NASA Astrophysics Data System (ADS)
Hoang Huynh, Sa; Ha, Minh Thien Huu; Binh Do, Huy; Nguyen, Tuan Anh; Luc, Quang Ho; Chang, Edward Yi
2018-04-01
The configuration of the interfacial misfit array at In x Ga1‑ x Sb/GaAs interfaces with different indium compositions and thicknesses grown by metalorganic chemical vapor deposition was systematically analyzed using X-ray diffraction (XRD) reciprocal space maps (RSMs). These analyses confirmed that the epilayer relaxation was mainly contributed to by the high degree of spatial correlation of the 90° misfit array (correlation factors <0.01). The anisotropic peak-broadening aspect ratio was found to have a non-linear composition dependence as well as be thickness-dependent, related to the strain relaxation of the epilayer. However, the peak-broadening behavior in each RSM scan direction had different composition and thickness dependences.
Wilson, Ryan B; Siegler, W Christopher; Hoggard, Jamin C; Fitz, Brian D; Nadeau, Jeremy S; Synovec, Robert E
2011-05-27
By taking into consideration band broadening theory and using those results to select experimental conditions, and also by reducing the injection pulse width, peak capacity production (i.e., peak capacity per separation time) is substantially improved for one dimensional (1D-GC) and comprehensive two dimensional (GC×GC) gas chromatography. A theoretical framework for determining the optimal linear gas velocity (the linear gas velocity producing the minimum H), from experimental parameters provides an in-depth understanding of the potential for GC separations in the absence of extra-column band broadening. The extra-column band broadening is referred to herein as off-column band broadening since it is additional band broadening not due to the on-column separation processes. The theory provides the basis to experimentally evaluate and improve temperature programmed 1D-GC separations, but in order to do so with a commercial 1D-GC instrument platform, off-column band broadening from injection and detection needed to be significantly reduced. Specifically for injection, a resistively heated transfer line is coupled to a high-speed diaphragm valve to provide a suitable injection pulse width (referred to herein as modified injection). Additionally, flame ionization detection (FID) was modified to provide a data collection rate of 5kHz. The use of long, relatively narrow open tubular capillary columns and a 40°C/min programming rate were explored for 1D-GC, specifically a 40m, 180μm i.d. capillary column operated at or above the optimal average linear gas velocity. Injection using standard auto-injection with a 1:400 split resulted in an average peak width of ∼1.5s, hence a peak capacity production of 40peaks/min. In contrast, use of modified injection produced ∼500ms peak widths for 1D-GC, i.e., a peak capacity production of 120peaks/min (a 3-fold improvement over standard auto-injection). Implementation of modified injection resulted in retention time, peak width
Baeza-Baeza, J J; Pous-Torres, S; Torres-Lapasió, J R; García-Alvarez-Coque, M C
2010-04-02
Peak broadening and skewness are fundamental parameters in chromatography, since they affect the resolution capability of a chromatographic column. A common practice to characterise chromatographic columns is to estimate the efficiency and asymmetry factor for the peaks of one or more solutes eluted at selected experimental conditions. This has the drawback that the extra-column contributions to the peak variance and skewness make the peak shape parameters depend on the retention time. We propose and discuss here the use of several approaches that allow the estimation of global parameters (non-dependent on the retention time) to describe the column performance. The global parameters arise from different linear relationships that can be established between the peak variance, standard deviation, or half-widths with the retention time. Some of them describe exclusively the column contribution to the peak broadening, whereas others consider the extra-column effects also. The estimation of peak skewness was also possible for the approaches based on the half-widths. The proposed approaches were applied to the characterisation of different columns (Spherisorb, Zorbax SB, Zorbax Eclipse, Kromasil, Chromolith, X-Terra and Inertsil), using the chromatographic data obtained for several diuretics and basic drugs (beta-blockers). Copyright (c) 2010 Elsevier B.V. All rights reserved.
Drits, Victor A.; Eberl, Dennis D.; Środoń, Jan
1998-01-01
A modified version of the Bertaut-Warren-Averbach (BWA) technique (Bertaut 1949, 1950; Warren and Averbach 1950) has been developed to measure coherent scattering domain (CSD) sizes and strains in minerals by analysis of X-ray diffraction (XRD) data. This method is used to measure CSD thickness distributions for calculated and experimental XRD patterns of illites and illite-smectites (I-S). The method almost exactly recovers CSD thickness distributions for calculated illite XRD patterns. Natural I-S samples contain swelling layers that lead to nonperiodic structures in the c* direction and to XRD peaks that are broadened and made asymmetric by mixed layering. Therefore, these peaks cannot be analyzed by the BWA method. These difficulties are overcome by K-saturation and heating prior to X-ray analysis in order to form 10-Å periodic structures. BWA analysis yields the thickness distribution of mixed-layer crystals (coherently diffracting stacks of fundamental illite particles). For most I-S samples, CSD thickness distributions can be approximated by lognormal functions. Mixed-layer crystal mean thickness and expandability then can be used to calculate fundamental illite particle mean thickness. Analyses of the dehydrated, K-saturated samples indicate that basal XRD reflections are broadened by symmetrical strain that may be related to local variations in smectite interlayers caused by dehydration, and that the standard deviation of the strain increases regularly with expandability. The 001 and 002 reflections are affected only slightly by this strain and therefore are suited for CSD thickness analysis. Mean mixed-layer crystal thicknesses for dehydrated I-S measured by the BWA method are very close to those measured by an integral peak width method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sivasankaran, S., E-mail: sivasankarangs1979@gmail.com; Sivaprasad, K., E-mail: ksp@nitt.edu; Narayanasamy, R., E-mail: narayan@nitt.edu
2011-07-15
Nanocrystalline AA 6061 alloy reinforced with alumina (0, 4, 8, and 12 wt.%) in amorphized state composite powder was synthesized by mechanical alloying and consolidated by conventional powder metallurgy route. The as-milled and as-sintered (573 K and 673 K) nanocomposites were characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The peaks corresponding to fine alumina was not observed by XRD patterns due to amorphization. Using high-resolution transmission electron microscope, it is confirmed that the presence of amorphized alumina observed in Al lattice fringes. The crystallite size, lattice strain, deformation stress, and strain energy density of AA 6061 matrixmore » were determined precisely from the first five most intensive reflection of XRD using simple Williamson-Hall models; uniform deformation model, uniform stress deformation model, and uniform energy density deformation model. Among the developed models, uniform energy density deformation model was observed to be the best fit and realistic model for mechanically alloyed powders. This model evidenced the more anisotropic nature of the ball milled powders. The XRD peaks of as-milled powder samples demonstrated a considerable broadening with percentage of reinforcement due to grain refinement and lattice distortions during same milling time (40 h). The as-sintered (673 K) unreinforced AA 6061 matrix crystallite size from well fitted uniform energy density deformation model was 98 nm. The as-milled and as-sintered (673 K) nanocrystallite matrix sizes for 12 wt.% Al{sub 2}O{sub 3} well fitted by uniform energy density deformation model were 38 nm and 77 nm respectively, which indicate that the fine Al{sub 2}O{sub 3} pinned the matrix grain boundary and prevented the grain growth during sintering. Finally, the lattice parameter of Al matrix in as-milled and as-sintered conditions was also investigated in this paper. Research highlights: {yields} Integral breadth methods using
Drits, Victor A.; Środoń, Jan; Eberl, D.D.
1997-01-01
The standard form of the Scherrer equation, which has been used to calculate the mean thickness of the coherent scattering domain (CSD) of illite crystals from X-ray diffraction (XRD) full width data at half maximum (FWHM) intensity, employs a constant, Ksh, of 0.89. Use of this constant is unjustified, even if swelling has no effect on peak broadening, because this constant is valid only if all CSDs have a single thickness. For different thickness distributions, the Scherrer “constant” has very different values.Analysis of fundamental particle thickness data (transmission electron microscopy, TEM) for samples of authigenic illite and illite/smectite from diagenetically altered pyroclastics and filamentous illites from sandstones reveals a unique family of lognormal thickness distributions for these clays. Experimental relations between the distributions' lognormal parameters and mean thicknesses are established. These relations then are used to calculate the mean thickness of CSDs for illitic samples from XRD FWHM, or from integral XRD peak widths (integrated intensity/maximum intensity).For mixed-layer illite/smectite, the measured thickness of the CSD corresponds to the mean thickness of the mixed-layer crystal. Using this measurement, the mean thickness of the fundamental particles that compose the mixed-layer crystals can be calculated after XRD determination of percent smectitic interlayers. The effect of mixed layering (swelling) on XRD peak width for these samples is eliminated by using the 003 reflection for glycolated samples, and the 001, 002 or 003 reflection for dehydrated, K-saturated samples. If this technique is applied to the 001 reflection of air-dried samples (Kubler index measurement), mean CSD thicknesses are underestimated due to the mixed-layering effect.The technique was calibrated using NEW MOD©-simulated XRD profiles of illite, and then tested on well-characterized illite and illite/smectite samples. The XRD measurements are in good
X-ray peak profile analysis of zinc oxide nanoparticles formed by simple precipitation method
NASA Astrophysics Data System (ADS)
Pelicano, Christian Mark; Rapadas, Nick Joaquin; Magdaluyo, Eduardo
2017-12-01
Zinc oxide (ZnO) nanoparticles were successfully synthesized by a simple precipitation method using zinc acetate and tetramethylammonium hydroxide. The synthesized ZnO nanoparticles were characterized by X-ray Diffraction analysis (XRD) and Transmission Electron Microscopy (TEM). The XRD result revealed a hexagonal wurtzite structure for the ZnO nanoparticles. The TEM image showed spherical nanoparticles with an average crystallite size of 6.70 nm. For x-ray peak analysis, Williamson-Hall (W-H) and Size-Strain Plot (SSP) methods were applied to examine the effects of crystallite size and lattice strain on the peak broadening of the ZnO nanoparticles. Based on the calculations, the estimated crystallite sizes and lattice strains obtained are in good agreement with each other.
Crystal imperfection studies of pure and silicon substituted hydroxyapatite using Raman and XRD.
Zou, Shuo; Huang, Jie; Best, Serena; Bonfield, William
2005-12-01
Hydroxyapatite (HA) is important in biomedical applications because of its chemical similarity to the mineral content of bone and its consequent bioactivity. Silicon substitution into the hydroxyapatite crystal lattice was found to enhance its bioactivity both in vitro and in vivo [1, 2]. However, the mechanism for the enhancement is still not well understood. In this paper, the crystal imperfections introduced by silicon substitution were studied using XRD and Raman spectroscopy. It was found that silicon substitution did not introduce microstrain, but deceased the crystal size in the hk0 direction. Three new vibration modes and peak broadening were observed in Raman spectra following silicon incorporation. The imperfections introduced by silicon substitution may play a role in enhancing bioactivity. A phenomenological relationship between the width of the PO4 v1 peak and crystal size was established.
Doppler broadening in the β-proton- γ decay sequence
NASA Astrophysics Data System (ADS)
Schwartz, Sarah; Wrede, C.; Bennett, M. B.; Liddick, S. N.; Perez-Loureiro, D.; Bowe, A.; Chen, A. A.; Chipps, K. A.; Cooper, N.; Irvine, D.; McNeice, E.; Montes, F.; Naqvi, F.; Ortez, R.; Pain, S. D.; Pereira, J.; Prokop, C.; Quaglia, J.; Quinn, S. J.; Sakstrup, J.; Santia, M.; Shanab, S.; Simon, A.; Spyrou, A.; Thiagalingam, E.
2015-10-01
We report the first observation of Doppler-broadening in β delayed proton- γ decay. The broadening occurs because the daughter nucleus γ decays while recoiling from proton emission. A method to analyze β delayed nucleon emission was applied to two Doppler-broadened 25Al peaks from the 26P(βpγ)25Al decay. The method was first tested on the broad 1613 keV γ-ray peak using known center-of-mass proton energies as constraints. The method was then applied to the 1776 keV γ-ray peak from the 2720 keV excited state of 25Al. The broadening was used to determine a 26Si excitation energy of 13.3 +/- 1.0 (stat.) +/- 0.7 (syst.) MeV. This energy is consistent with proton emission from the known T = 2 isobaric analog state of 26P in 26Si.
Ihlenborg, Marvin; Raupers, Björn; Gunzer, Frank; Grotemeyer, Jürgen
2015-11-21
The details of the ionization mechanism in atmospheric pressure are still not completely known. In order to obtain further insight into the occurring processes in atmospheric pressure laser ionization (APLI) a comparative study of atmospheric pressure chemical ionization (APCI) and APLI is presented in this paper. This study is carried out using similar experimental condition at atmospheric pressure employing a commercial ion mobility spectrometer (IMS). Two different peak broadening mechanisms can then be assigned, one related to a range of different species generated and detected, and furthermore for the first time a power broadening effect on the signals can be identified.
Carvajal Nuñez, U; Martel, L; Prieur, D; Lopez Honorato, E; Eloirdi, R; Farnan, I; Vitova, T; Somers, J
2013-10-07
A series of uranium carbide samples, prepared by arc melting with a C/U ratio ranging from 0.96 to 1.04, has been studied by X-ray diffraction (XRD), (13)C nuclear magnetic resonance (NMR), and extended X-ray absorption fine structure (EXAFS). XRD determines phase uniqueness and the increase of the lattice parameter versus the carbon content. In contrast, (13)C NMR detects the different carbon environments in the lattice and in this study, clearly identifies the presence of discrete peaks for carbon in the octahedral lattice site in UC and an additional peak associated with excess carbon in hyperstoichiometric samples. Two peaks associated with different levels of carbon deficiency are detected for all hypostoichiometric compositions. More than one carbon environment is always detected by (13)C NMR. This exemplifies the difficulty in obtaining a perfect stoichiometric uranium monocarbide UC(1.00). The (13)C MAS spectra of uranium carbides exhibit the effects resulting from the carbon content on both the broadening of the peaks and on the Knight shift. An abrupt spectral change occurs between hypo- and hyperstoichiometric samples. The results obtained by EXAFS highlight subtle differences between the different stoichiometries, and in the hyperstoichiometric samples, the EXAFS results are consistent with the excess carbon atoms being in the tetrahedral interstitial position.
Near-side jet peak broadening in Pb-Pb collisions at √{sNN } = 2.76 TeV
NASA Astrophysics Data System (ADS)
Kofarago, Monika; Alice Collaboration
2017-08-01
Two-particle angular correlation measurements are sensitive probes of the interactions of particles with the medium formed in heavy-ion collisions. Such measurements are done by determining the distribution of the relative pseudo-rapidity (Δη) and azimuthal angle (Δϕ) of particles with respect to a higher pT trigger particle (1
Self-phase-modulation induced spectral broadening in silicon waveguides
NASA Astrophysics Data System (ADS)
Boyraz, Ozdal; Indukuri, Tejaswi; Jalali, Bahram
2004-03-01
The prospect for generating supercontinuum pulses on a silicon chip is studied. Using ~4ps optical pulses with 2.2GW/cm2 peak power, a 2 fold spectral broadening is obtained. Theoretical calculations, that include the effect of two-photon-absorption, indicate up to 5 times spectral broadening is achievable at 10x higher peak powers. Representing a nonlinear loss mechanism at high intensities, TPA limits the maximum optical bandwidth that can be generated.
Self-phase-modulation induced spectral broadening in silicon waveguides.
Boyraz, Ozdal; Indukuri, Tejaswi; Jalali, Bahram
2004-03-08
The prospect for generating supercontinuum pulses on a silicon chip is studied. Using ~4ps optical pulses with 2.2GW/cm(2) peak power, a 2 fold spectral broadening is obtained. Theoretical calculations, that include the effect of two-photon-absorption, indicate up to 5 times spectral broadening is achievable at 10x higher peak powers. Representing a nonlinear loss mechanism at high intensities, TPA limits the maximum optical bandwidth that can be generated.
Exciton broadening in WS 2 /graphene heterostructures
Hill, Heather M.; Rigosi, Albert F.; Raja, Archana; ...
2017-11-01
Here, we have used optical spectroscopy to observe spectral broadening of WS 2 exciton reflectance peaks in heterostructures of monolayer WS 2 capped with mono- to few-layer graphene. The broadening is found to be similar for the A and B excitons and on the order of 5–10 meV. No strong dependence on the number of graphene layers was observed within experimental uncertainty. The broadening can be attributed to charge- and energy-transfer processes between the two materials, providing an observed lower bound for the corresponding time scales of 65 fs.
Tardocchi, M; Nocente, M; Proverbio, I; Kiptily, V G; Blanchard, P; Conroy, S; Fontanesi, M; Grosso, G; Kneupner, K; Lerche, E; Murari, A; Cippo, E Perelli; Pietropaolo, A; Syme, B; Van Eester, D; Gorini, G
2011-11-11
The spectral broadening of characteristic γ-ray emission peaks from the reaction (12)C((3)He,pγ)(14)N was measured in D((3)He) plasmas of the JET tokamak with ion cyclotron resonance heating tuned to the fundamental harmonic of (3)He. Intensities and detailed spectral shapes of γ-ray emission peaks were successfully reproduced using a physics model combining the kinetics of the reacting ions with a detailed description of the nuclear reaction differential cross sections for populating the L1-L8 (14)N excitation levels yielding the observed γ-ray emission. The results provide a paradigm, which leverages knowledge from areas of physics outside traditional plasma physics, for the development of nuclear radiation based methods for understanding and controlling fusion burning plasmas.
Peak broadening and peak shift pole figures investigations by STRESS-SPEC diffractometer at FRM II
NASA Astrophysics Data System (ADS)
Gan, W. M.; Randau, C.; Hofmann, M.; Brokmeier, H. G.; Mueller, M.; Schreyer, A.
2012-02-01
This paper studied for the first time peak intensity, peak position and FHWM pole figures with one time measurement at the neutron diffractometer STRESS-SPEC via in-situ tensile deformation on austenitic steel. Fibre distribution with its evolution from central tensile direction to normal direction of these three kinds of pole figures was obtained. Variation of peak position and FWHM can be correlated to the reorientation of the texture component.
An In-situ method for the study of strain broadening usingsynchrotronx-ray diffraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Chiu C.; Lynch, Peter A.; Cheary, Robert W.
2006-12-15
A tensonometer for stretching metal foils has beenconstructed for the study of strain broadening in x-ray diffraction lineprofiles. This device, which is designed for use on the powderdiffractometer in Station 2.3 at Daresbury Laboratory, allows in-situmeasurements to be performed on samples under stress. It can be used fordata collection in either transmission or reflection modes using eithersymmetric or asymmetric diffraction geometries. As a test case,measurements were carried out on a 18mum thick copper foil experiencingstrain levels of up to 5 percent using both symmetric reflection andsymmetric transmission diffraction. All the diffraction profilesdisplayed peak broadening and asymmetry which increased with strain.more » Themeasured profiles were analysed by the fundamental parameters approachusing the TOPAS peak fitting software. All the observed broadenedprofiles were modelled by convoluting a refineable diffraction profile,representing the dislocation and crystallite size broadening, with afixed instrumental profile pre-determined usinghigh quality LaB6reference powder. The de-convolution process yielded "pure" sampleintegral breadths and asymmetry results which displayed a strongdependence on applied strain and increased almost linearly with appliedstrain. Assuming crystallite size broadening in combination withdislocation broadening arising from fcc a/2<110>111 dislocations,we have extracted the variation of mechanic al property with strain. Theobservation of both peak asymmetry and broadening has been interpreted asa manifestation of a cellular structure with cell walls and cellinteriors possessing high and low dislocation densities.« less
Quantitative XRD analysis of {110} twin density in biotic aragonites.
Suzuki, Michio; Kim, Hyejin; Mukai, Hiroki; Nagasawa, Hiromichi; Kogure, Toshihiro
2012-12-01
{110} Twin densities in biotic aragonite have been estimated quantitatively from the peak widths of specific reflections in powder X-ray diffraction (XRD) patterns, as well as direct confirmation of the twins using transmission electron microscopy (TEM). Influence of the twin density on the peak widths in the XRD pattern was simulated using DIFFaX program, regarding (110) twin as interstratification of two types of aragonite unit layers with mirrored relationship. The simulation suggested that the twin density can be estimated from the difference of the peak widths between 111 and 021, or between 221 and 211 reflections. Biotic aragonite in the crossed-lamellar microstructure (three species) and nacreous microstructure (four species) of molluscan shells, fish otoliths (two species), and a coral were investigated. The XRD analyses indicated that aragonite crystals in the crossed-lamellar microstructure of the three species contain high density of the twins, which is consistent with the TEM examination. On the other hand, aragonite in the nacre of the four species showed almost no difference of the peak widths between the paired reflections, indicating low twin densities. The results for the fish otoliths were varied between the species. Such variation of the twin density in biotic aragonites may reflect different schemes of crystal growth in biomineralization. Copyright © 2012 Elsevier Inc. All rights reserved.
Interface contributions to peak broadening in CE-ESI-MS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Udseth, H.R.; Barinaga, C.J.; Smith, R.D.
1991-06-01
The applications of capillary electrophoresis (CE) are expanding, and a number of commercial CE instruments are now available. Combining CE with mass spectroscopy (MS), first done with an electrospray ionization (ESI) interface, yields additional advantages. Other interfaces have been proposed, but CE-ESI-MS offers better sensitivity, reduced background, applicability to higher molecular weight (MW) compounds and a better interface design. Our aim has been to exploit the advantages of automated CE coupled to MS for separation of biological materials. Details of our instrument design are provided. Samples used for these studies were a mixture of myoglobin proteins (MW {approximately}17 kilodaltons) andmore » a tryptic digest of tuna cytochrome c. The results show the ESI-MS interface does not broaden bands, and ion dissociation in the mass spectrometer permits the unambiguous identification of fragments in cases where mass alone is insufficient. 2 refs., 2 figs. (MHB)« less
Structure, Elastic Constants and XRD Spectra of Extended Solids under High Pressure
DOE Office of Scientific and Technical Information (OSTI.GOV)
Batyrev, I. G.; Coleman, S. P.; Ciezak-Jenkins, J. A.
We present results of evolutionary simulations based on density functional calculations of a potentially new type of energetic materials called extended solids: P-N and N-H. High-density structures with covalent bonds generated using variable and fixed concentration methods were analysed in terms of thermo-dynamical stability and agreement with experimental X-ray diffraction (XRD) spectra. X-ray diffraction spectra were calculated using a virtual diffraction algorithm that computes kinematic diffraction intensity in three-dimensional reciprocal space before being reduced to a two-theta line profile. Calculated XRD patterns were used to search for the structure of extended solids present at experimental pressures by optimizing data accordingmore » to experimental XRD peak position, peak intensity and theoretically calculated enthalpy. Elastic constants has been calculated for thermodynamically stable structures of P-N system.« less
Jin, Gaowa; Guo, Zhimou; Xiao, Yuansheng; Yan, Jingyu; Dong, Xuefang; Shen, Aijin; Wang, Chaoran; Liang, Xinmiao
2016-10-01
A practical method was established for the definition of chromatographic parameters in preparative liquid chromatography. The parameters contained both the peak broadening level under different amounts of sample loading and the concentration distribution of the target compound in the elution. The parameters of the peak broadening level were defined and expressed as a matrix, which consisted of sample loading, the forward broadening and the backward broadening levels. The concentration distribution of the target compound was described by the heat map of the elution profile. The most suitable stationary phase should exhibit the narrower peak broadening and it was best to broaden to both sides to compare to the peak under analytical conditions. Besides, the concentration distribution of the target compounds should be focused on the middle of the elution. The guiding principles were validated by purification of amitriptyline from the mixture of desipramine and amitriptyline. On the selected column, when the content of the impurity desipramine was lower than 0.1%, the recovery of target compound was much higher than the other columns even when the sample loading was as high as 8.03 mg/cm 3 . The parameters and methods could be used for the evaluation and selection of stationary phases in preparative chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Li, Zhong-Jun; Hou, Zhi-Ling; Song, Wei-Li; Liu, Xing-Da; Cao, Wen-Qiang; Shao, Xiao-Hong; Cao, Mao-Sheng
2016-05-01
Electromagnetic absorption materials have received increasing attention owing to their wide applications in aerospace, communication and the electronics industry, and multiferroic materials with both polarization and magnetic properties are considered promising ceramics for microwave absorption application. However, the insufficient absorption intensity coupled with the narrow effective absorption bandwidth has limited the development of high-performance multiferroic materials for practical microwave absorption. To address such issues, in the present work, we utilize interfacial engineering in BiFeO3 nanoparticles via Ca doping, with the purpose of tailoring the phase boundary. Upon Ca-substitution, the co-existence of both R3c and P4mm phases has been confirmed to massively enhance both dielectric and magnetic properties via manipulating the phase boundary and the destruction of the spiral spin structure. Unlike the commonly reported magnetic/dielectric hybrid microwave absorption composites, Bi0.95Ca0.05FeO3 has been found to deliver unusual continuous dual absorption peaks at a small thickness (1.56 mm), which has remarkably broadened the effective absorption bandwidth (8.7-12.1 GHz). The fundamental mechanisms based on the phase boundary engineering have been discussed, suggesting a novel platform for designing advanced multiferroic materials with wide applications.Electromagnetic absorption materials have received increasing attention owing to their wide applications in aerospace, communication and the electronics industry, and multiferroic materials with both polarization and magnetic properties are considered promising ceramics for microwave absorption application. However, the insufficient absorption intensity coupled with the narrow effective absorption bandwidth has limited the development of high-performance multiferroic materials for practical microwave absorption. To address such issues, in the present work, we utilize interfacial engineering in BiFeO3
[Identification of Dens Draconis and Os Draconis by XRD method].
Chen, Guang-Yun; Wu, Qi-Nan; Shen, Bei; Chen, Rong
2012-04-01
To establish an XRD method for evaluating the quality of Os Draconis and Dens Draconis and applying in judgement of the counterfeit. Dens Draconis, Os Draconis and the counterfeit of Os Draconis were analyzed by XRD. Their diffraction patterns were clustered analysis and evaluated their similarity degree. Established the analytical method of Dens Draconis and Os Draconis basing the features fingerprint information of the 10 common peaks by XRD pattern. Obtained the XRD pattern of the counterfeit of Os Draconis. The similarity degree of separate sources of Dens Draconis was high,while the similarity degree of separate sources of Os Draconis was significant different from each other. This method can be used for identification and evaluation of Os Draconis and Dens Draconis. It also can be used for identification the counterfeit of Os Draconis effectively.
Observation of Doppler broadening in beta-delayed proton-gamma decay
NASA Astrophysics Data System (ADS)
Schwartz, Sarah
The Doppler broadening of gamma-ray peaks due to nuclear recoil from beta-delayed nucleon emission can be used to measure the energies of the nucleons. The purpose of this Thesis is to test and apply this Doppler broadening method using gamma-ray peaks from the 26P(betapgamma) 25Al decay sequence. A fast beam of 26P was implanted into a planar Ge detector, which was used as a 26P beta-decay trigger. The SeGA array of high-purity Ge detectors was used to detect gamma rays from the 26P(betapgamma)25Al decay sequence. Radiative Doppler broadening in beta-delayed proton-gamma decay was observed for the first time. The Doppler broadening analysis method was verified using the 1613 keV gamma-ray line for which the proton energies were previously known. The 1776 keV gamma ray de-exciting the 2720 keV 25Al level was observed in 26P(betapgamma) 25Al decay for the first time and used to determine that the center-of-mass energy of the proton emission feeding the 2720-keV level is 5.1 +/- 1.0 (stat.) +/- 0.6 (syst.) MeV, corresponding to a 26Si excitation energy of 13.3 +/- 1.0 (stat.) +/- 0.7 (syst.) MeV for the proton-emitting level. The Doppler broadening method has been demonstrated to provide practical measurements of the energies for beta-delayed nucleon emissions populating excited states of nuclear recoils at least as heavy as A = 25.
Observation of Doppler broadening in β -delayed proton- γ decay
Schwartz, S. B.; Wrede, C.; Bennett, M. B.; ...
2015-09-14
Background: The Doppler broadening of gamma-ray peaks is due to nuclear recoil from beta-delayed nucleon emission can be used to measure the energies of the nucleons. This method has never been tested using beta-delayed proton emission or applied to a recoil heavier than A = 10. Purpose: To test and apply this Doppler broadening method using gamma-ray peaks from the P-26(beta p gamma)Al-25 decay sequence. Methods: A fast beam of P-26 was implanted into a planar Ge detector, which was used as a P-26 beta-decay trigger. The SeGA array of high-purity Ge detectors was used to detect gamma rays frommore » the P-26(beta p gamma)Al-25 decay sequence. Results: Radiative Doppler broadening in beta-delayed proton-gamma decay was observed for the first time. Moreover, the Doppler broadening analysis method was verified using the 1613-keV gamma-ray line for which the proton energies were previously known. The 1776-keV gamma ray de-exciting the 2720 keV Al-25 level was observed in P-26(beta p gamma)Al-25 decay for the first time and used to determine that the center-of-mass energy of the proton emission feeding the 2720-keV level is 5.1 +/- 1.0 (stat.) +/- 0.6 (syst.) MeV, corresponding to a Si-26 excitation energy of 13.3 +/- 1.0 (stat.) +/- 0.6 (syst.) MeV for the proton-emitting level. Conclusions: Finally, the Doppler broadening method has been demonstrated to provide practical measurements of the energies for beta-delayed nucleon emissions populating excited states of nuclear recoils at least as heavy as A = 25.« less
Observation of Doppler broadening in β -delayed proton-γ decay
NASA Astrophysics Data System (ADS)
Schwartz, S. B.; Wrede, C.; Bennett, M. B.; Liddick, S. N.; Pérez-Loureiro, D.; Bowe, A.; Chen, A. A.; Chipps, K. A.; Cooper, N.; Irvine, D.; McNeice, E.; Montes, F.; Naqvi, F.; Ortez, R.; Pain, S. D.; Pereira, J.; Prokop, C.; Quaglia, J.; Quinn, S. J.; Sakstrup, J.; Santia, M.; Shanab, S.; Simon, A.; Spyrou, A.; Thiagalingam, E.
2015-09-01
Background: The Doppler broadening of γ -ray peaks due to nuclear recoil from β -delayed nucleon emission can be used to measure the energies of the nucleons. This method has never been tested using β -delayed proton emission or applied to a recoil heavier than A =10 . Purpose: To test and apply this Doppler broadening method using γ -ray peaks from the 26P(β p γ )25Al decay sequence. Methods: A fast beam of 26P was implanted into a planar Ge detector, which was used as a 26P β -decay trigger. The SeGA array of high-purity Ge detectors was used to detect γ rays from the 26P(β p γ )25Al decay sequence. Results: Radiative Doppler broadening in β -delayed proton-γ decay was observed for the first time. The Doppler broadening analysis method was verified using the 1613-keV γ -ray line for which the proton energies were previously known. The 1776-keV γ ray de-exciting the 2720 keV 25Al level was observed in 26P(β p γ )25Al decay for the first time and used to determine that the center-of-mass energy of the proton emission feeding the 2720-keV level is 5.1 ±1.0 (stat.) ±0.6 (syst.) MeV, corresponding to a 26Si excitation energy of 13.3 ±1.0 (stat.) ±0.6 (syst.) MeV for the proton-emitting level. Conclusions: The Doppler broadening method has been demonstrated to provide practical measurements of the energies for β -delayed nucleon emissions populating excited states of nuclear recoils at least as heavy as A =25 .
Li, Zhong-Jun; Hou, Zhi-Ling; Song, Wei-Li; Liu, Xing-Da; Cao, Wen-Qiang; Shao, Xiao-Hong; Cao, Mao-Sheng
2016-05-21
Electromagnetic absorption materials have received increasing attention owing to their wide applications in aerospace, communication and the electronics industry, and multiferroic materials with both polarization and magnetic properties are considered promising ceramics for microwave absorption application. However, the insufficient absorption intensity coupled with the narrow effective absorption bandwidth has limited the development of high-performance multiferroic materials for practical microwave absorption. To address such issues, in the present work, we utilize interfacial engineering in BiFeO3 nanoparticles via Ca doping, with the purpose of tailoring the phase boundary. Upon Ca-substitution, the co-existence of both R3c and P4mm phases has been confirmed to massively enhance both dielectric and magnetic properties via manipulating the phase boundary and the destruction of the spiral spin structure. Unlike the commonly reported magnetic/dielectric hybrid microwave absorption composites, Bi0.95Ca0.05FeO3 has been found to deliver unusual continuous dual absorption peaks at a small thickness (1.56 mm), which has remarkably broadened the effective absorption bandwidth (8.7-12.1 GHz). The fundamental mechanisms based on the phase boundary engineering have been discussed, suggesting a novel platform for designing advanced multiferroic materials with wide applications.
NASA Astrophysics Data System (ADS)
Kim, Young Min; Park, Young Wook; Choi, Jin Hwan; Ju, Byeong Kwon; Jung, Jae Hoon; Kim, Jai Kyeong
2007-01-01
The authors report the optical and electroluminescent (EL) properties of white organic light-emitting diodes (OLEDs) which have two emitters with similar structures: 1, 1, 4, 4-tetraphenyl-1, 3-butadiene and 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline have an emission peak of 400nm around the near ultraviolet, and tris-(8-hydroxyquinoline) aluminum doped with 4-(dicyanomethylene)-2-methyl-6-(p-dimethylaminostyryl)-4H-pyran has an emission peak of 580nm producing a yellow color. The EL spectra of the white OLED have shown a broadening through visual range from 400to780nm. This spectral broadening is related to an exciplex emission at the organic solid interface.
An Experiment to Demonstrate the Energy Broadening of Annihilation Gamma Rays
ERIC Educational Resources Information Center
Ouseph, P. J.; DuBard, James L.
1978-01-01
Shows that when positions annihilate in solid materials the energy distribution of the annihilation gamma rays is much broader than that of a 0.511-Mev gamma peak. This broadening is caused by the momentum distribution of the electrons in the material. (Author/GA)
Impact of temperature-velocity distribution on fusion neutron peak shape
Munro, D. H.; Field, J. E.; Hatarik, R.; ...
2017-02-21
Doppler broadening of the 14 MeV DT and 2.45 MeV DD fusion neutron lines has long been our best measure of temperature in a burning plasma. At the National Ignition Facility (NIF), yields are high enough and our neutron spectrometers accurate enough that we see finer details of the peak shape. For example, we can measure the shift of the peak due to the bulk motion of the plasma, and we see indications of non-thermal broadening, skew, and kurtosis of the peak caused by the variations of temperature and fluid velocity during burn. We can also distinguish spectral differences amongmore » several lines of sight. Finally, this paper will review the theory of fusion neutron line shape, show examples of non-Gaussian line shapes and directional variations in NIF data, and describe detailed spectral shapes we see in radiation-hydrodynamics simulations of implosions.« less
Impact of temperature-velocity distribution on fusion neutron peak shape
NASA Astrophysics Data System (ADS)
Munro, D. H.; Field, J. E.; Hatarik, R.; Peterson, J. L.; Hartouni, E. P.; Spears, B. K.; Kilkenny, J. D.
2017-05-01
Doppler broadening of the 14 MeV DT and 2.45 MeV DD fusion neutron lines has long been our best measure of temperature in a burning plasma. At the National Ignition Facility (NIF), yields are high enough and our neutron spectrometers accurate enough that we see finer details of the peak shape. For example, we can measure the shift of the peak due to the bulk motion of the plasma, and we see indications of non-thermal broadening, skew, and kurtosis of the peak caused by the variations of temperature and fluid velocity during burn. We can also distinguish spectral differences among several lines of sight. This paper will review the theory of fusion neutron line shape, show examples of non-Gaussian line shapes and directional variations in NIF data, and describe detailed spectral shapes we see in radiation-hydrodynamics simulations of implosions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baumann, K; Weber, U; Simeonov, Y
2015-06-15
Purpose: Aim of this study was to analyze the modulating, broadening effect on the Bragg Peak due to heterogeneous geometries like multi-wire chambers in the beam path of a particle therapy beam line. The effect was described by a mathematical model which was implemented in the Monte-Carlo code FLUKA via user-routines, in order to reduce the computation time for the simulations. Methods: The depth dose curve of 80 MeV/u C12-ions in a water phantom was calculated using the Monte-Carlo code FLUKA (reference curve). The modulating effect on this dose distribution behind eleven mesh-like foils (periodicity ∼80 microns) occurring in amore » typical set of multi-wire and dose chambers was mathematically described by optimizing a normal distribution so that the reverence curve convoluted with this distribution equals the modulated dose curve. This distribution describes a displacement in water and was transferred in a probability distribution of the thickness of the eleven foils using the water equivalent thickness of the foil’s material. From this distribution the distribution of the thickness of one foil was determined inversely. In FLUKA the heterogeneous foils were replaced by homogeneous foils and a user-routine was programmed that varies the thickness of the homogeneous foils for each simulated particle using this distribution. Results: Using the mathematical model and user-routine in FLUKA the broadening effect could be reproduced exactly when replacing the heterogeneous foils by homogeneous ones. The computation time was reduced by 90 percent. Conclusion: In this study the broadening effect on the Bragg Peak due to heterogeneous structures was analyzed, described by a mathematical model and implemented in FLUKA via user-routines. Applying these routines the computing time was reduced by 90 percent. The developed tool can be used for any heterogeneous structure in the dimensions of microns to millimeters, in principle even for organic materials like lung
Impact of temperature-velocity distribution on fusion neutron peak shape
NASA Astrophysics Data System (ADS)
Munro, David
2016-10-01
Doppler broadening of the 14 MeV DT and 2.45 MeV DD fusion neutron lines has long been our best measure of temperature in a burning plasma. At the National Ignition Facility yields are high enough and our neutron spectrometers accurate enough that we see finer details of the peak shape. For example, we can measure the shift of the peak due to bulk motion of the plasma, and we see indications of non-thermal broadening, skew, and kurtosis of the peak caused by the variations of temperature and fluid velocity during burn. We can also distinguish spectral differences among several lines of sight. This talk will review the theory of fusion neutron line shape, show examples of non-Gaussian line shapes and directional variations in NIF data, and describe detailed spectral shapes we see in radhydro implosion simulations. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Feigel'man, M V; Skvortsov, M A
2012-10-05
In disordered superconductors, the local pairing field fluctuates in space, leading to the smearing of the BCS peak in the density of states and the appearance of the subgap tail states. We analyze the universal mesoscopic contributions to these effects and show that they are enhanced by the Coulomb repulsion. In the vicinity of the quantum critical point, where superconductivity is suppressed by the "fermionic mechanism," strong smearing of the peak due to mesoscopic fluctuations is predicted.
Exact Doppler broadening of tabulated cross sections. [SIGMA 1 kernel broadening method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cullen, D.E.; Weisbin, C.R.
1976-07-01
The SIGMA1 kernel broadening method is presented to Doppler broaden to any required accuracy a cross section that is described by a table of values and linear-linear interpolation in energy-cross section between tabulated values. The method is demonstrated to have no temperature or energy limitations and to be equally applicable to neutron or charged-particle cross sections. The method is qualitatively and quantitatively compared to contemporary approximate methods of Doppler broadening with particular emphasis on the effect of each approximation introduced.
X-ray line profile analysis of BaTiO3 thin film prepared by sol-gel deposition
NASA Astrophysics Data System (ADS)
Ooi, Zeen Vee; Saif, Ala'eddin A.; Wahab, Yufridin; Jamal, Zul Azhar Zahid
2017-04-01
Barium titanate (BaTiO3) thin film was prepared using sol-gel method and spun-coated on SiO2/Si substrate. The phase and crystallinity of the synthesized film were identified using X-ray diffractometer (XRD), which scanned at the range of 20° to 60°. The phase and lattice parameters of the fabricated film were extracted from the recorded XRD patterns using lattice geometry equations. The crystallite size and lattice strain were determined using X-ray line profile analysis (XLPA) with various approaches. The Scherrer equation was applied to the perovskite peaks of the film to explore the size contribution on the peak broadening. Meanwhile, the Williamson-Hall and size-strain plot (SSP) methods were used to review two main independent contributions, i.e. crystallite sizes and lattice strain, on the X-ray line broadening. From the analysis, it is found that Scherrer method gives smallest crystallite size value by ignoring the strain-induced broadening effect. On the other hand, Williamson-Hall and SSP graphs revealed the existence of the lattice strain within the film, which contributes to the broadening in the Bragg peak. The results that analyzed via both techniques show a linear trend with all data points fitted. However, result obtained from SSP method gives better settlement due to the best fit of the data.
Matching 4.7-Å XRD spacing in amelogenin nanoribbons and enamel matrix.
Sanii, B; Martinez-Avila, O; Simpliciano, C; Zuckermann, R N; Habelitz, S
2014-09-01
The recent discovery of conditions that induce nanoribbon structures of amelogenin protein in vitro raises questions about their role in enamel formation. Nanoribbons of recombinant human full-length amelogenin (rH174) are about 17 nm wide and self-align into parallel bundles; thus, they could act as templates for crystallization of nanofibrous apatite comprising dental enamel. Here we analyzed the secondary structures of nanoribbon amelogenin by x-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR) and tested if the structural motif matches previous data on the organic matrix of enamel. XRD analysis showed that a peak corresponding to 4.7 Å is present in nanoribbons of amelogenin. In addition, FTIR analysis showed that amelogenin in the form of nanoribbons was comprised of β-sheets by up to 75%, while amelogenin nanospheres had predominantly random-coil structure. The observation of a 4.7-Å XRD spacing confirms the presence of β-sheets and illustrates structural parallels between the in vitro assemblies and structural motifs in developing enamel. © International & American Associations for Dental Research.
Matching 4.7-Å XRD Spacing in Amelogenin Nanoribbons and Enamel Matrix
Sanii, B.; Martinez-Avila, O.; Simpliciano, C.; Zuckermann, R.N.; Habelitz, S.
2014-01-01
The recent discovery of conditions that induce nanoribbon structures of amelogenin protein in vitro raises questions about their role in enamel formation. Nanoribbons of recombinant human full-length amelogenin (rH174) are about 17 nm wide and self-align into parallel bundles; thus, they could act as templates for crystallization of nanofibrous apatite comprising dental enamel. Here we analyzed the secondary structures of nanoribbon amelogenin by x-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FTIR) and tested if the structural motif matches previous data on the organic matrix of enamel. XRD analysis showed that a peak corresponding to 4.7 Å is present in nanoribbons of amelogenin. In addition, FTIR analysis showed that amelogenin in the form of nanoribbons was comprised of β-sheets by up to 75%, while amelogenin nanospheres had predominantly random-coil structure. The observation of a 4.7-Å XRD spacing confirms the presence of β-sheets and illustrates structural parallels between the in vitro assemblies and structural motifs in developing enamel. PMID:25048248
Wang, Zhong; Dell'Osso, Louis F; Jacobs, Jonathan B; Burnstine, Robert A; Tomsak, Robert L
2006-12-01
To investigate the effects of four-muscle tenotomy on visual function and gaze angle in patients with infantile nystagmus syndrome (INS). Eye movements of nine patients with infantile nystagmus were recorded using infrared reflection or high-speed digital video techniques. Experimental protocols were designed to record the patients' eye-movement waveforms, pre- and post-tenotomy, at different gaze angles. We used the eXpanded Nystagmus Acuity Function (NAFX) to measure tenotomy-induced changes in the nystagmus at primary position and various gaze angles. The longest foveation domains (LFD) were measured from fitted curves. Peak-to-peak nystagmus amplitudes and foveation-period durations were also measured. All measurements were made unmasked. All seven patients with narrow, high-NAFX, gaze-angle regions showed broadening of these regions of higher visual function. Three patients showed moderate NAFX improvement (13.9-32.6%) at primary position, five showed large improvement (39.9-162.4%), and one showed no NAFX change (due to his high pretenotomy NAFX). Primary position measured acuities improved in six patients. All patients had reductions in nystagmus amplitudes ranging from 14.6 to 37%. The duration of the foveation period increased in all nine patients (11.2-200%). The percentage improvements in both the NAFX and the LFD decreased with higher pretenotomy values. In addition to elevating primary position NAFX, tenotomy also broadens the high-NAFX regions. This broadening effect is more prominent in patients who had sharp pretenotomy NAFX peaks. Four-muscle tenotomy produces higher primary position NAFX increases in infantile nystagmus patients whose pretenotomy values are relatively low, with the improvement decreasing at higher pretenotomy values. The tenotomy procedure improves visual function beyond primary position acuity. This extends the utility of surgical therapy to several different classes of patients with INS for whom other procedures are
Modeling and measurements of XRD spectra of extended solids under high pressure
NASA Astrophysics Data System (ADS)
Batyrev, I. G.; Coleman, S. P.; Stavrou, E.; Zaug, J. M.; Ciezak-Jenkins, J. A.
2017-06-01
We present results of evolutionary simulations based on density functional calculations of various extended solids: N-Si and N-H using variable and fixed concentration methods of USPEX. Predicted from the evolutionary simulations structures were analyzed in terms of thermo-dynamical stability and agreement with experimental X-ray diffraction spectra. Stability of the predicted system was estimated from convex-hull plots. X-ray diffraction spectra were calculated using a virtual diffraction algorithm which computes kinematic diffraction intensity in three-dimensional reciprocal space before being reduced to a two-theta line profile. Calculations of thousands of XRD spectra were used to search for a structure of extended solids at certain pressures with best fits to experimental data according to experimental XRD peak position, peak intensity and theoretically calculated enthalpy. Comparison of Raman and IR spectra calculated for best fitted structures with available experimental data shows reasonable agreement for certain vibration modes. Part of this work was performed by LLNL, Contract DE-AC52-07NA27344. We thank the Joint DoD / DOE Munitions Technology Development Program, the HE C-II research program at LLNL and Advanced Light Source, supported by BES DOE, Contract No. DE-AC02-05CH112.
Correlations of Apparent Cellulose Crystallinity Determined by XRD, NMR, IR, Raman, and SFG Methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, David K; Lee, Christopher; Dazen, Kevin
2015-07-04
Although the cellulose crystallinity index (CI) is used widely, its limitations have not been adequately described. In this study, the CI values of a set of reference samples were determined from X-ray diffraction (XRD), nuclear magnetic resonance (NMR), and infrared (IR), Raman, and vibrational sum frequency generation (SFG) spectroscopies. The intensities of certain crystalline peaks in IR, Raman, and SFG spectra positively correlated with the amount of crystalline cellulose in the sample, but the correlation with XRD was nonlinear as a result of fundamental differences in detection sensitivity to crystalline cellulose and improper baseline corrections for amorphous contributions. It ismore » demonstrated that the intensity and shape of the XRD signal is affected by both the amount of crystalline cellulose and crystal size, which makes XRD analysis complicated. It is clear that the methods investigated show the same qualitative trends for samples, but the absolute CI values differ depending on the determination method. This clearly indicates that the CI, as estimated by different methods, is not an absolute value and that for a given set of samples the CI values can be compared only as a qualitative measure.« less
Correlations of Apparent Cellulose Crystallinity Determined by XRD, NMR, IR, Raman, and SFG Methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Christopher M; Dazen, Kevin; Kafle, Kabindra
2015-01-01
Although the cellulose crystallinity index (CI) is used widely, its limitations have not been adequately described. In this study, the CI values of a set of reference samples were determined from X-ray diffraction (XRD), nuclear magnetic resonance (NMR), and infrared (IR), Raman, and vibrational sum frequency generation (SFG) spectroscopies. The intensities of certain crystalline peaks in IR, Raman, and SFG spectra positively correlated with the amount of crystalline cellulose in the sample, but the correlation with XRD was nonlinear as a result of fundamental differences in detection sensitivity to crystalline cellulose and improper baseline corrections for amorphous contributions. It ismore » demonstrated that the intensity and shape of the XRD signal is affected by both the amount of crystalline cellulose and crystal size, which makes XRD analysis complicated. It is clear that the methods investigated show the same qualitative trends for samples, but the absolute CI values differ depending on the determination method. This clearly indicates that the CI, as estimated by different methods, is not an absolute value and that for a given set of samples the CI values can be compared only as a qualitative measure.« less
Hafizovic, Jasmina; Bjørgen, Morten; Olsbye, Unni; Dietzel, Pascal D C; Bordiga, Silvia; Prestipino, Carmelo; Lamberti, Carlo; Lillerud, Karl Petter
2007-03-28
MOF-5 is the archetype metal-organic framework and has been subjected to numerous studies the past few years. The focal point of this report is the pitfalls related to the MOF-5 phase identification based on powder XRD data. A broad set of conditions and procedures have been reported for MOF-5 synthesis. These variations have led to materials with substantially different adsorption properties (specific surface areas in the range 700 to 3400 m(2)/g). The relatively low weight loss observed for some as synthesized samples upon solvent removal is also indicative of a low pore volume. Regrettably, these materials have all been described as MOF-5 without any further comments. Furthermore, the reported powder XRD patterns hint at structural differences: The variations in surface area are accompanied by peak splitting phenomena and rather pronounced changes in the relative peak intensities in the powder XRD patterns. In this work, we use single-crystal XRD to investigate structural differences between low and high surface area MOF-5. The low surface area MOF-5 sample had two different classes of crystals. For the dominant phase, Zn(OH)2 species partly occupied the cavities. The presence of Zn species makes the hosting cavity and possibly also adjacent cavities inaccessible and thus efficiently reduces the pore volume of the material. Furthermore, the minor phase consisted of doubly interpenetrated MOF-5 networks, which lowers the adsorption capacity. The presence of Zn species and lattice interpenetration changes the symmetry from cubic to trigonal and explains the peak splitting observed in the powder XRD patterns. Pore-filling effects from the Zn species (and partly the solvent molecules) are also responsible for the pronounced variations in powder XRD peak intensities. This latter conclusion is particularly useful for predicting the adsorption properties of a MOF-5-type material from powder XRD.
NASA Astrophysics Data System (ADS)
Wan, Chubin; Zhou, Xiaosong; Wang, Yuting; Li, Shina; Ju, Xin; Peng, Shuming
2014-01-01
The crystal structure and local atomic arrangements surrounding Ti atoms were determined for He-charged hexagonal close-packed (hcp) Ti films and measured at glancing angles by synchrotron radiation X-ray diffraction (XRD) and extended X-ray absorption fine structure (EXAFS) spectroscopy, respectively. The charged specimens were prepared by direct current magnetron sputtering with a He/Ar mixture. He atoms with a relatively medium concentration (He/Ti atomic ratio as high as 17 at.%) were incorporated evenly in the deposited films. XRD results showed the changes in the peak intensities in Ti films with different He contents. EXAFS Fourier Transform analysis indicated that the average Ti-Ti distance decreased significantly, and proved the existence of phase transition.
Zhang, Ya; Lucy, Charles A
2014-12-05
In HPLC, injection of solvents that differ from the eluent can result in peak broadening due to solvent strength mismatch or viscous fingering. Broadened, distorted or even split analyte peaks may result. Past studies of this injection-induced peak distortion in reversed phase (RPLC) and hydrophilic interaction (HILIC) liquid chromatography have led to the conclusion that the sample should be injected in the eluent or a weaker solvent. However, there have been no studies of injection-induced peak distortion in ion chromatography (IC). To address this, injection-induced effects were studied for six inorganic anions (F-, Cl-, NO2-, Br-, NO3- and SO4(2-)) on a Dionex AS23 IC column using a HCO3-/CO3(2-) eluent. The VanMiddlesworth-Dorsey injection sensitivity parameter (s) showed that IC of anions has much greater tolerance to the injection matrix (HCO3-/CO3(2-) herein) mismatch than RPLC or HILIC. Even when the injection contained a ten-fold greater concentration of HCO3-/CO3(2-) than the eluent, the peak shapes and separation efficiencies of six analyte ions did not change significantly. At more than ten-fold greater matrix concentrations, analyte anions that elute near the system peak of the matrix were distorted, and in the extreme cases exhibited a small secondary peak on the analyte peak front. These studies better guide the degree of dilution needed prior to IC analysis of anions. Copyright © 2014 Elsevier B.V. All rights reserved.
Studies of solar flares: Homology and X-ray line broadening
NASA Astrophysics Data System (ADS)
Ranns, Neale David Raymond
This thesis starts with an introduction to the solar atmosphere and the physics that governs its behaviour. The formation processes of spectral lines are presented followed by an explanation of employed plasma diagnostic techniques and line broadening mechanisms. The current understanding on some principle concepts of flare physics are reviewed and the topics of flare homology and non-thermal line broadening are introduced. The many solar satellites and instrumentation that were utilised during this thesis are described. Analysis techniques for some instruments are also presented. A series of solar flares that conform to the literature definition for homologous flares are examined. The apparent homology is shown to be caused by emerging flux rather than continual stressing of a single, or group of, magnetic structure's. The implications for flare homology are discussed. The analysis of a solar flare with a rise and peak in the observed non-thermal X-ray line broadening (Vnt) is then performed. The location of the hot plasma within the flare area is determined and consequently the source of Vnt is located to be within and above the flare loops. The flare footpoints are therefore discarded as a possible source location. Viable source locations are discussed with a view to determining the dominant mechanism for the generation of line broadening. The timing relationships between the hard X-ray (HXR) flux and Vnt in many solar flares are then examined. I show that there is a causal relationship between these two parameters and that the HXR rise time is related to the time delay between the maxima of HXR flux and Vnt. The temporal evolution of Vnt is shown to be dependent upon the shape of the HXR burst. The implications of these results are discussed in terms of determining the line broadening mechanism and the limitations of the data. A summary of the results in this thesis is then presented together with suggestions for future research.
Xu, Jucai; Sun-Waterhouse, Dongxiao; Qiu, Chaoying; Zhao, Mouming; Sun, Baoguo; Lin, Lianzhu; Su, Guowan
2017-10-27
The need to improve the peak capacity of liquid chromatography motivates the development of two-dimensional analysis systems. This paper presented a fully automated stop-flow two-dimensional liquid chromatography system with size exclusion chromatography followed by reversed phase liquid chromatography (SEC×RPLC) to efficiently separate peptides. The effects of different stop-flow operational parameters (stop-flow time, peak parking position, number of stop-flow periods and column temperature) on band broadening in the first dimension (1 st D) SEC column were quantitatively evaluated by using commercial small proteins and peptides. Results showed that the effects of peak parking position and the number of stop-flow periods on band broadening were relatively small. Unlike stop-flow analysis of large molecules with a long running time, additional band broadening was evidently observed for small molecule analytes due to the relatively high effective diffusion coefficient (D eff ). Therefore, shorter analysis time and lower 1 st D column temperature were suggested for analyzing small molecules. The stop-flow two-dimensional liquid chromatography (2D-LC) system was further tested on peanut peptides and an evidently improved resolution was observed for both stop-flow heart-cutting and comprehensive 2D-LC analysis (in spite of additional band broadening in SEC). The stop-flow SEC×RPLC, especially heart-cutting analysis with shorter analysis time and higher 1 st D resolution for selected fractions, offers a promising approach for efficient analysis of complex samples. Copyright © 2017 Elsevier B.V. All rights reserved.
The ExoMol pressure broadening diet: H2 and He line-broadening parameters
NASA Astrophysics Data System (ADS)
Barton, Emma J.; Hill, C.; Czurylo, M.; Li, H. Y.; Hyslop, A.; Yurchenko, Sergei N.; Tennyson, Jonathan
2017-12-01
In a variety of astronomical objects including gas giant (exo-)planets, brown dwarfs and cool stars, molecular hydrogen and helium are the major line broadeners. However, there is currently no systematic source for these parameters, particularly at the elevated temperatures encountered in many of these objects. The ExoMol project provides comprehensive molecular line lists for exoplanet and other hot atmospheres. The ExoMol database has recently been extended to provide additional data including temperature-dependent, pressure-broadening parameters. Here we assemble H2 and He pressure-broadening datasets for the molecules H2O, NH3, SO2, CH4, PH3, HCN and H2CO using available experimental and theoretical studies.
Experimental Air-Broadened Line Parameters in the nu2 Band of CH3D
NASA Technical Reports Server (NTRS)
Cross, Adriana Predoi; Brawley-Tremblay, Shannon; Povey, Chad; Smith, Mary Ann H.
2007-01-01
In this study we report the first experimental measurements of air-broadening and air-induced pressure-shift coefficients for approximately 378 transitions in the nu2 fundamental band of CH3D. These results were obtained from analysis of 17 room temperature laboratory absorption spectra recorded at 0.0056 cm(exp -1) resolution using the McMath-Pierce Fourier transform spectrometer located on Kitt Peak, Arizona. Three absorption cells with path lengths of 10.2, 25 and 150 cm were used to record the spectra. The total sample pressures ranged from 0.129x10(exp -2) to 52.855x10(exp -2) atm with CH3D volume mixing ratios of approximately 0.0109 in air. The spectra were analyzed using a multispectrum non-linear least-squares fitting technique. We report measurements for air pressure-broadening coefficients for transitions with quantum numbers as high as J" = 20 and K = 15, where K" = K' equivalent to K (for a parallel band). The measured air broadening coefficients range from 0.0205 to 0.0835 cm(exp -1) atm(exp -1) at 296 K. All the measured pressure-shift coefficients are negative and are found to vary from about -0.0005 to -0.0080 cm(exp -1) atm(exp -1) at the temperature of the spectra. We have examined the dependence of the measured broadening and shift parameters on the J" and K quantum numbers and also developed empirical expressions to describe the broadening coefficients in terms of m (m = -J", J" and J" + 1 in the (sup Q)P- (sup Q)Q-, and (sup Q)R-branch, respectively) and K. On average, the empirical expressions reproduce the measured broadening coefficients to within 4.4%.
Size distribution of magnetic iron oxide nanoparticles using Warren-Averbach XRD analysis
NASA Astrophysics Data System (ADS)
Mahadevan, S.; Behera, S. P.; Gnanaprakash, G.; Jayakumar, T.; Philip, J.; Rao, B. P. C.
2012-07-01
We use the Fourier transform based Warren-Averbach (WA) analysis to separate the contributions of X-ray diffraction (XRD) profile broadening due to crystallite size and microstrain for magnetic iron oxide nanoparticles. The profile shape of the column length distribution, obtained from WA analysis, is used to analyze the shape of the magnetic iron oxide nanoparticles. From the column length distribution, the crystallite size and its distribution are estimated for these nanoparticles which are compared with size distribution obtained from dynamic light scattering measurements. The crystallite size and size distribution of crystallites obtained from WA analysis are explained based on the experimental parameters employed in preparation of these magnetic iron oxide nanoparticles. The variation of volume weighted diameter (Dv, from WA analysis) with saturation magnetization (Ms) fits well to a core shell model wherein it is known that Ms=Mbulk(1-6g/Dv) with Mbulk as bulk magnetization of iron oxide and g as magnetic shell disorder thickness.
Foreign-gas broadening of nitrous oxide absorption lines.
NASA Technical Reports Server (NTRS)
Tubbs, L. D.; Williams, D.
1972-01-01
We have measured the foreign-gas broadening coefficients for collisional broadening of lines in the nu-3 fundamental of N2O by He, Ne, Ar, Kr, Xe, H2, D2, and CH4. These coefficients, which give the ratio of the line-broadening ability of these gases to the line-broadening ability of N2, can be used with recent measurements and calculations of N2 broadening to obtain optical collision cross sections.
Bayesian approach for peak detection in two-dimensional chromatography.
Vivó-Truyols, Gabriel
2012-03-20
A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual one-dimensional peaks have been originated from the same compound and should then be arranged in a two-dimensional peak. The merging algorithm is based on Bayesian inference. The user sets prior information about certain parameters (e.g., second-dimension retention time variability, first-dimension band broadening, chromatographic noise). On the basis of these priors, the algorithm calculates the probability of myriads of peak arrangements (i.e., ways of merging one-dimensional peaks), finding which of them holds the highest value. Uncertainty in each parameter can be accounted by adapting conveniently its probability distribution function, which in turn may change the final decision of the most probable peak arrangement. It has been demonstrated that the Bayesian approach presented in this paper follows the chromatographers' intuition. The algorithm has been applied and tested with LC × LC and GC × GC data and takes around 1 min to process chromatograms with several thousands of peaks.
VUV pressure-broadening in sulfur dioxide
NASA Astrophysics Data System (ADS)
Lyons, J. R.; Herde, H.; Stark, G.; Blackie, D. S.; Pickering, J. C.; de Oliveira, N.
2018-05-01
In the pre-oxygenated ancient Earth atmosphere, the lack of O3 absorption allowed ultraviolet photodissociation of numerous molecules in the troposphere and lower stratosphere. For molecules with narrow line-type absorption spectra, optically thick columns would have produced isotope fractionation due to self-shielding of the most abundant isotopologues. In the lower atmosphere pressure broadening would modify, and in some cases, eliminate these isotope signatures. Shielding is particularly important for quantifying or constraining photolysis-derived isotope effects, such as those believed to explain the sulfur mass-independent fractionation in Archean sedimentary rocks. Here, we report pressure broadening coefficients for natural abundance SO2 in theC˜1B2 ←X˜1A1 band system at 215 nm. For gas bath pressures up to 750 mbar, we find broadening coefficients of 0.30 ± 0.03 cm-1 atm-1 and 0.40 ± 0.04 cm-1 atm-1 for N2 and CO2, respectively. These broadening coefficients are ∼30% larger than SO2 broadening coefficients previously measured in the B˜ -X˜ bands at 308 nm. Because of the highly congested nature of the C˜ -X˜ bands, pressure broadening in the early Earth troposphere will cause line profile overlap that will diminish the self-shielding-derived mass-independent isotope fractionation for optically thick SO2 columns. Thus, non-explosive volcanic eruptions may not have left a signature of SO2 self-shielding in the ancient sedimentary rock record.
Jäger, Daniel T.; Rüsseler, Jascha
2016-01-01
The Broaden-and-Build Theory states that positive emotions broaden cognition and therefore build personal resources. However, missing theoretical precision regarding the interaction of the cognitive processes involved offers a variety of possible explanations for the mechanisms of broadening and building. In Experiment 1 we tested the causality assumption which states that positive emotions first broaden visual attention which in turn leads to broadened cognition. We examined the effects of a broadened, narrowed or neutral attentional scope of 72 subjects (30 men) on their momentary thought-action repertoire. Results showed that there were no significant differences between groups regarding the breadth or the content of the thought-action repertoire. In Experiment 2 we studied the non-causality hypothesis which assumes a non-causal relationship between cognitive processes. We did so by investigating the effects of negative, neutral, and positive affect on the visual attentional scope of 85 subjects (41 men) in Experiment 2a, as well as on the thought-action repertoire of 85 participants (42 men) in Experiment 2b. Results revealed an attentional broadening effect in Experiment 2a but no differences between groups concerning the breadth of the thought-action repertoire in Experiment 2b. However, a theory driven content analysis showed that positive affect promoted social actions. Thus, our results favor the non-causality assumption. Moreover, results indicate that positive emotions do not target personal resources in general but rather resources associated with social behavior. In conclusion, we argue that the Broaden-and-Build Theory should be refined. PMID:27826276
Synchronizing flash-melting in a diamond cell with synchrotron X ray diffraction (XRD)
NASA Astrophysics Data System (ADS)
Karandikar, Amol; Boehler, Reinhard; Meng, Yue; Rod, Eric; Shen, Guoyin
2013-06-01
The major challenges in measuring melting temperatures in laser heated diamond cells are sample instability, thermal runaway and chemical reactions. To circumvent these problems, we developed a ``flash heating'' method using a modulated CW fiber laser and fast X ray detection capability at APS (Pilatus 1M detector). As an example, Pt spheres of 5 micron diameter were loaded in a single crystal sapphire encapsulation in the diamond cell at 65 GPa and heated in a single flash heating event for 20 ms to reach a desired temperature. A CCD spectrometer and the Pilatus were synchronized to measure the temperature and the XRD signal, respectively, when the sample reached the thermal steady state. Each successive flash heating was done at a higher temperature. The integrated XRD pattern, collected during and after (300 K) each heating, showed no chemical reaction up to 3639 K, the highest temperature reached in the experiment. Pt111 and 200 peak intensity variation showed gradual recrystalization and complete diminishing at about 3600 K, indicating melting. Thus, synchronized flash heating with novel sample encapsulation circumvents previous notorious problems and enables accurate melting temperature measurement in the diamond cell using synchrotron XRD probe. Affiliation 2: Geowissenschaeften, Goethe-Universitaet, Altenhoeferallee 1, D-60438 Frankfurt a.M., Germany.
Eberl, D.D.; Nüesch, R.; Šucha, Vladimír; Tsipursky, S.
1998-01-01
The thicknesses of fundamental illite particles that compose mixed-layer illite-smectite (I-S) crystals can be measured by X-ray diffraction (XRD) peak broadening techniques (Bertaut-Warren-Averbach [BWA] method and integral peak-width method) if the effects of swelling and XRD background noise are eliminated from XRD patterns of the clays. Swelling is eliminated by intercalating Na-saturated I-S with polyvinylpyrrolidone having a molecular weight of 10,000 (PVP-10). Background is minimized by using polished metallic silicon wafers cut perpendicular to (100) as a substrate for XRD specimens, and by using a single-crystal monochromator. XRD measurements of PVP-intercalated diagenetic, hydrothermal and low-grade metamorphic I-S indicate that there are at least 2 types of crystallite thickness distribution shapes for illite fundamental particles, lognormal and asymptotic; that measurements of mean fundamental illite particle thicknesses made by various techniques (Bertant-Warren-Averbach, integral peak width, fixed cation content, and transmission electron microscopy [TEM]) give comparable results; and that strain (small differences in layer thicknesses) generally has a Gaussian distribution in the log-normal-type illites, but is often absent in the asymptotic-type illites.
Broadening of the divertor heat flux footprint with increasing number of ELM filaments in NSTX
NASA Astrophysics Data System (ADS)
Ahn, Joon-Wook
2014-10-01
We report on the broadening (narrowing) of the ELM heat flux footprint with increasing (decreasing) number of filamentary striations from in-depth thermography measurements in NSTX. Edge localized modes (ELMs) represent a challenge to future fusion devices, due to the high heat fluxes on plasma facing surfaces. One ameliorating factor has been that the divertor heat flux characteristic profile width (λq) has been observed to broaden with the size of ELM, as compared with the inter-ELM λq, which keeps the peak heat flux (qpeak) from increasing. In contrast, λq has been observed to narrow during ELMs under certain conditions in NSTX, for both naturally occurring and 3-D fields triggered ELMs. Fast thermographic measurements and detailed analysis demonstrate that the ELM λq increases with the number of observed filamentary striations, i . e . , profile narrowing (broadening) occurs when the number of striations is smaller (larger) than 3-4. With profile narrowing, qpeak at ELM peak times is inversely related (proportional) to λq (the ELM size), exacerbating the heat flux problem. Edge stability analysis shows that NSTX ELMs almost always lie on the current-driven kink/peeling mode side with low toroidal mode number (n = 1--5), consistent with the typical numbers of striations in NSTX (0-8) in comparison 10--15 striations are normally observed in intermediate-n peeling-ballooning ELMs, e.g., from JET. The NSTX characteristics may translate directly to ITER, which is also projected to lie on the low-n kink/peeling stability boundary. This work was supported by the U.S. DOE, Contract DE-AC05-00OR22725 (ORNL) and DE-AC02-09CH11466 (PPPL).
Wan, W J; Li, H; Cao, J C
2018-01-22
The authors present an experimental investigation of radio frequency modulation on pulsed terahertz quantum cascade lasers (QCLs) emitting around 4.3 THz. The QCL chip used in this work is based on a resonant phonon design which is able to generate a 1.2 W peak power at 10 K from a 400-µm-wide and 4-mm-long laser with a single plasmon waveguide. To enhance the radio frequency modulation efficiency and significantly broaden the terahertz spectra, the QCLs are also processed into a double-metal waveguide geometry with a Silicon lens out-coupler to improve the far-field beam quality. The measured beam patterns of the double-metal QCL show a record low divergence of 2.6° in vertical direction and 2.4° in horizontal direction. Finally we perform the inter-mode beat note and terahertz spectra measurements for both single plasmon and double-metal QCLs working in pulsed mode. Since the double-metal waveguide is more suitable for microwave signal transmission, the radio frequency modulation shows stronger effects on the spectral broadening for the double-metal QCL. Although we are not able to achieve comb operation in this work for the pulsed lasers due to the large phase noise, the homogeneous spectral broadening resulted from the radio frequency modulation can be potentially used for spectroscopic applications.
