Sample records for y-chromosome single-nucleotide polymorphisms

  1. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  2. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  3. Y-chromosome polymorphism: Possible largest Y chromosome in man?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murthy, D.S.K.; Al-Awadi, S.A.; Bastaki, L.

    The role of variations (inversions/deletion or duplication) in the heterochromatin in gonadal development and function, reproductive fitness, and malignant disease has been extensively studied. However, the causal-relationship of large Y (Yqh+) and repeated fetal loss has not been established unequivocally. An Arab couple (?Bedouin origin) with a history of repeated abortions were investigated. Karyotype analysis of the husband showed a very large Y chromosome, confirmed by GTG-, QFQ- and CBG-banding techniques. C-banding showed discontinuous distribution of the heterochromatin blocks separated by pale bands. The origin of the large heterochromatin segment could be due to tandem duplication of the Yq regionmore » or translocation (Yq:Yq). No other relatives (males) of the propositus have been available for investigation. Polymorphism of the Y chromosome could be attributed to evolutionary changes from an ancestral type, either by deletion or duplication of the heterochromatin segment. More detailed studies on isolated, aboriginal/tribal human populations will enable us to better understand the significance of the Y chromosome polymorphism.« less

  4. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  5. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  6. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    PubMed

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

  7. A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

    PubMed Central

    Macé, Matthias; Crouau-Roy, Brigitte

    2008-01-01

    Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953

  8. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  9. Contrasting patterns of X/Y polymorphism distinguish Carica papaya from other sex chromosome systems.

    PubMed

    Weingartner, Laura A; Moore, Richard C

    2012-12-01

    The sex chromosomes of the tropical crop papaya (Carica papaya) are evolutionarily young and consequently allow for the examination of evolutionary mechanisms that drive early sex chromosome divergence. We conducted a molecular population genetic analysis of four X/Y gene pairs from a collection of 45 wild papaya accessions. These population genetic analyses reveal striking differences in the patterns of polymorphism between the X and Y chromosomes that distinguish them from other sex chromosome systems. In most sex chromosome systems, the Y chromosome displays significantly reduced polymorphism levels, whereas the X chromosome maintains a level of polymorphism that is comparable to autosomal loci. However, the four papaya sex-linked loci that we examined display diversity patterns that are opposite this trend: the papaya X alleles exhibit significantly reduced polymorphism levels, whereas the papaya Y alleles maintain greater than expected levels of diversity. Our analyses suggest that selective sweeps in the regions of the X have contributed to this pattern while also revealing geographically restricted haplogroups on the Y. We discuss the possible role sexual selection and/or genomic conflict have played in shaping the contrasting patterns of polymorphism found for the papaya X and Y chromosomes.

  10. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

    PubMed

    Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

    2006-06-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

  11. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

    2006-01-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  12. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  13. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  14. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  15. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  16. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  17. Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

    PubMed Central

    2013-01-01

    Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome

  18. Y-Chromosome Haplogroups in the Bosnian-Herzegovinian Population Based on 23 Y-STR Loci.

    PubMed

    Doğan, Serkan; Ašić, Adna; Doğan, Gulsen; Besic, Larisa; Marjanovic, Damir

    2016-07-01

    In a study of the Bosnian-Herzegovinian (B&H) population, Y-chromosome marker frequencies for 100 individuals, generated using the PowerPlex Y23 kit, were used to perform Y-chromosome haplogroup assignment via Whit Athey's Haplogroup Predictor. This algorithm determines Y-chromosome haplogroups from Y-chromosome short tandem repeat (Y-STR) data using a Bayesian probability-based approach. The most frequent haplogroup appeared to be I2a, with a prevalence of 49%, followed by R1a and E1b1b, each accounting for 17% of all haplogroups within the population. Remaining haplogroups were J2a (5%), I1 (4%), R1b (4%), J2b (2%), G2a (1%), and N (1%). These results confirm previously published preliminary B&H population data published over 10 years ago, especially the prediction about the B&H population being a part of the Western Balkan area, which served as the Last Glacial Maximum refuge for the Paleolithic human European population. Furthermore, the results corroborate the hypothesis that this area was a significant stopping point on the "Middle East-Europe highway" during the Neolithic farmer migrations. Finally, since these results are almost completely in accordance with previously published data on B&H and neighboring populations generated by Y-chromosome single nucleotide polymorphism analysis, it can be concluded that in silico analysis of Y-STRs is a reliable method for approximation of the Y-chromosome haplogroup diversity of an examined population.

