridge, Andrew W; Cork, Steven J

2006-11-01

Fruit bodies of hypogeous fungi are an important food source for many small mammals and are consumed by larger mammals as well. A controversial hypothesis that prescribed burning increases fruiting of certain hypogeous fungi based on observations in Tasmania was tested in the Australian Capital Territory to determine if it applied in a quite different habitat. Ten pairs of plots, burnt and nonburnt, were established at each of two sites prescribe-burnt in May 1999. When sampled in early July, after autumn rains had initiated the fungal fruiting season, species richness and numbers of fruit bodies on the burnt plots were extremely low: most plots produced none at all. Both species richness and fruit body numbers were simultaneously high on nonburnt plots. One of the sites was resampled a year after the initial sampling. At that time species richness and fruit body abundance were still significantly less on burnt plots than on nonburnt, but a strong trend towards fungal recovery on the burnt plots was evident. This was particularly so when numbers of fruit bodies of one species, the hypogeous agaric Dermocybe globuliformis, were removed from the analysis. This species strongly dominated the nonburnt plots but was absent from burnt plots in both years. The trend towards recovery of fruit body abundance in the burnt plots one year after the burn was much more pronounced with exclusion of the Dermocybe data. The Tasmanian-based hypothesis was based mostly on the fruiting of two fire-adapted species in the Mesophelliaceae. Neither species occurred on our plots. Accordingly, the results and conclusions of the Tasmanian study cannot be extrapolated to other habitats without extensive additional study. Implications for management of habitat for fungi and the animals that rely on the fungi as a food source are discussed.

Nonvolatile Taste Components and Antioxidant Properties of Fruiting Body and Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom Pleurotus citrinopileatus (Agaricomycetes).

PubMed

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2016-01-01

Pleurotus citrinopileatus mycelium was prepared with high ergothioneine (Hi-Ergo) content and its proximate composition, nonvolatile taste components, and antioxidant properties were studied. The ergothioneine contents of fruiting bodies and Hi-Ergo and regular mycelia were 3.89, 14.57, and 0.37 mg/g dry weight, respectively. Hi-Ergo mycelium contained more dietary fiber, soluble polysaccharides, and ash but less carbohydrates, reducing sugar, fiber, and fat than regular mycelium. However, Hi-Ergo mycelium contained the smallest amounts of total sugars and polyols (47.43 mg/g dry weight). In addition, Hi-Ergo mycelium showed the most intense umami taste. On the basis of the half-maximal effective concentration values obtained, the 70% ethanolic extract from Hi-Ergo mycelium showed the most effective antioxidant activity, reducing power, and scavenging ability, whereas the fruiting body showed the most effective antioxidant activity, chelating ability, and Trolox-equivalent antioxidant capacity. Overall, Hi-Ergo mycelium could be beneficially used as a food-flavoring material or as a nutritional supplement.

Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

PubMed

Suseem, S R; Saral, Mary

2015-07-01

To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

PubMed

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Light-induced carotenogenesis in Myxococcus xanthus: evidence that CarS acts as an anti-repressor of CarA.

PubMed

Whitworth, D E; Hodgson, D A

2001-11-01

In the bacterium Myxococcus xanthus, carotenoids are produced in response to illumination, as a result of expression of the crt carotenoid biosynthesis genes. The majority of crt genes are clustered in the crtEBDC operon, which is repressed in the dark by CarA. Genetic data suggest that, in the light, CarS is synthesized and achieves activation of the crtEBDC operon by removing the repressive action of CarA. As CarS contains no known DNA-binding motif, the relief of CarA-mediated repression was postulated to result from a direct interaction between these two proteins. Use of the yeast two-hybrid system demonstrated direct interaction between CarA and CarS. The two-hybrid system also implied that CarA and, possibly, CarS are capable of homodimerization. Direct evidence for CarS anti-repressor action was provided in vitro. A glutathione S-transferase (GST)-CarA protein fusion was shown to bind specifically to a palindromic operator sequence within the crtEBDC promoter. CarA was prevented from binding to its operator, and prebound CarA was removed by the addition of purified CarS. CarS is therefore an anti-repressor.

Enzymatic characteristics of an ApaH-like phosphatase, PrpA, and a diadenosine tetraphosphate hydrolase, ApaH, from Myxococcus xanthus.

PubMed

Sasaki, Masashi; Takegawa, Kaoru; Kimura, Yoshio

2014-09-17

We characterized the activities of the Myxococcus xanthus ApaH-like phosphatases PrpA and ApaH, which share homologies with both phosphoprotein phosphatases and diadenosine tetraphosphate (Ap4A) hydrolases. PrpA exhibited a phosphatase activity towards p-nitrophenyl phosphate (pNPP), tyrosine phosphopeptide and tyrosine-phosphorylated protein, and a weak hydrolase activity towards ApnA and ATP. In the presence of Mn(2+), PrpA hydrolyzed Ap4A into AMP and ATP, whereas in the presence of Co(2+) PrpA hydrolyzed Ap4A into two molecules of ADP. ApaH exhibited high phosphatase activity towards pNPP, and hydrolase activity towards ApnA and ATP. Mn(2+) was required for ApaH-mediated pNPP dephosphorylation and ATP hydrolysis, whereas Co(2+) was required for ApnA hydrolysis. Thus, PrpA and ApaH may function mainly as a tyrosine protein phosphatase and an ApnA hydrolase, respectively. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Endo-β-1,3-Glucanase GLU1, from the Fruiting Body of Lentinula edodes, Belongs to a New Glycoside Hydrolase Family ▿ †

PubMed Central

Sakamoto, Yuichi; Nakade, Keiko; Konno, Naotake

2011-01-01

The cell wall of the fruiting body of the mushroom Lentinula edodes is degraded after harvesting by enzymes such as β-1,3-glucanase. In this study, a novel endo-type β-1,3-glucanase, GLU1, was purified from L. edodes fruiting bodies after harvesting. The gene encoding it, glu1, was isolated by rapid amplification of cDNA ends (RACE)-PCR using primers designed from the N-terminal amino acid sequence of GLU1. The putative amino acid sequence of the mature protein contained 247 amino acid residues with a molecular mass of 26 kDa and a pI of 3.87, and recombinant GLU1 expressed in Pichia pastoris exhibited β-1,3-glucanase activity. GLU1 catalyzed depolymerization of glucans composed of β-1,3-linked main chains, and reaction product analysis by thin-layer chromatography (TLC) clearly indicated that the enzyme had an endolytic mode. However, the amino acid sequence of GLU1 showed no significant similarity to known glycoside hydrolases. GLU1 has similarity to several hypothetical proteins in fungi, and GLU1 and highly similar proteins should be classified as a novel glycoside hydrolase family (GH128). PMID:21965406

Enhancer binding proteins act as hetero-oligomers and link secondary metabolite production to myxococcal development, motility, and predation.

PubMed

Volz, Carsten; Kegler, Carsten; Müller, Rolf

2012-11-21

Motile predatory Myxobacteria are producers of multiple secondary metabolites and, on starvation, undergo concerted cellular differentiation to form multicellular fruiting bodies. These abilities demand myxobacterial genomes to encode sophisticated regulatory networks that are not satisfactorily understood. Here, we present two bacterial enhancer binding proteins (bEBPs) encoded in Myxococcus xanthus acting as direct regulators of secondary metabolites intriguingly exhibiting activating and inhibitory effects. Elucidation of a regulon for each bEBP enabled us to unravel their role in myxococcal development, predation, and motility. Interestingly, both bEBPs are able to interact by forming a hetero-oligomeric complex. Our findings represent an alternative mode of operation of bEBPs, which are currently thought to enhance promoter activity by acting as homo-oligomers. Furthermore, a direct link between secondary metabolite gene expression and predation, motility, and cellular development could be shown for the first time. Copyright © 2012 Elsevier Ltd. All rights reserved.

Structural elucidation of polysaccharide containing 3-O-methyl galactose from fruiting bodies of Pleurotus citrinopileatus.

PubMed

He, Pengfei; Zhang, Anqiang; Zhou, Saijing; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong

2016-11-03

A water-soluble polysaccharide containing 3-O-methyl galactose (PCP60W) was isolated from fruiting bodies of Pleurotus citrinopileatus and purified by anion-exchange and gel column chromatography. This polysaccharide has an average molecular weight of 2.74 × 10 4  Da and its structure was elucidated using monosaccharide composition and methylation analysis combined with one- and two-dimensional (COSY, TOCSY, NOESY, HMQC and HMBC) NMR spectroscopy. PCP60W was shown to be a linear partially 3-O-methylated α-galactopyranan comprised of 6-linked galactose, 6-linked 3-O-methyl galactose and 4-linked glucose in a ratio of 3.0:1.0:0.6. This work provides additional evidence for the view that 3-O-methyl galactose is common to the genus Pleurotus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Highly oxygenated lanostane-type triterpenoids and their bioactivity from the fruiting body of Ganoderma gibbosum.

PubMed

Pu, De-Bing; Zheng, Xi; Gao, Jun-Bo; Zhang, Xing-Jie; Qi, Yan; Li, Xiao-Si; Wang, Yong-Mei; Li, Xiao-Nian; Li, Xiao-Li; Wan, Chun-Ping; Xiao, Wei-Lie

2017-06-01

Eight new highly oxygenated lanostane triterpenes, gibbosic acids A-H (1-8), along with three known ones (9-11), were isolated from the fruiting body of Ganoderma gibbosum. The structures of new isolates were assigned by NMR and HRESIMS experiments. The absolute configurations of 1 were further confirmed by single crystal X-ray diffraction data and computational ECD methods. Immunoregulatory effect and anti-inflammatory activities of these compounds were screened in murine lymphocyte proliferation assay and in lipopolysaccharide (LPS)-stimulated RAW-264.7 macrophages, respectively. Compound 2 exhibited immunostimulatory effect both in lymphocyte proliferation assay without any induction and ConA-induced mitogenic activity of T-lymphocyte, and the proportion of lymphocyte proliferation at the concentration of 0.1μM are 20.01% and 21.40%, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Changes in fruit and vegetable consumption of third-grade students in body quest: food of the warrior, a 17-class childhood obesity prevention program.

PubMed

Struempler, Barbara J; Parmer, Sondra M; Mastropietro, Lisa M; Arsiwalla, Dilbur; Bubb, Robert R

2014-01-01

To increase fruit and vegetable (FV) consumption of youth in Body Quest: Food of the Warrior (BQ), a childhood obesity prevention program. Quasi-experimental. Supplemental Nutrition Assistance Program-Education eligible schools (n = 60). Third-grade students (n = 2,477). Treatment groups (n = 1,674) self-reported foods consumed through the School Lunch Program for 17 weekly assessments; they participated in BQ curriculum, iPad app education, and weekly FV tastings. Control groups (n = 803) completed only pre- and post-assessments. Weekly FV consumed through School Lunch Program. ANCOVA and growth modeling. From before to after the program, the treatment group demonstrated significant, moderate increases in fruit (P < .01) and vegetable (P < .001) consumptions, increasing from 7 to 8 weekly FV servings. After the program, the treatment group consumed significantly (P < .001) more FV than the control group. Fruit and vegetable consumption increased to class 10 and then stabilized. From before to after the program, all FV predictors were significantly higher and included gender (vegetables), race (FV), and free/reduced lunch (fruit). Nutrition programs can increase FV intake. Even moderate increases in FV intake can be an initial step for the prevention of chronic disease. Copyright © 2014 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

Too hot to sleep? Sleep behaviour and surface body temperature of Wahlberg's Epauletted Fruit Bat.

PubMed

Downs, Colleen T; Awuah, Adwoa; Jordaan, Maryna; Magagula, Londiwe; Mkhize, Truth; Paine, Christine; Raymond-Bourret, Esmaella; Hart, Lorinda A

2015-01-01

The significance of sleep and factors that affect it have been well documented, however, in light of global climate change the effect of temperature on sleep patterns has only recently gained attention. Unlike many mammals, bats (order: Chiroptera) are nocturnal and little is known about their sleep and the effects of ambient temperature (Ta) on their sleep. Consequently we investigated seasonal temperature effects on sleep behaviour and surface body temperature of free-ranging Wahlberg's epauletted fruit bat, Epomophorus wahlbergi, at a tree roost. Sleep behaviours of E. wahlbergi were recorded, including: sleep duration and sleep incidences (i.e. one eye open and both eyes closed). Sleep differed significantly across all the individuals in terms of sleep duration and sleep incidences. Individuals generally spent more time awake than sleeping. The percentage of each day bats spent asleep was significantly higher during winter (27.6%), compared with summer (15.6%). In summer, 20.7% of the sleeping bats used one eye open sleep, and this is possibly the first evidence of one-eye-sleep in non-marine mammals. Sleep duration decreased with extreme heat as bats spent significantly more time trying to cool by licking their fur, spreading their wings and panting. Skin temperatures of E. wahlbergi were significantly higher when Ta was ≥35°C and no bats slept at these high temperatures. Consequently extremely hot days negatively impact roosting fruit bats, as they were forced to be awake to cool themselves. This has implications for these bats given predicted climate change scenarios.

Comparative genomics of transport proteins in developmental bacteria: Myxococcus xanthus and Streptomyces coelicolor

PubMed Central

2013-01-01

Background Two of the largest fully sequenced prokaryotic genomes are those of the actinobacterium, Streptomyces coelicolor (Sco), and the δ-proteobacterium, Myxococcus xanthus (Mxa), both differentiating, sporulating, antibiotic producing, soil microbes. Although the genomes of Sco and Mxa are the same size (~9 Mbp), Sco has 10% more genes that are on average 10% smaller than those in Mxa. Results Surprisingly, Sco has 93% more identifiable transport proteins than Mxa. This is because Sco has amplified several specific types of its transport protein genes, while Mxa has done so to a much lesser extent. Amplification is substrate- and family-specific. For example, Sco but not Mxa has amplified its voltage-gated ion channels but not its aquaporins and mechano-sensitive channels. Sco but not Mxa has also amplified drug efflux pumps of the DHA2 Family of the Major Facilitator Superfamily (MFS) (49 versus 6), amino acid transporters of the APC Family (17 versus 2), ABC-type sugar transport proteins (85 versus 6), and organic anion transporters of several families. Sco has not amplified most other types of transporters. Mxa has selectively amplified one family of macrolid exporters relative to Sco (16 versus 1), consistent with the observation that Mxa makes more macrolids than does Sco. Conclusions Except for electron transport carriers, there is a poor correlation between the types of transporters found in these two organisms, suggesting that their solutions to differentiative and metabolic needs evolved independently. A number of unexpected and surprising observations are presented, and predictions are made regarding the physiological functions of recognizable transporters as well as the existence of yet to be discovered transport systems in these two important model organisms and their relatives. The results provide insight into the evolutionary processes by which two dissimilar prokaryotes evolved complexity, particularly through selective chromosomal gene

Myxospore Coat Synthesis in Myxococcus xanthus: In Vivo Incorporation of Acetate and Glycine

PubMed Central

Filer, D.; White, D.; Kindler, S. H.; Rosenberg, E.

1977-01-01

Myxospore coat synthesis in Myxococcus xanthus was studied by incorporation of [14C]acetate into intermediates in the biosynthesis of coat polysaccharide and into acid-insoluble material during vegetative growth and after glycerol induction of myxospores. During short labeling periods at 27°C, the radioactivity was shown to be located primarily in N-acetyl groups rather than sugar moieties. Two hours after glycerol induction, the pools of N-acetylglucosamine 6-phosphate and uridine 5′-diphosphate-N-acetylgalactosamine (UDPGalNAc) plus uridine 5′-diphosphate-N-glucosamine increased about twofold and were labeled at twice the rate measured for vegetative cells. The increased rate of synthesis of UDPGalNAc and its precursors could be correlated with increased enzyme activities measured in vitro. Controlled acid hydrolysis revealed that the galactosamine portion of the myxospore coat was N-acetylated. After glycerol induction, the incorporation of acetate into acid-insoluble material increased threefold. This enhanced incorporation was sensitive to neither penicillin nor d-cycloserine. In contrast, bacitracin inhibited the incorporation of [14C]acetate into acid-insoluble material more effectively 2 h after myxospore induction than during vegetative growth. Chloramphenicol added to cells 90 min after induction blocked further increase in the rate of [14C]acetate incorporation. Since the myxospore coat contains glycine, polymer synthesis was also measured by chloramphenicol-insensitive [14C]glycine incorporation into acid-insoluble material. Although protein synthesis decreased after glycerol induction, glycine incorporation increased. Two hours after induction, glycine incorporation was only 75% inhibited by chloramphenicol and rifampin. The chloramphenicol-insensitive rate of incorporation of [14C]glycine increased during the first hour after myxospore induction and reached a peak rate after 2 to 3 h. The chloramphenicol-resistant incorporation of [14C

Daily Self-Monitoring of Body Weight, Step Count, Fruit/Vegetable Intake and Water Consumption: A Feasible and Effective Long-Term Weight Loss Maintenance Approach

PubMed Central

Akers, Jeremy D.; Cornett, Rachel A.; Savla, Jyoti S.; Davy, Kevin P.; Davy, Brenda M.

2012-01-01

Maintenance of weight loss remains a challenge for most individuals, thus practical and effective weight loss maintenance (WTLM) strategies are needed. A two-group (WEV versus WEV+) 12-month WTLM intervention trial was conducted (June 2007–February 2010) to determine the feasibility and effectiveness of weight loss maintenance intervention for older adults using daily self-monitoring of body weight, step count, fruit/vegetable intake and water consumption. Forty weight-reduced (mean weight lost = 6.7 ± 0.6 kg; BMI 29.2 ± 1.1 kg/m2) individuals aged 63 ± 1 yrs, who had previously participated in a 12-week randomized controlled weight loss intervention trial, were instructed to record daily body weight (Weight), step count (Exercise), and fruit/vegetable intake (Vegetable). Experimental group (WEV+) participants were also instructed to consume 16 floz of water before each main meal (i.e., three times daily), and to record daily water intake. Outcome measures included weight change, diet/physical activity behaviors, theoretical constructs related to health behaviors, and other clinical measures. Statistical analyses included growth curve analyses and repeated measures ANOVA. Over 12 months, there was a linear decline in weight (β = −0.32, P < 0.001) and a quadratic trend (β = 0.02, P < 0.01) over time, but no group difference (β = −0.23, P = 0.08). Analysis of the 365 days of self-reported body weight for each participant determined that weight loss was greater over the study period in WEV+ than WEV, corresponding to weight changes of −0.67 kg and 1.00 kg respectively, and an 87% greater weight loss (β = −0.01, P < 0.01). Overall compliance to daily tracking was 76 ± 5%. Daily self-monitoring of weight, physical activity, and fruit/vegetable consumption is a feasible and effective approach for maintaining weight loss for 12 months, and daily self-monitoring of increased water consumption may provide additional WTLM benefits. PMID:22709772

Intake of Raw Fruits and Vegetables Is Associated With Better Mental Health Than Intake of Processed Fruits and Vegetables

PubMed Central

Brookie, Kate L.; Best, Georgia I.; Conner, Tamlin S.

2018-01-01

Background: Higher intakes of fruits and vegetables, rich in micronutrients, have been associated with better mental health. However, cooking or processing may reduce the availability of these important micronutrients. This study investigated the differential associations between intake of raw fruits and vegetables, compared to processed (cooked or canned) fruits and vegetables, and mental health in young adults. Methods: In a cross-sectional survey design, 422 young adults ages 18–25 (66.1% female) living in New Zealand and the United States completed an online survey that assessed typical consumption of raw vs. cooked/canned/processed fruits and vegetables, negative and positive mental health (depressive symptoms, anxiety, negative mood, positive mood, life satisfaction, and flourishing), and covariates (including socio-economic status, body mass index, sleep, physical activity, smoking, and alcohol use). Results: Controlling for covariates, raw fruit and vegetable intake (FVI) predicted reduced depressive symptoms and higher positive mood, life satisfaction, and flourishing; processed FVI only predicted higher positive mood. The top 10 raw foods related to better mental health were carrots, bananas, apples, dark leafy greens like spinach, grapefruit, lettuce, citrus fruits, fresh berries, cucumber, and kiwifruit. Conclusions: Raw FVI, but not processed FVI, significantly predicted higher mental health outcomes when controlling for the covariates. Applications include recommending the consumption of raw fruits and vegetables to maximize mental health benefits. PMID:29692750

Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

PubMed Central

Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

2014-01-01

A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

Novel isolation of water-soluble polysaccharides from the fruiting bodies of Pleurotus ostreatus mushrooms.

PubMed

Palacios, Irene; García-Lafuente, Ana; Guillamón, Eva; Villares, Ana

2012-09-01

Novel water-soluble polysaccharides have been isolated from the fruiting bodies of the edible mushroom Pleurotus ostreatus. Three polysaccharide fractions were obtained by ethanol precipitation from cold water, hot water and hot aqueous NaOH extracts. The fractions were purified by size exclusion chromatography showing a unique carbohydrate occurring in each fraction: PC from the cold fraction, PH from the hot fraction and PB from the hot aqueous NaOH fraction. The analysis of the methylated alditol acetates and the NMR studies revealed that all the polysaccharides displayed a linear backbone. PC was formed by α-(1→3),(1→6)-linked galactopyranosyl residues whereas PH and PB consisted of glucose-linked units. PH was exclusively composed of glucopyranosyl units bound by α-(1→4) linkages whereas PB was a β-linked glucan showing (1→3) and (1→6) glycosidic bonds. The analysis of molecular arrangement by complexation with Congo red showed that only the β-linked polysaccharide (PB) displayed a triple helix conformation. Copyright © 2012 Elsevier Ltd. All rights reserved.

Complete Genome Sequence of the Fruiting Myxobacterium Melittangium boletus DSM 14713.

PubMed

Treuner-Lange, Anke; Bruckskotten, Marc; Rupp, Oliver; Goesmann, Alexander; Søgaard-Andersen, Lotte

2017-11-09

The formation of spore-filled fruiting bodies in response to starvation represents a hallmark of many members of the order Myxococcales Here, we present the complete 9.9-Mb genome of the fruiting type strain Melittangium boletus DSM 14713, the first member of this genus to have its genome sequenced. Copyright © 2017 Treuner-Lange et al.

Comparison of a dietary intervention promoting high intakes of fruits and vegetables with a low-fat approach: long-term effects on dietary intakes, eating behaviours and body weight in postmenopausal women.

PubMed

Lapointe, Annie; Weisnagel, S John; Provencher, Véronique; Bégin, Catherine; Dufour-Bouchard, Andrée-Ann; Trudeau, Caroline; Lemieux, Simone

2010-10-01

The aim of the present study was to compare the long-term effects of two dietary approaches on changes in dietary intakes, eating behaviours and body weight: (1) approach using restrictive messages to limit high-fat foods (low-fat intake; LOFAT); (2) approach emphasising non-restrictive messages directed towards the inclusion of fruits and vegetables (high intake of fruits and vegetables; HIFV). A total of sixty-eight overweight or obese postmenopausal women were randomly assigned to one of the two dietary approaches. The 6-month dietary intervention included three group sessions and ten individual sessions with a dietitian. Dietary intakes, eating behaviours and anthropometrics were measured at baseline, at the end of the dietary intervention (T = 6) and 6 months and 12 months after the end of the intervention (T = 12 and T = 18). In the LOFAT group, energy and fat intakes were lower at T = 6 when compared with baseline and remained lower at T = 12 and T = 18. In the HIFV group, fruit and vegetable intakes increased significantly at T = 6 but were no longer significantly different from baseline at T = 12 and T = 18. Dietary restraint increased at T = 6 and remained higher than baseline at T = 18 in the LOFAT group while no significant change was observed in the HIFV group. At T = 6, body weight was significantly lower than baseline in both groups (LOFAT: - 3.7 (SD 2.8) kg; HIFV: - 1.8 (SD 3.0) kg) and no significant difference in body-weight change from baseline was found between groups at T = 18. We concluded that weight loss was similar at 1-year follow-up in both dietary approaches. Despite relatively good improvements in the short term, the adherence to a 6-month dietary intervention promoting high intakes of fruits and vegetables was difficult to maintain.

Too Hot to Sleep? Sleep Behaviour and Surface Body Temperature of Wahlberg’s Epauletted Fruit Bat

PubMed Central

Downs, Colleen T.; Awuah, Adwoa; Jordaan, Maryna; Magagula, Londiwe; Mkhize, Truth; Paine, Christine; Raymond-Bourret, Esmaella; Hart, Lorinda A.

2015-01-01

The significance of sleep and factors that affect it have been well documented, however, in light of global climate change the effect of temperature on sleep patterns has only recently gained attention. Unlike many mammals, bats (order: Chiroptera) are nocturnal and little is known about their sleep and the effects of ambient temperature (Ta) on their sleep. Consequently we investigated seasonal temperature effects on sleep behaviour and surface body temperature of free-ranging Wahlberg’s epauletted fruit bat, Epomophorus wahlbergi, at a tree roost. Sleep behaviours of E. wahlbergi were recorded, including: sleep duration and sleep incidences (i.e. one eye open and both eyes closed). Sleep differed significantly across all the individuals in terms of sleep duration and sleep incidences. Individuals generally spent more time awake than sleeping. The percentage of each day bats spent asleep was significantly higher during winter (27.6%), compared with summer (15.6%). In summer, 20.7% of the sleeping bats used one eye open sleep, and this is possibly the first evidence of one-eye-sleep in non-marine mammals. Sleep duration decreased with extreme heat as bats spent significantly more time trying to cool by licking their fur, spreading their wings and panting. Skin temperatures of E. wahlbergi were significantly higher when Ta was ≥35°C and no bats slept at these high temperatures. Consequently extremely hot days negatively impact roosting fruit bats, as they were forced to be awake to cool themselves. This has implications for these bats given predicted climate change scenarios. PMID:25775371

Berry fruit enhances beneficial signaling in brain

USDA-ARS?s Scientific Manuscript database

Increased lifespans have led to population aging and brought attention to healthcare concerns associated with old age. A growing body of pre-clinical and clinical research has identified neurological benefits associated with the consumption of berry fruits. In addition to their now well-known antio...

An axenic culture system for fruiting body formation by an edible bolete phylogenetically related to culinary-medicinal penny bun mushroom, Boletus edulis Bull.:Fr. strains from China.

PubMed

Fu, Shao Chun; Zhang, Mei Yan; Shang, Xiao Dong; Chen, Ming Jie; Tan, Qi

2011-01-01

The ability of two freshly isolated Boletus stains to fruit under axenic conditions was tested using different solid and liquid nutrient media. One strain (YNCX04) produced numerous primordia from which fruiting bodies, 12 mm and 10 mm in length, with grey, convex pilei, and yellow-white, clavate stipes developed between 15 and 30 d after inoculation of fungal mycelium onto a solid medium consisting of mineral salts, thiamine, glucose, potato, an extract of Cunninghamia lanceolata root, and agar. The other strain (YNB200) produced numerous primordia but no sporophores. Strain YNCX04 lost the ability to form fruiting bodies in axenic culture 6 mo after initial isolation but retained the ability to form primordia for up to 18 mo. Based on internal transcribed spacer sequencing data, strains YNB200 and YNCX04 formed a sub-cluster together with four previously designated Boletus edulis strains from China. Phylogenetic analysis placed the Chinese strains closer to B. aestivalis than to European and North American strains of B. edulis, although a 29-bp fragment specific to all the B. aestivalis strains was absent from all the Chinese strains. Furthermore, partial 18S rDNA sequences from strains YNB200 and YNCX04 exhibited 98% similarity with an 18S rDNA sequence from B. edulis strain Be3. Further molecular studies are indicated to more accurately establish the taxonomic positions ofF3 and F4-3, as well as the Chinese strains designated as B. edulis.

Combined Supplementation with Grape Pomace and Omija Fruit Ethanol Extracts Dose-Dependently Improves Body Composition, Plasma Lipid Profiles, Inflammatory Status, and Antioxidant Capacity in Overweight and Obese Subjects.

PubMed

Han, Hye Jin; Jung, Un Ju; Kim, Hye-Jin; Cho, Su-Jung; Kim, Ae Hyang; Han, Youngji; Choi, Myung-Sook

2016-02-01

The aim of this study was to examine the efficacy of combined grape pomace and omija fruit ethanol extracts (GO) on metabolic disorders in overweight or obese subjects. Seventy-six subjects (30-70 years, body mass index ≥23.0 kg/m2) were divided into control (starch, 4 g/day, n = 24), low-GO (low dose GO, grape pomace extract [342.5 mg/day] + omija fruit extract [57.5 mg/day], n = 26), and high-GO (high dose GO, grape pomace extract [685 mg/day] + omija fruit extract [115 mg/day], n = 26) groups. Body composition, nutrient intake, plasma lipid profiles, inflammation, antioxidant capacity, and hepatotoxicity markers were assessed in all subjects at the baseline and 10 weeks after taking the supplements. The body weight and body fat of overweight or obese subjects was not significantly altered in the low-GO and high-GO groups. However, the high-GO supplement significantly decreased the baseline-adjusted final plasma total-cholesterol, low-density lipoprotein (LDL)-cholesterol, and non-high-density lipoprotein (HDL)-cholesterol levels and increased the baseline-adjusted final plasma apolipoprotein (apo) A-1 level compared with that of the control group. In addition, the high-GO supplement significantly lowered apo B, apo B/apo A-1, lipoprotein a (Lp[a]), atherogenic index, interleukin (IL)-1β, tumor necrosis factor-α, and elevated erythrocyte antioxidant capacity compared with the control group or the baseline levels. The low-GO supplement decreased the plasma IL-1β level and elevated erythrocyte superoxide dismutase activity compared with that at baseline. However, in general, high-GO exerted a greater effect than low-GO. There were no significant differences in activities of plasma glutamate oxaloacetate transaminase and glutamate pyruvate transaminase between the groups. This study is a preliminary clinical study to verify that GO could be beneficial for amelioration of obesity-related dyslipidemia, inflammation, and oxidative stress

Fruit Size Determines the Role of Three Scatter-Hoarding Rodents as Dispersers or Seed Predators of a Fleshy-Fruited Atacama Desert Shrub

PubMed Central

Loayza, Andrea P.; Squeo, Francisco A.

2016-01-01

Scatter-hoarding rodents can act as both predators and dispersers for many large-seeded plants because they cache seeds for future use, but occasionally forget them in sites with high survival and establishment probabilities. The most important fruit or seed trait influencing rodent foraging behavior is seed size; rodents prefer large seeds because they have higher nutritional content, but this preference can be counterbalanced by the higher costs of handling larger seeds. We designed a cafeteria experiment to assess whether fruit and seed size of Myrcianthes coquimbensis, an endangered desert shrub, influence the decision-making process during foraging by three species of scatter-hoarding rodents differing in body size: Abrothrix olivaceus, Phyllotis darwini and Octodon degus. We found that the size of fruits and seeds influenced foraging behavior in the three rodent species; the probability of a fruit being harvested and hoarded was higher for larger fruits than for smaller ones. Patterns of fruit size preference were not affected by rodent size; all species were able to hoard fruits within the entire range of sizes offered. Finally, fruit and seed size had no effect on the probability of seed predation, rodents typically ate only the fleshy pulp of the fruits offered and discarded whole, intact seeds. In conclusion, our results reveal that larger M. coquimbensis fruits have higher probabilities of being harvested, and ultimately of its seeds being hoarded and dispersed by scatter-hoarding rodents. As this plant has no other dispersers, rodents play an important role in its recruitment dynamics. PMID:27861550

Structural elucidation of a heteroglycan from the fruiting bodies of Agaricus blazei Murill.

PubMed

Liu, Jicheng; Zhang, Chunjing; Wang, Yajun; Yu, Haitao; Liu, Han; Wang, Liping; Yang, Xiuzhen; Liu, Zhecheng; Wen, Xianchun; Sun, Yongxu; Yu, Chunlei; Liu, Lei

2011-11-01

One water-soluble polysaccharide (ABP-W1) was purified from the fruiting bodies of Agaricus blazei by DEAE Sepharose Fast Flow and Sepharose 6 Fast Flow column chromatography. Its molecular weight was about 3.9×10(2) kDa as determined by high-performance size-exclusion chromatography (HPSEC). The structural feature of ABP-W1 was investigated by a combination of chemical and instrumental analysis, including partial hydrolysis with acid, periodate oxidation-Smith degradation, acetylation, methylation analysis and nuclear magnetic resonance spectroscopy (NMR (1)H, (13)C). The results revealed that ABP-W1 had a backbone consisting of (1→6)-linked-α-D-galactopyranosyl and (1→2,6)-linked-α-D-glucopyranosyl, which was branched with one single terminal (1→)-α-D-glucopyranosyl at the O-2 position of (1→2,6)-linked-α-D-glucopyranosyl along the main chain in the ratio of 1:1:1. The observation of the complex-formation between ABP-W1 and Congo Red indicated that ABP-W1 probably existed in a triple-strand helical conformation in water. Based on the data obtained, ABP-W1 was composed of a repeating unit with a structure as below: [structure: see text]. Copyright © 2011 Elsevier B.V. All rights reserved.

Memorizing fruit: The effect of a fruit memory-game on children's fruit intake.

PubMed

Folkvord, Frans; Anastasiadou, Dimitra Tatiana; Anschütz, Doeschka

2017-03-01

Food cues of palatable food are omnipresent, thereby simulating the intake of unhealthy snack food among children. As a consequence, this might lead to a higher intake of energy-dense snacks and less fruit and vegetables, a habit that increases the risk of developing chronic diseases. The aim of this experimental study is to examine whether playing a memory game with fruit affects fruit intake among young children. We used a randomized between-subject design with 127 children (age: 7-12 y) who played a memory-game, containing either fruit ( n  = 64) or non-food products ( n  = 63). While playing the memory-game in a separate room in school during school hours, free intake of fruit (mandarins, apples, bananas, and grapes) was measured. Afterwards, the children completed self-report measures, and length and weight were assessed. The main finding is that playing a memory-game containing fruit increases overall fruit intake ( P  = 0.016). Children who played the fruit version of the memory-game ate more bananas ( P  = 0.015) and mandarins ( P  = 0.036) than children who played the non-food memory-game; no effects were found for apples ( P  > 0.05) and grapes ( P  > 0.05). The findings suggest that playing a memory-game with fruit stimulates fruit intake among young children. This is an important finding because children eat insufficient fruit, according to international standards, and more traditional health interventions have limited success. Healthy eating habits of children maintain when they become adults, making it important to stimulate fruit intake among children in an enjoyable way. Nederlands Trial Register TC = 5687.

Rosaceae Fruit Development, Ripening and Post-harvest: An Epigenetic Perspective

PubMed Central

Farinati, Silvia; Rasori, Angela; Varotto, Serena; Bonghi, Claudio

2017-01-01

Rosaceae is a family with an extraordinary spectrum of fruit types, including fleshy peach, apple, and strawberry that provide unique contributions to a healthy diet for consumers, and represent an excellent model for studying fruit patterning and development. In recent years, many efforts have been made to unravel regulatory mechanism underlying the hormonal, transcriptomic, proteomic and metabolomic changes occurring during Rosaceae fruit development. More recently, several studies on fleshy (tomato) and dry (Arabidopsis) fruit model have contributed to a better understanding of epigenetic mechanisms underlying important heritable crop traits, such as ripening and stress response. In this context and summing up the results obtained so far, this review aims to collect the available information on epigenetic mechanisms that may provide an additional level in gene transcription regulation, thus influencing and driving the entire Rosaceae fruit developmental process. The whole body of information suggests that Rosaceae fruit could become also a model for studying the epigenetic basis of economically important phenotypes, allowing for their more efficient exploitation in plant breeding. PMID:28769956

Structure elucidation of a bioactive polysaccharide from fruiting bodies of Hericium erinaceus in different maturation stages.

PubMed

Li, Qiao-Zhen; Wu, Di; Zhou, Shuai; Liu, Yan-Fang; Li, Zheng-Peng; Feng, Jie; Yang, Yan

2016-06-25

HPB-3, a heteropolysaccharide, with a mean molecular weight of 1.5×10(4)Da, was obtained from the maturating-stage IV, V and VI fruiting body of Hericium erinaceus, exhibited higher macrophages stimulation activities, was able to upregulate the functional events mediated by activated macrophages, such as production of nitric oxide (NO). Monosaccharide composition analysis showed that HPB-3 comprised l-fucose, d-galactose and d-glucose in the ratio of 5.2:23.9:1. Its chemical structure was characterized by sugar and methylation analysis, along with (1)H and (13)C NMR spectroscopy, including (1)H-(1)H COSY, TOCSY, NOESY, HMQC and HMBC experiments. The results indicated that HPB-3 contained a-(1/6)-linked galactopyranosyl backbone, partially with a side chain composed of α-l-fucopyranose at the O-2 position. The predicted primary structure of the polysaccharide was established as below. Copyright © 2016 Elsevier Ltd. All rights reserved.