Cherepanova, Svetlana; Markovskaya, Dina; Kozlova, Ekaterina
2017-06-01
The X-ray diffraction (XRD) pattern of a deleterious phase in the photocatalyst based on Cd 1 - x Zn x S/Zn(OH) 2 contains two relatively intense asymmetric peaks with d-spacings of 2.72 and 1.56 Å. Very small diffraction peaks with interplanar distances of (d) ≃ 8.01, 5.40, 4.09, 3.15, 2.49 and 1.35 Å are characteristic of this phase but not always observed. To identify this phase, the XRD patterns for sheet-like hydroxide β-Zn(OH) 2 and sheet-like hydrozincite Zn 5 (CO 3 ) 2 (OH) 6 as well as for turbostratic hydrozincite were simulated. It is shown that the XRD pattern calculated on the basis of the last model gives the best correspondence with experimental data. Distances between layers in the turbostratically disordered hydrozincite fluctuate around d ≃ 8.01 Å. This average layer-to-layer distance is significantly higher than the interlayer distance 6.77 Å in the ordered Zn 5 (CO 3 ) 2 (OH) 6 probably due to a deficiency of CO 3 2- anions, excess OH - and the presence of water molecules in the interlayers. It is shown by variable-temperature XRD and thermogravimetric analysis (TGA) that the nanocrystalline turbostratic nonstoichiometric hydrozincite-like phase is quite thermostable. It decomposes into ZnO in air above 473 K.
Yang, Jia-Yue; Hu, Ming
2017-08-17
The power conversion efficiency of hybrid halide perovskite solar cells is profoundly influenced by the operating temperature. Here we investigate the temperature influence on the electronic band structure and optical absorption of cubic CH 3 NH 3 PbI 3 from first-principles by accounting for both the electron-phonon interaction and thermal expansion. Within the framework of density functional perturbation theory, the electron-phonon coupling induces slightly enlarged band gap and strongly broadened electronic relaxation time as temperature increases. The large broadening effect is mainly due to the presence of cation organic atoms. Consequently, the temperature-dependent absorption peak exhibits blue-shift position, decreased amplitude, and broadened width. This work uncovers the atomistic origin of temperature influence on the optical absorption of cubic CH 3 NH 3 PbI 3 and can provide guidance to design high-performance hybrid halide perovskite solar cells at different operating temperatures.
Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.
Foley, Joe P; Blackney, Donna M; Ennis, Erin J
2017-11-10
The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum
Statistical Fine Structure of Inhomogeneously Broadened Absorption Lines.
1987-07-31
inhomogeneously broadened optical absorption of pentacene n p-terphenyl at liquid helium temperatures... SFS is the actual frequency- ependent, time...statistical fine structure (SFS) in the inhomogeneously broadened optical absorption of pentacene in p-terphenyl at liquid helium temperatures. SFS is the...quite difficult . -2- We have observed for the first time statistical fine structure in the inhomogeneously broadened optical absorption of pentacene
ELM-free and inter-ELM divertor heat flux broadening induced by edge harmonics oscillation in NSTX
Gan, K. F.; Ahn, J. -W.; Gray, T. K.; ...
2017-10-26
A new n =1 dominated edge harmonic oscillation (EHO) has been found in NSTX. The new EHO, rotating toroidally in the counter-current direction and the opposite direction of the neutral beam, was observed during certain inter-ELM and ELM-free periods of H-mode operation. This EHO is associated with a significant broadening of the integral heat flux width (more » $${{\\lambda}_{\\operatorname{int}}}$$ ) by up to 150%, and a decrease in the divertor peak heat flux by >60%. An EHO induced filament was also observed by the gas puff imaging diagnostic. The toroidal rotating filaments could change the edge magnetic topology resulting in toroidal rotating strike point splitting and heat flux broadening. Finally, experimental result of the counter current rotation of strike points splitting is consistent with the counter-current EHO.« less
Hanrahan, Michael P; Venkatesh, Amrit; Carnahan, Scott L; Calahan, Julie L; Lubach, Joseph W; Munson, Eric J; Rossini, Aaron J
2017-10-25
We demonstrate that natural isotopic abundance 2D heteronuclear correlation (HETCOR) solid-state NMR spectra can be used to significantly reduce or eliminate the broadening of 1 H and 13 C solid-state NMR spectra of organic solids due to anisotropic bulk magnetic susceptibility (ABMS). ABMS often manifests in solids with aromatic groups, such as active pharmaceutical ingredients (APIs), and inhomogeneously broadens the NMR peaks of all nuclei in the sample. Inhomogeneous peaks with full widths at half maximum (FWHM) of ∼1 ppm typically result from ABMS broadening and the low spectral resolution impedes the analysis of solid-state NMR spectra. ABMS broadening of solid-state NMR spectra has previously been eliminated using 2D multiple-quantum correlation experiments, or by performing NMR experiments on diluted materials or single crystals. However, these experiments are often infeasible due to their poor sensitivity and/or provide limited gains in resolution. 2D 1 H- 13 C HETCOR experiments have previously been applied to reduce susceptibility broadening in paramagnetic solids and we show that this strategy can significantly reduce ABMS broadening in diamagnetic organic solids. Comparisons of 1D solid-state NMR spectra and 1 H and 13 C solid-state NMR spectra obtained from 2D 1 H- 13 C HETCOR NMR spectra show that the HETCOR spectrum directly increases resolution by a factor of 1.5 to 8. The direct gain in resolution is determined by the ratio of the inhomogeneous 13 C/ 1 H linewidth to the homogeneous 1 H linewidth, with the former depending on the magnitude of the ABMS broadening and the strength of the applied field and the latter on the efficiency of homonuclear decoupling. The direct gains in resolution obtained using the 2D HETCOR experiments are better than that obtained by dilution. For solids with long proton longitudinal relaxation times, dynamic nuclear polarization (DNP) was applied to enhance sensitivity and enable the acquisition of 2D 1 H- 13 C
NASA Astrophysics Data System (ADS)
Lafuente, B.; Bishop, J. L.; Fenton, L. K.; King, S. J.; Blake, D.; Sarrazin, P.; Downs, R.; Horgan, B. H.
2013-12-01
A field portable X-ray Diffraction (XRD) instrument was used at White Sands National Monument to perform in-situ measurements followed by laboratory analyses of the gypsum-rich dunes and to determine its modal mineralogy. The field instrument is a Terra XRD (Olympus NDT) based on the technology of the CheMin (Chemistry and Mineralogy) instrument onboard the Mars Science Laboratory (MSL) rover Curiosity which is providing the mineralogical and chemical composition of scooped soil samples and drilled rock powders collected at Gale Crater [1]. Using Terra at White Sands will contribute to 'ground truth' for gypsum-bearing environments on Mars. Together with data provided by VNIR spectra [2], this study clarifies our understanding of the origin and history of gypsum-rich sand dunes discovered near the northern polar region of Mars [3]. The results obtained from the field analyses performed by XRD and VNIR spectroscopy in four dunes at White Sands revealed the presence of quartz and dolomite. Their relative abundance has been estimated using the Reference Intensity Ratio (RIR) method. For this study, particulate samples of pure natural gypsum, quartz and dolomite were used to prepare calibration mixtures of gypsum-quartz and gypsum-dolomite with the 90-150μm size fractions. All single phases and mixtures were analyzed by XRD and RIR factors were calculated. Using this method, the relative abundance of quartz and dolomite has been estimated from the data collected in the field. Quartz appears to be present in low amounts (2-5 wt.%) while dolomite is present at percentages up to 80 wt.%. Samples from four dunes were collected and prepared for subsequent XRD analysis in the lab to estimate their composition and illustrate the changes in mineralogy with respect to location and grain size. Gypsum-dolomite mixtures: The dolomite XRD pattern is dominated by an intense diffraction peak at 2θ≈36 deg. which overlaps a peak of gypsum, This makes low concentrations of dolomite
NASA Technical Reports Server (NTRS)
Smith, M. A. H.; Rinsland, C. P.; Devi, Malathy V.; Benner, D. Chris; Thakur, K. B.
1988-01-01
Air- and nitrogen-broadened half-widths and line shifts at room temperature for more than 60 individual vibration-rotation transitions in the nu1 fundamental band of (O-16)3 and several transitions in the nu3 band were determined from infrared absorption spectra. These spectra were recorded at 0.005/cm resolution with a Fourier-transform spectrometer. A tunable-diode-laser spectrometer operating in the 1090-1150/cm region was also used to record data on oxygen-, nitrogen-, and air-broadened half-widths for selected individual transitions. The nitrogen- and air-broadened half-widths determined by these two different measurement techniques are consistent to within 4 percent. The results are in good agreement with other published measurements and calculations.
Wall-collision line broadening of molecular oxygen within nanoporous materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Can T.; Lewander, Maerta; Andersson-Engels, Stefan
2011-10-15
Wall-collision broadening of near-infrared absorption lines of molecular oxygen confined in nanoporous zirconia is studied by employing high-resolution diode-laser spectroscopy. The broadening is studied for pores of different sizes under a range of pressures, providing new insights on how wall collisions and intermolecular collisions influence the total spectroscopic line profile. The pressure series show that wall-collision broadening is relatively more prominent under reduced pressures, enabling sensitive means to probe pore sizes of porous materials. In addition, we show that the total wall-collision-broadened profile strongly deviates from a Voigt profile and that wall-collision broadening exhibits an additive-like behavior to the pressuremore » and Doppler broadening.« less
The broaden-and-build theory of positive emotions.
Fredrickson, Barbara L
2004-01-01
The broaden-and-build theory describes the form and function of a subset of positive emotions, including joy, interest, contentment and love. A key proposition is that these positive emotions broaden an individual's momentary thought-action repertoire: joy sparks the urge to play, interest sparks the urge to explore, contentment sparks the urge to savour and integrate, and love sparks a recurring cycle of each of these urges within safe, close relationships. The broadened mindsets arising from these positive emotions are contrasted to the narrowed mindsets sparked by many negative emotions (i.e. specific action tendencies, such as attack or flee). A second key proposition concerns the consequences of these broadened mindsets: by broadening an individual's momentary thought-action repertoire--whether through play, exploration or similar activities--positive emotions promote discovery of novel and creative actions, ideas and social bonds, which in turn build that individual's personal resources; ranging from physical and intellectual resources, to social and psychological resources. Importantly, these resources function as reserves that can be drawn on later to improve the odds of successful coping and survival. This chapter reviews the latest empirical evidence supporting the broaden-and-build theory and draws out implications the theory holds for optimizing health and well-being. PMID:15347528
Real-Time XRD Studies of Li-O2 Electrochemical Reaction in Nonaqueous Lithium-Oxygen Battery.
Lim, Hyunseob; Yilmaz, Eda; Byon, Hye Ryung
2012-11-01
Understanding of electrochemical process in rechargeable Li-O2 battery has suffered from lack of proper analytical tool, especially related to the identification of chemical species and number of electrons involved in the discharge/recharge process. Here we present a simple and straightforward analytical method for simultaneously attaining chemical and quantified information of Li2O2 (discharge product) and byproducts using in situ XRD measurement. By real-time monitoring of solid-state Li2O2 peak area, the accurate efficiency of Li2O2 formation and the number of electrons can be evaluated during full discharge. Furthermore, by observation of sequential area change of Li2O2 peak during recharge, we found nonlinearity of Li2O2 decomposition rate for the first time in ether-based electrolyte.
Temperature-Dependence of Air-Broadened Line Widths and Shifts in the nu3 Band of Ozone
NASA Technical Reports Server (NTRS)
Smith, Mary A. H.; Rinsland, Curtis P.; Devi, V. Malathy; Benner, D. Chris; Cox, A. M.
2006-01-01
The 9.6-micron bands of O3 are used by many remote-sensing experiments for retrievals of terrestrial atmospheric ozone concentration profiles. Line parameter errors can contribute significantly to the total errors in these retrievals, particularly for nadir-viewing. The McMath-Pierce Fourier transform spectrometer at the National Solar Observatory on Kitt Peak was used to record numerous high-resolution infrared absorption spectra of O3 broadened by various gases at temperatures between 160 and 300 K. Over 30 spectra were analyzed simultaneously using a multispectrum nonlinear least squares fitting technique to determine Lorentz air-broadening and pressure-induced shift coefficients along with their temperature dependences for selected transitions in the 3 fundamental band of (16)O3. We compare the present results with other measurements reported in the literature and with the ozone parameters on the 2000 and 2004 editions of the HITRAN database.
NASA Astrophysics Data System (ADS)
Rao, D. V.; Cesareo, R.; Brunetti, A.; Gigante, G. E.; Akatsuka, T.; Takeda, T.; Itai, Y.
2004-09-01
Relativistic and nonrelativistic Compton profile cross sections for H, C, N, O, P, and Ca and for a few important biological materials such as water, polyethylene, lucite, polystyrene, nylon, polycarbonate, bakelite, fat, bone and calcium hydroxyapatite are estimated for a number of Kα x-ray energies and for 59.54 keV (Am-241) γ photons. Energy broadening and geometrical broadening (ΔG) is estimated by assuming θmin and θmax are symmetrically situated around θ=90°. FWHM of J(PZ) and FWHM of Compton energy broadening are evaluated at various incident photon energies. These values are estimated around the centroid of the Compton profile with an energy interval of 0.1 and 1.0 keV for 59.54 keV photons. Total Compton, individual shell, and Compton energy-absorption scattering cross sections are evaluated in the energy region from 0.005 to 0.5 MeV. It is an attempt to know the effect of Doppler broadening for single atoms, many of which constitute the biological materials.
Andrews, John T.; Eberl, D.D.; Kristjansdottir, G.B.
2006-01-01
Tephras, mainly from Iceland, are becoming increasingly important in interpreting leads and lags in the Holocene climate system across NW Europe. Here we demonstrate that Quantitative Phase Analysis of x-ray diffractograms of the 150 um fraction and identify these same peaks in XRD scans - two of these correlate geochemically and chronologically with Hekla 1104 and 3. At a distal site to the WNW of Iceland, on the East Greenland margin (core MD99-2317), the weight% of volcanic glass reaches values of 11% at about the time of the Saksunarvatn tephra. The XRD method identifies the presence of volcanic glass but not its elemental composition; hence it will assist in focusing attention on specific sections of sediment cores for subsequent geochemical fingerprinting of tephras. ?? 2006 SAGE Publications.
THE EFFECT OF SATELLITE LINES FROM THE X-RAY SOURCE ON X-RAY DIFFRACTION PEAKS
The article discusses the development of a method for relating reactivity to crystallite size and strain parameters obtained by the Warren-Averbach technique. EPA has been using crystallite size and strain data obtained from x-ray diffraction (XRD) peak profile analysis to predic...
Probing transverse momentum broadening in heavy ion collisions
Mueller, A. H.; Wu, Bin; Xiao, Bo -Wen; ...
2016-10-20
We study the dijet azimuthal de-correlation in relativistic heavy ion collisions as an important probe of the transverse momentum broadening effects of a high energy jet traversing the quark–gluon plasma. We take into account both the soft gluon radiation in vacuum associated with the Sudakov logarithms and the jet P T-broadening effects in the QCD medium. We find that the Sudakov effects are dominant at the LHC, while the medium effects can play an important role at RHIC energies. This explains why the LHC experiments have not yet observed sizable P T-broadening effects in the measurement of dijet azimuthal correlationsmore » in heavy ion collisions. Future investigations at RHIC will provide a unique opportunity to study the -broadening effects and help to pin down the underlying mechanism for jet energy loss in a hot and dense medium.« less
Cross-phase modulation-induced spectral broadening in silicon waveguides.
Zhang, Yanbing; Husko, Chad; Lefrancois, Simon; Rey, Isabella H; Krauss, Thomas F; Schröder, Jochen; Eggleton, Benjamin J
2016-01-11
We analytically and experimentally investigate cross-phase modulation (XPM) in silicon waveguides. In contrast to the well known result in pure Kerr media, the spectral broadening ratio of XPM to self-phase modulation is not two in the presence of either two-photon absorption (TPA) or free carriers. The physical origin of this change is different for each effect. In the case of TPA, this nonlinear absorption attenuates and slightly modifies the pulse shape due to differential absorption in the pulse peak and wings. When free carriers are present two different mechanisms modify the dynamics. First, free-carrier absorption performs a similar role to TPA, but is additionally asymmetric due to the delayed free-carrier response. Second, free-carrier dispersion induces an asymmetric blue phase shift which competes directly with the symmetric Kerr-induced XPM red shift. We confirm this analysis with pump-probe experiments in a silicon photonic crystal waveguide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pakharukova, V.P., E-mail: verapakh@catalysis.ru; Novosibirsk State University, Pirogova Street 2, 630090 Novosibirsk; Research and Educational Center for Energy Efficient Catalysis, Novosibirsk State University, Novosibirsk 630090
2017-02-15
The structure and nanostructure features of nanocrystalline γ-Al{sub 2}O{sub 3} obtained by dehydration of boehmite with anisotropic platelet-shaped particles were investigated. The original models of 3D coherent nanostructure of γ-Al{sub 2}O{sub 3} were constructed. The models of nanostructured γ-Al{sub 2}O{sub 3} particles were first confirmed by a direct simulation of powder X–Ray diffraction (XRD) patterns using the Debye Scattering Equation (DSE) with assistance of high-resolution transmission electron microscopy (HRTEM) study. The average crystal structure of γ-Al{sub 2}O{sub 3} was shown to be tetragonally distorted. The experimental results revealed that thin γ-Al{sub 2}O{sub 3} platelets were heterogeneous on a nanometer scalemore » and nanometer-sized building blocks were separated by partially coherent interfaces. The XRD simulation results showed that a specific packing of the primary crystalline blocks in the nanostructured γ-Al{sub 2}O{sub 3} particles with formation of planar defects on (001), (100), and (101) planes nicely accounted for pronounced diffuse scattering, anisotropic peak broadening and peak shifts in the experimental XRD pattern. The identified planar defects in cation sublattice seem to be described as filling cation non-spinel sites in existing crystallographic models of γ-Al{sub 2}O{sub 3} structure. The overall findings provided an insight into the complex nanostructure, which is intrinsic to the metastable γ-Al{sub 2}O{sub 3} oxide. - Highlights: • Thin plate-like crystallites of γ-Al{sub 2}O{sub 3} were obtained. • Models of 3D coherent nanostructure of γ-Al{sub 2}O{sub 3} were constructed. • Models were verified by simulating XRD patterns using the Debye Scattering Equation. • Specific broadening of XRD peaks was explained in terms of planar defects. • Primary crystalline blocks in γ-Al{sub 2}O{sub 3} are separated by partially coherent interfaces.« less
Anomalous Evolution of the Near-Side Jet Peak Shape in Pb-Pb Collisions at √{sN N}=2.76 TeV
NASA Astrophysics Data System (ADS)
Adam, J.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, S.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; An, M.; Andrei, C.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Balasubramanian, S.; Baldisseri, A.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Buitron, S. A. I.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Conesa Balbastre, G.; Conesa Del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crkovská, J.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; de, S.; de Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; de Falco, A.; de Gruttola, D.; De Marco, N.; de Pasquale, S.; de Souza, R. D.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; di Bari, D.; di Mauro, A.; di Nezza, P.; di Ruzza, B.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Duggal, A. K.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Garg, P.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; Gonzalez, V.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L.; Grelli, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grion, N.; Gronefeld, J. M.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hladky, J.; Horak, D.; Hosokawa, R.; Hristov, P.; Hughes, C.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Isakov, V.; Islam, M. S.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Mohisin Khan, M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kileng, B.; Kim, D. W.; Kim, D. J.; Kim, D.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lazaridis, L.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.; Lehner, S.; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Llope, W.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martinengo, P.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Mastroserio, A.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A. N.; Mishra, T.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montes, E.; Moreira de Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao de Oliveira, R. A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Pal, S. K.; Palni, P.; Pan, J.; Pandey, A. K.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Park, W. J.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.; Peng, X.; Pereira da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sano, M.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H. P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thomas, D.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; Tripathy, S.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; van der Maarel, J.; van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yalcin, S.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zmeskal, J.; Alice Collaboration
2017-09-01
The measurement of two-particle angular correlations is a powerful tool to study jet quenching in a pT region inaccessible by direct jet identification. In these measurements pseudorapidity (Δ η ) and azimuthal (Δ φ ) differences are used to extract the shape of the near-side peak formed by particles associated with a higher pT trigger particle (1
Cascaded Raman shifting of high-peak-power nanosecond pulses in As₂S₃ and As₂Se₃ optical fibers.
White, Richard T; Monro, Tanya M
2011-06-15
We report efficient cascaded Raman scattering of near-IR nanosecond pulses in large-core (65 μm diameter) As₂S₃ and As₂Se₃ optical fibers. Raman scattering dominates other spectral broadening mechanisms, such as four-wave mixing, modulation instability, and soliton dynamics, because the fibers have large normal group-velocity dispersion in the spectral range of interest. With ~2 ns pump pulses at a wavelength of 1.9 μm, four Stokes peaks, all with peak powers greater than 1 kW, have been measured.
Self-Broadening and Self-Shift Coefficients in the Fundamental Band of 12C 16O
NASA Technical Reports Server (NTRS)
Devi, Malathy V.; Benner, D. Chris; Smith, Mary Ann H.; Rinsland, Curtis P.
1998-01-01
High quality and precise measurements of self-broadened and self-shift coefficients in the fundamental band of C-12O-16 were made using spectra recorded at room temperature with the high-resolution (0.0027 cm(exp -1)) McMath-Pierce Fourier transform spectrometer located at the National Solar Observatory on Kitt Peak, Arizona. The spectral region under investigation (2008-2247 cm(exp -1)) contains the P(31) to R(31) transitions. The data were obtained using a high-purity natural isotopic sample ofcarbon monoxide and two absorption cells with pathlengths of 4.08 and 9.98 cm, respectively. Various pressures of CO were used, ranging between 0.25 and 201.2 Torr. The results were obtained by analyzing five spectra simultaneously, using a multispectrum nonlinear least-squares fitting technique. The self-broadened coefficients ranged from 0.0426(2) cm(exp -1) atm(exp -1) at 296 K to 0.0924(2) cm(exp -1) atm(exp -1) at 296 K, while the pressure-induced shift coefficients varied between -0.0042(3) cm(exp -1) atm(exp -1) at 296 K and +0.0005(l) cm(exp -1) atm(exp -1) at 296 K. The value in parentheses is the estimated uncertainty in units of the last digit. The self-broadened coefficients of lines with same values of m in the P and R branches agree close to within experimental uncertainties while the self-shift coefficients showed considerable variation within and between the two branches. The mean value of the ratios of P branch to R branch self-broadened coefficients was found to be 1.01 with a standard deviation of + or - 0.01. Comparisons of the results with other published data were made.
Kakuda, Hiroyuki; Okada, Tetsuo; Otsuka, Makoto; Katsumoto, Yukiteru; Hasegawa, Takeshi
2009-01-01
A multivariate analytical technique has been applied to the analysis of simultaneous measurement data from differential scanning calorimetry (DSC) and X-ray diffraction (XRD) in order to study thermal changes in crystalline structure of a linear poly(ethylene imine) (LPEI) film. A large number of XRD patterns generated from the simultaneous measurements were subjected to an augmented alternative least-squares (ALS) regression analysis, and the XRD patterns were readily decomposed into chemically independent XRD patterns and their thermal profiles were also obtained at the same time. The decomposed XRD patterns and the profiles were useful in discussing the minute peaks in the DSC. The analytical results revealed the following changes of polymorphisms in detail: An LPEI film prepared by casting an aqueous solution was composed of sesquihydrate and hemihydrate crystals. The sesquihydrate one was lost at an early stage of heating, and the film changed into an amorphous state. Once the sesquihydrate was lost by heating, it was not recovered even when it was cooled back to room temperature. When the sample was heated again, structural changes were found between the hemihydrate and the amorphous components. In this manner, the simultaneous DSC-XRD measurements combined with ALS analysis proved to be powerful for obtaining a better understanding of the thermally induced changes of the crystalline structure in a polymer film.
Solar Wind Strahl Broadening by Self-Generated Plasma Waves
NASA Technical Reports Server (NTRS)
Pavan, J.; Vinas, A. F.; Yoon, P. H.; Ziebell, L. F.; Gaelzer, R.
2013-01-01
This Letter reports on the results of numerical simulations which may provide a possible explanation for the strahl broadening during quiet solar conditions. The relevant processes involved in the broadening are due to kinetic quasi-linear wave-particle interaction. Making use of static analytical electron distribution in an inhomogeneous field, it is found that self-generated electrostatic waves at the plasma frequency, i.e., Langmuir waves, are capable of scattering the strahl component, resulting in energy and pitch-angle diffusion that broadens its velocity distribution significantly. The present theoretical results provide an alternative or complementary explanation to the usual whistler diffusion scenario, suggesting that self-induced electrostatic waves at the plasma frequency might play a key role in broadening the solar wind strahl during quiet solar conditions.
Alternative Fuels Data Center: New York Broadens Network for Electric
Vehicle Charging New York Broadens Network for Electric Vehicle Charging to someone by E-mail Share Alternative Fuels Data Center: New York Broadens Network for Electric Vehicle Charging on Facebook Tweet about Alternative Fuels Data Center: New York Broadens Network for Electric Vehicle Charging on
Far-infrared self-broadening in methylcyanide - Absorber-perturber resonance
NASA Technical Reports Server (NTRS)
Buffa, G.; Tarrini, O.; De Natale, P.; Inguscio, M.; Pavone, F. S.; Prevedelli, M.; Evenson, K. M.; Zink, L. R.; Schwaab, G. W.
1992-01-01
Using tunable far-infrared spectrometers with high-frequency stability and accuracy, the self-pressure broadening and shift of CH3CN are measured. Evidence of absorber-perturber resonance effects on the collisional line shape are obtained. This tests the theoretical model and its possible improvements and also allows predictions of broadening and shift for a large class of molecules. Moreover, the resonance effect produces a theoretical temperature dependence of self-broadening that is different from what is commonly assumed.
Broadening Leaders? Culture Change as the Cure
2012-04-05
system. The muddy boots culture results from how the Army defines career success – defined by selection for battalion and brigade command. By looking at...commanders reinforce the perception – repeated tactical assignments in lieu of risking broadening assignments is the path to career success that...boots culture actually discourages the pursuit of broadening assignments – the ―narrow definition or path of career success for Army officers
Anomalous Evolution of the Near-Side Jet Peak Shape in Pb-Pb Collisions at s N N = 2.76 TeV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adam, J.; Adamová, D.; Aggarwal, M. M.
The measurement of two-particle angular correlations is a powerful tool to study jet quenching in a p T region inaccessible by direct jet identification. Here, the differences in the pseudorapidity (Δη) and azimuthal (Δφ) measurements are used to extract the shape of the near-side peak formed by particles associated with a higher pT trigger particle (1 < p T,trig < 8 GeV/c). A combined fit of the near-side peak and long-range correlations is applied to the data allowing the extraction of the centrality evolution of the peak shape in Pb-Pb collisions at √ sNN=2.76 TeV. A significant broadening of themore » peak in the Δη direction at low pT is found from peripheral to central collisions, which vanishes above 4 GeV/c, while in the Δφ direction the peak is almost independent of centrality. For the 10% most central collisions and 1 < p T,assoc < 2 GeV/c, 1 < p T,trig < 3 GeV/c a novel feature is observed: a depletion develops around the center of the peak. Our results are compared to pp collisions at the same center of mass energy and ampt model simulations. The comparison to the investigated models suggests that the broadening and the development of the depletion is connected to the strength of radial and longitudinal flow.« less
Anomalous Evolution of the Near-Side Jet Peak Shape in Pb-Pb Collisions at s N N = 2.76 TeV
Adam, J.; Adamová, D.; Aggarwal, M. M.; ...
2017-09-08
The measurement of two-particle angular correlations is a powerful tool to study jet quenching in a p T region inaccessible by direct jet identification. Here, the differences in the pseudorapidity (Δη) and azimuthal (Δφ) measurements are used to extract the shape of the near-side peak formed by particles associated with a higher pT trigger particle (1 < p T,trig < 8 GeV/c). A combined fit of the near-side peak and long-range correlations is applied to the data allowing the extraction of the centrality evolution of the peak shape in Pb-Pb collisions at √ sNN=2.76 TeV. A significant broadening of themore » peak in the Δη direction at low pT is found from peripheral to central collisions, which vanishes above 4 GeV/c, while in the Δφ direction the peak is almost independent of centrality. For the 10% most central collisions and 1 < p T,assoc < 2 GeV/c, 1 < p T,trig < 3 GeV/c a novel feature is observed: a depletion develops around the center of the peak. Our results are compared to pp collisions at the same center of mass energy and ampt model simulations. The comparison to the investigated models suggests that the broadening and the development of the depletion is connected to the strength of radial and longitudinal flow.« less
The effect of massive neutrinos on the BAO peak
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peloso, Marco; Pietroni, Massimo; Viel, Matteo
2015-07-01
We study the impact of neutrino masses on the shape and height of the BAO peak of the matter correlation function, both in real and redshift space. In order to describe the nonlinear evolution of the BAO peak we run N-body simulations and compare them with simple analytic formulae. We show that the evolution with redshift of the correlation function and its dependence on the neutrino masses is well reproduced in a simplified version of the Zel'dovich approximation, in which the mode-coupling contribution to the power spectrum is neglected. While in linear theory the BAO peak decreases for increasing neutrinomore » masses, the effect of nonlinear structure formation goes in the opposite direction, since the peak broadening by large scale flows is less effective. As a result of this combined effect, the peak decreases by ∼ 0.6 % for ∑ m{sub ν} = 0.15 eV and increases by ∼1.2% for ∑ m{sub ν} = 0.3 eV, with respect to a massless neutrino cosmology with equal value of the other cosmological parameters. We extend our analysis to redshift space and to halos, and confirm the agreement between simulations and the analytic formulae. We argue that all analytical approaches having the Zel'dovich propagator in their lowest order approximation should give comparable performances, irrespectively to their formulation in Lagrangian or in Eulerian space.« less
Zaliha, Omar; Elina, Hishamuddin; Sivaruby, Kanagaratnam; Norizzah, Abd Rashid; Marangoni, Alejandro G
2018-06-01
The in situ polymorphic forms and thermal transitions of refined, bleached and deodorized palm oil (RBDPO), palm stearin (RBDPS) and palm kernel oil (RBDPKO) were investigated using coupled X-ray diffraction (XRD) and differential scanning calorimetry (DSC). Results indicated that the DSC onset crystallisation temperature of RBDPO was at 22.6°C, with a single reflection at 4.2Å started to appear from 23.4 to 17.1°C, and were followed by two prominent exothermic peaks at 20.1°C and 8.5°C respectively. Further cooling to -40°C leads to the further formation of a β'polymorph. Upon heating, a of β'→βtransformation was observed between 32.1 to 40.8°C, before the sample was completely melted at 43.0°C. The crystallization onset temperature of RBDPS was 44.1°C, with the appearance of the α polymorph at the same temperature as the appearance of the first sharp DSC exothermic peak. This quickly changed from α→β´ in the range 25 to 21.7°C, along with the formation of a small β peak at -40°C. Upon heating, a small XRD peak for the β polymorph was observed between 32.2 to 36.0°C, becoming a mixture of (β´+ β) between 44.0 to 52.5°C. Only the β polymorph survived further heating to 59.8°C. For RBDPKO, the crystallization onset temperature was 11.6°C, with the formation of a single sharp exothermic peak at 6.5°C corresponding to the β' polymorphic form until the temperature reached -40°C. No transformation of the polymorphic form was observed during the melting process of RBDPKO, before being completely melted at 33.2°C. This work has demonstrated the detailed dynamics of polymorphic transformations of PKO and PS, two commercially important hardstocks used widely by industry and will contribute to a greater understanding of their crystallization and melting dynamics.
[Analysis of XRD spectral characteristics of soil clay mineral in two typical cultivated soils].
Zhang, Zhi-Dan; Luo, Xiang-Li; Jiang, Hai-Chao; Li, Qiao; Shen, Cong-Ying; Liu, Hang; Zhou, Ya-Juan; Zhao, Lan-Po; Wang, Ji-Hong
2014-07-01
The present paper took black soil and chernozem, the typical cultivated soil in major grain producing area of Northeast, as the study object, and determinated the soil particle composition characteristics of two cultivated soils under the same climate and location. Then XRD was used to study the composition and difference of clay mineral in two kinds of soil and the evolutionary mechanism was explored. The results showed that the two kinds of soil particles were composed mainly of the sand, followed by clay and silt. When the particle accumulation rate reached 50%, the central particle size was in the 15-130 microm interval. Except for black soil profile of Shengli Xiang, the content of clay showed converse sequence to the central particle in two soils. Clay accumulated under upper layer (18.82%) in black soil profile while under caliche layer (17.41%) in chernozem profile. Clay content was the least in parent material horizon except in black profile of Quanyanling. Analysis of clay XRD atlas showed that the difference lied in not only the strength of diffraction peak, but also in the mineral composition. The main contents of black soil and chernozem were both 2 : 1 clay, the composition of black soil was smectite/illite mixed layer-illite-vermiculite and that of chernozem was S/I mixture-illite-montmorillonite, and both of them contained little kaolinite, chlorite, quartz and other primary mineral. This paper used XRD to determine the characteristics of clay minerals comprehensively, and analyzed two kinds of typical cultivated soil comparatively, and it was a new perspective of soil minerals study.
NASA Astrophysics Data System (ADS)
Yang, J.; Zhang, T.; Han, L. A.; Cao, X. Z.; Yu, R. S.; Wang, B. Y.
2017-04-01
Hydrocarbon polymers, O-containing, F-containing and Cl-containing polymers are comprehensively studied by Coincidence Doppler Broadening Spectroscopy (CDBS). It is shown that for polymers with different chemical structure, CDBS results can effectively distinguish polar groups C dbnd O, Csbnd Cl, and Csbnd F. For polymers with similar chemical structure, the intensity of the element-specific peak in the CDBS ratio curve is dependent not only on the fraction of free positrons, but also on the content of characteristic atom in polymer repeated unit, and the polarity of the polymer molecule. For polymers containing several different polar groups, such as PCTFE (Csbnd F & Csbnd Cl) and PFA (Csbnd F & C dbnd O), whether the element-specific peak appears or not depends on the amount of the polar groups and its positron capture ability. This work may provide insights into potential applications of CDBS for studying complex polymer systems.
Statistical Fine Structure in Inhomogeneously Broadened Absorption Lines in Solids.
1987-12-22
the inhomogeneously broadened zero-phonon SijSo (0-0) absorption of pentacene molecules in crystals of p-terphenyl at liquid helium temperatures. SFS...structure (SFS) in the inhomogeneously broadened zero-phonon S, +- So (0-0) absorption of pentacene molecules in crystals of p-terphenyl at liquid helium...tile large multiplicity of local environments. Inhomogeneously broadened absorption lines are usually treated as smooth, Gaussian profiles. In recent
Immunity of intersubband polaritons to inhomogeneous broadening
NASA Astrophysics Data System (ADS)
Manceau, J.-M.; Biasiol, G.; Tran, N. L.; Carusotto, I.; Colombelli, R.
2017-12-01
We demonstrate that intersubband (ISB) polaritons are robust to inhomogeneous effects originating from the presence of multiple quantum wells (MQWs). In a series of samples that exhibit mid-infrared ISB absorption transitions with broadenings varying by a factor of 5 (from 4 to 20 meV), we observed polariton linewidths always lying in the 4 to 7 meV range only. We experimentally verified the dominantly inhomogeneous origin of the broadening of the ISB transition, and that the linewidth reduction effect of the polariton modes persists up to room-temperature. This immunity to inhomogeneous broadening is a direct consequence of the coupling of the large number of ISB oscillators to a single photonic mode. It is a precious tool to gauge the natural linewidth of the ISB plasmon that is otherwise masked in such MQWs system, and is also beneficial in view of perspective applications such as intersubband polariton lasers.
Mineralogy and provenance of clays in miarolitic cavities of the Pikes Peak Batholith, Colorado
Kile, D.E.
2005-01-01
Clay samples from 105 cavities within miarolitic granitic pegmatites throughout the Pikes Peak batholith, in Colorado, were analyzed by powder X-ray diffraction (XRD). Smectite (beidellite), illite, and kaolinite were found within the cavities. Calculation of crystallite-thickness distribution (CTD), mean thickness of the crystallites, and variance in crystallite thickness, as deduced from XRD patterns, allowed a determination of provenance and mode of formation for illite and smectite. Authigenic miarolitic-cavity illite and smectite show lognormal CTDs and larger mean thicknesses of crystallites than do their soil-derived counterparts; non-lognormal illite in a cavity results from mixing of cavity and soil illite. Analysis of mean thickness and thickness variance shows that crystal growth of illite is initiated by a nucleation event of short duration, followed by surface-controlled kinetics. Crystallization of the miarolitic cavity clays is presumed to occur by neoformation from hydrothermal fluids. The assessment of provenance allows a determination of regional and local distributions of clay minerals in miarolitic cavities within the Pikes Peak batholith.
EIT Noise Resonance Power Broadening: a probe for coherence dynamics
NASA Astrophysics Data System (ADS)
Crescimanno, Michael; O'Leary, Shannon; Snider, Charles
2012-06-01
EIT noise correlation spectroscopy holds promise as a simple, robust method for performing high resolution spectroscopy used in devices as diverse as magnetometers and clocks. One useful feature of these noise correlation resonances is that they do not power broaden with the EIT window. We report on measurements of the eventual power broadening (at higher optical powers) of these resonances and a simple, quantitative theoretical model that relates the observed power broadening slope with processes such as two-photon detuning gradients and coherence diffusion. These processes reduce the ground state coherence relative to that of a homogeneous system, and thus the power broadening slope of the EIT noise correlation resonance may be a simple, useful probe for coherence dynamics.
Puzenko, Alexander; Levy, Evgeniya; Shendrik, Andrey; Talary, Mark S; Caduff, Andreas; Feldman, Yuri
2012-11-21
In this, the third part of our series on the dielectric spectrum symmetrical broadening of water, we consider the nucleotide aqueous solutions. Where in Parts I [E. Levy et al., J. Chem. Phys. 136, 114502 (2012)] and II [E. Levy et al., J. Chem. Phys. 136, 114503 (2012)], the dipole-dipole or ion-dipole interaction had a dominant feature, now the interplay between these two types of dipole-matrix interactions will be considered. We present the results of high frequency dielectric measurements of different concentrations of adenosine monophosphate/adenosine-5'-triphosphate aqueous solutions. We observed the Cole-Cole broadening of the main relaxation peak of the solvent in the solutions. Moreover, depending on the nucleotide concentration, we observed both types of dipole-matrix interaction. The 3D trajectory approach (described in detail in Part I) is applied in order to highlight the differences between the two types of interaction.
Remote In-Situ Quantitative Mineralogical Analysis Using XRD/XRF
NASA Technical Reports Server (NTRS)
Blake, D. F.; Bish, D.; Vaniman, D.; Chipera, S.; Sarrazin, P.; Collins, S. A.; Elliott, S. T.
2001-01-01
X-Ray Diffraction (XRD) is the most direct and accurate method for determining mineralogy. The CHEMIN XRD/XRF instrument has shown promising results on a variety of mineral and rock samples. Additional information is contained in the original extended abstract.
Anomalous Evolution of the Near-Side Jet Peak Shape in Pb-Pb Collisions at sqrt[s_{NN}]=2.76 TeV.
Adam, J; Adamová, D; Aggarwal, M M; Aglieri Rinella, G; Agnello, M; Agrawal, N; Ahammed, Z; Ahmad, S; Ahn, S U; Aiola, S; Akindinov, A; Alam, S N; Albuquerque, D S D; Aleksandrov, D; Alessandro, B; Alexandre, D; Alfaro Molina, R; Alici, A; Alkin, A; Alme, J; Alt, T; Altinpinar, S; Altsybeev, I; Alves Garcia Prado, C; An, M; Andrei, C; Andrews, H A; Andronic, A; Anguelov, V; Anson, C; Antičić, T; Antinori, F; Antonioli, P; Anwar, R; Aphecetche, L; Appelshäuser, H; Arcelli, S; Arnaldi, R; Arnold, O W; Arsene, I C; Arslandok, M; Audurier, B; Augustinus, A; Averbeck, R; Azmi, M D; Badalà, A; Baek, Y W; Bagnasco, S; Bailhache, R; Bala, R; Balasubramanian, S; Baldisseri, A; Baral, R C; Barbano, A M; Barbera, R; Barile, F; Barnaföldi, G G; Barnby, L S; Barret, V; Bartalini, P; Barth, K; Bartke, J; Bartsch, E; Basile, M; Bastid, N; Basu, S; Bathen, B; Batigne, G; Batista Camejo, A; Batyunya, B; Batzing, P C; Bearden, I G; Beck, H; Bedda, C; Behera, N K; Belikov, I; Bellini, F; Bello Martinez, H; Bellwied, R; Beltran, L G E; Belyaev, V; Bencedi, G; Beole, S; Bercuci, A; Berdnikov, Y; Berenyi, D; Bertens, R A; Berzano, D; Betev, L; Bhasin, A; Bhat, I R; Bhati, A K; Bhattacharjee, B; Bhom, J; Bianchi, L; Bianchi, N; Bianchin, C; Bielčík, J; Bielčíková, J; Bilandzic, A; Biro, G; Biswas, R; Biswas, S; Bjelogrlic, S; Blair, J T; Blau, D; Blume, C; Bock, F; Bogdanov, A; Boldizsár, L; Bombara, M; Bonora, M; Book, J; Borel, H; Borissov, A; Borri, M; Botta, E; Bourjau, C; Braun-Munzinger, P; Bregant, M; Broker, T A; Browning, T A; Broz, M; Brucken, E J; Bruna, E; Bruno, G E; Budnikov, D; Buesching, H; Bufalino, S; Buhler, P; Buitron, S A I; Buncic, P; Busch, O; Buthelezi, Z; Butt, J B; Buxton, J T; Cabala, J; Caffarri, D; Caines, H; Caliva, A; Calvo Villar, E; Camerini, P; Carena, F; Carena, W; Carnesecchi, F; Castillo Castellanos, J; Castro, A J; Casula, E A R; Ceballos Sanchez, C; Cepila, J; Cerello, P; Cerkala, J; Chang, B; Chapeland, S; Chartier, M; Charvet, J L; Chattopadhyay, S; Chattopadhyay, S; Chauvin, A; Chelnokov, V; Cherney, M; Cheshkov, C; Cheynis, B; Chibante Barroso, V; Chinellato, D D; Cho, S; Chochula, P; Choi, K; Chojnacki, M; Choudhury, S; Christakoglou, P; Christensen, C H; Christiansen, P; Chujo, T; Chung, S U; Cicalo, C; Cifarelli, L; Cindolo, F; Cleymans, J; Colamaria, F; Colella, D; Collu, A; Colocci, M; Conesa Balbastre, G; Conesa Del Valle, Z; Connors, M E; Contreras, J G; Cormier, T M; Corrales Morales, Y; Cortés Maldonado, I; Cortese, P; Cosentino, M R; Costa, F; Crkovská, J; Crochet, P; Cruz Albino, R; Cuautle, E; Cunqueiro, L; Dahms, T; Dainese, A; Danisch, M C; Danu, A; Das, D; Das, I; Das, S; Dash, A; Dash, S; De, S; De Caro, A; de Cataldo, G; de Conti, C; de Cuveland, J; De Falco, A; De Gruttola, D; De Marco, N; De Pasquale, S; De Souza, R D; Deisting, A; Deloff, A; Deplano, C; Dhankher, P; Di Bari, D; Di Mauro, A; Di Nezza, P; Di Ruzza, B; Diaz Corchero, M A; Dietel, T; Dillenseger, P; Divià, R; Djuvsland, Ø; Dobrin, A; Domenicis Gimenez, D; Dönigus, B; Dordic, O; Drozhzhova, T; Dubey, A K; Dubla, A; Ducroux, L; Duggal, A K; Dupieux, P; Ehlers, R J; Elia, D; Endress, E; Engel, H; Epple, E; Erazmus, B; Erhardt, F; Espagnon, B; Esumi, S; Eulisse, G; Eum, J; Evans, D; Evdokimov, S; Eyyubova, G; Fabbietti, L; Fabris, D; Faivre, J; Fantoni, A; Fasel, M; Feldkamp, L; Feliciello, A; Feofilov, G; Ferencei, J; Fernández Téllez, A; Ferreiro, E G; Ferretti, A; Festanti, A; Feuillard, V J G; Figiel, J; Figueredo, M A S; Filchagin, S; Finogeev, D; Fionda, F M; Fiore, E M; Floris, M; Foertsch, S; Foka, P; Fokin, S; Fragiacomo, E; Francescon, A; Francisco, A; Frankenfeld, U; Fronze, G G; Fuchs, U; Furget, C; Furs, A; Fusco Girard, M; Gaardhøje, J J; Gagliardi, M; Gago, A M; Gajdosova, K; Gallio, M; Galvan, C D; Gangadharan, D R; Ganoti, P; Gao, C; Garabatos, C; Garcia-Solis, E; Garg, K; Garg, P; Gargiulo, C; Gasik, P; Gauger, E F; Gay Ducati, M B; Germain, M; Ghosh, P; Ghosh, S K; Gianotti, P; Giubellino, P; Giubilato, P; Gladysz-Dziadus, E; Glässel, P; Goméz Coral, D M; Gomez Ramirez, A; Gonzalez, A S; Gonzalez, V; González-Zamora, P; Gorbunov, S; Görlich, L; Gotovac, S; Grabski, V; Graczykowski, L K; Graham, K L; Greiner, L; Grelli, A; Grigoras, C; Grigoriev, V; Grigoryan, A; Grigoryan, S; Grion, N; Gronefeld, J M; Grosse-Oetringhaus, J F; Grosso, R; Gruber, L; Guber, F; Guernane, R; Guerzoni, B; Gulbrandsen, K; Gunji, T; Gupta, A; Gupta, R; Guzman, I B; Haake, R; Hadjidakis, C; Hamagaki, H; Hamar, G; Hamon, J C; Harris, J W; Harton, A; Hatzifotiadou, D; Hayashi, S; Heckel, S T; Hellbär, E; Helstrup, H; Herghelegiu, A; Herrera Corral, G; Herrmann, F; Hess, B A; Hetland, K F; Hillemanns, H; Hippolyte, B; Hladky, J; Horak, D; Hosokawa, R; Hristov, P; Hughes, C; Humanic, T J; Hussain, N; Hussain, T; Hutter, D; Hwang, D S; Ilkaev, R; Inaba, M; Ippolitov, M; Irfan, M; Isakov, V; Islam, M S; Ivanov, M; Ivanov, V; Izucheev, V; Jacak, B; Jacazio, N; Jacobs, P M; Jadhav, M B; Jadlovska, S; Jadlovsky, J; Jahnke, C; Jakubowska, M J; Janik, M A; Jayarathna, P H S Y; Jena, C; Jena, S; Jimenez Bustamante, R T; Jones, P G; Jusko, A; Kalinak, P; Kalweit, A; Kang, J H; Kaplin, V; Kar, S; Karasu Uysal, A; Karavichev, O; Karavicheva, T; Karayan, L; Karpechev, E; Kebschull, U; Keidel, R; Keijdener, D L D; Keil, M; Mohisin Khan, M; Khan, P; Khan, S A; Khanzadeev, A; Kharlov, Y; Khatun, A; Khuntia, A; Kileng, B; Kim, D W; Kim, D J; Kim, D; Kim, H; Kim, J S; Kim, J; Kim, M; Kim, M; Kim, S; Kim, T; Kirsch, S; Kisel, I; Kiselev, S; Kisiel, A; Kiss, G; Klay, J L; Klein, C; Klein, J; Klein-Bösing, C; Klewin, S; Kluge, A; Knichel, M L; Knospe, A G; Kobdaj, C; Kofarago, M; Kollegger, T; Kolojvari, A; Kondratiev, V; Kondratyeva, N; Kondratyuk, E; Konevskikh, A; Kopcik, M; Kour, M; Kouzinopoulos, C; Kovalenko, O; Kovalenko, V; Kowalski, M; Koyithatta Meethaleveedu, G; Králik, I; Kravčáková, A; Krivda, M; Krizek, F; Kryshen, E; Krzewicki, M; Kubera, A M; Kučera, V; Kuhn, C; Kuijer, P G; Kumar, A; Kumar, J; Kumar, L; Kumar, S; Kundu, S; Kurashvili, P; Kurepin, A; Kurepin, A B; Kuryakin, A; Kushpil, S; Kweon, M J; Kwon, Y; La Pointe, S L; La Rocca, P; Lagana Fernandes, C; Lakomov, I; Langoy, R; Lapidus, K; Lara, C; Lardeux, A; Lattuca, A; Laudi, E; Lazaridis, L; Lea, R; Leardini, L; Lee, S; Lehas, F; Lehner, S; Lehrbach, J; Lemmon, R C; Lenti, V; Leogrande, E; León Monzón, I; Lévai, P; Li, S; Li, X; Lien, J; Lietava, R; Lindal, S; Lindenstruth, V; Lippmann, C; Lisa, M A; Ljunggren, H M; Llope, W; Lodato, D F; Loenne, P I; Loginov, V; Loizides, C; Lopez, X; López Torres, E; Lowe, A; Luettig, P; Lunardon, M; Luparello, G; Lupi, M; Lutz, T H; Maevskaya, A; Mager, M; Mahajan, S; Mahmood, S M; Maire, A; Majka, R D; Malaev, M; Maldonado Cervantes, I; Malinina, L; Mal'Kevich, D; Malzacher, P; Mamonov, A; Manko, V; Manso, F; Manzari, V; Mao, Y; Marchisone, M; Mareš, J; Margagliotti, G V; Margotti, A; Margutti, J; Marín, A; Markert, C; Marquard, M; Martin, N A; Martinengo, P; Martínez, M I; Martínez García, G; Martinez Pedreira, M; Mas, A; Masciocchi, S; Masera, M; Masoni, A; Mastroserio, A; Matyja, A; Mayer, C; Mazer, J; Mazzilli, M; Mazzoni, M A; Meddi, F; Melikyan, Y; Menchaca-Rocha, A; Meninno, E; Mercado Pérez, J; Meres, M; Mhlanga, S; Miake, Y; Mieskolainen, M M; Mikhaylov, K; Milano, L; Milosevic, J; Mischke, A; Mishra, A N; Mishra, T; Miśkowiec, D; Mitra, J; Mitu, C M; Mohammadi, N; Mohanty, B; Molnar, L; Montes, E; Moreira De Godoy, D A; Moreno, L A P; Moretto, S; Morreale, A; Morsch, A; Muccifora, V; Mudnic, E; Mühlheim, D; Muhuri, S; Mukherjee, M; Mulligan, J D; Munhoz, M G; Münning, K; Munzer, R H; Murakami, H; Murray, S; Musa, L; Musinsky, J; Myers, C J; Naik, B; Nair, R; Nandi, B K; Nania, R; Nappi, E; Naru, M U; Natal da Luz, H; Nattrass, C; Navarro, S R; Nayak, K; Nayak, R; Nayak, T K; Nazarenko, S; Nedosekin, A; Negrao De Oliveira, R A; Nellen, L; Ng, F; Nicassio, M; Niculescu, M; Niedziela, J; Nielsen, B S; Nikolaev, S; Nikulin, S; Nikulin, V; Noferini, F; Nomokonov, P; Nooren, G; Noris, J C C; Norman, J; Nyanin, A; Nystrand, J; Oeschler, H; Oh, S; Ohlson, A; Okubo, T; Olah, L; Oleniacz, J; Oliveira Da Silva, A C; Oliver, M H; Onderwaater, J; Oppedisano, C; Orava, R; Oravec, M; Ortiz Velasquez, A; Oskarsson, A; Otwinowski, J; Oyama, K; Ozdemir, M; Pachmayer, Y; Pacik, V; Pagano, D; Pagano, P; Paić, G; Pal, S K; Palni, P; Pan, J; Pandey, A K; Papikyan, V; Pappalardo, G S; Pareek, P; Park, J; Park, W J; Parmar, S; Passfeld, A; Paticchio, V; Patra, R N; Paul, B; Pei, H; Peitzmann, T; Peng, X; Pereira Da Costa, H; Peresunko, D; Perez Lezama, E; Peskov, V; Pestov, Y; Petráček, V; Petrov, V; Petrovici, M; Petta, C; Piano, S; Pikna, M; Pillot, P; Pimentel, L O D L; Pinazza, O; Pinsky, L; Piyarathna, D B; Płoskoń, M; Planinic, M; Pluta, J; Pochybova, S; Podesta-Lerma, P L M; Poghosyan, M G; Polichtchouk, B; Poljak, N; Poonsawat, W; Pop, A; Poppenborg, H; Porteboeuf-Houssais, S; Porter, J; Pospisil, J; Prasad, S K; Preghenella, R; Prino, F; Pruneau, C A; Pshenichnov, I; Puccio, M; Puddu, G; Pujahari, P; Punin, V; Putschke, J; Qvigstad, H; Rachevski, A; Raha, S; Rajput, S; Rak, J; Rakotozafindrabe, A; Ramello, L; Rami, F; Rana, D B; Raniwala, R; Raniwala, S; Räsänen, S S; Rascanu, B T; Rathee, D; Ratza, V; Ravasenga, I; Read, K F; Redlich, K; Rehman, A; Reichelt, P; Reidt, F; Ren, X; Renfordt, R; Reolon, A R; Reshetin, A; Reygers, K; Riabov, V; Ricci, R A; Richert, T; Richter, M; Riedler, P; Riegler, W; Riggi, F; Ristea, C; Rodríguez Cahuantzi, M; Røed, K; Rogochaya, E; Rohr, D; Röhrich, D; Ronchetti, F; Ronflette, L; Rosnet, P; Rossi, A; Roukoutakis, F; Roy, A; Roy, C; Roy, P; Rubio Montero, A J; Rui, R; Russo, R; Ryabinkin, E; Ryabov, Y; Rybicki, A; Saarinen, S; Sadhu, S; Sadovsky, S; Šafařík, K; Sahlmuller, B; Sahoo, B; Sahoo, P; Sahoo, R; Sahoo, S; Sahu, P K; Saini, J; Sakai, S; Saleh, M A; Salzwedel, J; Sambyal, S; Samsonov, V; Sandoval, A; Sano, M; Sarkar, D; Sarkar, N; Sarma, P; Sas, M H P; Scapparone, E; Scarlassara, F; Scharenberg, R P; Schiaua, C; Schicker, R; Schmidt, C; Schmidt, H R; Schmidt, M; Schukraft, J; Schutz, Y; Schwarz, K; Schweda, K; Scioli, G; Scomparin, E; Scott, R; Šefčík, M; Seger, J E; Sekiguchi, Y; Sekihata, D; Selyuzhenkov, I; Senosi, K; Senyukov, S; Serradilla, E; Sett, P; Sevcenco, A; Shabanov, A; Shabetai, A; Shadura, O; Shahoyan, R; Shangaraev, A; Sharma, A; Sharma, A; Sharma, M; Sharma, M; Sharma, N; Sheikh, A I; Shigaki, K; Shou, Q; Shtejer, K; Sibiriak, Y; Siddhanta, S; Sielewicz, K M; Siemiarczuk, T; Silvermyr, D; Silvestre, C; Simatovic, G; Simonetti, G; Singaraju, R; Singh, R; Singhal, V; Sinha, T; Sitar, B; Sitta, M; Skaali, T B; Slupecki, M; Smirnov, N; Snellings, R J M; Snellman, T W; Song, J; Song, M; Song, Z; Soramel, F; Sorensen, S; Sozzi, F; Spiriti, E; Sputowska, I; Srivastava, B K; Stachel, J; Stan, I; Stankus, P; Stenlund, E; Steyn, G; Stiller, J H; Stocco, D; Strmen, P; Suaide, A A P; Sugitate, T; Suire, C; Suleymanov, M; Suljic, M; Sultanov, R; Šumbera, M; Sumowidagdo, S; Suzuki, K; Swain, S; Szabo, A; Szarka, I; Szczepankiewicz, A; Szymanski, M; Tabassam, U; Takahashi, J; Tambave, G J; Tanaka, N; Tarhini, M; Tariq, M; Tarzila, M G; Tauro, A; Tejeda Muñoz, G; Telesca, A; Terasaki, K; Terrevoli, C; Teyssier, B; Thakur, D; Thomas, D; Tieulent, R; Tikhonov, A; Timmins, A R; Toia, A; Tripathy, S; Trogolo, S; Trombetta, G; Trubnikov, V; Trzaska, W H; Tsuji, T; Tumkin, A; Turrisi, R; Tveter, T S; Ullaland, K; Umaka, E N; Uras, A; Usai, G L; Utrobicic, A; Vala, M; Van Der Maarel, J; Van Hoorne, J W; van Leeuwen, M; Vanat, T; Vande Vyvre, P; Varga, D; Vargas, A; Vargyas, M; Varma, R; Vasileiou, M; Vasiliev, A; Vauthier, A; Vázquez Doce, O; Vechernin, V; Veen, A M; Velure, A; Vercellin, E; Vergara Limón, S; Vernet, R; Vértesi, R; Vickovic, L; Vigolo, S; Viinikainen, J; Vilakazi, Z; Villalobos Baillie, O; Villatoro Tello, A; Vinogradov, A; Vinogradov, L; Virgili, T; Vislavicius, V; Vodopyanov, A; Völkl, M A; Voloshin, K; Voloshin, S A; Volpe, G; von Haller, B; Vorobyev, I; Voscek, D; Vranic, D; Vrláková, J; Wagner, B; Wagner, J; Wang, H; Wang, M; Watanabe, D; Watanabe, Y; Weber, M; Weber, S G; Weiser, D F; Wessels, J P; Westerhoff, U; Whitehead, A M; Wiechula, J; Wikne, J; Wilk, G; Wilkinson, J; Willems, G A; Williams, M C S; Windelband, B; Winn, M; Yalcin, S; Yang, P; Yano, S; Yin, Z; Yokoyama, H; Yoo, I-K; Yoon, J H; Yurchenko, V; Zaccolo, V; Zaman, A; Zampolli, C; Zanoli, H J C; Zaporozhets, S; Zardoshti, N; Zarochentsev, A; Závada, P; Zaviyalov, N; Zbroszczyk, H; Zhalov, M; Zhang, H; Zhang, X; Zhang, Y; Zhang, C; Zhang, Z; Zhao, C; Zhigareva, N; Zhou, D; Zhou, Y; Zhou, Z; Zhu, H; Zhu, J; Zichichi, A; Zimmermann, A; Zimmermann, M B; Zinovjev, G; Zmeskal, J
2017-09-08
The measurement of two-particle angular correlations is a powerful tool to study jet quenching in a p_{T} region inaccessible by direct jet identification. In these measurements pseudorapidity (Δη) and azimuthal (Δφ) differences are used to extract the shape of the near-side peak formed by particles associated with a higher p_{T} trigger particle (1
Electrochemical synthesis, characterisation and phytogenic properties of silver nanoparticles
NASA Astrophysics Data System (ADS)
Singaravelan, R.; Bangaru Sudarsan Alwar, S.
2015-12-01
This work exemplifies a simple and rapid method for the synthesis of silver nanodendrite with a novel electrochemical technique. The antibacterial activity of these silver nanoparticles (Ag NPs) against pathogenic bacteria was investigated along with the routine study of optical and spectral characterisation. The optical properties of the silver nanoparticles were characterised by diffuse reflectance spectroscopy. The optical band gap energy of the electrodeposited Ag NPs was determined from the diffuse reflectance using Kubelka-Munk formula. X-ray diffraction (XRD) studies were carried out to determine the crystalline nature of the silver nanoparticles which confirmed the formation of silver nanocrystals. The XRD pattern revealed that the electrodeposited Ag NPs were in the cubic geometry with dendrite preponderance. The average particle size and the peak broadening were deliberated using Debye-Scherrer equation and lattice strain due to the peak broadening was studied using Williamson-Hall method. Surface morphology of the Ag NPs was characterised by high-resolution scanning electron microscope and the results showed the high degree of aggregation in the particles. The antibacterial activity of the Ag NPs was evaluated and showed unprecedented level antibacterial activity against multidrug resistant strains such as Staphylococcus aureus, Bacillus subtilis, Klebsiella pneumonia and Escherichia coli in combination with Streptomycin.
140 W peak power laser system tunable in the LWIR.
Gutty, François; Grisard, Arnaud; Larat, Christian; Papillon, Dominique; Schwarz, Muriel; Gerard, Bruno; Ostendorf, Ralf; Rattunde, Marcel; Wagner, Joachim; Lallier, Eric
2017-08-07
We present a high peak power rapidly tunable laser system in the long-wave infrared comprising an external-cavity quantum cascade laser (EC-QCL) broadly tunable from 8 to 10 µm and an optical parametric amplifier (OPA) based on quasi phase-matching in orientation-patterned gallium arsenide (OP-GaAs) of fixed grating period. The nonlinear crystal is pumped by a pulsed fiber laser system to achieve efficient amplification in the OPA. Quasi phase-matching remains satisfied when the EC-QCL wavelength is swept from 8 to 10 µm with a crystal of fixed grating period through tuning the pump laser source around 2 µm. The OPA demonstrates parametric amplification from 8 µm to 10 µm and achieves output peak powers up to 140 W with spectral linewidths below 3.5 cm -1 . The beam profile quality (M 2 ) remains below 3.4 in both horizontal and vertical directions. Compared to the EC-QCL, the linewidth broadening is attributed to a coupling with the OPA.
EIT intensity noise spectroscopy power-broadening and level structure
NASA Astrophysics Data System (ADS)
Snider, Charles; Crescimanno, Michael; Oleary, Shannon
2011-05-01
One particularly interesting (and potentially technologically useful) characteristic of EIT coherence as viewed through intensity noise spectroscopy is its power-broadening resistant features. We detail a connection between the power broadening behavior and the underlying level structure by solving a more realistic quantum optics scenario modeled on recent experiments.
NASA Astrophysics Data System (ADS)
Kamarudin, Nadira; Abdullah, Wan Saffiey Wan; Hamid, Muhammad Azmi Abdul; Dollah, Mohd Taufik
2014-09-01
This paper presents the characterization and TL properties of dysprosium (Dy) doped calcium sulfate (CaSO4) TL material produced by co-precipitation technique with 0.5mol% concentration of dopant. The morphology of the produced TL material was studied using scanning electron microscope (SEM) and the micrograph shows that rectangular parallelepiped shaped crystal with the average of 150 μm in length were produced. The crystallinity of the produced powder was studied using x-ray powder diffraction (XRD). The XRD spectra show that the TL material produced is high purity anhydrite CaSO4 with average crystallite size of 74 nm with orthorhombic crystal system. The TL behavior of produced CaSO4:Dy was studied using a TLD reader after exposure to gamma ray by Co60 source with the doses of 1,5 and 10 Gy. The glow curve shows linear response with glow peak around 230°C which is desired development in the field of radiation dosimetry.
Powder-XRD and (14) N magic angle-spinning solid-state NMR spectroscopy of some metal nitrides.
Kempgens, Pierre; Britton, Jonathan
2016-05-01
Some metal nitrides (TiN, ZrN, InN, GaN, Ca3 N2 , Mg3 N2 , and Ge3 N4 ) have been studied by powder X-ray diffraction (XRD) and (14) N magic angle-spinning (MAS) solid-state NMR spectroscopy. For Ca3 N2 , Mg3 N2 , and Ge3 N4 , no (14) N NMR signal was observed. Low speed (νr = 2 kHz for TiN, ZrN, and GaN; νr = 1 kHz for InN) and 'high speed' (νr = 15 kHz for TiN; νr = 5 kHz for ZrN; νr = 10 kHz for InN and GaN) MAS NMR experiments were performed. For TiN, ZrN, InN, and GaN, powder-XRD was used to identify the phases present in each sample. The number of peaks observed for each sample in their (14) N MAS solid-state NMR spectrum matches perfectly well with the number of nitrogen-containing phases identified by powder-XRD. The (14) N MAS solid-state NMR spectra are symmetric and dominated by the quadrupolar interaction. The envelopes of the spinning sidebands manifold are Lorentzian, and it is concluded that there is a distribution of the quadrupolar coupling constants Qcc 's arising from structural defects in the compounds studied. Copyright © 2015 John Wiley & Sons, Ltd.
Medical vest broadens treatment capability
NASA Technical Reports Server (NTRS)
Johnson, G. S.
1970-01-01
Universal sized vest, with specially tailored pockets designed to hold medical supplies, provides first aid/first care medical teams with broadened on-site capability. Vest is made of nylon, tough fibrous materials, and polyvinyl chloride. Design facilitates rapid donning, doffing, and adjustment.
Causes of power broadening in EIT intensity noise spectroscopy
NASA Astrophysics Data System (ADS)
Crescimanno, Michael; Snider, Charles; O'Leary, Shannon
2011-05-01
EIT noise spectroscopy is a potentially promising way to simplify magnetometer design. One technically fortuitous characteristic of this intensity noise spectroscopy is the non-power broadening behaviour. We describe quantum optics theory applied to more realistic models of EIT systems that explain the existence and range of this power broadening-free regime.
Homogenization of Doppler broadening in spin-noise spectroscopy
NASA Astrophysics Data System (ADS)
Petrov, M. Yu.; Ryzhov, I. I.; Smirnov, D. S.; Belyaev, L. Yu.; Potekhin, R. A.; Glazov, M. M.; Kulyasov, V. N.; Kozlov, G. G.; Aleksandrov, E. B.; Zapasskii, V. S.
2018-03-01
The spin-noise spectroscopy, being a nonperturbative linear optics tool, is still reputed to reveal a number of capabilities specific to nonlinear optics techniques. The effect of the Doppler broadening homogenization discovered in this work essentially widens these unique properties of spin-noise spectroscopy. We investigate spin noise of a classical system—cesium atoms vapor with admixture of buffer gas—by measuring the spin-induced Faraday rotation fluctuations in the region of D 2 line. The line, under our experimental conditions, is strongly inhomogeneously broadened due to the Doppler effect. Despite that, optical spectrum of the spin-noise power has the shape typical for the homogeneously broadened line with a dip at the line center. This fact is in stark contrast with the results of previous studies of inhomogeneous quantum dot ensembles and Doppler broadened atomic systems. In addition, the two-color spin-noise measurements have shown, in a highly spectacular way, that fluctuations of the Faraday rotation within the line are either correlated or anticorrelated depending on whether the two wavelengths lie on the same side or on different sides of the resonance. The experimental data are interpreted in the frame of the developed theoretical model which takes into account both kinetics and spin dynamics of Cs atoms. It is shown that the unexpected behavior of the Faraday rotation noise spectra and effective homogenization of the optical transition in the spin-noise measurements are related to smallness of the momentum relaxation time of the atoms as compared with their spin-relaxation time. Our findings demonstrate abilities of spin-noise spectroscopy for studying dynamic properties of inhomogeneously broadened ensembles of randomly moving spins.
Influence of resonant collisions on the self-broadening of acetylene
NASA Astrophysics Data System (ADS)
Lehmann, Kevin K.
2017-03-01
Iwakuni et al. [Phys. Rev. Lett. 117, 143902 (2016)] have reported an ortho-para alternation of ˜10% in the self pressure broadening coefficients for ro-vibrational lines of the C2H2 transitions in the ν1+ν3 C-H (local mode) overtone band near 197 THz (1.52 μm). These authors attributed this effect to the contribution of resonant collisions, where the rotational energy change of one molecule is exactly compensated by the rotational energy change of its collision partner. Resonant collisions are known to be important in the case of self pressure broadening of highly polar molecules, such as HCN, but have not previously been invoked in the case of nonpolar molecules, such as acetylene, where the long range potential is dominated by the quadrupole-quadrupole electrostatic interaction. In the present work, the simple semiclassical Anderson-theory approach is used to estimate the rates of C2H2-C2H2 rotationally inelastic collisions and these used to predict pressure broadening rates, ignoring other contributions to the broadening, which should not have resonant enhancements. It is found that exactly resonant collisions do not make a major contribution to the broadening and these calculations predict an ortho-para alternation of the pressure broadening coefficients far below what was inferred by Iwakuni et al. The present results are consistent with a large body of published work that reported self-broadening coefficients of C2H2 ro-vibrational transitions that found negligible dependence on the vibrational transition and no even-odd alternation, even for Q and S branch transitions where any such effect is predicted to be much larger than for the P and R branch transitions studied by Iwakuni et al.