  19. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  20. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  1. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors.

    PubMed

    Phababpha, Suphawadee; Kukongviriyapan, Upa; Pakdeechote, Poungrat; Senggunprai, Laddawan; Kukongviriyapan, Veerapol; Settasatian, Chatri; Tatsanavivat, Pyatat; Intharaphet, Phongsak; Senthong, Vichai; Komanasin, Nantarat; Settasatian, Nongnuch; Greenwald, Stephen E

    2013-06-21

    Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. A total of 208 Thai subjects, aged 35-75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population.

  2. Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

    PubMed

    Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

    2005-02-01

    Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

  3. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  4. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  5. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    PubMed

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  7. Mosaic male fetus of Turner syndrome with partial chromosome Y: A case report.

    PubMed

    Xue, Dan; Cao, Dong-Hua; Mu, Kai; Lv, Yuan; Yang, Jun

    2018-06-01

    Turner syndrome, characterized by the presence of a monosomy X cell line, is a common chromosomal disorder. Patients with Turner syndrome are usually phenotypically female, and male cases are rarely reported. Here, we report a fetus with a mosaic karyotype: mos 45,X/46,X,del(Y)(q11.21). The fetus was initially misdiagnosed as female with Turner syndrome by both noninvasive prenatal testing and cytogenetic analysis of amniotic fluid and was subsequently found to have male anatomy by antenatal ultrasonography at 24 weeks gestational age. Through single nucleotide polymorphism-array and fluorescence in situ hybridization testing, we found that there was a truncated Y chromosome with sex-determining region Y (SRY) present in some cells of the fetus, which caused the male features in the fetus. © 2018 Japan Society of Obstetrics and Gynecology.

  8. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  9. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  10. High levels of Y-chromosome nucleotide diversity in the genus Pan

    PubMed Central

    Stone, Anne C.; Griffiths, Robert C.; Zegura, Stephen L.; Hammer, Michael F.

    2002-01-01

    Although some mitochondrial, X chromosome, and autosomal sequence diversity data are available for our closest relatives, Pan troglodytes and Pan paniscus, data from the nonrecombining portion of the Y chromosome (NRY) are more limited. We examined ≈3 kb of NRY DNA from 101 chimpanzees, seven bonobos, and 42 humans to investigate: (i) relative levels of intraspecific diversity; (ii) the degree of paternal lineage sorting among species and subspecies of the genus Pan; and (iii) the date of the chimpanzee/bonobo divergence. We identified 10 informative sequence-tagged sites associated with 23 polymorphisms on the NRY from the genus Pan. Nucleotide diversity was significantly higher on the NRY of chimpanzees and bonobos than on the human NRY. Similar to mtDNA, but unlike X-linked and autosomal loci, lineages defined by mutations on the NRY were not shared among subspecies of P. troglodytes. Comparisons with mtDNA ND2 sequences from some of the same individuals revealed a larger female versus male effective population size for chimpanzees. The NRY-based divergence time between chimpanzees and bonobos was estimated at ≈1.8 million years ago. In contrast to human populations who appear to have had a low effective size and a recent origin with subsequent population growth, some taxa within the genus Pan may be characterized by large populations of relatively constant size, more ancient origins, and high levels of subdivision. PMID:11756656

  11. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors

    PubMed Central

    2013-01-01

    Background Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. Methods A total of 208 Thai subjects, aged 35–75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Results Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Conclusions Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai

  12. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  13. Next Generation Sequencing Plus (NGS+) with Y-chromosomal Markers for Forensic Pedigree Searches.