Steroids and triterpenes from the fruit bodies of Ganoderma lucidum and their anti-complement activity.

PubMed

Seo, Hyo Won; Hung, Tran Manh; Na, MinKyun; Jung, Hyun Ju; Kim, Jin Cheol; Choi, Jae Sue; Kim, Jung Hee; Lee, Hyeong-Kyu; Lee, IkSoo; Bae, KiHwan; Hattori, Masao; Min, Byung Sun

2009-11-01

To determine the anti-complement activity of natural triterpenes, chromatographic separation of the EtOAc-soluble fraction from the fruiting body of Ganoderma lucidum led to the isolation of three steroids and five triterpenoids. They were identified as ergosterol peroxide (1), ergosterol (2), genoderic acid Sz (3), stella sterol (4), ganoderic aic C1 (5), ganoderic acid A (6), methyl ganoderate A (7), and lucidenic acid A (8) based on spectroscopic evidence and physicochemical properties. These compounds were examined for their anti-complement activity against the classical pathway of the complement system. Compounds 2 and 3 showed potent anti-complement activity with IC50 values of 52.0 and 44.6 microM, respectively. Compound 1 exhibited significant inhibitory activity with an IC50 value of 126.8 microM, whereas compounds 4-8 were inactive. Our findings suggested that in addition to the ketone group at C-3, the delta7(8), delta9(11)-lanostadiene type triterpene also plays an important role in inhibiting the hemolytic activity of human serum against erythrocytes.

Reversible antispermatogenic and antisteroidogenic activities of Feronia limonia fruit pulp in adult male rats

PubMed Central

Dhanapal, Ramaiyan; Ratna, J.Vijaya; Sarathchandran, I.; Gupta, Malaya

2012-01-01

Objective To explore the antispermatogenic and testicular antisteroidogenic activities of Feronia limonia fruit pulp southern India. Methods Fourty Wistar male albino rats (Rattus norvegicus) were equally divided into four groups. Experimental groups were administered with the ethanolic extract of Feronia limonia (F. limoni) fruit pulp at doses of 250 and 500 mg/kg body weight once daily for 55 days. All treated rats had corresponding recovery groups. At the end of each treatment periods, various spermatological indices, tissue biochemicals and testicular enzymes levels were analysed. Blood profiles were also estimated. Results Compared with the control, the F. limonia fruit pulp at both dose levels did not decrease body weight, which were associated with decline in epididymal sperm count, motility, viability and increased percent of abnormal sperm. Further, F. limonia fruit pulp at 500 mg/kg body weight markedly reduced the epididymal and testicular protein content by 24.58% and 29.86%, respectively, as well as the glucose-6-phosphate dehydrogenase and Δ5-3β-hydroxy steroid dehydrogenase) levels by 42.82% and 38.08%, respectively, while a significant elevation was observed in testicular cholesterol and ascorbic acid content. A gradual recovery of all parameters was observed after 55 days of treatment withdrawal. No significant alterations in haematological indices were observed. Conclusions The present findings indicate that F. limonia fruit pulp may have reversible antispermatogenic and antisteroidogenic properties, and could partially support the traditional use as male contraceptive. PMID:23569995

The Social Amoeba Polysphondylium pallidum Loses Encystation and Sporulation, but Can Still Erect Fruiting Bodies in the Absence of Cellulose

PubMed Central

Du, Qingyou; Schaap, Pauline

2014-01-01

Amoebas and other freely moving protists differentiate into walled cysts when exposed to stress. As cysts, amoeba pathogens are resistant to biocides, preventing treatment and eradication. Lack of gene modification procedures has left the mechanisms of encystation largely unexplored. Genetically tractable Dictyostelium discoideum amoebas require cellulose synthase for formation of multicellular fructifications with cellulose-rich stalk and spore cells. Amoebas of its distant relative Polysphondylium pallidum (Ppal), can additionally encyst individually in response to stress. Ppal has two cellulose synthase genes, DcsA and DcsB, which we deleted individually and in combination. Dcsa- mutants formed fruiting bodies with normal stalks, but their spore and cyst walls lacked cellulose, which obliterated stress-resistance of spores and rendered cysts entirely non-viable. A dcsa-/dcsb- mutant made no walled spores, stalk cells or cysts, although simple fruiting structures were formed with a droplet of amoeboid cells resting on an sheathed column of decaying cells. DcsB is expressed in prestalk and stalk cells, while DcsA is additionally expressed in spores and cysts. We conclude that cellulose is essential for encystation and that cellulose synthase may be a suitable target for drugs to prevent encystation and render amoeba pathogens susceptible to conventional antibiotics. PMID:25113829

The Effects of Herbs and Fruits on Leukaemia

PubMed Central

Saedi, Tayebeh Azam; Md Noor, Sabariah; Ismail, Patimah; Othman, Fauziah

2014-01-01

In developing countries, herbal therapy is the first and basis form of treatment for most types of diseases. About 75–80% of the world's population prefers herbal therapy as a major treatment due to its better adequacy and satisfactoriness, which enhance human body's symmetry with minimal side effects. Fruits and plants have been presented from the past as promising tools in becoming a natural anticancer agents. Many of these plant extracts are currently used in cancer therapy and prevention. This review paper will particularly explore and emphasize on herbs and fruits used in the treatment of the leukaemia. PMID:25250054

The genome sequence of the commercially cultivated mushroom Agrocybe aegerita reveals a conserved repertoire of fruiting-related genes and a versatile suite of biopolymer-degrading enzymes.

PubMed

Gupta, Deepak K; Rühl, Martin; Mishra, Bagdevi; Kleofas, Vanessa; Hofrichter, Martin; Herzog, Robert; Pecyna, Marek J; Sharma, Rahul; Kellner, Harald; Hennicke, Florian; Thines, Marco

2018-01-15

Agrocybe aegerita is an agaricomycete fungus with typical mushroom features, which is commercially cultivated for its culinary use. In nature, it is a saprotrophic or facultative pathogenic fungus causing a white-rot of hardwood in forests of warm and mild climate. The ease of cultivation and fructification on solidified media as well as its archetypal mushroom fruit body morphology render A. aegerita a well-suited model for investigating mushroom developmental biology. Here, the genome of the species is reported and analysed with respect to carbohydrate active genes and genes known to play a role during fruit body formation. In terms of fruit body development, our analyses revealed a conserved repertoire of fruiting-related genes, which corresponds well to the archetypal fruit body morphology of this mushroom. For some genes involved in fruit body formation, paralogisation was observed, but not all fruit body maturation-associated genes known from other agaricomycetes seem to be conserved in the genome sequence of A. aegerita. In terms of lytic enzymes, our analyses suggest a versatile arsenal of biopolymer-degrading enzymes that likely account for the flexible life style of this species. Regarding the amount of genes encoding CAZymes relevant for lignin degradation, A. aegerita shows more similarity to white-rot fungi than to litter decomposers, including 18 genes coding for unspecific peroxygenases and three dye-decolourising peroxidase genes expanding its lignocellulolytic machinery. The genome resource will be useful for developing strategies towards genetic manipulation of A. aegerita, which will subsequently allow functional genetics approaches to elucidate fundamentals of fruiting and vegetative growth including lignocellulolysis.

Evaluation of nutritional and antioxidant properties of the tropical fruits banana, litchi, mango, papaya, passion fruit and pineapple cultivated in Réunion French Island.

PubMed

Septembre-Malaterre, Axelle; Stanislas, Giovédie; Douraguia, Elisabeth; Gonthier, Marie-Paule

2016-12-01

Much attention is paid to the beneficial action of fruits against obesity-related oxidative stress. This study evaluated nutritional and antioxidant properties of banana, litchi, mango, papaya, passion fruit and pineapple from Réunion French Island. Results showed that total amounts of carbohydrates, vitamin C and carotenoids were 7.7-67.3g glucose equivalent, 4.7-84.9mg ascorbic acid equivalent and 26.6-3829.2μg β-carotene equivalent/100g fresh weight, respectively. Polyphenols were detected as the most abundant antioxidants (33.0-286.6mg gallic acid equivalent/100g fresh weight) with the highest content from passion fruit. UPLC-MS analysis led to identify epigallocatechin and quercetin derivatives from banana and litchi, ferulic, sinapic, syringic and gallic acids from pineapple and mango, and piceatannol from passion fruit. Polyphenol-rich extracts protected red blood cells and preadipose cells against oxidative stress. Altogether, these findings highlight nutritional benefits of French tropical fruits and their possible interest to improve antioxidant capacities of the body during obesity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Hepatotoxicity and subchronic toxicity tests of Morinda citrifolia (noni) fruit.

PubMed

West, Brett J; Su, Chen X; Jensen, C Jarakae

2009-10-01

Morinda citrifolia (noni) fruit juice has been approved as a safe food in many nations. A few cases of hepatitis in people who had been drinking noni juice have been reported, even though no causal link could be established between the liver injury and ingestion of the juice. To more fully evaluate the hepatotoxic potential of noni fruit juice, in vitro hepatotoxicity tests were conducted in human liver cells, HepG2 cell line. A subchronic oral toxicity test of noni fruit was also performed in Sprague-Dawley (SD) rats to provide benchmark data for understanding the safety of noni juice, without the potential confounding variables associated with many commercial noni juice products. Freeze-dried filtered noni fruit puree did not decrease HepG2 cell viability or induce neutral lipid accumulation and phospholipidosis. There were no histopathological changes or evidence of dose-responses in hematological and clinical chemistry measurements, including liver function tests. The no-observed-adverse-effect level (NOAEL) for freeze-dried noni fruit puree is greater than 6.86 g/kg body weight, equivalent to approximately 90 ml of noni fruit juice/kg. These findings corroborate previous conclusions that consumption of noni fruit juice is unlikely to induce adverse liver effects.

Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production

PubMed Central

Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B.; Igoshin, Oleg A.

2016-01-01

Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher’s equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase–a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics. PMID:27362260

Colony Expansion of Socially Motile Myxococcus xanthus Cells Is Driven by Growth, Motility, and Exopolysaccharide Production.

PubMed

Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A

2016-06-01

Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.

Analysis of imidacloprid residues in fruits, vegetables, cereals, fruit juices, and baby foods, and daily intake estimation in and around Lucknow, India.

PubMed

Kapoor, Upasana; Srivastava, M K; Srivastava, Ashutosh Kumar; Patel, D K; Garg, Veena; Srivastava, L P

2013-03-01

A total of 250 samples-including fruits, fruit juices, and baby foods (50 samples each), vegetables (70 samples), and cereals (30 samples)-were collected from Lucknow, India, and analyzed for the presence of imidacloprid residues. The QuEChERS (quick, easy, cheap, effective, rugged, and safe) method of extraction coupled with high-performance liquid chromatographic analysis were carried out, and imidacloprid residues were qualitatively confirmed by liquid chromatography-mass spectrometry. Imidacloprid was not detected in samples of fruit juices and baby foods. It was, however, detected in 38 samples of fruits, vegetables, and cereals, which is about 15.20% of the total samples. Of samples of fruits, 22% showed the presence of imidacloprid, and 2% of samples showed residues above the maximal residue limit. Although imidacloprid was detected in 24% of vegetable samples, only 5.71% showed the presence of imidacloprid above the maximal residue limit. However, 33% of cereal samples showed the presence of imidacloprid, and about 3% of samples were above the maximal residue limit. The calculated estimated daily intake ranged between 0.004 and 0.131 µg/kg body weight, and the hazard indices ranged from 0.007 to 0.218 for these food commodities. It is therefore indicated that lifetime consumption of vegetables, fruits, fruit juices, baby foods, wheat, rice, and pulses may not pose a health hazard for the population of Lucknow because the hazard indices for imidacloprid residues were below one. Copyright © 2012 SETAC.

27 CFR 24.213 - Heavy bodied blending wine.

Code of Federal Regulations, 2013 CFR

2013-04-01

..., DEPARTMENT OF THE TREASURY ALCOHOL WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...

27 CFR 24.213 - Heavy bodied blending wine.

Code of Federal Regulations, 2011 CFR

2011-04-01

..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...

27 CFR 24.213 - Heavy bodied blending wine.

Code of Federal Regulations, 2012 CFR

2012-04-01

..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...

27 CFR 24.213 - Heavy bodied blending wine.

Code of Federal Regulations, 2014 CFR

2014-04-01

..., DEPARTMENT OF THE TREASURY ALCOHOL WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...

Consequence of the antioxidant activities and tyrosinase inhibitory effects of various extracts from the fruiting bodies of Pleurotus ferulae

PubMed Central

Alam, Nuhu; Yoon, Ki Nam; Lee, Jae Seong; Cho, Hae Jin; Lee, Tae Soo

2011-01-01

This study was initiated to screen the antioxidant activities, tyrosinase inhibitory effects on the fruiting bodies of Pleurotus ferulae extracted with acetone, methanol and hot water. The antioxidant activities were performed on β-carotene–linoleic acid, reducing power, DPPH, ferrous ions chelating abilities, and xanthine oxidase. In addition to this, phenolic compounds were also analyzed. The methanolic extract showed the strongest β-carotene–linoleic acid inhibition and high reducing power as compared to other extracts. The scavenging effects on DPPH radicals, the acetonic and methanolic extracts were more effective than hot water extracts. The strongest chelating effect was obtained from the methanolic extract as compared to the tested synthetic antioxidant. Gallic acid, protocatechuic acid, caffeic acid, vanillin, ferulic acid, naringin, resveratrol, naringenin, hesperetin, formononetin and biochanin-A were detected from acetonitrile and hydrochloric acid (5:1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of acetonic, methanolic, and hot water extracts of P. ferulae increased with increasing concentration. The results suggested that consumption of P. ferulae might be beneficial to the antioxidant, xanthine oxidase, and tyrosinase protection system of the human body against oxidative damage and others complications. PMID:23961169

Fruits

USDA-ARS?s Scientific Manuscript database

In a botanical sense, fruits are the developed part of the seed-containing ovary. Evolutionarily speaking, plants have developed fruit with the goal of attracting insects, birds, reptiles and mammals to spread the seeds. Fruit can be dry such as the pod of a pea, or fleshy such as a peach. As humans...

β-Carbonic Anhydrases Play a Role in Fruiting Body Development and Ascospore Germination in the Filamentous Fungus Sordaria macrospora

PubMed Central

Elleuche, Skander; Pöggeler, Stefanie

2009-01-01

Carbon dioxide (CO2) is among the most important gases for all organisms. Its reversible interconversion to bicarbonate (HCO3 −) reaches equilibrium spontaneously, but slowly, and can be accelerated by a ubiquitous group of enzymes called carbonic anhydrases (CAs). These enzymes are grouped by their distinct structural features into α-, β-, γ-, δ- and ζ-classes. While physiological functions of mammalian, prokaryotic, plant and algal CAs have been extensively studied over the past years, the role of β-CAs in yeasts and the human pathogen Cryptococcus neoformans has been elucidated only recently, and the function of CAs in multicellular filamentous ascomycetes is mostly unknown. To assess the role of CAs in the development of filamentous ascomycetes, the function of three genes, cas1, cas2 and cas3 (carbonic anhydrase of Sordaria) encoding β-class carbonic anhydrases was characterized in the filamentous ascomycetous fungus Sordaria macrospora. Fluorescence microscopy was used to determine the localization of GFP- and DsRED-tagged CAs. While CAS1 and CAS3 are cytoplasmic enzymes, CAS2 is localized to the mitochondria. To assess the function of the three isoenzymes, we generated knock-out strains for all three cas genes (Δcas1, Δcas2, and Δcas3) as well as all combinations of double mutants. No effect on vegetative growth, fruiting-body and ascospore development was seen in the single mutant strains lacking cas1 or cas3, while single mutant Δcas2 was affected in vegetative growth, fruiting-body development and ascospore germination, and the double mutant strain Δcas1/2 was completely sterile. Defects caused by the lack of cas2 could be partially complemented by elevated CO2 levels or overexpression of cas1, cas3, or a non-mitochondrial cas2 variant. The results suggest that CAs are required for sexual reproduction in filamentous ascomycetes and that the multiplicity of isoforms results in redundancy of specific and non-specific functions. PMID:19365544

Beta-carbonic anhydrases play a role in fruiting body development and ascospore germination in the filamentous fungus Sordaria macrospora.

PubMed

Elleuche, Skander; Pöggeler, Stefanie

2009-01-01

Carbon dioxide (CO(2)) is among the most important gases for all organisms. Its reversible interconversion to bicarbonate (HCO(3) (-)) reaches equilibrium spontaneously, but slowly, and can be accelerated by a ubiquitous group of enzymes called carbonic anhydrases (CAs). These enzymes are grouped by their distinct structural features into alpha-, beta-, gamma-, delta- and zeta-classes. While physiological functions of mammalian, prokaryotic, plant and algal CAs have been extensively studied over the past years, the role of beta-CAs in yeasts and the human pathogen Cryptococcus neoformans has been elucidated only recently, and the function of CAs in multicellular filamentous ascomycetes is mostly unknown. To assess the role of CAs in the development of filamentous ascomycetes, the function of three genes, cas1, cas2 and cas3 (carbonic anhydrase of Sordaria) encoding beta-class carbonic anhydrases was characterized in the filamentous ascomycetous fungus Sordaria macrospora. Fluorescence microscopy was used to determine the localization of GFP- and DsRED-tagged CAs. While CAS1 and CAS3 are cytoplasmic enzymes, CAS2 is localized to the mitochondria. To assess the function of the three isoenzymes, we generated knock-out strains for all three cas genes (Deltacas1, Deltacas2, and Deltacas3) as well as all combinations of double mutants. No effect on vegetative growth, fruiting-body and ascospore development was seen in the single mutant strains lacking cas1 or cas3, while single mutant Deltacas2 was affected in vegetative growth, fruiting-body development and ascospore germination, and the double mutant strain Deltacas1/2 was completely sterile. Defects caused by the lack of cas2 could be partially complemented by elevated CO(2) levels or overexpression of cas1, cas3, or a non-mitochondrial cas2 variant. The results suggest that CAs are required for sexual reproduction in filamentous ascomycetes and that the multiplicity of isoforms results in redundancy of specific and

Investigation of the Blood Glucose Lowering Potential of the Jamaican Momordica charantia (Cerasee) Fruit in Sprague-Dawley Rats

PubMed Central

Burnett, A; McKoy, M-L; Singh, P

2015-01-01

ABSTRACT The Momordica charantia (MC) fruit has been documented to possess antidiabetic properties. However, these studies were not without controversy surrounding the blood glucose-lowering ability and the mechanism of action in diabetes therapy. In an effort to evaluate such claims in the Jamaican MC species known as cerasee, aqueous extracts of the unripe fruit were studied in normal and diabetic rats. Normal male Sprague-Dawley rats were divided into groups (n = 6) orally administered distilled water, 10% dimethyl sulfoxide (DMSO) solution, the aqueous extract (400 mg/kg body weight) and glibenclamide (15 mg/kg body weight), respectively prior to assessment of fasting blood glucose (FBG) concentration. The oral glucose tolerance test (OGTT) was conducted in normoglycaemic rats orally administered distilled water, 10% DMSO solution, glibenclamide (15 mg/kg body weight) or aqueous extracts of the fruit (200 and 400 mg/kg body weight). Blood glucose concentration was also monitored in streptozotocin-induced diabetic rats administered the aqueous extract (250 mg/kg body weight) or water vehicle after an overnight fast. The aqueous extracts showed no hypoglycaemic or antidiabetic activity. However, the administration of the aqueous extracts (200 and 400 mg/kg body weight) resulted in significant improvement in glucose tolerance of glucose-primed normoglycaemic rats during the OGTT. These data suggest that the glucose-lowering mechanism of the Jamaican MC fruit species likely involves altered glucose absorption across the gastrointestinal tract. PMID:26624580

Neotropical fish-fruit interactions: eco-evolutionary dynamics and conservation.

PubMed

Correa, Sandra Bibiana; Costa-Pereira, Raul; Fleming, Theodore; Goulding, Michael; Anderson, Jill T

2015-11-01

Frugivorous fish play a prominent role in seed dispersal and reproductive dynamics of plant communities in riparian and floodplain habitats of tropical regions worldwide. In Neotropical wetlands, many plant species have fleshy fruits and synchronize their fruiting with the flood season, when fruit-eating fish forage in forest and savannahs for periods of up to 7 months. We conducted a comprehensive analysis to examine the evolutionary origin of fish-fruit interactions, describe fruit traits associated with seed dispersal and seed predation, and assess the influence of fish size on the effectiveness of seed dispersal by fish (ichthyochory). To date, 62 studies have documented 566 species of fruits and seeds from 82 plant families in the diets of 69 Neotropical fish species. Fish interactions with flowering plants are likely to be as old as 70 million years in the Neotropics, pre-dating most modern bird-fruit and mammal-fruit interactions, and contributing to long-distance seed dispersal and possibly the radiation of early angiosperms. Ichthyochory occurs across the angiosperm phylogeny, and is more frequent among advanced eudicots. Numerous fish species are capable of dispersing small seeds, but only a limited number of species can disperse large seeds. The size of dispersed seeds and the probability of seed dispersal both increase with fish size. Large-bodied species are the most effective seed dispersal agents and remain the primary target of fishing activities in the Neotropics. Thus, conservation efforts should focus on these species to ensure continuity of plant recruitment dynamics and maintenance of plant diversity in riparian and floodplain ecosystems. © 2015 Cambridge Philosophical Society.

Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

PubMed

Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

2012-01-01

Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

Systematic Deletion of Homeobox Genes in Podospora anserina Uncovers Their Roles in Shaping the Fruiting Body

PubMed Central

Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

2012-01-01

Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures. PMID:22662159

HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

PubMed

Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

2014-01-01

The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

Effects of two energy-restricted diets containing different fruit amounts on body weight loss and macronutrient oxidation.

PubMed

Rodríguez, M Cristina; Parra, M Dolores; Marques-Lopes, Iva; De Morentin, Blanca E Martínez; González, Alvaro; Martínez, J Alfredo

2005-12-01

The consumption of specific foods in energy-restricted diets may affect the weight loss process. The purpose of this research was to evaluate whether obese women following two hypocaloric diets with distinct fruit content differ in weight loss and metabolic responses. Fifteen obese women were included, who were randomly assigned to follow a low or a high-fruit energy-restricted diet for 8 weeks. The main outcome variables were weight and fat losses. Metabolic measurements concerning macronutrient oxidation were also assessed by using (13)C labelled fructose and indirect calorimetry. The induced weight loss was similar for both diets (6.9 +/- 2% vs. 6.6 +/- 2%, p = 0.785). Both experimental diets similarly improved the lipid plasma profile in the participants, but the cholesterol fall was higher in obese subjects receiving the diet containing more fruit. No statistical differences in lipids carbohydrates and (13)C labelled fructose utilisation were observed, but protein oxidation was differently affected by the experimental diets. The compensatory effects of the associated fibre/fructose intake may explain the lack of a specific effect of the fruit amount on hypocaloric diets designed to weight loss, although the increased fibre content from enriched fruit diets may be involved in the favourable effects on cholesterol plasma levels.

Investigation of repressive and enhancive effects of fruit extracts on the activity of glucose-6-phophatase.

PubMed

Zahoor, Muhammad; Jan, Muhammad Rasul; Naz, Sumaira

2016-11-01

Glucose-6-phosphatase is a key enzyme of glucose metabolic pathways. Deficiency of this enzyme leads to glycogen storage disease. This enzyme also plays a negative role in diabetes mellitus disorder in which the catalytic activity of this enzyme increases. Thus there is need for activators to enhance the activity of glucose-6-phosphatase in glycogen storage disease of type 1b while in diabetes mellitus repressors are needed to reduce its activity. Crude extracts of apricot, fig, mulberry and apple fruits were investigated for their repressive/enhancive effects on glucose-6-phosphatase in vivo. Albino mice were used as experimental animal. All the selected extracts showed depressive effects on glucose-6-phosphatase, which shows that all these extracts can be used as antidiabetic supplement of food. The inhibitory pattern was competitive one, which was evident from the effect of increasing dose from 1g/Kg body weight to 3g/Kg body weight for all the selected fruit extracts. However fig and apple fruit extracts showed high repressive effects for high doses as compared to apricot and mulberry fruit extracts. None of these selected fruit extracts showed enhancive effect on glucose-6-phosphatase activity. All these fruits or their extracts can be used as antidiabetic dietary supplement for diabetes mellitus.

27 CFR 24.213 - Heavy bodied blending wine.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Heavy bodied blending wine..., DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.213 Heavy bodied blending wine. Heavy bodied blending wine is wine made for blending purposes from grapes or other fruit without...

The Effects of an Olive Fruit Polyphenol-Enriched Yogurt on Body Composition, Blood Redox Status, Physiological and Metabolic Parameters and Yogurt Microflora.

PubMed

Georgakouli, Kalliopi; Mpesios, Anastasios; Kouretas, Demetrios; Petrotos, Konstantinos; Mitsagga, Chrysanthi; Giavasis, Ioannis; Jamurtas, Athanasios Z

2016-06-03

In the present study we investigated the effects of an olive polyphenol-enriched yogurt on yogurt microflora, as well as hematological, physiological and metabolic parameters, blood redox status and body composition. In a randomized double-blind, crossover design, 16 (6 men, 10 women) nonsmoking volunteers with non-declared pathology consumed either 400 g of olive fruit polyphenol-enriched yogurt with 50 mg of encapsulated olive polyphenols (experimental condition-EC) or 400 g of plain yogurt (control condition-CC) every day for two weeks. Physiological measurements and blood collection were performed before and after two weeks of each condition. The results showed that body weight, body mass index, hip circumference and systolic blood pressure decreased significantly (p < 0.05) following the two-week consumption of yogurt regardless of condition. A tendency towards significance for decreased levels of low density lipoprotein (LDL) cholesterol (p = 0.06) and thiobarbituric acid reactive substances (p < 0.05) following two weeks of polyphenol-enriched yogurt consumption was observed. The population of lactic acid bacteria (LAB) and production of lactate in yogurt were significantly enhanced after addition of olive polyphenols, contrary to the population of yeasts and molds. The results indicate that consumption of the polyphenol-enriched yogurt may help individuals with non-declared pathology reduce body weight, blood pressure, LDL cholesterol levels and lipid peroxidation, and promote growth of beneficial LAB.

The Effects of an Olive Fruit Polyphenol-Enriched Yogurt on Body Composition, Blood Redox Status, Physiological and Metabolic Parameters and Yogurt Microflora

PubMed Central

Georgakouli, Kalliopi; Mpesios, Anastasios; Kouretas, Demetrios; Petrotos, Konstantinos; Mitsagga, Chrysanthi; Giavasis, Ioannis; Jamurtas, Athanasios Z.

2016-01-01

In the present study we investigated the effects of an olive polyphenol-enriched yogurt on yogurt microflora, as well as hematological, physiological and metabolic parameters, blood redox status and body composition. In a randomized double-blind, crossover design, 16 (6 men, 10 women) nonsmoking volunteers with non-declared pathology consumed either 400 g of olive fruit polyphenol-enriched yogurt with 50 mg of encapsulated olive polyphenols (experimental condition—EC) or 400 g of plain yogurt (control condition—CC) every day for two weeks. Physiological measurements and blood collection were performed before and after two weeks of each condition. The results showed that body weight, body mass index, hip circumference and systolic blood pressure decreased significantly (p < 0.05) following the two-week consumption of yogurt regardless of condition. A tendency towards significance for decreased levels of low density lipoprotein (LDL) cholesterol (p = 0.06) and thiobarbituric acid reactive substances (p < 0.05) following two weeks of polyphenol-enriched yogurt consumption was observed. The population of lactic acid bacteria (LAB) and production of lactate in yogurt were significantly enhanced after addition of olive polyphenols, contrary to the population of yeasts and molds. The results indicate that consumption of the polyphenol-enriched yogurt may help individuals with non-declared pathology reduce body weight, blood pressure, LDL cholesterol levels and lipid peroxidation, and promote growth of beneficial LAB. PMID:27271664

Avocado fruit (Persea americana Mill) exhibits chemo-protective potentiality against cyclophosphamide induced genotoxicity in human lymphocyte culture.

PubMed

Paul, Rajkumar; Kulkarni, Paresh; Ganesh, Narayan

2011-01-01

Diets rich in fruits and vegetables have been associated with reduced risks for many types of cancers. Avocado (Persea americana Mill.) is a widely consumed fruit containing many cancer preventing nutrients, vitamins and phytochemicals. Studies have shown that phytochemicals extracted from the avocado fruit selectively induce cell cycle arrest, inhibit growth, and induce apoptosis in precancerous and cancer cell lines. Our recent studies indicate that phytochemicals extracted with 50% Methanol from avocado fruits help in proliferation of human lymphocyte cells and decrease chromosomal aberrations induced by cyclophosphamide. Among three concentrations (100 mg, 150 mg and 200 mg per Kg Body Weight), the most effective conc. of extract was 200 mg/Kg Body Wt. It decreased significant level of numerical and structural aberrations (breaks, premature centromeric division etc. up to 88%, p < 0.0001)), and accrocentric associtation within D & G group (up to 78%, p = 0.0008). These studies suggest that phytochemicals from the avocado fruit can be utilized for making active chemoprotective ingredient for lowering the side effect of chemotherapy like cyclophosphamide in cancer therapy.

Turning behaviour depends on frictional damping in the fruit fly Drosophila.

PubMed

Hesselberg, Thomas; Lehmann, Fritz-Olaf

2007-12-01

Turning behaviour in the fruit fly Drosophila depends on several factors including not only feedback from sensory organs and muscular control of wing motion, but also the mass moments of inertia and the frictional damping coefficient of the rotating body. In the present study we evaluate the significance of body friction for yaw turning and thus the limits of visually mediated flight control in Drosophila, by scoring tethered flies flying in a flight simulator on their ability to visually compensate a bias on a moving object and a visual background panorama at different simulated frictional dampings. We estimated the fly's natural damping coefficient from a numerical aerodynamic model based on both friction on the body and the flapping wings during saccadic turning. The model predicts a coefficient of 54 x 10(-12) Nm s, which is more than 100-times larger than the value estimated from a previous study on the body alone. Our estimate suggests that friction plays a larger role for yaw turning in Drosophila than moments of inertia. The simulator experiments showed that visual performance of the fruit fly collapses near the physical conditions estimated for freely flying animals, which is consistent with the suggested role of the halteres for flight stabilization. However, kinematic analyses indicate that the measured loss of flight control might be due predominantly to the limited fine control in the fly's steering muscles below a threshold of 1-2 degrees stroke amplitude, rather than resulting from the limits of visual motion detection by the fly's compound eyes. We discuss the impact of these results and suggest that the elevated frictional coefficient permits freely flying fruit flies to passively terminate rotational body movements without producing counter-torque during the second half of the saccadic turning manoeuvre.

A possible dose-response association between distance to farmers' markets and roadside produce stands, frequency of shopping, fruit and vegetable consumption, and body mass index among customers in the Southern United States.

PubMed

Jilcott Pitts, Stephanie B; Hinkley, Jedediah; Wu, Qiang; McGuirt, Jared T; Lyonnais, Mary Jane; Rafferty, Ann P; Whitt, Olivia R; Winterbauer, Nancy; Phillips, Lisa

2017-01-11

The association between farmers' market characteristics and consumer shopping habits remains unclear. Our objective was to examine associations among distance to farmers' markets, amenities within farmers' markets, frequency of farmers' market shopping, fruit and vegetable consumption, and body mass index (BMI). We hypothesized that the relationship between frequency of farmers' market shopping and BMI would be mediated by fruit and vegetable consumption. In 15 farmers' markets in northeastern North Carolina, July-September 2015, we conducted a cross-sectional survey among 263 farmers' market customers (199 provided complete address data) and conducted farmers' market audits. To participate, customers had to be over 18 years of age, and English speaking. Dependent variables included farmers' market shopping frequency, fruit and vegetable consumption, and BMI. Analysis of variance, adjusted multinomial logistic regression, Poisson regression, and linear regression models, adjusted for age, race, sex, and education, were used to examine associations between distance to farmers' markets, amenities within farmers' markets, frequency of farmers' market shopping, fruit and vegetable consumption, and BMI. Those who reported shopping at farmers' markets a few times per year or less reported consuming 4.4 (standard deviation = 1.7) daily servings of fruits and vegetables, and those who reported shopping 2 or more times per week reported consuming 5.5 (2.2) daily servings. There was no association between farmers' market amenities, and shopping frequency or fruit and vegetable consumption. Those who shopped 2 or more times per week had a statistically significantly lower BMI than those who shopped less frequently. There was no evidence of mediation of the relationship between frequency of shopping and BMI by fruit and vegetable consumption. More work should be done to understand factors within farmers' markets that encourage fruit and vegetable purchases.

Chemical composition and nutritional and medicinal value of fruit bodies and submerged cultured mycelia of culinary-medicinal higher Basidiomycetes mushrooms.

PubMed

Cohen, Nachshol; Cohen, Jacob; Asatiani, Mikheil D; Varshney, Vinay K; Yu, Hui-Tzu; Yang, Yi-Chi; Li, Yu-Hsuan; Mau, Jeng-Leun; Wasser, Solomon P

2014-01-01

This research gives the results of a proximate analysis (moisture, ash, crude protein, fat, total carbohydrates, and total energy); a bioactive compounds analysis (γ-aminobutyric acid [GABA], ergothioneine, lovastatin, and cordycepin); fatty acid and amino acid analysis; and an analysis of macro- and microelement content of fruit bodies and mycelia of 15 higher Basidiomycetes medicinal mushroom strains belonging to 12 species. The results obtained demonstrate that almost all investigated mushrooms were found to be good sources of proteins and carbohydrates, with content varying in the ranges of 8.6-42.5% and 42.9-83.6%, respectively. Different species exhibited distinct free amino acid profiles. The total amino acid content was highest in Ophiocordyceps sinensis (MB) (23.84 mg/g) and Cordyceps militaris (FB) (23.69 mg/g). The quantification of the identified fatty acids indicated that, in general, palmitic acid, oleic acid, stearic acid, and linoleic acid were the major fatty acids. The micro- and macroelement compositions were studied, and the highest results were (as milligrams per kilogram) 224-7307 for calcium, 1668-38564 for potassium, 1091-11676 for phosphorus, and 5-97 for zinc. Bioactive components were lovastatin, GABA, and ergothioneine, which are commonly found in most mushrooms. C. militaris (FB), Pleurotus ostreatus (FB), and Coprinus comatus (FB) were most abundant and contained a high amount of GABA (756.30 μg/g, 1304.99 μg/g, 1092.45 μg/g, respectively) and ergothioneine (409.88 μg/g, 2443.53 μg/g, 764.35 μg/g, respectively). The highest lovastatin content was observed in Hericium erinaceus (FB) (14.38 μg/g) and Ganoderma lucidum (FB) (11.54 μg/g). In contrast to C. militaris (FB), cordycepin was not detected in O. sinensis (MB). The fruit body biomass of C. militaris cordycepin content reached 1.743 mg/g dry weight. The nutritional values of the mushroom species studied here could potentially be used in well-balanced diets and as sources

A genetic screen in Myxococcus xanthus identifies mutants that uncouple outer membrane exchange from a downstream cellular response.

PubMed

Dey, Arup; Wall, Daniel

2014-12-01

Upon physical contact with sibling cells, myxobacteria transiently fuse their outer membranes (OMs) and exchange OM proteins and lipids. From previous work, TraA and TraB were identified to be essential factors for OM exchange (OME) in donor and recipient cells. To define the genetic complexity of OME, we carried out a comprehensive forward genetic screen. The screen was based on the observation that Myxococcus xanthus nonmotile cells, by a Tra-dependent mechanism, block swarm expansion of motile cells when mixed. Thus, mutants defective in OME or a downstream responsive pathway were readily identified as escape flares from mixed inocula seeded on agar. This screen was surprisingly powerful, as we found >50 mutants defective in OME. Importantly, all of the mutations mapped to the traAB operon, suggesting that there may be few, if any, proteins besides TraA and TraB directly required for OME. We also found a second and phenotypically different class of mutants that exhibited wild-type OME but were defective in a responsive pathway. This pathway is postulated to control inner membrane homeostasis by covalently attaching amino acids to phospholipids. The identified proteins are homologous to the Staphylococcus aureus MprF protein, which is involved in membrane adaptation and antibiotic resistance. Interestingly, we also found that a small number of nonmotile cells were sufficient to block the swarming behavior of a large gliding-proficient population. This result suggests that an OME-derived signal could be amplified from a few nonmotile producers to act on many responder cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

USDA-ARS?s Scientific Manuscript database

Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

The groEL2 gene, but not groEL1, is required for biosynthesis of the secondary metabolite myxovirescin in Myxococcus xanthus DK1622.