D2O self-broadening study in 2.5 μ
NASA Astrophysics Data System (ADS)
Lavrentieva, N.; Lugovskoi, A.; Sinitsa, L.; Sherbakov, A.; Svetlichny, O.
2014-11-01
The absorption spectra of the D2O monomer in 3600…4200 cm-1 were recorded using Fourier Transform spectrometer FS-125M at room temperature and pressure of 15 and 33 mbar with spectral resolution of 0.03 cm-1 using 2.5 cm long absorption cell. Strong unblended D2O lines lying on the wing of the H2O stretching band were used to determine the line broadening parameters. They were determined from the line profile by Program VxpProfile. The differences between fitted line profiles and experimental ones do not exceed 2%. Registered D2O lines belong to (011) - (000) and (110) - (000) bands of the second triad. Self-broadening coefficients vary from 0.27 cm-1/atm to 0.445 cm-1/atm and they exceed 3 times the D2O-N2 line broadening coefficients in the v3. Calculations of self-broadening coefficients of the D2O lines were performed using semiempirical method based on the impact theory of broadening and included the correction factors. The calculated results well agree with experimental data.
The importance of system band broadening in modern size exclusion chromatography.
Goyon, Alexandre; Guillarme, Davy; Fekete, Szabolcs
2017-02-20
In the last few years, highly efficient UHP-SEC columns packed with sub-3μm particles were commercialized by several providers. Besides the particle size reduction, the dimensions of modern SEC stationary phases (150×4.6mm) was also modified compared to regular SEC columns (300×6 or 300×8mm). Because the analytes are excluded from the pores in SEC, the retention factors are very low, ranging from -1
Fitz, Brian D; Wilson, Ryan B; Parsons, Brendon A; Hoggard, Jamin C; Synovec, Robert E
2012-11-30
Peak capacity production is substantially improved for two-dimensional gas chromatography coupled with time-of-flight mass spectrometry (GC×GC-TOFMS) and applied to the fast separation of a 28 component liquid test mixture, and two complex vapor samples (a 65 component volatile organic compound test mixture, and the headspace of warm ground coffee beans). A high peak capacity is achieved in a short separation time by selecting appropriate experimental conditions based on theoretical modeling of on-column band broadening, and by reducing the off-column band broadening by applying a narrow, concentrated injection pulse onto the primary column using high-speed cryo-focusing injection (HSCFI), referred to as thermal injection. A long, relatively narrow open tubular capillary column (20 m, 100 μm inner diameter (i.d.) with a 0.4 μm film thickness to benefit column capacity) was used as the primary column. The initial flow rate was 2 ml/min (60 cm/s average linear flow velocity) which is slightly below the optimal average linear gas velocity of 83 cm/s, due to the flow rate constraint of the TOFMS vacuum system. The oven temperature programming rate was 30°C/min. The secondary column (1.8m, 100 μm i.d. with a 0.1 μm film thickness) provided a relatively high peak capacity separation, concurrent with a significantly shorter modulation period, P(M), than commonly applied with the commercial instrument. With this GC×GC-TOFMS instrumental platform, compounds in the 28 component liquid test mixture provided a ∼7 min separation (with a ∼6.5 min separation time window), producing average peak widths of ∼600 ms full width half maximum (FWHM), resulting in a peak capacity on the primary column of ∼400 peaks (at unit resolution). Using a secondary column with a 500 ms P(M), average peak widths of ∼20 ms FWHM were achieved, thus providing a peak capacity of 15 peaks on the second dimension. Overall, an ideal orthogonal GC×GC peak capacity of ∼6000 peaks (at unit
Thermal behavior of polyhalite: a high-temperature synchrotron XRD study
Xu, Hongwu; Guo, Xiaofeng; Bai, Jianming
2016-09-17
As an accessory mineral in marine evaporites, polyhalite, K 2MgCa 2(SO 4) 4·2H 2O, coexists with halite (NaCl) in salt formations, which have been considered as potential repositories for permanent storage of high-level nuclear wastes. However, because of the heat generated by radioactive decays in the wastes, polyhalite may dehydrate, and the released water will dissolve its neighboring salt, potentially affecting the repository integrity. Thus, studying the thermal behavior of polyhalite is important. In this paper, a polyhalite sample containing a small amount of halite was collected from the Salado formation at the WIPP site in Carlsbad, New Mexico. Tomore » determine its thermal behavior, in situ high-temperature synchrotron X-ray diffraction was conducted from room temperature to 1066 K with the sample powders sealed in a silica-glass capillary. At about 506 K, polyhalite started to decompose into water vapor, anhydrite (CaSO 4) and two langbeinite-type phases, K 2Ca x Mg 2-x (SO 4) 3, with different Ca/Mg ratios. XRD peaks of the minor halite disappeared, presumably due to its dissolution by water vapor. With further increasing temperature, the two langbeinite solid solution phases displayed complex variations in crystallinity, composition and their molar ratio and then were combined into the single-phase triple salt, K 2CaMg(SO 4) 3, at ~919 K. Rietveld analyses of the XRD data allowed determination of structural parameters of polyhalite and its decomposed anhydrite and langbeinite phases as a function of temperature. Finally, from the results, the thermal expansion coefficients of these phases have been derived, and the structural mechanisms of their thermal behavior been discussed.« less
Seeing the big picture: Broadening attention relieves sadness and depressed mood.
Gu, Li; Yang, Xueling; Li, Liman Man Wai; Zhou, Xinyue; Gao, Ding-Guo
2017-08-01
We examined whether the broadened attentional scope would affect people's sad or depressed mood with two experiments, enlightened by the meaning of "seeing the big picture" and the broaden-and-build model. Experiment 1 (n = 164) is a laboratory-based experiment, in which we manipulated the attentional scope by showing participants zoomed-out or zoomed-in scenes. In Experiment 2 (n = 44), we studied how depressed mood and positive and negative emotions were affected when participants watched distant versus proximal scenes for eight weeks in real life. Healthy participants in Experiment 1, who were induced to feel sad, could return to the baseline mood after having the broadened attention task but not after having the narrowed attention task, which indicated that immediate attention broadening manipulation could function as antidotes for the lingering effects of induced negative emotions. Participants with depressed mood in Experiment 2 showed reduced depressed mood, increased positive affect, and decreased negative affect after receiving attention broadening training compared to those receiving attention narrowing training. Our findings suggest a robust role of broadened attentional scope in relieving negative emotions and even mildly depressed mood in the long run. © 2017 Scandinavian Psychological Associations and John Wiley & Sons Ltd.
Multispectrum analysis of air-broadened spectra in the ν3 Q branch of 12CH4
NASA Astrophysics Data System (ADS)
Devi, V. Malathy; Benner, D. Chris; Gamache, Robert R.; Tran, H.; Smith, Mary Ann H.; Sams, Robert L.
2018-02-01
We report experimental measurements of spectral line shape parameters (air-broadened width, shift, and line mixing coefficients) for several transitions in the ν3 Q branch of methane in the 3000-3023 cm-1 region. 13 high-resolution, room temperature laboratory spectra of pure methane and air-broadened methane recorded with two different Fourier transform spectrometers are fitted. 12 of these spectra were acquired at 0.01 cm-1 resolution with the McMath-Pierce FTS at the National Solar Observatory on Kitt Peak, and one higher-resolution (∼0.0011 cm-1) low pressure methane spectrum was obtained with the Bruker IFS-120HR FTS at the Pacific Northwest National Laboratory, in Richland, Washington. All the spectra were obtained using high purity natural samples of CH4 and lean mixtures of the same natural CH4 in dry air. For the 12 spectra recorded at Kitt Peak, three different absorption cells (L = 5, 25 and 150 cm) were used while the methane spectrum at PNNL was obtained using a 19.95 cm long absorption cell. For the analysis, an interactive multispectrum nonlinear least squares fitting software was employed where all the 13 spectra were fitted simultaneously. An accurate and self-consistent set of line parameters were determined by constraining a few of those for severely blended transitions. Line mixing was measured for 14 transition pairs for the CH4-air collision system. A constant speed dependence parameter, consistent with measured speed dependence values obtained in other methane bands, was applied to all the transitions included in the fitted region. The present measurements are compared to values reported in the literature.
Single-photon superradiant beating from a Doppler-broadened ladder-type atomic ensemble
NASA Astrophysics Data System (ADS)
Lee, Yoon-Seok; Lee, Sang Min; Kim, Heonoh; Moon, Han Seb
2017-12-01
We report on heralded-single-photon superradiant beating in the spontaneous four-wave mixing process of Doppler-broadened ladder-type 87Rb atoms. When Doppler-broadened atoms contribute to two-photon coherence, the detection probability amplitudes of the heralded single photons are coherently superposed despite inhomogeneous broadened atomic media. Single-photon superradiant beating is observed, which constitutes evidence for the coherent superposition of two-photon amplitudes from different velocity classes in the Doppler-broadened atomic ensemble. We present a theoretical model in which the single-photon superradiant beating originates from the interference between wavelength-separated two-photon amplitudes via the reabsorption filtering effect.
NASA Technical Reports Server (NTRS)
Giver, L. P.; Gentry, B.; Schwemmer, G.; Wilkerson, T. D.
1982-01-01
Intensities were measured for 97 lines of H2O vapor between 932 and 961 nm. The lines were selected for their potential usefulness for remote laser measurements of H2O vapor in the earth's atmosphere. The spectra were obtained with several different H2O vapor abundances and N2 broadening gas pressures; the spectral resolution was 0.046/cm FWHM. Measured H2O line intensities range from 7 x 10 to the -25th to 7 x 10 to the -22nd/cm per (molecules/sq cm). H2O self-broadening coefficients were measured for 13 of these strongest lines; the mean value was 0.5/cm per atm. N2-collision-broadening coefficients were measured for 73 lines, and the average was 0.11 cm per atm HWHM. Pressure shifts in air were determined for a sample of six lines between 948 and 950 nm; these lines shift to lower frequency by an amount comparable to 0.1 of the collision-broadened widths measured in air or N2. The measured intensities of many lines of 300-000 band are much larger than expected from prior computations, in some cases by over an order of magnitude. Coriolis interactions with the stronger 201-000 band appear to be the primary cause of the enhancement of these line intensities.
Hydrogen Balmer Line Broadening in Solar and Stellar Flares
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han
2017-03-10
The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigtmore » profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ∼0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.« less
Hydrogen Balmer Line Broadening in Solar and Stellar Flares
NASA Technical Reports Server (NTRS)
Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han; Tremblay, Pier-Emmanuel; Brown, Stephen; Carlsson, Mats; Osten, Rachel A.; Wisniewski, John P.; Hawley, Suzanne L.
2017-01-01
The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a 'multithread' model improves the agreement with the observations. We revisit the three component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a 'hot spot' atmosphere heated by an ultra relativistic electron beam with reasonable filling factors: approximately 0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.
Hydrogen Balmer Line Broadening in Solar and Stellar Flares
NASA Astrophysics Data System (ADS)
Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han; Tremblay, Pier-Emmanuel; Brown, Stephen; Carlsson, Mats; Osten, Rachel A.; Wisniewski, John P.; Hawley, Suzanne L.
2017-03-01
The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ˜0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.
Hydrometallurgical Extraction of Zinc and Copper A 57Fe-Mössbauer and XRD Approach
NASA Astrophysics Data System (ADS)
Mulaba-Bafubiandi, A. F.; Waanders, F. B.
2005-02-01
The most commonly used route in the hydrometallurgical extraction of zinc and copper from a sulphide ore is the concentrate roast leach electro winning process. In the present investigation a zinc copper ore from the Maranda mine, located in the Murchison Greenstone Belt, South Africa, containing sphalerite (ZnS) and chalcopyrite (CuFeS2), was studied. The 57Fe-Mössbauer spectrum of the concentrate yielded pyrite, chalcopyrite and clinochlore, consistent with XRD data. Optimal roasting conditions were found to be 900°C for 3 h and the calcine produced contained according to X-ray diffractometry equal amounts of franklinite (ZnFe2O4) and zinc oxide (ZnO) and half the amount of willemite (Zn2SiO4). The Mössbauer spectrum showed predominantly franklinite (59%), hematite (6%) and other Zn- or Cu-depleted ferrites (35%). The latter could not be detected by XRD analyses as peak overlapping with other species occurred. Leaching was done with HCl, H2SO4 and HNO3, to determine which process would result in maximum recovery of Zn and Cu. More than 80% of both were recovered by using either one of the three techniques. From the residue of the leaching, the Fe-compounds were precipitated and <1% of the Zn and Cu was not recovered.
On the Stark broadening of Cr VI spectral lines in astrophysical plasma
NASA Astrophysics Data System (ADS)
Dimitrijević, M. S.; Simić, Z.; Sahal-Bréchot, S.
2017-02-01
Stark broadening parameters for Cr VI lines have been calculated using semiclassical perturbation method for conditions of interest for stellar plasma. Here are presented, as an example of obtained results, Stark broadening parameters for electron- and proton-impact broadening for Cr VI 4s 2S-4p 2P° λ = 1430 Å and Cr VI 4p 2P°-5s 2S λ = 611.8 Å multiplets. The obtained results are used to demonstrate the importance of Stark broadening of Cr VI in DO white dwarf atmospheres. Also the obtained results will enter in STARK-B database which is included in Virtual Atomic and Molecula Data Center - VAMDC.
NASA Astrophysics Data System (ADS)
Singh, Sanjay; Petricek, V.; Rajput, Parasmani; Hill, Adrian H.; Suard, E.; Barman, S. R.; Pandey, Dhananjai
2014-07-01
The modulated structure of the martensite phase of Ni2MnGa is revisited using high-resolution synchrotron x-ray powder diffraction measurements, which reveal higher-order satellite reflections up to the third order and phason broadening of the satellite peaks. The structure refinement, using the (3+1) dimensional superspace group approach, shows that the modulated structure of Ni2MnGa can be described by orthorhombic superspace group Immm(00γ)s00 with lattice parameters a=4.218 61(2)Å,b=5.546 96(3)Å, and c=4.187 63(2) Å, and an incommensurate modulation wave vector q =0.43160(3)c*=(3/7+δ)c*, where δ =0.00303(3) is the degree of incommensuration of the modulated structure. Additional satellite peak broadening, which could not be accounted for in terms of the anisotropic strain broadening based on a lattice parameter distribution, has been modeled in terms of phasons using fourth-rank covariant strain-tensor representation for incommensurate structures. The simulation of single-crystal diffraction patterns from the refined structural parameters unambiguously reveals a rational approximant structure with 7M modulation. The inhomogeneous displacement of different atomic sites on account of incommensurate modulation and the presence of phason broadening clearly rule out the adaptive phase model proposed recently by Kaufmann et al. [S. Kaufmann, U. K. Rößler, O. Heczko, M. Wuttig, J. Buschbeck, L. Schultz, and S. Fähler, Phys. Rev. Lett. 104, 145702 (2010), 10.1103/PhysRevLett.104.145702] and suggest that the modulation in Ni2MnGa originates from soft-mode phonons.
NASA Technical Reports Server (NTRS)
Rampe, E. B.; Morris, R. V.; Ming, D. W.; Archer, P. D.; Bish, D. L.; Chipera, S. J.; Vaniman, D. T.; Blake, D. F.; Bristow, T. F.; Sutter, B.;
2014-01-01
The Curiosity rover investigated the mineralogy of the Sheepbed mudstone member of the Yellowknife Bay formation in Gale crater. Data from the Chemistry and Mineralogy (CheMin) X-ray diffractometer (XRD) helped identify phyllosilicates in the two drilled samples, John Klein and Cumberland. These patterns showed peaks at low angles, consistent with (001) peaks in 2:1 swelling phyllosilicates [1]. Evolved gas analyses (EGA) by the Sample Analysis at Mars (SAM) instrument of these samples confirmed the presence of phyllosilicates through the release of H2O at high temperatures, consistent with dehydroxylation of octahedral OH in phyllosilicates [2]. CheMin data for the phyllosilicates at John Klein and Cumberland show that they are structurally similar in that their (02l) peaks are near 22.5 deg 2theta, suggesting both samples contain trioctahedral 2:1 phyllosilicates [1]. However, the positions of the (001) peaks differ: the phyllosilicate at John Klein has its (001) peak at 10 Angstroms, whereas the phyllosilicate at Cumberland has an (001) peak at 14 Angstroms. Such differences in (001) dspacings can be ascribed to the type of cation in the interlayer site [3]. For example, large monovalent cations (e.g., K(+)) have low hydration energies and readily lose their H2O of hydration, whereas small divalent cations (e.g., Mg(2+)) have high energies of hydration and retain H2O in the phyllosilicate interlayers [3,4]. The goal of this study is to determine whether differences in the interlayer cation composition can explain the CheMin data from John Klein and Cumberland and to use this knowledge to better understand phyllosilicate formation mechanisms.
Novel Sample-handling Approach for XRD Analysis with Minimal Sample Preparation
NASA Technical Reports Server (NTRS)
Sarrazin, P.; Chipera, S.; Bish, D.; Blake, D.; Feldman, S.; Vaniman, D.; Bryson, C.
2004-01-01
Sample preparation and sample handling are among the most critical operations associated with X-ray diffraction (XRD) analysis. These operations require attention in a laboratory environment, but they become a major constraint in the deployment of XRD instruments for robotic planetary exploration. We are developing a novel sample handling system that dramatically relaxes the constraints on sample preparation by allowing characterization of coarse-grained material that would normally be impossible to analyze with conventional powder-XRD techniques.
Effects of positive mood on attention broadening for self-related information.
Grol, Maud; Koster, Ernst H W; Bruyneel, Lynn; De Raedt, Rudi
2014-07-01
Studies on cognitive effects of positive emotions have associated positive emotions to broadened attention. Given the widely investigated relationship between self-focused attention and mood, it is important to investigate the effect of positive mood on visuospatial attention for self-related information. We used a performance-based measure to assess fluctuations in attentional broadening from self-related contrasted to not-self-related information. In Experiment 1, we checked that the self-related versus not-self-related stimuli did not evoke differential attention effects in general. In Experiment 2, we manipulated mood and found that an increase in positive mood was associated with a relative broadening of attention for self-related information. These results suggest that the meaning of the target of attention provides an interesting dimension for further investigation into the relation between positive emotions and attentional broadening.
NASA Astrophysics Data System (ADS)
Solanki, Rekha Garg; Rajaram, Poolla; Bajpai, P. K.
2018-05-01
This work is based on the growth, characterization and estimation of lattice strain and crystallite size in CdS nanoparticles by X-ray peak profile analysis. The CdS nanoparticles were synthesized by a non-aqueous solvothermal method and were characterized by powder X-ray diffraction (XRD), transmission electron microscopy (TEM), Raman and UV-visible spectroscopy. XRD confirms that the CdS nanoparticles have the hexagonal structure. The Williamson-Hall (W-H) method was used to study the X-ray peak profile analysis. The strain-size plot (SSP) was used to study the individual contributions of crystallite size and lattice strain from the X-rays peaks. The physical parameters such as strain, stress and energy density values were calculated using various models namely, isotropic strain model, anisotropic strain model and uniform deformation energy density model. The particle size was estimated from the TEM images to be in the range of 20-40 nm. The Raman spectrum shows the characteristic optical 1LO and 2LO vibrational modes of CdS. UV-visible absorption studies show that the band gap of the CdS nanoparticles is 2.48 eV. The results show that the crystallite size estimated from Scherrer's formula, W-H plots, SSP and the particle size calculated by TEM images are approximately similar.
Multispectrum analysis of air-broadened spectra in the ν 3 Q branch of 12CH4
Devi, V. Malathy; Benner, D. Chris; Gamache, Robert R.; ...
2017-12-06
In this paper, we report experimental measurements of spectral line shape parameters (air-broadened width, shift, and line mixing coefficients) for several transitions in the ν 3 Q branch of methane in the 3000–3023 cm -1 region. 13 high-resolution, room temperature laboratory spectra of pure methane and air-broadened methane recorded with two different Fourier transform spectrometers are fitted. 12 of these spectra were acquired at 0.01 cm -1 resolution with the McMath-Pierce FTS at the National Solar Observatory on Kitt Peak, and one higher-resolution (~0.0011 cm-1) low pressure methane spectrum was obtained with the Bruker IFS-120HR FTS at the Pacific Northwestmore » National Laboratory, in Richland, Washington. All the spectra were obtained using high purity natural samples of CH 4 and lean mixtures of the same natural CH 4 in dry air. For the 12 spectra recorded at Kitt Peak, three different absorption cells (L= 5, 25 and 150 cm) were used while the methane spectrum at PNNL was obtained using a 19.95 cm long absorption cell. For the analysis, an interactive multispectrum nonlinear least squares fitting software was employed where all the 13 spectra were fitted simultaneously. An accurate and self-consistent set of line parameters were determined by constraining a few of those for severely blended transitions. Line mixing was measured for fourteen transition pairs for the CH 4-air collision system. Lastly, a constant speed dependence parameter, consistent with measured speed dependence values obtained in other methane bands, was applied to all the transitions included in the fitted region. The present measurements are compared to values reported in the literature.« less
NASA Technical Reports Server (NTRS)
Smith, M. A. H.; Benner, D. Chris; Pedroi-Cross, A.; Devi, V. Malathy
2013-01-01
Lorentz self- and air-broadened half width and pressure-induced shift coefficients and their dependences on temperature have been measured from laboratory absorption spectra for nearly 130 transitions in the nu(sub 2) band of (12)CH4. In addition line mixing coefficients (using the relaxation matrix element formalism) for both self- and airbroadening were experimentally determined for the first time for a small number of transitions in this band. Accurate line positions and absolute line intensities were also determined. These parameters were obtained by analyzing high-resolution (approx. 0.003 to 0.01 per cm) laboratory spectra of high-purity natural CH4 and air-broadened CH4 recorded at temperatures between 226 and 297 K using the McMath-Pierce Fourier transform spectrometer (FTS) located at the National Solar Observatory on Kitt Peak, Arizona. A multispectrum nonlinear least squares technique was used to fit short (5-15 per cm) spectral intervals in 24-29 spectra simultaneously. Parameters were determined for nu(sub 2) transitions up to J" = 16. The variations of the measured broadening and shift parameters with the rotational quantum number index and tetrahedral symmetry species are examined. The present results are also compared with previous measurements available in the literature.
In Situ XRD Studies of the Process Dynamics During Annealing in Cold-Rolled Copper
NASA Astrophysics Data System (ADS)
Dey, Santu; Gayathri, N.; Bhattacharya, M.; Mukherjee, P.
2016-12-01
The dynamics of the release of stored energy during annealing along two different crystallographic planes, i.e., {111} and {220}, in deformed copper have been investigated using in situ X-ray diffraction measurements at 458 K and 473 K (185 °C and 200 °C). The study has been carried out on 50 and 80 pct cold-rolled Cu sheets. The microstructures of the rolled samples have been characterized using optical microscopy and electron backscattered diffraction measurements. The microstructural parameters were evaluated from the X-ray diffractogram using the Scherrer equation and the modified Rietveld method. The stored energy along different planes was determined using the modified Stibitz formula from the X-ray peak broadening, and the bulk stored energy was evaluated using differential scanning calorimetry. The process dynamics of recovery and recrystallization as observed through the release of stored energy have been modeled as the second-order and first-order processes, respectively.
Zhang, Zhi-dan; Li, Qiao; Luo, Xiang-li; Jiang, Hai-chao; Zheng, Qing-fu; Zhao, Lan-po; Wang, Ji-hong
2014-08-01
The present paper took the typical saline-alkali soil in Jilin province as study object, and determinated the soil clay mineral composition characteristics of soil in paddy field and dry land. Then XRD spectrum was used to analyze the evolutionary mechanism of clay mineral in the two kinds of soil. The results showed that the physical and chemical properties of soil in paddy field were better than those in dry land, and paddy field would promote the weathering of mineral particles in saline-alkali soil and enhance the silt content. Paddy field soil showed a strong potassium-removal process, with a higher degree of clay mineral hydration and lower degree of illite crystallinity. Analysis of XRD spectrum showed that the clay mineral composition was similar in two kinds of soil, while the intensity and position of diffraction peak showed difference. The evolution process of clay mineral in dry land was S/I mixture-->vermiculite, while in paddy field it was S/I mixture-->vermiculite-->kaolinite. One kind of hydroxylated 'chlorite' mineral would appear in saline-alkali soil in long-term cultivated paddy field. Taking into account that the physical and chemical properties of soil in paddy field were better then those in dry land, we could know that paddy field could help much improve soil structure, cultivate high-fertility soil and improve saline-alkali soil. This paper used XRD spectrum to determine the characteristics of clay minerals comprehensively, and analyzed two'kinds of land use comparatively, and was a new perspective of soil minerals study.
Švarcová, Silvie; Bezdička, Petr; Hradil, David; Hradilová, Janka; Žižak, Ivo
2011-01-01
Application of X-ray diffraction (XRD)-based techniques in the analysis of painted artworks is not only beneficial for indisputable identification of crystal constituents in colour layers, but it can also bring insight in material crystal structure, which can be affected by their geological formation, manufacturing procedure or secondary changes. This knowledge might be helpful for art historic evaluation of an artwork as well as for its conservation. By way of example of kaolinite, we show that classification of its crystal structure order based on XRD data is useful for estimation of its provenance. We found kaolinite in the preparation layer of a Gothic wall painting in a Czech church situated near Karlovy Vary, where there are important kaolin deposits. Comparing reference kaolin materials from eight various Czech deposits, we found that these can be differentiated just according to the kaolinite crystallinity. Within this study, we compared laboratory powder X-ray micro-diffraction (micro-XRD) with synchrotron radiation X-ray diffraction analysing the same real sample. We found that both techniques led to the same results.
NASA Technical Reports Server (NTRS)
Rinsland, Curtis P.; Smith, Mary Ann H.; Goldman, Aaron; Malathy Devi, V.
1991-01-01
Lorentz air-broadening coefficients and relative intensities have been measured for forty-three lines in the pure rotational band and twenty lines in the nu2 band of H2O-16 between 800 and 1150/cm. The results were derived from analysis of nine 0.017/cm-resolution atmospheric absorption spectra recorded over horizontal paths of 0.5-1.5 km with the McMath Fourier transform spectrometer and main solar telescope operated on Kitt Peak by the National Solar Observatory. A nonlinear least-squares spectral fitting technique was used in the spectral analysis. The results are compared with previous measurements and calculations. In most cases, the measured pressure-broadening coefficients and intensities are significantly different from the values in the 1986 HITRAN line parameters compilation.
Structural and spectroscopic study of mechanically synthesized SnO2 nanostructures
NASA Astrophysics Data System (ADS)
Vij, Ankush; Kumar, Ravi
2016-05-01
We report the single step synthesis of SnO2 nanostructures using high energy mechanical attrition method. X-ray diffraction (XRD) pattern reveals the single phase rutile structure with appreciable broadening of diffraction peaks, which is a signature of nanostructure formation. The average crystallite size of SnO2 nanostructures has been calculated to be ~15 nm. The micro-Raman study reveals the shifting of A1g Raman mode towards lower wave number, which is correlated with the nanostructure formation.
NASA Astrophysics Data System (ADS)
Tanaka, H.; Takeyama, K.; Yoshikawa, M.; Kajita, S.; Ohno, N.; Hayashi, Y.
2018-07-01
We have performed multipoint measurements with segmented electrodes and a microwave interferometer in the linear plasma device NAGDIS-II, in order to reveal cross-field motion and axial localization of the enhanced radial transport in the detached plasma. By changing the neutral pressure successively and applying several statistical analysis techniques, it was clarified that there is axially localized ion flux broadening accompanying an enhanced plasma ejection from the center with radially elongated spiraling structure. The spiraling plasma ejection accompanies the m = 0 mode drop near the center with the similar time scale. Further, such behavior composed of f > 1 kHz fluctuations is modulated by several-hundred-hertz fluctuation with m = 0. This cross-field transport causes non-negligible effect for the reduction of the ion flux peak in the detached plasma.
Broadening and collisional interference of lines in the IR spectra of ammonia. Theory
NASA Astrophysics Data System (ADS)
Cherkasov, M. R.
2016-06-01
The general theory of relaxation spectral shape parameters in the impact approximation (M. R. Cherkasov, J. Quant. Spectrosc. Radiat. Transfer 141, 73 (2014)) is adapted to the case of line broadening of infrared spectra of ammonia. Specific features of line broadening of parallel and perpendicular bands are discussed. It is shown that in both cases the spectrum consists of independently broadened singlets and doublets; however, the components of doublets can be affected by collisional interference. The paper is the first part of a cycle of studies devoted to the problems of spectral line broadening of ammonia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamarudin, Nadira; Abdullah, Wan Saffiey Wan; Dollah, Mohd Taufik
2014-09-03
This paper presents the characterization and TL properties of dysprosium (Dy) doped calcium sulfate (CaSO{sub 4}) TL material produced by co-precipitation technique with 0.5mol% concentration of dopant. The morphology of the produced TL material was studied using scanning electron microscope (SEM) and the micrograph shows that rectangular parallelepiped shaped crystal with the average of 150 μm in length were produced. The crystallinity of the produced powder was studied using x-ray powder diffraction (XRD). The XRD spectra show that the TL material produced is high purity anhydrite CaSO{sub 4} with average crystallite size of 74 nm with orthorhombic crystal system. Themore » TL behavior of produced CaSO{sub 4}:Dy was studied using a TLD reader after exposure to gamma ray by Co{sup 60} source with the doses of 1,5 and 10 Gy. The glow curve shows linear response with glow peak around 230°C which is desired development in the field of radiation dosimetry.« less
Khantamat, Orawan; Li, Chien-Hung; Liu, Si-Ping; Liu, Tingting; Lee, Han Ju; Zenasni, Oussama; Lee, Tai-Chou; Cai, Chengzhi; Lee, T Randall
2018-03-01
Titanium dioxide (TiO 2 ) has gained increasing interest in materials research due to its outstanding properties and promising applications in a wide range of fields. From this perspective, we report the synthesis of custom-designed anatase TiO 2 submicrometer particles coated with partial Au shells (ATiO 2 -AuShl). The synthetic strategy used herein yields uniformly shaped monodisperse particles. Amorphous TiO 2 core particles were synthesized using template-free oxidation and hydrolysis of titanium nitride (TiN); subsequent hydrothermal treatment generated anatase TiO 2 (ATiO 2 ) particles. Coating ATiO 2 particles with partial Au shells was accomplished using a simple seeded-growth method. Evaluation of the optical properties of these ATiO 2 -AuShl particles showed that these submicrometer composites exhibited an intense absorption peak for TiO 2 in the UV region (∼326 nm) and a broad extinction band in the visible range (∼650 nm) arising from the incomplete Au shell. These ATiO 2 -AuShl composite particles provide a unique and effective means for broadening the optical response of TiO 2 -based nano- and micron-scale materials. The simplicity of our synthetic method should broaden the application of ATiO 2 -AuShl particles in various visible light-driven technologies. Copyright © 2017 Elsevier Inc. All rights reserved.
The impact of column connection on band broadening in very high pressure liquid chromatography.
Stankovich, Joseph J; Gritti, Fabrice; Stevenson, Paul G; Guiochon, Georges
2013-09-01
A series of experiments was conducted to evaluate the degree of band broadening in very high pressure LC due to column connections. Different column manufacturers use slightly different designs for their column fittings. If the same column connections are repeatedly used to attach columns of different origins, different void volumes form between capillary tubes and column inlets. An Agilent Ultra Low Dispersion Kit (tubing id 75 μm) was installed on an Agilent Infinity 1290 ultra HPLC and used to connect successively an Agilent, a Phenomenex, and a Waters column. A series of uracil (unretained) samples were injected and eluted at a wide range of flow rates with a water/acetonitrile mixture as eluent. In order to determine the variance contribution from column connections as accurately as possible a nonretained probe compound was selected because the variance contribution from the column is the smallest for analytes, which have very low k values. Yet, this effect still has an impact on the resolution for moderately retained compounds (k > 2) for narrow-bore columns packed with fine particles, since variance contributions are additive for linear chromatographic systems. Each injection was replicated five times under the same experimental conditions. Then NanoViper column connections (tubing id 75 μm) were used and the same injections were made. This system was designed to minimize connection void volumes for any column. Band variances were calculated as the second central moment of elution peaks and used to assess the degree of band broadening due to the column connections. Band broadening may increase from 3.8 to 53.9% when conventional metal ferrules were used to join columns to connection sites. The results show that the variance contribution from improper connections can generate as much as 60.5% of the total variance observed. This demonstrates that column connections can play a larger role than the column packing with respect to band dispersion. © 2013 WILEY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adam, J.; Adamová, D.; Aggarwal, M. M.
In two-particle angular correlation measurements, jets give rise to a near-side peak, formed by particles associated to a higher-p T trigger particle. Measurements of these correlations as a function of pseudorapidity (Δη) and azimuthal (Δφ) differences are used to extract the centrality and p T dependence of the shape of the near-side peak in the p T range 1 < p T < 8 GeV/c in Pb-Pb and pp collisions at √ sNN = 2.76 TeV. A combined fit of the near-side peak and long-range correlations is applied to the data and the peak shape is quantified by the variancemore » of the distributions. And while the width of the peak in the Δφ direction is almost independent of centrality, a significant broadening in the Δη direction is found from peripheral to central collisions. This feature is prominent for the low-p T region and vanishes above 4 GeV/c. The widths measured in peripheral collisions are equal to those in pp collisions in the Δφ direction and above 3 GeV/c in the Δη direction. Furthermore, for the 10% most central collisions and 1 < p T,assoc < 2 GeV/c, 1 < p T,trig < 3 GeV/c, a departure from a Gaussian shape is found: a depletion develops around the center of the peak. Our results are compared to A Multi-Phase Transport (AMPT) model simulation as well as other theoretical calculations indicating that the broadening and the development of the depletion are connected to the strength of radial and longitudinal flow.« less
Adam, J.; Adamová, D.; Aggarwal, M. M.; ...
2017-09-08
In two-particle angular correlation measurements, jets give rise to a near-side peak, formed by particles associated to a higher-p T trigger particle. Measurements of these correlations as a function of pseudorapidity (Δη) and azimuthal (Δφ) differences are used to extract the centrality and p T dependence of the shape of the near-side peak in the p T range 1 < p T < 8 GeV/c in Pb-Pb and pp collisions at √ sNN = 2.76 TeV. A combined fit of the near-side peak and long-range correlations is applied to the data and the peak shape is quantified by the variancemore » of the distributions. And while the width of the peak in the Δφ direction is almost independent of centrality, a significant broadening in the Δη direction is found from peripheral to central collisions. This feature is prominent for the low-p T region and vanishes above 4 GeV/c. The widths measured in peripheral collisions are equal to those in pp collisions in the Δφ direction and above 3 GeV/c in the Δη direction. Furthermore, for the 10% most central collisions and 1 < p T,assoc < 2 GeV/c, 1 < p T,trig < 3 GeV/c, a departure from a Gaussian shape is found: a depletion develops around the center of the peak. Our results are compared to A Multi-Phase Transport (AMPT) model simulation as well as other theoretical calculations indicating that the broadening and the development of the depletion are connected to the strength of radial and longitudinal flow.« less
Dynamic XRD, Shock and Static Compression of CaF2
NASA Astrophysics Data System (ADS)
Kalita, Patricia; Specht, Paul; Root, Seth; Sinclair, Nicholas; Schuman, Adam; White, Melanie; Cornelius, Andrew; Smith, Jesse; Sinogeikin, Stanislav
2017-06-01
The high-pressure behavior of CaF2 is probed with x-ray diffraction (XRD) combined with both dynamic compression, using a two-stage light gas gun, and static compression, using diamond anvil cells. We use XRD to follow the unfolding of a shock-driven, fluorite to cotunnite phase transition, on the timescale of nanoseconds. The dynamic behavior of CaF2 under shock loading is contrasted with that under static compression. This work leverages experimental capabilities at the Advanced Photon Source: dynamic XRD and shock experiments at the Dynamic Compression Sector, as well as XRD and static compression in diamond anvil cell at the High-Pressure Collaborative Access Team. These experiments and cross-platform comparisons, open the door to an unprecedented understanding of equations of state and phase transitions at the microstructural level and at different time scales and will ultimately improve our capability to simulate the behavior of materials at extreme conditions. Sandia National Laboratories is a multi-mission laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.
Structural and spectroscopic study of mechanically synthesized SnO{sub 2} nanostructures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vij, Ankush, E-mail: vij-anx@yahoo.com; Kumar, Ravi; Presently at Beant College of Engineering and Technology, Gurdaspur-143521
2016-05-23
We report the single step synthesis of SnO{sub 2} nanostructures using high energy mechanical attrition method. X-ray diffraction (XRD) pattern reveals the single phase rutile structure with appreciable broadening of diffraction peaks, which is a signature of nanostructure formation. The average crystallite size of SnO{sub 2} nanostructures has been calculated to be ~15 nm. The micro-Raman study reveals the shifting of A{sub 1g} Raman mode towards lower wave number, which is correlated with the nanostructure formation.
NASA Technical Reports Server (NTRS)
Devi, V. Malathy; Benner, D. Chris; Smith, M. A. H.; Rinsland, C. P.
1994-01-01
High-resolution (0.01/cm) absorption spectra of lean mixtures of CH4 in dry air were recorded with the McMath-Pierce Fourier transform spectrometer (FTS) of the National Solar Observatory on Kitt Peak at various temperatures between 24 and -61 C. The spectra have been analyzed to determine the values at room temperature of pressure-broadened widths and pressure-induced shifts of more than 740 transitions. The temperature dependence of air-broadened widths and pressure-induced shifts was deduced for approx. 370 transitions in the nu(sub 1) + nu(sub 4), nu(sub 3) + nu(sub 4), and nu(sub 2) + nu(sub 3) bands of (12)CH4 located between 4118 and 4615/cm. These results were obtained by analyzing a total of 29 spectra simultaneously using a multi-spectral non-linear least-squares fitting technique. This new technique allowed the determination of correlated spectral line parameters (e.g. intensity and broadening coefficient) better than the procedure of averaging values obtained by fitting the spectra individually. This method also provided a direct determination of the uncertainties in the retrieved parameters due to random errors. For each band analysed in this study the dependence of the various spectral line parameters upon the tetrahedral symmetry species and the rotational quantum numbers of the transitions is also presented.
GOLD: Building capacity for broadening participation in the Geosciences
NASA Astrophysics Data System (ADS)
Adams, Amanda; Patino, Lina; Jones, Michael B.; Rom, Elizabeth
2017-04-01
The geosciences continue to lag other science, technology, engineering, and mathematics (STEM) disciplines in the engagement, recruitment and retention of traditionally underrepresented and underserved minorities, requiring more focused and strategic efforts to address this problem. Prior investments made by the National Science Foundation (NSF) related to broadening participation in STEM have identified many effective strategies and model programs for engaging, recruiting, and retaining underrepresented students in the geosciences. These investments also have documented clearly the importance of committed, knowledgeable, and persistent leadership for making local progress in broadening participation in STEM and the geosciences. Achieving diversity at larger and systemic scales requires a network of diversity "champions" who can catalyze widespread adoption of these evidence-based best practices and resources. Although many members of the geoscience community are committed to the ideals of broadening participation, the skills and competencies that empower people who wish to have an impact, and make them effective as leaders in that capacity for sustained periods of time, must be cultivated through professional development. The NSF GEO Opportunities for Leadership in Diversity (GOLD) program was implemented in 2016, as a funding opportunity utilizing the Ideas Lab mechanism. Ideas Labs are intensive workshops focused on finding innovative solutions to grand challenge problems. The ultimate aim of this Ideas Lab, organized by the NSF Directorate for Geosciences (GEO), was to facilitate the design, pilot implementation, and evaluation of innovative professional development curricula that can unleash the potential of geoscientists with interests in broadening participation to become impactful leaders within the community. The expectation is that mixing geoscientists with experts in broadening participation research, behavioral change, social psychology, institutional
MultiLaue: A Technique to Extract d-spacings from Laue XRD
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gainsforth, Zack; Marcus, Matthew A.; Tamura, Nobumichi
We present that broad spectrum X-ray Diffraction (XRD) is named Laue after Max von Laue, and is the original XRD technique. Today, monochromatic XRD is more common because Bragg's equation allows determination of d-spacings where Laue does not. Laue still remains in use for single crystal systems because it can be used to make very accurate unit cell determinations as well as for strain and orientation mapping. Lastly, a Laue technique which could provide unambiguous determination of lattice spacings, a la Bragg's equation would be a huge leap forward, especially for multiphase samples such as meteorites, interplanetary dust particles andmore » some geological specimens.« less
MultiLaue: A Technique to Extract d-spacings from Laue XRD
Gainsforth, Zack; Marcus, Matthew A.; Tamura, Nobumichi; ...
2016-07-25
We present that broad spectrum X-ray Diffraction (XRD) is named Laue after Max von Laue, and is the original XRD technique. Today, monochromatic XRD is more common because Bragg's equation allows determination of d-spacings where Laue does not. Laue still remains in use for single crystal systems because it can be used to make very accurate unit cell determinations as well as for strain and orientation mapping. Lastly, a Laue technique which could provide unambiguous determination of lattice spacings, a la Bragg's equation would be a huge leap forward, especially for multiphase samples such as meteorites, interplanetary dust particles andmore » some geological specimens.« less
NASA Astrophysics Data System (ADS)
Adam, J.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, S.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; An, M.; Andrei, C.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Balasubramanian, S.; Baldisseri, A.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Buitron, S. A. I.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, S.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Conesa Balbastre, G.; Conesa Del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crkovská, J.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; de, S.; de Caro, A.; de Cataldo, G.; de Conti, C.; de Cuveland, J.; de Falco, A.; de Gruttola, D.; De Marco, N.; de Pasquale, S.; de Souza, R. D.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; di Bari, D.; di Mauro, A.; di Nezza, P.; di Ruzza, B.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Duggal, A. K.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Garg, P.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; Gonzalez, V.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L.; Grelli, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grion, N.; Gronefeld, J. M.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hladky, J.; Horak, D.; Hosokawa, R.; Hristov, P.; Hughes, C.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Isakov, V.; Islam, M. S.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Mohisin Khan, M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kileng, B.; Kim, D. W.; Kim, D. J.; Kim, D.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lazaridis, L.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.; Lehner, S.; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Llope, W.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martinengo, P.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Mastroserio, A.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Mischke, A.; Mishra, A. N.; Mishra, T.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montes, E.; Moreira de Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Naik, B.; Nair, R.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Natal da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao de Oliveira, R. A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Pal, S. K.; Palni, P.; Pan, J.; Pandey, A. K.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Park, W. J.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.; Peng, X.; Pereira da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sano, M.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H. P.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thomas, D.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; Tripathy, S.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; van der Maarel, J.; van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yalcin, S.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zmeskal, J.; Alice Collaboration
2017-09-01
In two-particle angular correlation measurements, jets give rise to a near-side peak, formed by particles associated to a higher-pT trigger particle. Measurements of these correlations as a function of pseudorapidity (Δ η ) and azimuthal (Δ φ ) differences are used to extract the centrality and pT dependence of the shape of the near-side peak in the pT range 1
Commitment to Broadening Participation at NOAO
NASA Astrophysics Data System (ADS)
Garmany, Catharine D.; Norman, D.
2011-01-01
AURA and NOAO take seriously the importance of Broadening Participation in Astronomy. At the request of the AURA President, each of the AURA centers (NOAO, NSO, STSCI, Gemini) appointed a Diversity Advocates (DA). At NOAO this job is shared by Dara Norman and Katy Garmany, who were appointed by Dave Silva in Jan 2009. The DA's are members of the AURA Committee on Workforce and Diversity (WDC), a designated subcommittee of the AURA Board of Directors. The role of this committee includes reviewing activities and plans on an AURA wide basis aimed at broadening the participation within AURA, and reviewing AURA wide policies on the workforce. At NOAO, the role of the DAs spans a number of departments and activities. They serve on observatory search committees, and offer suggestions on how NOAO job searches can reach the most diverse audience. The DA's job is to insure that NOAO actively pursues every opportunity to increase diversity: to this end they are involved in outreach and educational activities that focus on workplace development and encourage inclusion of woman, minorities and persons with disabilities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dinh, Thanh-Chung; Renger, Thomas, E-mail: thomas.renger@jku.at
2016-07-21
In pigment-protein complexes, often the excited states are partially delocalized and the exciton-vibrational coupling in the basis of delocalized states contains large diagonal and small off-diagonal elements. This inequality may be used to introduce potential energy surfaces (PESs) of exciton states and to treat the inter-PES coupling in Markov and secular approximations. The resulting lineshape function consists of a Lorentzian peak that is broadened by the finite lifetime of the exciton states caused by the inter-PES coupling and a vibrational sideband that results from the mutual displacement of the excitonic PESs with respect to that of the ground state. Somore » far analytical expressions have been derived that relate the exciton relaxation-induced lifetime broadening to the Redfield [T. Renger and R. A. Marcus, J. Chem. Phys. 116, 9997 (2002)] or modified Redfield [M. Schröder, U. Kleinekathöfer, and M. Schreiber, J. Chem. Phys. 124, 084903 (2006)] rate constants of exciton relaxation, assuming that intra-PES nuclear relaxation is fast compared to inter-PES transfer. Here, we go beyond this approximation and provide an analytical expression, termed Non-equilibrium Modified Redfield (NeMoR) theory, for the lifetime broadening that takes into account the finite nuclear relaxation time. In an application of the theory to molecular dimers, we find that, for a widely used experimental spectral density of the exciton-vibrational coupling of pigment-protein complexes, the NeMoR spectrum at low-temperatures (T < 150 K) is better approximated by Redfield than by modified Redfield theory. At room temperature, the lifetime broadening obtained with Redfield theory underestimates the NeMoR broadening, whereas modified Redfield theory overestimates it by a similar amount. A fortuitous error compensation in Redfield theory is found to explain the good performance of this theory at low temperatures. Since steady state spectra of PPCs are often measured at low
Dinh, Thanh-Chung; Renger, Thomas
2016-07-21
In pigment-protein complexes, often the excited states are partially delocalized and the exciton-vibrational coupling in the basis of delocalized states contains large diagonal and small off-diagonal elements. This inequality may be used to introduce potential energy surfaces (PESs) of exciton states and to treat the inter-PES coupling in Markov and secular approximations. The resulting lineshape function consists of a Lorentzian peak that is broadened by the finite lifetime of the exciton states caused by the inter-PES coupling and a vibrational sideband that results from the mutual displacement of the excitonic PESs with respect to that of the ground state. So far analytical expressions have been derived that relate the exciton relaxation-induced lifetime broadening to the Redfield [T. Renger and R. A. Marcus, J. Chem. Phys. 116, 9997 (2002)] or modified Redfield [M. Schröder, U. Kleinekathöfer, and M. Schreiber, J. Chem. Phys. 124, 084903 (2006)] rate constants of exciton relaxation, assuming that intra-PES nuclear relaxation is fast compared to inter-PES transfer. Here, we go beyond this approximation and provide an analytical expression, termed Non-equilibrium Modified Redfield (NeMoR) theory, for the lifetime broadening that takes into account the finite nuclear relaxation time. In an application of the theory to molecular dimers, we find that, for a widely used experimental spectral density of the exciton-vibrational coupling of pigment-protein complexes, the NeMoR spectrum at low-temperatures (T < 150 K) is better approximated by Redfield than by modified Redfield theory. At room temperature, the lifetime broadening obtained with Redfield theory underestimates the NeMoR broadening, whereas modified Redfield theory overestimates it by a similar amount. A fortuitous error compensation in Redfield theory is found to explain the good performance of this theory at low temperatures. Since steady state spectra of PPCs are often measured at low temperatures
The XRD Amorphous Component in John Klein Drill Fines at Yellowknife Bay, Gale Crater, Mars
NASA Technical Reports Server (NTRS)
Morris, Richard V.; Ming,, Douglas W.; Blake, David; Vaniman, David; Bish, David L; Chipera, Steve; Downs, Robert; Morrison, Shaunna; Gellert, Ralf; Campbell, Iain;
2013-01-01
the position of its 021 diffraction peak is similar to that reported for John Klein. In both cases, the amorphous component has low SiO2 and MgO and high FeO + Fe2O3, P2O5, and SO3 concentrations relative to bulk sample. The chemical composition of the bulk drill fines and XRD crystalline, smectite, and amorphous components implies alteration of an initially basaltic material under near neutral conditions (not acid sulfate), with the sulfate incorporated later as veins of CaSO4 injected into the mudstone.
Positive emotions broaden the scope of attention and thought-action repertoires
Fredrickson, Barbara L.; Branigan, Christine
2011-01-01
The broaden-and-build theory (Fredrickson, 1998, 2001) hypothesises that positive emotions broaden the scope of attention and thought-action repertoires. Two experiments with 104 college students tested these hypotheses. In each, participants viewed a film that elicited (a) amusement, (b) contentment, (c) neutrality, (d) anger, or (e) anxiety. Scope of attention was assessed using a global-local visual processing task (Experiment 1) and thought-action repertoires were assessed using a Twenty Statements Test (Experiment 2). Compared to a neutral state, positive emotions broadened the scope of attention in Experiment 1 and thought-action repertoires in Experiment 2. In Experiment 2, negative emotions, relative to a neutral state, narrowed thought-action repertoires. Implications for promoting emotional well-being and physical health are discussed. PMID:21852891
Meta-Research: Broadening the Scope of PLOS Biology.
Kousta, Stavroula; Ferguson, Christine; Ganley, Emma
2016-01-01
In growing recognition of the importance of how scientific research is designed, performed, communicated, and evaluated, PLOS Biology announces a broadening of its scope to cover meta-research articles.
Measurement of Spectral Broadening in PTS-Polydiacetylene
NASA Astrophysics Data System (ADS)
Bhowmik, Achintya; Thakur, Mrinal
1998-03-01
PTS-polydiacetylene has significant potential for future applications in ultrafast all-optical switches and logic gates.(R. Quintero-Torres and M. Thakur, Appl. Phys. Lett., 66, 1310 (1995).) In this work, we have made detailed measurements of the instantaneous spectral line broadening in a 500 μm thick PTS single-crystal as a function of intensity and wavelength. A mode-locked Ti-Sapphire laser with 2 ps pulse-width at 82 MHz repetition rate, and a Nd:YAG laser with 60 ps pulse-width at 10 Hz repetition rate were used for measurements at 720-840 nm and 1064 nm wavelength respectively. The spectral bandwidth of the beam was recorded before and after passing through the PTS single-crystal by a high-resolution spectrometer. The nonlinear refractive index (n_2) of PTS as a function of wavelength has been determined from the spectral broadening data.
Degradation of the Bragg peak due to inhomogeneities.
Urie, M; Goitein, M; Holley, W R; Chen, G T
1986-01-01
The rapid fall-off of dose at the end of range of heavy charged particle beams has the potential in therapeutic applications of sparing critical structures just distal to the target volume. Here we explored the effects of highly inhomogeneous regions on this desirable depth-dose characteristic. The proton depth-dose distribution behind a lucite-air interface parallel to the beam was bimodal, indicating the presence of two groups of protons with different residual ranges, creating a step-like depth-dose distribution at the end of range. The residual ranges became more spread out as the interface was angled at 3 degrees, and still more at 6 degrees, to the direction of the beam. A second experiment showed little significant effect on the distal depth-dose of protons having passed through a mosaic of teflon and lucite. Anatomic studies demonstrated significant effects of complex fine inhomogeneities on the end of range characteristics. Monoenergetic protons passing through the petrous ridges and mastoid air cells in the base of skull showed a dramatic degradation of the distal Bragg peak. In beams with spread out Bragg peaks passing through regions of the base of skull, the distal fall-off from 90 to 20% dose was increased from its nominal 6 to well over 32 mm. Heavy ions showed a corresponding degradation in their ends of range. In the worst case in the base of skull region, a monoenergetic neon beam showed a broadening of the full width at half maximum of the Bragg peak to over 15 mm (compared with 4 mm in a homogeneous unit density medium). A similar effect was found with carbon ions in the abdomen, where the full width at half maximum of the Bragg peak (nominally 5.5 mm) was found to be greater than 25 mm behind gas-soft-tissue interfaces. We address the implications of these data for dose computation with heavy charged particles.
Ultrafast visualization of crystallization and grain growth in shock-compressed SiO2
Gleason, A. E.; Bolme, C. A.; Lee, H. J.; Nagler, B.; Galtier, E.; Milathianaki, D.; Hawreliak, J.; Kraus, R. G.; Eggert, J. H.; Fratanduono, D. E.; Collins, G. W.; Sandberg, R.; Yang, W.; Mao, W. L.
2015-01-01
Pressure- and temperature-induced phase transitions have been studied for more than a century but very little is known about the non-equilibrium processes by which the atoms rearrange. Shock compression generates a nearly instantaneous propagating high-pressure/temperature condition while in situ X-ray diffraction (XRD) probes the time-dependent atomic arrangement. Here we present in situ pump–probe XRD measurements on shock-compressed fused silica, revealing an amorphous to crystalline high-pressure stishovite phase transition. Using the size broadening of the diffraction peaks, the growth of nanocrystalline stishovite grains is resolved on the nanosecond timescale just after shock compression. At applied pressures above 18 GPa the nuclueation of stishovite appears to be kinetically limited to 1.4±0.4 ns. The functional form of this grain growth suggests homogeneous nucleation and attachment as the growth mechanism. These are the first observations of crystalline grain growth in the shock front between low- and high-pressure states via XRD. PMID:26337754
Wahab, M Farooq; Patel, Darshan C; Armstrong, Daniel W
2017-08-04
Most peak shapes obtained in separation science depart from linearity for various reasons such as thermodynamic, kinetic, or flow based effects. An indication of the nature of asymmetry often helps in problem solving e.g. in column overloading, slurry packing, buffer mismatch, and extra-column band broadening. However, existing tests for symmetry/asymmetry only indicate the skewness in excess (tail or front) and not the presence of both. Two simple graphical approaches are presented to analyze peak shapes typically observed in gas, liquid, and supercritical fluid chromatography as well as capillary electrophoresis. The derivative test relies on the symmetry of the inflection points and the maximum and minimum values of the derivative. The Gaussian test is a constrained curve fitting approach and determines the residuals. The residual pattern graphically allows the user to assess the problematic regions in a given peak, e.g., concurrent tailing or fronting, something which cannot be easily done with other current methods. The template provided in MS Excel automates this process. The total peak shape analysis extracts the peak parameters from the upper sections (>80% height) of the peak rather than the half height as is done conventionally. A number of situations are presented and the utility of this approach in solving practical problems is demonstrated. Copyright © 2017 Elsevier B.V. All rights reserved.
Air-Broadening of H2O as a Function of Temperature: 696 - 2163 cm(exp -1)
NASA Technical Reports Server (NTRS)
Toth, R. A.; Brown, L. R.; Smith, M. A. H.; Devi, V. Malathy; Benner, D. Chris; Dulick, M.
2006-01-01
The temperature dependence of air-broadened halfwidths are reported for some 500 transitions in the (000)-(000) and (010)-(000) bands of H2(16)O using gas sample temperatures ranging from 241 to 388 K. These observations were obtained from infrared laboratory spectra recorded at 0.006 to 0.011 cm(exp-1) resolution with the McMath-Pierce Fourier transform spectrometer located at Kitt Peak. The experimental values of the temperature dependence exponents, eta, were grouped into eight subsets and fitted to empirical functions in a semi-global procedure. Overall, the values of eta were found to decrease with increasing rotational quantum number J. The number of measurements (over 2200) and transitions (586) involved exceeds by a large margin that of any other comparable reported study.
Action potential broadening in a presynaptic channelopathy
NASA Astrophysics Data System (ADS)
Begum, Rahima; Bakiri, Yamina; Volynski, Kirill E.; Kullmann, Dimitri M.
2016-07-01
Brain development and interictal function are unaffected in many paroxysmal neurological channelopathies, possibly explained by homoeostatic plasticity of synaptic transmission. Episodic ataxia type 1 is caused by missense mutations of the potassium channel Kv1.1, which is abundantly expressed in the terminals of cerebellar basket cells. Presynaptic action potentials of small inhibitory terminals have not been characterized, and it is not known whether developmental plasticity compensates for the effects of Kv1.1 dysfunction. Here we use visually targeted patch-clamp recordings from basket cell terminals of mice harbouring an ataxia-associated mutation and their wild-type littermates. Presynaptic spikes are followed by a pronounced afterdepolarization, and are broadened by pharmacological blockade of Kv1.1 or by a dominant ataxia-associated mutation. Somatic recordings fail to detect such changes. Spike broadening leads to increased Ca2+ influx and GABA release, and decreased spontaneous Purkinje cell firing. We find no evidence for developmental compensation for inherited Kv1.1 dysfunction.
NASA Astrophysics Data System (ADS)
Dey, Ranajit; Bajpai, P. K.
2018-04-01
Implanted Au5+-ion-induced modification in structural and phonon properties of phase pure BiFeO3 (BFO) ceramics prepared by sol-gel method was investigated. These BFO samples were implanted by 15.8 MeV ions of Au5+ at various ion fluence ranging from 1 × 1014 to 5 × 1015 ions/cm2. Effect of Au5+ ions' implantation is explained in terms of structural phase transition coupled with amorphization/recrystallization due to ion implantation probed through XRD, SEM, EDX and Raman spectroscopy. XRD patterns show broad diffuse contributions due to amorphization in implanted samples. SEM images show grains collapsing and mounds' formation over the surface due to mass transport. The peaks of the Raman spectra were broadened and also the peak intensities were decreased for the samples irradiated with 15.8 MeV Au5+ ions at a fluence of 5 × 1015 ion/cm2. The percentage increase/decrease in amorphization and recrystallization has been estimated from Raman and XRD data, which support the synergistic effects being operative due to comparable nuclear and electronic energy losses at 15.8 MeV Au5+ ion implantation. Effect of thermal treatment on implanted samples is also probed and discussed.
Xu, Tianhua; Karanov, Boris; Shevchenko, Nikita A; Lavery, Domaniç; Liga, Gabriele; Killey, Robert I; Bayvel, Polina
2017-10-11
Nyquist-spaced transmission and digital signal processing have proved effective in maximising the spectral efficiency and reach of optical communication systems. In these systems, Kerr nonlinearity determines the performance limits, and leads to spectral broadening of the signals propagating in the fibre. Although digital nonlinearity compensation was validated to be promising for mitigating Kerr nonlinearities, the impact of spectral broadening on nonlinearity compensation has never been quantified. In this paper, the performance of multi-channel digital back-propagation (MC-DBP) for compensating fibre nonlinearities in Nyquist-spaced optical communication systems is investigated, when the effect of signal spectral broadening is considered. It is found that accounting for the spectral broadening effect is crucial for achieving the best performance of DBP in both single-channel and multi-channel communication systems, independent of modulation formats used. For multi-channel systems, the degradation of DBP performance due to neglecting the spectral broadening effect in the compensation is more significant for outer channels. Our work also quantified the minimum bandwidths of optical receivers and signal processing devices to ensure the optimal compensation of deterministic nonlinear distortions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
2016-11-30
The PeakWorks software is designed to assist in the quantitative analysis of atom probe tomography (APT) generated mass spectra. Specifically, through an interactive user interface, mass peaks can be identified automatically (defined by a threshold) and/or identified manually. The software then provides a means to assign specific elemental isotopes (including more than one) to each peak. The software also provides a means for the user to choose background subtraction of each peak based on background fitting functions, the choice of which is left to the users discretion. Peak ranging (the mass range over which peaks are integrated) is also automatedmore » allowing the user to chose a quantitative range (e.g. full-widthhalf- maximum). The software then integrates all identified peaks, providing a background-subtracted composition, which also includes the deconvolution of peaks (i.e. those peaks that happen to have overlapping isotopic masses). The software is also able to output a 'range file' that can be used in other software packages, such as within IVAS. A range file lists the peak identities, the mass range of each identified peak, and a color code for the peak. The software is also able to generate 'dummy' peak ranges within an outputted range file that can be used within IVAS to provide a means for background subtracted proximity histogram analysis.« less
Hydrogen and Nitrogen Broadened Ethane and Propane Absorption Cross Sections
NASA Astrophysics Data System (ADS)
Hargreaves, Robert J.; Appadoo, Dominique; Billinghurst, Brant E.; Bernath, Peter F.
2015-06-01
High-resolution infrared absorption cross sections are presented for the ν9 band of ethane (C2H6) at 823 cm-1. These cross sections make use of spectra recorded at the Australian Synchrotron using a Fourier transform infrared spectrometer with maximum resolution of 0.00096 cm-1. The spectra have been recorded at 150, 120 and 90 K for hydrogen and nitrogen broadened C2H6. They cover appropriate temperatures, pressures and broadening gases associated with the atmospheres of the Outer Planets and Titan, and will improve atmospheric retrievals. The THz/Far-IR beamline at the Australian Synchrotron is unique in combining a high-resolution Fourier transform spectrometer with an 'enclosive flow cooling' (EFC) cell designed to study molecules at low temperatures. The EFC cell is advantageous at temperatures for which the vapor pressure is very low, such as C2H6 at 90 K. Hydrogen broadened absorption cross sections of propane between 700 and 1200 cm-1 will also be presented based on spectra obtained at the Canadian Light Source.
Broadening the optical bandwidth of quantum cascade lasers using RF noise current perturbations.
Pinto, Tomás H P; Kirkbride, James M R; Ritchie, Grant A D
2018-04-15
We report on the broadening of the optical bandwidth of a distributed feedback quantum cascade laser (QCL) caused by the application of radio frequency (RF) noise to the injection current. The broadening is quantified both via Lamb-dip spectroscopy and the frequency noise power spectral density (PSD). The linewidth of the unperturbed QCL (emitting at ∼5.3 μm) determined by Lamb-dip spectroscopy is 680±170 kHz, and is in reasonable agreement with the linewidth of 460±40 kHz estimated by integrating the PSD measured under the same laser operating conditions. Measurements with both techniques reveal that by mixing the driving current with broadband RF noise the laser lineshape was reproducibly broadened up to ca 6 MHz with an increasing Gaussian contribution. The effects of linewidth broadening are then demonstrated in the two-color coherent transient spectra of nitric oxide.
Spectral broadening of VLF transmitter signals observed on DE 1 - A quasi-electrostatic phenomenon?
NASA Technical Reports Server (NTRS)
Inan, U. S.; Bell, T. F.
1985-01-01
Spectrally broadened VLF transmitter signals are observed on the DE 1 satellite using alternatively both electric and magnetic field sensors. It is found that at times when the electric field component undergoes significant bandwidth expansion (up to about 110 Hz) the magnetic field component has a bandwidth of less than 10 Hz. The results support the theory that the off-carrier components are quasi-electrostatic in nature. Measurement of the absolute E and B field magnitudes of the broadened signals are used to determine the wave Poynting vector. It is found that the observed power levels can be understood without invoking any strong amplification process that operates in conjunction with the spectral broadening. The implications of this finding in distinguishing among the various possible mechanisms for spectral broadening are discussed.
Spectral broadening measurement of the lower hybrid waves during long pulse operation in Tore Supra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berger-By, G.; Decampy, J.; Goniche, M.
2014-02-12
On many tokamaks (C-Mod, EAST, FTU, JET, HT-7, TS), a decrease in current drive efficiency of the Lower Hybrid (LH) waves is observed in high electron density plasmas. The cause of this behaviour is believed to be: Parametric Instabilities (PI) and Scattering from Density Fluctuations (SDF). For the ITER LH system, our knowledge must be improved to avoid such effects and to maintain the LH current drive efficiency at high density. The ITPA IOS group coordinates this effort [1] and all experimental data are essential to validate the numerical codes in progress. Usually the broadening of the LH wave frequencymore » spectrum is measured by a probe located in the plasma edge. For this study, the frequency spectrum of a reflected power signal from the LH antenna was used. In addition, the spectrum measurements are compared with the density fluctuations observed on RF probes located at the antenna mouth. Several plasma currents (0.6 to 1.4 MA) and densities up to 5.2 × 10{sup 19} m−3 have been realised on Tore Supra (TS) long pulses and with high injected RF power, up to 5.4 MW-30s. This allowed using a spectrum analyser to make several measurements during the plasma pulse. The side lobe amplitude, shifted by 20-30MHz with respect to the main peak, grows with increasing density. Furthermore, for an increase of plasma current at the same density, the spectra broaden and become asymmetric. Some parametric dependencies are shown in this paper.« less
Spectral broadening measurement of the lower hybrid waves during long pulse operation in Tore Supra
NASA Astrophysics Data System (ADS)
Berger-By, G.; Decampy, J.; Antar, G. Y.; Goniche, M.; Ekedahl, A.; Delpech, L.; Leroux, F.; Tore Supra Team
2014-02-01
On many tokamaks (C-Mod, EAST, FTU, JET, HT-7, TS), a decrease in current drive efficiency of the Lower Hybrid (LH) waves is observed in high electron density plasmas. The cause of this behaviour is believed to be: Parametric Instabilities (PI) and Scattering from Density Fluctuations (SDF). For the ITER LH system, our knowledge must be improved to avoid such effects and to maintain the LH current drive efficiency at high density. The ITPA IOS group coordinates this effort [1] and all experimental data are essential to validate the numerical codes in progress. Usually the broadening of the LH wave frequency spectrum is measured by a probe located in the plasma edge. For this study, the frequency spectrum of a reflected power signal from the LH antenna was used. In addition, the spectrum measurements are compared with the density fluctuations observed on RF probes located at the antenna mouth. Several plasma currents (0.6 to 1.4 MA) and densities up to 5.2 × 1019 m-3 have been realised on Tore Supra (TS) long pulses and with high injected RF power, up to 5.4 MW-30s. This allowed using a spectrum analyser to make several measurements during the plasma pulse. The side lobe amplitude, shifted by 20-30MHz with respect to the main peak, grows with increasing density. Furthermore, for an increase of plasma current at the same density, the spectra broaden and become asymmetric. Some parametric dependencies are shown in this paper.
Wideband nonlinear spectral broadening in ultra-short ultra - silicon rich nitride waveguides.
Choi, Ju Won; Chen, George F R; Ng, D K T; Ooi, Kelvin J A; Tan, Dawn T H
2016-06-08
CMOS-compatible nonlinear optics platforms with high Kerr nonlinearity facilitate the generation of broadband spectra based on self-phase modulation. Our ultra - silicon rich nitride (USRN) platform is designed to have a large nonlinear refractive index and low nonlinear losses at 1.55 μm for the facilitation of wideband spectral broadening. We investigate the ultrafast spectral characteristics of USRN waveguides with 1-mm-length, which have high nonlinear parameters (γ ∼ 550 W(-1)/m) and anomalous dispersion at 1.55 μm wavelength of input light. USRN add-drop ring resonators broaden output spectra by a factor of 2 compared with the bandwidth of input fs laser with the highest quality factors of 11000 and 15000. Two - fold self phase modulation induced spectral broadening is observed using waveguides only 430 μm in length, whereas a quadrupling of the output bandwidth is observed with USRN waveguides with a 1-mm-length. A broadening factor of around 3 per 1 mm length is achieved in the USRN waveguides, a value which is comparatively larger than many other CMOS-compatible platforms.
Wideband nonlinear spectral broadening in ultra-short ultra - silicon rich nitride waveguides
Choi, Ju Won; Chen, George F. R.; Ng, D. K. T.; Ooi, Kelvin J. A.; Tan, Dawn T. H.
2016-01-01
CMOS-compatible nonlinear optics platforms with high Kerr nonlinearity facilitate the generation of broadband spectra based on self-phase modulation. Our ultra – silicon rich nitride (USRN) platform is designed to have a large nonlinear refractive index and low nonlinear losses at 1.55 μm for the facilitation of wideband spectral broadening. We investigate the ultrafast spectral characteristics of USRN waveguides with 1-mm-length, which have high nonlinear parameters (γ ∼ 550 W−1/m) and anomalous dispersion at 1.55 μm wavelength of input light. USRN add-drop ring resonators broaden output spectra by a factor of 2 compared with the bandwidth of input fs laser with the highest quality factors of 11000 and 15000. Two – fold self phase modulation induced spectral broadening is observed using waveguides only 430 μm in length, whereas a quadrupling of the output bandwidth is observed with USRN waveguides with a 1-mm-length. A broadening factor of around 3 per 1 mm length is achieved in the USRN waveguides, a value which is comparatively larger than many other CMOS-compatible platforms. PMID:27272558
Helium broadened propane absorption cross sections in the far-IR
NASA Astrophysics Data System (ADS)
Wong, A.; Billinghurst, B.; Bernath, P. F.