    PubMed

    Qian, Xiaoqin; Hou, Jiayi; Wang, Zheng; Ye, Yi; Lang, Min; Gao, Tianzhen; Liu, Jing; Hou, Yiping

    2017-09-12

    There is high demand for forensic pedigree searches with Y-chromosome short tandem repeat (Y-STR) profiling in large-scale crime investigations. However, when two Y-STR haplotypes have a few mismatched loci, it is difficult to determine if they are from the same male lineage because of the high mutation rate of Y-STRs. Here we design a new strategy to handle cases in which none of pedigree samples shares identical Y-STR haplotype. We combine next generation sequencing (NGS), capillary electrophoresis and pyrosequencing under the term 'NGS+' for typing Y-STRs and Y-chromosomal single nucleotide polymorphisms (Y-SNPs). The high-resolution Y-SNP haplogroup and Y-STR haplotype can be obtained with NGS+. We further developed a new data-driven decision rule, FSindex, for estimating the likelihood for each retrieved pedigree. Our approach enables positive identification of pedigree from mismatched Y-STR haplotypes. It is envisaged that NGS+ will revolutionize forensic pedigree searches, especially when the person of interest was not recorded in forensic DNA database.

  14. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  15. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

    PubMed

    Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

    2006-08-01

    Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

  16. Differential distribution of Y-chromosome haplotypes in Swiss and Southern European goat breeds.

    PubMed

    Vidal, Oriol; Drögemüller, Cord; Obexer-Ruff, Gabriela; Reber, Irene; Jordana, Jordi; Martínez, Amparo; Bâlteanu, Valentin Adrian; Delgado, Juan Vicente; Eghbalsaied, Shahin; Landi, Vincenzo; Goyache, Felix; Traoré, Amadou; Pazzola, Michele; Vacca, Giuseppe Massimo; Badaoui, Bouabid; Pilla, Fabio; D'Andrea, Mariasilvia; Álvarez, Isabel; Capote, Juan; Sharaf, Abdoallah; Pons, Àgueda; Amills, Marcel

    2017-11-23

    The analysis of Y-chromosome variation has provided valuable clues about the paternal history of domestic animal populations. The main goal of the current work was to characterize Y-chromosome diversity in 31 goat populations from Central Eastern (Switzerland and Romania) and Southern Europe (Spain and Italy) as well as in reference populations from Africa and the Near East. Towards this end, we have genotyped seven single nucleotide polymorphisms (SNPs), mapping to the SRY, ZFY, AMELY and DDX3Y Y-linked loci, in 275 bucks from 31 populations. We have observed a low level of variability in the goat Y-chromosome, with just five haplotypes segregating in the whole set of populations. We have also found that Swiss bucks carry exclusively Y1 haplotypes (Y1A: 24%, Y1B1: 15%, Y1B2: 43% and Y1C: 18%), while in Italian and Spanish bucks Y2A is the most abundant haplotype (77%). Interestingly, in Carpathian goats from Romania the Y2A haplotype is also frequent (42%). The high Y-chromosome differentiation between Swiss and Italian/Spanish breeds might be due to the post-domestication spread of two different Near Eastern genetic stocks through the Danubian and Mediterranean corridors. Historical gene flow between Southern European and Northern African goats might have also contributed to generate such pattern of genetic differentiation.