PubMed

Wang, Yan; Li, Xi; Zhang, Wenyan; Zhou, Xiuwen; Li, Yue-zhong

2014-03-01

Myxococcus xanthus DK1622 possesses two copies of the groEL gene: groEL1, which participates in development, and groEL2, which is involved in the predatory ability of cells. In this study, we determined that the groEL2 gene is required for the biosynthesis of the secondary metabolite myxovirescin (TA), which plays essential roles in predation. The groEL2-knockout mutant strain was defective in producing a zone of inhibition and displayed decreased killing ability against Escherichia coli, while the groEL1-knockout mutant strain exhibited little difference from the wild-type strain DK1622. HPLC revealed that deletion of the groEL2 gene blocked the production of TA, which was present in the groEL1-knockout mutant. The addition of exogenous TA rescued the inhibition and killing abilities of the groEL2-knockout mutant against E. coli. Analysis of GroEL domain-swapping mutants indicated that the C-terminal equatorial domain of GroEL2 was essential for TA production, while the N-terminal equatorial or apical domains of GroEL2 were not sufficient to rescue TA production of the groEL2 knockout.

A novel fungal fruiting structure formed by Aspergillus niger and Aspergillus carbonarius in grape berries.

PubMed

Pisani, Cristina; Nguyen, Trang Thoaivan; Gubler, Walter Douglas

2015-09-01

Sour rot, is a pre-harvest disease that affects many grape varieties. Sour rot symptoms include initial berry cracking and breakdown of berry tissue. This is a disease complex with many filamentous fungi and bacteria involved, but is usually initiated by Aspergillus niger or Aspergillus carbonarius. Usually, by the time one sees the rot there are many other organisms involved and it is difficult to attribute the disease to one species. In this study two species of Aspergillus were shown to produce a previously unknown fruiting structure in infected berries. The nodulous morphology, bearing conidia, suggests them to be an 'everted polymorphic stroma'. This structure forms freely inside the berry pulp and assumes multiple shapes and sizes, sometimes sclerotium-like in form. It is composed of a mass of vegetative hyphae with or without tissue of the host containing spores or fruiting bodies bearing spores. Artificially inoculated berries placed in soil in winter showed the possible overwintering function of the fruiting body. Inoculated berry clusters on standing vines produced fruiting structures within 21 d post inoculation when wounds were made at veraison or after (July-September). Histological studies confirmed that the fruiting structure was indeed fungal tissue. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

The sweet side of life: nectar sugar type and concentration preference in Wahlberg's epauletted fruit bat.

PubMed

Coleman, J C; Downs, C T

2012-08-01

Whether nectarivores or frugivores place selective pressure on the plants they feed on, in terms of nectar or fruit traits, is much debated. Globally sugar preferences, concentration preference and digestive ability of avian nectarivores have been extensively researched. In contrast, relatively little is known about mammalian nectarivores or frugivores in terms of these, particularly Old World species. Consequently effect of sugar type and concentration on food preference in Wahlberg's epauletted fruit bat Epomophorus wahlbergi was investigated. Pair-wise choice tests were conducted using equicaloric hexose and sucrose solutions at five different concentrations (5%-25%). It was expected that they would prefer hexose sugars as these are dominant in available indigenous fruits. However, bats preferred hexoses only when offered dilute (5%) concentrations. From 10% to 25% they showed a decrease in volume intake. Their body mass was generally higher and similar after feeding during the night with the exception of 5% concentration where the mean body mass decreased. When E. wahlbergi were offered a range of sucrose or hexose solutions (10%-25%) respectively, they showed no concentration preference in terms of total volume consumed, nor energy intake. These findings suggest that these fruit bats do not appear to act as a selective pressure on sugar composition in Old World fruit. In fruit bats with high energy requirements, dietary flexibility may be an advantage when faced with seasonal and unpredictable fruit availability. Copyright © 2012 Elsevier Inc. All rights reserved.

An Attempt of Nondestructive Imaging of Sugar Distribution inside a Fruit Using Microwaves

NASA Astrophysics Data System (ADS)

Watanabe, Masakazu; Miyakawa, Michio

Chirp Pulse Microwave Computed Tomography (CP-MCT) that was originally developed for noninvasive imaging of a human body was applied to visualize sugar distribution inside a fruit. It can visualize not only permittivity distribution itself of a fruit but also various physical- or chemical-quantities relating to the permittivity value. Almost all fruits are dielectric materials containing much water, sugar, acids and so on. But for water, the principal ingredient of a fruit is sugar. Most of the fruits contain sugar from 8% to 22% by weight at the harvest time. Therefore sugar content distribution should be measured by CP-MCT nondestructively. By using apples and Japanese pears, feasibility of sugar distribution imaging has been evaluated by comparing the gray level of CP-MCT and sugar content of the cross section. The averaged correlation coefficients of the apple and pear are 0.793 and 0.681.

Fruit as Potent Natural Antioxidants and Their Biological Effects.

PubMed

Gomes-Rochette, Neuza F; Da Silveira Vasconcelos, Mirele; Nabavi, Seyed M; Mota, Erika F; Nunes-Pinheiro, Diana C S; Daglia, Maria; De Melo, Dirce F

The consumption of fruit has increased in the last 20 years, along with the growing recognition of its nutritional and protective values. Many of the benefits of a diet rich in fruit are attributed to the presence of different bioactive substances, such as vitamins, carotenoids and phenolic compounds. Flavanoids, a class of phenolic compounds, present particular antioxidant activity and thus provide protection against cellular damage caused by reactive oxygen species. Research suggests that an increased intake of plant foods is associated with a reduced incidence of chronic disease. There is currently a great deal of interest in the study of antioxidants, in particular due to the discovery of the damaging effects of free radicals to the body. Thus, this review aims to address the beneficial effects of the antioxidants present in fruits, on the neutralization of reactive species and the reduction of any damage they may cause.

Comparison of the nutrient content of fresh fruit juices vs commercial fruit juices.

PubMed

Densupsoontorn, Narumon; Jirapinyo, Pipop; Thamonsiri, Nuchnoi; Wongarn, Renu; Phosuya, Panarat; Tritiprat, Amornrat; Patraarat, Siriphan; Pidatcha, Pannee; Suwannthol, Lerson

2002-08-01

To compare the types and quantities of carbohydrate, electrolytes, pH and osmolarity of fresh fruit juices and commercial fruit juices. Forty kinds of fresh fruits available in Thai markets were analyzed for types and quantities of carbohydrate, electrolyte, pH and osmolarity and compared with previously obtained data for commercial fruit juices. Most fresh fruit juices did not contain sucrose, whereas, commercial fruit juices mostly have sucrose in the range of 3-112 g/L. Although both fruit juices were acidic (pH varied from 3.6-6.7 and 3.2-5.8 of fresh juice and commercial juice), fresh fruit juices had a more neutral pH than commercial fruit juices. Apple, guava, orange, pear, and pineapple juices from commercial fruit juices had a high osmolarity compared with fresh fruit juices. All types of fresh fruit juices contained less sodium than commercial ones, whereas, most fresh fruit juices contained more potassium, phosphorus, and magnesium than commercial fluids. The nutrient content of fresh fruit juices and commercial fruit juices from the same kinds of fruits are not the same, possibly due to the manufacturing process. Therefore, physicians should know the composition of fruit juices in order to advise patients properly.

Structure characteristics of a water-soluble polysaccharide purified from dragon fruit (Hylocereus undatus) pulp.

PubMed

Xu, Lishan; Zhang, Yaojie; Wang, Lizhi

2016-08-01

Dragon fruit is a tropical fruit with good taste. It can bring health benefits to human body. As one of the major bioactive components in this fruit, the polysaccharides might contribute to the health benefits. However, the precise structure information remains unknown. A leading polysaccharide of dragon fruit pulp, DFPP, was purified and identified by NMR and GC-MS. →4-β-d-GlcpA-1→, →6-β-d-Galp-1→ and →4-α-l-Rhap-1→ constituted the backbone and α-l-Araf-1→5-α-l-Araf-1→ formed the branch chain. The precise structure was putatively identified as below. The molecular weight was 2.2×10(3)kDa. The structure information of polysaccharides will be helpful to understand this fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

In depth analysis of the mechanism of action of metal-dependent sigma factors: characterization of CorE2 from Myxococcus xanthus

PubMed Central

Marcos-Torres, Francisco Javier; Pérez, Juana; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2016-01-01

Extracytoplasmic function sigma factors represent the third pillar of signal-transduction mechanisms in bacteria. The variety of stimuli they recognize and mechanisms of action they use have allowed their classification into more than 50 groups. We have characterized CorE2 from Myxococcus xanthus, which belongs to group ECF44 and upregulates the expression of two genes when it is activated by cadmium and zinc. Sigma factors of this group contain a Cys-rich domain (CRD) at the C terminus which is essential for detecting metals. Point mutations at the six Cys residues of the CRD have revealed the contribution of each residue to CorE2 activity. Some of them are essential, while others are either dispensable or their mutations only slightly affect the activity of the protein. However, importantly, mutation of Cys174 completely shifts the specificity of CorE2 from cadmium to copper, indicating that the Cys arrangement of the CRD determines the metal specificity. Moreover, the conserved CxC motif located between the σ2 domain and the σ4.2 region has also been found to be essential for activity. The results presented here contribute to our understanding of the mechanism of action of metal-dependent sigma factors and help to define new common features of the members of this group of regulators. PMID:26951374

Focus on Fruits: 10 Tips to Eat More Fruits

MedlinePlus

... lunch, pack a tangerine, banana, or grapes to eat or choose fruits from a salad bar. Individual containers of fruits like peaches or applesauce are easy to carry and convenient for lunch. 7 Enjoy fruit at dinner, too At dinner, add crushed pineapple to coleslaw ...

Edible coatings influence fruit ripening, quality, and aroma biosynthesis in mango fruit.

PubMed

Dang, Khuyen T H; Singh, Zora; Swinny, Ewald E

2008-02-27

The effects of different edible coatings on mango fruit ripening and ripe fruit quality parameters including color, firmness, soluble solids concentrations, total acidity, ascorbic acid, total carotenoids, fatty acids, and aroma volatiles were investigated. Hard mature green mango (Mangifera indica L. cv. Kensigton Pride) fruits were coated with aqueous mango carnauba (1:1 v/v), Semperfresh (0.6%), Aloe vera gel (1:1, v/v), or A. vera gel (100%). Untreated fruit served as the control. Following the coating, fruits were allowed to dry at room temperature and packed in soft-board trays to ripen at 21+/-1 degrees C and 55.2+/-11.1% relative humidity until the eating soft stage. Mango carnauba was effective in retarding fruit ripening, retaining fruit firmness, and improving fruit quality attributes including levels of fatty acids and aroma volatiles. Semperfresh and A. vera gel (1:1 or 100%) slightly delayed fruit ripening but reduced fruit aroma volatile development. A. vera gel coating did not exceed the commercial mango carnauba and Semperfresh in retarding fruit ripening and improving aroma volatile biosynthesis.

Antisense inhibition of tomato fruit sucrose synthase decreases fruit setting and the sucrose unloading capacity of young fruit.

PubMed Central

D'Aoust, M A; Yelle, S; Nguyen-Quoc, B

1999-01-01

The role of sucrose synthase (SuSy) in tomato fruit was studied in transgenic tomato (Lycopersicon esculentum) plants expressing an antisense fragment of fruit-specific SuSy RNA (TOMSSF) under the control of the cauliflower mosaic virus 35S promoter. Constitutive expression of the antisense RNA markedly inhibited SuSy activity in flowers and fruit pericarp tissues. However, inhibition was only slight in the endosperm and was undetectable in the embryo, shoot, petiole, and leaf tissues. The activity of sucrose phosphate synthase decreased in parallel with that of SuSy, but acid invertase activity did not increase in response to the reduced SuSy activity. The only effect on the carbohydrate content of young fruit was a slight reduction in starch accumulation. The in vitro sucrose import capacity of fruits was not reduced by SuSy inhibition at 23 days after anthesis, and the rate of starch synthesized from the imported sucrose was not lessened even when SuSy activity was decreased by 98%. However, the sucrose unloading capacity of 7-day-old fruit was substantially decreased in lines with low SuSy activity. In addition, the SuSy antisense fruit from the first week of flowering had a slower growth rate. A reduced fruit set, leading to markedly less fruit per plant at maturity, was observed for the plants with the least SuSy activity. These results suggest that SuSy participates in the control of sucrose import capacity of young tomato fruit, which is a determinant for fruit set and development. PMID:10590167

bZIP transcription factor SmJLB1 regulates autophagy-related genes Smatg8 and Smatg4 and is required for fruiting-body development and vegetative growth in Sordaria macrospora.

PubMed

Voigt, Oliver; Herzog, Britta; Jakobshagen, Antonia; Pöggeler, Stefanie

2013-12-01

Autophagy is a precisely controlled degradation process in eukaryotic cells, during which the bulk of the cytoplasm is engulfed by a double membrane vesicle, the autophagosome. Fusion of the autophagosome with the vacuole leads to breakdown of its contents, such as proteins and organelles, and the recycling of nutrients. Earlier studies of autophagic genes of the core autophagic machinery in the filamentous ascomycete Sordaria macrospora elucidated the impact of autophagy on fungal viability, vegetative growth and fruiting-body development. To gain further knowledge about the regulation of autophagy in S. macrospora, we analyzed the function of the bZIP transcription factor SmJLB1, a homolog of the Podospora anserina basic zipper-type transcription factor induced during incompatibility 4 (IDI-4) and the Aspergillus nidulans transcription factor jun-like bZIP A (JlbA). Generation of the homokaryotic deletion mutant demonstrated S. macrospora Smjlb1 is associated with autophagy-dependent processes. Deletion of Smjlb1 abolished fruiting-body formation and impaired vegetative growth. SmJLB1 is localized to the cytoplasm and to nuclei. Quantitative real-time PCR experiments revealed an upregulated expression of autophagy-related genes Smatg8 and Smatg4 in the Smjlb1 deletion mutant, suggesting a transcriptional repression function of SmJLB1. Copyright © 2013 Elsevier Inc. All rights reserved.

Relationship between body satisfaction with self esteemand unhealthy body weight management.

PubMed

Daniali, Shahrbanoo; Azadbakht, Leila; Mostafavi, Firoozeh

2013-01-01

< 0.004), consumption of fruit (r = 0.13, P < 0.008) all correlated with self-esteem significantly. Women with higher self esteem used higher fruits had a good nutrition overall (r = 0.11, P = 0.02). 92.15%, 10.8% of women respectively participated in one of healthy and unhealthy weight control behavior. There was not any Relationship between self esteem and healthy weight control behavior while finding showed reverse relationship between self esteem and Unhealthy Dieting Behaviors. It seemed women identity in our society tied to social appreciations that formed and supported by body satisfaction. When they feel their current appearance is differ from ideal appearance, they feel down and have lower self esteem and used unhealthy dieting behavior and low fruits daily. Due to importance of precise self evaluation, self esteem can be used to design and conduct public health programs, especially for women.

Impact of 100% Fruit Juice Consumption on Diet and Weight Status of Children: An Evidence-based Review.

PubMed

Crowe-White, Kristi; O'Neil, Carol E; Parrott, J Scott; Benson-Davies, Sue; Droke, Elizabeth; Gutschall, Melissa; Stote, Kim S; Wolfram, Taylor; Ziegler, Paula

2016-01-01

Consumption of 100% fruit juice remains controversial for its potential adverse impact on weight and displacement of essential foods in the diets of children. A systematic review of the literature published from 1995-2013 was conducted using the PubMed database to evaluate associations between intake of 100% fruit juice and weight/adiposity and nutrient intake/adequacy among children of 1 to 18 years of age. Weight status outcome measures included body mass index (BMI), BMI z-score, ponderal index, obesity, weight gain, adiposity measures, and body composition. Nutrient outcome measures included intake and adequacy of shortfall nutrients. Data extraction and analysis was conducted according to the Academy of Nutrition and Dietetics Evidence Analysis Process. Twenty-two studies on weight status provided evidence that did not support an association between 100% fruit juice consumption and weight/adiposity in children after controlling for energy intake. Limited evidence from eight studies suggests that children consuming 100% fruit juice have higher intake and adequacy of dietary fiber, vitamin C, magnesium, and potassium. Differences in methodology and study designs preclude causal determination of 100% fruit juice as sole influencer of weight status or nutrient intake/adequacy of shortfall nutrients. In context of a healthy dietary pattern, evidence suggests that consumption of 100% fruit juice may provide beneficial nutrients without contributing to pediatric obesity.

[Spectral navigation technology and its application in positioning the fruits of fruit trees].

PubMed

Yu, Xiao-Lei; Zhao, Zhi-Min

2010-03-01

An innovative technology of spectral navigation is presented in the present paper. This new method adopts reflectance spectra of fruits, leaves and branches as one of the key navigation parameters and positions the fruits of fruit trees relying on the diversity of spectral characteristics. The research results show that the distinct smoothness as effect is available in the spectrum of leaves of fruit trees. On the other hand, gradual increasing as the trend is an important feature in the spectrum of branches of fruit trees while the spectrum of fruit fluctuates. In addition, the peak diversity of reflectance rate between fruits and leaves of fruit trees is reached at 850 nm of wavelength. So the limit value can be designed at this wavelength in order to distinguish fruits and leaves. The method introduced here can not only quickly distinguish fruits, leaves and branches, but also avoid the effects of surroundings. Compared with the traditional navigation systems based on machine vision, there are still some special and unique features in the field of positioning the fruits of fruit trees using spectral navigation technology.

Competition for Assimilates and Fruit Position Affect Fruit Set in Indeterminate Greenhouse Tomato

PubMed Central

Bertin, N.

1995-01-01

Localization and characterization of fruit set in winter tomato crops was investigated to determine the main internal and external controlling factors and to establish a quantitative relationship between fruit set and competition for assimilates. Individual fruit growth and development was assessed on a beef tomato cultivar during the reproductive period (first nine inflorescences). A non-destructive photograph technique was used to measure fruit growth from very early stages of their development and then calliper measurements were made on big fruits. From these measurements we determined the precise developmental stage at which fruit growth stopped. Fruit potential growth, which is defined as the growth achieved in non-limiting conditions for assimilate supply, was also assessed by this method on plants thinned to one flower per inflorescence. The latter was used to calculate the ratio between actual and potential growth, which was found to be a good index of the competition for assimilates. Time lags of fruit set were observed mainly on distal organs. When more than three flowers were left on each inflorescence, distal organs developed at the same time as proximal organs of the following inflorescence. Consequently they were submitted to a double competition within one inflorescence and among inflorescences. It was shown that, what is commonly named ‘fruit set failure’, is not an irreversible death of the organ and that a small fruit could resume growth after a delay of several weeks as soon as the first fruits ripened and thus ceased to compete for assimilates. In that case proximal fruits resumed growth before distal ones. The delayed fruits contained only few seeds but a germination test confirmed that fertilization took place before fruit set failed. Competition for assimilates was calculated during plant development by the ratio between actual and potential fruit growth. Potential growth of proximal fruits was strongly dependent on the position of the

DifA, a methyl-accepting chemoreceptor protein-like sensory protein, uses a novel signaling mechanism to regulate exopolysaccharide production in Myxococcus xanthus.

PubMed

Xu, Qian; Black, Wesley P; Nascimi, Heidi M; Yang, Zhaomin

2011-02-01

DifA is a methyl-accepting chemotaxis protein (MCP)-like sensory transducer that regulates exopolysaccharide (EPS) production in Myxococcus xanthus. Here mutational analysis and molecular biology were used to probe the signaling mechanisms of DifA in EPS regulation. We first identified the start codon of DifA experimentally; this identification extended the N terminus of DifA for 45 amino acids (aa) from the previous bioinformatics prediction. This extension helped to address the outstanding question of how DifA receives input signals from type 4 pili without a prominent periplasmic domain. The results suggest that DifA uses its N-terminus extension to sense an upstream signal in EPS regulation. We suggest that the perception of the input signal by DifA is mediated by protein-protein interactions with upstream components. Subsequent signal transmission likely involves transmembrane signaling instead of direct intramolecular interactions between the input and the output modules in the cytoplasm. The basic functional unit of DifA for signal transduction is likely dimeric as mutational alteration of the predicted dimeric interface of DifA significantly affected EPS production. Deletions of 14-aa segments in the C terminus suggest that the newly defined flexible bundle subdomain in MCPs is likely critical for DifA function because shortening of this bundle can lead to constitutively active mutations.

Social support is a primary influence on home fruit, 100% juice, and vegetable availability.

PubMed

Baranowski, Tom; Watson, Kathy; Missaghian, Mariam; Broadfoot, Alison; Cullen, Karen; Nicklas, Theresa; Fisher, Jennifer; Baranowski, Janice; O'Donnell, Sharon

2008-07-01

Children tend to eat more fruit and vegetables when more are available in the home. We proposed and tested a model that predicts the availability at home (hereinafter termed "home availability") of fruit, 100% juice, and vegetables, using new measures of frequency of food shopping, purchase, and comparative purchase outcome expectancies (ie, the perceived benefits and costs of purchasing fruit and vegetables), home food pantry management practices, family social support for purchasing fruit and vegetables, food shopping practices, and body mass index (BMI). Participants (N=98) were recruited in 2004 in front of grocery stores and completed two telephone interviews. Cross-sectional hierarchical regression was employed with backward deletion of nonsignificant variables. Despite many statistically significant bivariate correlations between the new variables and home fruit, 100% juice, and vegetable availability, social support was the primary predictor of home fruit availability in multivariate regression. BMI and home 100% juice pantry management were the primary predictors of home 100% juice availability. Social support, BMI, and shopping practices were the primary predictors of home vegetable availability. Social support for purchasing fruit, 100% juice, and vegetables was an important, consistent predictor of home availability. These findings need to be replicated in larger samples.

Aquatic gilled mushrooms: Psathyrella fruiting in the Rogue River in southern Oregon.

PubMed

Frank, Jonathan L; Coffan, Robert A; Southworth, Darlene

2010-01-01

A species of Psathyrella (Basidiomycota) with true gills has been observed fruiting underwater in the clear, cold, flowing waters of the upper Rogue River in Oregon. Fruiting bodies develop and mature in the main channel, where they are constantly submerged, and were observed fruiting over 11 wk. These mushrooms develop underwater, not on wood recently washed into the river. Substrates include water-logged wood, gravel and the silty riverbed. DNA sequences of the ITS region and a portion of the ribosomal large subunit gene place this fungus in Psathyrella sensu stricto near P. atomata, P. fontinalis and P. superiorensis. Morphological characters distinguish the underwater mushroom from previously described species. Fruiting bodies have long fibrillose stipes with small diameter caps. Immature stages have a thin veil that is soon lost. Gills lack reddish edges. Cystidia are ventricose with subacute apices. Spores were observed as wedge-shape rafts released into gas pockets below the caps. Underwater gills and ballistospores indicate a recent adaptation to the stream environment. This particular river habitat combines the characteristics of spring-fed flows and cold, aerated water with woody debris in shallow depths on a fine volcanic substrate. Based on molecular and morphological evidence we conclude that the underwater mushrooms are a new species, Psathyrella aquatica. This report adds to the biodiversity of stream fungi that degrade woody substrates. The underwater environment is a new habitat for gilled mushrooms.

Structure characterization of a novel polysaccharide from Hericium erinaceus fruiting bodies and its immunomodulatory activities.

PubMed

Wu, Fangfang; Zhou, Chunhui; Zhou, Dandan; Ou, Shiyi; Zhang, Xiaoai; Huang, Huihua

2018-01-24

A novel polysaccharide fraction (HEP-S) was extracted and isolated from the fruiting bodies of Hericium erinaceus. Structural characterization revealed that HEP-S had an average molecular weight of 1.83 × 10 4 Da and consisted of rhamnose, fucose, mannose, glucose and galactose at a molar ratio of 1.47 : 0.93 : 1.36 : 8.68 : 4.08. Periodate oxidation-Smith degradation and NMR analysis showed that the main linkage types of HEP-S were composed of (1→)-α-d-Glc, (1→3,4)-α-d-Glc, (1→6)-α-d-Gal, (1→3,4)-β-d-Man, (1→3,6)-α-Rha and (1→2)-β-l-Fuc. The immunomodulatory assay indicated that HEP-S could significantly enhance the pinocytic and phagocytic capacity and promote the secretion of nitric oxide and pro-inflammatory cytokines by activating the corresponding mRNA and protein expression in RAW 264.7 cells involving a toll-like receptor 2 membrane receptor. Besides, HEP-S was also found to improve the adaptive immune function by enhancing T and B lymphocyte proliferation and increasing the interleukin-2, interleukin-4 and interferon-γ secretion in spleen lymphocytes. These results suggested that HEP-S could be used as a potential immunoregulatory agent in functional foods.

Bird fruit preferences match the frequency of fruit colours in tropical Asia

PubMed Central

Duan, Qiong; Goodale, Eben; Quan, Rui-chang

2014-01-01

While many factors explain the colour of fleshy fruits, it is thought that black and red fruits are common in part because frugivorous birds prefer these colours. We examined this still controversial hypothesis at a tropical Asian field site, using artificial fruits, fresh fruits, four wild-caught resident frugivorous bird species, and hand-raised naïve birds from three of the same species. We demonstrate that all birds favored red artificial fruits more than yellow, blue, black and green, although the artificial black colour was found subsequently to be similar to the artificial blue colour in its spectral reflectance. Wild-caught birds preferred both black and red fleshy natural fruits, whereas hand-raised naïve birds preferred black to red natural fleshy fruits and to those of other colours. All birds avoided artificial and naturally ripe green fruits. The inter-individual variation in colour choice was low and the preferences were constant over time, supporting the hypothesis that bird colour preferences are a contributing factor driving fruit colour evolution in tropical Asia. PMID:25033283

Comparison of fruit and vegetable intakes during weight loss in males and females.

PubMed

Williams, R L; Wood, L G; Collins, C E; Callister, R

2016-01-01

Globally, fruit and vegetable intakes are well below recommendations despite ample evidence to link insufficient intake with increased risk of overweight and obesity. Intakes of fruits and vegetables in the general population differ between males and females, and although there is growing evidence of intakes in men and women during weight loss, evidence that directly compares intakes in men and women during weight loss is lacking. This study aimed to identify any differences between males and females in fruit and vegetable intakes and plasma carotenoid concentrations during weight loss, and determine whether there is a relationship between any changes in fruit and vegetable intakes and weight change in both males and females. Men and women (n=100; body mass index 25-40 kg/m(2)) aged 18-60 years were selected for the study. Dietary intake of fruits and vegetables was assessed using the Australian Eating Survey and fasting blood was collected to assess plasma carotenoids, which were determined by high-performance liquid chromatography. There was little change in fruit or vegetable intakes during weight loss, although men tended to increase fruit intakes. Changes in intakes were influenced by baseline intakes, with males and females with the highest intakes at baseline reducing intakes. Males had better correlations between fruit and vegetable intakes and plasma carotenoid concentrations than females, and fruit and vegetable intakes during weight loss appear to predict weight loss for males but not females. Fruit and vegetable intake during weight loss does not appear to differ largely between males and females.

Profiling the outer membrane proteome during growth and development of the social bacterium Myxococcus xanthus by selective biotinylation and analyses of outer membrane vesicles.

PubMed

Kahnt, Jörg; Aguiluz, Kryssia; Koch, Jürgen; Treuner-Lange, Anke; Konovalova, Anna; Huntley, Stuart; Hoppert, Michael; Søgaard-Andersen, Lotte; Hedderich, Reiner

2010-10-01

Social behavior in the bacterium Myxococcus xanthus relies on contact-dependent activities involving cell-cell and cell-substratum interactions. To identify outer membrane proteins that have a role in these activities, we profiled the outer membrane proteome of growing and starving cells using two strategies. First, outer membrane proteins were enriched by biotinylation of intact cells using the reagent NHS (N-hydroxysuccinimide)-PEO(12) (polyethylene oxide)-biotin with subsequent membrane solubilization and affinity chromatography. Second, the proteome of outer membrane vesicles (OMV) was determined. Comparisons of detected proteins show that these methods have different detection profiles and together provide a comprehensive view of the outer membrane proteome. From 362 proteins identified, 274 (76%) were cell envelope proteins including 64 integral outer membrane proteins and 85 lipoproteins. The majority of these proteins were of unknown function. Among integral outer membrane proteins with homologues of known function, TonB-dependent transporters comprise the largest group. Our data suggest novel functions for these transporters. Among lipoproteins with homologues of known function, proteins with hydrolytic functions comprise the largest group. The luminal load of OMV was enriched for proteins with hydrolytic functions. Our data suggest that OMV have functions in predation and possibly in transfer of intercellular signaling molecules between cells.

A polysaccharide-peptide complex from abalone mushroom (Pleurotus abalonus) fruiting bodies increases activities and gene expression of antioxidant enzymes and reduces lipid peroxidation in senescence-accelerated mice.

PubMed

Li, L; Ng, T B; Song, M; Yuan, F; Liu, Z K; Wang, C L; Jiang, Y; Fu, M; Liu, F

2007-06-01

The antioxidant effects of a polysaccharide-peptide complex (F22) from mushroom (Pleurotus abalonus)-fruiting bodies were studied. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) in the liver, kidney, and brain of senescence-accelerated mice showed a marked increase after treatment with the polysaccharide-peptide complex. Concurrently, the gene expression levels of SOD, CAT, and GPx, as determined with real-time polymerase chain reaction, were up-regulated in the liver, kidney, and brain, whereas the MDA content in these organs declined. The maximal lifespan of the mice was prolonged.

Associations between local descriptive norms for overweight/obesity and insufficient fruit intake, individual-level diet, and 10-year change in body mass index and glycosylated haemoglobin in an Australian cohort.

PubMed

Carroll, Suzanne J; Niyonsenga, Theo; Coffee, Neil T; Taylor, Anne W; Daniel, Mark

2018-05-18

Descriptive norms (what other people do) relate to individual-level dietary behaviour and health outcome including overweight and obesity. Descriptive norms vary across residential areas but the impact of spatial variation in norms on individual-level diet and health is poorly understood. This study assessed spatial associations between local descriptive norms for overweight/obesity and insufficient fruit intake (spatially-specific local prevalence), and individual-level dietary intakes (fruit, vegetable and sugary drinks) and 10-year change in body mass index (BMI) and glycosylated haemoglobin (HbA 1c ). HbA 1c and BMI were clinically measured three times over 10 years for a population-based adult cohort (n = 4056) in Adelaide, South Australia. Local descriptive norms for both overweight/obesity and insufficient fruit intake specific to each cohort participant were calculated as the prevalence of these factors, constructed from geocoded population surveillance data aggregated for 1600 m road-network buffers centred on cohort participants' residential addresses. Latent growth models estimated the effect of local descriptive norms on dietary behaviours and change in HbA 1c and BMI, accounting for spatial clustering and covariates (individual-level age, sex, smoking status, employment and education, and area-level median household income). Local descriptive overweight/obesity norms were associated with individual-level fruit intake (inversely) and sugary drink consumption (positively), and worsening HbA 1c and BMI. Spatially-specific local norms for insufficient fruit intake were associated with individual-level fruit intake (inversely) and sugary drink consumption (positively) and worsening HbA 1c but not change in BMI. Individual-level fruit and vegetable intakes were not associated with change in HbA 1c or BMI. Sugary drink consumption was also not associated with change in HbA 1c but rather with increasing BMI. Adverse local descriptive norms for overweight

Effect of liberibacter infection (huanglongbing disease) of citrus on orange fruit physiology and fruit/fruit juice quality: chemical and physical analyses.

PubMed

Baldwin, Elizabeth; Plotto, Anne; Manthey, John; McCollum, Greg; Bai, Jinhe; Irey, Mike; Cameron, Randall; Luzio, Gary

2010-01-27

More than 90% of oranges in Florida are processed, and since Huanglongbing (HLB) disease has been rumored to affect fruit flavor, chemical and physical analyses were conducted on fruit and juice from healthy (Las -) and diseased (Las +) trees on three juice processing varieties over two seasons, and in some cases several harvests. Fruit, both asymptomatic and symptomatic for the disease, were used, and fresh squeezed and processed/pasteurized juices were evaluated. Fruit and juice characteristics measured included color, size, solids, acids, sugars, aroma volatiles, ascorbic acid, secondary metabolites, pectin, pectin-demethylating enzymes, and juice cloud. Results showed that asymptomatic fruit from symptomatic trees were similar to healthy fruit for many of the quality factors measured, but that juice from asymptomatic and especially symptomatic fruits were often higher in the bitter compounds limonin and nomilin. However, values were generally below reported taste threshold levels, and only symptomatic fruit seemed likely to cause flavor problems. There was variation due to harvest date, which was often greater than that due to disease. It is likely that the detrimental flavor attributes of symptomatic fruit (which often drop off the tree) will be largely diluted in commercial juice blends that include juice from fruit of several varieties, locations, and seasons.

Relationship between body satisfaction with self esteemand unhealthy body weight management

PubMed Central

Daniali, Shahrbanoo; Azadbakht, Leila; Mostafavi, Firoozeh

2013-01-01

.22, P < 0.001), income (r = 0.14, P < 0.004), consumption of fruit (r = 0.13, P < 0.008) all correlated with self-esteem significantly. Women with higher self esteem used higher fruits had a good nutrition overall (r = 0.11, P = 0.02). 92.15%, 10.8% of women respectively participated in one of healthy and unhealthy weight control behavior. There was not any Relationship between self esteem and healthy weight control behavior while finding showed reverse relationship between self esteem and Unhealthy Dieting Behaviors. Conclusion: It seemed women identity in our society tied to social appreciations that formed and supported by body satisfaction. When they feel their current appearance is differ from ideal appearance, they feel down and have lower self esteem and used unhealthy dieting behavior and low fruits daily. Due to importance of precise self evaluation, self esteem can be used to design and conduct public health programs, especially for women. PMID:24083279

Uncovering the Mystery of Gliding Motility in the Myxobacteria

PubMed Central

Nan, Beiyan; Zusman, David R.

2012-01-01

Bacterial gliding motility is the smooth movement of cells on solid surfaces unaided by flagella or pili. Many diverse groups of bacteria exhibit gliding, but the mechanism of gliding motility has remained a mystery since it was first observed more than a century ago. Recent studies on the motility of Myxococcus xanthus, a soil myxobacterium, suggest a likely mechanism for gliding in this organism. About forty M. xanthus genes were shown to be involved in gliding motility, and some of their protein products were labeled and localized within cells. These studies suggest that gliding motility in M. xanthus involves large multiprotein structural complexes, regulatory proteins, and cytoskeletal filaments. In this review, we summarize recent experiments that provide the basis for this emerging view of M. xanthus motility. We also discuss alternative models for gliding. PMID:21910630

Accumulation and distribution of mercury in fruiting bodies by fungus Suillus luteus foraged in Poland, Belarus and Sweden.

PubMed

Saba, Martyna; Falandysz, Jerzy; Nnorom, Innocent C

2016-02-01

Presented in this paper is result of the study of the bioconcentration potential of mercury (Hg) by Suillus luteus mushroom collected from regions within Central, Eastern, and Northern regions of Europe. As determined by cold-vapor atomic absorption spectroscopy, the Hg content varied from 0.13 ± 0.05 to 0.33 ± 0.13 mg kg(-1) dry matter for caps and from 0.038 ± 0.014 to 0.095 ± 0.038 mg kg(-1) dry matter in stems. The Hg content of the soil substratum (0-10 cm layer) underneath the fruiting bodies showed generally low Hg concentrations that varied widely ranging from 0.0030 to 0.15 mg kg(-1) dry matter with mean values varying from 0.0078 ± 0.0035 to 0.053 ± 0.025 mg kg(-1) dry matter, which is below typical content in the Earth crust. The caps were observed to be on the richer in Hg than the stems at ratio between 1.8 ± 0.4 and 5.3 ± 2.6. The S. luteus mushroom showed moderate ability to accumulate Hg with bioconcentration factor (BCF) values ranging from 3.6 ± 1.3 to 42 ± 18. The consumption of fresh S. luteus mushroom in quantities up to 300 g week(-1) (assuming no Hg ingestion from other foods) from background areas in the Central, Eastern, and Northern part of Europe will not result in the intake of Hg exceeds the provisional weekly tolerance limit (PTWI) of 0.004 mg kg(-1) body mass.