2017-09-01
Infrared absorption spectra for pure and He broadened propane have been recorded in the far-IR region (650-1300 cm-1) at the Canadian Light Source (CLS) facility using either the synchrotron or internal glowbar source depending on the required resolution. The measurements were made for 4 temperatures in the range 202-292 K and for 3 pressures of He broadening gas up to 100 Torr. Infrared absorption cross sections are derived from the spectra and the integrated cross sections are within 10 % of the corresponding values from the Pacific Northwest National Laboratory (PNNL) for all temperatures and pressures.
NASA Technical Reports Server (NTRS)
Smith, MaryAnn H.; Benner, D. Chris; Predoi-Cross, Adriana; Venkataraman, Malathy Devi
2009-01-01
Lorentz air-broadened half widths, pressure-induced shifts and their temperature dependences have been measured for over 430 transitions (allowed and forbidden) in the v4 band of (CH4)-12 over the temperature range 210 to 314 K. A multispectrum non linear least squares fitting technique was used to simultaneously fit a large number of high-resolution (0.006 to 0.01/cm) absorption spectra of pure methane and mixtures of methane diluted with dry air. Line mixing was detected for pairs of A-, E-, and F-species transitions in the P- and R-branch manifolds and quantified using the off-diagonal relaxation matrix elements formalism. The measured parameters are compared to air- and N2-broadened values reported in the literature for the v4 and other bands. The dependence of the various spectral line parameters upon the tetrahedral symmetry species and rotational quantum numbers of the transitions is discussed. All data used in the present work were recorded using the McMath-Pierce Fourier transform spectrometer located at the National Solar Observatory on Kitt Peak.
PULSE BROADENING MEASUREMENTS FROM THE GALACTIC CENTER PULSAR J1745-2900
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spitler, L. G.; Lee, K. J.; Eatough, R. P.
2014-01-01
We present temporal scattering measurements of single pulses and average profiles of PSR J1745-2900, a magnetar recently discovered only 3 arcsec away from Sagittarius A* (Sgr A*), from 1.2 to 18.95 GHz using the Effelsberg 100 m Radio Telescope, the Nançay Decimetric Radio Telescope, and the Jodrell Bank Lovell Telescope. Single pulse analysis shows that the integrated pulse profile above 2 GHz is dominated by pulse jitter, while below 2 GHz the pulse profile shape is dominated by scattering. This is the first object in the Galactic center (GC) with both pulse broadening and angular broadening measurements. We measure a pulse broadening time scale at 1 GHzmore » of τ{sub 1GHz} = 1.3 ± 0.2 and pulse broadening spectral index of α = –3.8 ± 0.2, which is several orders of magnitude lower than predicted by the NE2001 model (Cordes and Lazio 2002). If this scattering time scale is representative of the GC as a whole, then previous surveys should have detected many pulsars. The lack of detections implies either our understanding of scattering in the GC is incomplete or there are fewer pulsars in the GC than previously predicted. Given that magnetars are a rare class of radio pulsar, there are likely many canonical and millisecond pulsars in the GC, and not surprisingly, scattering in the GC is spatially complex.« less
Hydrogen sensor based on Sm-doped SnO{sub 2} nanostructures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Gurpreet; Hastir, Anita; Singh, Ravi Chand, E-mail: ravichand.singh@gmail.com
2016-05-23
In this paper the effect of samarium doping on the structural and hydrogen gas sensing properties of SnO{sub 2} nanoparticles has been reported. X-ray Diffraction (XRD) results revealed tetragonal rutile structure of both undoped and Sm-doped SnO{sub 2} nanoparticles. It has been observed that doping with samarium led to reduction in crystallite size of SnO{sub 2} nanoparticles which was confirmed from XRD analysis. Shifting and broadening of Raman peaks in case of doped nanoparticles has been explained by well-known phonon confinement model. The optimum operable temperature of both the sensors was found to 400 °C and the sensor response towardsmore » hydrogen gas has been improved after doping with samarium which was attributed to increase in sensing sites for the gas adsorption.« less
Broadening and Shifting of Atomic Strontium and Diatomic Bismuth Spectral Lines
2003-05-01
Upper Energy State, Ek kA q kA q jA jA Figure 2-4. Transition between the lower and upper energy states of an atom or molecule affected by quenching...broadened by both lifetime effects and quenching. This profile has a F HM given by Equation 2-16. W q q jA kA qq vNA (2-17) where N is the...December 1998 (AD-A361408)(9921302). 42. Predoi-Cross, Adriana , J. P. Bouanich, D. C. Benner, A. D. May, and J. R. Drummond. “Broadening, Shifting
Extraction of inhomogeneous broadening and nonradiative losses in InAs quantum-dot lasers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chow, Weng W.; Liu, Alan Y.; Gossard, Arthur C.
2015-10-28
We present a method to quantify inhomogeneous broadening and nonradiative losses in quantum dot lasers by comparing the gain and spontaneous emission results of a microscopic laser theory with measurements made on 1.3 μm InAs quantum-dot lasers. Calculated spontaneous-emission spectra are first matched to those measured experimentally to determine the inhomogeneous broadening in the experimental samples. This is possible because treatment of carrier scattering at the level of quantum kinetic equations provides the homogeneously broadened spectra without use of free parameters, such as the dephasing rate. Thus we then extract the nonradiative recombination current associated with the quantum-dot active regionmore » from a comparison of measured and calculated gain versus current relations.« less
Extraction of inhomogeneous broadening and nonradiative losses in InAs quantum-dot lasers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chow, Weng W., E-mail: wwchow@sandia.gov; Liu, Alan Y.; Gossard, Arthur C.
2015-10-26
We present a method to quantify inhomogeneous broadening and nonradiative losses in quantum dot lasers by comparing the gain and spontaneous emission results of a microscopic laser theory with measurements made on 1.3 μm InAs quantum-dot lasers. Calculated spontaneous-emission spectra are first matched to those measured experimentally to determine the inhomogeneous broadening in the experimental samples. This is possible because treatment of carrier scattering at the level of quantum kinetic equations provides the homogeneously broadened spectra without use of free parameters, such as the dephasing rate. We then extract the nonradiative recombination current associated with the quantum-dot active region from amore » comparison of measured and calculated gain versus current relations.« less
Windowed multipole for cross section Doppler broadening
NASA Astrophysics Data System (ADS)
Josey, C.; Ducru, P.; Forget, B.; Smith, K.
2016-02-01
This paper presents an in-depth analysis on the accuracy and performance of the windowed multipole Doppler broadening method. The basic theory behind cross section data is described, along with the basic multipole formalism followed by the approximations leading to windowed multipole method and the algorithm used to efficiently evaluate Doppler broadened cross sections. The method is tested by simulating the BEAVRS benchmark with a windowed multipole library composed of 70 nuclides. Accuracy of the method is demonstrated on a single assembly case where total neutron production rates and 238U capture rates compare within 0.1% to ACE format files at the same temperature. With regards to performance, clock cycle counts and cache misses were measured for single temperature ACE table lookup and for windowed multipole. The windowed multipole method was found to require 39.6% more clock cycles to evaluate, translating to a 7.9% performance loss overall. However, the algorithm has significantly better last-level cache performance, with 3 fewer misses per evaluation, or a 65% reduction in last-level misses. This is due to the small memory footprint of the windowed multipole method and better memory access pattern of the algorithm.
Extensional-wave stopband broadening across the joint of pipes of different thickness.
Su, Yuanda; Tang, Xiaoming; Liu, Yukai; Xu, Song; Zhuang, Chunxi
2015-11-01
The stopband of pipe extensional waves is an interesting natural phenomenon. This study demonstrates an important extension of this phenomenon. That is, the stopband can be effectively broadened by transmitting the waves across the joint of pipes of different thickness. The theoretical and experimental results reveal the detailed process of stopband forming along the pipe and the band broadening across the pipe joint. The result can be utilized to provide a method for logging while drilling acoustic isolation design.
[The application of Doppler broadening and Doppler shift to spectral analysis].
Xu, Wei; Fang, Zi-shen
2002-08-01
The distinction between Doppler broadening and Doppler shift has analyzed, Doppler broadening locally results from the distribution of velocities of the emitting particles, the line width gives the information on temperature of emitting particles. Doppler shift results when the emitting particles have a bulk non random flow velocity in a particular direction, the drift of central wavelength gives the information on flow velocity of emitting particles, and the Doppler shift only drifts the profile of line without changing the width. The difference between Gaussian fitting and the distribution of chord-integral line shape have also been discussed. The distribution of H alpha spectral line shape has been derived from the surface of limiter in HT-6M Tokamak with optical spectroscope multichannel analysis (OSMA), the result by double Gaussian fitting shows that the line shape make up of two port, the emitting of reflect particles with higher energy and the release particle from the limiter surface. Ion temperature and recycling particle flow velocity have been obtained from Doppler broadening and Doppler shift.
A Solar-flux Line-broadening Analysis
NASA Astrophysics Data System (ADS)
Gray, David F.
2018-04-01
The Fourier technique of extracting rotation rates and macroturbulence-velocity dispersions from the shapes and broadening of stellar spectral lines is applied to the solar-flux spectrum. Lines with equivalent widths less than ∼0.055 Å are shown to have the advantage over stronger lines by allowing the residual transform to be followed to higher frequencies. The standard radial-tangential macroturbulence formulation fits the observations well and yields an equatorial velocity that is within a few percent of the correct rate.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Shunli; Fu, Li; Gan, Wei
2016-01-21
In this report we show that the ability to measure the sub-1 cm -1 resolution phase-resolved and intensity high-resolution broadband sum frequency generation vibrational spectra (HR-BB-SFG-VS) of the –CN stretch vibration of the Langmuir-Blodgett (LB) monolayer of the 4-n-octyl-4’-cyanobiphenyl (8CB) on the z-cut α-quartz surface allows for the first time the direct comparison and understanding of the homogeneous and inhomogeneous broadenings in the imaginary and intensity SFG vibrational spectral lineshapes in detail. The difference of the full width at half maxima (FWHM) of the imaginary and intensity SFG-VS spectra of the same vibrational mode is the signature of the Voigtmore » lineshape and it measures the relative contribution to the overall lineshape from the homogeneous and inhomogeneous broadenings in SFG vibrational spectra. From the phase-resolved and intensity spectra, we found that the FWHM of the 2238.00 ±0.02 cm -1 peak in the phase-resolved imaginary and intensity spectra is 19.2 ± 0.2 cm -1 and 21.6 ± 0.4 cm -1, respectively, for the –CN group of the 8CB LB monolayer on the z-cut α-quartz crystal surface. The FWHM width difference of 2.4 cm -1 agrees quantitatively with a Voigt lineshape with a homogeneous broadening half width of Γ = 5.29 ± 0.08 cm -1 and a inhomogeneous standard derivation width Δω = 5.42 ± 0.07 cm -1. These results shed new lights on the understanding and interpretation of the lineshapes of both the phase-resolved and the intensity SFG vibrational spectra, as well as other incoherent and coherent spectroscopic techniques in general.« less
Chen, Shun-Li; Fu, Li; Gan, Wei; Wang, Hong-Fei
2016-01-21
In this report, we show that the ability to measure the sub-1 cm(-1) resolution phase-resolved and intensity high-resolution broadband sum frequency generation vibrational spectra of the -CN stretch vibration of the Langmuir-Blodgett (LB) monolayer of the 4-n-octyl-4'-cyanobiphenyl (8CB) on the z-cut α-quartz surface allows the direct comparison and understanding of the homogeneous and inhomogeneous broadenings in the imaginary and intensity SFG vibrational spectral line shapes in detail. The difference of the full width at half maximum (FWHM) of the imaginary and intensity sum-frequency generation vibrational spectroscopy spectra of the same vibrational mode is the signature of the Voigt line shape and it measures the relative contribution to the overall line shape from the homogeneous and inhomogeneous broadenings in SFG vibrational spectra. From the phase-resolved and intensity spectra, we found that the FWHM of the 2238.00 ± 0.02 cm(-1) peak in the phase-resolved imaginary and intensity spectra is 19.2 ± 0.2 cm(-1) and 21.6 ± 0.4 cm(-1), respectively, for the -CN group of the 8CB LB monolayer on the z-cut α-quartz crystal surface. The FWHM width difference of 2.4 cm(-1) agrees quantitatively with a Voigt line shape with a homogeneous broadening half width of Γ = 5.29 ± 0.08 cm(-1) and an inhomogeneous standard derivation width Δω = 5.42 ± 0.07 cm(-1). These results shed new lights on the understanding and interpretation of the line shapes of both the phase-resolved and the intensity SFG vibrational spectra, as well as other incoherent and coherent spectroscopic techniques in general.
LBQ2D, Extending the Line Broadened Quasilinear Model to TAE-EP Interaction
NASA Astrophysics Data System (ADS)
Ghantous, Katy; Gorelenkov, Nikolai; Berk, Herbert
2012-10-01
The line broadened quasilinear model was proposed and tested on the one dimensional electrostatic case of the bump on tailfootnotetextH.L Berk, B. Breizman and J. Fitzpatrick, Nucl. Fusion, 35:1661, 1995 to study the wave particle interaction. In conventional quasilinear theory, the sea of overlapping modes evolve with time as the particle distribution function self consistently undergo diffusion in phase space. The line broadened quasilinear model is an extension to the conventional theory in a way that allows treatment of isolated modes as well as overlapping modes by broadening the resonant line in phase space. This makes it possible to treat the evolution of modes self consistently from onset to saturation in either case. We describe here the model denoted by LBQ2D which is an extension of the proposed one dimensional line broadened quasilinear model to the case of TAEs interacting with energetic particles in two dimensional phase space, energy as well as canonical angular momentum. We study the saturation of isolated modes in various regimes and present the analytical derivation and numerical results. Finally, we present, using ITER parameters, the case where multiple modes overlap and describe the techniques used for the numerical treatment.
Ab Initio Computation of Dynamical Properties: Pressure Broadening
NASA Astrophysics Data System (ADS)
Wiesenfeld, Laurent; Drouin, Brian
2014-06-01
Rotational spectroscopy of polar molecules is the main observational tool in many areas of astrophysics, for gases of low densities (n ˜ 102 - 108 cm-3). Spectral line shapes in astrophysical media are largely dominated by turbulence-induced Doppler effects and natural line broadening are negligible. However line broadening remains an important tool for denser gases, like planetary high atmospheres. Understanding the excitation schemes of polar molecules requires the knowledge of excitation transfer rate due to collisional excitation, between the polar molecule and the ambient gas, usually H2. Transport properties in ionized media also require a precise knowledge of momentum transfer rates by elastic collisions. In order to assess the theoretically computed cross section and energy/momentum transfer rates, direct absolute experiments are scarce. The best way is to measure not individual scattering events but rather the global effect of the buffer gas, thanks to the pressure broadening cross sections, whose magnitude can be measured without any scaling parameters. At low temperatures, both elastic and inelastic scattering amplitudes are tested. At higher temperature, depending on the interaction strength, only inelastic scattering cross section are shown to play a significant role 1 ,2. Thanks to the advances of computer capabilities, it has become practical to compute spectral line parameters fromab initio quantum chemistry. In particular, the theory of rotational line broadening is readily incorporated into scattering quantum dynamical theory, like close-coupling schemes. The only approximations used in the computation are the isolated collision/isolated line approximations. We compute the non-binding interaction potential with high precision quantum chemistry and fit the resulting ab initio points onto a suitable functional. We have recently computed several such systems, for molecules in H2 buffer gas: H2O,3 H2CO,4 HCO+ .5 Detailed computations taking into
NASA Astrophysics Data System (ADS)
Zhang, Hao; Li, Wenxiu; Han, Peng; Chang, Xiaoyang; Liu, Jiaming; Lin, Jian; Xue, Xia; Zhu, Fang; Yang, Yang; Liu, Xiaojing; Zhang, Xiaofu; Huang, Anping; Xiao, Zhisong; Fang, Jiancheng
2018-01-01
Anomalous dispersion enhancement physical mechanism for Sagnac effect is described by special relativity derivation, and three kinds of definitions of minimum detectable angular rate of resonance optical gyroscope (ROG) are compared and the relations among them are investigated. The effect of linewidth broadening induced by anomalous dispersion on the sensitivity of ROG is discussed in this paper. Material dispersion-broadened resonance linewidth deteriorates the performance of a passive ROG and dispersion enhancement effect, while the sensitivity of a structural dispersion ROG is enhanced by two orders of magnitude even considering the dispersion-broadened resonance linewidth.
Origins of spectral broadening of incoherent waves: Catastrophic process of coherence degradation
NASA Astrophysics Data System (ADS)
Xu, G.; Garnier, J.; Rumpf, B.; Fusaro, A.; Suret, P.; Randoux, S.; Kudlinski, A.; Millot, G.; Picozzi, A.
2017-08-01
We revisit the mechanisms underlying the process of spectral broadening of incoherent optical waves propagating in nonlinear media on the basis of nonequilibrium thermodynamic considerations. A simple analysis reveals that a prerequisite for the existence of a significant spectral broadening of the waves is that the linear part of the energy (Hamiltonian) has different contributions of opposite signs. It turns out that, at variance with the expected soliton turbulence scenario, an increase of the amount of disorder (incoherence) in the system does not require the generation of a coherent soliton structure. We illustrate the idea by considering the propagation of two wave components in an optical fiber with opposite dispersion coefficients. A wave turbulence approach to the problem reveals that the increase of kinetic energy in one component is offset by the negative reduction in the other component, so that the waves exhibit, as a general rule, virtually unlimited spectral broadening. More precisely, a self-similar solution of the kinetic equations reveals that the spectra of the incoherent waves tend to relax toward a homogeneous distribution in the wake of a front that propagates in frequency space with a decelerating velocity. We discuss this catastrophic process of spectral broadening in the light of different important phenomena, in particular supercontinuum generation, soliton turbulence, wave condensation, and the runaway motion of mechanical systems composed of positive and negative masses.
Importance of Doppler broadening in Compton scatter imaging techniques
NASA Astrophysics Data System (ADS)
Rao, Donepudi V.; Takeda, Tohoru; Itai, Yuji; Seltzer, S. M.; Hubbell, John H.; Zeniya, Tsutomu; Akatsuka, Takao; Cesareo, Roberto; Brunetti, Antonio; Gigante, Giovanni E.
2001-12-01
Compton scattering is a potential tool for the determination of bone mineral content or tissue density for dose planning purposes, and requires knowledge of the energy distribution of the X-rays through biological materials of medical interest in the X-ray and (gamma) -ray region. The energy distribution is utilized in a number of ways in diagnostic radiology, for example, in determining primary photon spectra, electron densities in separate volumes, and in tomography and imaging. The choice of the X-ray energy is more related to X-ray absorption, where as that of the scattering angle is more related to geometry. The evaluation of all the contributions are mandatory in Compton profile measurements and is important in X-ray imaging systems in order to achieve good results. In view of this, Compton profile cross-sections for few biological materials are estimated at nineteen K(alpha) X-ray energies and 60 keV (Am-241) photons. Energy broadening, geometrical broadening from 1 to 180 degree(s), FWHM of J(Pz) and FWHM of Compton energy broadening has been evaluated at various incident photon energies. These values are estimated around the centroid of the Compton profile with an energy interval of 0.1 keV and 1.0 keV for 60 keV photons. The interaction cross sections for the above materials are estimated using fractions-by-weight of the constituent elements. Input data for these tables are purely theoretical.
NASA Astrophysics Data System (ADS)
Devi, M.; Predoi-Cross, A.; McKellar, R.; Benner, C.; Miller, C. E.; Toth, R. A.; Brown, L. R.
2008-12-01
Nearly 40 high resolution spectra of air-broadened CO2 recorded at temperatures between 215 and 294 K were analyzed using a multispectrum nonlinear least squares technique to determine temperature dependences of air-broadened half width and air-induced pressure shift coefficients in the 30013-00001 and 30012-00001 bands of 12CO2. Data were recorded with two different Fourier transform spectrometers (Kitt Peak FTS at the National Solar Observatory in Arizona and the Bomem FTS at NRC, Ottawa) with optical path lengths ranging between 25 m and 121 m. The sample pressures varied between 11 torr (pure CO2) and 924 torr (CO2-air) with volume mixing ratios of CO2 in air between ~ 0.015 and 0.11. To minimize systematic errors and increase the accuracy of the retrieved parameters, we constrained the multispectrum nonlinear least squares fittings to use quantum mechanical expressions for the rovibrational energies and intensities rather than retrieving the individual positions and intensities line-by-line. The results suggest minimal vibrational dependence for the temperature dependence coefficients.1 1 A. Predoi-Cross and R. Mckellar are grateful for financial support from the National Sciences and Engineering Research Council of Canada. The research at the Jet Propulsion laboratory (JPL), California Institute of Technology, was performed under contract with National Aeronautics and Space Administration. The support received from the National Science Foundation under Grant No. ATM-0338475 to the College of William and Mary is greatly appreciated. The authors thank Mike Dulick of the National Solar Observatory for his assistance in obtaining the data recorded at Kitt Peak.
Study the oxidation kinetics of uranium using XRD and Rietveld method
NASA Astrophysics Data System (ADS)
Zhang, Yanzhi; Guan, Weijun; Wang, Qinguo; Wang, Xiaolin; Lai, Xinchun; Shuai, Maobing
2010-03-01
The surface oxidation of uranium metal has been studied by X-ray diffraction (XRD) and Rietveld method in the range of 50~300°C in air. The oxidation processes are analyzed by XRD to determine the extent of surface oxidation and the oxide structure. The dynamics expression for the formation of UO2 was derived. At the beginning, the dynamic expression was nonlinear, but switched to linear subsequently for uranium in air and humid oxygen. That is, the growth kinetics of UO2 can be divided into two stages: nonlinear portion and linear portion. Using the kinetic data of linear portion, the activation energy of reaction between uranium and air was calculated about 46.0 kJ/mol. However the content of oxide as a function of time was linear in humid helium ambience. Contrast the dynamics results, it prove that the absence of oxygen would accelerate the corrosion rate of uranium in the humid gas. We can find that the XRD and Rietveld method are a useful convenient method to estimate the kinetics and thermodynamics of solid-gas reaction.
Habibi, Mohammad Hossein; Mardani, Maryam
2015-02-25
Binary zinc tin oxide nano-composite was synthesized by a facile sol-gel method using simple precursors from the solutions consisting of zinc acetate, tin(IV) chloride and ethanol. Effect of annealing temperature on optical and structural properties was investigated using X-ray diffraction (XRD), diffuse reflectance spectra (DRS), field emission scanning electron microscopy (FESEM) and Fourier transform infrared spectroscopy (FTIR). XRD results revealed the existence of the ZnO and SnO2 phases. FESEM results showed that binary zinc tin oxide nano-composites ranges from 56 to 60 nm in diameter at 400°C and 500°C annealing temperatures respectively. The optical band gap was increased from 2.72 eV to 3.11 eV with the increasing of the annealing temperature. FTIR results confirmed the presence of zinc oxide and tin oxide and the broad absorption peaks at 3426 and 1602 cm(-1) can be ascribed to the vibration of absorptive water, and the absorption peaks at 546, 1038 and 1410 cm(-1) are due to the vibration of Zn-O or Sn-O groups in binary zinc tin oxide. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Blass, W. E.; Halsey, G. W.; Jennings, D. E.
1987-01-01
Self- and foreign-gas broadening of ethane lines have been measured in the nu9 band at 12 microns. A coefficient of 0.125 per cm atm was determined for self broadening. Foreign-gas broadening coefficients determined are (in per cm atm) 0.090 for N2, 0.069 for He, 0.068 for Ar, 0.108 for H2, and 0.096 for CH4. Results are given for a sample temperature of 296 K.
Structure and morphology evolution of silica-modified pseudoboehmite aerogels during heat treatment
NASA Astrophysics Data System (ADS)
Pakharukova, V. P.; Shalygin, A. S.; Gerasimov, E. Yu.; Tsybulya, S. V.; Martyanov, O. N.
2016-01-01
Silica-modified pseudoboehmite aerogels (0, 10, 20 at% of Si) were prepared by sol-gel method followed by supercritical drying. The phase transformations, changes in structure and morphology upon calcination were thoroughly investigated by advanced X-Ray diffraction (XRD) techniques and high-resolution transmission electron microscopy (HRTEM). Obtained pseudoboehmite samples had specific nanostructure: ultrathin two-dimensional (2D) crystallites were loosely packed. The silica dopant drastically enhanced the crystallite anisotropy. Thus, the aerogel with Al:Si atomic ratio of 9:1 consisted of the pseudoboehmite nanosheets with thickness of one unit cell (average dimensions of 14.0×1.2×14.5 nm). The specific nanostructure caused remarkable features of experimental XRD patterns, including anisotropic peak broadening and appearance of forbidden reflection. Direct simulation of XRD patterns with using the Debye Scattering Equation allowed the size and morphology of pseudoboehmite crystallites to be determined. The silica addition strongly delayed formation of γ-alumina and further phase transformations upon calcinaton. Thermal stability of alumina was suggested to be affected by the particle morphology inherited from the pseudoboehmite precursor.
Ultrafast visualization of crystallization and grain growth in shock-compressed SiO 2
Gleason, A. E.; Bolme, C. A.; Lee, H. J.; ...
2015-09-04
Pressure- and temperature-induced phase transitions have been studied for more than a century but very little is known about the non-equilibrium processes by which the atoms rearrange. Shock compression generates a nearly instantaneous propagating high-pressure/temperature condition while in situ X-ray diffraction (XRD) probes the time-dependent atomic arrangement. Here we present in situ pump–probe XRD measurements on shock-compressed fused silica, revealing an amorphous to crystalline high-pressure stishovite phase transition. Using the size broadening of the diffraction peaks, the growth of nanocrystalline stishovite grains is resolved on the nanosecond timescale just after shock compression. At applied pressures above 18 GPa the nuclueationmore » of stishovite appears to be kinetically limited to 1.4 ± 0.4 ns. The functional form of this grain growth suggests homogeneous nucleation and attachment as the growth mechanism. As a result, these are the first observations of crystalline grain growth in the shock front between low- and high-pressure states via XRD.« less
NASA Technical Reports Server (NTRS)
Lundqvist, S.; Margolis, J.; Reid, J.
1982-01-01
Foreign-gas broadening coefficients have been measured for selected lines of ozone in the 9.2 micron region and for several R-branch lines of nitric oxide in the 5.4 micron region using a computerized tunable diode laser spectrometer. The data analysis showed the importance of fitting a Lorentzian line shape out to several times the halfwidth to obtain a correct value of the broadening coefficient. The measured broadening coefficients of nitric oxide were in good agreement with those obtained by Abels and Shaw (1966). The results of the analysis of eleven lines in the v-1 band and five lines in the v-3 band of ozone show a transition-dependent broadening coefficient. The average value of the foreign-gas broadening ceofficients for the measured v-1 and v-3 lines are 0.075 and 0.073 per cm per atm, respectively.
Broadening of divertor heat flux profile with increasing number of ELM filaments in NSTX
Ahn, J. -W.; Maingi, R.; Canik, J. M.; ...
2014-11-13
Edge localized modes (ELMs) represent a challenge to future fusion devices, owing to cyclical high peak heat fluxes on divertor plasma facing surfaces. One ameliorating factor has been that the heat flux characteristic profile width has been observed to broaden with the size of the ELM, as compared with the inter-ELM heat flux profile. In contrast, the heat flux profile has been observed to narrow during ELMs under certain conditions in NSTX. Here we show that the ELM heat flux profile width increases with the number of filamentary striations observed, i.e., profile narrowing is observed with zero or very fewmore » striations. Because NSTX often lies on the long wavelength current-driven mode side of ideal MHD instabilities, few filamentary structures can be expected under many conditions. Lastly, ITER is also projected to lie on the current driven low-n stability boundary, and therefore detailed projections of the unstable modes expected in ITER and the heat flux driven in ensuing filamentary structures is needed.« less
NASA Astrophysics Data System (ADS)
Senthil Kumar, R.; Rajkumar, P.
2014-11-01
The abstract of this paper explains the presence of minerals in air which causes great concern regarding public health issues. The spectroscopic investigation of air dust particles of several samples in various locations in the state of Tamilnadu, India is reported. Qualitative analyses were carried out to determine the major and minor constituent minerals present in the samples based on the FTIR, XRD absorption peaks. This study also identified the minerals like quartz, asbestos, kaolinite, calcite, hematite, montmorillonite, nacrite and several other trace minerals in the air dust particles. The presents of quartz is mainly found in all the samples invariably. Hence the percentage of quartz and its crystalline nature were determined with the help of extinction co-efficient and crystallinity index respectively. The shape and size of the particulates are studied with SEM analysis.
NASA Technical Reports Server (NTRS)
Prok, G. M.; Seng, G. T.
1980-01-01
Characterization data and a hydrocarbon compositional analysis are presented for a research test fuel designated as an experimental referee broadened-specification aviation turbine fuel. This research fuel, which is a special blend of kerosene and hydrotreated catalytic gas oil, is a hypothetical representation of a future fuel should it become necessary to broaden current kerojet specifications. It is used as a reference fuel in research investigations into the effects of fuel property variations on the performance and durability of jet aircraft components, including combustors and fuel systems.
The Frequency Evolution of Interstellar Pulse Broadening from Radio Pulsars
NASA Astrophysics Data System (ADS)
Löhmer, O.; Mitra, D.; Gupta, Y.; Kramer, M.; Ahuja, A.
2004-10-01
Using radio pulsars as probes of the interstellar medium (ISM) we study the frequency evolution of interstellar scattering. The frequency dependence of scatter broadening times, τsc, for most of the pulsars with low and intermediate dispersion measures (DM ≲ 400 pc cm-3) is consistent with the Kolmogorov spectrum of electron density fluctuations in a turbulent medium. In contrast, the measured τsc's for highly dispersed pulsars in the central region of the Galaxy are larger than expected and show a spectrum which is flatter than the Kolmogorov law. We analyse the first measurements of spectral indices of scatter broadening over the full known DM range and discuss possible explanations for the anomalous scattering behaviour along peculiar lines of sight (LOS).
ERIC Educational Resources Information Center
Metcalf, Heather
2016-01-01
This research methods Essay details the usefulness of critical theoretical frameworks and critical mixed-methodological approaches for life sciences education research on broadening participation in the life sciences. First, I draw on multidisciplinary research to discuss critical theory and methodologies. Then, I demonstrate the benefits of these…
Ghost features in Doppler-broadened spectra of rovibrational transitions in trapped HD+ ions
NASA Astrophysics Data System (ADS)
Patra, Sayan; Koelemeij, J. C. J.
2017-02-01
Doppler broadening plays an important role in laser rovibrational spectroscopy of trapped deuterated molecular hydrogen ions (HD+), even at the millikelvin temperatures achieved through sympathetic cooling by laser-cooled beryllium ions. Recently, Biesheuvel et al. (2016) presented a theoretical lineshape model for such transitions which not only considers linestrengths and Doppler broadening, but also the finite sample size and population redistribution by blackbody radiation, which are important in view of the long storage and probe times achievable in ion traps. Here, we employ the rate equation model developed by Biesheuvel et al. to theoretically study the Doppler-broadened hyperfine structure of the (v, L) : (0, 3) → (4, 2) rovibrational transition in HD+ at 1442 nm. We observe prominent yet hitherto unrecognized ghost features in the simulated spectrum, whose positions depend on the Doppler width, transition rates, and saturation levels of the hyperfine components addressed by the laser. We explain the origin and behavior of such features, and we provide a simple quantitative guideline to assess whether ghost features may appear. As such ghost features may be common to saturated Doppler-broadened spectra of rotational and vibrational transitions in trapped ions composed of partly overlapping lines, our work illustrates the necessity to use lineshape models that take into account all the relevant physics.
Deconvolving instrumental and intrinsic broadening in core-shell x-ray spectroscopies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fister, T. T.; Seidler, G. T.; Rehr, J. J.
2007-05-01
Intrinsic and experimental mechanisms frequently lead to broadening of spectral features in core-shell spectroscopies. For example, intrinsic broadening occurs in x-ray absorption spectroscopy (XAS) measurements of heavy elements where the core-hole lifetime is very short. On the other hand, nonresonant x-ray Raman scattering (XRS) and other energy loss measurements are more limited by instrumental resolution. Here, we demonstrate that the Richardson-Lucy (RL) iterative algorithm provides a robust method for deconvolving instrumental and intrinsic resolutions from typical XAS and XRS data. For the K-edge XAS of Ag, we find nearly complete removal of {approx}9.3 eV full width at half maximum broadeningmore » from the combined effects of the short core-hole lifetime and instrumental resolution. We are also able to remove nearly all instrumental broadening in an XRS measurement of diamond, with the resulting improved spectrum comparing favorably with prior soft x-ray XAS measurements. We present a practical methodology for implementing the RL algorithm in these problems, emphasizing the importance of testing for stability of the deconvolution process against noise amplification, perturbations in the initial spectra, and uncertainties in the core-hole lifetime.« less
[A peak recognition algorithm designed for chromatographic peaks of transformer oil].
Ou, Linjun; Cao, Jian
2014-09-01
In the field of the chromatographic peak identification of the transformer oil, the traditional first-order derivative requires slope threshold to achieve peak identification. In terms of its shortcomings of low automation and easy distortion, the first-order derivative method was improved by applying the moving average iterative method and the normalized analysis techniques to identify the peaks. Accurate identification of the chromatographic peaks was realized through using multiple iterations of the moving average of signal curves and square wave curves to determine the optimal value of the normalized peak identification parameters, combined with the absolute peak retention times and peak window. The experimental results show that this algorithm can accurately identify the peaks and is not sensitive to the noise, the chromatographic peak width or the peak shape changes. It has strong adaptability to meet the on-site requirements of online monitoring devices of dissolved gases in transformer oil.
[Study of the phase transformation of TiO2 with in-situ XRD in different gas].
Ma, Li-Jing; Guo, Lie-Jin
2011-04-01
TiO2 sample was prepared by sol-gel method from chloride titanium. The phase transformation of the prepared TiO2 sample was studied by in-situ XRD and normal XRD in different gas. The experimental results showed that the phase transformation temperatures of TiO2 were different under in-situ or normal XRD in different kinds of gas. The transformation of amorphous TiO2 to anatase was controlled by kinetics before 500 degrees C. In-situ XRD showed that the growth of anatase was inhibited, but the transformation of anatase to rutile was accelerated under inactive nitrogen in contrast to air. Also better crystal was obtained under hydrogen than in argon. These all showed that external oxygen might accelerate the growth of TiO2, but reduced gas might partly counteract the negative influence of lack of external oxygen. The mechanism of phase transformation of TiO2 was studied by in-situ XRD in order to control the structure in situ.
NASA Technical Reports Server (NTRS)
Rampe, Elizabeth B.; Morris, Richard V.; Chipera, Steve; Bish, David L.; Bristow, Thomas; Archer, Paul Douglas; Blake, David; Achilles, Cherie; Ming, Douglas W.; Vaniman, David;
2013-01-01
The Curiosity Rover landed on the Peace Vallis alluvial fan in Gale crater on August 5, 2012. A primary mission science objective is to search for past habitable environments, and, in particular, to assess the role of past water. Identifying the minerals and mineraloids that result from aqueous alteration at Gale crater is essential for understanding past aqueous processes at the MSL landing site and hence for interpreting the site's potential habitability. X-ray diffraction (XRD) data from the CheMin instrument and evolved gas analyses (EGA) from the SAM instrument have helped the MSL science team identify phases that resulted from aqueous processes: phyllosilicates and amorphous phases were measure in two drill samples (John Klein and Cumberland) obtained from the Sheepbed Member, Yellowknife Bay Fm., which is believed to represent a fluvial-lacustrine environment. A third set of analyses was obtained from scoop samples from the Rocknest sand shadow. Chemical data from the APXS instrument have helped constrain the chemical compositions of these secondary phases and suggest that the phyllosilicate component is Mg-enriched and the amorphous component is Fe-enriched, relatively Si-poor, and S- and H-bearing. To refine the phyllosilicate and amorphous components in the samples measured by MSL, we measured XRD and EGA data for a variety of relevant natural terrestrial phyllosilicates and synthetic mineraloids in laboratory testbeds of the CheMin and SAM instruments. Specifically, Mg-saturated smectites and vermiculites were measured with XRD at low relative humidity to understand the behavior of the 001 reflections under Mars-like conditions. Our laboratory XRD measurements suggest that interlayer cation composition affects the hydration state of swelling clays at low RH and, thus, the 001 peak positions. XRD patterns of synthetic amorphous materials, including allophane, ferrihydrite, and hisingerite were used in full-pattern fitting (FULLPAT) models to help
Vanlessen, Naomi; De Raedt, Rudi; Koster, Ernst H W; Pourtois, Gilles
2016-09-01
Positive mood contributes to mental and physical wellbeing. The broaden-and-build theory (Fredrickson, 2001) proposed that the beneficial effects of positive mood on life quality result from attentional broadening. In this article, we systematically review (following PRISMA guidelines; Moher et al., 2009), a host of studies investigating the nature and extent of attentional changes triggered by the experience of positive mood, with a focus on vision. While several studies reported a broadening of attention, others found that positive mood led to a more diffuse information processing style. Positive mood appears to lessen attention selectivity in a way that is context-specific and bound to limitations. We propose a new framework in which we postulate that positive mood impacts the balance between internally and externally directed attention, through modulations of cognitive control processes, instead of broadening attention per se. This novel model is able to accommodate discrepant findings, seeks to translate the phenomenon of the so-called broadening of attention with positive mood into functional terms, and provides plausible neurobiological mechanisms underlying this effect, suggesting a crucial role of the anterior and posterior cingulate cortex in this interaction. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhavoronkov, N.; Driben, R.; Bregadiolli, B. A.; Nalin, M.; Malomed, B. A.
2011-05-01
We demonstrate experimentally and support by a theoretical analysis an effect of asymmetric spectrum broadening, which results from doping of silver nanoparticles into a heavy-glass matrix, 90(0.5WO3-0.3SbPO4-0.2PbO)-10AgCl. The strong dispersion of the effective nonlinear coefficient of the composite significantly influences the spectral broadening via the self-phase modulation, and leads to a blue upshift of the spectrum. Further extension of the spectrum towards shorter wavelengths is suppressed by a growing loss caused by the plasmon resonance in the silver particles. The red-edge spectral broadening is dominated by the stimulated Raman scattering.
Positive emotions and the social broadening effects of Barack Obama.
Ong, Anthony D; Burrow, Anthony L; Fuller-Rowell, Thomas E
2012-10-01
Past experiments have demonstrated that the cognitive broadening produced by positive emotions may extend to social contexts. Building on this evidence, we hypothesized that positive emotions triggered by thinking about Barack Obama may broaden and expand people's sense of self to include others. Results from an expressive-writing study demonstrated that African American college students prompted to write about Obama immediately prior to and after the 2008 presidential election used more plural self-references, fewer other-references, and more social references. Mediation analyses revealed that writing about Obama increased positive emotions, which in turn increased the likelihood that people thought in terms of more-inclusive superordinate categories (we and us rather than they and them). Implications of these findings for the role of positive emotions in perspective-taking and intergroup relations are considered.
Fundamental edge broadening effects during focused electron beam induced nanosynthesis
Schmied, Roland; Fowlkes, Jason Davidson; Winkler, Robert; ...
2015-02-16
In this study, we explore lateral broadening effects of 3D structures fabricated through focused electron beam induced deposition using MeCpPt(IV)Me 3 precursor. In particular, the scaling behavior of proximity effects as a function of the primary electron energy and the deposit height is investigated through experiments and validated through simulations. Correlated Kelvin force microscopy and conductive atomic force microscopy measurements identified conductive and non-conductive proximity regions. It was determined that the highest primary electron energies enable the highest edge sharpness while lower energies contain a complex convolution of broadening effects. In addition, it is demonstrated that intermediate energies lead tomore » even more complex proximity effects that significantly reduce lateral edge sharpness and thus should be avoided if desiring high lateral resolution.« less
NASA Technical Reports Server (NTRS)
Mertens, Christopher J.; Moyers, Michael F.; Walker, Steven A.; Tweed, John
2010-01-01
Recent developments in NASA s deterministic High charge (Z) and Energy TRaNsport (HZETRN) code have included lateral broadening of primary ion beams due to small-angle multiple Coulomb scattering, and coupling of the ion-nuclear scattering interactions with energy loss and straggling. This new version of HZETRN is based on Green function methods, called GRNTRN, and is suitable for modeling transport with both space environment and laboratory boundary conditions. Multiple scattering processes are a necessary extension to GRNTRN in order to accurately model ion beam experiments, to simulate the physical and biological-effective radiation dose, and to develop new methods and strategies for light ion radiation therapy. In this paper we compare GRNTRN simulations of proton lateral broadening distributions with beam measurements taken at Loma Linda University Proton Therapy Facility. The simulated and measured lateral broadening distributions are compared for a 250 MeV proton beam on aluminum, polyethylene, polystyrene, bone substitute, iron, and lead target materials. The GRNTRN results are also compared to simulations from the Monte Carlo MCNPX code for the same projectile-target combinations described above.
Attention and positive affect: temporal switching or spatial broadening?
Phaf, R Hans
2015-04-01
Evolutionary reasoning and computation suggest that positive affect is associated with higher attentional flexibility than negative affect, even when affectively neutral material is processed. The affective modulation of interference in the Eriksen flanker task seems, however, more readily explained by a spatial broadening of attention due to positive affect. It is argued here that these results should also be interpreted in terms of an increased switching over time between flankers and target (i.e., flexibility). The two hypotheses were contrasted with positive and negative mood inductions in a masked-flanker task. The interval (Stimulus Onset Asynchrony; SOA) with which the masked flankers preceded the target letter was parametrically varied. In contrast to what is found with simultaneous non-masked flanker presentation, masking produced larger interference with negative than with positive moods. In addition, a crossover interaction between mood and SOA emerged. These results seem incompatible with a spatial broadening account and support an affective modulation account in terms of flexibility.
Li, Cen; Yang, Hongxia; Xiao, Yuancan; Zhandui; Sanglao; Wang, Zhang; Ladan, Duojie; Bi, Hongtao
2016-01-01
Zuotai (gTso thal) is one of the famous drugs containing mercury in Tibetan medicine. However, little is known about the chemical substance basis of its pharmacodynamics and the intrinsic link of different samples sources so far. Given this, energy dispersive spectrometry of X-ray (EDX), scanning electron microscopy (SEM), atomic force microscopy (AFM), and powder X-ray diffraction (XRD) were used to assay the elements, micromorphology, and phase composition of nine Zuotai samples from different regions, respectively; the XRD fingerprint features of Zuotai were analyzed by multivariate statistical analysis. EDX result shows that Zuotai contains Hg, S, O, Fe, Al, Cu, and other elements. SEM and AFM observations suggest that Zuotai is a kind of ancient nanodrug. Its particles are mainly in the range of 100–800 nm, which commonly further aggregate into 1–30 μm loosely amorphous particles. XRD test shows that β-HgS, S8, and α-HgS are its main phase compositions. XRD fingerprint analysis indicates that the similarity degrees of nine samples are very high, and the results of multivariate statistical analysis are broadly consistent with sample sources. The present research has revealed the physicochemical characteristics of Zuotai, and it would play a positive role in interpreting this mysterious Tibetan drug. PMID:27738409
Li, Cen; Yang, Hongxia; Du, Yuzhi; Xiao, Yuancan; Zhandui; Sanglao; Wang, Zhang; Ladan, Duojie; Bi, Hongtao; Wei, Lixin
2016-01-01
Zuotai ( gTso thal ) is one of the famous drugs containing mercury in Tibetan medicine. However, little is known about the chemical substance basis of its pharmacodynamics and the intrinsic link of different samples sources so far. Given this, energy dispersive spectrometry of X-ray (EDX), scanning electron microscopy (SEM), atomic force microscopy (AFM), and powder X-ray diffraction (XRD) were used to assay the elements, micromorphology, and phase composition of nine Zuotai samples from different regions, respectively; the XRD fingerprint features of Zuotai were analyzed by multivariate statistical analysis. EDX result shows that Zuotai contains Hg, S, O, Fe, Al, Cu, and other elements. SEM and AFM observations suggest that Zuotai is a kind of ancient nanodrug. Its particles are mainly in the range of 100-800 nm, which commonly further aggregate into 1-30 μ m loosely amorphous particles. XRD test shows that β -HgS, S 8 , and α -HgS are its main phase compositions. XRD fingerprint analysis indicates that the similarity degrees of nine samples are very high, and the results of multivariate statistical analysis are broadly consistent with sample sources. The present research has revealed the physicochemical characteristics of Zuotai , and it would play a positive role in interpreting this mysterious Tibetan drug.
Nitrogen-broadened lines of ethane at 150 K
NASA Technical Reports Server (NTRS)
Chudamani, S.; Varanasi, P.; Giver, L. P.; Valero, F. P. J.
1985-01-01
Spectral transmittance has been measured in the nu9 fundamental band of C2H6 at 150 K using a Fourier transform spectrometer with apodized spectral resolution of 0.06/cm. Comparison of observed spectral transmittance with a line-by-line computation using the spectral catalog of Atakan et al. (1983) has yielded N2-broadened half-widths at 150 K.
Phenomenological plasmon broadening and relation to the dispersion
NASA Astrophysics Data System (ADS)
Hobbiger, Raphael; Drachta, Jürgen T.; Kreil, Dominik; Böhm, Helga M.
2017-02-01
Pragmatic ways of including lifetime broadening of collective modes in the electron liquid are critically compared. Special focus lies on the impact of the damping parameter onto the dispersion. It is quantitatively exemplified for the two-dimensional case, for both, the charge ('sheet'-)plasmon and the spin-density plasmon. The predicted deviations fall within the resolution limits of advanced techniques.
The Effects of Career Broadening on Leadership Development
2007-03-01
development of its officer corps. Specifically, the study sought to find significant relationships between incidents of career broadening in the...Introduction Introduction In organizations where change is necessary, which is most organizations today, strong leadership relationships are required (Yukl...Holton, 2004; Mumford, Marks et al., 2000; Campion et. al., 1994; McCauley et. al., 1994). The relationship between personality and leadership is
Broadening and Simplifying the First SETI Protocol
NASA Astrophysics Data System (ADS)
Michaud, M. A. G.
The Declaration of Principles Concerning Activities Following the Detection of Extraterrestrial Intelligence, known informally as the First SETI Protocol, is the primary existing international guidance on this subject. During the fifteen years since the document was issued, several people have suggested revisions or additional protocols. This article proposes a broadened and simplified text that would apply to the detection of alien technology in our solar system as well as to electromagnetic signals from more remote sources.
PeakRanger: A cloud-enabled peak caller for ChIP-seq data
2011-01-01
Background Chromatin immunoprecipitation (ChIP), coupled with massively parallel short-read sequencing (seq) is used to probe chromatin dynamics. Although there are many algorithms to call peaks from ChIP-seq datasets, most are tuned either to handle punctate sites, such as transcriptional factor binding sites, or broad regions, such as histone modification marks; few can do both. Other algorithms are limited in their configurability, performance on large data sets, and ability to distinguish closely-spaced peaks. Results In this paper, we introduce PeakRanger, a peak caller software package that works equally well on punctate and broad sites, can resolve closely-spaced peaks, has excellent performance, and is easily customized. In addition, PeakRanger can be run in a parallel cloud computing environment to obtain extremely high performance on very large data sets. We present a series of benchmarks to evaluate PeakRanger against 10 other peak callers, and demonstrate the performance of PeakRanger on both real and synthetic data sets. We also present real world usages of PeakRanger, including peak-calling in the modENCODE project. Conclusions Compared to other peak callers tested, PeakRanger offers improved resolution in distinguishing extremely closely-spaced peaks. PeakRanger has above-average spatial accuracy in terms of identifying the precise location of binding events. PeakRanger also has excellent sensitivity and specificity in all benchmarks evaluated. In addition, PeakRanger offers significant improvements in run time when running on a single processor system, and very marked improvements when allowed to take advantage of the MapReduce parallel environment offered by a cloud computing resource. PeakRanger can be downloaded at the official site of modENCODE project: http://www.modencode.org/software/ranger/ PMID:21554709
He, Changfei; Shi, Shaowei; Wu, Xuefei; Russell, Thomas P; Wang, Dong
2018-06-06
The interfacial broadening between two different epoxy networks having different moduli was nanomechanically mapped. The interfacial broadening of the two networks produced an interfacial zone having a gradient in the concentration and, hence, properties of the original two networks. This interfacial broadening of the networks leads to the generation of a new network with a segmental composition corresponding to a mixture of the original two network segments. The intermixing of the two, by nature of the exchange reactions, was on the segmental level. By mapping the time dependence of the variation in the modulus at different temperatures, the kinetics of the exchange reaction was measured and, by varying the temperature, the activation energy of the exchange reaction was determined.
Positive mood broadens visual attention to positive stimuli.
Wadlinger, Heather A; Isaacowitz, Derek M
2006-03-01
In an attempt to investigate the impact of positive emotions on visual attention within the context of Fredrickson's (1998) broaden-and-build model, eye tracking was used in two studies to measure visual attentional preferences of college students (n=58, n=26) to emotional pictures. Half of each sample experienced induced positive mood immediately before viewing slides of three similarly-valenced images, in varying central-peripheral arrays. Attentional breadth was determined by measuring the percentage viewing time to peripheral images as well as by the number of visual saccades participants made per slide. Consistent with Fredrickson's theory, the first study showed that individuals induced into positive mood fixated more on peripheral stimuli than did control participants; however, this only held true for highly-valenced positive stimuli. Participants under induced positive mood also made more frequent saccades for slides of neutral and positive valence. A second study showed that these effects were not simply due to differences in emotional arousal between stimuli. Selective attentional broadening to positive stimuli may act both to facilitate later building of resources as well as to maintain current positive affective states.
ERIC Educational Resources Information Center
Fredrickson, Barbara L.
2001-01-01
Describes the broaden-and-build theory of positive emotions, situating it within the field of positive psychology. The theory posits that experiences of positive emotions broaden people's momentary thought-action repertoires, which in turn build their enduring personal resources (physical, intellectual, social, and psychological). Reviews…
Momentum broadening in unstable quark-gluon plasma
Carrington, M. E.; Mrówczyński, St.; Schenke, B.
2017-02-01
We present that quark-gluon plasma produced at the early stage of ultrarelativistic heavy-ion collisions is unstable, if weakly coupled, due to the anisotropy of its momentum distribution. Chromomagnetic fields are spontaneously generated and can reach magnitudes much exceeding typical values of the fields in equilibrated plasma. We consider a high-energy test parton traversing an unstable plasma that is populated with strong fields. We study the momentum broadening parametermore » $$ˆ\\atop{q}$$ which determines the radiative energy loss of the test parton. We develop a formalism which gives $$ˆ\\atop{q}$$ as the solution of an initial value problem, and we focus on extremely oblate plasmas which are physically relevant for relativistic heavy-ion collisions. The parameter $$ˆ\\atop{q}$$ is found to be strongly dependent on time. For short times it is of the order of the equilibrium value, but at later times $$ˆ\\atop{q}$$ grows exponentially due to the interaction of the test parton with unstable modes and becomes much bigger than the value in equilibrium. The momentum broadening is also strongly directionally dependent and is largest when the test parton velocity is transverse to the beam axis. Lastly, consequences of our findings for the phenomenology of jet quenching in relativistic heavy-ion collisions are briefly discussed.« less
Broadening the Horizons: Organizational Communication in the Real World.
ERIC Educational Resources Information Center
Swanson, Georgia
Working in the microcosm of an individual class, organizational communication instructors can broaden the student's horizon by starting with what are local types of diversity and then expanding the classroom understanding to include the larger world where that student is going to live and work. Speech communication teachers/scholars have seen…
Deconvolution of Stark broadened spectra for multi-point density measurements in a flow Z-pinch
Vogman, G. V.; Shumlak, U.
2011-10-13
Stark broadened emission spectra, once separated from other broadening effects, provide a convenient non-perturbing means of making plasma density measurements. A deconvolution technique has been developed to measure plasma densities in the ZaP flow Z-pinch experiment. The ZaP experiment uses sheared flow to mitigate MHD instabilities. The pinches exhibit Stark broadened emission spectra, which are captured at 20 locations using a multi-chord spectroscopic system. Spectra that are time- and chord-integrated are well approximated by a Voigt function. The proposed method simultaneously resolves plasma electron density and ion temperature by deconvolving the spectral Voigt profile into constituent functions: a Gaussian functionmore » associated with instrument effects and Doppler broadening by temperature; and a Lorentzian function associated with Stark broadening by electron density. The method uses analytic Fourier transforms of the constituent functions to fit the Voigt profile in the Fourier domain. The method is discussed and compared to a basic least-squares fit. The Fourier transform fitting routine requires fewer fitting parameters and shows promise in being less susceptible to instrumental noise and to contamination from neighboring spectral lines. The method is evaluated and tested using simulated lines and is applied to experimental data for the 229.69 nm C III line from multiple chords to determine plasma density and temperature across the diameter of the pinch. As a result, these measurements are used to gain a better understanding of Z-pinch equilibria.« less
Deconvolution of Stark broadened spectra for multi-point density measurements in a flow Z-pinch
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vogman, G. V.; Shumlak, U.
2011-10-15
Stark broadened emission spectra, once separated from other broadening effects, provide a convenient non-perturbing means of making plasma density measurements. A deconvolution technique has been developed to measure plasma densities in the ZaP flow Z-pinch experiment. The ZaP experiment uses sheared flow to mitigate MHD instabilities. The pinches exhibit Stark broadened emission spectra, which are captured at 20 locations using a multi-chord spectroscopic system. Spectra that are time- and chord-integrated are well approximated by a Voigt function. The proposed method simultaneously resolves plasma electron density and ion temperature by deconvolving the spectral Voigt profile into constituent functions: a Gaussian functionmore » associated with instrument effects and Doppler broadening by temperature; and a Lorentzian function associated with Stark broadening by electron density. The method uses analytic Fourier transforms of the constituent functions to fit the Voigt profile in the Fourier domain. The method is discussed and compared to a basic least-squares fit. The Fourier transform fitting routine requires fewer fitting parameters and shows promise in being less susceptible to instrumental noise and to contamination from neighboring spectral lines. The method is evaluated and tested using simulated lines and is applied to experimental data for the 229.69 nm C III line from multiple chords to determine plasma density and temperature across the diameter of the pinch. These measurements are used to gain a better understanding of Z-pinch equilibria.« less
Hoke, Eric T.; Slotcavage, Daniel J.; Dohner, Emma R.; Bowring, Andrea R.
2015-01-01
We report on reversible, light-induced transformations in (CH3NH3)Pb(BrxI1–x)3. Photoluminescence (PL) spectra of these perovskites develop a new, red-shifted peak at 1.68 eV that grows in intensity under constant, 1-sun illumination in less than a minute. This is accompanied by an increase in sub-bandgap absorption at ∼1.7 eV, indicating the formation of luminescent trap states. Light soaking causes a splitting of X-ray diffraction (XRD) peaks, suggesting segregation into two crystalline phases. Surprisingly, these photo-induced changes are fully reversible; the XRD patterns and the PL and absorption spectra revert to their initial states after the materials are left for a few minutes in the dark. We speculate that photoexcitation may cause halide segregation into iodide-rich minority and bromide-enriched majority domains, the former acting as a recombination center trap. This instability may limit achievable voltages from some mixed-halide perovskite solar cells and could have implications for the photostability of halide perovskites used in optoelectronics. PMID:28706629
Towards Broadening the Audience
NASA Astrophysics Data System (ADS)
Sakimoto, P. J.
2008-06-01
The strand Towards Broadening the Audience was intended to seed thoughtful conversations about building bridges for outreach programs across cultural barriers. Many participants spoke about progress in increasing the diversity of their outreach audiences, but it was new voices from time-honored sources that offered fundamentally new wisdom. From the religious traditions and tensions that mark the Holy Land came the simple concept of bringing unity through teaching the commonalities found in basic concepts of the observed sky. From Mayan traditions, both contemporary and ancient, came the reminder that the sky is intimately connected to all aspects of our lives. Astronomy outreach should therefore be a part of much larger family and community celebrations. Ideas such as these offer renewed hope for major advances in bringing space science outreach to much broader audiences. They tell us about the importance of learning from voices with perspectives different from our own, and of building partnerships based upon genuine cross-cultural understanding and mutual love of the sky.
NASA Astrophysics Data System (ADS)
Mukherjee, Souvik; Sarkar, Ketaki; Wiederrecht, Gary P.; Schaller, Richard D.; Gosztola, David J.; Stroscio, Michael A.; Dutta, Mitra
2018-04-01
We demonstrate here defect induced changes on the morphology and surface properties of indium oxide (In2O3) nanowires and further study their effects on the near-band-edge (NBE) emission, thereby showing the significant influence of surface states on In2O3 nanostructure based device characteristics for potential optoelectronic applications. In2O3 nanowires with cubic crystal structure (c-In2O3) were synthesized via carbothermal reduction technique using a gold-catalyst-assisted vapor-liquid-solid method. Onset of strong optical absorption could be observed at energies greater than 3.5 eV consistent with highly n-type characteristics due to unintentional doping from oxygen vacancy ({V}{{O}}) defects as confirmed using Raman spectroscopy. A combination of high resolution transmission electron microscopy, x-ray photoelectron spectroscopy and valence band analysis on the nanowire morphology and stoichiometry reveals presence of high-density of {V}{{O}} defects on the surface of the nanowires. As a result, chemisorbed oxygen species can be observed leading to upward band bending at the surface which corresponds to a smaller valence band offset of 2.15 eV. Temperature dependent photoluminescence (PL) spectroscopy was used to study the nature of the defect states and the influence of the surface states on the electronic band structure and NBE emission has been discussed. Our data reveals significant broadening of the NBE PL peak consistent with impurity band broadening leading to band-tailing effect from heavy doping.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mukherjee, Souvik; Sarkar, Ketaki; Wiederrecht, Gary P.
We demonstrate here defect induced changes on the morphology and surface properties of indium oxide (In2O3) nanowires and further study their effects on the near-band-edge (NBE) emission, thereby showing the significant influence of surface states on In2O3 nanostructure based device characteristics for potential optoelectronic applications. In2O3 nanowires with cubic crystal structure (c-In2O3) were synthesized via carbothermal reduction technique using a gold-catalyst-assisted vapor–liquid–solid method. Onset of strong optical absorption could be observed at energies greater than 3.5 eV consistent with highly n-type characteristics due to unintentional doping from oxygen vacancy (VO) defects as confirmed using Raman spectroscopy. A combination of highmore » resolution transmission electron microscopy, x-ray photoelectron spectroscopy and valence band analysis on the nanowire morphology and stoichiometry reveals presence of high-density of VO defects on the surface of the nanowires. As a result, chemisorbed oxygen species can be observed leading to upward band bending at the surface which corresponds to a smaller valence band offset of 2.15 eV. Temperature dependent photoluminescence (PL) spectroscopy was used to study the nature of the defect states and the influence of the surface states on the electronic band structure and NBE emission has been discussed. Our data reveals significant broadening of the NBE PL peak consistent with impurity band broadening leading to band-tailing effect from heavy doping.« less
NASA Astrophysics Data System (ADS)
Huennekens, J.; Gallagher, A.
1983-04-01
Sodium vapor, in the density range 1013 to 5 × 1014 cm-3, was excited by a cw dye laser, tuned 20-150 GHz from either the D1 or D2 resonance line. We observed a three-peak scattered spectrum, consisting of the Rayleigh component at the laser frequency, and the two fluorescence components (direct and sensitized) at the atomic resonance-line frequencies. Corrections to the Rayleigh signals for anisotropy and polarization effects, and to the fluorescence signals for radiation trapping, were made in order to obtain the ratio of the sum of the total intensities of the two fluorescence components to that of the Rayleigh component. This ratio combined with a measurement of the line-wing absorption coefficient yields the sodium density and the D-line self-broadening rate coefficients [kbr=4.67×10-7 cm3s-1 (+/-15%) for the D2 line and kbr=3.07×10-7 cm3s-1 (+/-15%) for the D1 line]. Asymmetry in the self-broadened line wings due to fine-structure recoupling was observed. The measured intensity ratio of the D lines, combined with pulsed measurements of the effective radiative decay rates in the presence of radiation trapping, yields the fine-structure collisional-mixing cross section [σ(3P32-->3P12)=172Å2(+/-18%)] at T≅300° C. Our results are compared to other experiments and to theory.
Mukherjee, Souvik; Sarkar, Ketaki; Wiederrecht, Gary P; Schaller, Richard D; Gosztola, David J; Stroscio, Michael A; Dutta, Mitra
2018-04-27
We demonstrate here defect induced changes on the morphology and surface properties of indium oxide (In 2 O 3 ) nanowires and further study their effects on the near-band-edge (NBE) emission, thereby showing the significant influence of surface states on In 2 O 3 nanostructure based device characteristics for potential optoelectronic applications. In 2 O 3 nanowires with cubic crystal structure (c-In 2 O 3 ) were synthesized via carbothermal reduction technique using a gold-catalyst-assisted vapor-liquid-solid method. Onset of strong optical absorption could be observed at energies greater than 3.5 eV consistent with highly n-type characteristics due to unintentional doping from oxygen vacancy [Formula: see text] defects as confirmed using Raman spectroscopy. A combination of high resolution transmission electron microscopy, x-ray photoelectron spectroscopy and valence band analysis on the nanowire morphology and stoichiometry reveals presence of high-density of [Formula: see text] defects on the surface of the nanowires. As a result, chemisorbed oxygen species can be observed leading to upward band bending at the surface which corresponds to a smaller valence band offset of 2.15 eV. Temperature dependent photoluminescence (PL) spectroscopy was used to study the nature of the defect states and the influence of the surface states on the electronic band structure and NBE emission has been discussed. Our data reveals significant broadening of the NBE PL peak consistent with impurity band broadening leading to band-tailing effect from heavy doping.
Mechanism of asymmetric lineshape broadening in GaAs1-xNx Raman spectra
NASA Astrophysics Data System (ADS)
Mialitsin, Aleksej; Fluegel, Brian; Ptak, Aaron; Mascarenhas, Angelo
2012-07-01
Resonance Raman spectroscopy is used to probe the asymmetric broadening of the LO phonon linewidth in a dilute GaAs1-xNx alloy (x=0.41%). Electronic Raman scattering from a broad continuum is observed that gets enhanced concurrently with the LO phonon linewidth under resonance. The Fano interaction between the LO phonon and the electronic continuum is used to develop a model that satisfactorily explains the origin of the asymmetric LO phonon linewidth broadening in this abnormal alloy as arising due to coupling between the discrete and the continuum configurations.
Automated peak picking and peak integration in macromolecular NMR spectra using AUTOPSY.
Koradi, R; Billeter, M; Engeli, M; Güntert, P; Wüthrich, K
1998-12-01
A new approach for automated peak picking of multidimensional protein NMR spectra with strong overlap is introduced, which makes use of the program AUTOPSY (automated peak picking for NMR spectroscopy). The main elements of this program are a novel function for local noise level calculation, the use of symmetry considerations, and the use of lineshapes extracted from well-separated peaks for resolving groups of strongly overlapping peaks. The algorithm generates peak lists with precise chemical shift and integral intensities, and a reliability measure for the recognition of each peak. The results of automated peak picking of NOESY spectra with AUTOPSY were tested in combination with the combined automated NOESY cross peak assignment and structure calculation routine NOAH implemented in the program DYANA. The quality of the resulting structures was found to be comparable with those from corresponding data obtained with manual peak picking. Copyright 1998 Academic Press.
Application of Mythen detector: In-situ XRD study on the thermal expansion behavior of metal indium
NASA Astrophysics Data System (ADS)
Du, Rong; Chen, ZhongJun; Cai, Quan; Fu, JianLong; Gong, Yu; Wu, ZhongHua
2016-07-01
A Mythen detector has been equipped at the beamline 4B9A of Beijing Synchrotron Radiation Facility (BSRF), which is expected to enable BSRF to perform time-resolved measurement of X-ray diffraction (XRD) full-profiles. In this paper, the thermal expansion behavior of metal indium has been studied by using the in-situ XRD technique with the Mythen detector. The indium was heated from 303 to 433 K with a heating rate of 2 K/min. The in-situ XRD full-profiles were collected with a rate of one profile per 10 seconds. Rietveld refinement was used to extract the structural parameters. The results demonstrate that these collected quasi-real-time XRD profiles can be well used for structural analysis. The metal indium was found to have a nonlinear thermal expansion behavior from room temperature to the melting point (429.65 K). The a-axis of the tetragonal unit cell expands with a biquadratic dependency on temperature, while the c-axis contracts with a cubic dependency on temperature. By the time-resolved XRD measurements, it was observed that the [200] preferred orientation can maintain to about 403.15 K. While (110) is the last and detectable crystal plane just before melting of the polycrystalline indium foil. This study is not only beneficial to the application of metal indium, but also exhibits the capacity of in-situ time-resolved XRD measurements at the X-ray diffraction station of BSRF.
Response Time Measurements of the NIF DANTE XRD-31 X-Ray Diodes (Pre-print)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Don Pellinen and Michael Griffin
2009-01-23
The XRD-31 is a fast, windowless X-ray vacuum photodiode developed by EG&G. It is currently the primary fast X-ray detector used to diagnose the X-rays on NIF and OMEGA on the multichannel DANTE spectrometer. The XRD-31 has a dynamic range of less than 1e-12 amps to more than 10 amps. A technique is described to measure the impulse response of the diodes to a 150 fs pulse of 200 nm laser light and a method to calculate the “risetime” for a square pulse and compare it with the computed electron transit time from the photocathode to the anode. Measured responsemore » time for 5 XRD-31s assembled in early 2004 was 149.7 ps +-2.75 ps.« less
Relational Themes in Counseling Supervision: Broadening and Narrowing Processes
ERIC Educational Resources Information Center
Gazzola, Nicola; Theriault, Anne
2007-01-01
This study investigated the experiences of broadening (i.e., thinking and acting creatively and being open to exploring new ways of being) and narrowing (i.e., the experience of perceiving one's choices as limited) in the supervisory process with the aim of identifying key relational themes from the perspective of supervisees. We interviewed 10…
NASA Technical Reports Server (NTRS)
Chipera, S. J.; Vaniman, D. T.; Bish, D. L.; Sarrazin, P.; Feldman, S.; Blake, D. F.; Bearman, G.; Bar-Cohen, Y.
2004-01-01
A miniature XRD/XRF (X-ray diffraction / X-ray fluorescence) instrument, CHEMIN, is currently being developed for definitive mineralogic analysis of soils and rocks on Mars. One of the technical issues that must be addressed to enable remote XRD analysis is how best to obtain a representative sample powder for analysis. For powder XRD analyses, it is beneficial to have a fine-grained sample to reduce preferred orientation effects and to provide a statistically significant number of crystallites to the X-ray beam. Although a two-dimensional detector as used in the CHEMIN instrument will produce good results even with poorly prepared powder, the quality of the data will improve and the time required for data collection will be reduced if the sample is fine-grained and randomly oriented. A variety of methods have been proposed for XRD sample preparation. Chipera et al. presented grain size distributions and XRD results from powders generated with an Ultrasonic/Sonic Driller/Corer (USDC) currently being developed at JPL. The USDC was shown to be an effective instrument for sampling rock to produce powder suitable for XRD. In this paper, we compare powder prepared using the USDC with powder obtained with a miniaturized rock crusher developed at JPL and with powder obtained with a rotary tungsten carbide bit to powders obtained from a laboratory bench-scale Retsch mill (provides benchmark mineralogical data). These comparisons will allow assessment of the suitability of these methods for analysis by an XRD/XRF instrument such as CHEMIN.
Synthesis and Characterization of Chitosan-p-t-Butylcalix[4]arene acid
NASA Astrophysics Data System (ADS)
Handayani, D. S.; Frimadasi, W.; Kusumaningsih, T.; Pranoto
2018-03-01
The synthesis of chitosan-p-t-butylcalix[4]arene acid was done with DIC (N, N’-diisopropylcarbodiimide) as the coupling agent. The structural analysis of the chitosan-p-t-butylcalix[4]arene acid was conducted by spectrophotometer Fourier Transform Infra Red (FTIR) and X-Ray Diffraction (XRD). Meanwhile, the surface area was investigated by Surface Area Analysis, the Scanning Electrone Microscope (SEM) analysed the surface morphology, and also the melting point temperature was determined. FTIR analysis on Chitosan-p-t-butylcalix[4]arene provides an overlapped absorption of -OH and -NH groups at 3438.26 cm-1. Meanwhile, a C = C aromatic bond present at 1480.43 cm-1. XRD analysis shows some broaden peaks due to the amorphous phase of the prepared material. The prepared material is a brownish yellow solid, odorless and porous. The melting point, surface area, and the average pore radius are above 300 °C, 9.42 m2 / g, and 52.5938 Å, respectively.