  17. High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

    PubMed Central

    Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

    2010-01-01

    Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

  18. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    PubMed Central

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that span the genome. Most of these markers are single nucleotide polymorphisms and sequences for these variants are provided in an accessible format. The average density of the new markers is one per 225 kb on the autosomes and one per megabase on the X chromosome. We include in this survey a set of P-element strains that provide additional use for high-resolution mapping. We show one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community. PMID:11381036

  19. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed

    2001-04-16

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markersmore » is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.« less

  20. Novel single nucleotide polymorphism associations with colorectal cancer on chromosome 8q24 in African and European Americans

    PubMed Central

    Kupfer, Sonia S.; Torres, Jada Benn; Hooker, Stanley; Anderson, Jeffrey R.; Skol, Andrew D.; Ellis, Nathan A.; Kittles, Rick A.

    2009-01-01

    Regions on chromosome 8q24 harbor susceptibility alleles for multiple cancers including colorectal (region 3) and prostate cancer (regions 1–4). The objectives of the present study were (i) to test whether single-nucleotide polymorphisms (SNPs) in region 4 are associated with colorectal cancer (CRC) in European or African Americans; (ii) to test whether 8q24 SNPs previously shown to be associated with colorectal and prostate cancer also show association in our multiethnic series and (iii) to test for association between 100 ancestry informative markers (AIMs) and CRC in both the African American and European American cohorts. In total, we genotyped nine markers on 8q24 and 100 unlinked AIMs in 569 CRC cases and 439 controls (490 European Americans and 518 African Americans) obtained retrospectively from a hospital-based sample. We found rs7008482 in 8q24 region 4 to be significantly associated with CRC in European Americans (P = 0.03). Also in region 4, we found that a second SNP, rs16900305, trended toward association with CRC in African Americans. The rs6983267 in region 3, previously implicated in CRC risk, trended toward association with disease in European Americans but not in African Americans. Finally, none of the 100 AIMs tested for association reached statistical significance after correction for multiple hypothesis testing. In summary, these results are evidence that 8q24 region 4 contains novel CRC-associated alleles in European and African Americans. PMID:19520795

  1. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  2. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  3. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    PubMed Central

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John J; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M; Asmann, Yan W; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I; Bertrand, Kimberly A; Birmann, Brenda M; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M; Brennan, Paul; Brooks-Wilson, Angela R; Cerhan, James R; Chanock, Stephen J; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J; de Sanjose, Silvia; Di Lollo, Simonetta; Diver, W Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G; Glimelius, Bengt; Habermann, Thomas M; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R; Holly, Elizabeth A; Jackson, Rebecca D; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S; Klein, Robert J; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry J; Monnereau, Alain; Morton, Lindsay M; Nieters, Alexandra; North, Kari E; Novak, Anne J; Offit, Kenneth; Purdue, Mark P; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K; Skibola, Christine F; Slager, Susan L; Smith, Alex; Smith, Martyn T; Southey, Melissa C; Staines, Anthony; Teras, Lauren R; Thompson, Carrie A; Tilly, Hervé; Tinker, Lesley F; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL. Methods GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis. Results Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765. Conclusions These data suggest several plausible genetic links between DLBCL and SLE. PMID:29214033

  4. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    PubMed

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  6. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    PubMed Central

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  7. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    PubMed

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  8. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  9. Association study of two functional single nucleotide polymorphisms of neuropeptide y gene with multiple sclerosis.

    PubMed

    Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad

    2016-12-01

    Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  11. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  12. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  13. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    PubMed

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  14. Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

    PubMed

    Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

    2017-04-04

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

  15. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses

    PubMed Central

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. PMID:26019166

  16. Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

    PubMed Central

    Watson, Claire L.; Lockwood, Diana N. J.

    2009-01-01

    Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

  17. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  18. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

  19. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  20. Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

    PubMed Central

    2014-01-01

    Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

  1. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  3. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

  4. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

    PubMed

    Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

    2018-01-01

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity

  5. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  6. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  7. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  8. Genome-Wide Search Identifies 1.9 Mb from the Polar Bear Y Chromosome for Evolutionary Analyses.