Fruits and vegetables intake and characteristics associated among adolescents from Southern Brazil

PubMed Central

2012-01-01

Background Increased body weight has been associated with an unhealthy diet, low consumption of fruits and vegetables. Our objective was to investigate whether adolescents had low intake of fruits and vegetables, and whether gender, age and education could affect the feeding patterns. Methods A population-based sample of adolescents, aged 12–19 years, were randomly selected in southern Brazil and included in this cross-sectional study. The total daily consumption of fruits, vegetables, rice and beans were investigated in standardized household interviews, using a food frequency questionnaire and questions, being categorized as five or more servings per day as the five-a-day diet. ANOVA, ANCOVA, and modified Poisson regression were used in the analysis. Results Adolescents (n = 568) were included, 49.5% boys, 14.3% had overweight and 8.8% obesity. Approximately 23% of participants consumed five daily servings of fruits and vegetables. It was observed that 36.7% of boys and 31.0% of girls consumed less than one serving of fruit per day, and 58.4% and 44.6%, respectively, consumed less than one serving of vegetables. The consumption of vegetables, fruits, and rice and beans were not independently associated with gender. Overweight was associated with higher intake of five-a-day, independently of confounding factors. Conclusions Adolescents from southern Brazil have lower frequency of consumption of five servings a day of fruits and vegetables combined. PMID:23158078

Predicting fruit fly's sensing rate with insect flight simulations.

PubMed

Chang, Song; Wang, Z Jane

2014-08-05

Without sensory feedback, flies cannot fly. Exactly how various feedback controls work in insects is a complex puzzle to solve. What do insects measure to stabilize their flight? How often and how fast must insects adjust their wings to remain stable? To gain insights into algorithms used by insects to control their dynamic instability, we develop a simulation tool to study free flight. To stabilize flight, we construct a control algorithm that modulates wing motion based on discrete measurements of the body-pitch orientation. Our simulations give theoretical bounds on both the sensing rate and the delay time between sensing and actuation. Interpreting our findings together with experimental results on fruit flies' reaction time and sensory motor reflexes, we conjecture that fruit flies sense their kinematic states every wing beat to stabilize their flight. We further propose a candidate for such a control involving the fly's haltere and first basalar motor neuron. Although we focus on fruit flies as a case study, the framework for our simulation and discrete control algorithms is applicable to studies of both natural and man-made fliers.

Impact of Fruit Smoothies on Adolescent Fruit Consumption at School

ERIC Educational Resources Information Center

Bates, Dylan; Price, Joseph

2015-01-01

We examine the impact of serving fruit smoothies during school breakfast on fruit consumption among middle school and high school students. We draw on observational plate-waste data over a 10-week period during which fruit smoothies were introduced for breakfast at two Utah schools. Our total sample includes 2,760 student-day observations. We find…

Fruit development and ripening.

PubMed

Seymour, Graham B; Østergaard, Lars; Chapman, Natalie H; Knapp, Sandra; Martin, Cathie

2013-01-01

Fruiting structures in the angiosperms range from completely dry to highly fleshy organs and provide many of our major crop products, including grains. In the model plant Arabidopsis, which has dry fruits, a high-level regulatory network of transcription factors controlling fruit development has been revealed. Studies on rare nonripening mutations in tomato, a model for fleshy fruits, have provided new insights into the networks responsible for the control of ripening. It is apparent that there are strong similarities between dry and fleshy fruits in the molecular circuits governing development and maturation. Translation of information from tomato to other fleshy-fruited species indicates that regulatory networks are conserved across a wide spectrum of angiosperm fruit morphologies. Fruits are an essential part of the human diet, and recent developments in the sequencing of angiosperm genomes have provided the foundation for a step change in crop improvement through the understanding and harnessing of genome-wide genetic and epigenetic variation.

Combined Treatments Reduce Chilling Injury and Maintain Fruit Quality in Avocado Fruit during Cold Quarantine.

PubMed

Sivankalyani, Velu; Feygenberg, Oleg; Maorer, Dalia; Zaaroor, Merav; Fallik, Elazar; Alkan, Noam

2015-01-01

Quarantine treatment enables export of avocado fruit (Persea americana) to parts of the world that enforce quarantine against fruit fly. The recommended cold-based quarantine treatment (storage at 1.1°C for 14 days) was studied with two commercial avocado cultivars 'Hass' and 'Ettinger' for 2 years. Chilling injuries (CIs) are prevalent in the avocado fruit after cold-quarantine treatment. Hence, we examined the effect of integrating several treatments: modified atmosphere (MA; fruit covered with perforated polyethylene bags), methyl jasmonate (MJ; fruit dipped in 2.5 μM MJ for Hass or 10 μM MJ for Ettinger for 30 s), 1-methylcyclopropene (1-MCP; fruit treated with 300 ppb 1-MCP for 18 h) and low-temperature conditioning (LTC; a gradual decrease in temperature over 3 days) on CI reduction during cold quarantine. Avocado fruit stored at 1°C suffered from severe CI, lipid peroxidation, and increased expression of chilling-responsive genes of fruit peel. The combined therapeutic treatments alleviated CI in cold-quarantined fruit to the level in fruit stored at commercial temperature (5°C). A successful therapeutic treatment was developed to protect 'Hass' and 'Ettinger' avocado fruit during cold quarantine against fruit fly, while maintaining fruit quality. Subsequently, treated fruit stored at 1°C had a longer shelf life and less decay than the fruit stored at 5°C. This therapeutic treatment could potentially enable the export of avocado fruit to all quarantine-enforcing countries. Similar methods might be applicable to other types of fruit that require cold quarantine.

Combined Treatments Reduce Chilling Injury and Maintain Fruit Quality in Avocado Fruit during Cold Quarantine

PubMed Central

Maorer, Dalia; Zaaroor, Merav; Fallik, Elazar; Alkan, Noam

2015-01-01

Quarantine treatment enables export of avocado fruit (Persea americana) to parts of the world that enforce quarantine against fruit fly. The recommended cold-based quarantine treatment (storage at 1.1°C for 14 days) was studied with two commercial avocado cultivars ‘Hass’ and ‘Ettinger’ for 2 years. Chilling injuries (CIs) are prevalent in the avocado fruit after cold-quarantine treatment. Hence, we examined the effect of integrating several treatments: modified atmosphere (MA; fruit covered with perforated polyethylene bags), methyl jasmonate (MJ; fruit dipped in 2.5 μM MJ for Hass or 10 μM MJ for Ettinger for 30 s), 1-methylcyclopropene (1-MCP; fruit treated with 300 ppb 1-MCP for 18 h) and low-temperature conditioning (LTC; a gradual decrease in temperature over 3 days) on CI reduction during cold quarantine. Avocado fruit stored at 1°C suffered from severe CI, lipid peroxidation, and increased expression of chilling-responsive genes of fruit peel. The combined therapeutic treatments alleviated CI in cold-quarantined fruit to the level in fruit stored at commercial temperature (5°C). A successful therapeutic treatment was developed to protect ‘Hass’ and ‘Ettinger’ avocado fruit during cold quarantine against fruit fly, while maintaining fruit quality. Subsequently, treated fruit stored at 1°C had a longer shelf life and less decay than the fruit stored at 5°C. This therapeutic treatment could potentially enable the export of avocado fruit to all quarantine-enforcing countries. Similar methods might be applicable to other types of fruit that require cold quarantine. PMID:26501421

Regulation of tomato fruit ascorbate content is more highly dependent on fruit irradiance than leaf irradiance.

PubMed

Gautier, Hélène; Massot, Capucine; Stevens, Rebecca; Sérino, Sylvie; Génard, Michel

2009-02-01

The mechanisms involving light control of vitamin C content in fruits are not yet fully understood. The present study aimed to evaluate the impact of fruit and leaf shading on ascorbate (AsA) accumulation in tomato fruit and to determine how fruit sugar content (as an AsA precursor) affected AsA content. Cherry tomato plants were grown in a glasshouse. The control treatment (normally irradiated fruits and irradiated leaves) was compared with the whole-plant shading treatment and with leaf or fruit shading treatments in fruits harvested at breaker stage. In a second experiment, the correlation between sugars and AsA was studied during ripening. Fruit shading was the most effective treatment in reducing fruit AsA content. Under normal conditions, AsA and sugar content were correlated and increased with the ripening stage. Reducing fruit irradiance strongly decreased the reduced AsA content (-74 %), without affecting sugars, so that sugar and reduced AsA were no longer correlated. Leaf shading delayed fruit ripening: it increased the accumulation of oxidized AsA in green fruits (+98 %), whereas it decreased the reduced AsA content in orange fruits (-19 %), suggesting that fruit AsA metabolism also depends on leaf irradiance. Under fruit shading only, the absence of a correlation between sugars and reduced AsA content indicated that fruit AsA content was not limited by leaf photosynthesis or sugar substrate, but strongly depended on fruit irradiance. Leaf shading most probably affected fruit AsA content by delaying fruit ripening, and suggested a complex regulation of AsA metabolism which depends on both fruit and leaf irradiance and fruit ripening stage.

Linking Fruit Ca Uptake Capacity to Fruit Growth and Pedicel Anatomy, a Cross-Species Study

PubMed Central

Song, Wenpei; Yi, Junwen; Kurniadinata, Odit F.; Wang, Huicong; Huang, Xuming

2018-01-01

Calcium (Ca) in flesh fruits is important for quality formation and maintenance. Most studies on fruit Ca focus on one species. This study attempted to understand some universal relations to fruit Ca uptake across species. Calcium contents in fruit tissues were analyzed in different fruits, including three cultivars of litchi, two cultivars each of grape and citrus, and one cultivar each of loquat, apple, pear, Indian jujube, and longan. In situ Ca distribution was revealed with electron probe and xylem functionality visualized by dye tracing. Fruit Ca uptake rate and activity were calculated and correlated with fruit growth and pedicel anatomy. The results showed that fruit Ca uptake rate was the highest in pomes (loquat, apple, and pear), followed by Indian jujube drupe, arillate fruits (litchis and longan) and citrus, while grape berries were the lowest. Fruit Ca uptake rate showed a strong positive correlation to growth rate. However, Ca uptake activity, reflecting Ca uptake rate relative to growth, was the highest in arillate fruits and loquat and lowest in grape berries, and had a poor correlation with fruit growth rate. In all fruits, Ca concentration in the pedicel was higher than in the fruit, and they displayed a good positive correlation. In the pedicel, Ca was most abundant in the phloem. Dye tracing showed that xylem function loss occurred with maturation in all species/varieties. Apple had the poorest xylem functionality with the least development of secondary xylem, but its Ca uptake rate was among the highest. Vessel density, size and area in the pedicel showed no correlation with fruit Ca uptake rate. It is concluded that: (1) fruit growth may be a key determinant of Ca uptake; (2) the universal pattern of Ca being higher in the pedicel than in the fruit indicates existence of a pedicel-fruit “bottleneck” effect in Ca transport across species; (3) xylem functionality loss with fruit maturation is also a universal event; (4) in the pedicel, Ca

DeepFruits: A Fruit Detection System Using Deep Neural Networks.

PubMed

Sa, Inkyu; Ge, Zongyuan; Dayoub, Feras; Upcroft, Ben; Perez, Tristan; McCool, Chris

2016-08-03

This paper presents a novel approach to fruit detection using deep convolutional neural networks. The aim is to build an accurate, fast and reliable fruit detection system, which is a vital element of an autonomous agricultural robotic platform; it is a key element for fruit yield estimation and automated harvesting. Recent work in deep neural networks has led to the development of a state-of-the-art object detector termed Faster Region-based CNN (Faster R-CNN). We adapt this model, through transfer learning, for the task of fruit detection using imagery obtained from two modalities: colour (RGB) and Near-Infrared (NIR). Early and late fusion methods are explored for combining the multi-modal (RGB and NIR) information. This leads to a novel multi-modal Faster R-CNN model, which achieves state-of-the-art results compared to prior work with the F1 score, which takes into account both precision and recall performances improving from 0 . 807 to 0 . 838 for the detection of sweet pepper. In addition to improved accuracy, this approach is also much quicker to deploy for new fruits, as it requires bounding box annotation rather than pixel-level annotation (annotating bounding boxes is approximately an order of magnitude quicker to perform). The model is retrained to perform the detection of seven fruits, with the entire process taking four hours to annotate and train the new model per fruit.

DeepFruits: A Fruit Detection System Using Deep Neural Networks

PubMed Central

Sa, Inkyu; Ge, Zongyuan; Dayoub, Feras; Upcroft, Ben; Perez, Tristan; McCool, Chris

2016-01-01

This paper presents a novel approach to fruit detection using deep convolutional neural networks. The aim is to build an accurate, fast and reliable fruit detection system, which is a vital element of an autonomous agricultural robotic platform; it is a key element for fruit yield estimation and automated harvesting. Recent work in deep neural networks has led to the development of a state-of-the-art object detector termed Faster Region-based CNN (Faster R-CNN). We adapt this model, through transfer learning, for the task of fruit detection using imagery obtained from two modalities: colour (RGB) and Near-Infrared (NIR). Early and late fusion methods are explored for combining the multi-modal (RGB and NIR) information. This leads to a novel multi-modal Faster R-CNN model, which achieves state-of-the-art results compared to prior work with the F1 score, which takes into account both precision and recall performances improving from 0.807 to 0.838 for the detection of sweet pepper. In addition to improved accuracy, this approach is also much quicker to deploy for new fruits, as it requires bounding box annotation rather than pixel-level annotation (annotating bounding boxes is approximately an order of magnitude quicker to perform). The model is retrained to perform the detection of seven fruits, with the entire process taking four hours to annotate and train the new model per fruit. PMID:27527168

The Role of Social Support and Self-efficacy for Planning Fruit and Vegetable Intake.

PubMed

Zhou, Guangyu; Gan, Yiqun; Hamilton, Kyra; Schwarzer, Ralf

2017-02-01

The aim of the current study was to examine the joint effect of self-efficacy, action planning, and received social support on fruit and vegetable intake. The study used a longitudinal design with 3 waves of data collection. Major university campus in Beijing, China. Young adults (n = 286). Age, gender, body mass index, dietary self-efficacy, and baseline behavior were measured at time 1. Two weeks after time 1, received social support and action planning were assessed (time 2); 4 weeks after time 1, subsequent fruit and vegetable consumption was measured (time 3). In a path analysis, action planning at time 2 was specified as a mediator between self-efficacy at time 1 and fruit and vegetable intake at time 3, controlling for age, gender, body mass index, and baseline behavior. In addition, in a conditional process analysis, received social support at time 2 was specified as a moderator of the self-efficacy-planning relationship. Action planning mediated between self-efficacy and subsequent dietary behavior, and received social support moderated between self-efficacy and planning supporting a compensation effect. Action planning served as a proximal predictor of fruit and vegetable intake, and planning one's consumption was facilitated by dietary self-efficacy. Through the identification of social cognitive factors influencing dietary planning, interventions can target self-efficacy and received social support to test the efficacy of these mechanisms in increasing individuals' ability to ensure they consume adequate amounts of fruits and vegetables. Copyright © 2016 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

Biochemical characterization of a lipase from olive fruit (Olea europaea L.).

PubMed

Panzanaro, S; Nutricati, E; Miceli, A; De Bellis, L

2010-09-01

Lipase (triacylglycerol acylhydrolase; EC 3.1.1.3) is the first enzyme of the degradation path of stored triacylglycerols (TAGs). In olive fruits, lipase may determine the increase of free fatty acids (FFAs) which level is an important index of virgin olive oil quality. However, despite the importance of virgin olive oil for nutrition and human health, few studies have been realized on lipase activity in Olea europaea fruits. In order to characterize olive lipase, fruits of the cv. Ogliarola, widely diffused in Salento area (Puglia, Italy), were harvested at four stages of ripening according to their skin colour (green, spotted I, spotted II, purple). Lipase activity was detected in the fatty layer obtained after centrifugation of the olive mesocarp homogenate. The enzyme exhibited a maximum activity at pH 5.0. The addition of calcium in the lipase assay medium leads to an increment of activity, whereas in the presence of copper the activity was reduced by 75%. Furthermore, mesocarp lipase activity increases during olive development but declined at maturity (purple stage). The data represent the first contribution to the biochemical characterization of an olive fruit lipase associated to oil bodies. 2010 Elsevier Masson SAS. All rights reserved.

Regulation of tomato fruit ascorbate content is more highly dependent on fruit irradiance than leaf irradiance

PubMed Central

Gautier, Hélène; Massot, Capucine; Stevens, Rebecca; Sérino, Sylvie; Génard, Michel

2009-01-01

Background and Aims The mechanisms involving light control of vitamin C content in fruits are not yet fully understood. The present study aimed to evaluate the impact of fruit and leaf shading on ascorbate (AsA) accumulation in tomato fruit and to determine how fruit sugar content (as an AsA precursor) affected AsA content. Methods Cherry tomato plants were grown in a glasshouse. The control treatment (normally irradiated fruits and irradiated leaves) was compared with the whole-plant shading treatment and with leaf or fruit shading treatments in fruits harvested at breaker stage. In a second experiment, the correlation between sugars and AsA was studied during ripening. Key Results Fruit shading was the most effective treatment in reducing fruit AsA content. Under normal conditions, AsA and sugar content were correlated and increased with the ripening stage. Reducing fruit irradiance strongly decreased the reduced AsA content (−74 %), without affecting sugars, so that sugar and reduced AsA were no longer correlated. Leaf shading delayed fruit ripening: it increased the accumulation of oxidized AsA in green fruits (+98 %), whereas it decreased the reduced AsA content in orange fruits (−19 %), suggesting that fruit AsA metabolism also depends on leaf irradiance. Conclusions Under fruit shading only, the absence of a correlation between sugars and reduced AsA content indicated that fruit AsA content was not limited by leaf photosynthesis or sugar substrate, but strongly depended on fruit irradiance. Leaf shading most probably affected fruit AsA content by delaying fruit ripening, and suggested a complex regulation of AsA metabolism which depends on both fruit and leaf irradiance and fruit ripening stage. PMID:19033285

Interactions between terrestrial mammals and the fruits of two neotropical rainforest tree species

NASA Astrophysics Data System (ADS)

Camargo-Sanabria, Angela A.; Mendoza, Eduardo

2016-05-01

Mammalian frugivory is a distinctive biotic interaction of tropical forests; however, most efforts in the Neotropics have focused on cases of animals foraging in the forest canopy, in particular primates and bats. In contrast much less is known about this interaction when it involves fruits deposited on the forest floor and terrestrial mammals. We conducted a camera-trapping survey to analyze the characteristics of the mammalian ensembles visiting fruits of Licania platypus and Pouteria sapota deposited on the forest floor in a well preserved tropical rainforest of Mexico. Both tree species produce large fruits but contrast in their population densities and fruit chemical composition. In particular, we expected that more species of terrestrial mammals would consume P. sapota fruits due to its higher pulp:seed ratio, lower availability and greater carbohydrate content. We monitored fruits at the base of 13 trees (P. sapota, n = 4 and L. platypus, n = 9) using camera-traps. We recorded 13 mammal species from which we had evidence of 8 consuming or removing fruits. These eight species accounted for 70% of the species of mammalian frugivores active in the forest floor of our study area. The ensemble of frugivores associated with L. platypus (6 spp.) was a subset of that associated with P. sapota (8 spp). Large body-sized species such as Tapirus bairdii, Pecari tajacu and Cuniculus paca were the mammals more frequently interacting with fruits of the focal species. Our results further our understanding of the characteristics of the interaction between terrestrial mammalian frugivores and large-sized fruits, helping to gain a more balanced view of its importance across different tropical forests and providing a baseline to compare against defaunated forests.

A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena.

PubMed

Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu

2015-01-01

The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment.

Physicochemical characterization of a high molecular weight bioactive β-D-glucan from the fruiting bodies of Ganoderma lucidum.

PubMed

Liu, Yanfang; Zhang, Jingsong; Tang, Qingjiu; Yang, Yan; Guo, Qingbin; Wang, Qi; Wu, Di; Cui, Steve W

2014-01-30

A purified polysaccharide coded as GLP20 was obtained by precipitating a hot-water extract from Ganoderma lucidum fruiting bodies with 20% (V/V) ethanol. Its total carbohydrate content was 95.9%. Structural analysis showed that GLP20 was a β-(1→3)-linked d-glucan with a (1→6)-β-d-glucopyranosyl side-branching unit on every third residue. Cell culture study revealed that GLP20 can significantly increase NO production of RAW264.7 macrophages. The analysis of light scattering and high performance size exclusion chromatography (HPSEC) showed that the molecular weight and polydispersity of GLP20 was 3.75 × 10(6)Da and 1.36, respectively. GLP20 had a rigid chain conformation in aqueous solution. A conformation transition occurred in the alkaline solution with NaOH concentration larger than 0.15M. The transition from ordered structure to single chain happened when GLP20 was heated above 135°C in water solution and was irreversible as demonstrated by differential scanning calorimetry (DSC). GLP20 existed as random coils in DMSO. Copyright © 2013 Elsevier Ltd. All rights reserved.

Food prices and body fatness among youths.

PubMed

Grossman, Michael; Tekin, Erdal; Wada, Roy

2014-01-01

We examine the effect of food prices on clinical measures of obesity, including body mass index (BMI) and percentage body fat (PBF) measures derived from bioelectrical impedance analysis (BIA) and dual energy X-ray absorptiometry (DXA), among youths ages 12 through 18 in the National Health and Nutrition Examination Survey. This is the first study to consider clinically measured levels of body composition rather than BMI to investigate the effects of food prices on obesity outcomes among youths classified by gender and race/ethnicity. Our findings suggest that increases in the real price per calorie of food for home consumption and the real price of fast-food restaurant food lead to improvements in obesity outcomes among youths. We also find that a rise in the real price of fruits and vegetables leads to increased obesity. Finally, our results indicate that measures of PBF derived from BIA and DXA are no less sensitive and in some cases more sensitive to the prices just mentioned than BMI, and serve an important role in demonstrating that rising food prices (except fruit and vegetable prices) are indeed associated with reductions in obesity rather than with reductions in body size proportions alone. Copyright © 2013 Elsevier B.V. All rights reserved.

Comparison of fruit syndromes between the Egyptian fruit-bat ( Rousettus aegyptiacus) and birds in East Mediterranean habitats

NASA Astrophysics Data System (ADS)

Korine, Carmi; Izhaki, Ido; Arad, Zeev

1998-04-01

This study analyses the fruit syndrome of the Egyptian fruit-bat, Rousettus aegyptiacus, the only fruit-bat found in East Mediterranean habitats. Two different sets of bat-fruit syndromes were revealed. One follows the general bat-fruit syndrome and one represents a special case of bat-dispersed fruit syndrome only found in East Mediterranean habitats. The latter syndrome is characterized by dry fruits with a relatively high protein content. Fruit species that belong to this syndrome are available mostly in winter (when the fruit-bat faces a severe shortage in fruit availability and inadequate fruit quality). The fruit syndromes and dietary overlap between frugivorous birds (based on the literature) and the fruit-bat were also studied. Features associated with each set of fruit species generally follow the known bat and bird syndromes. Bird-dispersed fruits tend to be small, with a high seed mass to pulp mass, variable in fat content and characterized by a high ash content. However, when the shared fruit species were included in the analysis, no significant differences were found in fruit features between the bird-dispersed and bat-dispersed fruit syndromes. A limited and asymmetrical dietary overlap was observed between these two taxa, mainly between introduced and cultivated fruits.

Genome Analysis of the Fruiting Body-Forming Myxobacterium Chondromyces crocatus Reveals High Potential for Natural Product Biosynthesis

PubMed Central

Zaburannyi, Nestor; Bunk, Boyke; Maier, Josef; Overmann, Jörg

2016-01-01

Here, we report the complete genome sequence of the type strain of the myxobacterial genus Chondromyces, Chondromyces crocatus Cm c5. It presents one of the largest prokaryotic genomes featuring a single circular chromosome and no plasmids. Analysis revealed an enlarged set of tRNA genes, along with reduced pressure on preferred codon usage compared to that of other bacterial genomes. The large coding capacity and the plethora of encoded secondary metabolite biosynthetic gene clusters are in line with the capability of Cm c5 to produce an arsenal of antibacterial, antifungal, and cytotoxic compounds. Known pathways of the ajudazol, chondramide, chondrochloren, crocacin, crocapeptin, and thuggacin compound families are complemented by many more natural compound biosynthetic gene clusters in the chromosome. Whole-genome comparison of the fruiting-body-forming type strain (Cm c5, DSM 14714) to an accustomed laboratory strain which has lost this ability (nonfruiting phenotype, Cm c5 fr−) revealed genetic changes in three loci. In addition to the low synteny found with the closest sequenced representative of the same family, Sorangium cellulosum, extensive genetic information duplication and broad application of eukaryotic-type signal transduction systems are hallmarks of this 11.3-Mbp prokaryotic genome. PMID:26773087

Recovery of laccase from processed Hericium erinaceus (Bull.:Fr) Pers. fruiting bodies in aqueous two-phase system.

PubMed

Rajagopalu, Devamalini; Show, Pau Loke; Tan, Yee Shin; Muniandy, Sekaran; Sabaratnam, Vikineswary; Ling, Tau Chuan

2016-09-01

The feasible use of aqueous two-phase systems (ATPSs) to establish a viable protocol for the recovery of laccase from processed Hericium erinaceus (Bull.:Fr.) Pers. fruiting bodies was evaluated. Cold-stored (4.00±1.00°C) H. erinaceus recorded the highest laccase activities of 2.02±0.04 U/mL among all the processed techniques. The evaluation was carried out in twenty-five ATPSs, which composed of polyethylene glycol (PEG) with various molecular weights and potassium phosphate salt solution to purify the protein from H. erinaceus. Optimum recovery condition was observed in the ATPS which contained 17% (w/w) PEG with a molecular weight of 8000 and 12.2% (w/w) potassium phosphate solution, at a volume ratio (VR) of 1.0. The use of ATPS resulted in one-single primary recovery stage process that produced an overall yield of 99% with a purification factor of 8.03±0.46. The molecular mass of laccases purified from the bottom phase was in the range of 55-66 kDa. The purity of the partitioned laccase was confirmed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Reproducible and controllable light induction of in vitro fruiting of the white-rot basidiomycete Pleurotus ostreatus.

PubMed

Arjona, Davinia; Aragón, Carlos; Aguilera, José Antonio; Ramírez, Lucía; Pisabarro, Antonio G

2009-05-01

Fruiting is a crucial developmental process in basidiomycetes yet the genetic and molecular factors that control it are not yet fully understood. The search for fruiting inducers is of major relevance for both basic research and for their use in industrial applications. In this paper, an efficient and reproducible protocol for controlled fruiting induction of Pleurotus ostreatus growing on synthetic medium is described. The protocol is based on the control of light intensity and photoperiod and permits the life cycle for this fungus to be completed in less than two weeks. The fruiting bodies produced by this method release fertile spores after 4-5 d of culture. Our results indicate that fruiting induction is solely dependent on the illumination regime and that it occurs long before the available nutrients are depleted in the culture. This protocol will greatly facilitate molecular and developmental biology research in this fungus as it avoids the need for complex culture media based on lignocellulosic materials or the use of chemical inducers.

Biotransformation of Tryptamine in Fruiting Mycelia of Psilocybe cubensis.

PubMed

Gartz, J

1989-06-01

Mycelial cultures of PSILOCYBE CUBENSIS, with the ability to form psilocybin and psilocin DE-NOVO, also hydroxylated and methylated fed tryptamine to give psilocin in up to 3.3% dry mass of the obtained fruit bodies. By using HPLC and TLC, it was found that these mushrooms contain only a small amount of psilocybin (0.01-0.2% dry mass). The values of psilocin are the highest described in any mushrooms.

Parasitism by Nycteribiidae and Streblidae Flies (Diptera) of a Malagasy Fruit Bat (Pteropodidae): Effects of Body Size and Throat Gland Development on Parasite Abundance.

PubMed

Rajemison, Faneva I; Noroalintseheno Lalarivoniaina, Oliva S; Goodman, Steven M

2017-07-01

We examined the possible effects of host body size and throat gland development on the abundance of blood-feeding nycteribiid and streblid flies parasitizing a Malagasy fruit bat, Rousettus madagascariensis G. Grandidier, 1928. Data were collected in the Parc National d'Ankarana in northern Madagascar during four visits: September 2014, 2015 (dry season), and January 2015, 2016 (wet season). Two bat fly species were identified, Eucampsipoda madagascarensis Theodor, 1955 (Nycteribiidae) and Megastrebla wenzeli (Jobling, 1952) (Streblidae). A positive correlation was found between host body size and abundance of E. madagascarensis during the four visits, suggesting that larger hosts have more parasites, and for M. wenzeli, this relationship was identified only during the wet season visits. In male hosts, body size and throat gland development are correlated with variation in E. madagascarensis abundance during the two seasons; this relationship was not found for M. wenzeli. We present some explanations for the observed patterns of bat fly abundance associated with throat gland development: increased vascularization and easier access to bloodmeals, chemical properties of gland secretions acting as attractants or perhaps being consumed, and modification of hair around the gland providing protection from bat grooming. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Socioeconomic gradient in consumption of whole fruit and 100% fruit juice among US children and adults.

PubMed

Drewnowski, Adam; Rehm, Colin D

2015-01-05

The consumption of fruit is generally associated with better health, but also higher socioeconomic status (SES). Most previous studies evaluating consumption of fruits have not separated 100% fruit juice and whole fruit, which may conceal interesting patterns in consumption. To estimate demographic and socioeconomic correlates of whole fruit versus 100% juice consumption among children and adults in the United States. Secondary analyses of two cycles of the nationally representative National Health and Nutrition Examination Survey (NHANES) from 2007-2010, by gender, age group, race/ethnicity and SES among 16,628 children and adults. Total fruit consumption (population average of 1.06 cup equivalents/d) fell far short of national goals. Overall, whole fruit provided about 65% of total fruit, while 100% juice provided the remainder. Whereas 100% juice consumption was highest among children and declined sharply with age, whole fruit consumption was highest among older adults. Total fruit and whole fruit consumption was generally higher among those with higher incomes or more education. By contrast, the highest 100% juice consumption was found among children, racial/ethnic minorities and lower-income groups. Consumption patterns for whole fruit versus 100% fruit juice showed different gradients by race/ethnicity, education, and income. The advice to replace 100% juice with whole fruit may pose a challenge for the economically disadvantaged and some minority groups, whose fruit consumption falls short of national goals.

Dietary Patterns and Body Mass Index in Children with Autism and Typically Developing Children

ERIC Educational Resources Information Center

Evans, E. Whitney; Must, Aviva; Anderson, Sarah E.; Curtin, Carol; Scampini, Renee; Maslin, Melissa; Bandini, Linda

2012-01-01

To determine whether dietary patterns (juice and sweetened non-dairy beverages, fruits, vegetables, fruits and vegetables, snack foods, and kid's meals) and associations between dietary patterns and body mass index (BMI) differed between 53 children with autism spectrum disorders (ASD) and 58 typically developing children, ages 3-11, multivariate…

Access to fast food and food prices: relationship with fruit and vegetable consumption and overweight among adolescents.

PubMed

Powell, Lisa M; Auld, M Christopher; Chaloupka, Frank J; O'Malley, Patrick M; Johnston, Lloyd D

2007-01-01

We examine the extent to which food prices and restaurant outlet density are associated with adolescent fruit and vegetable consumption, body mass index (BMI), and the probability of overweight. We use repeated cross-sections of individual-level data on adolescents from the Monitoring the Future Surveys from 1997 to 2003 combined with fast food and fruit and vegetable prices obtained from the American Chamber of Commerce Researchers Association and fast food and full-service restaurant outlet density measures obtained from Dun & Bradstreet. The results suggest that the price of a fast food meal is an important determinant of adolescents' body weight and eating habits: a 10% increase in the price of a fast food meal leads to a 3.0% increase in the probability of frequent fruit and vegetable consumption, a 0.4% decrease in BMI, and a 5.9% decrease in probability of overweight. The price of fruits and vegetables and restaurant outlet density are less important determinants, although these variables typically have the expected sign and are often statistically associated with our outcome measures. Despite these findings, changes in all observed economic and socio-demographic characteristics together only explain roughly one-quarter of the change in mean BMI and one-fifth of the change in overweight over the 1997-2003 sampling period.

Cacao seeds are a "Super Fruit": A comparative analysis of various fruit powders and products

PubMed Central

2011-01-01

Background Numerous popular media sources have developed lists of "Super Foods" and, more recently, "Super Fruits". Such distinctions often are based on the antioxidant capacity and content of naturally occurring compounds such as polyphenols within those whole fruits or juices of the fruit which may be linked to potential health benefits. Cocoa powder and chocolate are made from an extract of the seeds of the fruit of the Theobroma cacao tree. In this study, we compared cocoa powder and cocoa products to powders and juices derived from fruits commonly considered "Super Fruits". Results Various fruit powders and retail fruit products were obtained and analyzed for antioxidant capacity (ORAC (μM TE/g)), total polyphenol content (TP (mg/g)), and total flavanol content (TF (mg/g)). Among the various powders that were tested, cocoa powder was the most concentrated source of ORAC and TF. Similarly, dark chocolate was a significantly more concentrated source of ORAC and TF than the fruit juices. Conclusions Cocoa powder and dark chocolate had equivalent or significantly greater ORAC, TP, and TF values compared to the other fruit powders and juices tested, respectively. Cacao seeds thus provide nutritive value beyond that derived from their macronutrient composition and appear to meet the popular media's definition of a "Super Fruit". PMID:21299842

Cacao seeds are a "Super Fruit": A comparative analysis of various fruit powders and products.

PubMed

Crozier, Stephen J; Preston, Amy G; Hurst, Jeffrey W; Payne, Mark J; Mann, Julie; Hainly, Larry; Miller, Debra L

2011-02-07

Numerous popular media sources have developed lists of "Super Foods" and, more recently, "Super Fruits". Such distinctions often are based on the antioxidant capacity and content of naturally occurring compounds such as polyphenols within those whole fruits or juices of the fruit which may be linked to potential health benefits. Cocoa powder and chocolate are made from an extract of the seeds of the fruit of the Theobroma cacao tree. In this study, we compared cocoa powder and cocoa products to powders and juices derived from fruits commonly considered "Super Fruits". Various fruit powders and retail fruit products were obtained and analyzed for antioxidant capacity (ORAC (μM TE/g)), total polyphenol content (TP (mg/g)), and total flavanol content (TF (mg/g)). Among the various powders that were tested, cocoa powder was the most concentrated source of ORAC and TF. Similarly, dark chocolate was a significantly more concentrated source of ORAC and TF than the fruit juices. Cocoa powder and dark chocolate had equivalent or significantly greater ORAC, TP, and TF values compared to the other fruit powders and juices tested, respectively. Cacao seeds thus provide nutritive value beyond that derived from their macronutrient composition and appear to meet the popular media's definition of a "Super Fruit".

Fruit intake and incident diabetic retinopathy with type 2 diabetes.

PubMed

Tanaka, Shiro; Yoshimura, Yukio; Kawasaki, Ryo; Kamada, Chiemi; Tanaka, Sachiko; Horikawa, Chika; Ohashi, Yasuo; Araki, Atsushi; Ito, Hideki; Akanuma, Yasuo; Yamada, Nobuhiro; Yamashita, Hidetoshi; Sone, Hirohito

2013-03-01

Antioxidants and dietary fiber are postulated to have preventive effects on diabetic retinopathy, but evidence is lacking. We investigated this association in a cohort with type 2 diabetes 40-70 years of age with hemoglobin (Hb)A1C ≥6.5%, originally part of the Japan Diabetes Complications Study. After excluding people who did not respond to a dietary survey and patients with diabetic retinopathy or a major ocular disease at baseline, we analyzed 978 patients. Baseline dietary intake was assessed by a food frequency questionnaire based on food groups and 24-hour dietary records. Primary outcome was incident diabetic retinopathy determined using international severity scales. Mean fruit intake in quartiles ranged from 23 to 253 g/day, with increasing trends across quartiles of fruit intake for vitamin C, vitamin E, carotene, retinol equivalent, dietary fiber, potassium, and sodium. Mean energy intake ranged from 1644 to 1863 kcal/day, and fat intake was approximately 25%. HbA1C, body mass index, triglycerides, and systolic blood pressure were well controlled. During the 8-year follow-up, the numbers of incident cases of diabetic retinopathy from the first through the fourth quartiles of fruit intake were 83, 74, 69, and 59. Multivariate-adjusted hazard ratios for the second, third, and fourth quartiles of fruit intake compared with the first quartile were 0.66 (95% confidence interval = 0.46-0.92), 0.59 (0.41-0.85), and 0.48 (0.32-0.71) (test for trend, P < 0.01). There was no substantial effect modification by age, sex, HbA1C, diabetes duration, overweight, smoking, and hypertension. Risk for diabetic retinopathy declined with increased intake of fruits and vegetables, vitamin C, and carotene. Increased fruit intake in ranges commonly consumed was associated with reduced incident diabetic retinopathy among patients adhering to a low-fat energy-restricted diet.