NASA Astrophysics Data System (ADS)
Das, M.; Nath, P.; Sarkar, D.
2016-02-01
In this article effect of etching current density (J) on the microstructural, optical and electrical properties of photoelectrochemically prepared heterostructure is reported. Prepared samples are characterized by FESEM, XRD, UV-Visible, Raman and photoluminescence (PL) spectra and current-voltage (I-V) characteristics. FESEM shows presence of mixture of randomly distributed meso- and micro-pores. Porous layer thickness determined by cross section view of SEM is proportional to J. XRD shows crystalline nature but gradually extent of crystallinity decreases with increasing J. Raman spectra show large red-shift and asymmetric broadening with respect to crystalline silicon (c-Si). UV-visible reflectance and PL show blue shift in peaks with increasing J. The I-V characteristics are analyzed by the conventional thermionic emission (TE) model and Cheung's model to estimate the barrier height (φb), ideality factor (n) and series resistance (Rs) for comparison between the two models. The latter model is found to fit better.
Lifetime broadening in GaAs-AlGaAs quantum well lasers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kucharska, A.I.; Robbins, D.J.
1990-03-01
Experimental observations of spontaneous emission spectra from GaAs-AlGaAs quantum well lasers show that spectral broadening should be included in any realistic model of laser performance. The authors describe a model of the lifetime broadening due to intraband Auger processes of the Landsberg type and develop it for the case of electron-electron scattering in a 2-D system. They apply the model to the calculation of gain and spontaneous emission spectra and gain-current relationships in short-wavelength GaAs-AlGaAs quantum well lasers, and compare their results with those obtained using both a fixed intraband scattering time and one that varies as {ital n}{sup 1/2},more » where {ital n} is the volume injected carrier density.« less
NASA Astrophysics Data System (ADS)
Simón-Díaz, S.; Godart, M.; Castro, N.; Herrero, A.; Aerts, C.; Puls, J.; Telting, J.; Grassitelli, L.
2017-01-01
Context. The term macroturbulent broadening is commonly used to refer to a certain type of non-rotational broadening affecting the spectral line profiles of O- and B-type stars. It has been proposed to be a spectroscopic signature of the presence of stellar oscillations; however, we still lack a definitive confirmation of this hypothesis. Aims: We aim to provide new empirical clues about macroturbulent spectral line broadening in O- and B-type stars to evaluate its physical origin. Methods: We used high-resolution spectra of 430 stars with spectral types in the range O4 - B9 (all luminosity classes) compiled in the framework of the IACOB project. We characterized the line broadening of adequate diagnostic metal lines using a combined Fourier transform and goodness-of-fit technique. We performed a quantitative spectroscopic analysis of the whole sample using automatic tools coupled with a huge grid of fastwind models to determine their effective temperatures and gravities. We also incorporated quantitative information about line asymmetries into our observational description of the characteristics of the line profiles, and performed a comparison of the shape and type of line-profile variability found in a small sample of O stars and B supergiants with still undefined pulsational properties and B main-sequence stars with variable line profiles owing to a well-identified type of stellar oscillations or to the presence of spots in the stellar surface. Results: We present a homogeneous and statistically significant overview of the (single snapshot) line-broadening properties of stars in the whole O and B star domain. We find empirical evidence of the existence of various types of non-rotational broadening agents acting in the realm of massive stars. Even though all these additional sources of line-broadening could be quoted and quantified as a macroturbulent broadening from a practical point of view, their physical origin can be different. Contrarily to the early- to
Definitive Mineralogical Analysis of Mars Analog Rocks Using the CheMin XRD/XRF Instrument
NASA Technical Reports Server (NTRS)
Blake, D. F.; Sarrazin, P.; Bish, D. L.; Feldman, S.; Chipera, S. J.; Vaniman, D. T.; Collins, S.
2004-01-01
Mineral identification is a critical component of Mars Astrobiological missions. Chemical or elemental data alone are not definitive because a single elemental or chemical composition or even a single bonding type can represent a range of substances or mineral assemblages. Minerals are defined as unique structural and compositional phases that occur naturally. There are about 15,000 minerals that have been described on Earth, all uniquely identifiable via diffraction methods. There are likely many minerals yet undiscovered on Earth, and likewise on Mars. If an unknown phase is identified on Mars, it can be fully characterized by structural (X-ray Diffraction, XRD) and elemental analysis (X-ray Fluorescence, XRF) without recourse to other data because XRD relies on the principles of atomic arrangement for its determinations. XRD is the principal means of identification and characterization of minerals on Earth.
Signal broadening in the laser Doppler velocimeter.
NASA Technical Reports Server (NTRS)
Angus, J. C.; Edwards, R. V.; Dunning, J. W., Jr.
1971-01-01
Critical review of a recent paper in which Denison, Stevenson, and Fox (1971) discussed the sources of spectral broadening in the laser Doppler velocimeter. It is pointed out that, in their discussion, the above-mentioned authors indicated that the spread in wave vectors of the incident and detected fields and the finite length of time a scattering center stayed in the sample volume each contributed separately and independently to the observed spectral width of the scattered radiation. This statement is termed incorrect, and it is shown that the two effects are one and the same.
Metcalf, Heather
2016-01-01
This research methods Essay details the usefulness of critical theoretical frameworks and critical mixed-methodological approaches for life sciences education research on broadening participation in the life sciences. First, I draw on multidisciplinary research to discuss critical theory and methodologies. Then, I demonstrate the benefits of these approaches for researchers who study diversity and inclusion issues in the life sciences through examples from two critical mixed-methods studies of prominent issues in science, technology, engineering, and mathematics (STEM) participation and recognition. The first study pairs critical discourse analysis of the STEM workforce literature, data, and underlying surveys with quantitative analyses of STEM pathways into the workforce. This example illustrates the necessity of questioning popular models of retention. It also demonstrates the importance of intersecting demographic categories to reveal patterns of experience both within and between groups whose access to and participation in STEM we aim to improve. The second study’s critical approach applies research on inequities in prizes awarded by STEM professional societies toward organizational change. This example uses data from the life sciences professional societies to show the importance of placing data within context to broaden participation and understand challenges in creating sustainable change. PMID:27521238
NASA Technical Reports Server (NTRS)
Rinsland, Curtis P.; Smith, Mary Ann H.; Devi, V. Malathy; Benner, D. Chris
1988-01-01
Air-broadened and N2-broadened halfwidth and pressure shift coefficients of 294 transitions in the nu4 and nu2 bands of C-12H4 have been measured from laboratory absorption spectra recorded at room temperature with the Fourier transform spectrometer in the McMath solar telescope facility of the National Solar Observatory. Total pressures of up to 551 Torr were employed with absorption paths of 5-150 cm, CH4 volume mixing ratios of 2.6 percent or less, and resolutions of 0.005 and 0.01/cm. A nonlinear least-squares spectral fitting technique has been utilized in the analysis of the twenty-five measured spectra. Lines up to J double-prime = 18 in the nu4 band and J double-prime = 15 in the nu2 band have been analyzed.
Collisional Shift and Broadening of Iodine Spectral Lines in Air Near 543 nm
NASA Technical Reports Server (NTRS)
Fletcher, D. G.; McDaniel, J. C.
1995-01-01
The collisional processes that influence the absorption of monochromatic light by iodine in air have been investigated. Measurements were made in both a static cell and an underexpanded jet flow over the range of properties encountered in typical compressible-flow aerodynamic applications. Experimentally measured values of the collisional shift and broadening coefficients were 0.058 +/- 0.004 and 0.53 +/- 0.010 GHz K(exp 0.7)/torr, respectively. The measured shift value showed reasonable agreement with theoretical calculations based on Lindholm-Foley collisional theory for a simple dispersive potential. The measured collisional broadening showed less favorable agreement with the calculated value.
NASA Astrophysics Data System (ADS)
Mahadevan, S.; Manojkumar, R.; Jayakumar, T.; Das, C. R.; Rao, B. P. C.
2016-06-01
17-4 PH (precipitation hardening) stainless steel is a soft martensitic stainless steel strengthened by aging at appropriate temperature for sufficient duration. Precipitation of copper particles in the martensitic matrix during aging causes coherency strains which improves the mechanical properties, namely hardness and strength of the matrix. The contributions to X-ray diffraction (XRD) profile broadening due to coherency strains caused by precipitation and crystallite size changes due to aging are separated and quantified using the modified Williamson-Hall approach. The estimated normalized mean square strain and crystallite size are used to explain the observed changes in hardness. Microstructural changes observed in secondary electron images are in qualitative agreement with crystallite size changes estimated from XRD profile analysis. The precipitation kinetics in the age-hardening regime and overaged regime are studied from hardness changes and they follow the Avrami kinetics and Wilson's model, respectively. In overaged condition, the hardness changes are linearly correlated to the tempering parameter (also known as Larson-Miller parameter). Similar linear variation is observed between the normalized mean square strain (determined from XRD line profile analysis) and the tempering parameter, in the incoherent regime which is beyond peak microstrain conditions.
Theoretical calculation of CH3F/N2-broadening coefficients and their temperature dependence
NASA Astrophysics Data System (ADS)
Jellali, C.; Maaroufi, N.; Aroui, H.
2018-07-01
Using Robert and Bonamy formalism (with parabolic and exact trajectories) based on the semi-classical impact theory, N2-broadening coefficients of methyl fluoride CH3F were calculated for transitions belonging to the PP-, PQ-, PR-, RP-, RQ- and RR- sub-branches of the ν6 perpendicular band near 8.5 μm. The calculations showed the predominance of the dipole-quadruple interaction. The J and K rotational quantum numbers dependencies of the computed coefficients that are consistent with previous measurements were clearly observed in this study. For a fixed value of J, we noticed a decrease in the broadening coefficients, which was more significant at lower J values. In order to deduce the temperature exponent, the N2-broadening coefficients of CH3F were calculated at various temperatures of atmospheric interest between 183 and 296 K with J ≤ 60 and K ≤ 10. These exponents were, in general, J-dependent and K-independent, except for K close to J.
A Combined XRD/XRF Instrument for Lunar Resource Assessment
NASA Technical Reports Server (NTRS)
Vaniman, D. T.; Bish, D. L.; Chipera, S. J.; Blacic, J. D.
1992-01-01
Robotic surface missions to the Moon should be capable of measuring mineral as well as chemical abundances in regolith samples. Although much is already known about the lunar regolith, our data are far from comprehensive. Most of the regolith samples returned to Earth for analysis had lost the upper surface, or it was intermixed with deeper regolith. This upper surface is the part of the regolith most recently exposed to the solar wind; as such it will be important to resource assessment. In addition, it may be far easier to mine and process the uppermost few centimeters of regolith over a broad area than to engage in deep excavation of a smaller area. The most direct means of analyzing the regolith surface will be by studies in situ. In addition, the analysis of the impact-origin regolith surfaces, the Fe-rich glasses of mare pyroclastic deposits, are of resource interest, but are inadequately known; none of the extensive surface-exposed pyroclastic deposits of the Moon have been systematically sampled, although we know something about such deposits from the Apollo 17 site. Because of the potential importance of pyroclastic deposits, methods to quantify glass as well as mineral abundances will be important to resource evaluation. Combined x ray diffraction (XRD) and x ray fluorescence (XRF) analysis will address many resource characterization problems on the Moon. XRF methods are valuable for obtaining full major-element abundances with high precision. Such data, collected in parallel with quantitative mineralogy, permit unambiguous determination of both mineral and chemical abundances where concentrations are high enough to be of resource grade. Collection of both XRD and XRF data from a single sample provides simultaneous chemical and mineralogic information. These data can be used to correlate quantitative chemistry and mineralogy as a set of simultaneous linear equations, the solution of which can lead to full characterization of the sample. The use of
Line shape parameters of air-broadened water vapor transitions in the ν 1 and ν 3 spectral region
Malathy Devi, V.; Gamache, Robert R.; Vispoel, Bastien; ...
2017-11-26
A Bruker IFS-120HR Fourier transform spectrometer located at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington was used to record a series of spectra of pure H 2O and air-broadened H 2O in the regions of the ν 1 and ν 3 bands (3450–4000 cm -1) at different pressures, temperatures and volume mixing ratios of H 2O in air. Eighteen high-resolution, high signal-to-noise (S/N) ratio absorption spectra were recorded at T = 268, 296 and 353 K using two temperature-controlled absorption cells with path lengths of 9.906(1) and 19.95(1) cm. Furthermore, the resolution of the spectra recorded with themore » 9.906 cm and 19.95 cm absorption cells was 0.006 and 0.008 cm -1, respectively. A multispectrum nonlinear least squares fitting technique was employed to fit all the eighteen spectra simultaneously to retrieve 313 accurate line positions, 315 intensities, 229 Lorentz air-broadened half-width and 213 air-shift coefficients and their temperature dependences (136 for air-broadened width and 128 for air-shift coefficients, respectively). Room temperature self-broadened half-width coefficients for 209 transitions and self-shift coefficients for 106 transitions were also measured. Line mixing coefficients were experimentally determined for isolated sets of 10 transition pairs for H 2O-air and 8 transition pairs for H 2O-H 2O using the off-diagonal relaxation matrix element formalism, and 85 quadratic speed dependence parameters were measured. Modified Complex Robert-Bonamy (MCRB) calculations of self-, and air-broadened (from N 2- and O 2-broadening) half-width and air-shift coefficients, and temperature dependence exponents of air-broadened half-width coefficients are made. Finally, the measurements and calculations are compared with each other and with similar parameters reported in the literature.« less
Line shape parameters of air-broadened water vapor transitions in the ν1 and ν3 spectral region
NASA Astrophysics Data System (ADS)
Malathy Devi, V.; Gamache, Robert R.; Vispoel, Bastien; Renaud, Candice L.; Chris Benner, D.; Smith, Mary Ann H.; Blake, Thomas A.; Sams, Robert L.
2018-06-01
A Bruker IFS-120HR Fourier transform spectrometer located at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington was used to record a series of spectra of pure H2O and air-broadened H2O in the regions of the ν1 and ν3 bands (3450-4000 cm-1) at different pressures, temperatures and volume mixing ratios of H2O in air. Eighteen high-resolution, high signal-to-noise (S/N) ratio absorption spectra were recorded at T = 268, 296 and 353 K using two temperature-controlled absorption cells with path lengths of 9.906(1) and 19.95(1) cm. The resolution of the spectra recorded with the 9.906 cm and 19.95 cm absorption cells was 0.006 and 0.008 cm-1, respectively. A multispectrum nonlinear least squares fitting technique was employed to fit all the eighteen spectra simultaneously to retrieve 313 accurate line positions, 315 intensities, 229 Lorentz air-broadened half-width and 213 air-shift coefficients and their temperature dependences (136 for air-broadened width and 128 for air-shift coefficients, respectively). Room temperature self-broadened half-width coefficients for 209 transitions and self-shift coefficients for 106 transitions were also measured. Line mixing coefficients were experimentally determined for isolated sets of 10 transition pairs for H2O-air and 8 transition pairs for H2O-H2O using the off-diagonal relaxation matrix element formalism, and 85 quadratic speed dependence parameters were measured. Modified Complex Robert-Bonamy (MCRB) calculations of self-, and air-broadened (from N2- and O2-broadening) half-width and air-shift coefficients, and temperature dependence exponents of air-broadened half-width coefficients are made. The measurements and calculations are compared with each other and with similar parameters reported in the literature.
Line shape parameters of air-broadened water vapor transitions in the ν 1 and ν 3 spectral region
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malathy Devi, V.; Gamache, Robert R.; Vispoel, Bastien
A Bruker IFS-120HR Fourier transform spectrometer located at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington was used to record a series of spectra of pure H 2O and air-broadened H 2O in the regions of the ν 1 and ν 3 bands (3450–4000 cm -1) at different pressures, temperatures and volume mixing ratios of H 2O in air. Eighteen high-resolution, high signal-to-noise (S/N) ratio absorption spectra were recorded at T = 268, 296 and 353 K using two temperature-controlled absorption cells with path lengths of 9.906(1) and 19.95(1) cm. Furthermore, the resolution of the spectra recorded with themore » 9.906 cm and 19.95 cm absorption cells was 0.006 and 0.008 cm -1, respectively. A multispectrum nonlinear least squares fitting technique was employed to fit all the eighteen spectra simultaneously to retrieve 313 accurate line positions, 315 intensities, 229 Lorentz air-broadened half-width and 213 air-shift coefficients and their temperature dependences (136 for air-broadened width and 128 for air-shift coefficients, respectively). Room temperature self-broadened half-width coefficients for 209 transitions and self-shift coefficients for 106 transitions were also measured. Line mixing coefficients were experimentally determined for isolated sets of 10 transition pairs for H 2O-air and 8 transition pairs for H 2O-H 2O using the off-diagonal relaxation matrix element formalism, and 85 quadratic speed dependence parameters were measured. Modified Complex Robert-Bonamy (MCRB) calculations of self-, and air-broadened (from N 2- and O 2-broadening) half-width and air-shift coefficients, and temperature dependence exponents of air-broadened half-width coefficients are made. Finally, the measurements and calculations are compared with each other and with similar parameters reported in the literature.« less
Sharpening of the 6.8 nm peak in an Nd:YAG laser produced Gd plasma by using a pre-formed plasma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tian, Yong; Song, Xiaolin; Xie, Zhuo
For effective use of a laser-produced-plasma (LPP) light source, an LPP is desired to emit a narrow spectral peak because the reflection spectrum of multilayer mirrors for guiding emission from the source is very narrow. While a Gd plasma has been studied extensively as an extreme ultraviolet (EUV) light source at around 6.8 nm, where La/B{sub 4}C multilayer is reported to have a high reflectivity with a bandwidth of about 0.6 %, all previous works using an Nd:YAG laser reported very broad spectra. This paper reports the first narrowing of the 6.8 nm peak in the case of using anmore » Nd:YAG laser to generate a Gd plasma by using a pre-pulse. The best peak narrowing is observed when a pre-formed plasma is heated by a 1064 nm main laser pulse with a duration of 10 ns at the irradiation density of 4x 10{sup 11} W/cm{sup 2} at a delay time of 50 ns after the pre-pulse irradiation. The observed spectral width of about 0.3 nm is about one fifth of the value for no pre-formed plasma. The peak wavelength of the 6.8 nm band shifted to a longer wavelength side and the peak was broadened both for lower and higher laser irradiation density. It is discussed that this robustness of the peak position of the 6.8 nm Gd peak against temperature change is suitable to achieve a narrow bandwidth from an LPP generated on solid. The observed spectra are compared with those previously reported in various conditions.« less
Quantitative shock stage assessment in olivine and pyroxene bearing meteorites via in situ micro-XRD
NASA Astrophysics Data System (ADS)
McCausland, P. J.; Flemming, R. L.; Izawa, M. R.
2010-12-01
Shock metamorphism is observed in most meteorites and impact structures [1]. Qualitative petrographic observations underpin a shock classification system [1-3] based on the deformation features in common silicates and on textural relations such as the development of maskelynite from feldspars, mobility of sulphides and metal in veins and local Fe-reduction in silicates. Shock deformation of minerals produces streaks (mosaicity) rather than discrete spots in 2D X-ray diffraction patterns, representing the progressive disruption of the crystal lattice into a mosaic of rotated domains [4,5]. Here we use in situ micro-XRD [5,6] to measure the mosaicity of olivine and pyroxene in ordinary chondrites of increasing shock stages S1 to S5 and then apply the method to achondrites with qualitatively low to high shock. X-ray diffraction data were collected in situ on polished thin sections and slab cut surfaces using a Bruker D8 Discover micro X-ray diffractometer [5], operated using CuKα radiation generated at 40 kV and 40 mA with a beam diameter of 500 μm. Diffracted X-rays were recorded with a 2D detector, giving images with information in both the 2-theta and chi dimensions, in which each lattice plane (hkl) will have a diffraction spot or streak lying along an arc in chi of radius 2-theta (hkl). Individual reflections can be indexed and then integrated as a function of chi angle, allowing examination of the peak shape and quantitative analysis of the mosaic peak FWHM along chi. We find that both forsterite and enstatite exhibit greater mosaicity in chi with increasing shock stage: Forsterite chi ranges from <1° for S1 to >6° for S5. Enstatite chi values from the same meteorites show a more subdued growth of streak length with shock state, from ~1° to ~4°. A slab of the olivine shergottite DaG 476 exhibits forsterite mosaicity of 6.9°+/-1.1°, indicating that it has experienced shock stage S5, with shock pressures 30-45 GPa [1,4], consistent with the 40-45 GPa shock
H2-,He-and CO2-line broadening coefficients and pressure shifts for the HITRAN database
NASA Astrophysics Data System (ADS)
Wilzewski, Jonas; Gordon, Iouli E.; Rothman, Laurence S.
2014-06-01
To increase the potential of the HITRAN database in astronomy, experimental and theoretical line broadening coefficients and line shifts of molecules of planetary interest broadened by H2,He,and CO2 have been assembled from available peer-reviewed sources. Since H2 and He are major constituents in the atmospheres of gas giants, and CO2 predominates in atmospheres of some rocky planets with volcanic activity, these spectroscopic data are important for studying planetary atmospheres. The collected data were used to create semi-empirical models for complete data sets from the microwave to the UV part of the spectrum of the studied molecules. The presented work will help identify the need for further investigations of broadening and shifting of spectral lines.
Yang, X; Yang, L; Lin, J; Zhou, R
2016-01-28
Pd/CeO2-ZrO2-Nd2O3 (CZN) catalysts with different CeO2/ZrO2 molar ratios were synthesized and have been characterized by multiple techniques, e.g. XRD in combination with Rietveld refinement, UV-Raman, XPS and in situ DRIFTS. The XRD pattern of CZN with CeO2/ZrO2 molar ratios ≥1/2 can be indexed satisfactorily to the fluorite structure with a space group Fm3̄m, while the XRD patterns of CZ12 only display diffraction peaks of the tetragonal phase (S.G. P42/nmc). Nd addition can effectively stabilize the cubic structure of the CZN support and increase the enrichment of defect sites on the surface, which may be related to the better catalytic activity of Pd/CZN12 catalysts compared with Pd/CZ12. The presence of moderate ZrO2 can increase the concentration of O* active species, leading to accelerate the formation of nitrate species and thus enhance the catalytic activity of NOx and HC elimination. The Pd-dispersion decreases with the increasing Zr content, leading to the decreased CO catalytic activity, especially for the aged catalysts. The change regularity of the OSC value is almost the same with the in situ dynamic operational window, demonstrating that the in situ dynamic operational window is basically affected by the OSC value.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johns, H. M.; Kilcrease, D. P.; Colgan, J.
In this study, electron collisional broadening of observed spectral lines depends on plasma electron temperature and density. Including this effect in models of measured spectra is necessary to determine plasma conditions; however, computational limits make accurate line broadening treatments difficult to implement in large-scale plasma modeling efforts. In this paper, we report on improvements to the treatment of electron collisional line broadening and illustrate this with calculations using the Los Alamos ATOMIC code. We implement the Dimitrijevic and Konjevic modified semi-empirical model Dimitrijevic and Konjevic (1986 Astron. and Astrophy. 163 297 and 1987 Astron. Astrophys. 172 345), which we amendmore » by employing oscillator strengths from Hartree–Fock calculations. This line broadening model applies to near-neutral plasmas with electron temperatures of Te ~ 1 eV and electron densities of N e ~10 17 cm -3. We evaluate the D.K.-inspired model against the previous hydrogenic approach in ATOMIC through comparison to NIST-rated measurements for selected neutral and singly-ionized Ca, O, Fe, and Sn lines using both fine-structure and configuration-averaged oscillator strengths. The new D.K.-inspired model is significantly more accurate than the previous hydrogenic model and we find the use of configuration-averaged oscillator strengths a good approximation for applications such as LIBS (laser induced breakdown spectroscopy), for which we demonstrate the use of the D.K.-inspired model.« less
Johns, H. M.; Kilcrease, D. P.; Colgan, J.; ...
2015-09-29
In this study, electron collisional broadening of observed spectral lines depends on plasma electron temperature and density. Including this effect in models of measured spectra is necessary to determine plasma conditions; however, computational limits make accurate line broadening treatments difficult to implement in large-scale plasma modeling efforts. In this paper, we report on improvements to the treatment of electron collisional line broadening and illustrate this with calculations using the Los Alamos ATOMIC code. We implement the Dimitrijevic and Konjevic modified semi-empirical model Dimitrijevic and Konjevic (1986 Astron. and Astrophy. 163 297 and 1987 Astron. Astrophys. 172 345), which we amendmore » by employing oscillator strengths from Hartree–Fock calculations. This line broadening model applies to near-neutral plasmas with electron temperatures of Te ~ 1 eV and electron densities of N e ~10 17 cm -3. We evaluate the D.K.-inspired model against the previous hydrogenic approach in ATOMIC through comparison to NIST-rated measurements for selected neutral and singly-ionized Ca, O, Fe, and Sn lines using both fine-structure and configuration-averaged oscillator strengths. The new D.K.-inspired model is significantly more accurate than the previous hydrogenic model and we find the use of configuration-averaged oscillator strengths a good approximation for applications such as LIBS (laser induced breakdown spectroscopy), for which we demonstrate the use of the D.K.-inspired model.« less
The STARS Alliance: Viable Strategies for Broadening Participation in Computing
ERIC Educational Resources Information Center
Dahlberg, Teresa; Barnes, Tiffany; Buch, Kim; Rorrer, Audrey
2011-01-01
The Students and Technology in Academia, Research, and Service (STARS) Alliance is a nationally-connected system of regional partnerships among higher education, K-12 schools, industry and the community with a mission to broaden the participation of women, under-represented minorities and persons with disabilities in computing (BPC). Each regional…
Law, Y K; Hassanali, A A
2018-03-14
In this work, we examine the importance of nuclear quantum effects on capturing the line broadening and vibronic structure of optical spectra. We determine the absorption spectra of three aromatic molecules indole, pyridine, and benzene using time dependent density functional theory with several molecular dynamics sampling protocols: force-field based empirical potentials, ab initio simulations, and finally path-integrals for the inclusion of nuclear quantum effects. We show that the absorption spectrum for all these chromophores are similarly broadened in the presence of nuclear quantum effects regardless of the presence of hydrogen bond donor or acceptor groups. We also show that simulations incorporating nuclear quantum effects are able to reproduce the heterogeneous broadening of the absorption spectra even with empirical force fields. The spectral broadening associated with nuclear quantum effects can be accounted for by the broadened distribution of chromophore size as revealed by a particle in the box model. We also highlight the role that nuclear quantum effects have on the underlying electronic structure of aromatic molecules as probed by various electrostatic properties.
NASA Astrophysics Data System (ADS)
Law, Y. K.; Hassanali, A. A.
2018-03-01
In this work, we examine the importance of nuclear quantum effects on capturing the line broadening and vibronic structure of optical spectra. We determine the absorption spectra of three aromatic molecules indole, pyridine, and benzene using time dependent density functional theory with several molecular dynamics sampling protocols: force-field based empirical potentials, ab initio simulations, and finally path-integrals for the inclusion of nuclear quantum effects. We show that the absorption spectrum for all these chromophores are similarly broadened in the presence of nuclear quantum effects regardless of the presence of hydrogen bond donor or acceptor groups. We also show that simulations incorporating nuclear quantum effects are able to reproduce the heterogeneous broadening of the absorption spectra even with empirical force fields. The spectral broadening associated with nuclear quantum effects can be accounted for by the broadened distribution of chromophore size as revealed by a particle in the box model. We also highlight the role that nuclear quantum effects have on the underlying electronic structure of aromatic molecules as probed by various electrostatic properties.
NASA Astrophysics Data System (ADS)
Chen, Lin; Qin, Guang-You; Wei, Shu-Yi; Xiao, Bo-Wen; Zhang, Han-Zhong
2017-11-01
Jet-related correlations have been regarded as important tools for studying jet-medium interaction and jet quenching in relativistic heavy-ion collisions at RHIC and the LHC. Here we present our recent work [L. Chen, G.-Y. Qin, S.-Y. Wei, B.-W. Xiao, H.-Z. Zhang, Probing Transverse Momentum Broadening via Dihadron and Hadron-jet Angular Correlations in Relativistic Heavy-ion Collisions, arxiv:arXiv:1607.01932] and show that the back-to-back angular correlations in dijet, dihadron and hadron-jet measurements can be utilized as a quantitative tool to probe the medium-induced transverse momentum broadening and to extract jet quenching parameter q̂. By comparing with the dihadron and hadron-jet angular correlation data at RHIC, we obtain the medium-induced transverse momentum broadening, averaged over different jet paths, 〈 p⊥2 〉 ∼ 13 GeV2 for a quark jet in most central Au-Au collisions at 200A GeV. Future experiments with statistically improved data on jet-related (angular) correlations will allow us to obtain more precise knowledge of jet quenching parameter and parton-medium interaction in high-energy nuclear collisions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Fan; Kollias, Pavlos; Shaw, Raymond A.
Cloud droplet size distributions (CDSDs), which are related to cloud albedo and lifetime, are usually broader in warm clouds than predicted from adiabatic parcel calculations. We investigate a mechanism for the CDSD broadening using a Lagrangian bin-microphysics cloud parcel model that considers the condensational growth of cloud droplets formed on polydisperse, sub-micrometer aerosols in an adiabatic cloud parcel that undergoes vertical oscillations, such as those due to cloud circulations or turbulence. Results show that the CDSD can be broadened during condensational growth as a result of Ostwald ripening amplified by droplet deactivation and reactivation, which is consistent with Korolev (1995).more » The relative roles of the solute effect, curvature effect, deactivation and reactivation on CDSD broadening are investigated. Deactivation of smaller cloud droplets, which is due to the combination of curvature and solute effects in the downdraft region, enhances the growth of larger cloud droplets and thus contributes particles to the larger size end of the CDSD. Droplet reactivation, which occurs in the updraft region, contributes particles to the smaller size end of the CDSD. In addition, we find that growth of the largest cloud droplets strongly depends on the residence time of cloud droplet in the cloud rather than the magnitude of local variability in the supersaturation fluctuation. This is because the environmental saturation ratio is strongly buffered by smaller cloud droplets. Two necessary conditions for this CDSD broadening, which generally occur in the atmosphere, are: (1) droplets form on polydisperse aerosols of varying hygroscopicity and (2) the cloud parcel experiences upwards and downwards motions. Therefore we expect that this mechanism for CDSD broadening is possible in real clouds. Our results also suggest it is important to consider both curvature and solute effects before and after cloud droplet activation in a cloud model. The importance
Yang, Fan; Kollias, Pavlos; Shaw, Raymond A.; ...
2017-12-06
Cloud droplet size distributions (CDSDs), which are related to cloud albedo and lifetime, are usually broader in warm clouds than predicted from adiabatic parcel calculations. We investigate a mechanism for the CDSD broadening using a Lagrangian bin-microphysics cloud parcel model that considers the condensational growth of cloud droplets formed on polydisperse, sub-micrometer aerosols in an adiabatic cloud parcel that undergoes vertical oscillations, such as those due to cloud circulations or turbulence. Results show that the CDSD can be broadened during condensational growth as a result of Ostwald ripening amplified by droplet deactivation and reactivation, which is consistent with Korolev (1995).more » The relative roles of the solute effect, curvature effect, deactivation and reactivation on CDSD broadening are investigated. Deactivation of smaller cloud droplets, which is due to the combination of curvature and solute effects in the downdraft region, enhances the growth of larger cloud droplets and thus contributes particles to the larger size end of the CDSD. Droplet reactivation, which occurs in the updraft region, contributes particles to the smaller size end of the CDSD. In addition, we find that growth of the largest cloud droplets strongly depends on the residence time of cloud droplet in the cloud rather than the magnitude of local variability in the supersaturation fluctuation. This is because the environmental saturation ratio is strongly buffered by smaller cloud droplets. Two necessary conditions for this CDSD broadening, which generally occur in the atmosphere, are: (1) droplets form on polydisperse aerosols of varying hygroscopicity and (2) the cloud parcel experiences upwards and downwards motions. Therefore we expect that this mechanism for CDSD broadening is possible in real clouds. Our results also suggest it is important to consider both curvature and solute effects before and after cloud droplet activation in a cloud model. The importance
NASA Astrophysics Data System (ADS)
Yang, Fan; Kollias, Pavlos; Shaw, Raymond A.; Vogelmann, Andrew M.
2018-05-01
Cloud droplet size distributions (CDSDs), which are related to cloud albedo and rain formation, are usually broader in warm clouds than predicted from adiabatic parcel calculations. We investigate a mechanism for the CDSD broadening using a moving-size-grid cloud parcel model that considers the condensational growth of cloud droplets formed on polydisperse, submicrometer aerosols in an adiabatic cloud parcel that undergoes vertical oscillations, such as those due to cloud circulations or turbulence. Results show that the CDSD can be broadened during condensational growth as a result of Ostwald ripening amplified by droplet deactivation and reactivation, which is consistent with early work. The relative roles of the solute effect, curvature effect, deactivation and reactivation on CDSD broadening are investigated. Deactivation of smaller cloud droplets, which is due to the combination of curvature and solute effects in the downdraft region, enhances the growth of larger cloud droplets and thus contributes particles to the larger size end of the CDSD. Droplet reactivation, which occurs in the updraft region, contributes particles to the smaller size end of the CDSD. In addition, we find that growth of the largest cloud droplets strongly depends on the residence time of cloud droplet in the cloud rather than the magnitude of local variability in the supersaturation fluctuation. This is because the environmental saturation ratio is strongly buffered by numerous smaller cloud droplets. Two necessary conditions for this CDSD broadening, which generally occur in the atmosphere, are as follows: (1) droplets form on aerosols of different sizes, and (2) the cloud parcel experiences upwards and downwards motions. Therefore we expect that this mechanism for CDSD broadening is possible in real clouds. Our results also suggest it is important to consider both curvature and solute effects before and after cloud droplet activation in a cloud model. The importance of this mechanism
Optically enhanced SnO{sub 2}/CdSe core/shell nanostructures grown by sol-gel spin coating method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Vijay, E-mail: vijaynadda83@gmail.com; Goswami, Y. C.; Rajaram, P.
2015-08-28
Synthesis of SnO{sub 2}/CdSe metal oxide/ chalcogenide nanostructures on glass micro slides using ultrasonic sol-gel process followed by spin coating has been reported. Stannous chloride, cadmium chloride and selenium dioxide compounds were used for Sn, Cd and Se precursors respectively. Ethylene glycol was used as complexing agent. The samples were characterized by XRD, SEM, AFM and UV-spectrophotometer. All the peaks shown in diffractograms are identified for SnO{sub 2}. Peak broadening observed in core shell due to stress behavior of CdSe lattice. Scanning electron microscope and AFM exhibits the conversion of cluster in to nanorods structures forms. Atomic force microscope showsmore » the structures in nanorods form and a roughness reduced 1.5194 nm by the deposition of CdSe. Uv Visible spectra shows a new absorption edge in the visible region make them useful for optoelectronic applications.« less
Xie, Shangran; Pang, Meng; Bao, Xiaoyi; Chen, Liang
2012-03-12
The dependence of Brillouin linewidth and peak frequency on lightwave state of polarization (SOP) due to fiber inhomogeneity in single mode fiber (SMF) is investigated by using Brillouin optical time domain analysis (BOTDA) system. Theoretical analysis shows fiber inhomogeneity leads to fiber birefringence and sound velocity variation, both of which can cause the broadening and asymmetry of the Brillouin gain spectrum (BGS) and thus contribute to the variation of Brillouin linewidth and peak frequency with lightwave SOP. Due to fiber inhomogeneity both in lateral profile and longitudinal direction, the measured BGS is the superposition of several spectrum components with different peak frequencies within the interaction length. When pump or probe SOP changes, both the peak Brillouin gain and the overlapping area of the optical and acoustic mode profile that determine the peak efficiency of each spectrum component vary within the interaction length, which further changes the linewidth and peak frequency of the superimposed BGS. The SOP dependence of Brillouin linewidth and peak frequency was experimentally demonstrated and quantified by measuring the spectrum asymmetric factor and fitting obtained effective peak frequency respectively via BOTDA system on standard step-index SMF-28 fiber. Experimental results show that on this fiber the Brillouin spectrum asymmetric factor and effective peak frequency vary in the range of 2% and 0.06MHz respectively over distance with orthogonal probe input SOPs. Experimental results also show that in distributed fiber Brillouin sensing, polarization scrambler (PS) can be used to reduce the SOP dependence of Brillouin linewidth and peak frequency caused by fiber inhomogeneity in lateral profile, however it maintains the effects caused by fiber inhomogeneity in longitudinal direction. In the case of non-ideal polarization scrambling using practical PS, the fluctuation of effective Brillouin peak frequency caused by fiber inhomogeneity
Transboundary natural area protection: Broadening the definition of national security
Haven B. Cook
2007-01-01
This paper looks at the definition and concept of national security, and examines how the environment is linked with national security. The traditional, state view of national security that guides most foreign policy includes the concepts of military power, sovereignty and geopolitical stability. This paper advocates broadening the definition of security to include...
Quality's Higher Education Dividends: Broadened Custodianship and Global Public Scholarship
ERIC Educational Resources Information Center
Jacobs, Gerrie J.
2010-01-01
This paper speculates on the possible contribution of the quality movement to higher education and the perceived dividends received from this, in general, over the past two decades but also, more specifically, with reference to the author's institution in South Africa. The first major quality contribution is a gradual broadening of higher…
Liu, Yongliang; Thibodeaux, Devron; Gamble, Gary; Bauer, Philip; VanDerveer, Don
2012-08-01
Despite considerable efforts in developing curve-fitting protocols to evaluate the crystallinity index (CI) from X-ray diffraction (XRD) measurements, in its present state XRD can only provide a qualitative or semi-quantitative assessment of the amounts of crystalline or amorphous fraction in a sample. The greatest barrier to establishing quantitative XRD is the lack of appropriate cellulose standards, which are needed to calibrate the XRD measurements. In practice, samples with known CI are very difficult to prepare or determine. In a previous study, we reported the development of a simple algorithm for determining fiber crystallinity information from Fourier transform infrared (FT-IR) spectroscopy. Hence, in this study we not only compared the fiber crystallinity information between FT-IR and XRD measurements, by developing a simple XRD algorithm in place of a time-consuming and subjective curve-fitting process, but we also suggested a direct way of determining cotton cellulose CI by calibrating XRD with the use of CI(IR) as references.
Broaden Engineering Technology students' knowledge through hands-on with motion robotics
USDA-ARS?s Scientific Manuscript database
The skills and knowledge that employers value most are not always well-aligned with undergraduate engineering technology programs. With the support of a federal grant, we identify and propose to broaden the undergraduate student experience to include training in transferable skills with agricultura...
Exciton broadening and band renormalization due to Dexter-like intervalley coupling
NASA Astrophysics Data System (ADS)
Bernal-Villamil, Ivan; Berghäuser, Gunnar; Selig, Malte; Niehues, Iris; Schmidt, Robert; Schneider, Robert; Tonndorf, Philipp; Erhart, Paul; Michaelis de Vasconcellos, Steffen; Bratschitsch, Rudolf; Knorr, Andreas; Malic, Ermin
2018-04-01
A remarkable property of atomically thin transition metal dichalcogenides (TMDs) is the possibility to selectively address single valleys by circularly polarized light. In the context of technological applications, it is very important to understand possible intervalley coupling mechanisms. Here, we show how the Dexter-like intervalley coupling mixes A and B states from opposite valleys leading to a significant broadening γB_{1s} of the B1s exciton. The effect is much more pronounced in tungsten-based TMDs, where the coupling excitonic states are quasi-resonant. We calculate a ratio γB_{1s}/γA_{1s}≈ 4.0 , which is in good agreement with the experimentally measured value of 3.9+/-0.7 . In addition to the broadening effect, the Dexter-like intervalley coupling also leads to a considerable energy renormalization resulting in an increased energetic distance between A1s and B1s states.
An Experimental and Theoretical Study of Nitrogen-Broadened Acetylene Lines
NASA Technical Reports Server (NTRS)
Thibault, Franck; Martinez, Raul Z.; Bermejo, Dionisio; Ivanov, Sergey V.; Buzykin, Oleg G.; Ma, Qiancheng
2014-01-01
We present experimental nitrogen-broadening coefficients derived from Voigt profiles of isotropic Raman Q-lines measured in the 2 band of acetylene (C2H2) at 150 K and 298 K, and compare them to theoretical values obtained through calculations that were carried out specifically for this work. Namely, full classical calculations based on Gordon's approach, two kinds of semi-classical calculations based on Robert Bonamy method as well as full quantum dynamical calculations were performed. All the computations employed exactly the same ab initio potential energy surface for the C2H2N2 system which is, to our knowledge, the most realistic, accurate and up-to-date one. The resulting calculated collisional half-widths are in good agreement with the experimental ones only for the full classical and quantum dynamical methods. In addition, we have performed similar calculations for IR absorption lines and compared the results to bibliographic values. Results obtained with the full classical method are again in good agreement with the available room temperature experimental data. The quantum dynamical close-coupling calculations are too time consuming to provide a complete set of values and therefore have been performed only for the R(0) line of C2H2. The broadening coefficient obtained for this line at 173 K and 297 K also compares quite well with the available experimental data. The traditional Robert Bonamy semi-classical formalism, however, strongly overestimates the values of half-width for both Qand R-lines. The refined semi-classical Robert Bonamy method, first proposed for the calculations of pressure broadening coefficients of isotropic Raman lines, is also used for IR lines. By using this improved model that takes into account effects from line coupling, the calculated semi-classical widths are significantly reduced and closer to the measured ones.
Broadening Participation in the Society for Integrative and Comparative Biology
Wilga, Cheryl A.D.; Nishiguchi, Michele; Tsukimura, Brian
2017-01-01
Synopsis The goal of the Society for Integrative and Comparative Biology’s Broadening Participation Committee (SICB BPC) is to increase the number of underrepresented group (URG) members within the society and to expand their capabilities as future researchers and leaders within SICB. Our short-term 10-year goal was to increase the recruitment and retention of URG members in the society by 10%. Our long-term 25-year goal is to increase the membership of URG in the society through recruitment and retention until the membership demographic mirrors that of the US Census. Our plans to accomplish this included establishment of a formal standing committee, establishment of a moderate budget to support BPC activities, hosting professional development workshops, hosting diversity and mentor socials, and obtaining grant funds to supplement our budget. This paper documents broadening participation activities in the society, discusses the effectiveness of these activities, and evaluates BPC goals after 5 years of targeted funded activities. Over the past 5 years, the number of URG members rose by 5.2% to a total of 16.2%, members who report ethnicity and gender increased by 25.2% and 18%, respectively, and the number of members attending BPC activities has increased to 33% by 2016. SICB has made significant advances in broadening participation, not only through increased expenditures, but also with a commitment by its members and leadership to increase diversity. Most members realize that increasing diversity will both improve the Society’s ability to develop different approaches to tackling problems within integrative biology, and help solve larger global issues that are evident throughout science and technology fields. In addition, having URG members as part of the executive committee would provide other URG members role models within the society, as well as have a voice in the leadership that represents diversity and inclusion for all scientists. PMID:28881934
NASA Astrophysics Data System (ADS)
Cunha, L.; Apreutesei, M.; Moura, C.; Alves, E.; Barradas, N. P.; Cristea, D.
2018-04-01
The purpose of this work is to discuss the main structural characteristics of a group of tantalum oxynitride (TaNxOy) thin films, with different compositions, prepared by magnetron sputtering, and to interpret and compare the structural changes, by X-ray diffraction (XRD), when the samples are vacuum annealed under two different conditions: i) annealing, followed by ex-situ XRD: one sample of each deposition run was annealed at a different temperature, until a maximum of 800 °C, and the XRD patterns were obtained, at room temperature, after each annealing process; ii) annealing with in-situ XRD: the diffraction patterns are obtained, at certain temperatures, during the annealing process, using always the same sample. In-situ XRD annealing could be an interesting process to perform annealing, and analysing the evolution of the structure with the temperature, when compared to the classical process. A higher structural stability was observed in some of the samples, particularly on those with highest oxygen content, but also on the sample with non-metal (O + N) to metal (Ta) ratio around 0.5.
Extending, Broadening and Rethinking Existing Research on Transfer of Training
ERIC Educational Resources Information Center
Volet, Simone
2013-01-01
The aim of this Special Issue was to generate a new integrated agenda for research on transfer of training. It brought together scholars from diverse perspectives and invited them to strive toward synergy. This article examines how this collection of articles, as well as other bodies of literature, can help extend, broaden and rethink current…
High temperature XRD of Cu2.1Zn0.9SnSe4
NASA Astrophysics Data System (ADS)
Chetty, Raju; Mallik, Ramesh Chandra
2014-04-01
Quaternary compound with chemical composition Cu2.1Zn0.9SnSe4 is prepared by solid state synthesis. High temperature XRD (X-Ray Diffraction) of this compound is used in studying the effect of temperature on lattice parameters and thermal expansion coefficients. Thermal expansion coefficient is one of the important quantities in evaluating the Grüneisen parameter which further useful in determining the lattice thermal conductivity of the material. The high temperature XRD of the material revealed that the lattice parameters as well as thermal expansion coefficients of the material increased with increase in temperature which confirms the presence of anharmonicty.
Acousto-optics bandwidth broadening in a Bragg cell based on arbitrary synthesized signal methods.
Peled, Itay; Kaminsky, Ron; Kotler, Zvi
2015-06-01
In this work, we present the advantages of driving a multichannel acousto-optical deflector (AOD) with a digitally synthesized multifrequency RF signal. We demonstrate a significant bandwidth broadening of ∼40% by providing well-tuned phase control of the array transducers. Moreover, using a multifrequency, complex signal, we manage to suppress the harmonic deflections and return most of the spurious energy to the main beam. This method allows us to operate the AOD with more than an octave of bandwidth with negligible spurious energy going to the harmonic beams and a total bandwidth broadening of over 70%.
Strategies for broadening public involvement in space developments
NASA Technical Reports Server (NTRS)
Harris, Philip R.
1992-01-01
There is widespread public interest in and goodwill toward the space program. For NASA's plans for the next 25 years to be achieved, this public reservoir of support needs to be tapped and channeled. NASA endeavors have to reach out beyond the scientific, technological, and aerospace communities to foster wider participation in space exploration and exploitation. To broaden NASA support and spread out the financing of space activities, recommendations for consideration are offered in the area of economics, political, institutional, international, and managerial areas.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garimella, Venkata BS; Hamid, Ahmed M.; Deng, Liulin
In this work, we report an approach for spatial and temporal gas phase ion population manipulation, and demonstrate its application for the collapse of the ion distributions in ion mobility (IM) separations into tighter packets providing higher sensitivity measurements in conjunction with mass spectrometry (MS). We do this for ions moving from a conventionally traveling wave (TW)-driven region to a region where the TW is intermittently halted or ‘stuttered’. This approach causes the ion packets spanning a number of TW-created traveling traps (TT) to be redistributed into fewer TT, resulting in spatial compression. The degree of spatial compression is controllablemore » and determined by the ratio of stationary time of the TW in the second region to its moving time. This compression ratio ion mobility programming (CRIMP) approach has been implemented using Structures for Lossless Ion Manipulations (SLIM) in conjunction with MS. CRIMP with the SLIM-MS platform is shown to provide increased peak intensities, reduced peak widths, and improved S/N ratios with MS detection. CRIMP also provides a foundation for extremely long path length and multi-pass IM separations in SLIM providing greatly enhanced IM resolution by reducing the detrimental effects of diffusional peak broadening due to increasing peak widths.« less
Broadening the diagnosis of bipolar disorder: benefits vs. risks
STRAKOWSKI, STEPHEN M.; FLECK, DAVID E.; MAJ, MARIO
2011-01-01
There is considerable debate over whether bipolar and related disorders that share common signs and symptoms, but are currently defined as distinct clinical entities in DSM-IV and ICD-10, may be better characterized as falling within a more broadly defined “bipolar spectrum”. With a spectrum view in mind, the possibility of broadening the diagnosis of bipolar disorder has been proposed. This paper discusses some of the rationale for an expanded diagnostic scheme from both clinical and research perspectives in light of potential drawbacks. The ultimate goal of broadening the diagnosis of bipolar disorder is to help identify a common etiopathogenesis for these conditions to better guide treatment. To help achieve this goal, bipolar researchers have increasingly expanded their patient populations to identify objective biological or endophenotypic markers that transcend phenomenological observation. Although this approach has and will likely continue to produce beneficial results, the upcoming DSM-IV and ICD-10 revisions will place increasing scrutiny on psychiatry’s diagnostic classification systems and pressure to re-evaluate our conceptions of bipolar disorder. However, until research findings can provide consistent and converging evidence as to the validity of a broader diagnostic conception, clinical expansion to a dimensional bipolar spectrum should be considered with caution. PMID:21991268
The Organization as Client: Broadening the Concept of Employee Assistance Programs.
ERIC Educational Resources Information Center
Googins, Bradley; Davidson, Bruce N.
1993-01-01
Notes that many employee assistance programs (EAPs) are broadening their function to address rapidly changing human and social issues of environments in which they operate, refocusing practice to include organization as the client. Discusses traditional EAP practice, evolution of EAPs, changes confronting corporations, and alternative model in…
Doppler broadening of neutron-induced resonances using ab initio phonon spectrum
NASA Astrophysics Data System (ADS)
Noguere, G.; Maldonado, P.; De Saint Jean, C.
2018-05-01
Neutron resonances observed in neutron cross section data can only be compared with their theoretical analogues after a correct broadening of the resonance widths. This broadening is usually carried out by two different theoretical models, namely the Free Gas Model and the Crystal Lattice Model, which, however, are only applicable under certain assumptions. Here, we use neutron transmission experiments on UO2 samples at T=23.7 K and T=293.7 K, to investigate the limitations of these models when an ab initio phonon spectrum is introduced in the calculations. Comparisons of the experimental and theoretical transmissions highlight the underestimation of the energy transferred at low temperature and its impact on the accurate determination of the radiation widths Γ_{γ_{λ}} of the 238U resonances λ. The observed deficiency of the model represents an experimental evidence that the Debye-Waller factor is not correctly calculated at low temperature near the Neel temperature ( TN=30.8 K).
Liu, Pin W.; Blair, Nathaniel T.
2017-01-01
Action potential (AP) shape is a key determinant of cellular electrophysiological behavior. We found that in small-diameter, capsaicin-sensitive dorsal root ganglia neurons corresponding to nociceptors (from rats of either sex), stimulation at frequencies as low as 1 Hz produced progressive broadening of the APs. Stimulation at 10 Hz for 3 s resulted in an increase in AP width by an average of 76 ± 7% at 22°C and by 38 ± 3% at 35°C. AP clamp experiments showed that spike broadening results from frequency-dependent reduction of potassium current during spike repolarization. The major current responsible for frequency-dependent reduction of overall spike-repolarizing potassium current was identified as Kv3 current by its sensitivity to low concentrations of 4-aminopyridine (IC50 <100 μm) and block by the peptide inhibitor blood depressing substance I (BDS-I). There was a small component of Kv1-mediated current during AP repolarization, but this current did not show frequency-dependent reduction. In a small fraction of cells, there was a component of calcium-dependent potassium current that showed frequency-dependent reduction, but the contribution to overall potassium current reduction was almost always much smaller than that of Kv3-mediated current. These results show that Kv3 channels make a major contribution to spike repolarization in small-diameter DRG neurons and undergo frequency-dependent reduction, leading to spike broadening at moderate firing frequencies. Spike broadening from frequency-dependent reduction in Kv3 current could mitigate the frequency-dependent decreases in conduction velocity typical of C-fiber axons. SIGNIFICANCE STATEMENT Small-diameter dorsal root ganglia (DRG) neurons mediating nociception and other sensory modalities express many types of potassium channels, but how they combine to control firing patterns and conduction is not well understood. We found that action potentials of small-diameter rat DRG neurons showed spike
Pressure broadening of the ((dt. mu. )dee)/sup */ formation resonances
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cohen, J.S.; Leon, M.; Padial, N.T.
1988-01-01
The treatment of ((dt..mu..)dee)/sup */ formation at high densities as a pressure broadening process is discussed. The quasistatic approximation is shown to satisfy the usual conditions of muon-catalyzed fusion better than does the impact approximation. Complete accurate results are shown for the impact approximation, and a preliminary rough treatment is presented to illustrate the quasistatic approximation. 13 refs., 8 figs.
Al-Haj Husain, Nadin; Camilleri, Josette; Özcan, Mutlu
2016-12-01
Polishing procedures might alter monolithic zirconia (MZ) surface resulting in phase changes that can be deleterious for clinical performance and antagonist tooth wear. This study investigated the topographical features and phase transformation in MZ after polishing with different regimens simulating the clinical workflow. MZ specimens (Katana Zirconia HT, Kuraray-Noritake) (12×12×1.8 mm(3)) were grinded and polished using one of the five systems assessed: BG: Silicone carbide polishers (Brownie, Greenie, Super Greenie); CG: Diamond impregnated ceramic polisher kit (Ceragloss); EV: Synthetically bonded grinder interspersed with diamond (EVE Kit); SL: Urethane coated paper with aluminium oxide grits (Soflex Finishing and Polishing System Kit) and DB: Diamond bur (8 µm). Polished specimens were initially roughened with 220 µm diamond burs (Grinding Bur-GB) (10 s, 160.000160,000 rpm) and considered for baseline measurements. Polishing regimens were performed for 10 s using a slow-speed hand piece under water-cooling except for SL, in a custom made device (750 g; 5000 and 75,000 rpm). Surface roughnesses, phase changes (XRD) were assessed, surface characterization was performed (SEM, EDS). The highest roughness was obtained with the EV system (1.11 µm) compared to those of other systems (0.13-0.4 µm) (pθ and minor peak at 34.94°2θ. While GB, CG, EV, SL and DB exhibited a peak shift to the left, BG demonstrated a right peak shift on the 2θ scale. Monoclinic phase change was not noted in any of the groups. All polishing methods, except BG, exhibited a peak shift towards the lower angles of the 2-theta scale. Since the peak shifts were in the order of fractions of an angle they are attributed to stress formation rather than a phase change in the material. Thus, all polishing systems tested may not be detrimental for the phase transformation of MZ. EV system resulted in the highest roughness and none of the polishing regimens restored the polishability to the
Spectral broadening of optical transitions in InAs/GaAs coupled quantum dot pairs
NASA Astrophysics Data System (ADS)
Kumar, P.; Czarnocki, C.; Jennings, C.; Casara, J.; Monteros, A. L.; Zahbihi, N.; Scheibner, M.; Economou, S. E.; Bracker, A. S.; Pursley, B. C.; Gammon, D.; Carter, S. G.
The optical transitions in InAs/GaAs coupled quantum dot (CQD) pairs are investigated experimentally. These coupled dot systems provide new means to study the interaction of quantum states with the mechanical modes of the crystal environment. Here, the line width and line shape of CQD optical transitions are analyzed in detail as a function of temperature, excitation power, excitation energy, and tunnel coupling strength. A significant line broadening, up to 25 times the typical lifetime-limited linewidth of single-dot excitons, is being observed at level anti-crossings where the coherent tunnel coupling between spatially direct and indirect exciton states is considerable. The experimental observations are compared with theoretical predictions where linewidth broadening at anti-crossings is attributed to the phonon assisted transitions, and found to be strongly dependent on the energy splitting of the two exciton branches. This work focuses on understanding the linewidth broadening due to the pure dephasing, and fundamental aspects of the interaction of these systems with the local environment. This work was supported by the Defense Threat Reduction Agency, Basic Research Award HDTRA1-15-1-0011.
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Lima Batista, Anderson Márcio; Miranda, Marcus Aurélio Ribeiro; Martins, Fátima Itana Chaves Custódio
Several methods can be used to obtain, from powder diffraction patterns, crystallite size and lattice strain of polycrystalline samples. Some examples are the Scherrer equation, Williamson–Hall plots, Warren/Averbach Fourier decomposition, Whole Powder Pattern Modeling, and Debye function analysis. To apply some of these methods, it is necessary to remove the contribution of the instrument to the widths of the diffraction peaks. Nowadays, one of the main samples used for this purpose is the LaB6 SRM660b commercialized by the National Institute of Standard Technology; the width of the diffraction peak of this sample is caused only by the instrumental apparatus. However,more » this sample can be expensive for researchers in developing countries. In this work, the authors present a simple route to obtain micron-sized polycrystalline CeO 2that have a full width at half maximum comparable with the SRM660b and therefore it can be used to remove instrumental broadening.« less
Gable, Philip; Harmon-Jones, Eddie
2010-02-01
Positive and negative affects high in motivational intensity cause a narrowing of attentional focus. In contrast, positive affects low in motivational intensity cause a broadening of attentional focus. The attentional consequences of negative affects low in motivational intensity have not been experimentally investigated. Experiment 1 compared the attentional consequences of negative affect low in motivational intensity (sadness) relative to a neutral affective state. Results indicated that low-motivation negative affect caused attentional broadening. Experiment 2 found that disgust, a high-motivation negative affect not previously investigated in attentional studies, narrowed attentional focus. These experiments support the conceptual model linking high-motivation affective states to narrowed attention and low-motivation affective states to broadened attention.
NASA Astrophysics Data System (ADS)
Martin-Lopez, S.; Carrasco-Sanz, A.; Corredera, P.; Abrardi, L.; Hernanz, M. L.; Gonzalez-Herraez, M.
2006-12-01
The development of high-power cw fiber lasers has triggered a great interest in the phenomena of nonlinear pump spectral broadening and cw supercontinuum generation. These effects have very convenient applications in Raman amplification, optical fiber metrology, and fiber sensing. In particular, it was recently shown that pump incoherence has a strong impact in these processes. We study experimentally the effect of pump incoherence in nonlinear pump spectral broadening and cw supercontinuum generation in optical fibers. We show that under certain experimental conditions an optimum degree of pump incoherence yields the best performance in the broadening process. We qualitatively explain these results, and we point out that these results may have important implications in cw supercontinuum optimization.
Experimental and Theoretical Studies of Pressure Broadened Alkali-Metal Atom Resonance Lines
NASA Technical Reports Server (NTRS)
Shindo, F.; Zhu, C.; Kirby, K.; Babb, J. F.
2006-01-01
We are carrying out a joint theoretical and experimental research program to study the broadening of alkali atom resonance lines due to collisions with helium and molecular hydrogen for applications to spectroscopic studies of brown dwarfs and extrasolar giant planets.
Kinematical line broadening and spatially resolved line profiles from AGN.
NASA Astrophysics Data System (ADS)
Schulz, H.; Muecke, A.; Boer, B.; Dresen, M.; Schmidt-Kaler, T.
1995-03-01
We study geometrical effects for emission-line broadening in the optically thin limit by integrating the projected line emissivity along prespecified lines of sight that intersect rotating or expanding disks or cone-like configurations. Analytical expressions are given for the case that emissivity and velocity follow power laws of the radial distance. The results help to interpret spatially resolved spectra and to check the reliability of numerical computations. In the second part we describe a numerical code applicable to any geometrical configuration. Turbulent motions, atmospheric seeing and effects induced by the size of the observing aperture are simulated with appropriate convolution procedures. An application to narrow-line Hα profiles from the central region of the Seyfert galaxy NGC 7469 is presented. The shapes and asymmetries as well as the relative strengths of the Hα lines from different spatial positions can be explained by emission from a nuclear rotating disk of ionized gas, for which the distribution of Hα line emissivity and the rotation curve are derived. Appreciable turbulent line broadening with a Gaussian σ of ~40% of the rotational velocity has to be included to obtain a satisfactory fit.
Search for Magnetically Broadened Cascade Emission from Blazars with VERITAS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Archambault, S.; Griffin, S.; Archer, A.
2017-02-01
We present a search for magnetically broadened gamma-ray emission around active galactic nuclei (AGNs), using VERITAS observations of seven hard-spectrum blazars. A cascade process occurs when multi-TeV gamma-rays from an AGN interact with extragalactic background light (EBL) photons to produce electron–positron pairs, which then interact with cosmic microwave background photons via inverse-Compton scattering to produce gamma-rays. Due to the deflection of the electron–positron pairs, a non-zero intergalactic magnetic field (IGMF) would potentially produce detectable effects on the angular distribution of the cascade emission. In particular, an angular broadening compared to the unscattered emission could occur. Through non-detection of angularly broadenedmore » emission from 1ES 1218+304, the source with the largest predicted cascade fraction, we exclude a range of IGMF strengths around 10{sup −14} G at the 95% confidence level. The extent of the exclusion range varies with the assumptions made about the intrinsic spectrum of 1ES 1218+304 and the EBL model used in the simulation of the cascade process. All of the sources are used to set limits on the flux due to extended emission.« less
Stark broadening of Ca IV spectral lines of astrophysical interest
NASA Astrophysics Data System (ADS)
Alonso-Medina, A.; Colón, C.
2014-12-01
Ca IV emission lines are under the preview of Solar Ultraviolet Measurements of Emitted Radiation device aboard the Solar and Heliospheric Observatory. Also, lines of the Ca IV in planetary nebulae NGC 7027 were detected with the Short Wavelength Spectrometer on board the Infrared Space Observatory. These facts justify an attempt to provide new spectroscopic parameters of Ca IV. There are no theoretical or experimental Stark broadening data for Ca IV. Using the Griem semi-empirical approach and the COWAN code, we report in this paper calculated values of the Stark broadening parameters for 467 lines of Ca IV. They were calculated using a set of wavefunctions obtained by using Hartree-Fock relativistic calculations. These lines arising from 3s23p4ns (n = 4, 5), 3s23p44p, 3s23p4nd (n = 3, 4) configurations. Stark widths and shifts are presented for an electron density of 1017 cm-3 and temperatures T = 10 000, 20 000 and 50 200 K. As these data cannot be compared to others in the literature, we present an analysis of the different regularities of the values presented in this work.
Quantum Optics Models of EIT Noise and Power Broadening
NASA Astrophysics Data System (ADS)
Snider, Chad; Crescimanno, Michael; O'Leary, Shannon
2011-04-01
When two coherent beams of light interact with an atom they tend to drive the atom to a non-absorbing state through a process called Electromagnetically Induced Transparency (EIT). If the light's frequency dithers, the atom's state stochastically moves in and out of this non-absorbing state. We describe a simple quantum optics model of this process that captures the essential experimentally observed statistical features of this EIT noise, with a particular emphasis on understanding power broadening.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kotani, Teruhisa, E-mail: tkotani@iis.u-tokyo.ac.jp; Institute of Industrial Science, The University of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8505; Advanced Technology Research Laboratories, Sharp Corporation, 2613-1 Ichinomoto-cho, Tenri, Nara 632-8567
2015-09-14
Blue shift and broadening of the absorption spectra of mid-infrared intersubband transition in non-polar m-plane AlGaN/GaN 10 quantum wells were observed with increasing doping density. As the doping density was increased from 6.6 × 10{sup 11} to 6.0 × 10{sup 12 }cm{sup −2} per a quantum well, the intersubband absorption peak energy shifted from 274.0 meV to 302.9 meV, and the full width at half maximum increased from 56.4 meV to 112.4 meV. Theoretical calculations reveal that the blue shift is due to many body effects, and the intersubband linewidth in doped AlGaN/GaN QW is mainly determined by scattering due to interface roughness, LO phonons, and ionized impurities.
Temperature Dependences of Air-Broadening and Shift Parameters in the ν_3 Band of Ozone
NASA Astrophysics Data System (ADS)
Smith, Mary Ann H.; Devi, V. Malathy; Benner, D. Chris
2015-06-01
Line parameter errors can contribute significantly to the total errors in retrievals of terrestrial atmospheric ozone concentration profiles using the strong 9.6-μm band, particularly for nadir-viewing experiments Detailed knowledge of the interfering ozone signal is also needed for retrievals of other atmospheric species in this spectral region. We have determined Lorentz air-broadening and pressure-induced shift coefficients along with their temperature dependences for a number of transitions in the ν_3 fundamental band of 16O_3. These results were obtained by applying the multispectrum nonlinear least-squares fitting technique to a set of 31 high-resolution infrared absorption spectra of O_3 recorded at temperatures between 160 and 300 K with several different room-temperature and coolable sample cells at the McMath-Pierce Fourier transform spectrometer at the National Solar Observatory on Kitt Peak. We compare our results with other available measurements and with the ozone line parameters in the HITRAN database. J.~Worden et al., J.~Geophys.~Res. 109 (2004) 9308-9319. R.~Beer et al., Geophys.~Res.~Lett. 35 (2008) L09801. D.~Chris Benner et al., JQSRT 53 (1995) 705-721. Rothman et al., J. Quant. Spectrosc. Radiat. Transfer 130 (2013) 4. JQSRT 130 (2013) 4-50.
Broadening Educational Outcomes: Social Relations, Skills Development, and Employability for Youth
ERIC Educational Resources Information Center
Dejaeghere, Joan; Wiger, Nancy Pellowski; Willemsen, Laura Wangsness
2016-01-01
This article argues that, if a global development aim is to address educational inequalities, the post-2015 agenda needs to conceptually and practically broaden the focus of learning to include social relations as important processes and outcomes for achieving educational equity. We draw on Sen's capability approach and Bourdieu's forms of capital…
Electromagnetically-induced-transparency intensity-correlation power broadening in a buffer gas
NASA Astrophysics Data System (ADS)
Zheng, Aojie; Green, Alaina; Crescimanno, Michael; O'Leary, Shannon
2016-04-01
Electromagnetically-induced-transparency (EIT) noise correlation spectroscopy holds promise as a simple, robust method for performing high-resolution spectroscopy used in optical magnetometry and clocks. Of relevance to these applications, we report on the role of buffer gas pressure and magnetic field gradients on power broadening of Zeeman-EIT noise correlation resonances.
Zhang, Peng; Li, Houqiang; Wang, Honghui; Wong, Stephen T C; Zhou, Xiaobo
2011-01-01
Peak detection is one of the most important steps in mass spectrometry (MS) analysis. However, the detection result is greatly affected by severe spectrum variations. Unfortunately, most current peak detection methods are neither flexible enough to revise false detection results nor robust enough to resist spectrum variations. To improve flexibility, we introduce peak tree to represent the peak information in MS spectra. Each tree node is a peak judgment on a range of scales, and each tree decomposition, as a set of nodes, is a candidate peak detection result. To improve robustness, we combine peak detection and common peak alignment into a closed-loop framework, which finds the optimal decomposition via both peak intensity and common peak information. The common peak information is derived and loopily refined from the density clustering of the latest peak detection result. Finally, we present an improved ant colony optimization biomarker selection method to build a whole MS analysis system. Experiment shows that our peak detection method can better resist spectrum variations and provide higher sensitivity and lower false detection rates than conventional methods. The benefits from our peak-tree-based system for MS disease analysis are also proved on real SELDI data.
Broadening Participation in the Society for Integrative and Comparative Biology.
Wilga, Cheryl A D; Nishiguchi, Michele; Tsukimura, Brian
2017-07-01
The goal of the Society for Integrative and Comparative Biology's Broadening Participation Committee (SICB BPC) is to increase the number of underrepresented group (URG) members within the society and to expand their capabilities as future researchers and leaders within SICB. Our short-term 10-year goal was to increase the recruitment and retention of URG members in the society by 10%. Our long-term 25-year goal is to increase the membership of URG in the society through recruitment and retention until the membership demographic mirrors that of the US Census. Our plans to accomplish this included establishment of a formal standing committee, establishment of a moderate budget to support BPC activities, hosting professional development workshops, hosting diversity and mentor socials, and obtaining grant funds to supplement our budget. This paper documents broadening participation activities in the society, discusses the effectiveness of these activities, and evaluates BPC goals after 5 years of targeted funded activities. Over the past 5 years, the number of URG members rose by 5.2% to a total of 16.2%, members who report ethnicity and gender increased by 25.2% and 18%, respectively, and the number of members attending BPC activities has increased to 33% by 2016. SICB has made significant advances in broadening participation, not only through increased expenditures, but also with a commitment by its members and leadership to increase diversity. Most members realize that increasing diversity will both improve the Society's ability to develop different approaches to tackling problems within integrative biology, and help solve larger global issues that are evident throughout science and technology fields. In addition, having URG members as part of the executive committee would provide other URG members role models within the society, as well as have a voice in the leadership that represents diversity and inclusion for all scientists. © The Author 2017. Published by
Improving Program Design and Assessment with Broadening Participation Resources
NASA Astrophysics Data System (ADS)
Siegfried, D.; Johnson, A.; Thomas, S. H.; Fauver, A.; Detrick, L.