    PubMed

    Bidon, Tobias; Schreck, Nancy; Hailer, Frank; Nilsson, Maria A; Janke, Axel

    2015-05-27

    The male-inherited Y chromosome is the major haploid fraction of the mammalian genome, rendering Y-linked sequences an indispensable resource for evolutionary research. However, despite recent large-scale genome sequencing approaches, only a handful of Y chromosome sequences have been characterized to date, mainly in model organisms. Using polar bear (Ursus maritimus) genomes, we compare two different in silico approaches to identify Y-linked sequences: 1) Similarity to known Y-linked genes and 2) difference in the average read depth of autosomal versus sex chromosomal scaffolds. Specifically, we mapped available genomic sequencing short reads from a male and a female polar bear against the reference genome and identify 112 Y-chromosomal scaffolds with a combined length of 1.9 Mb. We verified the in silico findings for the longer polar bear scaffolds by male-specific in vitro amplification, demonstrating the reliability of the average read depth approach. The obtained Y chromosome sequences contain protein-coding sequences, single nucleotide polymorphisms, microsatellites, and transposable elements that are useful for evolutionary studies. A high-resolution phylogeny of the polar bear patriline shows two highly divergent Y chromosome lineages, obtained from analysis of the identified Y scaffolds in 12 previously published male polar bear genomes. Moreover, we find evidence of gene conversion among ZFX and ZFY sequences in the giant panda lineage and in the ancestor of ursine and tremarctine bears. Thus, the identification of Y-linked scaffold sequences from unordered genome sequences yields valuable data to infer phylogenomic and population-genomic patterns in bears. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms.

    PubMed

    Børsting, Claus; Morling, Niels

    2012-02-01

    In some relationship cases, the initial investigations of autosomal short tandem repeats (STRs) lead to an ambiguous conclusion and supplementary investigations become necessary. Six unusual paternity cases were previously investigated by other researchers and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. Three cases were solved by the SNP investigation without the need for any additional testing. In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. The case work examples underline the importance of performing supplementary investigations, and they advocate for the implementation of several panels that may be used in the highly unusual cases. Panels with SNPs or other markers with low mutation probabilities are preferable as supplementary markers, because the risk of detecting (additional) mutations is very low. © 2012 American Association of Blood Banks.

  10. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  11. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  12. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  13. Nucleotide, cytogenetic and expression impact of the human chromosome 8p23.1 inversion polymorphism.

    PubMed

    Bosch, Nina; Morell, Marta; Ponsa, Immaculada; Mercader, Josep Maria; Armengol, Lluís; Estivill, Xavier

    2009-12-14

    The human chromosome 8p23.1 region contains a 3.8-4.5 Mb segment which can be found in different orientations (defined as genomic inversion) among individuals. The identification of single nucleotide polymorphisms (SNPs) tightly linked to the genomic orientation of a given region should be useful to indirectly evaluate the genotypes of large genomic orientations in the individuals. We have identified 16 SNPs, which are in linkage disequilibrium (LD) with the 8p23.1 inversion as detected by fluorescent in situ hybridization (FISH). The variability of the 8p23.1 orientation in 150 HapMap samples was predicted using this set of SNPs and was verified by FISH in a subset of samples. Four genes (NEIL2, MSRA, CTSB and BLK) were found differentially expressed (p<0.0005) according to the orientation of the 8p23.1 region. Finally, we have found variable levels of mosaicism for the orientation of the 8p23.1 as determined by FISH. By means of dense SNP genotyping of the region, haplotype-based computational analyses and FISH experiments we could infer and verify the orientation status of alleles in the 8p23.1 region by detecting two short haplotype stretches at both ends of the inverted region, which are likely the relic of the chromosome in which the original inversion occurred. Moreover, an impact of 8p23.1 inversion on gene expression levels cannot be ruled out, since four genes from this region have statistically significant different expression levels depending on the inversion status. FISH results in lymphoblastoid cell lines suggest the presence of mosaicism regarding the 8p23.1 inversion.