Fruit and Vegetable Consumption and Changes in Anthropometric Variables in Adult Populations: A Systematic Review and Meta-Analysis of Prospective Cohort Studies

PubMed Central

Schwingshackl, Lukas; Hoffmann, Georg; Kalle-Uhlmann, Tamara; Arregui, Maria; Buijsse, Brian; Boeing, Heiner

2015-01-01

Background Randomized controlled trials provide conflicting results on the effects of increased fruit and vegetable consumption on changes in body weight. We aimed to perform a systematic review and meta-analysis of prospective cohort studies on fruit and vegetable consumption in relation to changes in anthropometric measures. Methods PubMed and EMBASE were searched up to July 2015 for prospective studies reporting on habitual fruit and/or vegetable consumption in relation to changes in body weight or waist circumference or to risk of weight gain/overweight/obesity in adults. Random-effects meta-analysis was applied to pool results across studies. Findings Seventeen cohort studies (from 20 reports) including 563,277 participants met our inclusion criteria. Higher intake of fruits was inversely associated with weight change (decrease) (beta-coefficient per 100-g increment, -13.68 g/year; 95% CI, -22.97 to -4.40). No significant changes could be observed for combined fruit and vegetable consumption or vegetable consumption. Increased intake of fruits was inversely associated with changes (decrease) in waist circumference (beta: -0.04 cm/year; 95% CI, -0.05 to -0.02). Comparing the highest combined fruit & vegetable, fruit, and vegetable intake categories were associated with a 9%, 17%, and 17% reduced risk of adiposity (odds ratio [OR]: 0.91, 95% CI, 0.84 to 0.99), (OR: 0.83, 95% CI, 0.71 to 0.99), and (OR: 0.83, 95% CI, 0.70 to 0.99), respectively. Conclusion This meta-analysis showed several inverse associations between fruit and vegetable intake and prospective improvements in anthropometric parameters, and risk of adiposity. The present meta-analysis seems to be limited by low study quality. Nevertheless, when combined with evolutionary nutrition and epidemiological modeling studies, these findings have public health relevance and support all initiatives to increase fruit and vegetable intake. PMID:26474158

The relationship between fruit and vegetable intake with gastroesophageal reflux disease in Iranian adults

PubMed Central

Keshteli, Ammar Hassanzadeh; Shaabani, Pouria; Tabibian, Seyed-Reza; Saneei, Parvane; Esmaillzadeh, Ahmad; Adibi, Peyman

2017-01-01

Background: Findings from studies that investigated the relationship between fruit and vegetable intake with gastroesophageal reflux disease (GERD) were inconsistent. We aimed to assess the relationship between fruit and vegetable consumption and GERD among a large group of Iranian adults. Materials and Methods: In this cross-sectional study on 3979 adults, a validated food frequency questionnaire was used to assess usual dietary intakes including fruits and vegetables. The presence of heartburn sometimes or more during the past 3 months were considered as having GERD. Results: The prevalence of GERD among study population was 23.9%. After adjustment for potential confounding factors, those with the highest consumption of fruits had 25% lower risk for GERD, in comparison to those with the lowest intake (odds ratio [OR] = 0.75, 95% confidence interval [CI]: 0.59–0.97). Vegetable intake was not significantly related to the risk of GERD in crude or multivariable-adjusted models. However, participants with the highest intake of fruits and vegetables had 33% lower risk of GERD (OR = 0.67, 95% CI: 0.51–0.88), after adjustment for confounders. Women with the highest fruit and vegetable intake had 36% lower risk for GERD (OR = 0.64, 95% CI: 0.45–0.91). Overweight/obese participants in the last tertile of fruit consumption had 42% lower risk for GERD, in comparison to the first category (OR = 0.58, 95% CI: 0.42–0.83). Furthermore, participants with body mass index higher than 25 kg/m2 and higher intake of fruits and vegetables had 53% lower risk for GERD (OR = 0.47, 95% CI: 0.32-0.69). Conclusion: We found inverse associations between fruit intake as well as fruit and vegetable intake and risk of GERD among Iranian adults. PMID:29259636

The relationship between fruit and vegetable intake with gastroesophageal reflux disease in Iranian adults.

PubMed

Keshteli, Ammar Hassanzadeh; Shaabani, Pouria; Tabibian, Seyed-Reza; Saneei, Parvane; Esmaillzadeh, Ahmad; Adibi, Peyman

2017-01-01

Findings from studies that investigated the relationship between fruit and vegetable intake with gastroesophageal reflux disease (GERD) were inconsistent. We aimed to assess the relationship between fruit and vegetable consumption and GERD among a large group of Iranian adults. In this cross-sectional study on 3979 adults, a validated food frequency questionnaire was used to assess usual dietary intakes including fruits and vegetables. The presence of heartburn sometimes or more during the past 3 months were considered as having GERD. The prevalence of GERD among study population was 23.9%. After adjustment for potential confounding factors, those with the highest consumption of fruits had 25% lower risk for GERD, in comparison to those with the lowest intake (odds ratio [OR] = 0.75, 95% confidence interval [CI]: 0.59-0.97). Vegetable intake was not significantly related to the risk of GERD in crude or multivariable-adjusted models. However, participants with the highest intake of fruits and vegetables had 33% lower risk of GERD (OR = 0.67, 95% CI: 0.51-0.88), after adjustment for confounders. Women with the highest fruit and vegetable intake had 36% lower risk for GERD (OR = 0.64, 95% CI: 0.45-0.91). Overweight/obese participants in the last tertile of fruit consumption had 42% lower risk for GERD, in comparison to the first category (OR = 0.58, 95% CI: 0.42-0.83). Furthermore, participants with body mass index higher than 25 kg/m 2 and higher intake of fruits and vegetables had 53% lower risk for GERD (OR = 0.47, 95% CI: 0.32-0.69). We found inverse associations between fruit intake as well as fruit and vegetable intake and risk of GERD among Iranian adults.

Multiple layers of temporal and spatial control regulate accumulation of the fruiting body-specific protein APP in Sordaria macrospora and Neurospora crassa.

PubMed

Nowrousian, Minou; Piotrowski, Markus; Kück, Ulrich

2007-07-01

During fungal fruiting body development, specialized cell types differentiate from vegetative mycelium. We have isolated a protein from the ascomycete Sordaria macrospora that is not present during vegetative growth but accumulates in perithecia. The protein was sequenced by mass spectrometry and the corresponding gene was termed app (abundant perithecial protein). app transcript occurs only after the onset of sexual development; however, the formation of ascospores is not a prerequisite for APP accumulation. The transcript of the Neurospora crassa ortholog is present prior to fertilization, but the protein accumulates only after fertilization. In crosses of N. crassa Deltaapp strains with the wild type, APP accumulates when the wild type serves as female parent, but not in the reciprocal cross; thus, the presence of a functional female app allele is necessary and sufficient for APP accumulation. These findings highlight multiple layers of temporal and spatial control of gene expression during fungal development.

Fleshy-fruits phenology: temporal variability on quantity and quality of animal-dispersed fruits in a cerrado-savanna

NASA Astrophysics Data System (ADS)

de Camargo, Maria Gabriela G.; Cazetta, Eliana; Schaefer, Martin; Morellato, L. Patrícia C.

2014-05-01

Time and quantity and quality of fruits and seeds produced are limiting factors for the recruitment of new individuals and maintenance plant species. Furthermore, species that produced fruits dispersed by animals have an important role as a source of food for different groups of animals and relay on them to dispersed their seeds. In most of the Brazilian cerrado-savanna, as in others tropical vegetations, there is a predominance of animal-dispersed species, however there is a lack of information about fruit production and its availability over time on tropical savannas. Beyond the comprehension of fruiting patterns and their relation to biotic and abiotic factors, the fruit production over time can be associated with data on fruit quality such as the fruit color and nutritional content. Those combined informations allow us to evaluate the quantity and quality of resources available in a plant community for frugivores and seed predators. For a cerrado-savanna woody community in southeastern Brazil, subjected to a marked seasonal climate, we intended to describe: (i) fruit availability over time (in number and biomass); (ii) nutritional content; and (ii) fruit color patterns over a year. We counted fortnightly the number of ripe fruits and estimated fruit biomass over a year. For the nutritional content, we evaluated the percentage of protein, lipids and carbohydrates in the pulp or aril of fleshy-fruits. We classified fruit colors in red, black, yellow, dark-red, blue and multicolored (when the fruit display is composed by a combination of two non-green colors or more). We observed a period of the highest fruit production in the wet season, with two peaks of production, and a decline in the dry season, a possible period of scarcity. As expected, fruit nutritional content followed mainly the fruiting pattern in biomass. For lipids there was a different seasonal pattern in which lipid-rich fruits were produced mainly at the end of the wet season while fruits with less

Prevention of metabolic diseases: fruits (including fruit sugars) vs. vegetables.

PubMed

Kuzma, Jessica N; Schmidt, Kelsey A; Kratz, Mario

2017-07-01

To discuss recent evidence from observational and intervention studies on the relationship between fruit and vegetable (F&V) consumption and metabolic disease. Observational studies have consistently demonstrated a modest inverse association between the intake of fruit and leafy green vegetables, but not total vegetables, and biomarkers of metabolic disease as well as incident type 2 diabetes mellitus. This is in contrast to limited evidence from recently published randomized controlled dietary intervention trials, which - in sum - suggests little to no impact of increased F&V consumption on biomarkers of metabolic disease. Evidence from observational studies that fruit and leafy green vegetable intake is associated with lower type 2 diabetes risk and better metabolic health could not be confirmed by dietary intervention trials. It is unclear whether this discrepancy is because of limitations inherent in observational studies (e.g., subjective dietary assessment methods, residual confounding) or due to limitations in the few available intervention studies (e.g., short duration of follow-up, interventions combining whole fruit and fruit juice, or lack of compliance). Future studies that attempt to address these limitations are needed to provide more conclusive insight into the impact of F&V consumption on metabolic health.

A Novel Method for Tracking Individuals of Fruit Fly Swarms Flying in a Laboratory Flight Arena

PubMed Central

Cheng, Xi En; Qian, Zhi-Ming; Wang, Shuo Hong; Jiang, Nan; Guo, Aike; Chen, Yan Qiu

2015-01-01

The growing interest in studying social behaviours of swarming fruit flies, Drosophila melanogaster, has heightened the need for developing tools that provide quantitative motion data. To achieve such a goal, multi-camera three-dimensional tracking technology is the key experimental gateway. We have developed a novel tracking system for tracking hundreds of fruit flies flying in a confined cubic flight arena. In addition to the proposed tracking algorithm, this work offers additional contributions in three aspects: body detection, orientation estimation, and data validation. To demonstrate the opportunities that the proposed system offers for generating high-throughput quantitative motion data, we conducted experiments on five experimental configurations. We also performed quantitative analysis on the kinematics and the spatial structure and the motion patterns of fruit fly swarms. We found that there exists an asymptotic distance between fruit flies in swarms as the population density increases. Further, we discovered the evidence for repulsive response when the distance between fruit flies approached the asymptotic distance. Overall, the proposed tracking system presents a powerful method for studying flight behaviours of fruit flies in a three-dimensional environment. PMID:26083385

Sorbitol, Rubus fruit, and misconception.

PubMed

Lee, Jungmin

2015-01-01

It is unclear how the misunderstanding that Rubus fruits (e.g., blackberries, raspberries) are high in sugar alcohol began, or when it started circulating in the United States. In reality, they contain little sugar alcohol. Numerous research groups have reported zero detectable amounts of sugar alcohol in fully ripe Rubus fruit, with the exception of three out of 82 Rubus fruit samples (cloudberry 0.01 g/100 g, red raspberry 0.03 g/100 g, and blackberry 4.8 g/100 g(∗); (∗)highly unusual as 73 other blackberry samples contained no detectable sorbitol). Past findings on simple carbohydrate composition of Rubus fruit, other commonly consumed Rosaceae fruit, and additional fruits (24 genera and species) are summarised. We are hopeful that this review will clarify Rosaceae fruit sugar alcohol concentrations and individual sugar composition; examples of non-Rosaceae fruit and prepared foods containing sugar alcohol are included for comparison. A brief summary of sugar alcohol and health will also be presented. Published by Elsevier Ltd.

Radiation preservation of foods of plant origin. Part V. Temperate fruits: pome fruits, stone fruits, and berries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, P.

1986-01-01

The current status of research on the application of ionizing radiation for improving the storage of temperate fruits, i.e., apple, pear, peach, nectarine, apricot, cherry, plum, strawberry, bilberry, cranberry, raspberry, and black currant, is reviewed. Changes in fruit metabolism, chemical composition, texture, and organoleptic quality attributes are discussed with reference to the irradiation dose. The feasibility of using radiation either alone or in conjunction with heat treatment, refrigeration, and controlled atmospheres (CA) for the control of storage decay caused by fungal pathogens is considered. Areas of further research are suggested before irradiation could be considered for practical application in somemore » of these temperate fruits. The recent trends in the possible use of irradiation for disinfestation of certain pome and stone fruits and the prospects for the commercial utilization of irradiation for improving the market life of strawberries are discussed. 156 references.« less

Phytosanitary irradiation of peach fruit moth (Lepidoptera: Carposinidae) in apple fruits

NASA Astrophysics Data System (ADS)

Zhan, Guoping; Li, Baishu; Gao, Meixu; Liu, Bo; Wang, Yuejin; Liu, Tao; Ren, Lili

2014-10-01

Peach fruit moth, Carposina sasakii Matsumura, is a serious pest of many pome and stone fruits and presents a quarantine problem in some export markets. It is widely distributed in pome fruit production areas in China, Japan, Korea, North Korea and the Far Eastern Federal District of Russia. In this investigation, gamma radiation dose-response tests were conducted with late eggs (5-d-old) and various larval stages, followed by large-scale confirmatory tests on the most tolerant stage in fruit, the fifth instar. The dose-response tests, with the target radiation dose of 20 (late eggs), 40, 60, 80, 100, 120, 140, and 160 Gy (late fifth instars in vitro) respectively applied to all stages, showed that the tolerance to radiation increased with increasing age and developmental stage. The fifth instar (most advanced instar in fruits) was determined to be the most tolerant stage requiring an estimated minimum absorbed dose of 208.6 Gy (95% CI: 195.0, 226.5 Gy) to prevent adult emergence at 99.9968% efficacy (95% confidence level). In the confirmatory tests, irradiation was applied to 30,850 late fifth instars in apple fruits with a target dose of 200 Gy (171.6-227.8 Gy measured), but only 4 deformed adults emerged that died 2 d afterwards without laying eggs. A dose of 228 Gy may be recommended as a phytosanitary irradiation treatment under ambient atmosphere for the control of peach fruit moth on all commodities with an efficacy of 99.9902% at 95% confidence level.

Active and passive stabilization of body pitch in insect flight

PubMed Central

Ristroph, Leif; Ristroph, Gunnar; Morozova, Svetlana; Bergou, Attila J.; Chang, Song; Guckenheimer, John; Wang, Z. Jane; Cohen, Itai

2013-01-01

Flying insects have evolved sophisticated sensory–motor systems, and here we argue that such systems are used to keep upright against intrinsic flight instabilities. We describe a theory that predicts the instability growth rate in body pitch from flapping-wing aerodynamics and reveals two ways of achieving balanced flight: active control with sufficiently rapid reactions and passive stabilization with high body drag. By glueing magnets to fruit flies and perturbing their flight using magnetic impulses, we show that these insects employ active control that is indeed fast relative to the instability. Moreover, we find that fruit flies with their control sensors disabled can keep upright if high-drag fibres are also attached to their bodies, an observation consistent with our prediction for the passive stability condition. Finally, we extend this framework to unify the control strategies used by hovering animals and also furnish criteria for achieving pitch stability in flapping-wing robots. PMID:23697713

The Role of Personality Traits in Young Adult Fruit and Vegetable Consumption.

PubMed

Conner, Tamlin S; Thompson, Laura M; Knight, Rachel L; Flett, Jayde A M; Richardson, Aimee C; Brookie, Kate L

2017-01-01

This project investigated how individual differences in the big-five personality traits (neuroticism, extraversion, openness to experience, conscientiousness, and agreeableness) predicted plant-food consumption in young adults. A total of 1073 participants from two samples of young adults aged 17-25 reported their daily servings of fruits, vegetables, and two unhealthy foods for comparison purposes using an Internet daily diary for 21 or 13 days (micro-longitudinal, correlational design). Participants also completed the Neuroticism, Extraversion, Openness Five Factor Inventory (NEO-FFI) measure of personality, and demographic covariates including gender, age, ethnicity, and body mass index (BMI). Analyses used hierarchical regression to predict average daily fruit and vegetable consumption as separate dependent variables from the demographic covariates (step 1) and the five personality traits (step 2). Results showed that young adults higher in openness and extraversion, and to some extent conscientiousness, ate more fruits and vegetables than their less open, less extraverted, and less conscientious peers. Neuroticism and agreeableness were unrelated to fruit and vegetable consumption. These associations were unique to eating fruit and vegetables and mostly did not extend to unhealthy foods tested. Young adult women also ate more fruit and vegetables than young adult men. Results suggest that traits associated with greater intellect, curiosity, and social engagement (openness and extraversion), and to a lesser extent, discipline (conscientiousness) are associated with greater plant-food consumption in this population. Findings reinforce the importance of personality in establishing healthy dietary habits in young adulthood that could translate into better health outcomes later in life.

The economic burden of inadequate consumption of vegetables and fruit in Canada.

PubMed

Ekwaru, John Paul; Ohinmaa, Arto; Loehr, Sarah; Setayeshgar, Solmaz; Thanh, Nguyen Xuan; Veugelers, Paul J

2017-02-01

Public health decision makers not only consider health benefits but also economic implications when articulating and issuing lifestyle recommendations. Whereas various estimates exist for the economic burden of physical inactivity, excess body weight and smoking, estimates of the economic burden associated with our diet are rare. In the present study, we estimated the economic burden attributable to the inadequate consumption of vegetables and fruit in Canada. We accessed the Canadian Community Health Survey to assess the inadequacy in the consumption of vegetables and fruit and published meta-analyses to assemble risk estimates for chronic diseases. Based on these inadequacy and risk estimates, we calculated the population-attributable fraction and avoidable direct and indirect costs to society. Direct costs include those for hospital care, physician services and drugs in 2015. About 80 % of women and 89 % of men consume inadequate amounts of vegetables and fruit. We estimated this to result in an economic burden of $CAN 3·3 billion per year, of which 30·5 % is direct health-care costs and 69·5 % is indirect costs due to productivity losses. A modest 1 percentage point annual reduction in the prevalence of inadequate vegetables and fruit consumption over the next 20 years would avoid approximately $CAN 10·8 billion, and an increase of one serving of vegetables and fruit per day would avoid approximately $CAN 9·2 billion. Further investments in the promotion of vegetables and fruit will prevent chronic disease and substantially reduce direct and indirect health-care costs.

Fruit-related terms and images on food packages and advertisements affect children's perceptions of foods' fruit content.

PubMed

Heller, Rebecca; Martin-Biggers, Jennifer; Berhaupt-Glickstein, Amanda; Quick, Virginia; Byrd-Bredbenner, Carol

2015-10-01

To determine whether food label information and advertisements for foods containing no fruit cause children to have a false impression of the foods' fruit content. In the food label condition, a trained researcher showed each child sixteen different food label photographs depicting front-of-food label packages that varied with regard to fruit content (i.e. real fruit v. sham fruit) and label elements. In the food advertisement condition, children viewed sixteen, 30 s television food advertisements with similar fruit content and label elements as in the food label condition. After viewing each food label and advertisement, children responded to the question 'Did they use fruit to make this?' with responses of yes, no or don't know. Schools, day-care centres, after-school programmes and other community groups. Children aged 4-7 years. In the food label condition, χ 2 analysis of within fruit content variation differences indicated children (n 58; mean age 4·2 years) were significantly more accurate in identifying real fruit foods as the label's informational load increased and were least accurate when neither a fruit name nor an image was on the label. Children (n 49; mean age 5·4 years) in the food advertisement condition were more likely to identify real fruit foods when advertisements had fruit images compared with when no image was included, while fruit images in advertisements for sham fruit foods significantly reduced accuracy of responses. Findings suggest that labels and advertisements for sham fruit foods mislead children with regard to the food's real fruit content.

Evolution of the bilaterian body plan: what have we learned from annelids?

NASA Technical Reports Server (NTRS)

Shankland, M.; Seaver, E. C.

2000-01-01

Annelids, unlike their vertebrate or fruit fly cousins, are a bilaterian taxon often overlooked when addressing the question of body plan evolution. However, recent data suggest that annelids offer unique insights on the early evolution of spiral cleavage, anteroposterior axis formation, body axis segmentation, and head versus trunk distinction.

Abscisic acid triggers whole-plant and fruit-specific mechanisms to increase fruit calcium uptake and prevent blossom end rot development in tomato fruit.

PubMed

de Freitas, Sergio Tonetto; Shackel, Kenneth A; Mitcham, Elizabeth J

2011-05-01

Calcium (Ca) uptake into fruit and leaves is dependent on xylemic water movement, and hence presumably driven by transpiration and growth. High leaf transpiration is thought to restrict Ca movement to low-transpiring tomato fruit, which may increase fruit susceptibility to the Ca-deficiency disorder, blossom end rot (BER). The objective of this study was to analyse the effect of reduced leaf transpiration in abscisic acid (ABA)-treated plants on fruit and leaf Ca uptake and BER development. Tomato cultivars Ace 55 (Vf) and AB2 were grown in a greenhouse environment under Ca-deficit conditions and plants were treated weekly after pollination with water (control) or 500 mg l(-1) ABA. BER incidence was completely prevented in the ABA-treated plants and reached values of 30-45% in the water-treated controls. ABA-treated plants had higher stem water potential, lower leaf stomatal conductance, and lower whole-plant water loss than water-treated plants. ABA treatment increased total tissue and apoplastic water-soluble Ca concentrations in the fruit, and decreased Ca concentrations in leaves. In ABA-treated plants, fruit had a higher number of Safranin-O-stained xylem vessels at early stages of growth and development. ABA treatment reduced the phloem/xylem ratio of fruit sap uptake. The results indicate that ABA prevents BER development by increasing fruit Ca uptake, possibly by a combination of whole-plant and fruit-specific mechanisms.

Freeze-frame fruit selection by birds

USGS Publications Warehouse

Foster, Mercedes S.

2008-01-01

The choice of fruits by an avian frugivore is affected by choices it makes at multiple hierarchical levels (e.g., species of fruit, individual tree, individual fruit). Factors that influence those choices vary among levels in the hierarchy and include characteristics of the environment, the tree, and the fruit itself. Feeding experiments with wild-caught birds were conducted at El Tirol, Departamento de Itapua, Paraguay to test whether birds were selecting among individual fruits based on fruit size. Feeding on larger fruits, which have proportionally more pulp, is generally more efficient than feeding on small fruits. In trials (n = 56) with seven species of birds in four families, birds selected larger fruits 86% of the time. However, in only six instances were size differences significant, which is likely a reflection of small sample sizes.

Pepper Weevil (Coleoptera: Curculionidae) Preferences for Specific Pepper Cultivars, Plant Parts, Fruit Colors, Fruit Sizes, and Timing

PubMed Central

Seal, Dakshina R.; Martin, Cliff G.

2016-01-01

Peppers (Capsicum spp.) are an important crop in the USA, with about 32,000 ha cultivated in 2007, which resulted in $588 million in farm revenue. The pepper weevil, Anthonomus eugenii Cano (Coleoptera: Curculionidae), is the most troublesome insect pest of peppers in the southern United States. It is therefore urgent to find different vulnerabilities of pepper cultivars, fruit and plants parts, fruit colors and sizes, and timing to infestation by A. eugenii. Also relevant is testing whether fruit length and infestation state affect fruit numbers, weights, and proportions of fruit that are infested. Counts of A. eugenii adults and marks from oviposition and feeding suggested that C. chinense Jacquin “Habanero” was least susceptible, and C. annuum L. cultivars “SY” and “SR” were most susceptible. Comparison of plant parts and fruit sizes revealed that A. eugenii preferred the peduncle, calyx, and top of pepper fruits over the middle, bottom, leaves, or remainder of flowers. Anthonomus eugenii does not discriminate between green or yellow fruit color nor vary diurnally in numbers. Based on adult counts, medium to extra-large fruits (≥1.5 cm long) attracted more weevils than small fruits (<1.5 cm). However based on proportions of fruit numbers or fruit weights that were infested, there were no differences between large and small fruits. Choice of pepper cultivar can thus be an important part of an IPM cultural control program designed to combat A. eugenii by reduced susceptibility or by synchronous fruit drop of infested fruits. Our results are potentially helpful in developing scouting programs including paying particular attention to the preferred locations of adults and their sites of feeding and oviposition on the fruit. The results also suggested the potential value of spraying when the fruits are still immature to prevent and control infestation. PMID:26959066

Fruit, Vegetable and Dietary Carotenoid Intakes Explain Variation in Skin-Color in Young Caucasian Women: A Cross-Sectional Study.

PubMed

Pezdirc, Kristine; Hutchesson, Melinda J; Whitehead, Ross; Ozakinci, Gozde; Perrett, David; Collins, Clare E

2015-07-15

Fruit and vegetables contain carotenoid pigments, which accumulate in human skin, contributing to its yellowness. This effect has a beneficial impact on appearance. The aim was to evaluate associations between diet (fruit, vegetable and dietary carotenoid intakes) and skin color in young women. Ninety-one Caucasian women (Median and Interquartile Range (IQR) age 22.1 (18.1-29.1) years, BMI 22.9 (18.5-31.9) kg/m2) were recruited from the Hunter region (Australia). Fruit, vegetable and dietary carotenoid intakes were estimated by a validated food frequency questionnaire. Skin color was measured at nine body locations (sun exposed and unexposed sites) using spectrophotometry. Multiple linear regression was used to assess the relationship between fruit and vegetable intakes and skin yellowness adjusting for known confounders. Higher combined fruit and vegetable intakes (β = 0.8, p = 0.017) were associated with higher overall skin yellowness values. Higher fruit combined fruit and vegetable intakes (β = 1.0, p = 0.004) were associated with increased unexposed skin yellowness. Combined fruit and vegetables plus dietary carotenoid intakes contribute to skin yellowness in young Caucasian women. Evaluation of interventions using improvements in appearance as an incentive for increasing fruit and vegetable consumption in young women is warranted.

Fruit, Vegetable and Dietary Carotenoid Intakes Explain Variation in Skin-Color in Young Caucasian Women: A Cross-Sectional Study

PubMed Central

Pezdirc, Kristine; Hutchesson, Melinda J.; Whitehead, Ross; Ozakinci, Gozde; Perrett, David; Collins, Clare E.

2015-01-01

Fruit and vegetables contain carotenoid pigments, which accumulate in human skin, contributing to its yellowness. This effect has a beneficial impact on appearance. The aim was to evaluate associations between diet (fruit, vegetable and dietary carotenoid intakes) and skin color in young women. Ninety-one Caucasian women (Median and Interquartile Range (IQR) age 22.1 (18.1–29.1) years, BMI 22.9 (18.5–31.9) kg/m2) were recruited from the Hunter region (Australia). Fruit, vegetable and dietary carotenoid intakes were estimated by a validated food frequency questionnaire. Skin color was measured at nine body locations (sun exposed and unexposed sites) using spectrophotometry. Multiple linear regression was used to assess the relationship between fruit and vegetable intakes and skin yellowness adjusting for known confounders. Higher combined fruit and vegetable intakes (β = 0.8, p = 0.017) were associated with higher overall skin yellowness values. Higher fruit combined fruit and vegetable intakes (β = 1.0, p = 0.004) were associated with increased unexposed skin yellowness. Combined fruit and vegetables plus dietary carotenoid intakes contribute to skin yellowness in young Caucasian women. Evaluation of interventions using improvements in appearance as an incentive for increasing fruit and vegetable consumption in young women is warranted. PMID:26184306

Exercise in Young Adulthood with Simultaneous and Future Changes in Fruit and Vegetable Intake.

PubMed

Jayawardene, Wasantha P; Torabi, Mohammad R; Lohrmann, David K

2016-01-01

Regarding weight management, changes in exercise behavior can also influence nutrition behavior by application of self-regulatory psychological resources across behaviors (transfer effect). This study aimed to determine: (1) if changes in exercise frequency in young adulthood predict simultaneous changes in fruit/vegetable intake (transfer as co-occurrence); and (2) if exercise frequency affects future fruit/vegetable intake (transfer as carry-over). 6244 respondents of the National Longitudinal Survey of Youth 1997 were followed at ages 18-22 (Time-1), 23-27 (Time-2), and 27-31 (Time-3). Repeated measures analysis of variance and hierarchical multiple regression determined if the change in exercise frequency between Time-1 and Time-2 was associated with simultaneous and sequential changes in fruit/vegetable intake frequency, controlling for sex, race/ethnicity, education, income, body mass index, and baseline fruit/vegetable intake. Only 9% continued exercising for 30 minutes more than 5 days/week, while 15% transitioned to adequate exercise and another 15% transitioned to inadequate exercise; for both fruits and vegetables, intake of once per day or more increased with age. Males were more likely to exercise adequately and females to consume fruits/vegetables adequately. Exercise frequency transition was linearly associated with concurrent fruit/vegetable intake during Time-1 and Time-2. The highest increase in mean fruit/vegetable intake occurred for participants who transitioned from inadequate to adequate exercise. A significant Time-2 exercise frequency effect on Time-3 fruit/vegetable intake emerged, after accounting for baseline intake. Increase in Time-2 exercise by one day/week resulted in increased Time-3 fruit and vegetable intakes by 0.17 and 0.13 times/week, respectively. Transfer effects, although usually discussed in interventions, may also be applicable to voluntary behavior change processes. Newly engaging in and continuing exercise behavior over

Fruit ripening using hyperspectral imaging

NASA Astrophysics Data System (ADS)

., Swetha; Chidangil, Santhosh; Karpate, Tanvi; Asundi, Anand

2017-06-01

The ripening of fruits is associated with changes, in some cases subtle, in the color of the fruit. Traditionally spectroscopy used to measure these subtle changes and infer the ripeness of fruits. Spectrometers provides high-resolution but only measure a small area of the fruit. That might not be a good indicator of the overall ripeness. In this paper, we propose a compact tunable LED based hyper spectral imaging system that scans through a set of wavelengths and images, the reflectance from the whole fruit. Based on the type of fruit, only specific wavelengths need to be scanned. Following a validation using a Rubik's cube, an example banana going through its ripening cycles is used to demonstrate the system.

Environmental Education as a Lived-Body Practice? A Contemplative Pedagogy Perspective

ERIC Educational Resources Information Center

Pulkki, Jani; Dahlin, Bo; Varri, Veli-Matti

2017-01-01

Environmental education usually appeals to the students' knowledge and rational understanding. Even though this is needed, there is a neglected aspect of learning ecologically fruitful action; that of the lived-body. This paper introduces the lived-body as an important site for learning ecological action. An argument is made for the need of a…

Model-assisted analysis of spatial and temporal variations in fruit temperature and transpiration highlighting the role of fruit development.

PubMed

Nordey, Thibault; Léchaudel, Mathieu; Saudreau, Marc; Joas, Jacques; Génard, Michel

2014-01-01

Fruit physiology is strongly affected by both fruit temperature and water losses through transpiration. Fruit temperature and its transpiration vary with environmental factors and fruit characteristics. In line with previous studies, measurements of physical and thermal fruit properties were found to significantly vary between fruit tissues and maturity stages. To study the impact of these variations on fruit temperature and transpiration, a modelling approach was used. A physical model was developed to predict the spatial and temporal variations of fruit temperature and transpiration according to the spatial and temporal variations of environmental factors and thermal and physical fruit properties. Model predictions compared well to temperature measurements on mango fruits, making it possible to accurately simulate the daily temperature variations of the sunny and shaded sides of fruits. Model simulations indicated that fruit development induced an increase in both the temperature gradient within the fruit and fruit water losses, mainly due to fruit expansion. However, the evolution of fruit characteristics has only a very slight impact on the average temperature and the transpiration per surface unit. The importance of temperature and transpiration gradients highlighted in this study made it necessary to take spatial and temporal variations of environmental factors and fruit characteristics into account to model fruit physiology.

Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

PubMed Central

Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

2008-01-01

Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528

Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.

PubMed

Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

2008-02-17

Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.

Phenolic compounds in hawthorn (Crataegus grayana) fruits and leaves and changes during fruit ripening.

PubMed

Liu, Pengzhan; Kallio, Heikki; Yang, Baoru

2011-10-26

Phenolics in the fruits and leaves of Crataegus grayana were identified by HPLC-UV-ESI-MS. The contents of these compounds and their changes during autumn were also analyzed. Epicatechin [1-7 mg/g dry mass (DM) in fruits and 1-10 mg/g DM in leaves), procyanidins B2 (2-4 and 1-8 mg/g DM) and C1 (2-4 and 1-8 mg/g DM), hyperoside (0.5-1 and 2-11 mg/g DM), and a quercetin-pentoside (0.3-0.5 and 2-6 mg/g DM) were the major phenolics in both fruits and leaves. C-Glycosyl flavones were present in leaves (2-5 mg/g DM), whereas only trace levels were found in fruits. Ideain and 5-O-caffeoylquinic acid were found only in fruits. An additional 11 phenolics were identified/tentatively identified. Total phenolic contents reached highest levels by the end of August in fruits and by the end of September in leaves. The compositional profiles of phenolics in fruits and leaves of C. grayana were different from those of other Crataegus species.

How Do Fruits Ripen?

ERIC Educational Resources Information Center

Sargent, Steven A.

2005-01-01

A fruit is alive, and for it to ripen normally, many biochemical reactions must occur in a proper order. After pollination, proper nutrition, growing conditions, and certain plant hormones cause the fruit to develop and grow to proper size. During this time, fruits store energy in the form of starch and sugars, called photosynthates because they…

Satisfying America's Fruit Gap: Summary of an Expert Roundtable on the Role of 100% Fruit Juice.

PubMed

Byrd-Bredbenner, Carol; Ferruzzi, Mario G; Fulgoni, Victor L; Murray, Robert; Pivonka, Elizabeth; Wallace, Taylor C

2017-07-01

The 2015 to 2020 Dietary Guidelines for Americans (DGAs) recognize the role of 100% fruit juice in health and in helping people meet daily fruit recommendations and state that 100% fruit juice is a nutrient-dense beverage that should be a primary choice, along with water and low-fat/fat-free milk. The DGAs note that children are consuming 100% fruit juice within recommendations (that is, 120 to 180 mL/d for children aged 1 to 6 y and 236 to 355 mL/d for children aged 7 to 18 y). Evidence shows that compared to nonconsumers, those who consume 100% fruit juice come closer to meeting daily fruit needs and have better diet quality. In children, 100% fruit juice is associated with increased intakes of nutrients such as vitamin C, folate, and potassium. When consumed within the DGA recommendations, 100% fruit juice is not associated with overweight/obesity or childhood dental caries and does not compromise fiber intake. Preliminary data suggest that polyphenols in some 100% fruit juices may inhibit absorption of naturally occurring sugars. Given its role in promoting health and in helping people meet fruit needs, experts participating in a roundtable discussion agreed that there is no science-based reason to restrict access to 100% fruit juice in public health nutrition policy and programs such as the Special Supplemental Nutrition Program for Women, Infants, and Children (WIC). Reducing or eliminating 100% fruit juice could lead to unintended consequences such as reduced daily fruit intake and increased consumption of less nutritious beverages (for example, sugar-sweetened beverages). © 2017 Institute of Food Technologists®.

Acute and subacute toxicity evaluation of ethanolic extract from fruits of Schinus molle in rats.

PubMed

Ferrero, Adriana; Minetti, Alejandra; Bras, Cristina; Zanetti, Noelia

2007-09-25

Ethanolic and hexanic extracts from fruits and leaves of Schinus molle showed ability to control several insect pests. Potential vertebrate toxicity associated with insecticidal plants requires investigation before institutional promotion. The aim of the present study was to evaluate the acute and subacute toxicity of ethanolic extracts from fruits of Schinus molle in rats. The plant extract was added to the diet at 2g/kg body weight/day during 1 day to evaluate acute toxicity and at 1g/kg body weight/day during 14 days to evaluate subacute toxicity. At the end of the exposure and after 7 days, behavioral and functional parameters in a functional observational battery and motor activity in an open field were assessed. Finally, histopathological examinations were conducted on several organs. In both exposures, an increase in the arousal level was observed in experimental groups. Also, the landing foot splay parameter increased in the experimental group after acute exposure. Only the subacute exposure produced a significant increase in the motor activity in the open field. All these changes disappeared after 7 days. None of the exposures affected the different organs evaluated. Our results suggest that ethanolic extracts from fruits and leaves of Schinus molle should be relatively safe to use as insecticide.

Fruit photosynthesis in Satsuma mandarin.