2012-12-01
Many theoretical and research-based approaches suggest how to best use mentoring to enhance an undergraduate research program. The Institute for Broadening Participation's Pathways to Engineering and Pathways to Ocean Sciences projects synthesized a set of mentoring studies, theoretical sources, and other texts pertinent to undergraduate research program design into a suite of practical tools that includes an online mentoring manual, an online reference library of mentoring and diversity literature, and practical guides such as Using Social Media to Build Diversity in Your REU. The overall goal is to provide easy-to-access resources that can assist faculty and program directors in implementing or honing the mentoring elements in their research programs for undergraduates. IBP's Online Mentoring Manual addresses common themes, such as modeling, student self-efficacy, career development, retention and evaluation. The Online Diversity Reference Library provides a comprehensive, annotated selection of key policy documents, research studies, intervention studies, and other texts on broadening participation in science, technology, engineering and mathematics. IBP's suite of tools provides the theoretical underpinnings and research findings that can help leaders in education integrate site-appropriate mentoring elements into their educational programs. Program directors and faculty from a variety of program types and disciplines have benefitted from using the Manual and other resources. IBP continues the work of translating and synthesizing theory to practice and welcomes your participation and partnership in that effort.
Self- and CO2-broadened line shape parameters for infrared bands of HDO
NASA Astrophysics Data System (ADS)
Smith, Mary-Ann H.; Malathy Devi, V.; Benner, D. Chris; Sung, Keeyoon; Mantz, Arlan W.; Gamache, Robert R.; Villanueva, Geronimo L.
2015-11-01
Knowledge of CO2-broadened HDO line widths and their temperature dependence is required to interpret infrared spectra of the atmospheres of Mars and Venus. However, this information is currently absent in most spectroscopic databases. We have analyzed nine high-resolution, high signal-to-noise spectra of HDO and HDO+CO2 mixtures to obtain broadening coefficients and other line shape parameters for transitions of the ν2 and ν3 vibrational bands located at 7.13 and 2.70 μm, respectively. The gas samples were prepared by mixing equal amounts of high-purity distilled H2O and 99% enriched D2O. The spectra were recorded at different temperatures (255-296 K) using a 20.38 cm long coolable cell [1] installed in the sample compartment of the Bruker IFS125HR Fourier transform spectrometer at the Jet Propulsion Laboratory in Pasadena, CA. The retrieved HDO spectroscopic parameters include line positions, intensities, self- and CO2-broadened half-width and pressure-induced shift coefficients and the temperature dependences for CO2 broadening. These spectroscopic parameters were obtained by simultaneous multispectrum fitting [2] of the same interval in all nine spectra. A non-Voigt line shape with speed dependence was applied. Line mixing was also observed for several transition pairs. Preliminary results compare well with the few other measurements reported in the literature.[1] K. Sung et al., J. Mol. Spectrosc. 162, 124-134 (2010).[2] D. C. Benner et al., J. Quant. Spectrosc. Radiat Transfer 53, 705-721 (1995).The research performed at the College of William and Mary was supported by NASA’s Mars Fundamental Research Program (Grant NNX13AG66G). The research at Jet Propulsion Laboratory, California Institute of Technology, Connecticut College, Langley Research Center, and Goddard Space Flight Center was conducted under contracts and cooperative agreements with the National Aeronautics and Space Administration. RRG is pleased to acknowledge support of this study by the
NASA Technical Reports Server (NTRS)
Idone, V. P.; Orville, R. E.
1985-01-01
The correlation between peak relative light intensity L(R) and stroke peak current I(R) is examined for 39 subsequent return strokes in two triggered lightning flashes. One flash contained 19 strokes and the other 20 strokes for which direct measurements were available of the return stroke peak current at ground. Peak currents ranged from 1.6 to 21 kA. The measurements of peak relative light intensity were obtained from photographic streak recordings using calibrated film and microsecond resolution. Correlations, significant at better than the 0.1 percent level, were found for several functional relationships. Although a relation between L(R) and I(R) is evident in these data, none of the analytical relations considered is clearly favored. The correlation between L(R) and the maximum rate of current rise is also examined, but less correlation than between L(R) and I(R) is found. In addition, the peak relative intensity near ground is evaluated for 22 dart leaders, and a mean ratio of peak dart leader to peak return stroke relative light intensity was found to be 0.1 with a range of 0.02-0.23. Using two different methods, the peak current near ground in these dart leaders is estimated to range from 0.1 to 6 kA.
NASA Astrophysics Data System (ADS)
Duan, B.; Bari, M. A.; Wu, Z. Q.; Jun, Y.; Li, Y. M.; Wang, J. G.
2012-11-01
Aims: We present relativistic quantum mechanical calculations of electron-impact broadening of the singlet and triplet transition 2s3s ← 2s3p in four Be-like ions from N IV to Ne VII. Methods: In our theoretical calculations, the K-matrix and related symmetry information determined by the colliding systems are generated by the DARC codes. Results: A careful comparison between our calculations and experimental results shows good agreement. Our calculated widths of spectral lines also agree with earlier theoretical results. Our investigations provide new methods of calculating electron-impact broadening parameters for plasma diagnostics.
XRD and FTIR crystallinity indices in sound human tooth enamel and synthetic hydroxyapatite.
Reyes-Gasga, José; Martínez-Piñeiro, Esmeralda L; Rodríguez-Álvarez, Galois; Tiznado-Orozco, Gaby E; García-García, Ramiro; Brès, Etienne F
2013-12-01
The crystallinity index (CI) is a measure of the percentage of crystalline material in a given sample and it is also correlated to the degree of order within the crystals. In the literature two ways are reported to measure the CI: X-ray diffraction and infrared spectroscopy. Although the CI determined by these techniques has been adopted in the field of archeology as a structural order measure in the bone with the idea that it can help e.g. in the sequencing of the bones in chronological and/or stratigraphic order, some debate remains about the reliability of the CI values. To investigate similarities and differences between the two techniques, the CI of sound human tooth enamel and synthetic hydroxyapatite (HAP) was measured in this work by X-ray diffraction (XRD) and Fourier Transform Infrared spectroscopy (FTIR), at room temperature and after heat treatment. Although the (CI)XRD index is related to the crystal structure of the samples and the (CI)FTIR index is related to the vibration modes of the molecular bonds, both indices showed similar qualitative behavior for heat-treated samples. At room temperature, the (CI)XRD value indicated that enamel is more crystalline than synthetic HAP, while (CI)FTIR indicated the opposite. Scanning (SEM) and transmission (TEM) images were also used to corroborate the measured CI values. © 2013.
NASA Technical Reports Server (NTRS)
Fox, Kenneth; Jennings, Donald E.; Stern, Elizabeth A.; Hubbard, Rob
1988-01-01
Pressure-broadened widths of rotational-vibrational lines in CH4 have been measured at very high spectral resolution in the R-branch of the 3nu3 overtone. The broadening gases were Ar, He, H2, and N2. Results are presented as averages for J-multiplets at ambient temperature. The overall values (per cm per atm) for these R-branch lines are 0.0651 (CH4-Ar), 0.0508 (CH4-He), 0.0728 (CH4-H2), and 0.0715 (CH4-N2).
NASA Astrophysics Data System (ADS)
Zareii, Seyyed Mojtaba; Arabi, Hadi; Pourarian, Faiz
2014-05-01
A comprehensive study of structural, morphological, hydrogen absorption and magnetic properties of MmNi4.22 Co0.48Mn0.15Al0.15 alloy as a promising hydrogen storage media was investigated. The X-ray diffraction (XRD) profiles show that the alloy maintains its crystal structure (hexagonal LaNi5-type) even after 30 hydrogenation/dehydrogenation (H/D) cycles. However, the XRD peaks are found to be slightly broadened after cycling. SEM images reveal that particles size of the cycled sample decreases, with more uniform particle size distribution compared to noncycled ones. The pressure-composition (PC) isotherms and kinetics curves of hydrogen absorption reaction were obtained at different working temperatures by using a homemade Sievert apparatus. The enthalpy and entropy of hydride formation of the alloy were evaluated. Furthermore, the Jander diffusion and Johnson-Mehl-Avrami models as the fitting models were employed to study the kinetic mechanism of hydriding reaction and its activation energy. The room temperature magnetic measurements indicate that the milling and H/D cycling change the magnetic properties of the as-annealed alloy.
Synthesis and characterization of Ce, Cu co-doped ZnS nanoparticles
NASA Astrophysics Data System (ADS)
Harish, G. S.; Sreedhara Reddy, P.
2015-09-01
Ce, Cu co-doped ZnS nanoparticles were prepared at room temperature using a chemical co-precipitation method. The prepared nanoparticles were characterized by X- ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy dispersive analysis of X-rays (EDAX), diffuse reflectance spectroscopy (DRS), photoluminescence (PL) and high resolution Raman spectroscopic techniques. Transmission electron microscopy (TEM) and X-ray diffraction studies showed that the diameter of the particles was around 2-3 nm. Broadened XRD peaks revealed the formation of nanoparticles with a face centered cubic (fcc) structure. DRS studies confirmed that the band gap increased with an increase in the dopant concentration. The Raman spectra of undoped and Ce, Cu ions co-doped ZnS nanoparticles showed longitudinal optical mode and transverse optical mode. Compared with the Raman modes (276 and 351 cm-1) of undoped ZnS nanoparticles, the Raman modes of Ce, Cu co- doped ZnS nanoparticles were slightly shifted towards lower frequency. PL spectra of the samples showed remarkable enhancement in the intensity upon doping.
NASA Astrophysics Data System (ADS)
Saat, Asmalina Mohamed; Johan, Mohd Rafie
2017-12-01
Synthesis of AlPO4 nanocomposite depends on the ratio of aluminum to phosphate, method of synthesis and the source for aluminum and phosphate source used. Variation of phosphate and aluminum source used will form multiple equilibria reactions and affected by ions variability and concentration, stoichiometry, temperature during reaction process and especially the precipitation pH. Aluminum nitrate was used to produce a partially phosphorylated poly vinyl alcohol-aluminum phosphate (PPVA-AlPO4) nanocomposite with various nanoparticle shapes, structural and properties. Synthesis of PPVA-AlPO4 nanocomposite with aluminum nitrate shows enhancement of thermal and structural in comparison with pure PVA and modified PPVA. Thermogravimetric (TGA) analysis shows that the weight residue of PPVA-AlPO4 composite was higher than PPVA and PVA. X-ray diffraction (XRD) pattern of PVA shows a single peak broadening after the addition of phosphoric acid. Meanwhile, XRD pattern of PPVA-AlPO4 demonstrates multiple phases of AlPO4 in the nanocomposite. Field Emission Scanning Electron Microscopy (FESEM) confirmed the existence of multiple geometrical phases and nanosize of spherical particles.
Brunstein, Craig; Quesenberry, Carol; Davis, John; Jackson, Gene; Scott, Glenn R.; D'Erchia, Terry D.; Swibas, Ed; Carter, Lorna; McKinney, Kevin; Cole, Jim
2006-01-01
For 200 years, Pikes Peak has been a symbol of America's Western Frontier--a beacon that drew prospectors during the great 1859-60 Gold Rush to the 'Pikes Peak country,' the scenic destination for hundreds of thousands of visitors each year, and an enduring source of pride for cities in the region, the State of Colorado, and the Nation. November 2006 marks the 200th anniversary of the Zebulon M. Pike expedition's first sighting of what has become one of the world's most famous mountains--Pikes Peak. In the decades following that sighting, Pikes Peak became symbolic of America's Western Frontier, embodying the spirit of Native Americans, early explorers, trappers, and traders who traversed the vast uncharted wilderness of the Western Great Plains and the Southern Rocky Mountains. High-quality printed paper copies of this poster are available at no cost from Information Services, U.S. Geological Survey (1-888-ASK-USGS).
NASA Astrophysics Data System (ADS)
Baldan, M. R.; Almeida, E. C.; Azevedo, A. F.; Gonçalves, E. S.; Rezende, M. C.; Ferreira, N. G.
2007-11-01
The graphitization index provided by X-ray diffraction (XRD) and Raman spectrometry for reticulated vitreous carbon (RVC) substrates, carbonized at different heat treatment temperatures (HTT), is investigated. A systematic study of the dependence between the disorder-induced D and G Raman bands is presented. The crystallite size La was obtained for both X-ray diffraction and Raman spectrometry techniques. Particularly, the validity for La determination, from Raman spectra, is pointed out comparing the commonly used formula based on peaks amplitude ratio ( ID/ IG) and the recent proposed equation that uses the integrated intensities of D and G bands. The results discrepancy is discussed taken into account the strong contribution of the line broadening presented in carbon materials heat treated below 2000 °C.
Liu, Pin W; Blair, Nathaniel T; Bean, Bruce P
2017-10-04
Action potential (AP) shape is a key determinant of cellular electrophysiological behavior. We found that in small-diameter, capsaicin-sensitive dorsal root ganglia neurons corresponding to nociceptors (from rats of either sex), stimulation at frequencies as low as 1 Hz produced progressive broadening of the APs. Stimulation at 10 Hz for 3 s resulted in an increase in AP width by an average of 76 ± 7% at 22°C and by 38 ± 3% at 35°C. AP clamp experiments showed that spike broadening results from frequency-dependent reduction of potassium current during spike repolarization. The major current responsible for frequency-dependent reduction of overall spike-repolarizing potassium current was identified as Kv3 current by its sensitivity to low concentrations of 4-aminopyridine (IC 50 <100 μm) and block by the peptide inhibitor blood depressing substance I (BDS-I). There was a small component of Kv1-mediated current during AP repolarization, but this current did not show frequency-dependent reduction. In a small fraction of cells, there was a component of calcium-dependent potassium current that showed frequency-dependent reduction, but the contribution to overall potassium current reduction was almost always much smaller than that of Kv3-mediated current. These results show that Kv3 channels make a major contribution to spike repolarization in small-diameter DRG neurons and undergo frequency-dependent reduction, leading to spike broadening at moderate firing frequencies. Spike broadening from frequency-dependent reduction in Kv3 current could mitigate the frequency-dependent decreases in conduction velocity typical of C-fiber axons. SIGNIFICANCE STATEMENT Small-diameter dorsal root ganglia (DRG) neurons mediating nociception and other sensory modalities express many types of potassium channels, but how they combine to control firing patterns and conduction is not well understood. We found that action potentials of small-diameter rat DRG neurons showed spike
ERIC Educational Resources Information Center
Scott, Daniel G.; Evans, Jessica
2010-01-01
This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…
NASA Astrophysics Data System (ADS)
Parmigiani, Francesca; Finot, Christophe; Mukasa, Kazunori; Ibsen, Morten; Roelens, Michael A.; Petropoulos, Periklis; Richardson, David J.
2006-08-01
We propose a new method for generating flat self-phase modulation (SPM)-broadened spectra based on seeding a highly nonlinear fiber (HNLF) with chirp-free parabolic pulses generated using linear pulse shaping in a superstructured fiber Bragg grating (SSFBG). We show that the use of grating reshaped parabolic pulses allows substantially better performance in terms of the extent of SPM-based spectral broadening and flatness relative to conventional hyperbolic secant (sech) pulses. We demonstrate both numerically and experimentally the generation of SPM-broadened pulses centred at 1542 nm with 92% of the pulse energy remaining within the 29 nm 3 dB spectral bandwidth. Applications in spectra slicing and pulse compression are demonstrated.
A Study on Factors Affecting Strength of Solidified Peat through XRD and FESEM Analysis
NASA Astrophysics Data System (ADS)
Rahman, J. A.; Napia, A. M. A.; Nazri, M. A. A.; Mohamed, R. M. S. R.; Al-Geethi, A. S.
2018-04-01
Peat is soft soil that often causes multiple problems to construction. Peat has low shear strength and high deformation characteristics. Thus, peat soil needs to be stabilized or treated. Study on peat stabilization has been conducted for decades with various admixtures and mixing formulations. This project intends to provide an overview of the solidification of peat soil and the factors that affecting the strength of solidified peat soil. Three types of peats which are fabric, hemic and sapric were used in this study to understand the differences on the effect. The understanding of the factors affecting strength of solidified peat in this study is limited to XRD and FESEM analysis only. Peat samples were collected at Pontian, Johor and Parit Raja, Johor. Peat soil was solidified using fly ash, bottom ash and Portland cement with two mixing formulation following literature review. The solidified peat were cured for 7 days, 14 days, 28 days and 56 days. All samples were tested using Unconfined Compressive Strength Test (UCS), X-ray diffraction (XRD) and Field Emission Scanning Electron Microscope (FESEM). The compressive strength test of solidified peat had shown consistently increase of sheer strength, qu for Mixing 1 while decrease of its compressive strength value for Mixing 2. All samples were tested and compared for each curing days. Through XRD, it is found that all solidified peat are dominated with pargasite and richterite. The highest qu is Fabric Mixing 1(FM1) with the value of 105.94 kPa. This sample were proven contain pargasite. Samples with high qu were observed to be having fly ash and bottom ash bound together with the help of pargasite. Sample with decreasing strength showed less amount of pargasite in it. In can be concluded that XRD and FESEM findings are in line with UCS values.
Bispo Júnior, José Patrício; Gerschman, Sílvia
2013-01-01
This article reflects upon the relation between democracy and health councils. It seeks to analyze the councils as a space for broadening the scope of democracy. First, some characteristics and principles of the liberal democratic regime are presented, with an emphasis on the minimalist and procedural approach of decision-making. The fragilities of the representative model and the establishment of new relations between the Government and society are then discussed in light of the new social grammar and the complexity of the division between governmental and societal responsibilities. The principles of deliberative democracy and the idea of substantive democracy are subsequently presented. Broadening the scope of democracy is understood not only as the guarantee of civil and political rights, but also especially, of social rights. Lastly, based on discussion of the participation and deliberation categories, the health councils are analyzed as potential mechanisms for broadening the scope of democracy.
Covariance Matrix of a Double-Differential Doppler-Broadened Elastic Scattering Cross Section
NASA Astrophysics Data System (ADS)
Arbanas, G.; Becker, B.; Dagan, R.; Dunn, M. E.; Larson, N. M.; Leal, L. C.; Williams, M. L.
2012-05-01
Legendre moments of a double-differential Doppler-broadened elastic neutron scattering cross section on 238U are computed near the 6.67 eV resonance at temperature T = 103 K up to angular order 14. A covariance matrix of these Legendre moments is computed as a functional of the covariance matrix of the elastic scattering cross section. A variance of double-differential Doppler-broadened elastic scattering cross section is computed from the covariance of Legendre moments. Notice: This manuscript has been authored by UT-Battelle, LLC, under contract DE-AC05-00OR22725 with the U.S. Department of Energy. The United States Government retains and the publisher, by accepting the article for publication, acknowledges that the United States Government retains a non-exclusive, paid-up, irrevocable, world-wide license to publish or reproduce the published form of this manuscript, or allow others to do so, for United States Government purposes.
Broadening of resistive transition and irreversibility line for epitaxial YBa2Cu3O7-δ thin film
NASA Astrophysics Data System (ADS)
Xiao-jun, Xu; Ke-bin, Li; Jun, Fang; Zhi-he, Wang; Xiao-wen, Cao
1996-04-01
The broadening of resistive transition of c axis oriented epitaxial YBCO thin film has been measured for three configurations: (1) Hparc and H ⊥ I; (2) Hparab plane and H ⊥ I; (3) Hparab plane and HparI in magnetic field up to 8 Tesla(T), and for different angle θ of magnetic field relative to the ab plane with H = 4T. The results obtained indicate that the broadening of resistive transition is mainly determined by the angle θ, but is hardly related to the angle α made between magnetic field and tran sport current in ab plane. This means that the broadening of resistive transition is not determined by flux motion drived by apparent Lorentz force. An expression of angular dependence of irreversibility line has been given.
Pressure broadening and frequency shift of the D 1 and D 2 lines of K in the presence of Ne and Kr
NASA Astrophysics Data System (ADS)
Wang, Xulin; Chen, Yao; Quan, Wei; Chi, Haotian; Fang, Jiancheng
2018-02-01
We present the results of pressure broadening and frequency shift of K D 1 and D 2 lines in presence of 1-4 amg of Neon gas and 1-5 amg of Krypton gas by laser absorption spectroscopy. Both pressure broadening and frequency shift are linearly related to gas density with high accuracy. The asymmetry of the absorption line shape caused by van der Waals potential was first found in the near-line wings of large density Kr in the experiment. We have also investigated the temperature dependence of the pressure broadening and frequency shift in a range of 353-403 K in Neon and 373-417 K in Krypton and compared the results of the pressure broadening and frequency shift with previous values.
NASA Astrophysics Data System (ADS)
Biktagirov, T. B.; Smirnov, A. N.; Davydov, V. Yu.; Doherty, M. W.; Alkauskas, A.; Gibson, B. C.; Soltamov, V. A.
2017-08-01
The negatively charged nitrogen-vacancy (NV-) center in diamond is a promising candidate for many quantum applications. Here, we examine the splitting and broadening of the center's infrared (IR) zero-phonon line (ZPL). We develop a model for these effects that accounts for the strain induced by photodependent microscopic distributions of defects. We apply this model to interpret observed variations of the IR ZPL shape with temperature and photoexcitation conditions. We identify an anomalous temperature-dependent broadening mechanism and that defects other than the substitutional nitrogen center significantly contribute to strain broadening. The former conclusion suggests the presence of a strong Jahn-Teller effect in the center's singlet levels and the latter indicates that major sources of broadening are yet to be identified. These conclusions have important implications for the understanding of the center and the engineering of diamond quantum devices. Finally, we propose that, once the major sources of broadening are identified, the IR ZPL has the potential to be a sensitive spectroscopic tool for probing microscopic strain fields and performing defect tomography.
Larraín, Demetrio; Suárez, Francisco; Braun, Hernán; Chapochnick, Javier; Diaz, Lidia; Rojas, Iván
2018-06-05
To describe our experience with the multidisciplinary management of both thoracic/diaphragmatic endometriosis (TED), applying a broadened definition of the “thoracic endometriosis syndrome (TES)” to define cases. We present a retrospective series of consecutive patients affected by pathology-proven TED, treated at our institution, during a period of 7 years. Five women were included. Two cases were referred due to catamenial chest/shoulder pain, one due to recurrent catamenial pneumothorax, one due to new-onset diaphragmatic hernia. One patient had not thoracic symptoms, and diaphragmatic endometriosis was found during gynecologic laparoscopy for pelvic endometriosis. Endometriosis was histologically confirmed in all cases. After follow-up all patients remain asymptomatic. Broadened TES criteria could increase the incidence of TED and determine better knowledge of this condition. Multidisciplinary, minimally invasive surgery is effective and safe, but should be reserved to tertiary referral centers.
cSELF (Computer Science Education from Life): Broadening Participation through Design Agency
ERIC Educational Resources Information Center
Bennett, Audrey; Eglash, Ron
2013-01-01
The phrase "broadening participation" is often used to describe efforts to decrease the race and gender gap in science and engineering education, and in this paper the authors describe an educational program focused on addressing the lower achievement rates and career interests of underrepresented ethnic groups (African American, Native…
NASA Astrophysics Data System (ADS)
Rous, Philip
2013-03-01
Over the past two decades, UMBC has undertaken a series of efforts to broaden participation in the natural sciences and mathematics, beginning with the establishment of the Meyerhoff program. Using as examples the multiple initiatives that followed, and with a focus on the challenge of increasing access and success of all students who enter as both freshmen and transfer students, I will describe a model of culture change that we have employed repeatedly to understand and guide our efforts in broadening participation. Particular attention will be paid to the concept of cultural capital, the role of innovators and the challenge of scaling small-scale innovations towards institutional change. Supported by the National Science Foundation and the Bill and Melinda Gates Foundation.
Wang, Cheng; Schires, Kevin; Osiński, Marek; Poole, Philip J.; Grillot, Frédéric
2016-01-01
In semiconductor lasers, current injection not only provides the optical gain, but also induces variation of the refractive index, as governed by the Kramers-Krönig relation. The linear coupling between the changes of the effective refractive index and the modal gain is described by the linewidth broadening factor, which is responsible for many static and dynamic features of semiconductor lasers. Intensive efforts have been made to characterize this factor in the past three decades. In this paper, we propose a simple, flexible technique for measuring the linewidth broadening factor of semiconductor lasers. It relies on the stable optical injection locking of semiconductor lasers, and the linewidth broadening factor is extracted from the residual side-modes, which are supported by the amplified spontaneous emission. This new technique has great advantages of insensitivity to thermal effects, the bias current, and the choice of injection-locked mode. In addition, it does not require the explicit knowledge of optical injection conditions, including the injection strength and the frequency detuning. The standard deviation of the measurements is less than 15%. PMID:27302301
Nuclear p ⊥-broadening of an energetic parton pair
NASA Astrophysics Data System (ADS)
Cougoulic, Florian; Peigné, Stéphane
2018-05-01
We revisit the transverse momentum broadening of a fast parton pair crossing a nuclear medium, putting emphasis on the pair global color state, for any number of colors N and within the eikonal limit for parton propagation and the Gaussian approximation for the gluon field of the target. The pair transverse momentum probability distribution is derived in a kinetic equation approach, and is determined by an operator ℬ describing the possible transitions between the pair color states when crossing the medium. The exponential of ℬ encompasses the 4-point correlators of Wilson lines in the saturation formalism. We emphasize the relation of ℬ with the anomalous dimension matrices appearing in the study of soft gluon radiation associated to hard 2 → 2 partonic processes. In a well-chosen, orthonormal basis of the pair color states, we rederive ℬ for any type of parton pair, making maximal use of SU( N) invariants and using `birdtrack' color pictorial notations, providing a quite economical derivation of all previously known 4-point correlators (or equivalently, anomalous dimension matrices for 2 → 2 parton scattering). We discuss some general features of the pair transverse momentum distribution. The latter simplifies in the `compact pair expansion' which singles out the global charges (Casimirs) of the pair color states. This study should provide the necessary tools to address nuclear broadening of n-parton systems in phenomenology while highlighting the color structure of the process.
XRD and FTIR structural investigation of gadolinium-zinc-borate glass ceramics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borodi, G.; Pascuta, P.; Dan, V.
2013-11-13
X-ray diffraction (XRD) and Fourier transform infrared (FTIR) spectroscopy measurements have been employed to investigate the (Gd{sub 2}O{sub 3}){sub x}⋅(B{sub 2}O{sub 3}){sub (60−x)}⋅(ZnO){sub 40} glass ceramics system, with 0 ≤ x ≤ 15 mol%. After heat treatment applied at 860 °C for 2 h, some structural changes were observed and new crystalline phases appeared in the structure of the samples. In these glass ceramics four crystalline phases were identified using powder diffraction files (PDF 2), namely ZnB{sub 4}O{sub 7}, Zn{sub 4}O(B{sub 6}O{sub 12}), Zn{sub 3}(BO{sub 3}){sub 2} and GdBO{sub 3}. From the XRD data, the average unit-cell parameter and themore » quantitative ratio of the crystallographic phases in the studied samples were evaluated. FTIR data revealed that the BO{sub 3}, BO{sub 4} and ZnO{sub 4} are the main structural units of these glass ceramics network. The compositional dependence of the different structural units which appear in the studied samples was followed.« less
Stark broadening of resonant Cr II 3d5-3d44p spectral lines in hot stellar atmospheres
NASA Astrophysics Data System (ADS)
Simić, Z.; Dimitrijević, M. S.; Sahal-Bréchot, S.
2013-07-01
New Stark broadening parameters of interest for the astrophysical, laboratory and technological plasma modelling, investigations and analysis for nine resonant Cr II multiplets have been determined within the semiclassical perturbation approach. In order to demonstrate one possibility for their usage in astrophysical plasma research, obtained results have been applied to the analysis of the Stark broadening influence on stellar spectral line shapes.
Peak high-frequency HRV and peak alpha frequency higher in PTSD.
Wahbeh, Helané; Oken, Barry S
2013-03-01
Posttraumatic stress disorder (PTSD) is difficult to treat and current PTSD treatments are not effective for all people. Despite limited evidence for its efficacy, some clinicians have implemented biofeedback for PTSD treatment. As a first step in constructing an effective biofeedback treatment program, we assessed respiration, electroencephalography (EEG) and heart rate variability (HRV) as potential biofeedback parameters for a future clinical trial. This cross-sectional study included 86 veterans; 59 with and 27 without PTSD. Data were collected on EEG measures, HRV, and respiration rate during an attentive resting state. Measures were analyzed to assess sensitivity to PTSD status and the relationship to PTSD symptoms. Peak alpha frequency was higher in the PTSD group (F(1,84) = 6.14, p = 0.01). Peak high-frequency HRV was lower in the PTSD group (F(2,78) = 26.5, p < 0.00005) when adjusting for respiration rate. All other EEG and HRV measures and respiration were not different between groups. Peak high-frequency HRV and peak alpha frequency are sensitive to PTSD status and may be potential biofeedback parameters for future PTSD clinical trials.
Infrared absorption cross sections of propane broadened by hydrogen
NASA Astrophysics Data System (ADS)
Wong, A.; Hargreaves, R. J.; Billinghurst, B.; Bernath, P. F.
2017-09-01
Fourier transform infrared absorption cross-sections of pure propane (C3H8) and propane broadened with H2 have been calculated from transmittance spectra recorded at temperatures from 292 K to 205 K. Transmittance spectra were recorded at the Canadian Light Source (CLS) Far-Infrared beamline, utilizing both the synchrotron source and the internal glowbar source. The absorption cross-sections have been calibrated to Pacific Northwest National Laboratory (PNNL) reference cross-sections of propane and can be used to interpret astronomical observations of giant planets such as Jupiter and Saturn as well as exoplanets.
Metcalf, Heather
This research methods Essay details the usefulness of critical theoretical frameworks and critical mixed-methodological approaches for life sciences education research on broadening participation in the life sciences. First, I draw on multidisciplinary research to discuss critical theory and methodologies. Then, I demonstrate the benefits of these approaches for researchers who study diversity and inclusion issues in the life sciences through examples from two critical mixed-methods studies of prominent issues in science, technology, engineering, and mathematics (STEM) participation and recognition. The first study pairs critical discourse analysis of the STEM workforce literature, data, and underlying surveys with quantitative analyses of STEM pathways into the workforce. This example illustrates the necessity of questioning popular models of retention. It also demonstrates the importance of intersecting demographic categories to reveal patterns of experience both within and between groups whose access to and participation in STEM we aim to improve. The second study's critical approach applies research on inequities in prizes awarded by STEM professional societies toward organizational change. This example uses data from the life sciences professional societies to show the importance of placing data within context to broaden participation and understand challenges in creating sustainable change. © 2016 H. Metcalf. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Shao, Li-Rong; Halvorsrud, Ragnhild; Borg-Graham, Lyle; Storm, Johan F
1999-01-01
The role of large-conductance Ca2+-dependent K+ channels (BK-channels; also known as maxi-K- or slo-channels) in spike broadening during repetitive firing was studied in CA1 pyramidal cells, using sharp electrode intracellular recordings in rat hippocampal slices, and computer modelling. Trains of action potentials elicited by depolarizing current pulses showed a progressive, frequency-dependent spike broadening, reflecting a reduced rate of repolarization. During a 50 ms long 5 spike train, the spike duration increased by 63·6 ± 3·4% from the 1st to the 3rd spike. The amplitude of the fast after-hyperpolarization (fAHP) also rapidly declined during each train. Suppression of BK-channel activity with (a) the selective BK-channel blocker iberiotoxin (IbTX, 60 nM), (b) the non-peptidergic BK-channel blocker paxilline (2–10 μM), or (c) calcium-free medium, broadened the 1st spike to a similar degree (≈60%). BK-channel suppression also caused a similar change in spike waveform as observed during repetitive firing, and eliminated (occluded) most of the spike broadening during repetitive firing. Computer simulations using a reduced compartmental model with transient BK-channel current and 10 other active ionic currents, produced an activity-dependent spike broadening that was strongly reduced when the BK-channel inactivation mechanism was removed. These results, which are supported by recent voltage-clamp data, strongly suggest that in CA1 pyramidal cells, fast inactivation of a transient BK-channel current (ICT), substantially contributes to frequency-dependent spike broadening during repetitive firing. PMID:10562340
... Living with Asthma > Managing Asthma Measuring Your Peak Flow Rate Download Instructions A peak flow meter is ... to use. Who Benefits from Using a Peak Flow Meter? Many healthcare providers believe that people who ...
The Peak Flow Working Group: test of portable peak flow meters by explosive decompression.
Pedersen, O F; Miller, M R
1997-02-01
In 1991, 50 new Vitalograph peak flow meters and 27 previously used mini-Wright peak flow meters were tested at three peak flows by use of a calibrator applying explosive decompression. The mini-Wright peak flow meters were also compared with eight new meters. For both makes of meter there was an excellent within-meter and between-meter variation. The accuracy, however, was poor, with a maximal overestimation of true flows of 50 and 70 L.min-1 in the interval from 200 to 400 L.min-1 for the Vitalograph and mini-Wright meters, respectively. The deviation is explained by the physical characteristics of the variable orifice peak flow meters. They have been supplied with equidistant scales, which give non-linear readings.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-02
... exempt commercial market (``ECM'') under sections 2(h)(3)-(5) of the Commodity Exchange Act (``CEA'' or... (``Reauthorization Act'') \\4\\ significantly broadened the CFTC's regulatory authority with respect to ECMs by creating, in section 2(h)(7) of the CEA, a new regulatory category--ECMs on which significant price...
Virus-Specific T Cells: Broadening Applicability.
Barrett, A John; Prockop, Susan; Bollard, Catherine M
2018-01-01
Virus infection remains an appreciable cause of morbidity and mortality after hematopoietic stem cell transplantation (HSCT). Although pharmacotherapy and/or antibody therapy may help prevent or treat viral disease, these drugs are expensive, toxic, and often ineffective due to primary or secondary resistance. Further, effective treatments are limited for many infections (eg, adenovirus, BK virus), which are increasingly detected after alternative donor transplants. These deficiencies in conventional therapeutics have increased interest in an immunotherapeutic approach to viral disorders, leading to adoptive transfer of virus-specific cytotoxic T lymphocytes (VSTs), which can rapidly reconstitute antiviral immunity post-transplantation without causing graft-versus-host disease. This review will explore how the VST field has improved outcomes for many patients with life-threatening viral infections after HSCT, and how to broaden applicability beyond the "patient-specific" products, as well as extending to other viral diseases even outside the context of HSCT. Copyright © 2017 The American Society for Blood and Marrow Transplantation. All rights reserved.
NASA Astrophysics Data System (ADS)
Jones, B.; Patino, L. C.; Rom, E. L.; Adams, A.
2017-12-01
The geosciences continue to lag other science, technology, engineering, and mathematics (STEM) disciplines in the engagement, recruitment and retention of traditionally underrepresented and underserved groups, requiring more focused and strategic efforts to address this problem. Prior investments made by the National Science Foundation (NSF) related to broadening participation in STEM have identified many effective strategies and model programs for engaging, recruiting, and retaining underrepresented students in the geosciences. These investments also have documented clearly the importance of committed, knowledgeable, and persistent leadership for making local progress in this area. Achieving diversity at larger and systemic scales requires a network of diversity "champions" who can catalyze widespread adoption of these evidence-based best practices and resources. Although many members of the geoscience community are committed to the ideals of broadening participation, the skills and competencies to achieve success must be developed. The NSF GEO Opportunities for Leadership in Diversity (GOLD) program was implemented in 2016, as a funding opportunity utilizing the Ideas Lab mechanism. Ideas Labs are intensive workshops focused on finding innovative solutions to grand challenge problems. The ultimate aim of this Ideas Lab, organized by the NSF Directorate for Geosciences (GEO), was to facilitate the design, pilot implementation, and evaluation of innovative professional development curricula that can unleash the potential of geoscientists with interests in broadening participation to become impactful leaders within the community. The expectation is that mixing geoscientists with experts in broadening participation research, behavioral change, social psychology, institutional change management, leadership development research, and pedagogies for professional development will not only engender fresh thinking and innovative approaches for preparing and empowering
Moyer, Robert D.
1985-01-01
A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.
Moyer, R.D.
A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.
Elucidation of reaction mechanism involved in the formation of LaNiO3 from XRD and TG analysis
NASA Astrophysics Data System (ADS)
Dharmadhikari, Dipti V.; Athawale, Anjali A.
2013-06-01
The present work is focused on the synthesis and elucidation of reaction mechanism involved in the formation of LaNiO3 with the help of X-ray diffraction (XRD) and thermogravimetric (TG) analysis. LaNiO3 was synthesized by hydrothermal method by heating at 160°C under autogenous pressure for 6h. Pure phase product was obtained after calcining the hydrothermally activated product for 6h at 700°C. The various phases of the product obtained after hydrothermal treatment and calcination followed by the formation of pure phase nanocrystalline lanthanum nickel oxide could be determined from XRD analysis of the samples. The reaction mechanism and phase formation temperature has been interpreted by thermogravimetric analysis of the hydrothermally synthesized product and XRD analysis.
Coherent forward broadening in cold atom clouds
NASA Astrophysics Data System (ADS)
Sutherland, R. T.; Robicheaux, F.
2016-02-01
It is shown that homogeneous line-broadening in a diffuse cold atom cloud is proportional to the resonant optical depth of the cloud. Furthermore, it is demonstrated how the strong directionality of the coherent interactions causes the cloud's spectra to depend strongly on its shape, even when the cloud is held at constant densities. These two numerical observations can be predicted analytically by extending the single-photon wave-function model. Lastly, elongating a cloud along the line of laser propagation causes the excitation probability distribution to deviate from the exponential decay predicted by the Beer-Lambert law to the extent where the atoms at the back of the cloud are more excited than the atoms at the front. These calculations are conducted at the low densities relevant to recent experiments.
NASA Astrophysics Data System (ADS)
Mossberg, T. W.; Whittaker, E.; Kachru, R.; Hartmann, S. R.
1980-11-01
A variant of the trilevel-echo effect is observed and utilized to measure the effective cross section for broadening of the 3P12-3P32 transition of sodium by the noble gases. The cross section measured here should be the same as the broadening cross section obtained from a direct measurement of the collisionally broadened 3P12-3P32 transition linewidth (if such a measurement were possible). The new echo, the "inverted-difference-frequency" (IDF) trilevel echo, is well suited to the study of transitions between excited states of the same parity. At 400 K the measured broadening cross sections are He 115(12) Å2, Ne 120(12) Å2, Ar 234(23) Å2, Kr 266(27) Å2, and Xe 311(31) Å2. With He as the perturber, the cross section for broadening of the 3P12-3P32 transition can be calculated from measured depolarization and fine-structure-changing collision cross sections. With the other perturbers, however, collisional phase changes appear to be important. An intuitive diagrammatic technique for the analysis of echoes is applied to the IDF trilevel echo.
Peak-flow characteristics of Virginia streams
Austin, Samuel H.; Krstolic, Jennifer L.; Wiegand, Ute
2011-01-01
Peak-flow annual exceedance probabilities, also called probability-percent chance flow estimates, and regional regression equations are provided describing the peak-flow characteristics of Virginia streams. Statistical methods are used to evaluate peak-flow data. Analysis of Virginia peak-flow data collected from 1895 through 2007 is summarized. Methods are provided for estimating unregulated peak flow of gaged and ungaged streams. Station peak-flow characteristics identified by fitting the logarithms of annual peak flows to a Log Pearson Type III frequency distribution yield annual exceedance probabilities of 0.5, 0.4292, 0.2, 0.1, 0.04, 0.02, 0.01, 0.005, and 0.002 for 476 streamgaging stations. Stream basin characteristics computed using spatial data and a geographic information system are used as explanatory variables in regional regression model equations for six physiographic regions to estimate regional annual exceedance probabilities at gaged and ungaged sites. Weighted peak-flow values that combine annual exceedance probabilities computed from gaging station data and from regional regression equations provide improved peak-flow estimates. Text, figures, and lists are provided summarizing selected peak-flow sites, delineated physiographic regions, peak-flow estimates, basin characteristics, regional regression model equations, error estimates, definitions, data sources, and candidate regression model equations. This study supersedes previous studies of peak flows in Virginia.
NASA Astrophysics Data System (ADS)
Rodero, A.; García, M. C.
2017-09-01
In this work we propose a new method allowing gas temperature determination in argon non-thermal plasma jets, based on the measurement of the collisional broadening of different argon atomic lines corresponding to transitions into both resonance levels s2 and s4 of the 3p54s configuration. The method was developed for fourteen lines: Ar I 978.45, 935.42, 922.45, 852.14, 840.82, 826.45, 750.39 (corresponding to transitions falling to level s2) and 965.77, 842.46, 810.37, 800.62, 751.46, 738.40, 727.29 nm (corresponding to transitions falling to level s4). A carefully study of the relative importance of all broadening mechanisms to the whole profile for these lines, under a broad range of experimental conditions, revealed that for electron densities and gas temperature lower than 1015 cm-3 and 2000 K, the Stark and Doppler broadenings can be neglected in the method, but the van der Waals contribution should not be ever discarded for gas temperature determination. The gas temperature of a microwave non-thermal plasma jet was determined using nine of these lines. Results were consistent with each other, and with those obtained from the rotational temperature derived from OH ro-vibrational band. Also, the influence of the air entrance on the collisional broadening of the lines has been studied and the way the method should be modified to include this effect is indicated.
NASA Technical Reports Server (NTRS)
Morris, R. V.; Rampe, E. B.; Graff, T. G.; Archer, P. D., Jr.; Le, L.; Ming, D. W.; Sutter, B.
2015-01-01
The Mars Science Laboratory (MSL) CheMin instrument on the Curiosity rover is a transmission X-ray diffractometer (Co-Kalpha radiation source and a approx.5deg to approx.52deg 2theta range) where the analyzed powder samples are constrained to have discrete particle diameters <150 microns by a sieve. To date, diffraction patterns have been obtained for one basaltic soil (Rocknest (RN)) and four drill fines of coherent rock (John Klein (JK), Cumberland (CB), Windjana (WJ), and Confidence Hills (CH)). The CheMin instrument has detected and quantified the abundance of both primary igneous (e.g., feldspar, olivine, and pyroxene) and secondary (e.g., Ca-sulfates, hematite, akaganeite, and Fe-saponite) minerals. The diffraction patterns of all CheMin samples are also characterized by a broad diffraction band centered near 30deg 2theta and by increasing diffraction intensity (scattering continuum) from approx.15deg to approx.5deg, the 2theta minimum. Both the broad band and the scattering continuum are attributed to the presence of an XRD amorphous component. Estimates of amorphous component abundance, based on the XRD data itself and on mass-balance calculations using APXS data crystalline component chemistry derived from XRD data, martian meteorites, and/or stoichiometry [e.g., 6-9], range from approx.20 wt.% to approx.50 wt.% of bulk sample. The APXSbased calculations show that the amorphous component is rich in volatile elements (esp. SO3) and is not simply primary basaltic glass, which was used as a surrogate to model the broad band in the RN CheMin pattern. For RN, the entire volatile inventory (except minor anhydrite) is assigned to the amorphous component because no volatile-bearing crystalline phases were reported within detection limits [2]. For JK and CB, Fesaponite, basanite, and akaganeite are volatile-bearing crystalline components. Here we report transmission XRD patterns for sulfate and silicate phases relevant to interpretation of MSL-CheMin XRD amorphous
Mineralogical composition of the meteorite El Pozo (Mexico): a Raman, infrared and XRD study.
Ostrooumov, Mikhail; Hernández-Bernal, Maria del Sol
2011-12-01
The Raman (RMP), infrared (IR) and XRD analysis have been applied to the examination of mineralogical composition of El Pozo meteorite (an ordinary chondrite L5 type; village Valle of Allende, founded in State of Chihuahua, Mexico: 26°56'N and 105°24'W, 1998). RMP measurements in the range of 100-3500 cm(-1) revealed principal characteristic bands of the major minerals: olivine, two polymorph modifications of pyroxene (OPx and CPx) and plagioclase. Some bands of the minor minerals (hematite and goethite) were also identified. All these minerals were clearly distinguished using IR and XRD techniques. XRD technique has shown the presence of some metallic phases such as kamacite and taenite as well as troilite and chromite. These minerals do not have characteristic Raman spectra because Fe-Ni metals have no active modes for Raman spectroscopy and troilite is a weak Raman scatterer. Raman mapping microspectroscopy was a key part in the investigation of El Pozo meteorite's spatial distribution of the main minerals because these samples are structurally and chemically complex and heterogeneous. The mineral mapping by Raman spectroscopy has provided information for a certain spatial region on which a spatial distribution coexists of the three typical mineral assemblages: olivine; olivine+orthopyroxene; and orthopyroxene. Copyright © 2011 Elsevier B.V. All rights reserved.
Air-broadened Lorentz halfwidths and pressure-induced line shifts in the nu(4) band of C-13H4
NASA Technical Reports Server (NTRS)
Devi, V. Malathy; Benner, D. Chris; Rinsland, Curtis P.; Smith, Mary Ann H.
1988-01-01
Air-broadened halfwidths and pressure-induced line shifts in the nu(4) fundamental of C-13H4 were determined from spectra recorded at room temperature and at 0.01/cm resolution using a Fourier transform spectrometer. Halfwidths and pressure shifts were determined for over 180 transitions belonging to J-double prime values of less than or = to 16. Comparisons of air-broadened halfwidths and pressure-induced line shifts made for identical transitions in the nu(4) bands of C-12H4 and C-13H4 have shown that C-13H4 air-broadened halfwidths are about 5 percent smaller than the corresponding C-12H4 halfwidths, and the pressure shifts for C-13H4 lines are about 5-15 percent larger than those for C-12H4.
Peak High-Frequency HRV and Peak Alpha Frequency Higher in PTSD
Oken, Barry S.
2012-01-01
Posttraumatic stress disorder (PTSD) is difficult to treat and current PTSD treatments are not effective for all people. Despite limited evidence for its efficacy, some clinicians have implemented biofeedback for PTSD treatment. As a first step in constructing an effective biofeedback treatment program, we assessed respiration, electroencephalography (EEG) and heart rate variability (HRV) as potential biofeedback parameters for a future clinical trial. This cross-sectional study included 86 veterans; 59 with and 27 without PTSD. Data were collected on EEG measures, HRV, and respiration rate during an attentive resting state. Measures were analyzed to assess sensitivity to PTSD status and the relationship to PTSD symptoms. Peak alpha frequency was higher in the PTSD group (F(1,84) = 6.14, p = 0.01). Peak high-frequency HRV was lower in the PTSD group (F(2,78) = 26.5, p<0.00005) when adjusting for respiration rate. All other EEG and HRV measures and respiration were not different between groups. Peak high-frequency HRV and peak alpha frequency are sensitive to PTSD status and may be potential biofeedback parameters for future PTSD clinical trials. PMID:23178990
Attitudes and Motivation of Poor and Good Spellers: Broadening Planned Behavior Theory
ERIC Educational Resources Information Center
Sideridis, Georgios D.
2005-01-01
The purpose of the present study was to broaden planned behavior theory and examine its applicability to predict the academic achievement of students of low and high spelling ability. Two hundred fifty seven students, 54 low spellers and 203 high spellers from thirty elementary schools in northern Greece, participated in the study. Between groups…
Music-induced positive mood broadens the scope of auditory attention
Makkonen, Tommi; Eerola, Tuomas
2017-01-01
Abstract Previous studies indicate that positive mood broadens the scope of visual attention, which can manifest as heightened distractibility. We used event-related potentials (ERP) to investigate whether music-induced positive mood has comparable effects on selective attention in the auditory domain. Subjects listened to experimenter-selected happy, neutral or sad instrumental music and afterwards participated in a dichotic listening task. Distractor sounds in the unattended channel elicited responses related to early sound encoding (N1/MMN) and bottom-up attention capture (P3a) while target sounds in the attended channel elicited a response related to top-down-controlled processing of task-relevant stimuli (P3b). For the subjects in a happy mood, the N1/MMN responses to the distractor sounds were enlarged while the P3b elicited by the target sounds was diminished. Behaviorally, these subjects tended to show heightened error rates on target trials following the distractor sounds. Thus, the ERP and behavioral results indicate that the subjects in a happy mood allocated their attentional resources more diffusely across the attended and the to-be-ignored channels. Therefore, the current study extends previous research on the effects of mood on visual attention and indicates that even unfamiliar instrumental music can broaden the scope of auditory attention via its effects on mood. PMID:28460035
Music-induced positive mood broadens the scope of auditory attention.
Putkinen, Vesa; Makkonen, Tommi; Eerola, Tuomas
2017-07-01
Previous studies indicate that positive mood broadens the scope of visual attention, which can manifest as heightened distractibility. We used event-related potentials (ERP) to investigate whether music-induced positive mood has comparable effects on selective attention in the auditory domain. Subjects listened to experimenter-selected happy, neutral or sad instrumental music and afterwards participated in a dichotic listening task. Distractor sounds in the unattended channel elicited responses related to early sound encoding (N1/MMN) and bottom-up attention capture (P3a) while target sounds in the attended channel elicited a response related to top-down-controlled processing of task-relevant stimuli (P3b). For the subjects in a happy mood, the N1/MMN responses to the distractor sounds were enlarged while the P3b elicited by the target sounds was diminished. Behaviorally, these subjects tended to show heightened error rates on target trials following the distractor sounds. Thus, the ERP and behavioral results indicate that the subjects in a happy mood allocated their attentional resources more diffusely across the attended and the to-be-ignored channels. Therefore, the current study extends previous research on the effects of mood on visual attention and indicates that even unfamiliar instrumental music can broaden the scope of auditory attention via its effects on mood. © The Author (2017). Published by Oxford University Press.
Dvořák, Martin; Svobodová, Jana; Dubský, Pavel; Riesová, Martina; Vigh, Gyula; Gaš, Bohuslav
2015-03-01
Although the classical formula of peak resolution was derived to characterize the extent of separation only for Gaussian peaks of equal areas, it is often used even when the peaks follow non-Gaussian distributions and/or have unequal areas. This practice can result in misleading information about the extent of separation in terms of the severity of peak overlap. We propose here the use of the equivalent peak resolution value, a term based on relative peak overlap, to characterize the extent of separation that had been achieved. The definition of equivalent peak resolution is not constrained either by the form(s) of the concentration distribution function(s) of the peaks (Gaussian or non-Gaussian) or the relative area of the peaks. The equivalent peak resolution value and the classically defined peak resolution value are numerically identical when the separated peaks are Gaussian and have identical areas and SDs. Using our new freeware program, Resolution Analyzer, one can calculate both the classically defined and the equivalent peak resolution values. With the help of this tool, we demonstrate here that the classical peak resolution values mischaracterize the extent of peak overlap even when the peaks are Gaussian but have different areas. We show that under ideal conditions of the separation process, the relative peak overlap value is easily accessible by fitting the overall peak profile as the sum of two Gaussian functions. The applicability of the new approach is demonstrated on real separations. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Osteoporosis: Peak Bone Mass in Women
... Osteoporosis: Peak Bone Mass in Women Osteoporosis: Peak Bone Mass in Women Bones are the framework for ... that affect peak bone mass. Factors Affecting Peak Bone Mass A variety of genetic and environmental factors ...
Eberl, D.D.; Drits, V.A.; Środoń, Jan; Nüesch, R.
1996-01-01
Particle size may strongly influence the physical and chemical properties of a substance (e.g. its rheology, surface area, cation exchange capacity, solubility, etc.), and its measurement in rocks may yield geological information about ancient environments (sediment provenance, degree of metamorphism, degree of weathering, current directions, distance to shore, etc.). Therefore mineralogists, geologists, chemists, soil scientists, and others who deal with clay-size material would like to have a convenient method for measuring particle size distributions. Nano-size crystals generally are too fine to be measured by light microscopy. Laser scattering methods give only average particle sizes; therefore particle size can not be measured in a particular crystallographic direction. Also, the particles measured by laser techniques may be composed of several different minerals, and may be agglomerations of individual crystals. Measurement by electron and atomic force microscopy is tedious, expensive, and time consuming. It is difficult to measure more than a few hundred particles per sample by these methods. This many measurements, often taking several days of intensive effort, may yield an accurate mean size for a sample, but may be too few to determine an accurate distribution of sizes. Measurement of size distributions by X-ray diffraction (XRD) solves these shortcomings. An X-ray scan of a sample occurs automatically, taking a few minutes to a few hours. The resulting XRD peaks average diffraction effects from billions of individual nano-size crystals. The size that is measured by XRD may be related to the size of the individual crystals of the mineral in the sample, rather than to the size of particles formed from the agglomeration of these crystals. Therefore one can determine the size of a particular mineral in a mixture of minerals, and the sizes in a particular crystallographic direction of that mineral.
XRD and SEM study of alumina silicate porcelain insulator
NASA Astrophysics Data System (ADS)
Duddi, Dharmender; Singh, G. P.; Kalra, Swati; Shekhawat, M. S.; Tak, S. K.
2018-05-01
Higher strength electrical porcelain is a requirement of industry. This will be achieved by a specific composition of raw materials, which is consisted of clays and feldspars. Water absorption, particle size and insulating properties are of special interest now a day. China clay, Ball clay and Quartz are widely used by ceramic industries in Bikaner district of Rajasthan. Sample for present study were prepared by mixing of above clay, feldspar with MnO2, then shrinkage is observed. Bar shaped samples were prepared and heated up to a temperature of about 1185° C to observe shrinkage. For phase study of XRD and SEM are observed.
NASA Technical Reports Server (NTRS)
2002-01-01
(Released 14 June 2002) The Science This THEMIS visible image shows a classic example of a martian impact crater with a central peak. Central peaks are common in large, fresh craters on both Mars and the Moon. This peak formed during the extremely high-energy impact cratering event. In many martian craters the central peak has been either eroded or buried by later sedimentary processes, so the presence of a peak in this crater indicates that the crater is relatively young and has experienced little degradation. Observations of large craters on the Earth and the Moon, as well as computer modeling of the impact process, show that the central peak contains material brought from deep beneath the surface. The material exposed in these peaks will provide an excellent opportunity to study the composition of the martian interior using THEMIS multi-spectral infrared observations. The ejecta material around the crater can is well preserved, again indicating relatively little modification of this landform since its initial creation. The inner walls of this approximately 18 km diameter crater show complex slumping that likely occurred during the impact event. Since that time there has been some downslope movement of material to form the small chutes and gullies that can be seen on the inner crater wall. Small (50-100 m) mega-ripples composed of mobile material can be seen on the floor of the crater. Much of this material may have come from the walls of the crater itself, or may have been blown into the crater by the wind. The Story When a meteor smacked into the surface of Mars with extremely high energy, pow! Not only did it punch an 11-mile-wide crater in the smoother terrain, it created a central peak in the middle of the crater. This peak forms kind of on the 'rebound.' You can see this same effect if you drop a single drop of milk into a glass of milk. With craters, in the heat and fury of the impact, some of the land material can even liquefy. Central peaks like the one
An Integrated XRF/XRD Instrument for Mars Exobiology and Geology Experiments
NASA Technical Reports Server (NTRS)
Koppel, L. N.; Franco, E. D.; Kerner, J. A.; Fonda, M. L.; Schwartz, D. E.; Marshall, J. R.
1993-01-01
By employing an integrated x-ray instrument on a future Mars mission, data obtained will greatly augment those returned by Viking; details characterizing the past and present environment on Mars and those relevant to the possibility of the origin and evolution of life will be acquired. A combined x-ray fluorescence/x-ray diffraction (XRF/XRD) instrument was breadboarded and demonstrated to accommodate important exobiology and geology experiment objectives outlined for MESUR and future Mars missions. Among others, primary objectives for the exploration of Mars include the intense study of local areas on Mars to establish the chemical, mineralogical, and petrological character of different components of the surface material; to determine the distribution, abundance, and sources and sinks of volatile materials, including an assessment of the biologic potential, now and during past epoches; and to establish the global chemical and physical characteristics of the Martian surface. The XRF/XRD breadboard instrument identifies and quantifies soil surface elemental, mineralogical, and petrological characteristics and acquires data necessary to address questions on volatile abundance and distribution. Additionally, the breadboard is able to characterize the biogenic element constituents of soil samples providing information on the biologic potential of the Mars environment. Preliminary breadboard experiments confirmed the fundamental instrument design approach and measurement performance.
Effect of gear ratio on peak power and time to peak power in BMX cyclists.
Rylands, Lee P; Roberts, Simon J; Hurst, Howard T
2017-03-01
The aim of this study was to ascertain if gear ratio selection would have an effect on peak power and time to peak power production in elite Bicycle Motocross (BMX) cyclists. Eight male elite BMX riders volunteered for the study. Each rider performed three, 10-s maximal sprints on an Olympic standard indoor BMX track. The riders' bicycles were fitted with a portable SRM power meter. Each rider performed the three sprints using gear ratios of 41/16, 43/16 and 45/16 tooth. The results from the 41/16 and 45/16 gear ratios were compared to the current standard 43/16 gear ratio. Statistically, significant differences were found between the gear ratios for peak power (F(2,14) = 6.448; p = .010) and peak torque (F(2,14) = 4.777; p = .026), but no significant difference was found for time to peak power (F(2,14) = 0.200; p = .821). When comparing gear ratios, the results showed a 45/16 gear ratio elicited the highest peak power,1658 ± 221 W, compared to 1436 ± 129 W and 1380 ± 56 W, for the 43/16 and 41/16 ratios, respectively. The time to peak power showed a 41/16 tooth gear ratio attained peak power in -0.01 s and a 45/16 in 0.22 s compared to the 43/16. The findings of this study suggest that gear ratio choice has a significant effect on peak power production, though time to peak power output is not significantly affected. Therefore, selecting a higher gear ratio results in riders attaining higher power outputs without reducing their start time.
PeakVizor: Visual Analytics of Peaks in Video Clickstreams from Massive Open Online Courses.
Chen, Qing; Chen, Yuanzhe; Liu, Dongyu; Shi, Conglei; Wu, Yingcai; Qu, Huamin
2016-10-01
Massive open online courses (MOOCs) aim to facilitate open-access and massive-participation education. These courses have attracted millions of learners recently. At present, most MOOC platforms record the web log data of learner interactions with course videos. Such large amounts of multivariate data pose a new challenge in terms of analyzing online learning behaviors. Previous studies have mainly focused on the aggregate behaviors of learners from a summative view; however, few attempts have been made to conduct a detailed analysis of such behaviors. To determine complex learning patterns in MOOC video interactions, this paper introduces a comprehensive visualization system called PeakVizor. This system enables course instructors and education experts to analyze the "peaks" or the video segments that generate numerous clickstreams. The system features three views at different levels: the overview with glyphs to display valuable statistics regarding the peaks detected; the flow view to present spatio-temporal information regarding the peaks; and the correlation view to show the correlation between different learner groups and the peaks. Case studies and interviews conducted with domain experts have demonstrated the usefulness and effectiveness of PeakVizor, and new findings about learning behaviors in MOOC platforms have been reported.
NASA Astrophysics Data System (ADS)
Ngo, N. H.; Lin, H.; Hodges, J. T.; Tran, H.
2017-12-01
High signal-to-noise ratio spectra of the (3-0) band P(1) and P(17) lines of CO broadened by He, Ar, Kr and SF6 were measured with a frequency-stabilized cavity ring-down spectroscopy system. For each collision-partner and both lines, multiple spectra were measured over pressures spanning nearly three decades up to 130 kPa. These data were analyzed with a multispectrum fitting procedure. Line shapes were modeled using the Hartmann-Tran (HT) profile with first-order line mixing as well as several other simplified profiles. The results show that for all considered collision partners (with the exception of SF6), the HT profile captures the measured line shapes with maximum absolute residuals that are within 0.1% of the peak absorption. In the case of SF6, which is the heaviest perturber investigated here, the maximum residuals for the HT profile are twice as large as for the other collision partners.
Coherent Forward Broadening in Cold Atom Clouds
NASA Astrophysics Data System (ADS)
Sutherland, R. T.; Robicheaux, Francis
2016-05-01
It is shown that homogeneous line-broadening in a diffuse cold atom cloud is proportional to the resonant optical depth of the cloud. Further, it is demonstrated how the strong directionality of the coherent interactions causes the cloud's spectra to depend strongly on its shape, even when the cloud is held at constant densities. These two numerical observations can be predicted analytically by extending the single photon wavefunction model. Lastly, elongating a cloud along the line of laser propagation causes the excitation probability distribution to deviate from the exponential decay predicted by the Beer-Lambert law to the extent where the atoms in the back of the cloud are more excited than the atoms in the front. These calculations are conducted at low densities relevant to recent experiments. This work was supported by the National Science Foundation under Grant No. 1404419-PHY.
PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information
Wu, Hao; Ji, Hongkai
2014-01-01
ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116
Position sensitivity in large spectroscopic LaBr3:Ce crystals for Doppler broadening correction
NASA Astrophysics Data System (ADS)
Blasi, N.; Giaz, A.; Boiano, C.; Brambilla, S.; Camera, F.; Million, B.; Riboldi, S.
2016-12-01
The position sensitivity of a large LaBr3:Ce crystal was investigated with the aim of correcting for the Doppler broadening in nuclear physics experiments. The crystal was cylindrical, 3 in×3 in (7.62 cm x 7.62 cm) and with diffusive surfaces as typically used in nuclear physics basic research to measure medium or high energy gamma rays (0.5 MeV
NASA Technical Reports Server (NTRS)
Castro, Stephanie L.; Bailey, Sheila G.; Raffaelle, Ryne P.; Banger, Kulbinder K.; Hepp, Aloysius F.
2003-01-01
Nanometer sized particles of the chalcopyrite compounds CuInS2 and CuInSe2 were synthesized by thermal decomposition of molecular single-source precursors (PPh3)2CuIn(SEt)4 and (PPh3)2CuIn(SePh)4, respectively, in the non-coordinating solvent dioctyl phthalate at temperatures between 200 and 300 C. The nanoparticles range in size from 3 - 30 nm and are aggregated to form roughly spherical clusters of about 500 nm in diameter. X-ray diffraction of the nanoparticle powders shows greatly broadened lines indicative of very small particle sizes, which is confirmed by TEM. Peaks present in the XRD can be indexed to reference patterns for the respective chalcopyrite compounds. Optical spectroscopy and elemental analysis by energy dispersive spectroscopy support the identification of the nanoparticles as chalcopyrites.
Synthesis and optical properties of Eu 3+ and Tb 3+ doped GaN nanocrystallite powders
NASA Astrophysics Data System (ADS)
Nyk, M.; Kudrawiec, R.; Strek, W.; Misiewicz, J.
2006-05-01
The GaN nanocrystallite powders obtained by thermal decomposition of pure and doped gallium nitrate followed by nitridation with ammonia are investigated in this paper. The evolution of the phase composition, structure and morphology was studied. The average size of GaN nanocrystallites estimated from the broadening of XRD diffraction peaks was found to be ˜9-21 nm. The photoluminescence and cathodoluminescence properties of pure and Eu 3+ and Tb 3+ doped GaN nanocrystallites were measured and analyzed. A strong emission related to f-f electron transition in Eu and Tb ions has been observed. In addition, a red/yellow emission related to a recombination in the GaN nanocrystalline grains has been observed. It has been shown that this emission strongly depends on the excitation source.
Positron annihilation lifetime and Doppler broadening spectroscopy at the ELBE facility
NASA Astrophysics Data System (ADS)
Wagner, Andreas; Butterling, Maik; Liedke, Maciej O.; Potzger, Kay; Krause-Rehberg, Reinhard
2018-05-01
The Helmholtz-Zentrum Dresden-Rossendorf operates a superconducting linear accelerator for electrons with energies up to 35 MeV and average beam currents up to 1.6 mA with bunch charges up to 120 pC. The electron beam is employed to produce several secondary beams including X-rays from bremsstrahlung production, coherent IR light in a Free Electron Laser, superradiant THz radiation, neutrons, and positrons. The secondary positron beam after moderation feeds the Monoenergetic Positron Source (MePS) where positron annihilation lifetime (PALS) and positron annihilation Doppler-broadening experiments in materials science are performed. The adjustable repetition rate of the continuous-wave electron beams allows matching of the pulse separation to the positron lifetime in the sample under study. The energy of the positron beam can be set between 0.5 keV and 20 keV to perform depth resolved defect spectroscopy and porosity studies especially for thin films. Bulk materials, fluids, gases, and even radioactive samples can be studied at the unique Gamma-induced Positron Source (GiPS) where an intense bremsstrahlung source generates positrons directly inside the material under study. A 22Na-based monoenergetic positron beam serves for offline experiments and additional depth-resolved Doppler-broadening studies complementing both accelerator-based sources.
NASA Astrophysics Data System (ADS)
Petrova, T. M.; Solodov, A. M.; Solodov, A. A.; Deichuli, V. M.; Starikov, V. I.
2018-05-01
The water vapour line broadening and shifting for 97 lines in the ν1 + ν2 + ν3 band induced by hydrogen pressure are measured with Bruker IFS 125 HR FTIR spectrometer. The measurements were performed at room temperature, at the spectral resolution of 0.01 cm-1 and in a wide pressure range of H2. The calculations of the broadening γ and shift δ coefficients were performed in the semi-classical method framework with use of an effective vibrationally depended interaction potential. Two potential parameters were optimised to improve the quality of calculations. Good agreements with measured broadening coefficients were achieved. The comparison of calculated broadening coefficients γ with the previous measurements is discussed. The analytical expressions that reproduce these coefficients for rotational, ν2, ν1, and ν3 vibrational bands are presented.
Conlon, Eddie
2013-12-01
Two issues of particular interest in the Irish context are (1) the motivation for broadening engineering education to include the humanities, and an emphasis on social responsibility and (2) the process by which broadening can take place. Greater community engagement, arising from a socially-driven model of engineering education, is necessary if engineering practice is to move beyond its present captivity by corporate interests.
Mössbauer and XRD study of novel quaternary Sn-Fe-Co-Ni electroplated alloy
NASA Astrophysics Data System (ADS)
Kuzmann, E.; Sziráki, L.; Stichleutner, S.; Homonnay, Z.; Lak, G. B.; El-Sharif, M.; Chisholm, C. U.
2017-11-01
Constant current electrochemical deposition technique was used to obtain quaternary alloys of Sn-Fe-Co-Ni from a gluconate electrolyte, which to date have not been reported in the literature. For the characterization of electroplated alloys, 57Fe and 119Sn Conversion Electron Mössbauer Spectroscopy (CEMS), XRD and SEM/EDAX were used. XRD revealed the amorphous character of the novel Sn-Fe-Co-Ni electrodeposited alloys. 57Fe Mössbauer spectrum of quaternary deposit with composition of 37.0 at% Sn, 38.8 at% Fe, 16.8 at% Co and 7.4 at% Ni displayed a magnetically split sextet (B = 28.9T) with broad lines typical of iron bearing ferromagnetic amorphous alloys. Magnetically split 119Sn spectra reflecting a transferred hyperfine field (B = 2.3T) were also observed. New quaternary Sn-Fe-Co-Ni alloys were successfully prepared.
Mastin, M.C.; Kresch, D.L.
2005-01-01
The 1921 peak discharge at Skagit River near Concrete, Washington (U.S. Geological Survey streamflow-gaging station 12194000), was verified using peak-discharge data from the flood of October 21, 2003, the largest flood since 1921. This peak discharge is critical to determining other high discharges at the gaging station and to reliably estimating the 100-year flood, the primary design flood being used in a current flood study of the Skagit River basin. The four largest annual peak discharges of record (1897, 1909, 1917, and 1921) were used to determine the 100-year flood discharge at Skagit River near Concrete. The peak discharge on December 13, 1921, was determined by James E. Stewart of the U.S. Geological Survey using a slope-area measurement and a contracted-opening measurement. An extended stage-discharge rating curve based on the 1921 peak discharge was used to determine the peak discharges of the three other large floods. Any inaccuracy in the 1921 peak discharge also would affect the accuracies of the three other largest peak discharges. The peak discharge of the 1921 flood was recalculated using the cross sections and high-water marks surveyed after the 1921 flood in conjunction with a new estimate of the channel roughness coefficient (n value) based on an n-verification analysis of the peak discharge of the October 21, 2003, flood. The n value used by Stewart for his slope-area measurement of the 1921 flood was 0.033, and the corresponding calculated peak discharge was 240,000 cubic feet per second (ft3/s). Determination of a single definitive water-surface profile for use in the n-verification analysis was precluded because of considerable variation in elevations of surveyed high-water marks from the flood on October 21, 2003. Therefore, n values were determined for two separate water-surface profiles thought to bracket a plausible range of water-surface slopes defined by high-water marks. The n value determined using the flattest plausible slope was 0
NASA Astrophysics Data System (ADS)
Sears, Trevor; Twagirayezu, Sylvestre; Hall, Gregory
2017-06-01
Saturation dip spectra of acetylene in the v_1 + v_3 band have been obtained for rotational lines with J = 31-37 inclusive, using a diode laser referenced to a frequency comb. The estimated accuracy and precision of the measurements is better than 10 kHz in 194 THz. Data were obtained as a function of sample pressure to investigate the broadening of the saturation features. The observed line shapes are well modeled by convolution of a fixed Gaussian transit-time and varying Lorentzian lifetime broadening, i.e. a Voigt-type profile. The lines exhibit a significantly larger collisional (lifetime) broadening than has been measured in conventional Doppler and pressure-broadened samples at ambient temperatures. The figure shows the fitted Lorentzian width versus sample pressure for P(31). The slope of this plot gives the pressure broadening coefficient, γ_{self} = 9.35(13) MHz/mbar. For comparison, the coefficient derived from conventional Doppler and pressure broadened spectra for this transition is 2.7 MHz/mbar. The sub-Doppler broadening coefficients are all significantly larger than the conventionally measured ones, due to the increased importance of velocity-changing collisions. The measurements therefore give information on the balance between hard phase- or state-changing and large cross-section velocity-changing collisions. Acknowledgments: Work at Brookhaven National Laboratory was carried out under Contract No. DE-SC0012704 with the U.S. Department of Energy, Office of Science, and supported by its Division of Chemical Sciences, Geosciences and Biosciences within the Office of Basic Energy Sciences. J. Molec. Spectrosc. 209, 216-227 (2001) and J. Quant. Spectrosc. Rad. Transf. 76, 237-267 (2003)
Sethi, Sapna; Kothiyal, N C; Nema, Arvind K
2012-07-01
Leachate recirculation at neutral PH accompanied with buffer/nutrients addition has been used successfully in earlier stabilization of municipal solid waste in bioreactor landfills. In the present study, efforts were made to enhance the stabilization rate of municipal solid waste (MSW) and organic solid waste (OSW) in simulated landfill bioreactors by controlling the pH of recirculated leachate towards slightly alkaline side in absence of additional buffer and nutrients addition. Enhanced stabilization in waste samples was monitored with the help of analytical tools like Fourier Transform Infrared Spectroscopy (FTIR) and X-Ray Diffraction (XRD). Predominance of bands assigned to inorganic compounds and comparatively lower intensities of bands for organic compounds in the FTIR spectra of waste samples degraded with leachate recirculation under controlled pH confirmed higher rate of biodegradation and mineralization of waste than the samples degraded without controlled leachate recirculation. XRD spectra also confirmed to a greater extent of mineralization in the waste samples degraded under leachate recirculation with controlled pH. Comparison of XRD spectra of two types of wastes pointed out higher degree of mineralization in organic solid waste as compared to municipal solid waste.
Pei, Jing-cheng; Fan, Lu-wei; Xie, Hao
2014-12-01
Based on the conventional test methods, the infrared absorption spectrum, Raman spectrum and X-ray diffraction (XRD) were employed to study the characters of the vibration spectrum and mineral composition of Huanglong jade. The testing results show that Huanglong jade shows typical vibrational spectrum characteristics of quartziferous jade. The main infrared absorption bands at 1162, 1076, 800, 779, 691, 530 and 466 cm(-1) were induced by the asymmetric stretching vibration, symmetrical stretching vibration and bending vibration of Si-O-Si separately. Especially the absorption band near 800 cm(-1) is split, which indicates that Huanglong jade has good crystallinity. In Raman spectrum, the main strong vibration bands at 463 and 355 cm(-1) were attributed to bending vibration of Si-O-Si. XRD test confirmed that Quartz is main mineral composition of Huanglong jade and there is a small amount of hematite in red color samples which induced the red color of Huanglong jade. This is the first report on the infrared, Raman and XRD spectra feature of Huanglong jade. It will provide a scientific basis for the identification, naming and other research for huanglong jade.
Contaminant-State Broadening Mechanism in a Driven Dissipative Rydberg System
NASA Astrophysics Data System (ADS)
Porto, J. V.
2017-04-01
The strong interactions in Rydberg atoms make them an ideal system for the study of correlated many-body physics, both in the presence and absence of dissipation. Using such highly excited atomic states requires addressing challenges posed by the dense spectrum of Rydberg levels, the detrimental effects of spontaneous emission, and strong interactions. A full understanding of the scope and limitations of many Rydberg-based proposals requires simultaneously including these effects, which typically cannot be described by a mean-field treatment due to correlations in the quantum coherent and dissipative processes. We study a driven, dissipative system of Rydberg atoms in a 3D optical lattice, and observe substantial deviation from single-particle excitation rates, both on and off resonance. The observed broadened spectra cannot be explained by van der Waals interactions or a mean-field treatment of the system. Based on the magnitude of the broadening and the scaling with density and two-photon Rabi frequency, we attribute these effects to unavoidable blackbody-induced transitions to nearby Rydberg states of opposite parity, which have large, resonant dipole-dipole interactions with the state of interest. Even at low densities of Rydberg atoms, uncontrolled production of atoms in other states significantly modifies the energy levels of the remaining atoms. These off-diagonal exchange interactions result in complex many-body states of the system and have implications for off-resonant Rydberg dressing proposals. This work was partially supported by the ARL-CDQI program.
Self- and Air-Broadened Line Shapes in the 2v3 P and R Branches of 12CH4
NASA Technical Reports Server (NTRS)
Devi, V. Malathy; Benner, D. Chris; Sung, Keeyoon; Crawford, Timothy J.; Yu, Shanshan; Brown, Linda R.; Smith, Mary Ann H.; Mantz, Arlan W.; Boudon, Vincent; Ismail, Syed
2015-01-01
In this paper we report line shape parameters of 12CH4 for several hundred 2V(sub 3) transitions in the spectral regions 5891-5996 cm( exp -1) (P branch) and 6015-6115 cm(exp -1) (R branch). Air- and self-broadening coefficients were measured as a function of temperature; line mixing via off-diagonal relaxation matrix element coefficients was also obtained for 47 transition pairs. In total, nearly 1517 positions and intensities were retrieved, but many transitions were too weak for the line shape study. For this analysis, we used 25 high-resolution (0.0056 and 0.0067 cm(ex[ -1) and high signal-to-noise (S/N) spectra of high-purity 12CH4 and the same high-purity 12CH4 broadened by dry air recorded at different sample temperatures between 130 K and 295 K with the Bruker IFS 125HR Fourier transform spectrometer at JPL. Three different absorption cells were used (1) a White cell set to a path length of 13.09 m for room temperature data, (2) a single-pass 0.2038 m long coolable cell (for self-broadening) and (3) a multipass cell with 20.941 m total path coolable Herriott cell (for air-broadening). In total there were 13 spectra with pure 12CH4 (0.27-599 Torr) and 12 air-broadened spectra with total sample pressures of 80-805 Torr and volume mixing ratios (VMR) of methane between 0.18 and 1.0. An interactive multispectrum nonlinear least-squares technique was employed to fit the individual P10-P1 and R0-R10 manifolds in all the spectra simultaneously. Results obtained from the present analysis are compared to other recent measurements.
Peak phosphorus - peak food? The need to close the phosphorus cycle.
Rhodes, Christopher J
2013-01-01
The peak in the world production of phosphorus has been predicted to occur in 2033, based on world reserves of rock phosphate (URR) reckoned at around 24,000 million tonnes (Mt), with around 18,000 Mt remaining. This figure was reckoned-up to 71,000 Mt, by the USGS, in 2012, but a production maximum during the present century is still highly probable. There are complex issues over what the demand will be for phosphorus in the future, as measured against a rising population (from 7 billion to over 9 billion in 2050), and a greater per capita demand for fertiliser to grow more grain, in part to feed animals and meet a rising demand for meat by a human species that is not merely more populous but more affluent. As a counterweight to this, we may expect that greater efficiencies in the use of phosphorus - including recycling from farms and of human and animal waste - will reduce the per capita demand for phosphate rock. The unseen game changer is peak oil, since phosphate is mined and recovered using machinery powered by liquid fuels refined from crude oil. Hence, peak oil and peak phosphorus might appear as conjoined twins. There is no unequivocal case that we can afford to ignore the likelihood of a supply-demand gap for phosphorus occurring sometime this century, and it would be perilous to do so.
High temperature XRD of Cu{sub 2.1}Zn{sub 0.9}SnSe{sub 4}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chetty, Raju, E-mail: rcmallik@physics.iisc.ernet.in; Mallik, Ramesh Chandra, E-mail: rcmallik@physics.iisc.ernet.in
2014-04-24
Quaternary compound with chemical composition Cu{sub 2.1}Zn{sub 0.9}SnSe{sub 4} is prepared by solid state synthesis. High temperature XRD (X-Ray Diffraction) of this compound is used in studying the effect of temperature on lattice parameters and thermal expansion coefficients. Thermal expansion coefficient is one of the important quantities in evaluating the Grüneisen parameter which further useful in determining the lattice thermal conductivity of the material. The high temperature XRD of the material revealed that the lattice parameters as well as thermal expansion coefficients of the material increased with increase in temperature which confirms the presence of anharmonicty.
Pressure broadening and fine-structure-dependent predissociation in oxygen B 3sigma(u)-, v = 0.
Hannemann, Sandro; Wu, GuoRong; van Duijn, Eric-Jan; Ubachs, Wim; Cosby, Philip C
2005-11-01
Both laser-induced fluorescence and cavity ring-down spectral observations were made in the Schumann-Runge band system of oxygen, using a novel-type ultranarrow deep-UV pulsed laser source. From measurements on the very weak (0,0) band pressure broadening, pressure shift, and predissociation line-broadening parameters were determined for the B 3sigma(u)-, v = 0,F(i) fine-structure components for various rotational levels in O2. The information content from these studies was combined with that of entirely independent measurements probing the much stronger (0,10), (0,19), and (0,20) Schumann-Runge bands involving preparation of vibrationally excited O2 molecules via photolysis of ozone. The investigations result in a consistent set of predissociation widths for the B 3sigma(u)-, v = 0 state of oxygen.
NASA Astrophysics Data System (ADS)
Ahmad, S.; Ahmad, A.; Bacha, B. A.; Khan, A. A.; Abdul Jabar, M. S.
2017-12-01
Surface Plasmon Polaritons (SPPs) are theoretically investigated at the interface of a dielectric metal and gold. The output pulse from the dielectric is used as the input pulse for the generation of SPPs. The SPPs show soliton-like behavior at the interface. The solitary form of a SPP is maintained under the effects of Kerr nonlinearity, Doppler broadening and Fresnel dragging whereas its phase shift is significantly modified. A 0.3radian phase shift is calculated in the presence of both Kerr nonlinearity and Fresnel dragging in the absence of plasma motion. The phase shift is enhanced to 60radian due to the combined effect of Doppler broadening, Kerr nonlinearity and Fresnel dragging. The results may have significant applications in nano-photonics, optical tweezers, photovoltaic devices, plasmonster and sensing technology.
From forensic epigenetics to forensic epigenomics: broadening DNA investigative intelligence.
Vidaki, Athina; Kayser, Manfred
2017-12-21
Human genetic variation is a major resource in forensics, but does not allow all forensically relevant questions to be answered. Some questions may instead be addressable via epigenomics, as the epigenome acts as an interphase between the fixed genome and the dynamic environment. We envision future forensic applications of DNA methylation analysis that will broaden DNA-based forensic intelligence. Together with genetic prediction of appearance and biogeographic ancestry, epigenomic lifestyle prediction is expected to increase the ability of police to find unknown perpetrators of crime who are not identifiable using current forensic DNA profiling.
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Pressure broadening of the ((dt. mu. )dee)* formation resonances
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cohen, J.S.; Leon, M.; Padial, N.T.
1988-12-27
The treatment of ((dt..mu..)dee)* formation at high densities as a pressure broadening process is discussed. Cross sections for collisions of the complex (dt..mu..)dee, and of the D/sub 2/ molecule from which it is formed, with the bath molecules have been accurately calculated. These cross sections are used to calculate the collisional width in three variations of the impact approximation that have been proposed for this problem. In general, the quasistatic approximation is shown to satisfy the usual conditions of muon-catalyzed fusion better than does the impact approximation. A preliminary rough treatment is presented to illustrate the quasistatic approximation.
Commercial observation satellites: broadening the sources of geospatial data
NASA Astrophysics Data System (ADS)
Baker, John C.; O'Connell, Kevin M.; Venzor, Jose A.
2002-09-01
Commercial observation satellites promise to broaden substantially the sources of imagery data available to potential users of geospatial data and related information products. We examine the new trend toward private firms acquiring and operating high-resolution imagery satellites. These commercial observation satellites build on the substantial experience in Earth observation operations provided by government-owned imaging satellites for civilian and military purposes. However, commercial satellites will require governments and companies to reconcile public and private interests in allowing broad public access to high-resolution satellite imagery data without creating national security risks or placing the private firms at a disadvantage compared with other providers of geospatial data.
How to use your peak flow meter
Peak flow meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak flow meter ... your airways are narrowed and blocked due to asthma, your peak flow values drop. You can check ...
NASA Astrophysics Data System (ADS)
Ostrooumov, M.
2016-08-01
The Raman microprobe (RMP), infrared (IR) and XRD analysis have been applied to the examination of mineralogical composition of seven mexican meteorites: Aldama, Cosina, El Pozo, Escalon, Nuevo Mercurio,Pacula, Zapotitlan Salinas.
USDA-ARS?s Scientific Manuscript database
Despite considerable efforts in developing the curve-fitting protocol to evaluate the crystallinity index (CI) from the X-ray diffraction (XRD) measurement, in its present state XRD procedure can only provide a qualitative or semi-quantitative assessment of the amounts of crystalline or amorphous po...
Peak-flow frequency relations and evaluation of the peak-flow gaging network in Nebraska
Soenksen, Philip J.; Miller, Lisa D.; Sharpe, Jennifer B.; Watton, Jason R.
1999-01-01
Estimates of peak-flow magnitude and frequency are required for the efficient design of structures that convey flood flows or occupy floodways, such as bridges, culverts, and roads. The U.S. Geological Survey, in cooperation with the Nebraska Department of Roads, conducted a study to update peak-flow frequency analyses for selected streamflow-gaging stations, develop a new set of peak-flow frequency relations for ungaged streams, and evaluate the peak-flow gaging-station network for Nebraska. Data from stations located in or within about 50 miles of Nebraska were analyzed using guidelines of the Interagency Advisory Committee on Water Data in Bulletin 17B. New generalized skew relations were developed for use in frequency analyses of unregulated streams. Thirty-three drainage-basin characteristics related to morphology, soils, and precipitation were quantified using a geographic information system, related computer programs, and digital spatial data.For unregulated streams, eight sets of regional regression equations relating drainage-basin to peak-flow characteristics were developed for seven regions of the state using a generalized least squares procedure. Two sets of regional peak-flow frequency equations were developed for basins with average soil permeability greater than 4 inches per hour, and six sets of equations were developed for specific geographic areas, usually based on drainage-basin boundaries. Standard errors of estimate for the 100-year frequency equations (1percent probability) ranged from 12.1 to 63.8 percent. For regulated reaches of nine streams, graphs of peak flow for standard frequencies and distance upstream of the mouth were estimated.The regional networks of streamflow-gaging stations on unregulated streams were analyzed to evaluate how additional data might affect the average sampling errors of the newly developed peak-flow equations for the 100-year frequency occurrence. Results indicated that data from new stations, rather than more
Adam, Asrul; Ibrahim, Zuwairie; Mokhtar, Norrima; Shapiai, Mohd Ibrahim; Cumming, Paul; Mubin, Marizan
2016-01-01
Various peak models have been introduced to detect and analyze peaks in the time domain analysis of electroencephalogram (EEG) signals. In general, peak model in the time domain analysis consists of a set of signal parameters, such as amplitude, width, and slope. Models including those proposed by Dumpala, Acir, Liu, and Dingle are routinely used to detect peaks in EEG signals acquired in clinical studies of epilepsy or eye blink. The optimal peak model is the most reliable peak detection performance in a particular application. A fair measure of performance of different models requires a common and unbiased platform. In this study, we evaluate the performance of the four different peak models using the extreme learning machine (ELM)-based peak detection algorithm. We found that the Dingle model gave the best performance, with 72 % accuracy in the analysis of real EEG data. Statistical analysis conferred that the Dingle model afforded significantly better mean testing accuracy than did the Acir and Liu models, which were in the range 37-52 %. Meanwhile, the Dingle model has no significant difference compared to Dumpala model.
[NIR and XRD analysis of drill-hole samples from Zhamuaobao iron-graphite deposit, Inner Mongolia].
Li, Ying-kui; Cao, Jian-jin; Wu, Zheng-quan; Dai, Dong-le; Lin, Zu-xu
2015-01-01
The author analyzed the 4202 drill-hole samples from Zhamuaobao iron-graphite deposit by using near infrared spectroscopy(NIR) and X-ray diffraction(XRD) measuring and testing techniques, and then compared and summarized the results of two kinds of testing technology. The results indicate that some difference of the mineral composition exists among different layers, the lithology from upper to deeper is the clay gravel layer of tertiary and quaternary, mudstone, mica quartz schist, quartz actinolite scarn, skarnization marble, iron ore deposits, graphite deposits and mica quartz schist. The petrogenesis in different depth also shows difference, which may indicate the geological characteristic to some extent. The samples had mainly undergone such processes as oxidization, carbonation, chloritization and skarn alteration. The research results can not only improve the geological feature of the mining area, but also have great importance in ore exploration, mining, mineral processing and so on. What's more, as XRD can provide preliminary information about the mineral composition, NIR can make further judgement on the existence of the minerals. The research integrated the advantages of both NIR and XRD measuring and testing techniques, put forward a method with two kinds of modern testing technology combined with each other, which may improve the accuracy of the mineral composition identification. In the meantime, the NIR will be more wildly used in geography on the basis of mineral spectroscopy.
Effect of silver doping on the elastic properties of CdS nanoparticles
NASA Astrophysics Data System (ADS)
Dey, P. C.; Das, R.
2018-05-01
CdS and Ag doped CdS (CdS/Ag) nanoparticles have been prepared via chemical method from a Cadmium acetate precursor and Thiourea. The synthesized CdS and CdS/Ag nanoparticles have been characterized by the X-ray Diffraction and High Resolution Transmission Electron Microscope. Here, these nanoparticles have been synthesized at room temperature and all the characterization have also been done at room temperature only. The XRD results reveal that the products are crystalline with cubic zinc blende structure. HRTEM images show that the prepared nanoparticles are nearly spherical in shape. Williamson-Hall method and Size-Strain Plot (SSP) have been used to study the individual contribution of crystalline sizes and lattice strain on the peak broadening of the CdS and CdS/Ag nanoparticles. The different modified model of Williamson-Hall method such as, uniform deformation model, uniform stress deformation model and uniform energy density deformation model and SSP method have been used to calculate the different physical parameter such as lattice strain, stress and energy density for all diffraction peaks of the XRD, corresponding to the CdS and silver doped CdS (CdS/Ag). The obtained results reveal that the average particle size of the prepared CdS and CdS/Ag nanoparticles estimated from the HRTEM images, Williamson-Hall analysis and SSP method are highly correlated with each other. Further, all these result confirms that doping of Ag significantly affects the elastic properties of CdS.
2013-03-01
12 curve fit to the 2Σ1 2� − 2Σ1 2� difference potential Table 2.2a: Lennard - Jones parameters for Rubidium + Helium lines. Difference...Table Page Table 2.2a. Lennard - Jones parameters for Rubidium + Helium lines 22 Table 2.2b. Line broadening and shift parameters for Rb + He lines...all nine M + Ng pairs, using Lennard - Jones (6-12) potentials in Anderson- Talman 25 Table 2.2e. Broadening and shift coefficients (in MHz/torr
NASA Astrophysics Data System (ADS)
Patle, L. B.; Labhane, P. K.; Huse, V. R.; Gaikwad, K. D.; Chaudhari, A. L.
2018-05-01
The nanoparticles of Pure and doped Ti1-xFexO were synthesized by modified co-precipitation method successfully with nominal composite of x=0.0, 0.01, 0.03 and 0.05 at room temperature. The precursors were further calcined at 500°C for 6hrs in muffle furnace which results in the formation of different TiO2 phase compositions. The structural analysis carried out by XRD (Bruker D8 Cu-Kα1). X-ray peak broadening analysis was used to evaluate the crystalline sizes, the lattice parameters, atomic packing fraction, c/a ratio, X-ray density and Volume of unit cell. The Williamson Hall analysis is used to find grain size and Strain of prepared TiO2 nano particles. Crystalline TiO2 with a Tetragonal Anatase phase is confirmed by XRD results. The grain size of pure and Fe doped samples were found in the range of 10nm to 18nm. All the physical parameters of anatase tetragonal TiO2 nanoparticles were calculated more precisely using modified W-H plot a uniform deformation model (UDM). The results calculated from both the techniques were approximately similar.
CARRIER-LATTICE RELAXATION FOR BROADENING EPR LINEWIDTH IN Nd0.55Sr0.45MnO3
NASA Astrophysics Data System (ADS)
Fan, Jiyu; Zhang, Xiyuan; Tong, Wei; Zhang, Lei; Zhang, Weichun; Zhu, Yan; Shi, Yangguang; Hu, Dazhi; Hong, Bo; Ying, Yao; Ling, Langsheng; Pi, Li; Zhang, Yuheng
2013-12-01
In this paper, we report the electron paramagnetic resonance (EPR) study of perovskite manganite Nd0.55Sr0.45MnO3. Experimental data reveal that the EPR linewidth broadens with a quasilinear manner up to 480 K. The broadening of the EPR linewidth can be understood in terms of the shortening of carrier-lattice relaxation time due to the occurrence of strong carrier-phonon interactions. Two same activation energies obtained respectively from the temperature dependence of EPR intensity and resistivity indicate that the linewidth variation is correlated to the small polaron hopping. Therefore, the carrier-lattice coupling play a major role for deciding its magnetism in the present system.
Origin of weak lensing convergence peaks
NASA Astrophysics Data System (ADS)
Liu, Jia; Haiman, Zoltán
2016-08-01
Weak lensing convergence peaks are a promising tool to probe nonlinear structure evolution at late times, providing additional cosmological information beyond second-order statistics. Previous theoretical and observational studies have shown that the cosmological constraints on Ωm and σ8 are improved by a factor of up to ≈2 when peak counts and second-order statistics are combined, compared to using the latter alone. We study the origin of lensing peaks using observational data from the 154 deg2 Canada-France-Hawaii Telescope Lensing Survey. We found that while high peaks (with height κ >3.5 σκ , where σκ is the rms of the convergence κ ) are typically due to one single massive halo of ≈1 015M⊙ , low peaks (κ ≲σκ ) are associated with constellations of 2-8 smaller halos (≲1 013M⊙ ). In addition, halos responsible for forming low peaks are found to be significantly offset from the line of sight towards the peak center (impact parameter ≳ their virial radii), compared with ≈0.25 virial radii for halos linked with high peaks, hinting that low peaks are more immune to baryonic processes whose impact is confined to the inner regions of the dark matter halos. Our findings are in good agreement with results from the simulation work by Yang et al. [Phys. Rev. D 84, 043529 (2011)].
Multiscale peak detection in wavelet space.
Zhang, Zhi-Min; Tong, Xia; Peng, Ying; Ma, Pan; Zhang, Ming-Jin; Lu, Hong-Mei; Chen, Xiao-Qing; Liang, Yi-Zeng
2015-12-07
Accurate peak detection is essential for analyzing high-throughput datasets generated by analytical instruments. Derivatives with noise reduction and matched filtration are frequently used, but they are sensitive to baseline variations, random noise and deviations in the peak shape. A continuous wavelet transform (CWT)-based method is more practical and popular in this situation, which can increase the accuracy and reliability by identifying peaks across scales in wavelet space and implicitly removing noise as well as the baseline. However, its computational load is relatively high and the estimated features of peaks may not be accurate in the case of peaks that are overlapping, dense or weak. In this study, we present multi-scale peak detection (MSPD) by taking full advantage of additional information in wavelet space including ridges, valleys, and zero-crossings. It can achieve a high accuracy by thresholding each detected peak with the maximum of its ridge. It has been comprehensively evaluated with MALDI-TOF spectra in proteomics, the CAMDA 2006 SELDI dataset as well as the Romanian database of Raman spectra, which is particularly suitable for detecting peaks in high-throughput analytical signals. Receiver operating characteristic (ROC) curves show that MSPD can detect more true peaks while keeping the false discovery rate lower than MassSpecWavelet and MALDIquant methods. Superior results in Raman spectra suggest that MSPD seems to be a more universal method for peak detection. MSPD has been designed and implemented efficiently in Python and Cython. It is available as an open source package at .
NASA Astrophysics Data System (ADS)
Castrillo, A.; de Vizia, M. D.; Fasci, E.; Odintsova, T.; Moretti, L.; Gianfrani, L.
The expression of the Doppler width of a spectral line, valid for a gaseous sample at thermodynamic equilibrium, represents a powerful tool to link the thermodynamic temperature to an optical frequency. This is the basis of a relatively new method of primary gas thermometry, known as Doppler broadening thermometry. Implemented at the Second University of Naples on H218O molecules at the temperature of the triple point of water, this method has recently allowed to determine the Boltzmann constant with a global uncertainty of 24 parts over 106. Even though this is the best result ever obtained by using an optical method, its uncertainty is still far from the requirement for the new definition of the unit kelvin. To this end, Doppler broadening thermometry should approach the accuracy of 1 part per million. In this paper, we will report on our recent efforts to further develop and optimize Doppler broadening thermometry at 1.39 μm, using acetylene as a molecular target. Main progresses and current limitations will be highlighted.
Simultaneous influence of Stark effect and excessive line broadening on the Hα line
NASA Astrophysics Data System (ADS)
Cvetanović, Nikola; Ivković, Saša S.; Obradović, Bratislav M.; Kuraica, Milorad M.
2017-12-01
The aim of this paper is to study the combined influence of the Stark effect and the excessive Doppler broadening on the Balmer alpha line in hydrogen discharges. Since this line is a good candidate for measuring electric field in various types of discharges with different gas compositions, a simple method for field measurement based on polarization spectroscopy is developed, that includes all the excitation mechanisms. To simultaneously test the flexibility of the fitting procedure and investigate the excessive broadening, we applied the fitting procedure on line profiles obtained at a range of conditions from two different discharges. The range of pressures and voltages was examined in an abnormal glow and in dielectric barrier discharge operating with hydrogen gas. The model fitting function was able to respond and follow the change in the line profile caused by the change of conditions. This procedure can therefore be recommended for electric field measurement. Contribution to the "Topical Issue: Physics of Ionized Gases (SPIG 2016)", edited by Goran Poparic, Bratislav Obradovic, Dragana Maric and Aleksandar Milosavljevic.
Quasiparticle Lifetime Broadening in Resonant X-ray Scattering of NH4NO3.
Vinson, John; Jach, Terrence; Müller, Matthias; Unterumsberger, Rainer; Beckhoff, Burkhard
2016-07-15
It has been previously shown that two effects cause dramatic changes in the x-ray absorption and emission spectra from the N K edge of the insulating crystal ammonium nitrate. First, vibrational disorder causes major changes in the absorption spectrum, originating not only from the thermal population of phonons, but, significantly, from zero-point motion as well. Second, the anomalously large broadening ( ~ 4 eV) of the emission originating from nitrate σ states is due to unusually short lifetimes of quasiparticles in an otherwise extremely narrow band. In this work we investigate the coupling of these effects to core and valence excitons that are created as the initial x-ray excitation energy is progressively reduced toward the N edge. Using a GW /Bethe-Salpeter approach, we show the extent to which this anomalous broadening is captured by the GW approximation. The data and calculations demonstrate the importance that the complex self-energies (finite lifetimes) of valence bands have on the interpretation of emission spectra. We produce a scheme to explain why extreme lifetimes should appear in σ states of other similar compounds.
Raines, Timothy H.
1998-01-01
The potential extreme peak-discharge curves as related to contributing drainage area were estimated for each of the three hydrologic regions from measured extreme peaks of record at 186 sites with streamflow-gaging stations and from measured extreme peaks at 37 sites without streamflow-gaging stations in and near the Brazos River Basin. The potential extreme peak-discharge curves generally are similar for hydrologic regions 1 and 2, and the curve for region 3 consistently is below the curves for regions 1 and 2, which indicates smaller peak discharges.
Rothhardt, J; Hädrich, S; Röser, F; Limpert, J; Tünnermann, A
2008-06-09
We present a high peak power degenerated parametric amplifier operating at 1030 nm and 97 kHz repetition rate. Pulses of a state-of-the art fiber chirped-pulse amplification (FCPA) system with 840 fs pulse duration and 410 microJ pulse energy are used as pump and seed source for a two stage optical parametric amplifier. Additional spectral broadening of the seed signal in a photonic crystal fiber creates enough bandwidth for ultrashort pulse generation. Subsequent amplification of the broadband seed signal in two 1 mm BBO crystals results in 41 microJ output pulse energy. Compression in a SF 11 prism compressor yields 37 microJ pulses as short as 52 fs. Thus, pulse shortening of more than one order of magnitude is achieved. Further scaling in terms of average power and pulse energy seems possible and will be discussed, since both concepts involved, the fiber laser and the parametric amplifier have the reputation to be immune against thermo-optical effects.
Can You Hear That Peak? Utilization of Auditory and Visual Feedback at Peak Limb Velocity.
Loria, Tristan; de Grosbois, John; Tremblay, Luc
2016-09-01
At rest, the central nervous system combines and integrates multisensory cues to yield an optimal percept. When engaging in action, the relative weighing of sensory modalities has been shown to be altered. Because the timing of peak velocity is the critical moment in some goal-directed movements (e.g., overarm throwing), the current study sought to test whether visual and auditory cues are optimally integrated at that specific kinematic marker when it is the critical part of the trajectory. Participants performed an upper-limb movement in which they were required to reach their peak limb velocity when the right index finger intersected a virtual target (i.e., a flinging movement). Brief auditory, visual, or audiovisual feedback (i.e., 20 ms in duration) was provided to participants at peak limb velocity. Performance was assessed primarily through the resultant position of peak limb velocity and the variability of that position. Relative to when no feedback was provided, auditory feedback significantly reduced the resultant endpoint variability of the finger position at peak limb velocity. However, no such reductions were found for the visual or audiovisual feedback conditions. Further, providing both auditory and visual cues concurrently also failed to yield the theoretically predicted improvements in endpoint variability. Overall, the central nervous system can make significant use of an auditory cue but may not optimally integrate a visual and auditory cue at peak limb velocity, when peak velocity is the critical part of the trajectory.
[Infrared spectroscopy and XRD studies of coral fossils].
Chen, Quan-li; Zhou, Guan-min; Yin, Zuo-wei
2012-08-01
Coral fossil is an old remain of multicellular animal on the earth, and formed by various geological processes. The structural characteristics and compositions of the coral fossils with different color and radial texture on the surface were studied by infrared absorption spectroscopy and X-ray powder diffraction analyses. The results show that the studied coral fossils mainly are composed of SiO2, and the radial microstructure characterized by the calcareous coral cross-section is preserved. It is formed by metasomatism by SiO2. The infrared absorption spectra of the coral fossil with different color and texture are essentially the same, showing typical infrared absorption spectra of the quartz jade. XRD analysis shows that the main components of the coral fossils with different color and texture are consistent and mainly composed of SiO2 with a trace amount of other minerals and without CaCO3.
Structure and morphology evolution of silica-modified pseudoboehmite aerogels during heat treatment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pakharukova, V.P., E-mail: verapakh@catalysis.ru; Novosibirsk State University, Pirogova Street 2, 630090 Novosibirsk; Research and Educational Center for Energy Efficient Catalysis, Novosibirsk State University, Novosibirsk 630090
Silica-modified pseudoboehmite aerogels (0, 10, 20 at% of Si) were prepared by sol–gel method followed by supercritical drying. The phase transformations, changes in structure and morphology upon calcination were thoroughly investigated by advanced X-Ray diffraction (XRD) techniques and high-resolution transmission electron microscopy (HRTEM). Obtained pseudoboehmite samples had specific nanostructure: ultrathin two-dimensional (2D) crystallites were loosely packed. The silica dopant drastically enhanced the crystallite anisotropy. Thus, the aerogel with Al:Si atomic ratio of 9:1 consisted of the pseudoboehmite nanosheets with thickness of one unit cell (average dimensions of 14.0×1.2×14.5 nm). The specific nanostructure caused remarkable features of experimental XRD patterns, includingmore » anisotropic peak broadening and appearance of forbidden reflection. Direct simulation of XRD patterns with using the Debye Scattering Equation allowed the size and morphology of pseudoboehmite crystallites to be determined. The silica addition strongly delayed formation of γ-alumina and further phase transformations upon calcinaton. Thermal stability of alumina was suggested to be affected by the particle morphology inherited from the pseudoboehmite precursor. - Graphical abstract: Pseudoboehmite samples had specific nanostructure: ultrathin two-dimensional (2D) crystallites were loosely packed. - Highlights: • Silica-doped boehmites were prepared by sol–gel method with supercritical drying. • Ultrathin two-dimensional crystallites of pseudoboehmite were obtained. • Changes in structure and morphology upon calcination were studied. • Simulation of XRD patterns was performed with use of the Debye Scattering Equation. • Thermal stability of alumina depended on morphology inherited from pseudoboehmite.« less
The assembly of ant-farmed gardens: mutualism specialization following host broadening
Janda, Milan
2017-01-01
Ant-gardens (AGs) are ant/plant mutualisms in which ants farm epiphytes in return for nest space and food rewards. They occur in the Neotropics and Australasia, but not in Africa, and their evolutionary assembly remains unclear. We here use phylogenetic frameworks for important AG lineages in Australasia, namely the ant genus Philidris and domatium-bearing ferns (Lecanopteris) and flowering plants in the Apocynaceae (Hoya and Dischidia) and Rubiaceae (Myrmecodia, Hydnophytum, Anthorrhiza, Myrmephytum and Squamellaria). Our analyses revealed that in these clades, diaspore dispersal by ants evolved at least 13 times, five times in the Late Miocene and Pliocene in Australasia and seven times during the Pliocene in Southeast Asia, after Philidris ants had arrived there, with subsequent dispersal between these two areas. A uniquely specialized AG system evolved in Fiji at the onset of the Quaternary. The farming in the same AG of epiphytes that do not offer nest spaces suggests that a broadening of the ants' plant host spectrum drove the evolution of additional domatium-bearing AG-epiphytes by selecting on pre-adapted morphological traits. Consistent with this, we found a statistical correlation between the evolution of diaspore dispersal by ants and domatia in all three lineages. Our study highlights how host broadening by a symbiont has led to new farming mutualisms. PMID:28298344
Theory and Simulation of Exoplanetary Atmospheric Haze: Giant Spectral Line Broadening
NASA Astrophysics Data System (ADS)
Sadeghpour, Hossein; Felfeli, Zineb; Kharchenko, Vasili; Babb, James; Vrinceanu, Daniel
2018-01-01
Prominent spectral features in observed transmission spectra of exoplanets are obscured. Atmospheric haze is the leading candidate for the flattening of spectral transmission of expolanetray occultation, but also for solar system planets, Earth and cometary atmospheres. Such spectra which carry information about how the planetary atmospheres become opaque to stellar light in transit, show broad absorption where strong absorption lines from sodium or potassium and water are predicted to exist. In this work, we develop a detailed atomistic theoretical model, taking into account interaction between an atomic or molecular radiator with dust and haze particulates. Our model considers a realistic structure of haze particulates from small seed particles up to sub-micron irregularly shaped aggregates. This theory of interaction between haze and radiator particles allows to consider nearly all realistic structure, size and chemical composition of haze particulates. The computed shift and broadening of emission spectra will include both quasi-static (mean field) and collisional (pressure) shift and broadening. Our spectral calculations will be verified with available laboratory experimental data on spectra of alkali atoms in liquid droplet, solid ice, dust and dense gaseous environments. The simplicity, elegance and generality of the proposed model makes it amenable to a broad community of users in astrophysics and chemistry. The verified models can be used for analysis of emission and absorption spectra of alkali atoms from exoplanets, solar system planets, satellites and comets.
Origins of extreme broadening mechanisms in near-edge x-ray spectra of nitrogen compounds
NASA Astrophysics Data System (ADS)
Vinson, John; Jach, Terrence; Elam, W. T.; Denlinger, J. D.
2014-11-01
We demonstrate the observation of many-body lifetime effects in valence-band x-ray emission. A comparison of the N K α emission of crystalline ammonium nitrate to molecular-orbital calculations revealed an unexpected, extreme broadening of the NO σ recombination—so extensively as to virtually disappear. GW calculations establish that this disappearance is due to a large imaginary component of the self-energy associated with the NO σ orbitals. Building upon density-functional theory, we have calculated radiative transitions from the nitrogen 1 s level of ammonium nitrate and ammonium chloride using a Bethe-Salpeter method to include electron-hole interactions. The absorption and emission spectra of both crystals evince large, orbital-dependent sensitivity to molecular dynamics. We demonstrate that many-body effects as well as thermal and zero-point motion are vital for understanding observed spectra. A computational approach using average atomic positions and uniform broadening to account for lifetime and phonon effects is unsatisfactory.
Campo, Jochen; Wenseleers, Wim; Hales, Joel M; Makarov, Nikolay S; Perry, Joseph W
2012-08-16
A practical yet accurate dispersion model for the molecular first hyperpolarizability β is presented, incorporating both homogeneous and inhomogeneous line broadening because these affect the β dispersion differently, even if they are indistinguishable in linear absorption. Consequently, combining the absorption spectrum with one free shape-determining parameter Ginhom, the inhomogeneous line width, turns out to be necessary and sufficient to obtain a reliable description of the β dispersion, requiring no information on the homogeneous (including vibronic) and inhomogeneous line broadening mechanisms involved, providing an ideal model for practical use in extrapolating experimental nonlinear optical (NLO) data. The model is applied to the efficient NLO chromophore picolinium quinodimethane, yielding an excellent fit of the two-photon resonant wavelength-dependent data and a dependable static value β0 = 316 × 10(-30) esu. Furthermore, we show that including a second electronic excited state in the model does yield an improved description of the NLO data at shorter wavelengths but has only limited influence on β0.
Broadening the interface bandwidth in simulation based training
NASA Technical Reports Server (NTRS)
Somers, Larry E.
1989-01-01
Currently most computer based simulations rely exclusively on computer generated graphics to create the simulation. When training is involved, the method almost exclusively used to display information to the learner is text displayed on the cathode ray tube. MICROEXPERT Systems is concentrating on broadening the communications bandwidth between the computer and user by employing a novel approach to video image storage combined with sound and voice output. An expert system is used to combine and control the presentation of analog video, sound, and voice output with computer based graphics and text. Researchers are currently involved in the development of several graphics based user interfaces for NASA, the U.S. Army, and the U.S. Navy. Here, the focus is on the human factors considerations, software modules, and hardware components being used to develop these interfaces.
Resonance frequency broadening of wave-particle interaction in tokamaks due to Alfvénic eigenmode
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meng, Guo; Gorelenkov, Nikolai N.; Duarte, Vinicius N.
We use the guiding center code ORBIT to study the broadening of resonances and the parametric dependence of the resonance frequency broadening widthmore » $$\\Delta\\Omega$$ on the nonlinear particle trapping frequency $$\\omega_b$$ of wave-particle interaction with specific examples using realistic equilibrium DIII-D shot 159243 (Collins et al. 2016 Phys. Rev. Lett. 116 095001). When the mode amplitude is small, the pendulum approximation for energetic particle dynamics near the resonance is found to be applicable and the ratio of the resonance frequency width to the deeply trapped bounce frequency $$\\Delta\\Omega/\\omega_b$$ equals 4, as predicted by theory. Lastly, it is found that as the mode amplitude increases, the coefficient $$a=\\Delta\\Omega/\\omega_b$$ becomes increasingly smaller because of the breaking down of the nonlinear pendulum approximation for the wave-particle interaction.« less
Resonance frequency broadening of wave-particle interaction in tokamaks due to Alfvénic eigenmode
Meng, Guo; Gorelenkov, Nikolai N.; Duarte, Vinicius N.; ...
2018-01-19
We use the guiding center code ORBIT to study the broadening of resonances and the parametric dependence of the resonance frequency broadening widthmore » $$\\Delta\\Omega$$ on the nonlinear particle trapping frequency $$\\omega_b$$ of wave-particle interaction with specific examples using realistic equilibrium DIII-D shot 159243 (Collins et al. 2016 Phys. Rev. Lett. 116 095001). When the mode amplitude is small, the pendulum approximation for energetic particle dynamics near the resonance is found to be applicable and the ratio of the resonance frequency width to the deeply trapped bounce frequency $$\\Delta\\Omega/\\omega_b$$ equals 4, as predicted by theory. Lastly, it is found that as the mode amplitude increases, the coefficient $$a=\\Delta\\Omega/\\omega_b$$ becomes increasingly smaller because of the breaking down of the nonlinear pendulum approximation for the wave-particle interaction.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gharagozlou, Mehrnaz, E-mail: gharagozlou@icrc.ac.ir; Bayati, R.
Highlights: • Anatase TiO{sub 2}/B{sub 12} hybrid nanostructured catalyst was successfully synthesized by sol–gel technique. • The nanoparticle catalyst was doped with iron at several concentrations. • Nanoparticles were characterized in detail by XRD, Raman, TEM, EDS, and spectroscopy techniques. • The formation mechanism and role of point defects on photocatalytic properties were discussed. • A structure-property-processing correlation was established. - Abstract: We report a processing-structure-property correlation in B{sub 12}-anatase titania hybrid catalysts doped with several concentrations of iron. Our results clearly show that low-level iron doping alters structure, defect content, and photocatalytic characteristics of TiO{sub 2}. XRD and Ramanmore » studies revealed formation of a single-phase anatase TiO{sub 2} where no iron based segregation in particular iron oxide, was detected. FT-IR spectra clearly confirmed sensitization of TiO{sub 2} nanoparticles with vitamin B{sub 12}. TEM micrographs and diffraction patterns confirmed crystallization of anatase nanoparticles with a radius of 15–20 nm. Both XRD and Raman signals showed a peak shift and a peak broadening which are surmised to originate from creation of point defects, namely oxygen vacancy and titanium interstitial. The doped samples revealed a narrower band gap as compared to undoped samples. Photocatalytic activity of the samples was assessed through measuring the decomposition rate of rhodamine B. It was found that sensitization with vitamin B{sub 12} and Fe-doping significantly enhances the photocatalytic efficiency of the anatase nanoparticles. We also showed that there is an optimum Fe-doping level where the maximum photocatalytic activity is achieved. The boost of photocatalytic activity was qualitatively understood to originate from a more effective use of the light photons, formation of point defects, which enhance the charge separation, higher carrier mobility.« less
Cavity-ring-down Doppler-broadening primary thermometry
NASA Astrophysics Data System (ADS)
Gotti, Riccardo; Moretti, Luigi; Gatti, Davide; Castrillo, Antonio; Galzerano, Gianluca; Laporta, Paolo; Gianfrani, Livio; Marangoni, Marco
2018-01-01
A step forward in Doppler-broadening thermometry is demonstrated using a comb-assisted cavity-ring-down spectroscopic approach applied to an isolated near-infrared line of carbon dioxide at thermodynamic equilibrium. Specifically, the line-shape of the Pe(12 ) line of the (30012 )←(00001 ) band of C O2 at 1.578 µm is accurately measured and its Doppler width extracted from a refined multispectrum fitting procedure accounting for the speed dependence of the relaxation rates, which were found to play a role even at the very low pressures explored, from 1 to 7 Pa. The thermodynamic gas temperature is retrieved with relative uncertainties of 8 ×10-6 (type A) and 11 ×10-6 (type B), which ranks the system at the first place among optical methods. Thanks to a measurement time of only ≈5 h , the technique represents a promising pathway toward the optical determination of the thermodynamic temperature with a global uncertainty at the 10-6 level.
NASA Technical Reports Server (NTRS)
Tubbs, L. D.; Williams, D.
1972-01-01
The strengths of the rotational lines in the R branch of the CO fundamental have been determined at temperatures of 298, 202, and 132 K by means of a high-resolution spectrograph. The results can be used to determine line strengths at other temperatures by means of the Herman-Wallis relation or by considerations of the populations of the rotational levels in the ground vibrational state. Parameters describing the self-broadening and carbon dioxide broadening of CO lines have been determined at 298 and 202 K. The results are compared with other recent experimental and theoretical studies.
A model to forecast peak spreading.
DOT National Transportation Integrated Search
2012-04-01
As traffic congestion increases, the K-factor, defined as the proportion of the 24-hour traffic volume that occurs during the peak hour, may decrease. This behavioral response is known as peak spreading: as congestion grows during the peak travel tim...
Air- and N2-Broadening Coefficients and Pressure-Shift Coefficients in the C-12(O2-16) Laser Bands
NASA Technical Reports Server (NTRS)
Devi, V. Malathy; Benner, D. Chris; Smith, Mary Ann H.; Rinsland, Curtis P.
1998-01-01
In this paper we report the pressure broadening and the pressure-induced line shift coefficients for 46 individual rovibrational lines in both the (12)C(16)O2, 00(sup 0)1-(10(sup 0)0-02(sup 0)0)I, and 00(sup 0)1-(10(sup 0)0-02(sup 0)0)II, laser bands (laser band I centered at 960.959/cm and laser band II centered at 1063.735/cm) determined from spectra recorded with the McMath-Pierce Fourier transform spectrometer. The results were obtained from analysis of 10 long-path laboratory absorption spectra recorded at room temperature using a multispectrum nonlinear least-squares technique. Pressure effects caused by both air and nitrogen have been investigated. The air-broadening coefficients determined in this study agree well with the values in the 1996 HITRAN database; ratios and standard deviations of the ratios of the present air-broadening measurements to the 1996 HITRAN values for the two laser bands are: 1.005(15) for laser band I and 1.005(14) for laser band II. Broadening by nitrogen is 3 to 4% larger than that of air. The pressure-induced line shift coefficients are found to be transition dependent and different for the P- and R-branch lines with same J" value. No noticeable differences in the shift coefficients caused by air and nitrogen were found. The results obtained are compared with available values previously reported in the literature.
Investigation of irradiation effects induced by self-ion in 6H-SiC combining RBS/C, Raman and XRD
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaabane, Nihed; Debelle, Aurelien; Sattonnay, Gael
2012-01-01
Single crystals of 6H-SiC were irradiated at room temperature and 670 K with 4 MeV C ions at two fluences: 1015 and 1016 cm2 (0.16 and 1.6 dpa at the damage peak). Damage accumulation was studied by a combination of X-ray diffraction (XRD), Raman spectroscopy and Rutherford backscattering spectrometry in channelling geometry (RBS/C) along the [0001] direction. The irradiated layer is found to be composed of a low damage region up to 1.5 lm followed by a region where the disorder level is higher, consistent with SRIM predictions. At room temperature and low fluence, typically 1015 cm2, the strain depthmore » profile follows the dpa depth distribution (with a maximum value of 2%). The disorder is most likely due to small defect clusters. When increasing the fluence up to 1016 cm2, a buried amorphous layer forms, as indicated by e.g. Raman results where the Si C bands become broader or even disappear. At a higher irradiation temperature of 670 K, amorphization is not observed at the same fluence, revealing a dynamic annealing process. However, results tend to suggest that the irradiated layer is highly heterogeneous and composed of different types of defects.« less
NASA Astrophysics Data System (ADS)
Dean, Timothy C.; Ventrice, Carl A.
1995-05-01
As a final report for phase 1 of the project, the researchers are submitting to the Tennessee Tech Office of Research the following two papers (reprinted in this report): 'Collision Line Broadening Effects on Spectrometric Data from the Optical Plume Anomaly System (OPAD),' presented at the 30th AIAA/ASME/SAE/ASEE Joint Propulsion Conference, 27-29 June 1994, and 'Calculation of Collision Cross Sections for Atomic Line Broadening in the Plume of the Space Shuttle Main Engine (SSME),' presented at the IEEE Southeastcon '95, 26-29 March 1995. These papers fully state the problem and the progress made up to the end of NASA Fiscal Year 1994. The NASA OPAD system was devised to predict concentrations of anomalous species in the plume of the Space Shuttle Main Engine (SSME) through analysis of spectrometric data. The self absorption of the radiation of these plume anomalies is highly dependent on the line shape of the atomic transition of interest. The Collision Line Broadening paper discusses the methods used to predict line shapes of atomic transitions in the environment of a rocket plume. The Voigt profile is used as the line shape factor since both Doppler and collisional line broadening are significant. Methods used to determine the collisional cross sections are discussed and the results are given and compared with experimental data. These collisional cross sections are then incorporated into the current self absorbing radiative model and the predicted spectrum is compared to actual spectral data collected from the Stennis Space Center Diagnostic Test Facility rocket engine. The second paper included in this report investigates an analytical method for determining the cross sections for collision line broadening by molecular perturbers, using effective central force interaction potentials. These cross sections are determined for several atomic species with H2, one of the principal constituents of the SSME plume environment, and compared with experimental data.
Temperature dependence of the pressure broadening of spectral lines
NASA Astrophysics Data System (ADS)
Roston, G. D.; Helmi, M. S.
2012-12-01
The aim of this work is to obtain a formula relating the pressure broadening coefficient of the spectral line β with the temperature T, when the difference potential ΔV(R) between the upper and lower states of the emitting atom is represented by (Lennard - Jones) potential, The obtained formula is a power index law of β on T. This formula is applied for calculating β for different interactions of Ar, Ne, TI, Hg, Cd and Zn with the inert gases (Xe, Kr, Ar, Ne and He) at different temperatures. The results of these calculations are in good agreement with the corresponding values obtained before numerically. The obtained formula is considered very important in astrophysical problems.
Broadening sources of Diginity and Affirmation in Work and Relationship
Byars-Winston, Angela
2012-01-01
This article builds on assertions in Richardson’s (2012, this issue) Major Contribution on counseling for work and relationship. In this reaction, I expand on the relevance and potential of the counseling for work and relationship perspective to enrich the field of counseling psychology. My comments focus on three considerations to further extend the cultural relevance of Richardson’s work and relationship perspective: (1) broadening sources of dignity, (2) centering knowledge of marginalized communities, and (3) promoting psychologists’ critical consciousness. Richardson’s perspective holds great promise for being a guiding heuristic to inform counseling psychology research, theory, and practice. PMID:22563131
Line mixing in a N2-broadened CO2 Q branch observed with a tunable diode laser
NASA Technical Reports Server (NTRS)
Gentry, Bruce; Strow, L. Larrabee
1987-01-01
Line-mixing effects have been observed in the infrared Q branch of the (11/1/0,03/1/0)I-00/0/0 band of CO2 at 2076/cm. A tunable diode laser spectrometer was used to record spectra of CO2 broadened by N2 and O2 at total pressures ranging from 100 to 720 torr. The observed absorption coefficients are up to 65 percent lower than those calculated using an isolated Lorentzian line approximation. A simple energy gap scaling law is used to determine the off-diagonal relaxation matrix elements from the known pressure-broadening coefficients. The spectra calculated using these matrix elements reproduces the observed absorption coefficients to within several percent.
NASA Astrophysics Data System (ADS)
Buldyreva, J.; Margulès, L.; Motiyenko, R. A.; Rohart, F.
2013-11-01
Relaxation parameters for K-components (K≤6) of six J→J+1 rotational transitions (J=6, 10, 17, 22, 31 and 33) of CH335Cl perturbed by O2 are measured at room temperature with Voigt, speed-dependent Voigt and Galatry profiles in order to probe the speed-dependence effects. With respect to the previous study of CH335Cl-N2 system [Guinet et al., J Quant Spectrosc Radiat Transfer 2012;113:1113], higher active-gas pressures are reached, providing better signal-to-noise ratios, and the exact expression of the Beer-Lambert law is introduced in the fitting procedure, leading, among other advantages, to much more realistic low-pressure results. The broadening parameters of the considered lines are also computed by a semi-classical method for various relative velocities of colliders and the powers characterizing the dependence of the collisional cross-sections on relative speeds are deduced as functions of the rotational numbers J and K. Additional calculations performed with the Maxwell-Boltzmann distribution of velocities show no significant difference with the earlier results [Buldyreva et al., Phys Chem Chem Phys 2011;13:20326] obtained within the mean thermal velocity approximation. Weighted sums of the presently measured Voigt-profile O2-broadening parameters and of the previously published N2-broadening ones are calculated to yield experimental air-broadening coefficients for spectroscopic databases.
NASA Astrophysics Data System (ADS)
Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe
2018-06-01
Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1
de Jonge, Niels; Verch, Andreas; Demers, Hendrix
2018-02-01
The spatial resolution of aberration-corrected annular dark field scanning transmission electron microscopy was studied as function of the vertical position z within a sample. The samples consisted of gold nanoparticles (AuNPs) positioned in different horizontal layers within aluminum matrices of 0.6 and 1.0 µm thickness. The highest resolution was achieved in the top layer, whereas the resolution was reduced by beam broadening for AuNPs deeper in the sample. To examine the influence of the beam broadening, the intensity profiles of line scans over nanoparticles at a certain vertical location were analyzed. The experimental data were compared with Monte Carlo simulations that accurately matched the data. The spatial resolution was also calculated using three different theoretical models of the beam blurring as function of the vertical position within the sample. One model considered beam blurring to occur as a single scattering event but was found to be inaccurate for larger depths of the AuNPs in the sample. Two models were adapted and evaluated that include estimates for multiple scattering, and these described the data with sufficient accuracy to be able to predict the resolution. The beam broadening depended on z 1.5 in all three models.
NASA Technical Reports Server (NTRS)
Park, Yeonjoon (Inventor); Kim, Hyun Jung (Inventor); Skuza, Jonathan R. (Inventor); Lee, Kunik (Inventor); Choi, Sang Hyouk (Inventor); King, Glen C. (Inventor)
2017-01-01
An X-ray defraction (XRD) characterization method for sigma=3 twin defects in cubic semiconductor (100) wafers includes a concentration measurement method and a wafer mapping method for any cubic tetrahedral semiconductor wafers including GaAs (100) wafers and Si (100) wafers. The methods use the cubic semiconductor's (004) pole figure in order to detect sigma=3/{111} twin defects. The XRD methods are applicable to any (100) wafers of tetrahedral cubic semiconductors in the diamond structure (Si, Ge, C) and cubic zinc-blend structure (InP, InGaAs, CdTe, ZnSe, and so on) with various growth methods such as Liquid Encapsulated Czochralski (LEC) growth, Molecular Beam Epitaxy (MBE), Organometallic Vapor Phase Epitaxy (OMVPE), Czochralski growth and Metal Organic Chemical Vapor Deposition (MOCVD) growth.
N2 pressure - broadened O3 line widths and strengths near 1129.4 cm-1
NASA Technical Reports Server (NTRS)
Copeland, G. E.; Majorana, L. N.; Harward, C. N.; Steinkamp, R. J.
1982-01-01
A Beer's Law experiment was performed with a tunable diode laser to find the N2 pressure broadening characteristics of a single 03 absorption line at 1129.426 cm for N2 pressures from 10 to 100 torr (O3 pressure = 3.16 torr). SO2 line positions were used for wavelength calibration. Line shapes were interatively fitted to a Lorentz function. Results were delta (HWHM in MHz) = 47.44 (+ or - 5.34) MHz + 1.730 (+ or - 0.088) MHz/torr *p(torr) with sigma = 0.9897. This intercept compares well with the Doppler O3 - O3 broadened (at 3.16 torr) width of 44.52 Hz. This result in a HWHM line width of 0.44 cm atm at 760 torr and 285 K. The line strengths integrated over delta nu = 0.55 cm were found to be N2 pressure dependent.
Hubbert's Peak: A Physicist's View
NASA Astrophysics Data System (ADS)
McDonald, Richard
2011-11-01
Oil and its by-products, as used in manufacturing, agriculture, and transportation, are the lifeblood of today's 7 billion-person population and our 65T world economy. Despite this importance, estimates of future oil production seem dominated by wishful thinking rather than quantitative analysis. Better studies are needed. In 1956, Dr. M.King Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Thus, the peak of oil production is referred to as ``Hubbert's Peak.'' Prof. Al Bartlett extended this work in publications and lectures on population and oil. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. This paper extends this line of work to include analyses of individual countries, inclusion of multiple Gaussian peaks, and analysis of reserves data. While this is not strictly a predictive theory, we will demonstrate a ``closed'' story connecting production, oil-in-place, and reserves. This gives us the ``most likely'' estimate of future oil availability. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.
E-cigarettes: a need to broaden the debate.
Latif, E; Nair, M
2016-11-01
The unregulated market for e-cigarettes continues to grow, with debates on their efficacy and impact on global public health. E-cigarettes, or electronic nicotine delivery systems (ENDs), are marketed as a 'safe' alternative to tobacco products and a tool for 'harm reduction'. Some public health experts are calling it a 'game changer' and favour the 'harm reduction' strategy, while others dispute this claim. In our opinion, the debate needs to be broadened to encompass other related concerns and effects on non-users and affected stakeholders. As with tobacco control, a holistic approach is needed to build a raft of policies that effectively address the issue from all angles and look beyond the direct health implications of e-cigarette use to explore the social, economic, political and environmental aspects of this debate, putting 'harm reduction' in context.
Synthesis of Mn doped ZnS nanocrystals: Crystallographic and morphological study
NASA Astrophysics Data System (ADS)
Shaikh, Azharuddin Z.; Shirsath, Narendra B.; Sonawane, Prabhakar S.
2018-05-01
The influence of doping concentration on the physical properties of ZnS nanocrystals synthesized using coprecipitation method at room temperature is reported in this paper. In particular, we have studied the structural properties of Zn1-xMnxS where (x=0.01, 0.03, 0.05) by X-ray diffraction. X-ray peak broadening analysis used to calculate the crystalline sizes, lattice parameters, number of unit cell per particle and volume of unit cell. Crystalline ZnS with a cubic structure is confirmed by XRD results. The grain size of pure and Mn doped samples were found in the range of 7nm to 9nm. All the physical parameters of cubic ZnS nanocrystals were calculated are similar with standard values. The scanning electron microscope (SEM) which revealed that the synthesized nanocrystals are well-crystalline and possessing cubic phase.
NASA Astrophysics Data System (ADS)
Bürkle, Sebastian; Walter, Nicole; Wagner, Steven
2018-06-01
A set of high-resolution absorption spectrometers based on TDLAS was used to determine the impact of combustion-relevant gases on the pressure shift and broadening of H2O, CO2, C2H2 and CH4 absorption lines in the near-infrared spectral region. In particular, self- and foreign-broadening coefficients induced by CO2, N2, O2, air, C2H2 and CH4 were measured. The absorption lines under investigation are suitable to measure the respective species in typical combustion environments via laser absorption spectroscopy. Additionally, species-dependent self- and foreign-induced pressure shift coefficients were measured and compared to the literature. The experiments were performed in two specifically designed absorption cells over a wide pressure range from 5 to 180 kPa. Different sources of uncertainty were identified and quantified to achieve relative measurement uncertainties of 0.7-1.5% for broadening coefficients and 0.6-1.6% for pressure shift coefficients.
Trace elemental analysis of Indian natural moonstone gems by PIXE and XRD techniques.
Venkateswara Rao, R; Venkateswarulu, P; Kasipathi, C; Sivajyothi, S
2013-12-01
A selected number of Indian Eastern Ghats natural moonstone gems were studied with a powerful nuclear analytical and non-destructive Proton Induced X-ray Emission (PIXE) technique. Thirteen elements, including V, Co, Ni, Zn, Ga, Ba and Pb, were identified in these moonstones and may be useful in interpreting the various geochemical conditions and the probable cause of their inceptions in the moonstone gemstone matrix. Furthermore, preliminary XRD studies of different moonstone patterns were performed. The PIXE technique is a powerful method for quickly determining the elemental concentration of a substance. A 3MeV proton beam was employed to excite the samples. The chemical constituents of moonstones from parts of the Eastern Ghats geological formations of Andhra Pradesh, India were determined, and gemological studies were performed on those gems. The crystal structure and the lattice parameters of the moonstones were estimated using X-Ray Diffraction studies, trace and minor elements were determined using the PIXE technique, and major compositional elements were confirmed by XRD. In the present work, the usefulness and versatility of the PIXE technique for research in geo-scientific methodology is established. © 2013 Elsevier Ltd. All rights reserved.
Automated asteroseismic peak detections
NASA Astrophysics Data System (ADS)
García Saravia Ortiz de Montellano, Andrés; Hekker, S.; Themeßl, N.
2018-05-01
Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible in a power density spectrum. Identification of oscillation modes is usually done by visual inspection that is time-consuming and has a degree of subjectivity. Here, we present a peak-detection algorithm especially suited for the detection of solar-like oscillations. It reliably characterizes the solar-like oscillations in a power density spectrum and estimates their parameters without human intervention. Furthermore, we provide a metric to characterize the false positive and false negative rates to provide further information about the reliability of a detected oscillation mode or the significance of a lack of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler.
Pressure broadening and pressure shift of diatomic iodine at 675 nm
NASA Astrophysics Data System (ADS)
Wolf, Erich N.
Doppler-limited, steady-state, linear absorption spectra of 127 I2 (diatomic iodine) near 675 nm were recorded with an internally-referenced wavelength modulation spectrometer, built around a free-running diode laser using phase-sensitive detection, and capable of exceeding the signal-to-noise limit imposed by the 12-bit data acquisition system. Observed I2 lines were accounted for by published spectroscopic constants. Pressure broadening and pressure shift coefficients were determined respectively from the line-widths and line-center shifts as a function of buffer gas pressure, which were determined from nonlinear regression analysis of observed line shapes against a Gaussian-Lorentzian convolution line shape model. This model included a linear superposition of the I2 hyperfine structure based on changes in the nuclear electric quadrupole coupling constant. Room temperature (292 K) values of these coefficients were determined for six unblended I 2 lines in the region 14,817.95 to 14,819.45 cm-1 for each of the following buffer gases: the atoms He, Ne, Ar, Kr, and Xe; and the molecules H2, D2, N2, CO2, N2O, air, and H2O. These coefficients were also determined at one additional temperature (388 K) for He and CO2, and at two additional temperatures (348 and 388 K) for Ar. Elastic collision cross-sections were determined for all pressure broadening coefficients in this region. Room temperature values of these coefficients were also determined for several low-J I2 lines in the region 14,946.17 to 14,850.29 cm-1 for Ar. A line shape model, obtained from a first-order perturbation solution of the time-dependent Schrodinger equation for randomly occurring interactions between a two-level system and a buffer gas treated as step-function potentials, reveals a relationship between the ratio of pressure broadening to pressure shift coefficients and a change in the wave function phase-factor, interpreted as reflecting the "cause and effect" of state-changing events in the
Code of Federal Regulations, 2010 CFR
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Atlas Peak. 9.140 Section... THE TREASURY LIQUORS AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.140 Atlas Peak. (a) Name. The name of the viticultural area described in this section is “Atlas Peak.” (b...
Kevers, Ruth; Rober, Peter; Derluyn, Ilse; De Haene, Lucia
2016-12-01
In the aftermath of war and armed conflict, individuals and communities face the challenge of dealing with recollections of violence and atrocity. This article aims to contribute to a better understanding of processes of remembering and forgetting histories of violence in post-conflict communities and to reflect on related implications for trauma rehabilitation in post-conflict settings. Starting from the observation that memory operates at the core of PTSD symptomatology, we more closely explore how this notion of traumatic memory is conceptualized within PTSD-centered research and interventions. Subsequently, we aim to broaden this understanding of traumatic memory and post-trauma care by connecting to findings from social memory studies and transcultural trauma research. Drawing on an analysis of scholarly literature, this analysis develops into a perspective on memory that moves beyond a symptomatic framing toward an understanding of memory that emphasizes its relational, political, moral, and cultural nature. Post-conflict memory is presented as inextricably embedded in communal relations, involving ongoing trade-offs between individual and collective responses to trauma and a complex negotiation of speech and silence. In a concluding discussion, we develop implications of this broadened understanding for post-conflict trauma-focused rehabilitation.
Quasiparticle lifetime broadening in resonant x-ray scattering of NH4NO3
NASA Astrophysics Data System (ADS)
Vinson, John; Jach, Terrence; Müller, Matthias; Unterumsberger, Rainer; Beckhoff, Burkhard
2016-07-01
It has been previously shown that two effects cause dramatic changes in the x-ray absorption and emission spectra from the N K edge of the insulating crystal ammonium nitrate. First, vibrational disorder causes major changes in the absorption spectrum, originating not only from the thermal population of phonons, but, significantly, from zero-point motion as well. Second, the anomalously large broadening (˜4 eV) of the emission originating from nitrate σ states is due to the unusually short lifetimes of quasiparticles in an otherwise extremely narrow band. In this work, we investigate the coupling of these effects to core and valence excitons that are created as the initial x-ray excitation energy is progressively reduced toward the N edge. Using a G W /Bethe-Salpeter approach, we show the extent to which this anomalous broadening is captured by the G W approximation. The data and calculations demonstrate the importance that the complex self-energies (finite lifetimes) of the valence bands have on the interpretation of emission spectra. We produce a scheme to explain why extreme lifetimes should appear in σ states of other similar compounds.
NASA Astrophysics Data System (ADS)
Werwein, Viktor; Li, Gang; Serdyukov, Anton; Brunzendorf, Jens; Werhahn, Olav; Ebert, Volker
2018-06-01
In the present study, we report highly accurate air-induced broadening and shift coefficients for the nitrous oxide (N2O) 0002-0000 band at 2.26 μm of the main isotopologue retrieved from high-resolution Fourier transform infrared (FTIR) measurements with metrologically determined pressure, temperature, absorption path length and chemical composition. Most of our retrieved air-broadening coefficients agree with previously generated datasets within the expanded (confidence interval of 95%) uncertainties. For the air-shift coefficients our results suggest a different rotational dependence compared to literature. The present study benefits from improved measurement conditions and a detailed metrological uncertainty description. Comparing to literature, the uncertainties of the previous broadening and shift coefficients are improved by a factor of up to 39 and up to 22, respectively.
Zhang, Ping; Wang, Tianqi; Zhang, Longlong; Wu, Daishe; Frost, Ray L
2015-12-05
Hydrocalumite (CaAl-LDH-Cl) interacted with a natural anionic surfactant, sodium hexadecyl sulfate (SHS), was performed using an intercalation method. To understand the intercalation behavior and characterize the resulting products, powder X-ray diffraction (XRD), scan electron microscopy (SEM) and mid-infrared (MIR) spectroscopy combined with near-infrared (NIR) spectroscopy technique were used. The XRD analysis indicated that SHS was intercalated into CaAl-LDH-Cl successfully, resulting in an expansion of the interlayer (from 0.78 nm to 2.74 nm). The bands of C-H stretching vibrations of SHS were observed in the near-infrared spectra, which indicated that the resulting products were indeed CaAl-LDH-SHS. In addition, the bands of water stretching vibrations and OH groups shifted to higher wavenumbers when SHS was intercalated into CaAl-LDH-Cl interlayer space. Copyright © 2015 Elsevier B.V. All rights reserved.