PubMed

Hiratsuka, Shin; Suzuki, Mayu; Nishimura, Hiroshi; Nada, Kazuyoshi

2015-12-01

To clarify detailed characteristics of fruit photosynthesis, possible gas exchange pathway and photosynthetic response to different environments were investigated in Satsuma mandarin (Citrus unshiu). About 300 mm(-2) stomata were present on fruit surface during young stages (∼10-30 mm diameter fruit) and each stoma increased in size until approximately 88 days after full bloom (DAFB), while the stomata collapsed steadily thereafter; more than 50% stomata deformed at 153 DAFB. The transpiration rate of the fruit appeared to match with stoma development and its intactness rather than the density. Gross photosynthetic rate of the rind increased gradually with increasing CO2 up to 500 ppm but decreased at higher concentrations, which may resemble C4 photosynthesis. In contrast, leaf photosynthesis increased constantly with CO2 increment. Although both fruit and leaf photosynthesis were accelerated by rising photosynthetic photon flux density (PPFD), fruit photosynthesis was greater under considerably lower PPFD from 13.5 to 68 μmolm(-2)s(-1). Thus, Satsuma mandarin fruit appears to incorporate CO2 through fully developed and non-collapsed stomata, and subject it to fruit photosynthesis, which may be characterized as intermediate status among C3, C4 and shade plant photosynthesis. The device of fruit photosynthesis may develop differently from its leaf to capture CO2 efficiently. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Anorexia nervosa and body dysmorphic disorder: A comparison of body image concerns and explicit and implicit attractiveness beliefs.

PubMed

Hartmann, A S; Thomas, J J; Greenberg, J L; Elliott, C M; Matheny, N L; Wilhelm, S

2015-06-01

Although body image is central to the etiological models of anorexia nervosa and body dysmorphic disorder, studies comparing body image and beliefs about attractiveness between the disorders are rare. Sixty-nine individuals (anorexia nervosa: n=24, body dysmorphic disorder: n=23, healthy controls: n=22) completed self-report measures (body image and general psychopathology), diagnostic interviews, and Go/No-Go Association tasks measuring implicit associations. Compared to controls, both clinical groups exhibited greater negative body image, a more negative attitude toward their physical selves, and more dysfunctional coping strategies (ps<.001). Also, both clinical groups shared greater explicit beliefs about the importance of attractiveness (ps<.001). In addition to supporting previous research with regard to comparable body image disturbance, this study also showed that beliefs regarding the importance of appearance (e.g., "one must be attractive to be successful") might be a fruitful target for therapy across both disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluation of oral therapy on Mansonial Schistosomiasis using single dose of Balanites aegyptiaca fruits and praziquantel.

PubMed

Koko, W S; Abdalla, H S; Galal, M; Khalid, H S

2005-01-01

The efficacy of Balanites aegyptiaca fruit mesocarp was compared with praziquantel in mice infected with Sudanese strain of Schistosoma mansoni. Infected mice were given a single dose of 200 mg/kg body weight of B. aegyptiaca fruit mesocarp and 200 mg/kg b.w. of praziquantel after 6 weeks from the onset of the infection. A significant reduction was observed in EPG (egg count per gram of faeces), eggs burden in tissues and recovery of adult worms (P<0.05) for both the plant and the drug-treated animals.

The ORAC/kcal ratio qualifies nutritional and functional properties of fruit juices, nectars, and fruit drinks.

PubMed

Ninfali, Paolino; Chiarabini, Andrea; Angelino, Donato

2014-09-01

Fruit beverages are source of antioxidants, but their sugar content plays an important role in the epidemic of obesity. In this study, we considered 32 fruit beverages consumed in Italy (13 fruit juices, 11 nectars, and 8 fruit drinks), which were analyzed for caloric intake, total phenols (TP), ascorbic acid, and antioxidant capacity (oxygen radical absorbance capacity (ORAC) method). Results showed that the caloric intake was almost completely provided by the sugar content, ranging from 5.5 to 19%. The ORAC/kcal ratio was taken as an indicator of the antioxidant performance of fruit beverages. Fruit juices containing berries, red orange, and goji showed the best performances, together with berries or pears nectars and fruit drinks made with rose hips or tea extracts. The 95% of antioxidant capacity was provided by TP, which showed a significant linear correlation with the net ORAC values. Overall, the results indicate that the ORAC/kcal ratio is a suitable parameter to rank the quality of fruit beverages.

CaGLK2 regulates natural variation of chlorophyll content and fruit color in pepper fruit.

PubMed

Brand, Arnon; Borovsky, Yelena; Hill, Theresa; Rahman, Khalis Afnan Abdul; Bellalou, Aharon; Van Deynze, Allen; Paran, Ilan

2014-10-01

We provide multiple evidences that CaGLK2 underlies a quantitative trait locus controlling natural variation in chlorophyll content and immature fruit color of pepper via modulating chloroplast compartment size. Pepper fruit quality is attributed to a variety of traits, affecting visual appearance, flavor, chemical composition and nutritional value. Among the quality traits, fruit color is of primary importance because the pigments that confer color are associated with nutrition, health and flavor. Although gene models have been proposed for qualitative aspects of fruit color, large natural variation in quantitative pigment content and fruit color exists in pepper. However, its genetic basis is largely unknown which hampers its utilization for plant improvement. We studied the role of GLK2, a GOLDEN2-like transcription factor that regulates chloroplast development in controlling natural variation for chlorophyll content and immature fruit color of pepper. The role of GLK2 in regulating fruit development has been studied previously in tomato using ectopic expression and the uniform ripening mutant analyses. However, pepper provides a unique opportunity to further study the function of this gene because of the wide natural variation of fruit colors in this species. Segregation, sequencing and expression analyses indicated that pepper GLK2 (CaGLK2) corresponds to the recently reported pc10 QTL that controls chloroplast development and chlorophyll content in pepper. CaGLK2 exerts its effect on chloroplast compartment size predominantly during immature fruit development. We show that the genetic background, sequence variation and expression pattern confer a complex and multi-level regulation of CaGLK2 and fruit color in Capsicum. The positive effect on fruit quality predominantly at the green stage conferred by CaGLK2 can be utilized to breed green pepper varieties with improved nutritional values and taste.

Functional Analysis of Mating Type Genes and Transcriptome Analysis during Fruiting Body Development of Botrytis cinerea

PubMed Central

2018-01-01

ABSTRACT Botrytis cinerea is a plant-pathogenic fungus producing apothecia as sexual fruiting bodies. To study the function of mating type (MAT) genes, single-gene deletion mutants were generated in both genes of the MAT1-1 locus and both genes of the MAT1-2 locus. Deletion mutants in two MAT genes were entirely sterile, while mutants in the other two MAT genes were able to develop stipes but never formed an apothecial disk. Little was known about the reprogramming of gene expression during apothecium development. We analyzed transcriptomes of sclerotia, three stages of apothecium development (primordia, stipes, and apothecial disks), and ascospores by RNA sequencing. Ten secondary metabolite gene clusters were upregulated at the onset of sexual development and downregulated in ascospores released from apothecia. Notably, more than 3,900 genes were differentially expressed in ascospores compared to mature apothecial disks. Among the genes that were upregulated in ascospores were numerous genes encoding virulence factors, which reveals that ascospores are transcriptionally primed for infection prior to their arrival on a host plant. Strikingly, the massive transcriptional changes at the initiation and completion of the sexual cycle often affected clusters of genes, rather than randomly dispersed genes. Thirty-five clusters of genes were jointly upregulated during the onset of sexual reproduction, while 99 clusters of genes (comprising >900 genes) were jointly downregulated in ascospores. These transcriptional changes coincided with changes in expression of genes encoding enzymes participating in chromatin organization, hinting at the occurrence of massive epigenetic regulation of gene expression during sexual reproduction. PMID:29440571

Hot-water immersion quarantine treatment against Mediterranean fruit fly and Oriental fruit fly (Diptera: Tephritidae) eggs and larvae in litchi and longan fruit exported from Hawaii.

PubMed

Armstrong, John W; Follett, Peter A

2007-08-01

Immersion of litchi fruit in 49 degrees C water for 20 min followed by hydrocooling in ambient (24 +/- 4 degrees C) temperature water for 20 min was tested as a quarantine treatment against potential infestations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann); and oriental fruit fly, Bactrocera dorsalis Hendel, eggs or larvae in Hawaiian litchi, Litchi chinensis Sonnerat. The 49 degrees C hot-water immersion of litchi provided probit 9 (99.9968% mortality with >95% confidence) quarantine security against eggs and first instars. There were no survivors from 15,000 each feeding and nonfeeding Mediterranean fruit fly or oriental fruit fly third instars immersed in a computer-controlled water bath that simulated the litchi seed-surface temperature profile during the 49 degrees C hot-water immersion treatment. Litchi served as the model for longan, Dimocarpus longan Lour., a closely related fruit that is smaller and also has commercial potential for Hawaii. Modified fruit infestation and holding techniques used to obtain adequate estimated treated populations from poor host fruit, such as litchi and longan, are described. Data from these experiments were used to obtain approval of a hot-water immersion quarantine treatment against fruit flies for litchi and longan exported from Hawaii to the U.S. mainland.

Temperate Tree Fruits

USDA-ARS?s Scientific Manuscript database

North America has four native temperate tree fruit genera that have each played key cultural roles due to their edible fruit, medicinal uses, as well as their value as hardwood: Malus (apple), Prunus (cherry, plum, peach, etc.), Diospyros (persimmon), and Asimina (paw paw). Native North American spe...

Parental Views of Promoting Fruit and Vegetable Intake Among Overweight Preschoolers and School-Aged Children

PubMed Central

Nepper, Martha J.; Chai, Weiwen

2017-01-01

Given the importance of parental influence on children’s eating habits, we explored perceptions of parents of overweight (body mass index–for-age percentile ≥85%) preschoolers (3-5 years) and overweight school-aged children (6-12 years) regarding challenges in promoting fruit and vegetable intake and how they and other family members influence their overweight children’s dietary habits. Focus groups were conducted with 13 parents of overweight preschoolers and 14 parents of overweight school-aged children. Codes and themes were developed by inductive data analysis. Four common themes were identified: short shelf life of fresh fruits and vegetables prohibiting parents from purchasing, children’s taste changes in fruits and vegetables, parents having the primary influence on children’s dietary intake, and wanting fruits and vegetables “ready to go.” Parents of school-aged children were more concerned about their children’s weight, and extended family members negatively influenced children’s dietary intake compared with parents of preschoolers. Our findings provide valuable insight for nutrition/health educators when developing family-based interventions for weight management. PMID:28462357

Simultaneous transcriptome analysis of Colletotrichum gloeosporioides and tomato fruit pathosystem reveals novel fungal pathogenicity and fruit defense strategies.

PubMed

Alkan, Noam; Friedlander, Gilgi; Ment, Dana; Prusky, Dov; Fluhr, Robert

2015-01-01

The fungus Colletotrichum gloeosporioides breaches the fruit cuticle but remains quiescent until fruit ripening signals a switch to necrotrophy, culminating in devastating anthracnose disease. There is a need to understand the distinct fungal arms strategy and the simultaneous fruit response. Transcriptome analysis of fungal-fruit interactions was carried out concurrently in the appressoria, quiescent and necrotrophic stages. Conidia germinating on unripe fruit cuticle showed stage-specific transcription that was accompanied by massive fruit defense responses. The subsequent quiescent stage showed the development of dendritic-like structures and swollen hyphae within the fruit epidermis. The quiescent fungal transcriptome was characterized by activation of chromatin remodeling genes and unsuspected environmental alkalization. Fruit response was portrayed by continued highly integrated massive up-regulation of defense genes. During cuticle infection of green or ripe fruit, fungi recapitulate the same developmental stages but with differing quiescent time spans. The necrotrophic stage showed a dramatic shift in fungal metabolism and up-regulation of pathogenicity factors. Fruit response to necrotrophy showed activation of the salicylic acid pathway, climaxing in cell death. Transcriptome analysis of C. gloeosporioides infection of fruit reveals its distinct stage-specific lifestyle and the concurrent changing fruit response, deepening our perception of the unfolding fungal-fruit arms and defenses race. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Fruit and vegetable consumption and hypertriglyceridemia: Korean National Health and Nutrition Examination Surveys (KNHANES) 2007-2009.

PubMed

Yuan, C; Lee, H-J; Shin, H J; Stampfer, M J; Cho, E

2015-11-01

Limited research has been conducted on the association between intake of fruits and vegetables and hypertriglyceridemia, especially in Asian populations. This study aimed to investigate the association between total fruit and vegetable intake, as well as subgroups of fruit and vegetable intake, with hypertriglyceridemia among Korean adults. We conducted a cross-sectional study of 7934 adults aged 19-64 years from the fourth Korean Health and Nutrition Examination Survey. Fruit and vegetable intake was estimated from a food frequency questionnaire. Subgroups of fruits and vegetables included citrus, non-citrus and carotene-rich fruits and cruciferous, green leafy and carotene-rich vegetables. Hypertriglyceridemia (plasma triglyceride ⩾150 mg/dl) was diagnosed using a blood sample drawn after 12+ hours of fasting. There were 2001 (25.2%) cases of hypertriglyceridemia among the participants. Total fruit intake was significantly inversely associated with the prevalence of hypertriglyceridemia; the multivariate odds ratios (95% confidence intervals) of hypertriglyceridemia across increasing quintiles were 1.00 (ref), 0.76 (0.62, 0.92), 0.72 (0.58, 0.90), 0.68 (0.54, 0.85) and 0.64 (0.49, 0.82; Ptrend=0.001) after controlling for survey year, body mass index, waist circumference, smoking, alcohol drinking, physical activity, education and income. Similar inverse associations were found for all fruit subgroups. However, we found no significant association between intakes of total or subgroups of vegetable and hypertriglyceridemia; the odds ratio for top vs bottom quintile was 1.00 (0.81-1.24) for total vegetable intake. Our findings support a potential beneficial role of fruit consumption to reduce blood triglyceride levels in Asian populations.

Biological Control of Olive Fruit Fly

USDA-ARS?s Scientific Manuscript database

Domestication of olive fruit, Olea europaea L., produced a better host for olive fruit fly, Bactrocera oleae (Gmelin), than wild olives, but fruit domestication reduced natural enemy efficiency. Important factors for selection of natural enemies for control of olive fruit fly include climate matchi...

Fruit Calcium: Transport and Physiology

PubMed Central

Hocking, Bradleigh; Tyerman, Stephen D.; Burton, Rachel A.; Gilliham, Matthew

2016-01-01

Calcium has well-documented roles in plant signaling, water relations and cell wall interactions. Significant research into how calcium impacts these individual processes in various tissues has been carried out; however, the influence of calcium on fruit ripening has not been thoroughly explored. Here, we review the current state of knowledge on how calcium may impact the development, physical traits and disease susceptibility of fruit through facilitating developmental and stress response signaling, stabilizing membranes, influencing water relations and modifying cell wall properties through cross-linking of de-esterified pectins. We explore the involvement of calcium in hormone signaling integral to the physiological mechanisms behind common disorders that have been associated with fruit calcium deficiency (e.g., blossom end rot in tomatoes or bitter pit in apples). This review works toward an improved understanding of how the many roles of calcium interact to influence fruit ripening, and proposes future research directions to fill knowledge gaps. Specifically, we focus mostly on grapes and present a model that integrates existing knowledge around these various functions of calcium in fruit, which provides a basis for understanding the physiological impacts of sub-optimal calcium nutrition in grapes. Calcium accumulation and distribution in fruit is shown to be highly dependent on water delivery and cell wall interactions in the apoplasm. Localized calcium deficiencies observed in particular species or varieties can result from differences in xylem morphology, fruit water relations and pectin composition, and can cause leaky membranes, irregular cell wall softening, impaired hormonal signaling and aberrant fruit development. We propose that the role of apoplasmic calcium-pectin crosslinking, particularly in the xylem, is an understudied area that may have a key influence on fruit water relations. Furthermore, we believe that improved knowledge of the calcium

Evaluating health benefits of various fruits

USDA-ARS?s Scientific Manuscript database

Fruits are an essential part of our daily diets. Most fruits are naturally low in fat, sodium and calories. Fruits are important sources of many nutrients, including potassium, dietary fiber, vitamin C, folic acid and they do not contain cholesterol. Some fruits have laxative effects, prevent uri...

Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

PubMed Central

2010-01-01

Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

21 CFR 150.140 - Fruit jelly.

Code of Federal Regulations, 2014 CFR

2014-04-01

... CONSUMPTION FRUIT BUTTERS, JELLIES, PRESERVES, AND RELATED PRODUCTS Requirements for Specific Standardized Fruit Butters, Jellies, Preserves, and Related Products § 150.140 Fruit jelly. (a) The jellies for which... Section Name of fruit Apple 7.5 Apricot 7.0 Blackberry (other than dewberry) 10.0 Black raspberry 9.0...

21 CFR 150.140 - Fruit jelly.

Code of Federal Regulations, 2011 CFR

2011-04-01

... CONSUMPTION FRUIT BUTTERS, JELLIES, PRESERVES, AND RELATED PRODUCTS Requirements for Specific Standardized Fruit Butters, Jellies, Preserves, and Related Products § 150.140 Fruit jelly. (a) The jellies for which... Section Name of fruit Apple 7.5 Apricot 7.0 Blackberry (other than dewberry) 10.0 Black raspberry 9.0...

Association of raw fruit and fruit juice consumption with blood pressure: the INTERMAP Study1234

PubMed Central

Oude Griep, Linda M; Stamler, Jeremiah; Chan, Queenie; Van Horn, Linda; Steffen, Lyn M; Miura, Katsuyuki; Ueshima, Hirotsugu; Okuda, Nagako; Zhao, Liancheng; Daviglus, Martha L; Elliott, Paul

2013-01-01

Background: Epidemiologic evidence suggests that fruit consumption may lower the risk of cardiovascular diseases through blood pressure (BP)–lowering effects; little is known on the independent effect of raw fruit and fruit juice on BP. Objective: The objective was to quantify associations of raw fruit and fruit juice consumption with BP by using cross-sectional data from the INTERnational study on MAcro/micronutrients and blood Pressure (INTERMAP) of 4680 men and women aged 40–59 y from Japan, China, the United Kingdom, and the United States. Design: During 4 visits, 8 BP, four 24-h dietary recalls, and two 24-h urine samples were collected. Country-specific multivariate-controlled linear regression coefficients, including adjustment for urinary sodium excretion, were estimated and pooled, weighted by inverse of their variance. Results: The average total raw fruit consumption varied from a mean ± SD of 52 ± 65 g/1000 kcal in the United States to 68 ± 70 g/1000 kcal in China. Individual raw fruit intake was not associated with BP in pooled analyses for all countries or in participants from Western countries, although a positive association with diastolic BP was observed in East Asian participants (per 50 g/1000 kcal; 0.37 mm Hg; 95% CI: 0.02, 0.71). Positive relationships with diastolic BP were found for citrus fruit intake in Western consumers (per 25 g/1000 kcal; 0.47 mm Hg; 95% CI: 0.12, 0.81) and for apple intake in East Asian consumers (0.40 mm Hg; 95% CI: 0.03, 0.78). Among East Asian banana consumers, banana intake was inversely associated with diastolic BP (−1.01 mm Hg; 95% CI: −1.88, −0.02). Fruit juice intake, which was negligible in Asia, was not related to BP in Western countries. Conclusion: Consistent associations were not found between raw fruit and fruit juice consumption of individuals and BP. This observational study was registered at www.clinicaltrials.gov as NCT00005271. PMID:23553162

Development of passion fruit juice beverage

NASA Astrophysics Data System (ADS)

Zhu, Xiang-hao; Duan, Zhen-hua; Yang, Yu-xia; Huang, Xin-hui; Xu, Cheng-ling; Huang, Zhi-zhuo

2017-12-01

In this experiment, the whole fruit of passion fruit was used as raw material. The effects of the ratio of material to liquid (RML), the amount of sucrose addition and the pH on the quality of passion fruit juice beverage were investigated by single factor test. And the optimum process conditions of passion fruit juice beverage were determined by orthogonal test. The results show that the optimum process paramenters were as follow: RML was 1:3, pH was 4.0 and sucrose addition was 8%. Under such optimal conditions, the color of passion fruit juice beverage was red, the flavor of passion fruit was rich and it tasted pleasant.

Gene expression in developing watermelon fruit

PubMed Central

Wechter, W Patrick; Levi, Amnon; Harris, Karen R; Davis, Angela R; Fei, Zhangjun; Katzir, Nurit; Giovannoni, James J; Salman-Minkov, Ayelet; Hernandez, Alvaro; Thimmapuram, Jyothi; Tadmor, Yaakov; Portnoy, Vitaly; Trebitsh, Tova

2008-01-01

Background Cultivated watermelon form large fruits that are highly variable in size, shape, color, and content, yet have extremely narrow genetic diversity. Whereas a plethora of genes involved in cell wall metabolism, ethylene biosynthesis, fruit softening, and secondary metabolism during fruit development and ripening have been identified in other plant species, little is known of the genes involved in these processes in watermelon. A microarray and quantitative Real-Time PCR-based study was conducted in watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai var. lanatus] in order to elucidate the flow of events associated with fruit development and ripening in this species. RNA from three different maturation stages of watermelon fruits, as well as leaf, were collected from field grown plants during three consecutive years, and analyzed for gene expression using high-density photolithography microarrays and quantitative PCR. Results High-density photolithography arrays, composed of probes of 832 EST-unigenes from a subtracted, fruit development, cDNA library of watermelon were utilized to examine gene expression at three distinct time-points in watermelon fruit development. Analysis was performed with field-grown fruits over three consecutive growing seasons. Microarray analysis identified three hundred and thirty-five unique ESTs that are differentially regulated by at least two-fold in watermelon fruits during the early, ripening, or mature stage when compared to leaf. Of the 335 ESTs identified, 211 share significant homology with known gene products and 96 had no significant matches with any database accession. Of the modulated watermelon ESTs related to annotated genes, a significant number were found to be associated with or involved in the vascular system, carotenoid biosynthesis, transcriptional regulation, pathogen and stress response, and ethylene biosynthesis. Ethylene bioassays, performed with a closely related watermelon genotype with a similar

Fluoride content in bottled drinking waters, carbonated soft drinks and fruit juices in Davangere city, India.

PubMed

Thippeswamy, H M; Kumar, Nanditha; Anand, S R; Prashant, G M; Chandu, G N

2010-01-01

The regular ingestion of fluoride lowers the prevalence of dental caries. The total daily intake of fluoride for optimal dental health should be 0.05-0.07 mg fluoride/kg body weight and to avoid the risk of dental fluorosis, the daily intake should not exceed a daily level of 0.10 mg fluoride/kg body weight. The main source of fluoride is from drinking water and other beverages. As in other countries, consumption of bottled water, juices and carbonated beverages has increased in our country. To analyze the fluoride content in bottled water, juices and carbonated soft drinks that were commonly available in Davangere city. Three samples of 10 commercially available brands of bottled drinking water, 12 fruit juices and 12 carbonated soft drinks were purchased. Bottled water and carbonated soft drinks were stored at a cold place until fluoride analysis was performed and a clear juice was prepared using different fruits without the addition of water. Then, the fluoride analysis was performed. The mean and standard deviation of fluoride content of bottled water, fruit juices and carbonated soft drinks were measured, which were found to be 0.20 mg (±0.19) F/L, 0.29 mg (±0.06) F/L and 0.22 mg (±0.05) F/L, respectively. In viewing the results of the present study, it can be concluded that regulation of the optimal range of fluoride in bottled drinking water, carbonated soft drinks and fruit juices should be drawn for the Indian scenario.

Yucca brevifolia fruit production, predispersal seed predation, and fruit removal by rodents during two years of contrasting reproduction

USGS Publications Warehouse

Borchert, Mark I.; DeFalco, Lesley

2016-01-01

PREMISE OF THE STUDY: The distribution of Yucca brevifolia, a keystone species of the Mojave Desert, may contract with climate change, yet reproduction and dispersal are poorly understood. We tracked reproduction, seed predation, and fruit dispersal for two years and discuss whether Y. brevifolia is a masting species. METHODS: Fruit maturation, seed predation (larval yucca moths), and fruit dispersal (rodents) were monitored on a random sample of panicles during 2013 and 2014, which were years of high and low reproduction, respectively. Fates of fruits placed on the ground and in canopies were also tracked. Rodents were live-trapped to assess abundance and species composition. KEY RESULTS: In 2013, 66% of inflorescences produced fruit of which 53% escaped larval predation; 19.5% of seeds were destroyed in infested fruits. Total seed production was estimated to be >100 times greater in 2013 than 2014. One-third of the fruit crop fell to the ground and was removed by rodents over the course of 120 d. After ground fruits became scarce, rodents exploited canopy fruits. Rodent numbers were low in 2013, so fruits remained in canopies for 370 d. In 2014, fruit production was approximately 20% lower. Larvae infested the majority of fruits, and almost twice the number of seeds were damaged. Fruits were exploited by rodents within 65 d. CONCLUSIONS: High fertilization, prolific seed production, and low predispersal predation in 2013 suggests that pollinator attraction and satiation of seed predators influence masting in Y. brevifolia. Abundant, prolonged fruit availability to seed-dispersing rodents likely extends recruitment opportunities during mast years.

Health Benefits of Fruits and Vegetables1

PubMed Central

Slavin, Joanne L.; Lloyd, Beate

2012-01-01

Fruits and vegetables are universally promoted as healthy. The Dietary Guidelines for Americans 2010 recommend you make one-half of your plate fruits and vegetables. Myplate.gov also supports that one-half the plate should be fruits and vegetables. Fruits and vegetables include a diverse group of plant foods that vary greatly in content of energy and nutrients. Additionally, fruits and vegetables supply dietary fiber, and fiber intake is linked to lower incidence of cardiovascular disease and obesity. Fruits and vegetables also supply vitamins and minerals to the diet and are sources of phytochemicals that function as antioxidants, phytoestrogens, and antiinflammatory agents and through other protective mechanisms. In this review, we describe the existing dietary guidance on intake of fruits and vegetables. We also review attempts to characterize fruits and vegetables into groups based on similar chemical structures and functions. Differences among fruits and vegetables in nutrient composition are detailed. We summarize the epidemiological and clinical studies on the health benefits of fruits and vegetables. Finally, we discuss the role of fiber in fruits and vegetables in disease prevention. PMID:22797986

A comprehensive survey of fruit grading systems for tropical fruits of Maharashtra.

PubMed

Khoje, Suchitra A; Bodhe, S K

2015-01-01

It is said that the backbone of Indian economy is agriculture. The contribution of the agriculture sector to the national GDP (Gross Domestic Products) was 14.6% in the year 2010. To attain a growth rate equivalent to that of industry (viz., about 9%), it is highly mandatory for Indian agriculture to modernize and use automation at various stages of cultivation and post-harvesting techniques. The use of computers in assessing the quality of fruits is one of the major activities in post-harvesting technology. As of now, this assessment is majorly done manually, except for a few fruits. Currently, the fruit quality assessment by machine vision in India is still at research level. Major research has been carried out in countries like China, Malaysia, UK, and Netherlands. To suit the Indian market and psychology of Indian farmers, it is necessary to develop indigenous technology. This paper is the first step toward evaluating the research carried out by the research community all over world for tropical fruits. For the purpose of survey, we have concentrated on the tropical fruits of the state of Maharashtra, while keeping in focus of the review image processing algorithms.

21 CFR 73.250 - Fruit juice.

Code of Federal Regulations, 2010 CFR

2010-04-01

... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.250 Fruit juice. (a) Identity. (1) The color additive fruit... the water infusion of the dried fruit. The color additive may be concentrated or dried. The definition of fruit juice in this paragraph is for the purpose of identity as a color additive only and shall...

Metabolizable energy in Chinese tallow fruit for Yellow-rumped Warblers, Northern Cardinals, and American Robins

USGS Publications Warehouse

Baldwin, M.J.; Barrow, W.C.; Jeske, C.; Rohwer, F.C.

2008-01-01

The invasive exotic Chinese tallow tree (Triadica sebifera) produces an abundant fruit crop, which is primarily bird-dispersed. The fruit pulp of tallow is lipid-rich, high in saturated fatty acids, and consumed by many bird species. Long-chained fatty acids can be difficult for many birds to digest and we investigated the ability of tallow consumers to assimilate energy in the pulp. We used the total collection method and compared apparent metabolizable energy (AME) of tallow fruit for three species of birds with differing fruit composition in their natural diets. All birds exhibited nitrogen deficits and lost body mass during the trials. Northern Cardinals (Cardinalis cardinalis) lost more mass (8.73%/day) than Yellow-rumped Warblers (Dendroica coronata) (5.29%/day) and American Robins (Turdus migratorius) (5.48%/day), and had larger nitrogen deficits (-120.1 mg N/g diet) than both species as well (-36.4 mg N/g diet and -68.9 mg N/g diet, respectively). Food intake relative to metabolic body mass was highest in Yellow-rumped Warblers (0.70 g-dry/g 0.75??day). Northern Cardinal and American Robin food intake was lower and did not differ from each other (both species: 0.13 g-dry/g 0.75??day). Nitrogen corrected values of AME were used to make species comparisons. Yellow-rumped-Warblers exhibited the highest values of AME (30.00 kJ/g), followed by American Robins (23.90 kJ/g), and Northern Cardinals (14.34 kJ/g). We suggest tallow may be an important winter food source for Yellow-rumped Warblers where their ranges overlap.

Terminalia bellirica (Gaertn.) Roxb. fruit mitigates CCl4 induced oxidative stress and hepatotoxicity in rats.

PubMed

Kuriakose, Jayesh; Lal Raisa, Helen; A, Vysakh; Eldhose, Binil; M S, Latha

2017-09-01

Terminalia bellirica (Gaertn.) Roxb. is a medicinal plant used for the treatment of various ailments in the traditional system of medicine like Ayurveda where it has been prescribed as a rejuvenator and general health tonic. The fruit of the plant is one of the components of the age old ayurvedic formulation-'Triphala'. The present study evaluates curative effect of aqueous acetone extract of Terminalia bellirica fruits (AATB) against CCl 4 induced oxidative stress and liver damage in an animal model. Two doses of the fruit extract (200mg/kg body weight and 400mg/kg body weight) were investigated for the beneficial effects. At the end of the treatment, liver function markers (ALT, AST, ALP, GGT, LDH, total bilirubin, total protein, albumin, globulin, albumin-globulin ratio) as well as hepatic oxidative stress markers (SOD, CAT, GSH) were evaluated. Treatment with AATB significantly restored the parameters towards normal level as compared to the elevated biochemical markers in the CCl 4 treated animals. Reversal to normal tissue architecture was observed in histological evaluation. The results of AATB (400mg/kg) were found comparable with that of standard drug silymarin in all the parameters. The above findings suggest the therapeutic potential of the plant in alleviating hepatic oxidative stress and tissue damage, hence the traditional use of the plant in this regard stands justified. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Microbiological Spoilage of Fruits and Vegetables

NASA Astrophysics Data System (ADS)

Barth, Margaret; Hankinson, Thomas R.; Zhuang, Hong; Breidt, Frederick

Consumption of fruit and vegetable products has dramatically increased in the United States by more than 30% during the past few decades. It is also estimated that about 20% of all fruits and vegetables produced is lost each year due to spoilage. The focus of this chapter is to provide a general background on microbiological spoilage of fruit and vegetable products that are organized in three categories: fresh whole fruits and vegetables, fresh-cut fruits and vegetables, and fermented or acidified vegetable products. This chapter will address characteristics of spoilage microorganisms associated with each of these fruit and vegetable categories including spoilage mechanisms, spoilage defects, prevention and control of spoilage, and methods for detecting spoilage microorganisms.

Immunostimulatory activity of snake fruit (Salacca edulis Reinw.) cultivar Pondoh Hitam extract on the activation of macrophages in vitro

NASA Astrophysics Data System (ADS)

Wijanarti, Sri; Putra, Agus Budiawan Naro; Nishi, Kosuke; Harmayani, Eni; Sugahara, Takuya

2017-05-01

Snake fruit (Salacca edulis Reinw) cultivar Pondoh Hitam is a tropical fruit produced in Indonesia. It is consumed freshly or processed and believed as the most delicious snake fruit cultivar. Snake fruit flesh contains high polisaccharides such as pectin and dietary fiber. Therefore, snake fruit is a potential immunostimulator candidates but the immunological effect of snake fruit flesh has not been reported. In the present study, immunostimulatory activity of snake fruit flesh extract (SFFE) on macrophages activation was evaluated. SFFE was prepared by extracting from snake fruit flesh with water, methanol 70%, and ethanol 70% for 15 h at 4°C. Then obtained SFFE was used to stimulated cytokine production in vitro using J774.1 cell line. The extract giving strongest stimulation was sellected for in vivo assay to stimulate cytokines production and gene expression using peritoneal macrophage (P-mac) of BALB/c mice. The results showed that SFFE exhibited immunostimulatory activities. Immunostimulatory activity could be indicated by macrophages activation characteristics such as cytokines production. Water extract of SFFE gave strongest stimulation on cytokines production in vitro and sellected for in vivo assay. In vivo assay showed that SFFE stimulated cytokines production as well as their gene expression levels. The optimum stimulation was demonstrated by SFFE 16.7 mg/g. Overall findings suggest that SFFE has a potent beneficial effects to promote the body health through activating macrophages.

Yield and fruit quality traits of dragon fruit lines and cultivars grown in Puerto Rico

USDA-ARS?s Scientific Manuscript database

Dragon fruit or pitahaya (Hylocereus undatus and Selenicereus megalanthus) is a member of the Cactaceae family and native to the tropical forest regions of Mexico, Central, and South America. The fruit was practically unknown 15 years ago but it occupies a growing niche in Europe’s exotic fruit mar...

76 FR 18419 - Movement of Hass Avocados From Areas Where Mediterranean Fruit Fly or South American Fruit Fly Exist

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-04

... Avocados From Areas Where Mediterranean Fruit Fly or South American Fruit Fly Exist AGENCY: Animal and... Mediterranean fruit fly quarantined areas in the United States with a certificate if the fruit is safeguarded... quarantine regulations to remove trapping requirements for Mediterranean fruit fly for Hass avocados imported...

[Consumption of fruit juices and fruit drinks: impact on the health of children and teenagers, the dentist's point of view].

PubMed

Catteau, C; Trentesaux, T; Delfosse, C; Rousset, M-M

2012-02-01

The French dietary guidelines published in 2001 recommend daily consumption of 5 portions of fruit or vegetable. Despite this advice, the consumption of fruit in France, especially in the north of France, is low, whereas sale of 100% fruit juices, fruit drinks, and fruit-flavored beverages is increasing. The impact of contemporary changes in beverage patterns on dental caries has received less attention than the impact on childhood obesity. Nevertheless, the cariogenic potential of soft drinks is known. Drinking fruit juices, fruit drinks, or fruit-flavored beverages over a long period of time and continuous sipping could therefore be harmful for the teeth. The aim of this study was to examine the sugar content of such beverages. Four different major supermarkets were visited to select a representative sample of beverages for sale. Fruit juices, nectars, fruit drinks (water and fruit juices) and fruit-flavored waters were included. Lemonades, teas, and drinks containing artificial sweetener were not included. The data were collected in April 2010 by reading nutrition labels. The variables studied were the sugar content (g/100mL), the presence of added sugar, and the percentage of fruit juices. A descriptive analysis of the variables studied was conducted. The mean sugar content of the French population's favorite juices (orange, grapefruit, pineapple, apple, and grape) was compared to the sugar content of a corresponding 100-g portion of fresh fruit. The data were processed using Microsoft Excel. Hundred and eighty-seven different beverages were analyzed: 89 fruit juices, 26 nectars, 51 fruit drinks (sparkling or flat), and 21 fruit-flavored waters. Unlike fruit-flavored waters, nectars and fruit drinks contained fruit juices. Nectars and fruit drinks contained an average of 44.5% (± 10.7%) and 10.5% (± 3.8%) fruit juice, respectively. The sugar content varied from 0 g/100mL to 17.5 g/100mL. The average sugar content was 2.4 (± 2.1) g/100mL, 8.8 (± 2.3) g/100m

Fruit Consumption by Youth in the United States

PubMed Central

Herrick, Kirsten A.; Rossen, Lauren M.; Nielsen, Samara Joy; Branum, Amy M; Ogden, Cynthia L.

2016-01-01

Objectives To describe the contribution of whole fruit, including discrete types of fruit, to total fruit consumption and to investigate differences in consumption by socio-demographic characteristics. Methods We analyzed data from 3129 youth aged 2–19 years, from the National Health and Nutrition Examination Survey, 2011–2012. Using the Food Patterns Equivalents Database (FPED) and the What We Eat in America 150 food groups (WWEIA 150), we calculated the contribution of whole fruit, 100% fruit juices, mixed fruit dishes, and 12 discrete fruit and fruit juices to total fruit consumption. We examined differences by age, sex, race and Hispanic origin, and poverty status. Results Nearly 90% of total fruit intake came from whole fruits (53%) and 100% fruit juices (34%) among youth aged 2–19 y. Apples, apple juice, citrus juice and bananas were responsible for almost half of total fruit consumption. Apples accounted for 18.9% of fruit intake. Differences by age were predominantly between youth aged 2–5 y and 6–11 y. For example, apples contributed a larger percentage of total fruit intake among youth 6–11 y (22.4%) than among youth 2–5 y (14.6%), but apple juice contributed a smaller percentage (8.8% v 16.8%), p<0.05. There were race/Hispanic origin differences in intake of citrus fruits, berries, melons, dried fruit, and citrus juices and other fruit juices. Conclusion These findings provide insight into what fruits U.S. youth are consuming and demographic factors that may influence consumption. PMID:26391940

Uncovering the Molecular Mechanism of Anti-Allergic Activity of Silkworm Pupa-Grown Cordyceps militaris Fruit Body.