Broadening and shifting of Bragg reflections of nanoscale-microtwinned LT-Ni3Sn2
NASA Astrophysics Data System (ADS)
Leineweber, Andreas; Krumeich, Frank
2013-12-01
The effect of nanoscale microtwinning of long-range ordered domains in LT-Ni3Sn2 on its diffraction behaviour was studied by X-ray powder diffraction and electron microscopy. LT-Ni3Sn2 exhibits a Ni2In/NiAs-type structure with a superstructure breaking the symmetry relative to the hexagonal high-temperature (HT) to the orthorhombic low-temperature (LT) phase, implying three different twin-domain orientations. The microstructure was generated by annealing HT-Ni3Sn2 considerably below the order-disorder transition temperature, establishing the LT phase avoiding too much domain coarsening. High-resolution electron microscopy reveals domain sizes of 100-200 Å compatible with the Scherrer broadening of the superstructure reflections recorded by X-ray diffraction. Whereas the orthorhombic symmetry of the LT phase leads in powder-diffraction patterns from coarse-domain size material to splitting of the fundamental reflections, this splitting does not occur for the LT-Ni3Sn2 with nanoscale domains. Instead, a (pseudo)hexagonal indexing is possible giving hexagonal lattice parameters, which are, however, incompatible with the positions of the superstructure reflections. This can be attributed to interference between X-rays scattered by the differently oriented, truly orthorhombic domains leading to merging of the fundamental reflections. These show pronounced anisotropic microstrain-like broadening, where the integral breadths ? on the reciprocal d-spacing scale of a series of higher order reflection increase in a non-linear fashion with upward curvature with the reciprocal d-spacings ? of these reflections. Such a type of unusual microstrain broadening appears to be typical for microstructures which are inhomogeneous on the nanoscale, and in which the structural inhomogeneities lead to small phase shifts of the scattered radiation from different locations (e.g. domains).
Goldsworthy, W.W.; Robinson, J.B.
1959-03-31
A peak voltage amplitude limiting system adapted for use with a cascade type amplifier is described. In its detailed aspects, the invention includes an amplifier having at least a first triode tube and a second triode tube, the cathode of the second tube being connected to the anode of the first tube. A peak limiter triode tube has its control grid coupled to thc anode of the second tube and its anode connected to the cathode of the second tube. The operation of the limiter is controlled by a bias voltage source connected to the control grid of the limiter tube and the output of the system is taken from the anode of the second tube.
Comparing the line broadened quasilinear model to Vlasov code
NASA Astrophysics Data System (ADS)
Ghantous, K.; Berk, H. L.; Gorelenkov, N. N.
2014-03-01
The Line Broadened Quasilinear (LBQ) model is revisited to study its predicted saturation level as compared with predictions of a Vlasov solver BOT [Lilley et al., Phys. Rev. Lett. 102, 195003 (2009) and M. Lilley, BOT Manual. The parametric dependencies of the model are modified to achieve more accuracy compared to the results of the Vlasov solver both in regards to a mode amplitude's time evolution to a saturated state and its final steady state amplitude in the parameter space of the model's applicability. However, the regions of stability as predicted by LBQ model and BOT are found to significantly differ from each other. The solutions of the BOT simulations are found to have a larger region of instability than the LBQ simulations.
Distribution of Chern number by Landau level broadening in Hofstadter butterfly
NASA Astrophysics Data System (ADS)
Yoshioka, Nobuyuki; Matsuura, Hiroyasu; Ogata, Masao
2015-04-01
We discuss the relationship between the quantum Hall conductance and a fractal energy band structure, Hofstadter butterfly, on a square lattice under a magnetic field. At first, we calculate the Hall conductance of Hofstadter butterfly on the basis of the linear responce theory. By classifying the bands into some groups with a help of continued fraction expansion, we find that the conductance at the band gaps between the groups accord with the denominators of fractions obtained by aborting the expansion halfway. The broadening of Landau levels is given as an account of this correspondance.
Huntsinger, Jeffrey R
2012-11-01
The current research challenges the common view that positive affect and negative affect generate a broadened or narrowed attentional focus, respectively. Contrary to this view, two studies found that the link between affect and attentional focus as measured by a traditional flanker task (Study 1) and a modified flanker task (Study 2) reflects whatever focus is momentarily dominant. Further, in these studies when neither focus was dominant, the link between affect and attentional focus vanished. These results demonstrate that, like reward, positive affect and negative affect are not dedicated to a particular broadened or narrowed attentional scope but rather provide embodied information about the value of currently accessible attentional orientations. (PsycINFO Database Record (c) 2012 APA, all rights reserved).
Drees, H; Müller, E; Dries, M; Gerthsen, D
2018-02-01
Resolution in scanning transmission electron microscopy (STEM) is ultimately limited by the diameter of the electron beam. The electron beam diameter is not only determined by the properties of the condenser lens system but also by electron scattering in the specimen which leads to electron-beam broadening and degradation of the resolution with increasing specimen thickness. In this work we introduce a new method to measure electron-beam broadening which is based on STEM imaging with a multi-segmented STEM detector. We focus on STEM at low electron energies between 10 and 30 keV and use an amorphous carbon film with known thickness as test object. The experimental results are compared with calculated beam diameters using different analytical models and Monte-Carlo simulations. We find excellent agreement of the experimental data with the recently published model by Gauvin and Rudinsky [1] for small t/λ el (thickness to elastic mean free path) values which are considered in our study. Copyright © 2017 Elsevier B.V. All rights reserved.
XRD and EBSD analysis of anisotropic microstructure development in cold rolled F138 stainless steel
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Vincentis, N.S., E-mail: devincentis@ifir-conic
The microstructural characteristics of deformation-processed materials highly influence their mechanical properties. For a complete characterization of a microstructure both local and global information must be gathered, which requires the combination of different analysis techniques. X-ray and Electron Backscatter Diffraction were used in the present paper to characterize the deformation induced in a cold rolled F138 austenitic stainless steel sample. The results obtained using laboratory and synchrotron X-ray sources were compared and combined with EBSD quantitative results, allowing the global and local characterization and orientation dependence of the deformation microstructure. A particular behavior was observed in the XRD data corresponding tomore » the planes with < 220 >∥ ND, likely due to a smaller amount of defects accumulated in the crystals with that particular orientation. EBSD was used to separate the scans data into partitions and to calculate misorientation variables and parameters, showing that this behavior can be attributed to a combination of larger grain sizes, lower local boundary misorientations and dislocation densities for crystals having < 220 >∥ ND. Several conclusions, of general validity for the evaluation of microstructure anisotropy, can be extracted from the results. - Highlights: •Combined XRD and EBSD for studying microstructure gave a superb insight on anisotropic accumulation of defects. •W-H and CMWP methods were applied for checking consistency of results. •XRD showed that a smaller accumulation of defects occurred in crystals with < 220 >∥ ND. •High brilliance X-ray beam allowed to study the anisotropy of defect accumulation.« less
Solid State Reduction of MoO3 with Carbon via Mechanical Alloying to Synthesize Nano-Crystaline MoO2
NASA Astrophysics Data System (ADS)
Saghafi, M.; Ataie, A.; Heshmati-Manesh, S.
In this research, effect of milling time on solid state reduction of MoO3 with carbon has been investigated. It was found that mechanical activation of a mixture of MoO3 and carbon at ambient temperature by high energy ball milling was not able to reduce MoO3 to metallic molybdenum. MoO3 was converted to MoO2 at the first stage of reduction and peaks of the latter phase in X-ray diffraction patterns were detected when the milling time exceeded from 50 hours. The main effect of increased milling time at this stage was decreasing of MoO3 peak intensities and significant peak broadening due to decrease in size of crystallites. After prolonged milling, MoO3 was fully reduced to nano-crystalline MoO2 and its mean crystallite size was calculated using Williamson-Hall technique and found to be 17.5 nm. Thermodynamic investigations also confirm the possibility of reduction of MoO3 to MoO2 during the milling operation at room temperature. But, further reduction to metallic molybdenum requires thermal activation at higher temperature near 1100 K. XRD and SEM techniques were employed to evaluate the powder particles characteristics.
The Boson peak in supercooled water.
Kumar, Pradeep; Wikfeldt, K Thor; Schlesinger, Daniel; Pettersson, Lars G M; Stanley, H Eugene
2013-01-01
We perform extensive molecular dynamics simulations of the TIP4P/2005 model of water to investigate the origin of the Boson peak reported in experiments on supercooled water in nanoconfined pores, and in hydration water around proteins. We find that the onset of the Boson peak in supercooled bulk water coincides with the crossover to a predominantly low-density-like liquid below the Widom line TW. The frequency and onset temperature of the Boson peak in our simulations of bulk water agree well with the results from experiments on nanoconfined water. Our results suggest that the Boson peak in water is not an exclusive effect of confinement. We further find that, similar to other glass-forming liquids, the vibrational modes corresponding to the Boson peak are spatially extended and are related to transverse phonons found in the parent crystal, here ice Ih.
Composition and microstructure of MTA and Aureoseal Plus: XRF, EDS, XRD and FESEM evaluation.
Cianconi, L; Palopoli, P; Campanella, V; Mancini, M
2016-12-01
The aim of this study was to determine the chemical composition and the phases' microstructure of Aureoseal Plus (OGNA, Italy) and ProRoot MTA (Dentsply Tulsa Dental, USA) and to compare their characteristics. Study Design: Comparing Aureoseal Plus and ProRoot MTA microstructure by means of several analyses type. The chemical analysis of the two cements was assessed following the UNI EN ISO 196-2 norm. X-Ray fluorescence (XRF) was used to determine the element composition. The crystalline structure was analysed quantitatively using x-ray diffraction (XRD). Powders morphology was evaluated using a scanning electron microscope (SEM) with backscattering detectors, and a field emission scanning electron microscope (FESEM). Elemental analysis was performed by energy dispersive x-ray analysis (EDS). The semi-quantitative XRF analysis showed the presence of heavy metal oxides in both cements. The XRD spectra of the two cements reported the presence of dicalcium silicate, tricalcium silicate, tricalcium aluminate, tetracalcium aluminoferrite, bismuth oxide and gypsum. SEM analysis showed that ProRoot MTA powder is less coarse and more homogeneous than Aureoseal. Both powders are formed by particles of different shapes: round, prismatic and oblong. The EDS analysis showed that some ProRoot MTA particles, differently from Aureoseal, contain Ca, Si, Al and Fe. Oblong particles in ProRoot and Aureoseal are rich of bismuth. The strong interest in developing new Portland cement-based endodontic sealers will create materials with increased handling characteristics and physicochemical properties. A thorough investigation on two cement powders was carried out by using XRF, XRD, SEM and EDS analysis. To date there was a lack of studies on Aureoseal Plus. This cement is similar in composition to ProRoot MTA. Despite that it has distinctive elements that could improve its characteristics, resulting in a good alternative to MTA.
In-situ XRD and EDS method study on the oxidation behaviour of Ni-Cu sulphide ore.
Li, Guangshi; Cheng, Hongwei; Xiong, Xiaolu; Lu, Xionggang; Xu, Cong; Lu, Changyuan; Zou, Xingli; Xu, Qian
2017-06-12
The oxidation mechanism of sulfides is the key issue during the sulphide-metallurgy process. In this study, the phase transformation and element migration were clearly demonstrated by in-situ laboratory-based X-ray diffraction (XRD) and energy-dispersive X-ray spectroscopy (EDS), respectively. The reaction sequence and a four-step oxidation mechanism were proposed and identified. The elemental distribution demonstrated that at a low temperature, the Fe atoms diffused outward and the Ni/Cu atoms migrated toward the inner core, whereas the opposite diffusion processes were observed at a higher temperature. Importantly, the unique visual presentation of the oxidation behaviour provided by the combination of in-situ XRD and EDS might be useful for optimising the process parameters to improve the Ni/Cu extraction efficiency during Ni-Cu sulphide metallurgy.
Umesh P. Agarwal; Sally A. Ralph; Carlos Baez; Richard S. Reiner; Steve P. Verrill
2017-01-01
Although X-ray diffraction (XRD) has been the most widely used technique to investigate crystallinity index (CrI) and crystallite size (L200) of cellulose materials, there are not many studies that have taken into account the role of sample moisture on these measurements. The present investigation focuses on a variety of celluloses and cellulose...
NASA Technical Reports Server (NTRS)
Woo, Richard; Goldstein, Richard M.
1994-01-01
Spectral broadening measurements conducted at S-band (13-cm wavelength) during solar minimum conditions in the heliocentric distance range of 3-8 R(sub O) by Mariner 4, Pioneer 10, Mariner 10, Helios 1, Helios 2, and Viking have been combined to reveal a factor of 2.6 reduction in bandwidth from equator to pole. Since spectral broadening bandwidth depends on electron density fluctuation and solar wind speed, and latitudinal variation of the former is available from coherence bandwidth measurements, the remote sensing spectral broadening measurements provide the first determination of the latitudinal variation of solar wind speed in the acceleration region. When combined with electron density measurements deduced from white-light coronagraphs, this result also leads to the first determination of the latitudinal variation of mass flux in the acceleration region. From equator to pole, solar wind speed increases by a factor of 2.2, while mass flux decreases by a factor of 2.3. These results are consistent with measurements of solar wind speed by multi-station intensity scintillation measurements, as well as measurements of mass flux inferred from Lyman alpha observations, both of which pertain to the solar wind beyond 0.5 AU. The spectral broadening observations, therefore, strengthen earlier conclusions about the latitudinal variation of solar wind speed and mass flux, and reinforce current solar coronal models and their implications for solar wind acceleration and solar wind modeling.
NASA Astrophysics Data System (ADS)
Wazen, P.; Bourdet, G. L.
1991-01-01
The authors studied the Doppler-broadened 11.76-micron N-15H3 emission line optically pumped in a ring resonator by a CW CO2 laser operating on the 10R(42) line. Behavior related to the optical pumping of gas Doppler-broadened lines is found and shown to be very dependent on the laser parameters. For instance, the laser emission can occur in one direction or two directions simultaneously. A local gain model based on the interaction of two laser fields with a three-level molecular system is used to clarify the emission characteristics of this laser. Basically, the two-photon or Raman process and the Rabi splitting generate a gain anisotropy and an anomalous dispersion curve. The effects lead to a different optical path for the two directions of propagation and, consequently, a simultaneous bidirectional emission with unequal emission frequency.
High temperature XRD of Cu2GeSe3
NASA Astrophysics Data System (ADS)
Premkumar D., S.; Chetty, Raju; Malar, P.; Mallik, Ramesh Chandra
2015-06-01
The Cu2GeSe3 is prepared by solid state synthesis method. The high temperature XRD has been done at different temperature from 30 °C to 450 °C. The reitveld refinement confirms Cu2GeSe3 phase and orthorhombic crystal structure. The lattice constants are increasing with increase in the temperature and their rate of increase with respect to temperature are used for finding the thermal expansion coefficient. The calculation of the linear and volume coefficient of thermal expansion is done from 30 °C to 400 °C. Decrease in the values of linear expansion coefficients with temperature are observed along a and c axis. Since thermal expansion coefficient is the consequence of the distortion of atoms in the lattice; this can be further used to find the minimum lattice thermal conductivity at given temperature.
(abstract) Line Mixing Behavior of Hydrogen-Broadened Ammonia Under Jovian Atmospheric Conditions
NASA Technical Reports Server (NTRS)
Spilker, Thomas R.
1994-01-01
Laboratory spectral data reported last year have been used to investigate the line mixing behavior of hydrogen-broadened ammonia inversion lines. The data show that broadening parameters appearing in the modified Ben-Reuven opacity formalism of Berge and Gulkis (1976) cannot maintain constant values over pressure ranges that include low to moderate pressures and high pressures. Also, they cannot change drastically in value, as in the Spilker (1990) revision of the Berge and Gulkis formalism. It has long been recognized that at low pressures, less than about 1 bar of a Jovian atmospheric mixture, a VVW formalism yields more accurate predictions of ammonia opacity than Ben-Reuven formalisms. At higher pressures the Ben-Reuven formalisms are more accurate. Since the Ben-Reuven lineshape collapses to a VVW lineshape in the low pressure limit, this low pressure inaccuracy of the Ben-Reuven formalisms is surprising. By incorporating various behavior, a new formalism is produced that is more accurate than previous formalisms, particularly in the critical 'transition region' from 0.5 to 2 bars, and that can be used without discontinuity from pressures of zero to hundreds of bars. The new formalism will be useful in such applications as interpretation of radio astronomical and radio occultation data on giant planet atmospheres, and radiative transfer modeling of those atmospheres.
Method and apparatus for current-output peak detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Geronimo, Gianluigi
2017-01-24
A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.
Zhang, Jiafu; Wang, Yixun; Zhang, Liye; Zhang, Ruihong; Liu, Guangqing; Cheng, Gang
2014-01-01
X-ray diffraction (XRD) was used to understand the interactions of cellulose in lignocellulosic biomass with ionic liquids (ILs). The experiment was designed in such a way that the process of swelling and solubilization of crystalline cellulose in plant cell walls was followed by XRD. Three different feedstocks, switchgrass, corn stover and rice husk, were pretreated using 1-butyl-3-methylimidazolium acetate ([C4mim][OAc]) at temperatures of 50-130°C for 6h. At a 5 wt.% biomass loading, increasing pretreatment temperature led to a drop in biomass crystallinity index (CrI), which was due to swelling of crystalline cellulose. After most of the crystalline cellulose was swollen with IL molecules, a low-order structure was found in the pretreated samples. Upon further increasing temperature, cellulose II structure started to form in the pretreated biomass samples as a result of solubilization of cellulose in [C4mim][OAc] and subsequent regeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.
Peak distortion effects in analytical ion chromatography.
Wahab, M Farooq; Anderson, Jordan K; Abdelrady, Mohamed; Lucy, Charles A
2014-01-07
The elution profile of chromatographic peaks provides fundamental understanding of the processes that occur in the mobile phase and the stationary phase. Major advances have been made in the column chemistry and suppressor technology in ion chromatography (IC) to handle a variety of sample matrices and ions. However, if the samples contain high concentrations of matrix ions, the overloaded peak elution profile is distorted. Consequently, the trace peaks shift their positions in the chromatogram in a manner that depends on the peak shape of the overloading analyte. In this work, the peak shapes in IC are examined from a fundamental perspective. Three commercial IC columns AS16, AS18, and AS23 were studied with borate, hydroxide and carbonate as suppressible eluents. Monovalent ions (chloride, bromide, and nitrate) are used as model analytes under analytical (0.1 mM) to overload conditions (10-500 mM). Both peak fronting and tailing are observed. On the basis of competitive Langmuir isotherms, if the eluent anion is more strongly retained than the analyte ion on an ion exchanger, the analyte peak is fronting. If the eluent is more weakly retained on the stationary phase, the analyte peak always tails under overload conditions regardless of the stationary phase capacity. If the charge of the analyte and eluent anions are different (e.g., Br(-) vs CO3(2-)), the analyte peak shapes depend on the eluent concentration in a more complex pattern. It was shown that there are interesting similarities with peak distortions due to strongly retained mobile phase components in other modes of liquid chromatography.
NASA Astrophysics Data System (ADS)
Prakash, Roopa; Choudhury, Vishal; Arun, S.; Supradeepa, V. R.
2018-02-01
Continuous-wave(CW) supercontinuum sources find applications in various domains such as imaging, spectroscopy, test and measurement. They are generated by pumping an optical fiber with a CW laser in the anomalous-dispersion region close to its zero-dispersion wavelength. Modulation instability(MI) sidebands are created, and further broadened and equalized by additional nonlinear processes generating the supercontinuum. This necessitates high optical powers and at lower powers, only MI sidebands can be seen without the formation of the supercontinuum. Obtaining a supercontinuum at low, easily manageable optical powers is attractive for many applications, but current techniques cannot achieve this. In this work, we propose a new mechanism for low power supercontinuum generation utilizing the modified MI gain spectrum for a line-broadened, decorrelated pump. A novel two-stage generation mechanism is demonstrated, where the first stage constituting standard telecom fiber slightly broadens the input pump linewidth. However, this process in the presence of dispersion, acts to de-correlate the different spectral components of the pump signal. When this is sent through highly nonlinear fiber near its zero-dispersion wavelength, the shape of the MI gain spectrum is modified, and this process naturally results in the generation of a broadband, equalized supercontinuum source at much lower powers than possible using conventional single stage spectral broadening. Here, we demonstrate a 0.5W supercontinuum source pumped using a 4W Erbium-Ytterbium co-doped fiber laser with a bandwidth spanning from 1300nm to 2000nm. We also demonstrate an interesting behaviour of this technique of relative insensitivity to the pump wavelength vis-a-vis zero-dispersion wavelength of the fiber.
Kong, Fan-Zhi; Yang, Ying; He, Yu-Chen; Zhang, Qiang; Li, Guo-Qing; Fan, Liu-Yin; Xiao, Hua; Li, Shan; Cao, Cheng-Xi
2016-09-01
In this work, charge-to-mass ratio (C/M) and band broadening analyses were combined to provide better guidance for the design of free-flow zone electrophoresis carrier buffer (CB). First, the C/M analyses of hemoglobin and C-phycocyanin (C-PC) under different pH were performed by CLC Protein Workbench software. Second, band dispersion due to the initial bandwidth, diffusion, and hydrodynamic broadening were discussed, respectively. Based on the analyses of the C/M and band broadening, a better guidance for preparation of free-flow zone electrophoresis CB was obtained. Series of experiments were performed to validate the proposed method. The experimental data showed high accordance with our prediction allowing the CB to be prepared easily with our proposed method. To further evaluate this method, C-PC was purified from crude extracts of Spirulina platensis with the selected separation condition. Results showed that C-PC was well separated from other phycobiliproteins that have similar physicochemical properties, and analytical grade product with purity up to 4.5 (A620/A280) was obtained. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ham, Sujin; Chung, Heejae; Kim, Tae-Woo; Kim, Jiwon; Kim, Dongho
2018-02-01
Lead halide perovskite nanoparticles (NPs) are attractive as they exhibit excellent color purity and have a tunable band gap, and can thus be applied in highly efficient photovoltaic and light-emitting diodes. Fundamental studies of emission linewidth broadening due to spectral shifts in perovskite NPs may suggest a way to improve their color purity. However, the carrier-induced Stark shift that causes spectral diffusion still requires investigation. In this study, we explore composition-related emission linewidth broadening by comparing CsPbBr3 and CH 3 NH 3 PbBr 3 (MAPbBr3) perovskite NPs. We find that the MAPbBr3 NPs are more sensitive to fluctuations in the local electric fields than the CsPbBr3 NPs due to an intrinsic difference in the dipole moment between the two A cations (Cs and MA), which shows a carrier-induced Stark shift. The results indicate that the compositions of perovskite NPs are closely associated with emission linewidth broadening and they also provide insights into the development of NP-based devices with high color purity.
ITALIAN PEAK AND ITALIAN PEAK MIDDLE ROADLESS AREAS, IDAHO AND MONTANA.
Skipp, Betty; Lambeth, Robert H.
1984-01-01
The Italian Peak and Italian Peak Middle Roadless Areas, in southwestern Montana and east-central Idaho, contain areas of probable mineral-resource potential based on combined geologic, geophysical, and geochemical studies and prospect examination. Small areas along the western, southern, and northeastern boundaries of the roadless areas have probable mineral resource potential for zinc, lead, silver, and uranium. An area of probable resource potential just east of and including a part of the Birch Creek mining district, may contain stratabound and fault-controlled silver and base metals, even though geochemical anomalies are low, and extensive prospecting has not identified any significant mineralization. The roadless areas are a part of the overthrust belt, and oil and gas possibilities must be assessed.
DOUBLE-PEAKED NARROW-LINE ACTIVE GALACTIC NUCLEI. II. THE CASE OF EQUAL PEAKS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, K. L.; Shields, G. A.; Salviander, S.
Active galactic nuclei (AGNs) with double-peaked narrow lines (DPAGNs) may be caused by kiloparsec-scale binary AGNs, bipolar outflows, or rotating gaseous disks. We examine the class of DPAGNs in which the two narrow-line components have closely similar intensity as being especially likely to involve disks or jets. Two spectroscopic indicators support this likelihood. For DPAGNs from Smith et al., the 'equal-peaked' objects (EPAGNs) have [Ne V]/[O III]ratios lower than for a control sample of non-double-peaked AGNs. This is unexpected for a pair of normal AGNs in a galactic merger, but may be consistent with [O III] emission from a rotatingmore » ring with relatively little gas at small radii. Also, [O III]/H{beta} ratios of the redshifted and blueshifted systems in the EPAGN are more similar to each other than in a control sample, suggestive of a single ionizing source and inconsistent with the binary interpretation.« less
Relationships between Electroencephalographic Spectral Peaks Across Frequency Bands
van Albada, S. J.; Robinson, P. A.
2013-01-01
The degree to which electroencephalographic spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification. PMID:23483663
Hubbert's Peak -- A Physicist's View
NASA Astrophysics Data System (ADS)
McDonald, Richard
2011-04-01
Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.
NASA Astrophysics Data System (ADS)
Bakala, P.; Goluchová, K.; Török, G.; Šrámková, E.; Abramowicz, M. A.; Vincent, F. H.; Mazur, G. P.
2015-09-01
Context. High-frequency (millisecond) quasi-periodic oscillations (HF QPOs) are observed in the X-ray power-density spectra of several microquasars and low-mass X-ray binaries. Two distinct QPO peaks, so-called twin peak QPOs, are often detected simultaneously exhibiting their frequency ratio close or equal to 3:2. A widely discussed class of proposed QPOs models is based on oscillations of accretion toroidal structures orbiting in the close vicinity of black holes or neutron stars. Aims: Following the analytic theory and previous studies of observable spectral signatures, we aim to model the twin peak QPOs as a spectral imprint of specific dual oscillation regime defined by a combination of the lowest radial and vertical oscillation mode of slender tori. We consider the model of an optically thick slender accretion torus with constant specific angular momentum. We examined power spectra and fluorescent Kα iron line profiles for two different simulation setups with the mode frequency relations corresponding to the epicyclic resonance HF QPOs model and modified relativistic precession QPOs model. Methods: We used relativistic ray-tracing implemented in the parallel simulation code LSDplus. In the background of the Kerr spacetime geometry, we analyzed the influence of the distant observer inclination and the spin of the central compact object. Relativistic optical projection of the oscillating slender torus is illustrated by images in false colours related to the frequency shift. Results: We show that performed simulations yield power spectra with the pair of dominant peaks that correspond to the frequencies of radial and vertical oscillation modes and with the peak frequency ratio equal to the proper value 3:2 on a wide range of inclinations and spin values. We also discuss exceptional cases of a very low and very high inclination, as well as unstable high spin relativistic precession-like configurations that predict a constant frequency ratio equal to 1:2. We
Temperature dependence of the hydrogen-broadening coefficient for the nu 9 fundamental of ethane
NASA Technical Reports Server (NTRS)
Halsey, G. W.; Hillman, J. J.; Nadler, Shacher; Jennings, D. E.
1988-01-01
Experimental results for the temperature dependence of the H2-broadening coefficient for the nu 9 fundamental of ethane are reported. Measurements were made over the temperature range 95-300 K using a novel low-temperature absorption cell. These spectra were recorded with the Doppler-limited diode laser spectrometer at NASA Goddard. The results are compared with recent measurements and model predictions.
Rotational broadening and conservation of angular momentum in post-extreme horizontal branch stars
NASA Astrophysics Data System (ADS)
Fontaine, G.; Latour, M.
2018-06-01
We show that the recent realization that isolated post-extreme horizontal branch (post-EHB) stars are generally characterized by rotational broadening with values of V rot sini between 25 and 30 km s-1 can be explained as a natural consequence of the conservation of angular momentum from the previous He-core burning phase on the EHB. The progenitors of these evolved objects, the EHB stars, are known to be slow rotators with an average value of V rot sini of 7.7 km s-1. This implies significant spin-up between the EHB and post-EHB phases. Using representative evolutionary models of hot subdwarf stars, we demonstrate that angular momentum conservation in uniformly rotating structures (rigid-body rotation) boosts that value of the projected equatorial rotation speed by a factor 3.6 by the time the model has reached the region of the surface gravity-effective temperature plane where the newly-studied post-EHB objects are found. This is exactly what is needed to account for their observed atmospheric broadening. We note that the decrease of the moment of inertia causing the spin-up is mostly due to the redistribution of matter that produces more centrally-condensed structures in the post-EHB phase of evolution, not to the decrease of the radius per se.
Dyer, A.L.
1958-07-29
An improvement in peak reading voltmeters is described, which provides for storing an electrical charge representative of the magnitude of a transient voltage pulse and thereafter measuring the stored charge, drawing oniy negligible energy from the storage element. The incoming voltage is rectified and stored in a condenser. The voltage of the capacitor is applied across a piezoelectric crystal between two parallel plates. Amy change in the voltage of the capacitor is reflected in a change in the dielectric constant of the crystal and the capacitance between a second pair of plates affixed to the crystal is altered. The latter capacitor forms part of the frequency determlning circuit of an oscillator and means is provided for indicating the frequency deviation which is a measure of the peak voltage applied to the voltmeter.
Peak Experiences: Some Empirical Tests.
ERIC Educational Resources Information Center
Wuthnow, Robert
1978-01-01
This article presents findings regarding peak experiences from a systematic random sample of 1,000 persons in the San Francisco-Oakland area. Evidence is presented on the incidence of peak experiences, on the kinds of life styles which tend to be associated with these experiences, and on some of the social implications that these experiences have.…
Reprint of: Virus-Specific T Cells: Broadening Applicability.
Barrett, A John; Prockop, Susan; Bollard, Catherine M
2018-03-01
Virus infection remains an appreciable cause of morbidity and mortality after hematopoietic stem cell transplantation (HSCT). Although pharmacotherapy and/or antibody therapy may help prevent or treat viral disease, these drugs are expensive, toxic, and often ineffective due to primary or secondary resistance. Further, effective treatments are limited for many infections (eg, adenovirus, BK virus), which are increasingly detected after alternative donor transplants. These deficiencies in conventional therapeutics have increased interest in an immunotherapeutic approach to viral disorders, leading to adoptive transfer of virus-specific cytotoxic T lymphocytes (VSTs), which can rapidly reconstitute antiviral immunity post-transplantation without causing graft-versus-host disease. This review will explore how the VST field has improved outcomes for many patients with life-threatening viral infections after HSCT, and how to broaden applicability beyond the "patient-specific" products, as well as extending to other viral diseases even outside the context of HSCT. Copyright © 2018. Published by Elsevier Inc.
Dynamic Stark broadening as the Dicke narrowing effect
NASA Astrophysics Data System (ADS)
Calisti, A.; Mossé, C.; Ferri, S.; Talin, B.; Rosmej, F.; Bureyeva, L. A.; Lisitsa, V. S.
2010-01-01
A very fast method to account for charged particle dynamics effects in calculations of spectral line shape emitted by plasmas is presented. This method is based on a formulation of the frequency fluctuation model (FFM), which provides an expression of the dynamic line shape as a functional of the static distribution of frequencies. Thus, the main numerical work rests on the calculation of the quasistatic Stark profile. This method for taking into account ion dynamics allows a very fast and accurate calculation of Stark broadening of atomic hydrogen high- n series emission lines. It is not limited to hydrogen spectra. Results on helium- β and Lyman- α lines emitted by argon in microballoon implosion experiment conditions compared with experimental data and simulation results are also presented. The present approach reduces the computer time by more than 2 orders of magnitude as compared with the original FFM with an improvement of the calculation precision, and it opens broad possibilities for its application in spectral line-shape codes.
VASQUEZ PEAK WILDERNESS STUDY AREA, AND ST. LOUIS PEAK, AND WILLIAMS FORK ROADLESS AREAS, COLORADO.
Theobald, P.K.; Bielski, A.M.
1984-01-01
A mineral-resource survey was conducted during the years 1979-82 in the Vasquez Peak Wilderness Study Area and in the St. Louis Peak and Williams Fork Roadless Areas, central Front Range, Colorado. Probable resource potential for the occurrence of copper, lead, zinc, and silver in massive sulfide deposits has been identified in calcareous metamorphic rocks in the northern part of the St. Louis Peak Roadless Area and in the southern part of the Williams Fork Roadless Area. A probable resource potential for vein-type uranium deposits is identified along the Berthoud Pass fault zone in the eastern part of the Vasquez Peak Wilderness Study Area. A large area encompassing the eastern and southeastern part of each of the three areas has probable and substantiated potential for either high-grade lead-zinc-silver vein deposits, or larger, lower-grade clustered vein deposits. A probable resource potential for stockwork molybdenum deposits related to porphyry molybdenum type mineralization exists beneath the lead-zinc-silver-rich veins. The nature of the geologic terrane indicates little likelihood for the occurrence of organic fuels.
Peak water limits to freshwater withdrawal and use
Gleick, Peter H.; Palaniappan, Meena
2010-01-01
Freshwater resources are fundamental for maintaining human health, agricultural production, economic activity as well as critical ecosystem functions. As populations and economies grow, new constraints on water resources are appearing, raising questions about limits to water availability. Such resource questions are not new. The specter of “peak oil”—a peaking and then decline in oil production—has long been predicted and debated. We present here a detailed assessment and definition of three concepts of “peak water”: peak renewable water, peak nonrenewable water, and peak ecological water. These concepts can help hydrologists, water managers, policy makers, and the public understand and manage different water systems more effectively and sustainably. Peak renewable water applies where flow constraints limit total water availability over time. Peak nonrenewable water is observable in groundwater systems where production rates substantially exceed natural recharge rates and where overpumping or contamination leads to a peak of production followed by a decline, similar to more traditional peak-oil curves. Peak “ecological” water is defined as the point beyond which the total costs of ecological disruptions and damages exceed the total value provided by human use of that water. Despite uncertainties in quantifying many of these costs and benefits in consistent ways, more and more watersheds appear to have already passed the point of peak water. Applying these concepts can help shift the way freshwater resources are managed toward more productive, equitable, efficient, and sustainable use. PMID:20498082
Peak-flow characteristics of Wyoming streams
Miller, Kirk A.
2003-01-01
Peak-flow characteristics for unregulated streams in Wyoming are described in this report. Frequency relations for annual peak flows through water year 2000 at 364 streamflow-gaging stations in and near Wyoming were evaluated and revised or updated as needed. Analyses of historical floods, temporal trends, and generalized skew were included in the evaluation. Physical and climatic basin characteristics were determined for each gaging station using a geographic information system. Gaging stations with similar peak-flow and basin characteristics were grouped into six hydrologic regions. Regional statistical relations between peak-flow and basin characteristics were explored using multiple-regression techniques. Generalized least squares regression equations for estimating magnitudes of annual peak flows with selected recurrence intervals from 1.5 to 500 years were developed for each region. Average standard errors of estimate range from 34 to 131 percent. Average standard errors of prediction range from 35 to 135 percent. Several statistics for evaluating and comparing the errors in these estimates are described. Limitations of the equations are described. Methods for applying the regional equations for various circumstances are listed and examples are given.
Yang, Yanli; Wang, Shengrui; Liu, Jingyang; Xu, Yisheng; Zhou, Xiaoyun
2016-05-17
Lysine adsorption at clay/aqueous interfaces plays an important role in the mobility, bioavailability, and degradation of amino acids in the environment. Knowledge of these interfacial interactions facilitates our full understanding of the fate and transport of amino acids. Here, X-ray diffraction (XRD) and attenuated total reflectance Fourier-transform infrared spectroscopy (ATR-FTIR) measurements were used to explore the dynamic process of lysine adsorption on montmorillonite and the competition with Ca(2+) at the molecular level. Density functional theory (DFT) calculations were employed to determine the peak assignments of dissolved lysine in the solution phase. Three surface complexes, including dicationic, cationic, and zwitterionic structures, were observed to attach to the clay edge sites and penetrate the interlayer space. The increased surface coverage and Ca(2+) competition did not affect the interfacial lysine structures at a certain pH, whereas an elevated lysine concentration contributed to zwitterionic-type coordination at pH 10. Moreover, clay dissolution at pH 4 could be inhibited at a higher surface coverage with 5 and 10 mM lysine, whereas the inhibition effect was inconspicuous or undetected at pH 7 and 10. The presence of Ca(2+) not only could remove a part of the adsorbed lysine but also could facilitate the readsorption of dissolved Si(4+) and Al(3+) and surface protonation. Our results provide new insights into the process of lysine adsorption and its effects on montmorillonite surface sites.
Exploration of geo-mineral compounds in granite mining soils using XRD pattern data analysis
NASA Astrophysics Data System (ADS)
Koteswara Reddy, G.; Yarakkula, Kiran
2017-11-01
The purpose of the study was to investigate the major minerals present in granite mining waste and agricultural soils near and away from mining areas. The mineral exploration of representative sub-soil samples are identified by X-Ray Diffractometer (XRD) pattern data analysis. The morphological features and quantitative elementary analysis was performed by Scanning Electron Microscopy-Energy Dispersed Spectroscopy (SEM-EDS).The XRD pattern data revealed that the major minerals are identified as Quartz, Albite, Anorthite, K-Feldspars, Muscovite, Annite, Lepidolite, Illite, Enstatite and Ferrosilite in granite waste. However, in case of agricultural farm soils the major minerals are identified as Gypsum, Calcite, Magnetite, Hematite, Muscovite, K-Feldspars and Quartz. Moreover, the agricultural soils neighbouring mining areas, the minerals are found that, the enriched Mica group minerals (Lepidolite and Illite) the enriched Orthopyroxene group minerals (Ferrosilite and Enstatite). It is observed that the Mica and Orthopyroxene group minerals are present in agricultural farm soils neighbouring mining areas and absent in agricultural farm soils away from mining areas. The study demonstrated that the chemical migration takes place at agricultural farm lands in the vicinity of the granite mining areas.
Predicting Peak Flows following Forest Fires
NASA Astrophysics Data System (ADS)
Elliot, William J.; Miller, Mary Ellen; Dobre, Mariana
2016-04-01
Following forest fires, peak flows in perennial and ephemeral streams often increase by a factor of 10 or more. This increase in peak flow rate may overwhelm existing downstream structures, such as road culverts, causing serious damage to road fills at stream crossings. In order to predict peak flow rates following wildfires, we have applied two different tools. One is based on the U.S.D.A Natural Resource Conservation Service Curve Number Method (CN), and the other is by applying the Water Erosion Prediction Project (WEPP) to the watershed. In our presentation, we will describe the science behind the two methods, and present the main variables for each model. We will then provide an example of a comparison of the two methods to a fire-prone watershed upstream of the City of Flagstaff, Arizona, USA, where a fire spread model was applied for current fuel loads, and for likely fuel loads following a fuel reduction treatment. When applying the curve number method, determining the time to peak flow can be problematic for low severity fires because the runoff flow paths are both surface and through shallow lateral flow. The WEPP watershed version incorporates shallow lateral flow into stream channels. However, the version of the WEPP model that was used for this study did not have channel routing capabilities, but rather relied on regression relationships to estimate peak flows from individual hillslope polygon peak runoff rates. We found that the two methods gave similar results if applied correctly, with the WEPP predictions somewhat greater than the CN predictions. Later releases of the WEPP model have incorporated alternative methods for routing peak flows that need to be evaluated.
Passive radio frequency peak power multiplier
Farkas, Zoltan D.; Wilson, Perry B.
1977-01-01
Peak power multiplication of a radio frequency source by simultaneous charging of two high-Q resonant microwave cavities by applying the source output through a directional coupler to the cavities and then reversing the phase of the source power to the coupler, thereby permitting the power in the cavities to simultaneously discharge through the coupler to the load in combination with power from the source to apply a peak power to the load that is a multiplication of the source peak power.
Line parameters for CO2 broadening in the ν2 band of HD16O
NASA Astrophysics Data System (ADS)
Devi, V. Malathy; Benner, D. Chris; Sung, Keeyoon; Crawford, Timothy J.; Gamache, Robert R.; Renaud, Candice L.; Smith, Mary Ann H.; Mantz, Arlan W.; Villanueva, Geronimo L.
2017-01-01
CO2-rich planetary atmospheres such as those of Mars and Venus require accurate knowledge of CO2 broadened HDO half-width coefficients and their temperature dependence exponents for reliable abundance determination. Although a few calculated line lists have recently been published on HDO-CO2 line shapes and their temperature dependences, laboratory measurements of those parameters are thus far non-existent. In this work, we report the first measurements of CO2-broadened half-width and pressure-shift coefficients and their temperature dependences for over 220 transitions in the ν2 band. First measurements of self-broadened half-width and self-shift coefficients at room temperature are also obtained for majority of these transitions. In addition, the first experimental determination of collisional line mixing has been reported for 11 transition pairs for HDO-CO2 and HDO-HDO systems. These results were obtained by analyzing ten high-resolution spectra of HDO and HDO-CO2 mixtures at various sample temperatures and pressures recorded with the Bruker IFS-125HR Fourier transform spectrometer at the Jet Propulsion Laboratory (JPL). Two coolable absorption cells with path lengths of 20.38 cm and 20.941 m were used to record the spectra. The various line parameters were retrieved by fitting all ten spectra simultaneously using a multispectrum nonlinear least squares fitting algorithm. The HDO transitions in the 1100-4100 cm-1 range were extracted from the HITRAN2012 database. For the ν2 and 2ν2 -ν2 bands there were 2245 and 435 transitions, respectively. Modified Complex Robert-Bonamy formalism (MCRB) calculations were made for the half-width coefficients, their temperature dependence and the pressure shift coefficients for the HDO-CO2 and HDO-HDO collision systems. MCRB calculations are compared with the measured values.
Synchrotron-based XRD from rat bone of different age groups.
Rao, D V; Gigante, G E; Cesareo, R; Brunetti, A; Schiavon, N; Akatsuka, T; Yuasa, T; Takeda, T
2017-05-01
Synchrotron-based XRD spectra from rat bone of different age groups (w, 56 w and 78w), lumber vertebra at early stages of bone formation, Calcium hydroxyapatite (HAp) [Ca 10 (PO 4 ) 6 (OH) 2 ] bone fill with varying composition (60% and 70%) and bone cream (35-48%), has been acquired with 15keV synchrotron X-rays. Experiments were performed at Desy, Hamburg, Germany, utilizing the Resonant and Diffraction beamline (P9), with 15keV X-rays (λ=0.82666 A 0 ). Diffraction data were quantitatively analyzed using the Rietveld refinement approach, which allowed us to characterize the structure of these samples in their early stages. Hydroxyapatite, received considerable attention in medical and materials sciences, since these materials are the hard tissues, such as bone and teeth. Higher bioactivity of these samples gained reasonable interest for biological application and for bone tissue repair in oral surgery and orthopedics. The results obtained from these samples, such as phase data, crystalline size of the phases, as well as the degree of crystallinity, confirm the apatite family crystallizing in a hexagonal system, space group P6 3 /m with the lattice parameters of a=9.4328Å and c=6.8842Å (JCPDS card #09-0432). Synchrotron-based XRD patterns are relatively sharp and well resolved and can be attributed to the hexagonal crystal form of hydroxyapatite. All the samples were examined with scanning electron microscope at an accelerating voltage of 15kV. The presence of large globules of different sizes is observed, in small age groups of the rat bone (8w) and lumber vertebra (LV), as distinguished from, large age groups (56 and 78w) in all samples with different magnification, reflects an amorphous phase without significant traces of crystalline phases. Scanning electron microscopy (SEM) was used to characterize the morphology and crystalline properties of Hap, for all the samples, from 2 to 100μm resolution. Copyright © 2017 Elsevier B.V. All rights reserved.
Grall; Leonard; Sacks
2000-02-01
Recent advances in column heating technology have made possible very fast linear temperature programming for high-speed gas chromatography. A fused-silica capillary column is contained in a tubular metal jacket, which is resistively heated by a precision power supply. With very rapid column heating, the rate of peak-capacity production is significantly enhanced, but the total peak capacity and the boiling-point resolution (minimum boiling-point difference required for the separation of two nonpolar compounds on a nonpolar column) are reduced relative to more conventional heating rates used with convection-oven instruments. As temperature-programming rates increase, elution temperatures also increase with the result that retention may become insignificant prior to elution. This results in inefficient utilization of the down-stream end of the column and causes a loss in the rate of peak-capacity production. The rate of peak-capacity production is increased by the use of shorter columns and higher carrier gas velocities. With high programming rates (100-600 degrees C/min), column lengths of 6-12 m and average linear carrier gas velocities in the 100-150 cm/s range are satisfactory. In this study, the rate of peak-capacity production, the total peak capacity, and the boiling point resolution are determined for C10-C28 n-alkanes using 6-18 m long columns, 50-200 cm/s average carrier gas velocities, and 60-600 degrees C/min programming rates. It was found that with a 6-meter-long, 0.25-mm i.d. column programmed at a rate of 600 degrees C/min, a maximum peak-capacity production rate of 6.1 peaks/s was obtained. A total peak capacity of about 75 peaks was produced in a 37-s long separation spanning a boiling-point range from n-C10 (174 degrees C) to n-C28 (432 degrees C).
Complete wavelength mismatching effect in a Doppler broadened Y-type six-level EIT atomic medium
NASA Astrophysics Data System (ADS)
Bharti, Vineet; Wasan, Ajay
We present a theoretical study of the Doppler broadened Y-type six-level atomic system, using a density matrix approach, to investigate the effect of varying control field wavelengths and closely spaced hyperfine levels in the 5P state of 87Rb. The closely spaced hyperfine levels in our six-level system affect the optical properties of Y-type system and cause asymmetry in absorption profiles. Depending upon the choices of π-probe, σ+-control and σ--control fields transitions, we consider three regimes: (i) perfect wavelength matching regime (λp=λ=λ), (ii) partial wavelength mismatching regime (λp≠λ=λ), and (iii) complete wavelength mismatching regime (λp≠λ≠λ). The complete wavelength mismatching regime is further distinguished into two situations, i.e., λ<λ and λ>λ. We have shown that in the room temperature atomic vapor, the asymmetric transparency window gets broadened in the partial wavelength mismatching regime as compared to the perfect wavelength matching regime. This broad transparency window also splits at the line center in the complete wavelength mismatching regime.
Effect of Copper and Zirconium Addition on Properties of Fe-Co-Si-B-Nb Bulk Metallic Glasses
NASA Astrophysics Data System (ADS)
Ikram, Haris; Khalid, Fazal Ahmad; Akmal, Muhammad; Abbas, Zameer
2017-07-01
In this research work, iron-based bulk metallic glasses (BMGs) have been fabricated, characterized and compared with Fe-Si alloy. BMG alloys of composition ((Fe0.6Co0.4)0.75B0.20Si0.05)96Nb4) were synthesized by suction casting technique using chilled copper die. Effect of copper and zirconium addition on magnetic, mechanical, thermal and electrochemical behavior of ((Fe0.6Co0.4)0.75B0.20Si0.05)96Nb4 BMGs was investigated. Furthermore, effect of annealing on nano-crystallization and subsequently on magnetic and mechanical behavior was also analyzed. Amorphousness of structure was evidenced by XRD analysis and microscopic visualization, whereas nano-crystallization behavior was identified by peak broadening of XRD patterns. Magnetic properties, measured by vibrating sample magnetometer, were found to be improved for as-cast BMG alloys by copper addition and further enhanced by nano-crystallization after annealing. Mechanical properties were observed to be increased by zirconium addition while slightly declined by copper addition. Potentiodynamic polarization analysis manifested the positive role of zirconium in enhancing corrosion resistance of BMGs in acidic, basic and brine mediums. Moreover, mechanical properties and corrosion analysis results affirmed the superiority of BMG alloys over Fe-Si alloy.
Optical and dielectric properties of NiFe2O4 nanoparticles under different synthesized temperature
NASA Astrophysics Data System (ADS)
Parishani, Marziye; Nadafan, Marzieh; Dehghani, Zahra; Malekfar, Rasoul; Khorrami, G. H. H.
In this research, NiFe2O4 nanoparticles was prepared via the simple sol-gel route, using different sintering temperature. This nanoparticle was characterized via X-ray diffraction (XRD) pattern, scanning electron microscopy (SEM), and FTIR spectra. The XRD patterns show by increasing the synthesized temperature, the intensity, and broadening of peaks are decreased so the results are more crystallization and raising the size of nanoparticles. The size distribution in the histogram of the NiFe2O4 nanoparticles is 42, 96, and 315 nm at 750 °C, 850 °C, and 950 °C, respectively. The FTIR spectra were evaluated using Kramers-Kronig method. Results approved the existing of certain relations between sintering temperatures and grain size of nanoparticles. By raising the temperature from 750 °C to 950 °C, the grain size was increased from 70 nm to 300 nm and the optical constants of nanoparticles were strongly related to synthesizing temperature as well. Since by increasing temperature, both real/imaginary parts of the refractive index and dielectric function were decreased. Consequently, the transversal (TO) and longitudinal (LO) phonon frequencies are detected. The TO and LO frequencies have shifted to red frequencies by increasing reaction temperature.
NASA Astrophysics Data System (ADS)
Paul, Subir; Mandal, Chandranath
2013-10-01
Surface treatments of 304 stainless steel by electro-coating and passivating in few inorganic electrolytes were found to be very effective in drastically reducing the corrosion rate of the material in stimulated body fluid (SBF) by several orders in comparison to that of 316L steel, presently being used for orthopedic implants. Polarization studies of electrodeposited hydroxyl apatite coating on 304 steel showed remarkably improved corrosion current. Cyclic polarization of the material in SBF reflected the broadened passivity region, much lower passive current, and narrower hysteresis loops. Similar effects were also found through the formation of inorganic coatings by passivation in NaF, CaNO3, and calcium phosphate buffer solutions. Surface characterization by XRD showed the peaks of the respective coating crystals. The morphology of the coatings studied by SEM showed a flake-type structure for hydroxyapatite coating and fine spherical-subspherical particles for other coatings.
Zbik, Marek S; Frost, Ray L
2010-06-15
The structure-building phenomena within clay aggregates are governed by forces acting between clay particles. Measurements of such forces are important to understand in order to manipulate the aggregate structure for applications such as dewatering of mineral processing tailings. A parallel particle orientation is required when conducting XRD investigation on the oriented samples and conduct force measurements acting between basal planes of clay mineral platelets using atomic force microscopy (AFM). To investigate how smectite clay platelets were oriented on silicon wafer substrate when dried from suspension range of methods like SEM, XRD and AFM were employed. From these investigations, we conclude that high clay concentrations and larger particle diameters (up to 5 microm) in suspension result in random orientation of platelets in the substrate. The best possible laminar orientation in the clay dry film, represented in the XRD 001/020 intensity ratio of 47 was obtained by drying thin layers from 0.02 wt.% clay suspensions of the natural pH. Conducted AFM investigations show that smectite studied in water based electrolytes show very long-range repulsive forces lower in strength than electrostatic forces from double-layer repulsion. It was suggested that these forces may have structural nature. Smectite surface layers rehydrate in water environment forms surface gel with spongy and cellular texture which cushion approaching AFM probe. This structural effect can be measured in distances larger than 1000 nm from substrate surface and when probe penetrate this gel layer, structural linkages are forming between substrate and clay covered probe. These linkages prevent subsequently smooth detachments of AFM probe on way back when retrieval. This effect of tearing new formed structure apart involves larger adhesion-like forces measured in retrieval. It is also suggested that these effect may be enhanced by the nano-clay particles interaction. 2010 Elsevier Inc. All
DOE Office of Scientific and Technical Information (OSTI.GOV)
Costamante, L.; Aharonian, F.; Khangulyan, D.
2007-07-12
An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less
NASA Astrophysics Data System (ADS)
Yoshida, Y.; Matsumura, A.; Higeta, K.; Inoue, T.; Shimizu, S.; Motonami, Y.; Sato, M.; Sadahiro, T.; Fujii, K.
1991-07-01
The hardness depth profiles of cemented carbides which were implanted with high-energy B + ions have been estimated using a dynamic microhardness tester. The B + implantations into (16% Co)-cemented WC alloys were carried out under conditions where the implantation energies were 1-3 MeV and the fluences 1 × 10 17-1 × 10 18ions/cm 2. The profiles show that the implanted layer becomes harder as fluences are chosen at higher values and there is a peak at a certain depth which depends on the implantation energy. In X-ray diffraction (XRD) studies of the implanted surface the broadened refraction peaks of only WC and Co are detected and the increments of lattice strain and of residual stress in the near-surface region are observed. It is supposed that the hardening effect should be induced by an increase in residual stress produced by lattice strain. The hardness depth profile in successive implantation of ions with different energies agrees with the compounded profile of each one of the implantations. It is concluded that the hardness depth profile can be controlled under adequate conditions of implantation.
NASA Astrophysics Data System (ADS)
Buldt, J.; Müller, M.; Klas, R.; Eidam, T.; Limpert, J.; Tünnermann, A.
2018-02-01
We present a novel approach for temporal contrast enhancement of energetic laser pulses by filtered SPM broadened spectra. A measured temporal contrast enhancement by at least 7 orders of magnitude in a simple setup has been achieved. This technique is applicable to a wide range of laser parameters and poses a highly efficient alternative to existing contrast-enhancement methods.
Peak experiences of psilocybin users and non-users.
Cummins, Christina; Lyke, Jennifer
2013-01-01
Maslow (1970) defined peak experiences as the most wonderful experiences of a person's life, which may include a sense of awe, well-being, or transcendence. Furthermore, recent research has suggested that psilocybin can produce experiences subjectively rated as uniquely meaningful and significant (Griffiths et al. 2006). It is therefore possible that psilocybin may facilitate or change the nature of peak experiences in users compared to non-users. This study was designed to compare the peak experiences of psilocybin users and non-users, to evaluate the frequency of peak experiences while under the influence of psilocybin, and to assess the perceived degree of alteration of consciousness during these experiences. Participants were recruited through convenience and snowball sampling from undergraduate classes and at a musical event. Participants were divided into three groups, those who reported a peak experience while under the influence of psilocybin (psilocybin peak experience: PPE), participants who had used psilocybin but reported their peak experiences did not occur while they were under the influence of psilocybin (non-psilocybin peak experience: NPPE), and participants who had never used psilocybin (non-user: NU). A total of 101 participants were asked to think about their peak experiences and complete a measure evaluating the degree of alteration of consciousness during that experience. Results indicated that 47% of psilocybin users reported their peak experience occurred while using psilocybin. In addition, there were significant differences among the three groups on all dimensions of alteration of consciousness. Future research is necessary to identify factors that influence the peak experiences of psilocybin users in naturalistic settings and contribute to the different characteristics of peak experiences of psilocybin users and non-users.
Extragalactic Peaked-spectrum Radio Sources at Low Frequencies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.
We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak.more » We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.« less
Individual vision and peak distribution in collective actions
NASA Astrophysics Data System (ADS)
Lu, Peng
2017-06-01
People make decisions on whether they should participate as participants or not as free riders in collective actions with heterogeneous visions. Besides of the utility heterogeneity and cost heterogeneity, this work includes and investigates the effect of vision heterogeneity by constructing a decision model, i.e. the revised peak model of participants. In this model, potential participants make decisions under the joint influence of utility, cost, and vision heterogeneities. The outcomes of simulations indicate that vision heterogeneity reduces the values of peaks, and the relative variance of peaks is stable. Under normal distributions of vision heterogeneity and other factors, the peaks of participants are normally distributed as well. Therefore, it is necessary to predict distribution traits of peaks based on distribution traits of related factors such as vision heterogeneity and so on. We predict the distribution of peaks with parameters of both mean and standard deviation, which provides the confident intervals and robust predictions of peaks. Besides, we validate the peak model of via the Yuyuan Incident, a real case in China (2014), and the model works well in explaining the dynamics and predicting the peak of real case.
Sun, Zhiming; Park, Yuri; Zheng, Shuilin; Ayoko, Godwin A; Frost, Ray L
2013-10-15
An Arizona SAz-2 calcium montmorillonite was modified by a typical dialkyl cationic surfactant (didodecyldimethylammonium bromide, abbreviated to DDDMA) through direct ion exchange. The obtained organoclays were characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HR-TEM), high-resolution thermogravimetric analysis (HR-TG), and infrared emission spectroscopy (IES). The intercalation of surfactants greatly increased the basal spacing of the interlayers and the conformation arrangement of the loaded surfactant were assessed based on the XRD and TEM measurements. This work shows that the dialkyl surfactant can be directly intercalated into the montmorillonite without first undergoing Na(+) exchange. Moreover, the thermal stability of organoclays and the different arrangements of the surfactant molecules intercalated in the SAz-2 Ca-montmorillonite were determined by a combination of TG and IES techniques. The detailed conformational ordering of different intercalated surfactants under different conditions was also studied. The surfactant molecule DDDMA has proved to be thermally stable even at 400°C which indicates that the prepared organoclay is stable to significantly high temperatures. This study offers new insights into the structure and thermal stabilities of SAz-2 Ca-montmorillonite modified with DDDMA. The experimental results also confirm the potential applications of organic SAz-2 Ca-montmorillonites as adsorbents and polymer-clay nanocomposites. Copyright © 2013 Elsevier Inc. All rights reserved.
Slade, R.M.; Asquith, W.H.
1996-01-01
About 23,000 annual peak streamflows and about 400 historical peak streamflows exist for about 950 stations in the surface-water data-collection network of Texas. These data are presented on a computer diskette along with the corresponding dates, gage heights, and information concerning the basin, and nature or cause for the flood. Also on the computer diskette is a U.S. Geological Survey computer program that estimates peak-streamflow frequency based on annual and historical peak streamflow. The program estimates peak streamflow for 2-, 5-, 10-, 25-, 50-, and 100-year recurrence intervals and is based on guidelines established by the Interagency Advisory Committee on Water Data. Explanations are presented for installing the program, and an example is presented with discussion of its options.
NASA Astrophysics Data System (ADS)
Köhn, A.; Guidi, L.; Holzhauer, E.; Maj, O.; Poli, E.; Snicker, A.; Weber, H.
2018-07-01
Plasma turbulence, and edge density fluctuations in particular, can under certain conditions broaden the cross-section of injected microwave beams significantly. This can be a severe problem for applications relying on well-localized deposition of the microwave power, like the control of MHD instabilities. Here we investigate this broadening mechanism as a function of fluctuation level, background density and propagation length in a fusion-relevant scenario using two numerical codes, the full-wave code IPF-FDMC and the novel wave kinetic equation solver WKBeam. The latter treats the effects of fluctuations using a statistical approach, based on an iterative solution of the scattering problem (Born approximation). The full-wave simulations are used to benchmark this approach. The Born approximation is shown to be valid over a large parameter range, including ITER-relevant scenarios.
Stark broadening of the B III 2s-2p lines
NASA Astrophysics Data System (ADS)
Griem, Hans R.; Ralchenko, Yuri V.; Bray, Igor
1997-12-01
We present a quantum-mechanical calculation of Stark linewidths from electron-ion collisions for the 2s1/2-2p1/2,3/2, λ=2066 and 2067 Å, resonance transitions in B III. The results confirm previous quantum-mechanical R-matrix calculations, but contradict recent measurements and semiclassical and some semiempirical calculations. The differences between the calculations can be attributed to the dominance of small L partial waves in the electron-atom scattering, while the large Stark widths inferred from the measurements would be substantially reduced if allowance is made for hydrodynamic turbulence from high-Reynolds-number flows and the associated Doppler broadening.
Jones, K P; Mullee, M A
1990-01-01
OBJECTIVE--To compare measurements of the peak expiratory flow rate taken by the mini Wright peak flow meter and the turbine spirometer. DESIGN--Pragmatic study with randomised order of use of recording instruments. Phase 1 compared a peak expiratory flow type expiration recorded by the mini Wright peak flow meter with an expiration to forced vital capacity recorded by the turbine spirometer. Phase 2 compared peak expiratory flow type expirations recorded by both meters. Reproducibility was assessed separately. SETTING--Routine surgeries at Aldermoor Health Centre, Southampton. SUBJECTS--212 Patients aged 4 to 78 presenting with asthma or obstructive airways disease. Each patient contributed only once to each phase (105 in phase 1, 107 in phase 2), but some entered both phases on separate occasions. Reproducibility was tested on a further 31 patients. MAIN OUTCOME MEASURE--95% Limits of agreement between measurements on the two meters. RESULTS--208 (98%) Of the readings taken by the mini Wright meter were higher than the corresponding readings taken by the turbine spirometer, but the 95% limits of agreement (mean difference (2 SD] were wide (1 to 173 l/min). Differences due to errors in reproducibility were not sufficient to predict this level of disagreement. Analysis by age, sex, order of use, and the type of expiration did not detect any significant differences. CONCLUSIONS--The two methods of measuring peak expiratory flow rate were not comparable. The mini Wright meter is likely to remain the preferred instrument in general practice. PMID:2142611
1988-01-29
Electronic Origin of Pentacene in p-Terphenyl by T. P. Carter, M. Manavi, and W. E. Moerner Prepared for Publication inDTIC Journal of Chemical Physics...Classification) Statistical Fine Structure in the Inhomogeneously Broadened Electronic Origin of Pentacene in p-Terphenyl 12. PERSONAL AUTHOR(S) T. P...of pentacene in p-terphenyl using laser FM spectroscopy. Statistical fine structure is time-independent structure on the inhomogeneous line caused by
Helping System Engineers Bridge the Peaks
NASA Technical Reports Server (NTRS)
Rungta, Neha; Tkachuk, Oksana; Person, Suzette; Biatek, Jason; Whalen, Michael W.; Castle, Joseph; Castle, JosephGundy-Burlet, Karen
2014-01-01
In our experience at NASA, system engineers generally follow the Twin Peaks approach when developing safety-critical systems. However, iterations between the peaks require considerable manual, and in some cases duplicate, effort. A significant part of the manual effort stems from the fact that requirements are written in English natural language rather than a formal notation. In this work, we propose an approach that enables system engineers to leverage formal requirements and automated test generation to streamline iterations, effectively "bridging the peaks". The key to the approach is a formal language notation that a) system engineers are comfortable with, b) is supported by a family of automated V&V tools, and c) is semantically rich enough to describe the requirements of interest. We believe the combination of formalizing requirements and providing tool support to automate the iterations will lead to a more efficient Twin Peaks implementation at NASA.
The high - low-p clinoenstatite transition: in situ xrd and ultrasonic study
NASA Astrophysics Data System (ADS)
Müller, H. J.; Wunder, B.; Lathe, C.; Schilling, F. R.
2003-04-01
Using single-crystal X-ray diffraction analyses in a diamond anvil cell Angel et al. (1992) published the transformation of MgSiO_3 from LCEn to a C2/c-polymorph (HCEn) at around 5.5 - 8.0 GPa and room-T (RT)conditions. This LCEn - HCEn-transition is not quenchable. However, the knowledge of the exact phase boundary positions for the MgSiO_3-transitions is essential as pyroxene is an important component of the Earth's mantle and will significantly influence elastic properties (e.g. v_p, v_s) of the mantle. We determined the HCEn - LCEn-transition by in-situ XRD experiments under high P, T using the multi-anvil appar atus MAX80 at the synchrotron facility HASYLAB, Hamburg. Our preliminary results only represent the minimum P-conditions of the HCEn - LCEn phase boundary, which is approximated by equation P (GPa) = 0.0021T (/C) + 6.06. Nevertheless, our results are in good agreement to data published by Angel & Hugh-Jones (1994). The invariant point defined by the intersection of the HCEn - LCEn equilibrium determined within this study and the OEn - LCEn reaction after Angel &Hugh-Jones (1994) lies at about 7.9 GPa and 875/C. This is in contrast to earlier experimental results of Kanzaki (1991) and Ulmer &Stalder (2001). The samples for the ultrasonic interferometry experiments were prepared by hot-isostatic pressing also using the MAX80. Adjacent XRD ruled out any phase transition during the hip-process. For the ultrasonic measurements one of the six anvils of MAX80 were exchanged by an anvil equipped with lithium niobate p- and s-wave transducers of 33.3 MHz natural frequency (Mueller et al., 2002). Corresponding to the XRD experiments HCEn was formed by increasing the pressure at RT. The velocities of elastic compressional and shear waves were measured under in situ conditions using the classical digital sweep technique. After the phase transition to LCEn as a result of rising the temperature at given pressure the measurements were repeated. The newly developed
NASA Astrophysics Data System (ADS)
Ceselin, Giorgia; Tasinato, Nicola; Puzzarini, Cristina; Charmet, Andrea Pietropolli; Stoppa, Paolo; Giorgianni, Santi
2017-09-01
To monitor the constituents and trace pollutants of Earth atmosphere and understand its evolution, accurate spectroscopic parameters are fundamental information. SO2 is produced by both natural and anthropogenic sources and it is one of the principal causes of acid rains as well as an important component of fine aerosol particles, once oxidized to sulfate. The present work aims at determining SO2 broadening parameters using N2 and O2 as atmospherically relevant damping gases. Measurements are carried out in the infrared (IR) and mm-/sub-mm wave regions, around 8.8 μm and in the 104 GHz-1.1 THz interval, respectively. IR ro-vibrational transitions are recorded by using a tunable diode laser spectrometer, whereas the microwave spectra are recorded by using a frequency-modulated millimeter-/submillimeter-wave spectrometer. SO2-N2 and SO2-O2 collisional cross sections are retrieved for several ν1 band ro-vibrational transitions of 32S16O2, for some transitions belonging to either ν1 + ν2 - ν2 of 32S16O2 or ν1 of 34S16O2 as well as for about 20 pure rotational transitions in the vibrational ground state of the main isotopic species. From N2- and O2- broadening coefficients the broadening parameters of SO2 in air are derived. The work is completed with the study of the dependence of foreign broadening coefficients on the rotational quantum numbers.
Broadening the Participation of Native Americans in Earth Science
NASA Astrophysics Data System (ADS)
Bueno Watts, Nievita
Climate change is not a thing of the future. Indigenous people are being affected by climate changes now. Native American Earth scientists could help Native communities deal with both climate change and environmental pollution issues, but are noticeably lacking in Earth Science degree programs. The Earth Sciences produce the lowest percentage of minority scientists when compared with other science and engineering fields. Twenty semi-structured interviews were gathered from American Indian/ Alaska Native Earth Scientists and program directors who work directly with Native students to broaden participation in the field. Data was analyzed using qualitative methods and constant comparison analysis. Barriers Native students faced in this field are discussed, as well as supports which go the furthest in assisting achievement of higher education goals. Program directors give insight into building pathways and programs to encourage Native student participation and success in Earth Science degree programs. Factors which impede obtaining a college degree include financial barriers, pressures from familial obligations, and health issues. Factors which impede the decision to study Earth Science include unfamiliarity with geoscience as a field of study and career choice, the uninviting nature of Earth Science as a profession, and curriculum that is irrelevant to the practical needs of Native communities or courses which are inaccessible geographically. Factors which impede progress that are embedded in Earth Science programs include educational preparation, academic information and counseling and the prevalence of a Western scientific perspective to the exclusion of all other perspectives. Intradepartmental relationships also pose barriers to the success of some students, particularly those who are non-traditional students (53%) or women (80%). Factors which support degree completion include financial assistance, mentors and mentoring, and research experiences. Earth scientists
NASA Astrophysics Data System (ADS)
Martinet, Nicolas; Schneider, Peter; Hildebrandt, Hendrik; Shan, HuanYuan; Asgari, Marika; Dietrich, Jörg P.; Harnois-Déraps, Joachim; Erben, Thomas; Grado, Aniello; Heymans, Catherine; Hoekstra, Henk; Klaes, Dominik; Kuijken, Konrad; Merten, Julian; Nakajima, Reiko
2018-02-01
We study the statistics of peaks in a weak-lensing reconstructed mass map of the first 450 deg2 of the Kilo Degree Survey (KiDS-450). The map is computed with aperture masses directly applied to the shear field with an NFW-like compensated filter. We compare the peak statistics in the observations with that of simulations for various cosmologies to constrain the cosmological parameter S_8 = σ _8 √{Ω _m/0.3}, which probes the (Ωm, σ8) plane perpendicularly to its main degeneracy. We estimate S8 = 0.750 ± 0.059, using peaks in the signal-to-noise range 0 ≤ S/N ≤ 4, and accounting for various systematics, such as multiplicative shear bias, mean redshift bias, baryon feedback, intrinsic alignment, and shear-position coupling. These constraints are ˜ 25 per cent tighter than the constraints from the high significance peaks alone (3 ≤ S/N ≤ 4) which typically trace single-massive haloes. This demonstrates the gain of information from low-S/N peaks. However, we find that including S/N < 0 peaks does not add further information. Our results are in good agreement with the tomographic shear two-point correlation function measurement in KiDS-450. Combining shear peaks with non-tomographic measurements of the shear two-point correlation functions yields a ˜20 per cent improvement in the uncertainty on S8 compared to the shear two-point correlation functions alone, highlighting the great potential of peaks as a cosmological probe.