PubMed

Wu, Ting-Feng; Chan, Yu-Yi; Shi, Wan-Yin; Jhong, Meng-Ting

2017-01-01

Cordyceps militaris has been widely used as an herbal drug and tonic food in East Asia and has also been recently studied in the West because of its various pharmacological activities such as antitumoral, anti-inflammatory and immunomodulatory effects. In this study, we examined the molecular mechanism underlying the anti-allergic activity of ethanol extract prepared from silkworm pupa-cultivated Cordyceps militaris fruit bodies in activated mast cells. Our results showed that ethanol extract treatment significantly inhibited the release of [Formula: see text]-hexosaminidase (a degranulation marker) and mRNA levels of tumor necrosis factor-[Formula: see text] as well as interleukin-4 in RBL-2H3 cells. The cells were sensitized with 2,4-dinitrophenol specific IgE and then stimulated with human serum albumin conjugated with 2,4-dinitrophenol. Oral administration of 300[Formula: see text]mg/kg ethanol extract significantly ameliorated IgE-induced allergic reaction in mice with passive cutaneous anaphylaxis. Western immunoblotting results demonstrated that ethanol extract incubation significantly inhibited Syk/PI3K/MEKK4/JNK/c-jun biochemical cascade in activated RBL-2H3 cells, which activated the expression of various allergic cytokines. In addition, it suppressed Erk activation and PLC[Formula: see text] evocation, which would respectively evoke the synthesis of lipid mediators and Ca[Formula: see text] mobilization to induce degranulation in stimulated RBL-2H3 cells. A compound, identified as [Formula: see text]-sitostenone, was shown to inhibit [Formula: see text]-hexosaminidase secretion from activated mast cells. Our study demonstrated that ethanol extract contained the ingredients, which could inhibit immediate degranulation and de novo synthesis of allergic lipid mediators and cytokines in activated mast cells.

Berry fruit and nuts: their role in reducing oxidative stress and inflammation in the aging brain

USDA-ARS?s Scientific Manuscript database

Berry fruits and nuts are nutrient dense and contain a variety of bioactive phytochemicals, specifically polyphenols. A growing body of literature describes pre-clinical research, using both in vitro and in vivo techniques, which show beneficial effects of nut and berry consumption on the brain in ...

Health working with industry to promote fruit and vegetables: a case study of the Western Australian Fruit and Vegetable Campaign with reflection on effectiveness of inter-sectoral action.

PubMed

Miller, Margaret; Pollard, Christina

2005-04-01

In 1990, the Department of Health in Western Australia (DOH) initiated a five-year campaign to increase awareness of the need to eat more fruit and vegetables and to encourage increased consumption. This paper describes aspects of the campaign and reviews the strengths and weaknesses of health and fruit and vegetable industry alliances to extend and sustain the campaign. The fruit and vegetable industry was engaged through information sharing, consultation, working groups and joint promotions. The partnership was examined in terms of six inter-sectoral action dimensions (necessity; opportunity and capacity to work together; established relationships for goal achievement; degree of planning; potential for evaluation; and sustainability of action). There were both need and opportunity for each sector to work together. Health had commitment, expertise and resources to plan, implement and evaluate the campaign. Industry had established channels of communication within the supply chain. Sustained health sector presence provided incentive, endorsement and policy direction. Resources and infrastructure limited partnership sustainability. Greatest potential for success occurred when participants' contributions were closely aligned to their core business and there was a body responsible for co-ordinating action.

Effects of NUTRIOSE® dietary fiber supplementation on body weight, body composition, energy intake, and hunger in overweight men.

PubMed

Guerin-Deremaux, Laetitia; Li, Shuguang; Pochat, Marine; Wils, Daniel; Mubasher, Mohamed; Reifer, Cheryl; Miller, Larry E

2011-09-01

The objective of the present study was to determine the effectiveness of a soluble dietary fiber, NUTRIOSE(®), on body weight, body composition, energy intake and hunger in overweight Chinese men. The volunteers were randomized in double-blind fashion to 250 ml fruit juice supplemented with NUTRIOSE(®) (Test, n = 60) or a maltodextrin (Control, n = 60) at a dosage of 17 g twice daily for 12 weeks. Body weight, body composition were performed at 0, 4, 8 and 12 weeks while daily energy intake and hunger were assessed every 3 days. Test subjects had reductions in body weight (1.5 kg, P < 0.001), body mass index (0.5 kg/m(2), P < 0.001) and body fat percentage (0.3%, P < 0.001) versus Controls. NUTRIOSE(®) supplementation resulted in a lower daily energy intake (3,079 kJ/day, P < 0.001) with group differences noted as early as 3 days. Test subjects reported less hunger across the study period versus Controls (P < 0.01). NUTRIOSE(®) supplementation for 12 weeks results in body composition improvements and reduces body weight, energy intake and hunger in overweight men.

Adult Intake of Minimally Processed Fruits and Vegetables: Associations with Cardiometabolic Disease Risk Factors.

PubMed

Cavallo, David N; Horino, Masako; McCarthy, William J

2016-09-01

The US Department of Agriculture launched ChooseMyPlate.gov nutrition recommendations designed to encourage increased fruit and vegetable intake, in part, as a strategy for improving weight control through the consumption of high-satiation foods. The purpose of this cross-sectional study was to assess the relationship between adults' reported daily intake of fruits and nonstarchy vegetables (ie, those thought to have the lowest energy density) expressed as a proportion of their total daily food intake and objectively measured cardiovascular and metabolic disease risk factors using data from the 2009-2010 National Health and Nutrition Examination Survey (NHANES). Physical activity was included as a moderator variable. This study employed a cross-sectional examination of 2009-2010 NHANES data to assess how daily fruit and nonstarchy vegetable intake was associated with anthropometric measures and cardiometabolic blood chemistry markers. Adults free of cardiac or metabolic disease (n=1,197) participated in 24-hour dietary recalls; a variety of cardiometabolic biomarkers and anthropometric measures were also collected from participants. Among participants with complete data on all variables, the ratio of the combined cup-equivalents of fruit and nonstarchy vegetable intake to the total gram weight of all foods consumed daily (F/V ratio) served as the primary independent variable. Main dependent measures included fasting glucose, insulin, glycosylated hemoglobin, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, triglycerides, total cholesterol, waist circumference, and body mass index. Demographic and behavioral predictors of the F/V ratio and the association between the F/V ratio and cardiometabolic disease risk factors were examined using multivariate regression. Body mass index (β=-2.58; 95% CI -3.88 to -1.28), waist circumference (β=-6.33; 95% CI -9.81 to -2.84), and insulin (β=-0.21; 95% CI -0.37 to -0.05) were inversely

Unripe red fruits may be aposematic

PubMed Central

Ne'eman, Gidi; Izhaki, Ido

2009-01-01

The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red while still unripe and then to black or dark blue upon ripening. The red color does not seem to function primarily in dispersal (unless red fruits form advertisement flags when there are already black ripe fruits on the plant) because the red unripe fruits of these species are poisonous, spiny, or unpalatable. The unripe red fruits of Nerium oleander are very poisonous, those of Rhamnus alaternus and Anabasis articulata are moderately poisonous, those of Rubus sanguineus are very sour, those of Pistacia sp. contain unpalatable resin and those of Emex spinosa and Hedysarum spinosissimum are prickly. We propose that these unripe red fruits are aposematic, protecting them from herbivory before seed maturation. PMID:19847110

Unripe red fruits may be aposematic.

PubMed

Lev-Yadun, Simcha; Ne'eman, Gidi; Izhaki, Ido

2009-09-01

The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red while still unripe and then to black or dark blue upon ripening. The red color does not seem to function primarily in dispersal (unless red fruits form advertisement flags when there are already black ripe fruits on the plant) because the red unripe fruits of these species are poisonous, spiny, or unpalatable. The unripe red fruits of Nerium oleander are very poisonous, those of Rhamnus alaternus and Anabasis articulata are moderately poisonous, those of Rubus sanguineus are very sour, those of Pistacia sp. contain unpalatable resin and those of Emex spinosa and Hedysarum spinosissimum are prickly. We propose that these unripe red fruits are aposematic, protecting them from herbivory before seed maturation.

Interaction between juniper Juniperus communis L. and its fruit pest insects: Pest abundance, fruit characteristics and seed viability

NASA Astrophysics Data System (ADS)

García, Daniel

1998-12-01

The relationships between the fruit features of Juniperus communis and the presence of fruit pests were studied in Sierra Nevada, SE Spain. The abundance of two insect species — a pulp-sucking scale and a seed-predator wasp — was surveyed with respect both to fruit characteristics and to viability of seeds contained therein. Seed-predator pressure was not significantly related to any fruit characteristics; however, pulp suckers tended to be more abundant in plants with low pulp: seed ratios and high fruit-water content. In addition, fruits with high levels of pulp-sucker attack tended to have higher water content. A multi-factor ANOVA, considering the identity of the plant and the attack of the different pests as factors, showed that plant identity accounts for most of the variation in fruit characteristics. The viability of seeds tended to be lower in plants strongly attacked by both pests. Fruits attacked by seed predators showed significantly lower proportions of viable and unviable seeds than did unattacked fruits. Seed viability was also lower in those fruits heavily attacked by pulp suckers, but this pattern is strongly mediated by plant identity. Pest activity proved to be clearly associated with a direct decrease in juniper reproductive capacity. This loss involved a reduction of the viable-seed number, mainly related to the seed predator, as well as a reduction of fruit attractiveness to frugivorous dispersers, related to the pulp sucker.

PERCEPTION OF BODY WEIGHT AMONG SAUDI SCHOOL CHILDREN

PubMed Central

Abalkhail, Baha; Shawky, Sherine; Ghabrah, Tawfik

2002-01-01

Objectives: The objectives of this study were to explore the perception of body weight among students in schools in Jeddah City and identify the main determinants of self-perceived obesity, weight management goals and practices. Material and Methods: Data were collected from a sample of Saudi school children of 42 boys’ and 42 girls’ schools in Jeddah city during the month of April 2000. Personal interviews were conducted to collect data on socio-demographic factors, food choices, perception of body weight, weight management goals and weight management practices, as well as the actual measurement of weight and height. Students were asked about their perception of their body weight [responses included: very underweight (thin), slightly underweight, about right weight, slightly overweight and grossly overweight (obese)]. Proportion, prevalence and 95% confidence intervals were calculated. Multiple logistic regression models were fitted to calculate the adjusted odds ratio (OR) for an attempt to lose weight and weight management practices. Results: The distribution of self-perception of body size was nearly similar to the measured body mass index (BMI) classification except for the overweight students, where 21.3% perceived themselves, as slightly overweight and 5.5% as very overweight although 13.4% were actually overweight and 13.5% were obese by BMI standards. Approximately half the students took at least 3 pieces of fruit or fruit juice servings, and a third ate at least 4 vegetable servings per day. A third of the students managed to lose weight. This coincides with the proportion of those actually overweight and obese. Around 28.0% of the students ate less food, fat or calories, 31.0% took exercise and 17.6% were engaged in vigorous exercise to lose weight or prevent weight gain. Staying for at least 24 hours without food which is a potentially harmful means of weight control was practiced by 10.0% of students. Females were less likely than males to be

Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

PubMed

Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena

2012-12-01

Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

Bioactivities and Health Benefits of Wild Fruits

PubMed Central

Li, Ya; Zhang, Jiao-Jiao; Xu, Dong-Ping; Zhou, Tong; Zhou, Yue; Li, Sha; Li, Hua-Bin

2016-01-01

Wild fruits are exotic or underutilized. Wild fruits contain many bioactive compounds, such as anthocyanins and flavonoids. Many studies have shown that wild fruits possess various bioactivities and health benefits, such as free radical scavenging, antioxidant, anti-inflammatory, antimicrobial, and anticancer activity. Therefore, wild fruits have the potential to be developed into functional foods or pharmaceuticals to prevent and treat several chronic diseases. In the present article, we review current knowledge about the bioactivities and health benefits of wild fruits, which is valuable for the exploitation and utilization of wild fruits. PMID:27527154

Multiplex PCR in determination of Opiinae parasitoids of fruit flies, Bactrocera sp., infesting star fruit and guava

PubMed Central

Shariff, S.; Ibrahim, N. J.; Md-Zain, B. M.; Idris, A. B.; Suhana, Y.; Roff, M. N.; Yaakop, S.

2014-01-01

Abstract Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b . Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs

Multiplex PCR in determination of Opiinae parasitoids of fruit flies, Bactrocera sp., infesting star fruit and guava.

PubMed

Shariff, S; Ibrahim, N J; Md-Zain, B M; Idris, A B; Suhana, Y; Roff, M N; Yaakop, S

2014-01-23

Malaysia is a tropical country that produces commercial fruits, including star fruits, Averrhoa carambola L. (Oxalidales: Oxalidaceae), and guavas, Psidium guajava L. (Myrtales: Myrtaceae). There is a high demand for these fruits, and they are planted for both local consumption and export purposes. Unfortunately, there has been a gradual reduction of these fruits, which has been shown to be related to fruit fly infestation, especially from the Bactrocera species. Most parasitic wasps (Hymenoptera: Braconidae: Opiinae) are known as parasitoids of fruit fly larvae. In this study, star fruits and guavas infested by fruit fry larvae were collected from the Malaysian Agricultural Research and Development Institute. The parasitized larvae were reared under laboratory conditions until the emergence of adult parasitoids. Multiplex PCR was performed to determine the braconid species using two mitochondrial DNA markers, namely cytochrome oxidase subunit I and cytochrome b. Two benefits of using multiplex PCR are the targeted bands can be amplified simultaneously using the same reaction and the identification process of the braconid species can be done accurately and rapidly. The species of fruit flies were confirmed using the COI marker. The results obtained from our study show that Diachasmimorpha longicaudata (Ashmead) (Hymenoptera: Braconidae), Fopius arisanus (Sonan), and Pysttalia incisi (Silvestri) were parasitoids associated with Bactrocera carambolae (Drew and Hancock) (Diptera: Tephritidae) infested star fruits. Fopius arisanus was also the parasitoid associated with Bactrocera papayae (Drew and Hancock) infested guavas. Maximum parsimony was been constructed in Opiinae species to compare tree resolution between these two genes in differentiating among closely related species. The confirmation of the relationship between braconids and fruit fly species is very important, recognized as preliminary data, and highly necessary in biological control programs. This is an

From root to fruit: RNA-Seq analysis shows that arbuscular mycorrhizal symbiosis may affect tomato fruit metabolism.

PubMed

Zouari, Inès; Salvioli, Alessandra; Chialva, Matteo; Novero, Mara; Miozzi, Laura; Tenore, Gian Carlo; Bagnaresi, Paolo; Bonfante, Paola

2014-03-21

Tomato (Solanum lycopersicum) establishes a beneficial symbiosis with arbuscular mycorrhizal (AM) fungi. The formation of the mycorrhizal association in the roots leads to plant-wide modulation of gene expression. To understand the systemic effect of the fungal symbiosis on the tomato fruit, we used RNA-Seq to perform global transcriptome profiling on Moneymaker tomato fruits at the turning ripening stage. Fruits were collected at 55 days after flowering, from plants colonized with Funneliformis mosseae and from control plants, which were fertilized to avoid responses related to nutrient deficiency. Transcriptome analysis identified 712 genes that are differentially expressed in fruits from mycorrhizal and control plants. Gene Ontology (GO) enrichment analysis of these genes showed 81 overrepresented functional GO classes. Up-regulated GO classes include photosynthesis, stress response, transport, amino acid synthesis and carbohydrate metabolism functions, suggesting a general impact of fungal symbiosis on primary metabolisms and, particularly, on mineral nutrition. Down-regulated GO classes include cell wall, metabolism and ethylene response pathways. Quantitative RT-PCR validated the RNA-Seq results for 12 genes out of 14 when tested at three fruit ripening stages, mature green, breaker and turning. Quantification of fruit nutraceutical and mineral contents produced values consistent with the expression changes observed by RNA-Seq analysis. This RNA-Seq profiling produced a novel data set that explores the intersection of mycorrhization and fruit development. We found that the fruits of mycorrhizal plants show two transcriptomic "signatures": genes characteristic of a climacteric fleshy fruit, and genes characteristic of mycorrhizal status, like phosphate and sulphate transporters. Moreover, mycorrhizal plants under low nutrient conditions produce fruits with a nutrient content similar to those from non-mycorrhizal plants under high nutrient conditions

Why fruits go to the dark side

NASA Astrophysics Data System (ADS)

Schaefer, H. Martin

2011-11-01

The colours of fleshy fruits are usually attributed to attract seed dispersers to the plant. A cursory look at the gaudy colours of fleshy fruits on offer in a local fruit stall gives the impression that plants use primarily bright colours to attract fruit consumer. This impression is misleading; many small fruits 'go to the dark side' and become dark purple or black when ripe. Intermingled in foliage, these colours, which are produced by anthocyanins, can be fairly inconspicuous and are thus not easily reconciled with a signalling function to attract seed dispersers. In this review I therefore discuss complementary hypotheses on the function and evolution of fruit colouration. First, I focus on the evidence that fruit colours indeed function as signals to attract seed dispersers. I then show that anthocyanins, the most prevalent fruit pigments, are important dietary antioxidants that can be selected by blackcaps ( Sylvia atricapilla) which are important avian seed dispersers of many European plants. Moreover, the consumption of anthocyanins increases the likelihood that blackcaps mount an immune response during immune challenges. As a next step, I review evidence that anthocyanins accumulate in fruit skin in response to abiotic factors, in particular high illumination coupled with low temperature favour the increase of anthocyanins. Finally, I show that anthocyanins can also be selected for by fruit antagonists, consumers that do not disperse seeds. In particular, high contents of anthocyanins strongly reduce fungal growth in fruit tissue. Taken together, there are various selective pressures which likely influence fruit colour evolution. Currently, the relative importance of each of these selective agents is unknown. There is consequently a need to develop a more encompassing framework on fruit colour evolution.

Effects of ethanol on food consumption and skin temperature in the Egyptian fruit bat (Rousettus aegyptiacus).

PubMed

Korine, Carmi; Sánchez, Francisco; Pinshow, Berry

2011-09-01

Since mammalian frugivores generally choose to eat ripe fruit in which ethanol concentration ([EtOH]) increases as the fruit ripens, we asked whether ethanol acts as an appetitive stimulant in the Egyptian fruit bat, Rousettus aegyptiacus, and also studied the effects of ethanol on their skin temperature (T(s)). We hypothesized that the responses of fruit bats to dietary ethanol are concentration dependent and tested the predictions that the bats' response is positive, i.e., they eat more when [EtOH] in the food is in the range found in naturally ripe fruit, while it negatively affects them at higher concentrations. We also tested the prediction that in winter, even when availability of fruit is low and thermoregulatory costs are high, ingestion of ethanol by fruit bats is low because assimilated ethanol reduces shivering thermogenesis and peripheral vasodilation; these, alone or together, are detrimental to the maintenance of body temperature (T(b)). In summer, captive bats offered food containing 0.1% ethanol significantly increased consumption over food with no ethanol; they did not change consumption when food contained 0.01, 0.3, or 0.5% ethanol; but significantly decreased consumption at higher levels of ethanol [EtOH], i.e., 1 and 2%. In winter, captive bats ate significantly less when their food contained 0.1% ethanol than when it contained 0, 0.3, or 0.5%. During summer, freshly caught bats ate significantly more ethanol-containing food than freshly caught bats in winter. Skin temperature (T(s)) in Egyptian fruit bats decreased significantly at an ambient temperature (T(a)) of 12 °C (winter conditions) after gavage with liquid food containing 1% ethanol. The effect was clearly temperature-dependent, since ethanol did not have the same effect on bats gavaged with food containing 1% or no ethanol at a T(a) of 25 °C (summer conditions). In conclusion, ethanol may act as an appetitive stimulant for Egyptian fruit bats at low concentrations, but only in

Association between Dietary Patterns and Body Composition in a Group or Puerto Rican Obese Adults: a Pilot Study

PubMed Central

Soltero, Sandra M.; Palacios, Cristina

2012-01-01

Objective Obesity is a public health problem in Puerto Rico. Dietary patterns that include high intakes of energy and sweetened drinks and low consumption of fruits, vegetables and fiber are associated with obesity. The aim of this study is to relate dietary patterns with body composition in obese subjects. Methods Dietary patterns were evaluated using 3-day food records. Body composition was assessed by body weight, hip and waist circumferences and % body fat, and then used to classify subjects by obesity stages using BMI and by low or high risk using WHR or % body fat. The resulting comparison groups were associated with energy, macronutrients, fruits, vegetables, fiber, and sweetened drinks intake and with meal energy density and meal frequency intake. Kruskal Wallis and Mann Whitney tests were used to compare groups and Spearman correlations were used for continuous variables. Results Thirty subjects completed the study. By BMI, 30% were obese type I, 33% type II and 37% type III; by WHR, 43% were low risk and 57% high risk; by % body fat, all were high risk. Dietary patterns were similar between groups. WHR was positively correlated with fiber consumption (r=0.42; p<0.05) and CHO intake (r=0.35; p=0.057). Conclusion In this pilot study, dietary patterns appeared similar between groups and sound with nutritional recommendations; however, we observed a poor quality of the diet due to very low intakes of fruits, vegetables and fiber and high intakes of sweetened drinks. PMID:21449494

Fruit and vegetables and cancer risk.

PubMed

Key, T J

2011-01-04

The possibility that fruit and vegetables may help to reduce the risk of cancer has been studied for over 30 years, but no protective effects have been firmly established. For cancers of the upper gastrointestinal tract, epidemiological studies have generally observed that people with a relatively high intake of fruit and vegetables have a moderately reduced risk, but these observations must be interpreted cautiously because of potential confounding by smoking and alcohol. For lung cancer, recent large prospective analyses with detailed adjustment for smoking have not shown a convincing association between fruit and vegetable intake and reduced risk. For other common cancers, including colorectal, breast and prostate cancer, epidemiological studies suggest little or no association between total fruit and vegetable consumption and risk. It is still possible that there are benefits to be identified: there could be benefits in populations with low average intakes of fruit and vegetables, such that those eating moderate amounts have a lower cancer risk than those eating very low amounts, and there could also be effects of particular nutrients in certain fruits and vegetables, as fruit and vegetables have very varied composition. Nutritional principles indicate that healthy diets should include at least moderate amounts of fruit and vegetables, but the available data suggest that general increases in fruit and vegetable intake would not have much effect on cancer rates, at least in well-nourished populations. Current advice in relation to diet and cancer should include the recommendation to consume adequate amounts of fruit and vegetables, but should put most emphasis on the well-established adverse effects of obesity and high alcohol intakes.

Fruit and vegetables and cancer risk

PubMed Central

Key, T J

2011-01-01

The possibility that fruit and vegetables may help to reduce the risk of cancer has been studied for over 30 years, but no protective effects have been firmly established. For cancers of the upper gastrointestinal tract, epidemiological studies have generally observed that people with a relatively high intake of fruit and vegetables have a moderately reduced risk, but these observations must be interpreted cautiously because of potential confounding by smoking and alcohol. For lung cancer, recent large prospective analyses with detailed adjustment for smoking have not shown a convincing association between fruit and vegetable intake and reduced risk. For other common cancers, including colorectal, breast and prostate cancer, epidemiological studies suggest little or no association between total fruit and vegetable consumption and risk. It is still possible that there are benefits to be identified: there could be benefits in populations with low average intakes of fruit and vegetables, such that those eating moderate amounts have a lower cancer risk than those eating very low amounts, and there could also be effects of particular nutrients in certain fruits and vegetables, as fruit and vegetables have very varied composition. Nutritional principles indicate that healthy diets should include at least moderate amounts of fruit and vegetables, but the available data suggest that general increases in fruit and vegetable intake would not have much effect on cancer rates, at least in well-nourished populations. Current advice in relation to diet and cancer should include the recommendation to consume adequate amounts of fruit and vegetables, but should put most emphasis on the well-established adverse effects of obesity and high alcohol intakes. PMID:21119663

Differences in water soluble non-digestible polysaccharides and anti-inflammatory activities of fruiting bodies from two cultivated Xylaria nigripes strains.

PubMed

Chen, Ching-Fu; Su, Chun-Han; Lai, Ming-Nan; Ng, Lean-Teik

2018-05-12

Polysaccharides including β-glucans are important bioactive components of mushroom. Xylaria nigripes is a popular medicinal fungus that has been used for treating trauma, insomnia and mental illness. This study examined the physicochemical characteristics and anti-inflammatory activities of water soluble non-digestible polysaccharides (TXNP and CXNP) from fruiting bodies of two cultivated X. nigripes strains (TXN and CXN). Results showed that both TXNP and CXNP possessed relatively similar FT-IR spectra. TXNP had a triple helix conformation and molecular weight of 853.8 kDa, whereas the molecular weight of CXNP was 14.7 kDa. The monosaccharide composition of TXNP was predominantly glucose, whereas CXNP contained xylose, mannose and glucose. Although both TXNP and CXNP dose-dependently suppressed the production of NO, IL-1β, TNF-α and PGE2, as well as the expression of iNOS, COX-2 and NF-κB in the lipopolysaccharide-induced RAW264.7 macrophages, the potency of TXNP was stronger. This study reveals that under similar conditions of cultivation and extraction procedures, the different physicochemical characteristics of polysaccharides from TXN and CXN may have contributed to the differences in their anti-inflammatory potency. Copyright © 2018. Published by Elsevier B.V.

Chemistry, Nutrition, and Health-Promoting Properties of Hericium erinaceus (Lion's Mane) Mushroom Fruiting Bodies and Mycelia and Their Bioactive Compounds.

PubMed

Friedman, Mendel

2015-08-19

The culinary and medicinal mushroom Hericium erinaceus is widely consumed in Asian countries, but apparently not in the United States, for its nutritional and health benefits. To stimulate broader interest in the reported beneficial properties, this overview surveys and consolidates the widely scattered literature on the chemistry (isolation and structural characterization) of polysaccharides and secondary metabolites such as erinacines, hericerins, hericenones, resorcinols, steroids, mono- and diterpenes, and volatile aroma compounds, nutritional composition, food and industrial uses, and exceptional nutritional and health-promoting aspects of H. erinaceus. The reported health-promoting properties of the mushroom fruit bodies, mycelia, and bioactive pure compounds include antibiotic, anticarcinogenic, antidiabetic, antifatigue, antihypertensive, antihyperlipodemic, antisenescence, cardioprotective, hepatoprotective, nephroprotective, and neuroprotective properties and improvement of anxiety, cognitive function, and depression. The described anti-inflammatory, antioxidative, and immunostimulating properties in cells, animals, and humans seem to be responsible for the multiple health-promoting properties. A wide range of research advances and techniques are described and evaluated. The collated information and suggestion for further research might facilitate and guide further studies to optimize the use of the whole mushrooms and about 70 characterized actual and potential bioactive secondary metabolites to help prevent or treat human chronic, cognitive, and neurological diseases.

Prenatal toxicity test of Morinda citrifolia (noni) fruit.

PubMed

West, Brett J; Su, Chen X; Jensen, C Jarakae

2008-12-01

Morinda citrifolia (noni) fruit juice use has increased greatly within the past decade, with more than 80,000,000 liters being consumed world wide. With increasing widespread use and the potential use among pregnant women, a prenatal developmental toxicity test was conducted to further evaluate the safety of noni juice. Freeze-dried noni fruit puree from French Polynesia was administered daily by gastric intubation to separate dose groups (n = 12) of pregnant Sprague Dawley rats at 1.72, 3.43, and 6.86 g/kg body weight, with a control group receiving water in place of noni. The dose schedule was followed from the first day of gestation until one day prior to expected delivery, 21 days. There were no symptoms of toxicity in the pregnant dams. There was no difference between the control and any noni group in the number of live fetuses, resorptions, fetal weight and length, or skeletal abnormalities. No dead fetuses, gross external malformations, or internal organ defects were observed in any group. These findings do not indicate that toxicity from noni juice to developing embryos and fetuses is expected.

Mercury in fruiting bodies of dark honey fungus (Armillaria solidipes) and beneath substratum soils collected from spatially distant areas.

PubMed

Falandysz, Jerzy; Mazur, Aneta; Kojta, Anna K; Jarzyńska, Grażyna; Drewnowska, Małgorzata; Dryżałowska, Anna; Nnorom, Innocent C

2013-03-15

This paper reports data on bioconcentration potential and baseline mercury concentrations of fruiting bodies of dark honey fungus (Armillaria solidipes) Peck and soil substrate layer (0-10 cm) from 12 spatially distant sites across Poland. Mercury content of caps, stipes and soil samples were determined using validated analytical procedure including cold-vapor atomic absorption spectroscopy after thermal decomposition of the sample matrix and further amalgamation and desorption of mercury from gold wool. Mean mercury concentrations ranged from 20 ± 8 to 300 ± 70 ng g(-1) dry weight (dw) in caps, from 20 ± 6 to 160 ± 40 ng g(-1) dw in stipes, and in underlying soil were from 20 ± 2 to 100 ± 130 ng g(-1) dw. The results showed that stipes mercury concentrations were 1.1- to 1.7-fold lower than those of caps. All caps and the majority of stipes were characterized by bioconcentration factor values > 1, indicating that dark honey fungus can be characterized as a moderate mercury accumulator. Occasional or relatively frequent eating of meals including caps of dark honey fungus is considered safe in view of the low total mercury content, and the mercury intake rates are below the current reference dose and provisionally tolerable weekly intake limits for this hazardous metal. © 2012 Society of Chemical Industry.

Longitudinal Associations Between Observed and Perceived Neighborhood Food Availability and Body Mass Index in a Multiethnic Urban Sample.

PubMed

Zenk, Shannon N; Mentz, Graciela; Schulz, Amy J; Johnson-Lawrence, Vicki; Gaines, Causandra R

2017-02-01

Blacks, Hispanics, and women of lower socioeconomic status tend to have a higher risk of obesity. Numerous studies over the past decade examined the role of the neighborhood food environment in body weight. However, few were longitudinal. This longitudinal study examined whether multiple measures of neighborhood food availability were associated with body mass index (BMI) in a predominately Black and Hispanic adult sample living in low- to moderate-income urban neighborhoods. This longitudinal study used two waves of data (2002, 2008), including interviewer-measured height and weight, from a community survey of adults ( n = 219). In both 2002 and 2008, multiple measures characterized neighborhood food availability: GIS-derived availability of retail food outlets (large grocery store, small grocery store, convenience store, liquor stores), observed fruit and vegetable availability (count of stores selling 10 or more fresh fruit or vegetable varieties), and perceived fruit and vegetable access. Random intercept models estimated multivariable associations, controlling for individual-level demographics and neighborhood median household income. Small grocery store availability was associated with 1.22-unit increase in BMI ( p = .047), while each unit increase in perceived fruit and vegetable access was associated with a 0.69-unit decrease in BMI ( p = .055). BMI was not associated with large grocery store, convenience store, or liquor store availability, or with observed fruit and vegetable availability. Findings suggest that improving the neighborhood food environment, particularly at small grocery stores, may help urban residents living in low- to moderate-income neighborhoods achieve healthier body weights over time.

[Association between fruit availability at home and fruit-related eating behavior among sixth-grade schoolchildren in Sakado City, Japan].

PubMed

Takamura, Miho; Okubo, Hitomi; Sasaki, Satoshi; Takemi, Yukari

2010-03-01

The recommended daily intake of fruits in Japan is 200 g, but average actual intake is much lower. We examined associations between self-reported fruit availability at home and fruit-related eating behavior among sixth-grade schoolchildren in Sakado City, Saitama Prefecture, Japan. As part of a larger study of school children in Sakado City, 659 sixth-grade from all 13 primary schools in the city completed a survey in their classroom in October 2007 (valid respondent rate 92%). Dietary intake over the previous 1-month period was assessed with a brief, self-administered diet history questionnaires for 10-year-olds. A second questionnaire also assessed health, dietary knowledge, attitudes and behaviors, and perceived food availability at home. Children reported fruit availability at home using the four options of always, often, sometimes, or never. Associations between fruit availability at home and fruit-related eating behaviors were statistically tested, including perception of the importance of and self-efficacy in eating fruits for health as well as the frequency of eating fruit by children and their family, with all analyses conducted separately by gender. Mean fruit intake was the highest among those children who reported that fruits were always available at home (boys 54 g/1,000 kcal, girls 65 g/1,000 kcal), followed by those reporting availability as often (31 g/1,000 kcal, 37 g/1,000 kcal), sometimes (16 g/1,000 kcal, 13 g/1,000 kcal), or never (9 g/1,000 kcal, 12 g/1,000 kcal). Availability was positively associated with intake (P for trend < 0.001). Additionally, it was positively associated with childrens' perception of the importance of eating fruit for better health (boys only, P < 0.001), self-efficacy in eating more fruit (P < 0.001), and the family frequency of eating fruit (P < 0.001). These findings suggest that fruit availability at home is a significant factor in fruit-related eating behavior, consistent with results of similar studies in western

Evaluations of the health benefits of eating more fruit depend on the amount of fruit previously eaten, variety, and timing.

PubMed

Burns, Rachel J; Rothman, Alexander J

2016-10-01

Though research has demonstrated that people generally perceive fruits to be healthy foods, little is known about how people think about the health benefits associated with eating increasing quantities of fruit. The purpose of this paper is to examine how evaluations of healthiness change as participants consider eating increasing quantities of fruit, and to explore how additional contextual features (i.e., variety and timing) can be leveraged to improve evaluations. In two within-subjects experiments, participants rated how good or bad for one's health it would be to eat increasing quantities of either the same fruit or a variety of fruits. In study 1, all participants were instructed to imagine eating the fruit over the course of the day. In study 2, the temporal distribution of the fruit (throughout the day, during a single meal) was manipulated. In general, both studies demonstrated that evaluations of overall healthiness for eating increasing quantities of the same fruit tended to diminish beyond two pieces of fruit, whereas the overall healthiness of eating increasing quantities of a variety of fruit remained stable. Study 2 demonstrated that evaluations of healthiness increased as additional fruit was considered when a variety of fruit was imagined to be eaten throughout the day. Thus, the health benefits that people assign to eating increasing quantities of fruit seem to increase, but only if eating a variety of fruits throughout the day is considered. This study suggests that evaluations of the healthiness of fruit are not made in isolation; evaluations of healthiness are contextualized by what has been eaten previously and when it was eaten. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fruit and vegetable consumption is inversely associated with having pancreatic cancer.

PubMed

Jansen, Rick J; Robinson, Dennis P; Stolzenberg-Solomon, Rachael Z; Bamlet, William R; de Andrade, Mariza; Oberg, Ann L; Hammer, Traci J; Rabe, Kari G; Anderson, Kristin E; Olson, Janet E; Sinha, Rashmi; Petersen, Gloria M

2011-12-01

Studies on fruit, vegetable, fiber, and grain consumption and pancreatic cancer risk are inconclusive. We used a clinic-based case-control study specifically designed to address limitations of both cohort and case-control studies to examine the relationship. Participants were excluded who reported changing their diet within 5 years prior to study entry. And 384 rapidly ascertained cases and 983 controls (frequency matched on age (±5 years), race, sex, and residence) completed epidemiologic surveys and 144-item food frequency questionnaires. Odds ratios (OR) and 95% confidence intervals were calculated using logistic regression adjusted for age, sex, smoking, body mass index, energy intake, and alcohol consumption. Comparing highest to lowest quintiles, we observed significant inverse associations (OR < 0.8) with significant trends (p (trend) < 0.05) for citrus, melon, and berries, other fruits, dark green vegetables, deep yellow vegetables, tomato, other vegetables, dry bean and pea, insoluble fiber, soluble fiber, whole grains, and orange/grapefruit juice, and an increased association with non-whole grains. Results were similar after adjusting for diabetes or total sugar intake. We provide evidence that lower consumption of fruits, vegetables, whole grains, and fiber is associated with having pancreatic cancer. This may have a role in developing prevention strategies.

Fruit and vegetable consumption is inversely associated with having pancreatic cancer

PubMed Central

Robinson, Dennis P.; Stolzenberg-Solomon, Rachael Z.; Bamlet, William R.; de Andrade, Mariza; Oberg, Ann L.; Hammer, Traci J.; Rabe, Kari G.; Anderson, Kristin E.; Olson, Janet E.; Sinha, Rashmi; Petersen, Gloria M.

2012-01-01

Objective Studies on fruit, vegetable, fiber, and grain consumption and pancreatic cancer risk are inconclusive. We used a clinic-based case–control study specifically designed to address limitations of both cohort and case–control studies to examine the relationship. Methods Participants were excluded who reported changing their diet within 5 years prior to study entry. And 384 rapidly ascertained cases and 983 controls (frequency matched on age (±5 years), race, sex, and residence) completed epidemiologic surveys and 144-item food frequency questionnaires. Odds ratios (OR) and 95% confidence intervals were calculated using logistic regression adjusted for age, sex, smoking, body mass index, energy intake, and alcohol consumption. Results Comparing highest to lowest quintiles, we observed significant inverse associations (OR < 0.8) with significant trends (ptrend < 0.05) for citrus, melon, and berries, other fruits, dark green vegetables, deep yellow vegetables, tomato, other vegetables, dry bean and pea, insoluble fiber, soluble fiber, whole grains, and orange/grapefruit juice, and an increased association with non-whole grains. Results were similar after adjusting for diabetes or total sugar intake. Conclusions We provide evidence that lower consumption of fruits, vegetables, whole grains, and fiber is associated with having pancreatic cancer. This may have a role in developing prevention strategies. PMID:21915615

Comparative Transcriptome Analysis of Climacteric Fruit of Chinese Pear (Pyrus ussuriensis) Reveals New Insights into Fruit Ripening

PubMed Central

Tan, Dongmei; Jiang, Zhongyu; Wei, Yun; Li, Juncai; Wang, Aide

2014-01-01

The fruit of Pyrus ussuriensis is typically climacteric. During ripening, the fruits produce a large amount of ethylene, and their firmness drops rapidly. Although the molecular basis of climacteric fruit ripening has been studied in depth, some aspects remain unclear. Here, we compared the transcriptomes of pre- and post-climacteric fruits of Chinese pear (P. ussuriensis c.v. Nanguo) using RNA-seq. In total, 3,279 unigenes were differentially expressed between the pre- and post-climacteric fruits. Differentially expressed genes (DEGs) were subjected to Gene Ontology analysis, and 31 categories were significantly enriched in the groups ‘biological process’, ‘molecular function’ and ‘cellular component’. The DEGs included genes related to plant hormones, such as ethylene, ABA, auxin, GA and brassinosteroid, and transcription factors, such as MADS, NAC, WRKY and HSF. Moreover, genes encoding enzymes related to DNA methylation, cytoskeletal proteins and heat shock proteins (HSPs) showed differential expression between the pre- and post-climacteric fruits. Select DEGs were subjected to further analysis using quantitative RT-PCR (qRT-PCR), and the results were consistent with those of RNA-seq. Our data suggest that in addition to ethylene, other hormones play important roles in regulating fruit ripening and may interact with ethylene signaling during this process. DNA methylation-related methyltransferase and cytoskeletal protein genes are also involved in fruit ripening. Our results provide useful information for future research on pear fruit ripening. PMID:25215597

Changing how I feel about the food: experimentally manipulated affective associations with fruits change fruit choice behaviors.

PubMed

Walsh, Erin M; Kiviniemi, Marc T

2014-04-01

Fewer than half of Americans meet current recommendations for fruit and vegetable intake. The behavioral affective associations model posits that feelings and emotions associated with a behavior are a proximal influence on decision making. Cross-sectional evidence supports the model and suggests that affective associations predict fruit and vegetable consumption. The purpose of this study was to test whether a causal relation exists between affective associations about fruits and future fruit consumption behavior, as measured by a snack selection task. Following a baseline assessment of cognitive and affective variables, participants' (N = 161) affective associations about fruits were experimentally manipulated with an implicit priming paradigm. Images of fruits were repeatedly paired with positive, negative, or neutral affective stimuli. The key outcome measure was a behavioral choice task in which participants chose between fruit and a granola bar. Participants in the positive prime condition were three times more likely than those in the negative condition to select a piece of fruit over the granola bar alternative in the snack selection task. They were also twice as likely as those in the neutral condition to select fruit. There were no changes in self-reported affective associations or cognitive beliefs. These findings provide further evidence of the implicit and direct influence of affective associations on behavior, suggesting the need to both incorporate the role of affect in health decision making models, as well as the potential utility of intervention strategies targeting affective associations with health-related behaviors.

Changing how I feel about the food: experimentally manipulated affective associations with fruits change fruit choice behaviors

PubMed Central

Kiviniemi, Marc T.

2013-01-01

Fewer than half of Americans meet current recommendations for fruit and vegetable intake. The behavioral affective associations model posits that feelings and emotions associated with a behavior are a proximal influence on decision making. Cross-sectional evidence supports the model and suggests that affective associations predict fruit and vegetable consumption. The purpose of this study was to test whether a causal relation exists between affective associations about fruits and future fruit consumption behavior, as measured by a snack selection task. Following a baseline assessment of cognitive and affective variables, participants’ (N = 161) affective associations about fruits were experimentally manipulated with an implicit priming paradigm. Images of fruits were repeatedly paired with positive, negative, or neutral affective stimuli. The key outcome measure was a behavioral choice task in which participants chose between fruit and a granola bar. Participants in the positive prime condition were three times more likely than those in the negative condition to select a piece of fruit over the granola bar alternative in the snack selection task. They were also twice as likely as those in the neutral condition to select fruit. There were no changes in self-reported affective associations or cognitive beliefs. These findings provide further evidence of the implicit and direct influence of affective associations on behavior, suggesting the need to both incorporate the role of affect in health decision making models, as well as the potential utility of intervention strategies targeting affective associations with health-related behaviors. PMID:23299831

Children's intake of fruit and selected energy-dense nutrient-poor foods is associated with fathers' intake.

PubMed

Hall, Laura; Collins, Clare E; Morgan, Philip J; Burrows, Tracy L; Lubans, David R; Callister, Robin

2011-07-01

Parental dietary intake, lifestyle behavior, and parenting style influence a child's weight status. Few studies have examined associations between parent-child dietary intake, or specific father-child associations. This cross-sectional study examined associations between father-child dietary intakes of fruit, vegetables, and selected energy-dense nutrient-poor foods. The study population consisted of overweight fathers with 50 father-child dyads included in the analysis; median (interquartile range) age of fathers was 39±8.0 years; body mass index was 32.7±5.3; and their primary school-aged children (n=50) (54% boys aged 8.5±3.0 years, body mass index z score 0.6±1.6) who had been targeted to participate in the Healthy Dads, Healthy Kids pilot trial in the Hunter region, New South Wales, Australia in 2008. Dietary intakes of fathers and children were assessed using validated food frequency questionnaires, with mothers reporting their child's food intake. Descriptive statistics were reported and Spearman's rank order correlations used to test the strength of associations between father-child intakes. Fathers' median (interquartile range) daily fruit and vegetable intakes were 0.9 (1.5) and 2.2 (1.3) servings/day, respectively, whereas children consumed 2.1 (2.4) fruit and 2.9 (2.1) vegetable servings/day. Moderately-strong positive correlations were found between father-child fruit intakes (r=0.40, P<0.01), cookies (r=0.54, P<0.001), and potato chips (r=0.33, P<0.05). There were no associations between intakes of vegetables, ice cream, chocolate, or french fries (P>0.05). Children's intakes of fruit and some energy-dense nutrient-poor foods but not vegetables were related to their father's intakes. The targeting of fathers should be tested in experimental studies as a potential strategy to improve child and family eating habits. Copyright © 2011 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

Fruit load governs transpiration of olive trees

PubMed Central

Bustan, Amnon; Dag, Arnon; Yermiyahu, Uri; Erel, Ran; Presnov, Eugene; Agam, Nurit; Kool, Dilia; Iwema, Joost; Zipori, Isaac; Ben-Gal, Alon

2016-01-01

We tested the hypothesis that whole-tree water consumption of olives (Olea europaea L.) is fruit load-dependent and investigated the driving physiological mechanisms. Fruit load was manipulated in mature olives grown in weighing-drainage lysimeters. Fruit was thinned or entirely removed from trees at three separate stages of growth: early, mid and late in the season. Tree-scale transpiration, calculated from lysimeter water balance, was found to be a function of fruit load, canopy size and weather conditions. Fruit removal caused an immediate decline in water consumption, measured as whole-plant transpiration normalized to tree size, which persisted until the end of the season. The later the execution of fruit removal, the greater was the response. The amount of water transpired by a fruit-loaded tree was found to be roughly 30% greater than that of an equivalent low- or nonyielding tree. The tree-scale response to fruit was reflected in stem water potential but was not mirrored in leaf-scale physiological measurements of stomatal conductance or photosynthesis. Trees with low or no fruit load had higher vegetative growth rates. However, no significant difference was observed in the overall aboveground dry biomass among groups, when fruit was included. This case, where carbon sources and sinks were both not limiting, suggests that the role of fruit on water consumption involves signaling and alterations in hydraulic properties of vascular tissues and tree organs. PMID:26802540

Mandarin fruit quality: a review.

PubMed

Goldenberg, Livnat; Yaniv, Yossi; Porat, Ron; Carmi, Nir

2018-01-01

During the last decade, there has been a continuous rise in consumption and global marketing of fresh, easy-to-peel mandarins, with current annual production of nearly 29 million tons. Nevertheless, most of the existing knowledge on quality traits of citrus fruit comes from research conducted on oranges and grapefruit, which are the main products for the citrus juice manufacturing industry; relatively little is yet known regarding the unique fruit quality traits of mandarins, nor about the great diversity in these traits among the various natural sub-groups and varieties of mandarins. In the present review we discuss the physiological, biochemical, and molecular factors governing key fruit quality attributes of mandarins, including fruit colour, size and shape, ease of peeling, seedlessness, flavour, and nutritional quality. Fruit colour, size, and shape contribute to external appearance; peelability and seedlessness to ease of consumption; and flavour and nutritional quality to internal quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Trace elements in fruit juices.

PubMed

Bragança, Victor Luiz Cordoba; Melnikov, Petr; Zanoni, Lourdes Z

2012-05-01

Fruit juices are widely consumed in tropical countries as part of habitual diet. The concentrations of several minerals in these beverages were evaluated. Four commercially available brands of juices were analyzed for cadmium, lead, copper, zinc, aluminum, iron, chromium, manganese, and molybdenum. The levels ranged from 0.02 to 0.08 mg/L for copper, from 0.05 to 0.23 mg/L for zinc, from 0.1 to 0.4 mg/L for aluminum, from 0.02 to 0.45 mg/L for iron, and from 0.01 to 0.22 mg/L for manganese. The levels of cadmium, lead, and chromium in all samples were very low or undetectable. The metal contents of fruit juices depend on a number of factors, including the soil composition, the external conditions during fruit growing and fruit harvesting, as well as on details of the fruit juice manufacturing processes employed. The concentrations of none of the metals in juice samples analyzed exceeded the limits imposed by local legislation.

Trichoderma rot on ‘Fallglo’ Tangerine Fruit

USDA-ARS?s Scientific Manuscript database

In September 2009, Trichoderma rot symptoms were observed on ‘Fallglo’ fruit after 7 weeks of storage. Fourteen days prior to harvest, fruit were treated by dipping into one of four different fungicide solutions. Control fruit were dipped in tap water. After harvest, the fruit were degreening with 5...

Assessing the impact of deforestation of the Atlantic rainforest on ant-fruit interactions: a field experiment using synthetic fruits.

PubMed

Bieber, Ana Gabriela D; Silva, Paulo S D; Sendoya, Sebastián F; Oliveira, Paulo S

2014-01-01

Ants frequently interact with fleshy fruits on the ground of tropical forests. This interaction is regarded as mutualistic because seeds benefit from enhanced germination and dispersal to nutrient-rich microsites, whereas ants benefit from consuming the nutritious pulp/aril. Considering that the process of deforestation affects many attributes of the ecosystem such as species abundance and composition, and interspecific interactions, we asked whether the interaction between ants and fallen fleshy fruits in the Brazilian Atlantic forest differs between human-created fragments and undisturbed forests. We controlled diaspore type and quantity by using synthetic fruits (a plastic 'seed' covered by a lipid-rich 'pulp'), which were comparable to lipid-rich fruits. Eight independent areas (four undisturbed forests, and four disturbed forest fragments) were used in the field experiment, in which we recorded the attracted ant species, ant behaviour, and fruit removal distance. Fruits in undisturbed forest sites attracted a higher number of species than those in disturbed forests. Moreover, the occurrence of large, fruit-carrying ponerine ants (Pachycondyla, Odontomachus; 1.1 to 1.4 cm) was higher in undisturbed forests. Large species (≥3 mm) of Pheidole (Myrmicinae), also able to remove fruits, did not differ between forest types. Following these changes in species occurrence, fruit displacement was more frequent in undisturbed than in disturbed forests. Moreover, displacement distances were also greater in the undisturbed forests. Our data suggest that fallen fleshy fruits interacting with ants face different fates depending on the conservation status of the forest. Together with the severe loss of their primary dispersers in human-disturbed tropical forest sites, vertebrate-dispersed fruits may also be deprived of potential ant-derived benefits in these habitats due to shifts in the composition of interacting ant species. Our data illustrate the use of synthetic fruits

The structure of the fruit peel in two varieties of Malus domestica Borkh. (Rosaceae) before and after storage.

PubMed

Konarska, Agata

2013-06-01

The structure of fruit peel of two apple varieties 'Szampion' and 'Jonagold' was investigated using light microscopy as well as scanning and transmission electron microscopy. The samples were taken immediately after harvest and after 6-month controlled atmosphere storage. The Szampion and Jonagold fruit differed in terms of the surface type, number of lenticels, thickness of the cuticular epithelium, height of epidermal cells and thickness of the hypodermis as well as the amount of crystalline wax and the number of microcracks formed on the fruit surface. The 6-month storage resulted in fruit weight loss, increased numbers and depth of microcracks, thickening of the amorphous wax layer and enhanced production of platelet forms of crystalline wax, which filled the microcracks abundantly. Compared with Jonagold, the Szampion fruit exhibited a fewer lenticels, a bigger number of microcracks, smaller amounts of crystalline wax and more substantial weight loss. The apple varieties studied had a reticulate-lamellate cuticle, and at harvest, the epidermal and hypodermal cells contained numerous amyloplasts filled with starch grains, which were not found after the storage period. Additionally, after storage, the cell protoplasts in the apple peel displayed a disorganised structure, and their vacuoles contained fragments of cell membranes, intravacuolar precipitates and deposits, and spherical bodies. The results may facilitate better understanding of changes occurring in fruits of Szampion and Jonagold during storage and help choose the best storage conditions to reduce loss of weight and prevent impairment of fruit quality.

Genomics of Tropical Fruit Tree Crops

USDA-ARS?s Scientific Manuscript database

The genetic improvement of tropical fruit trees is limited when compared to progress achieved in temperate fruit trees and annual crops. Tropical fruit tree breeding programs require significant resources to develop new cultivars that are adapted to modern shipping and storage requirements. The use...

"FruitZotic": A Sensory Approach to Introducing Preschoolers to Fresh Exotic Fruits at Head Start Locations in Western Massachusetts

ERIC Educational Resources Information Center

Kannan, Srimathi; Smith, Rebecca; Foley, Christine; Del Sole, Sarah; White, Alissa; Sheldon, Lisa A.; Mietlcki-Floyd, Shirley; Severin, Suzanne

2011-01-01

FruitZotic incorporated fruit stories (exotic-fruits-literacy), a "See, Smell, Hear, Touch and Taste" (sensory) segment and a question-prompted discussion. Three take-home components incorporating the exotic fruits were: Coloring Activity, Recipes, and Fact Sheets. Sensory based nutrition education can increase familiarity with exotic…

Trichoderma rot on ‘Fallglo’ Tangerine Fruit

USDA-ARS?s Scientific Manuscript database

In September 2009, brown rot symptoms were observed on ‘Fallglo’ fruit after 7 weeks of storage. Fourteen days prior to harvest, fruit were treated by dipping into one of four different fungicide solutions. Control fruit were dipped in tap water. After harvest, the fruit were degreened with 5 ppm et...

Anthocyanin Management in Fruits by Fertilization.

PubMed

Jezek, Mareike; Zörb, Christian; Merkt, Nikolaus; Geilfus, Christoph-Martin

2018-01-31

Anthocyanins are water-soluble vacuolar plant pigments that are mainly synthesized in epidermal layers and the flesh of fruits such as apples, cherries, grapes, and other berries. Because of their attractive red to purple coloration and their health-promoting potential, anthocyanins are significant determinants for the quality and market value of fruits and fruit-derived products. In crops, anthocyanin accumulation in leaves can be caused by nutrient deficiency which is usually ascribed to insufficient nitrogen or phosphorus fertilization. However, it is a little-known fact that the plant's nutrient status also impacts anthocyanin synthesis in fruits. Hence, strategic nutrient supply can be a powerful tool to modify the anthocyanin content and consequently the quality and market value of important agricultural commodities. Here we summarize the current knowledge of the influence of plant nutrients on anthocyanin synthesis in fruits of major global market value and discuss the underlying cellular processes that integrate nutrient signaling with fruit anthocyanin formation. It is highlighted that fertilization that is finely tuned in amount and timing has the potential to positively influence the fruit quality by regulating anthocyanin levels. We outline new approaches to enrich plant based foods with health-promoting anthocyanins.

Genomics-assisted breeding in fruit trees.

PubMed

Iwata, Hiroyoshi; Minamikawa, Mai F; Kajiya-Kanegae, Hiromi; Ishimori, Motoyuki; Hayashi, Takeshi

2016-01-01

Recent advancements in genomic analysis technologies have opened up new avenues to promote the efficiency of plant breeding. Novel genomics-based approaches for plant breeding and genetics research, such as genome-wide association studies (GWAS) and genomic selection (GS), are useful, especially in fruit tree breeding. The breeding of fruit trees is hindered by their long generation time, large plant size, long juvenile phase, and the necessity to wait for the physiological maturity of the plant to assess the marketable product (fruit). In this article, we describe the potential of genomics-assisted breeding, which uses these novel genomics-based approaches, to break through these barriers in conventional fruit tree breeding. We first introduce the molecular marker systems and whole-genome sequence data that are available for fruit tree breeding. Next we introduce the statistical methods for biparental linkage and quantitative trait locus (QTL) mapping as well as GWAS and GS. We then review QTL mapping, GWAS, and GS studies conducted on fruit trees. We also review novel technologies for rapid generation advancement. Finally, we note the future prospects of genomics-assisted fruit tree breeding and problems that need to be overcome in the breeding.

Genomics-assisted breeding in fruit trees

PubMed Central

Iwata, Hiroyoshi; Minamikawa, Mai F.; Kajiya-Kanegae, Hiromi; Ishimori, Motoyuki; Hayashi, Takeshi

2016-01-01

Recent advancements in genomic analysis technologies have opened up new avenues to promote the efficiency of plant breeding. Novel genomics-based approaches for plant breeding and genetics research, such as genome-wide association studies (GWAS) and genomic selection (GS), are useful, especially in fruit tree breeding. The breeding of fruit trees is hindered by their long generation time, large plant size, long juvenile phase, and the necessity to wait for the physiological maturity of the plant to assess the marketable product (fruit). In this article, we describe the potential of genomics-assisted breeding, which uses these novel genomics-based approaches, to break through these barriers in conventional fruit tree breeding. We first introduce the molecular marker systems and whole-genome sequence data that are available for fruit tree breeding. Next we introduce the statistical methods for biparental linkage and quantitative trait locus (QTL) mapping as well as GWAS and GS. We then review QTL mapping, GWAS, and GS studies conducted on fruit trees. We also review novel technologies for rapid generation advancement. Finally, we note the future prospects of genomics-assisted fruit tree breeding and problems that need to be overcome in the breeding. PMID:27069395

Current status of tropical fruit breeding and genetics for three tropical fruit species cultivated in Japan: pineapple, mango, and papaya

PubMed Central

Ogata, Tatsushi; Yamanaka, Shinsuke; Shoda, Moriyuki; Urasaki, Naoya; Yamamoto, Toshiya

2016-01-01

Tropical fruit crops are predominantly produced in tropical and subtropical developing countries, but some are now grown in southern Japan. Pineapple (Ananas comosus), mango (Mangifera indica) and papaya (Carica papaya) are major tropical fruits cultivated in Japan. Modern, well-organized breeding systems have not yet been developed for most tropical fruit species. Most parts of Japan are in the temperate climate zone, but some southern areas such as the Ryukyu Islands, which stretch from Kyushu to Taiwan, are at the northern limits for tropical fruit production without artificial heating. In this review, we describe the current status of tropical fruit breeding, genetics, genomics, and biotechnology of three main tropical fruits (pineapple, mango, and papaya) that are cultivated and consumed in Japan. More than ten new elite cultivars of pineapple have been released with improved fruit quality and suitability for consumption as fresh fruit. New challenges and perspectives for obtaining high fruit quality are discussed in the context of breeding programs for pineapple. PMID:27069392

76 FR 26654 - Movement of Hass Avocados From Areas Where Mediterranean Fruit Fly or South American Fruit Fly Exist

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-09

... Fly or South American Fruit Fly Exist AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION... Mediterranean fruit fly quarantined areas in the United States with a certificate if the fruit is safeguarded... regulations to remove trapping requirements for Mediterranean fruit fly for Hass avocados imported from the...

Pollination biology of fruit-bearing hedgerow plants and the role of flower-visiting insects in fruit-set.

PubMed

Jacobs, Jennifer H; Clark, Suzanne J; Denholm, Ian; Goulson, Dave; Stoate, Chris; Osborne, Juliet L

2009-12-01

In the UK, the flowers of fruit-bearing hedgerow plants provide a succession of pollen and nectar for flower-visiting insects for much of the year. The fruits of hedgerow plants are a source of winter food for frugivorous birds on farmland. It is unclear whether recent declines in pollinator populations are likely to threaten fruit-set and hence food supply for birds. The present study investigates the pollination biology of five common hedgerow plants: blackthorn (Prunus spinosa), hawthorn (Crataegus monogyna), dog rose (Rosa canina), bramble (Rubus fruticosus) and ivy (Hedera helix). The requirement for insect pollination was investigated initially by excluding insects from flowers by using mesh bags and comparing immature and mature fruit-set with those of open-pollinated flowers. Those plants that showed a requirement for insect pollination were then tested to compare fruit-set under two additional pollination service scenarios: (1) reduced pollination, with insects excluded from flowers bagged for part of the flowering period, and (2) supplemental pollination, with flowers hand cross-pollinated to test for pollen limitation. The proportions of flowers setting fruit in blackthorn, hawthorn and ivy were significantly reduced when insects were excluded from flowers by using mesh bags, whereas fruit-set in bramble and dog rose were unaffected. Restricting the exposure of flowers to pollinators had no significant effect on fruit-set. However, blackthorn and hawthorn were found to be pollen-limited, suggesting that the pollination service was inadequate in the study area. Ensuring strong populations of insect pollinators may be essential to guarantee a winter fruit supply for birds in UK hedgerows.

Ethylene biosynthesis in detached young persimmon fruit is initiated in calyx and modulated by water loss from the fruit.

PubMed

Nakano, Ryohei; Ogura, Emi; Kubo, Yasutaka; Inaba, Akitsugu

2003-01-01

Persimmon (Diospyros kaki Thunb.) fruit are usually classified as climacteric fruit; however, unlike typical climacteric fruits, persimmon fruit exhibit a unique characteristic in that the younger the stage of fruit detached, the greater the level of ethylene produced. To investigate ethylene induction mechanisms in detached young persimmon fruit, we cloned three cDNAs encoding 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (DK-ACS1, 2, and -3) and two encoding ACC oxidase (DK-ACO1 and -2) genes involved in ethylene biosynthesis, and we analyzed their expression in various fruit tissues. Ethylene production was induced within a few days of detachment in all fruit tissues tested, accompanied by temporally and spatially coordinated expression of all the DK-ACS and DK-ACO genes. In all tissues except the calyx, treatment with 1-methylcyclopropene, an inhibitor of ethylene action, suppressed ethylene production and ethylene biosynthesis-related gene expression. In the calyx, one ACC synthase gene (DK-ACS2) exhibited increased mRNA accumulation accompanied by a large quantity of ethylene production, and treatment of the fruit with 1-methylcyclopropene did not prevent either the accumulation of DK-ACS2 transcripts or ethylene induction. Furthermore, the alleviation of water loss from the fruit significantly delayed the onset of ethylene production and the expression of DK-ACS2 in the calyx. These results indicate that ethylene biosynthesis in detached young persimmon fruit is initially induced in calyx and is modulated by water loss through transcriptional activation of DK-ACS2. The ethylene produced in the calyx subsequently diffuses to other fruit tissues and acts as a secondary signal that stimulates autocatalytic ethylene biosynthesis in these tissues, leading to a burst of ethylene production.

Fruit load governs transpiration of olive trees.

PubMed

Bustan, Amnon; Dag, Arnon; Yermiyahu, Uri; Erel, Ran; Presnov, Eugene; Agam, Nurit; Kool, Dilia; Iwema, Joost; Zipori, Isaac; Ben-Gal, Alon

2016-03-01

We tested the hypothesis that whole-tree water consumption of olives (Olea europaea L.) is fruit load-dependent and investigated the driving physiological mechanisms. Fruit load was manipulated in mature olives grown in weighing-drainage lysimeters. Fruit was thinned or entirely removed from trees at three separate stages of growth: early, mid and late in the season. Tree-scale transpiration, calculated from lysimeter water balance, was found to be a function of fruit load, canopy size and weather conditions. Fruit removal caused an immediate decline in water consumption, measured as whole-plant transpiration normalized to tree size, which persisted until the end of the season. The later the execution of fruit removal, the greater was the response. The amount of water transpired by a fruit-loaded tree was found to be roughly 30% greater than that of an equivalent low- or nonyielding tree. The tree-scale response to fruit was reflected in stem water potential but was not mirrored in leaf-scale physiological measurements of stomatal conductance or photosynthesis. Trees with low or no fruit load had higher vegetative growth rates. However, no significant difference was observed in the overall aboveground dry biomass among groups, when fruit was included. This case, where carbon sources and sinks were both not limiting, suggests that the role of fruit on water consumption involves signaling and alterations in hydraulic properties of vascular tissues and tree organs. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Gene expression in Citrus sinensis fruit tissues harvested from huanglongbing-infected trees: comparison with girdled fruit.

PubMed

Liao, Hui-Ling; Burns, Jacqueline K

2012-05-01

Distribution of viable Candidatus Liberibacter asiaticus (CaLas) in sweet orange fruit and leaves ('Hamlin' and 'Valencia') and transcriptomic changes associated with huanglongbing (HLB) infection in fruit tissues are reported. Viable CaLas was present in most fruit tissues tested in HLB trees, with the highest titre detected in vascular tissue near the calyx abscission zone. Transcriptomic changes associated with HLB infection were analysed in flavedo (FF), vascular tissue (VT), and juice vesicles (JV) from symptomatic (SY), asymptomatic (AS), and healthy (H) fruit. In SY 'Hamlin', HLB altered the expression of more genes in FF and VT than in JV, whereas in SY 'Valencia', the number of genes whose expression was changed by HLB was similar in these tissues. The expression of more genes was altered in SY 'Valencia' JV than in SY 'Hamlin' JV. More genes were also affected in AS 'Valencia' FF and VT than in AS 'Valencia' JV. Most genes whose expression was changed by HLB were classified as transporters or involved in carbohydrate metabolism. Physiological characteristics of HLB-infected and girdled fruit were compared to differentiate between HLB-specific and carbohydrate metabolism-related symptoms. SY and girdled fruit were smaller than H and ungirdled fruit, respectively, with poor juice quality. However, girdling did not cause misshapen fruit or differential peel coloration. Quantitative PCR analysis indicated that many selected genes changed their expression significantly in SY flavedo but not in girdled flavedo. Mechanisms regulating development of HLB symptoms may lie in the host disease response rather than being a direct consequence of carbohydrate starvation.

Chaneya, a New Genus of Winged Fruit from the Tertiary of North America and Eastern Asia.

PubMed

Wang; Manchester

2000-01-01

A new genus is recognized on the basis of wind-dispersed fruits from the Eocene of western North America and Miocene of eastern Asia. The fruits consist of an accrescent hypogynous calyx of five obovate sepals and one or more globose fruit bodies. Although the fossils were formerly placed in the extant genera Porana (Convolvulaceae) and Astronium (Anacardiaceae), our investigation of numerous specimens from several floras in the western United States (e.g., Florissant, Green River, Clarno) and Canada (Whipsaw Creek, British Columbia) and the Yilan and Shanwang floras of China reveals unique characters that indicate that the fossils are a distinct genus, which we name Chaneya. Unlike Porana and Astronium, the fossil calyces have stomata that are longitudinally aligned, and early stages of fruit development show a gynoecium of five apocarpous carpels, of which only one or two usually enlarge at maturity. Precise systematic placement of the fossil genus is uncertain, but similarities to the extant Picrasma of the Simaroubaceae are suggestive of possible affinities. Two species are recognized: Chaneya tenuis (Lesq.) comb. nov., from the Eocene of western North America and northeastern China, and Chaneya kokangensis (Endo) comb. nov., from the Miocene of eastern Asia.

Comparative microstructure study of oil palm fruit bunch fibre, mesocarp and kernels after microwave pre-treatment

NASA Astrophysics Data System (ADS)

Chang, Jessie S. L.; Chan, Y. S.; Law, M. C.; Leo, C. P.

2017-07-01

The implementation of microwave technology in palm oil processing offers numerous advantages; besides elimination of polluted palm oil mill effluent, it also reduces energy consumption, processing time and space. However, microwave exposure could damage a material’s microstructure which affected the quality of fruit that can be related to its physical structure including the texture and appearance. In this work, empty fruit bunches, mesocarp and kernel was microwave dried and their respective microstructures were examined. The microwave pretreatments were conducted at 100W and 200W and the microstructure investigation of both treated and untreated samples were evaluated using scanning electron microscope. The micrographs demonstrated that microwave does not significantly influence kernel and mesocarp but noticeable change was found on the empty fruit bunches where the sizes of the granular starch were reduced and a small portion of the silica bodies were disrupted. From the experimental data, the microwave irradiation was shown to be efficiently applied on empty fruit bunches followed by mesocarp and kernel as significant weight loss and size reduction was observed after the microwave treatments. The current work showed that microwave treatment did not change the physical surfaces of samples but sample shrinkage is observed.

Carbon allocation during fruiting in Rubus chamaemorus

PubMed Central

Gauci, R.; Otrysko, B.; Catford, J.-G.; Lapointe, L.

2009-01-01

Background and Aims Rubus chamaemorus (cloudberry) is a herbaceous clonal peatland plant that produces an extensive underground rhizome system with distant ramets. Most of these ramets are non-floral. The main objectives of this study were to determine: (a) if plant growth was source limited in cloudberry; (b) if the non-floral ramets translocated carbon (C) to the fruit; and (c) if there was competition between fruit, leaves and rhizomes for C during fruit development. Methods Floral and non-floral ramet activities were monitored during the period of flower and fruit development using three approaches: gas exchange measurements, 14CO2 labelling and dry mass accumulation in the different organs. Source and sink activity were manipulated by eliminating leaves or flowers or by reducing rhizome length. Key Results Photosynthetic rates were lower in floral than in deflowered ramets. Autoradiographs and 14C labelling data clearly indicated that fruit is a very strong sink for the floral ramet, whereas non-floral ramets translocated C toward the rhizome but not toward floral ramets. Nevertheless, rhizomes received some C from the floral ramet throughout the fruiting period. Ramets with shorter rhizomes produced smaller leaves and smaller fruits, and defoliated ramets produced very small fruits. Conclusions Plant growth appears to be source-limited in cloudberry since a reduction in sink strength did not induce a reduction in photosynthetic activity. Non-floral ramets did not participate directly to fruit development. Developing leaves appear to compete with the developing fruit but the intensity of this competition could vary with the specific timing of the two organs. The rhizome appears to act both as a source but also potentially as a sink during fruit development. Further studies are needed to characterize better the complex role played by the rhizome in fruit C nutrition. PMID:19520701

Evaluation of Low-Temperature Phosphine Fumigation for Control of Oriental Fruit Fly in Loquat Fruit.

PubMed

Liu, Tao; Li, Li; Li, Baishu; Zhan, Guoping; Wang, Yuejin

2018-05-28

Oriental fruit fly, Bactrocera dorsalis (Hendel; Diptera: Tephritidae), is recognized as a quarantine pest and a threat to Chinese loquat (Eriobotrya japonica Lindl.) fruit exports. Since loquat fruit is very sensitive to methyl bromide (MB) fumigation and cold treatment, in this study, low-temperature phosphine (PH3) fumigation was investigated to develop an alternative phytosanitary treatment method. Tolerance tests showed that the third instar was the most tolerant of all life stages of B dorsalis to PH3 gas at 8°C. Toxicity assay with 500-3000 ppm PH3 and subsequent probit analysis showed that 2000 ppm PH3 was optimal for fumigation and 152.75 h of treatment duration were required to achieve 99.9968% mortality. In the verification test, 144 and 168 h of treatment duration with 2000 ppm PH3 completely killed 35,277 and 35,134 B. dorsalis third instars, respectively. However, 13 live larvae were found after 120 h of treatment. Furthermore, these treatments reduced fruit respiration rates while causing no adverse effects on other fruit quality parameters, including firmness, soluble solid content, and titratable acidity over 192 h storage at 8°C. The results strongly suggest that low-temperature PH3 fumigation could be used for the postharvest control of B. dorsalis in loquat fruit.

Relationships among rat numbers, abundance of oil palm fruit and damage levels to fruit in an oil palm plantation.

PubMed

Puan, Chong Leong; Goldizen, Anne W; Zakaria, Mohamed; Hafidzi, Mohd N; Baxter, Greg S

2011-06-01

The relationships between vertebrate pests and crop damage are often complex and difficult to study. In palm oil plantations rodents remain the major pests, causing substantial monetary losses. The present study examined the numerical and functional responses of rodents to changes in the availability of oil palm fruit and the damage associated with that response. For the study, 200 traps were set in pairs on a 10 × 10 trapping grid for 3 consecutive nights in each of 6 study plots at 8-week intervals in a 2569 ha oil palm plantation at Labu, Negeri Sembilan state in Peninsular Malaysia over 14 months. A total of 1292 individual rats were captured over 25 200 trap-nights. Animals were identified, aged, sexed, weighed and measured. An index of the relative abundance of rats was calculated based on trapping success. Damage to infructescences was assessed at each trap point. Regardless of the age of palms, there were positive and significant relationships between the relative abundance of rats and numbers of infructescences. The levels of damage to infructescences were significantly correlated with the relative abundance of rats. A steep increase in damage was observed with an increase in mature infructescences, indicating a feeding preference of rats for mature infructescences. For both males and females of all rat species, there were weak and non-significant correlations between body condition and infructescence numbers. These results indicated that there was a numerical and a functional response by rats to the availability of palm fruit and a resulting increase in depredation of oil palm fruits. The ways in which this information might aid in future pest control are discussed. © 2011 ISZS, Blackwell Publishing and IOZ/CAS.

Why don't poor men eat fruit? Socioeconomic differences in motivations for fruit consumption☆

PubMed Central

Pechey, Rachel; Monsivais, Pablo; Ng, Yin-Lam; Marteau, Theresa M.

2015-01-01

Background: Those of lower socioeconomic status (SES) tend to have less healthy diets than those of higher SES. This study aimed to assess whether differences in motivations for particular foods might contribute to socioeconomic differences in consumption. Methods: Participants (n = 732) rated their frequency of consumption and explicit liking of fruit, cake and cheese. They reported eating motivations (e.g., health, hunger, price) and related attributes of the investigated foods (healthiness, expected satiety, value for money). Participants were randomly assigned to an implicit liking task (Single Category Implicit Association Task) for one food category. Analyses were conducted separately for different SES measures (income, education, occupational group). Results: Lower SES and male participants reported eating less fruit, but no SES differences were found for cheese or cake. Analyses therefore focused on fruit. In implicit liking analyses, results (for income and education) reflected patterning in consumption, with lower SES and male participants liking fruit less. In explicit liking analyses, no differences were found by SES. Higher SES participants (all indicators) were more likely to report health and weight control and less likely report price as motivators of food choices. For perceptions of fruit, no SES-based differences were found in healthiness whilst significant interactions (but not main effects) were found (for income and education) for expected satiety and value for money. Neither liking nor perceptions of fruit were found to mediate the relationship between SES and frequency of fruit consumption. Conclusions: There is evidence for social patterning in food motivation, but differences are modified by the choice of implicit or explicit measures. Further work should clarify the extent to which these motivations may be contributing to the social and gender patterning in diet. PMID:25451584