  14. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  15. Genetic variation within the Y chromosome is not associated with histological characteristics of the atherosclerotic carotid artery or aneurysmal wall.

    PubMed

    Haitjema, Saskia; van Setten, Jessica; Eales, James; van der Laan, Sander W; Gandin, Ilaria; de Vries, Jean-Paul P M; de Borst, Gert J; Pasterkamp, Gerard; Asselbergs, Folkert W; Charchar, Fadi J; Wilson, James F; de Jager, Saskia C A; Tomaszewski, Maciej; den Ruijter, Hester M

    2017-04-01

    Haplogroup I, a common European paternal lineage of the Y chromosome, is associated with increased risk of coronary artery disease in British men. It is unclear whether this haplogroup or any other haplogroup on the Y chromosome is associated with histological characteristics of the diseased vessel wall in other vascular manifestations of cardiovascular diseases showing a male preponderance. We examined Dutch men undergoing either carotid endarterectomy from the Athero-Express biobank (AE, n = 1217) or open aneurysm repair from the Aneurysm-Express biobank (AAA, n = 393). Upon resolving the Y chromosome phylogeny, each man was assigned to one of the paternal lineages based on combinations of single nucleotide polymorphisms of the male-specific region of the Y chromosome. We examined the associations between the Y chromosome and the histological characteristics of the carotid plaque and aneurysm wall, including lipid content, leukocyte infiltration and intraplaque haemorrhage, in all men. A majority of men were carriers of either haplogroup I (AE: 28% AAA: 24%) or haplogroup R (AE: 59% AAA: 61%). We found no association between Y chromosomal haplogroups and histological characteristics of plaque collected from carotid arteries or tissue specimens of aneurysms. Moreover, the distribution of frequency for all Y chromosomal haplogroups in both cohorts was similar to that of a general population of Dutch men. Our data show that genetic variation on the Y chromosome is not associated with histological characteristics of the plaques from carotid arteries or specimens of aneurysms in men of Dutch origin. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  17. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  18. Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

    PubMed

    Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

    2015-09-15

    Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  20. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  1. Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

    PubMed

    Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

    2016-02-01

    The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P < 1.94 × 10(-7) (Bonferroni correction: 0.05/257,558). Tests of association revealed 2 significantly associated SNPs, one occurring in SAP30BP (rs820218; P = 3.8E-9) on chromosome 17q25 and another occurring in SASH1 (rs12527089; P = 1.9E-7) on chromosome 6q24. This study represents the first attempt to identify genetic factors influencing rotator cuff tearing by a genome-wide association study using a dense/complete set of SNPs. Two SNPs were significantly associated with rotator cuff tearing, residing in SAP30BP on chromosome 17 and SASH1 on chromosome 6. Both genes are associated with the cellular process of apoptosis. Identification of potential genes or genetic variants associated with rotator cuff tearing may help in identifying individuals at risk for the development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  2. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

    PubMed

    Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

    2002-03-01

    Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

  3. Abundance and Characterization of Perfect Microsatellites on the Cattle Y Chromosome.

    PubMed

    Ma, Zhi-Jie

    2017-07-03

    Microsatellites or simple sequence repeats (SSRs) are found in most organisms and play an important role in genomic organization and function. To characterize the abundance of SSRs (1-6 base-pairs [bp]) on the cattle Y chromsome, the relative frequency and density of perfect or uninterrupted SSRs based on the published Y chromosome sequence were examined. A total of 17,273 perfect SSRs were found, with total length of 324.78 kb, indicating that approximately 0.75% of the cattle Y chromosome sequence (43.30 Mb) comprises perfect SSRs, with an average length of 18.80 bp. The relative frequency and density were 398.92 loci/Mb and 7500.62 bp/Mb, respectively. The proportions of the six classes of perfect SSRs were highly variable on the cattle Y chromosome. Mononucleotide repeats had a total number of 8073 (46.74%) and an average length of 15.45 bp, and were the most abundant SSRs class, while the percentages of di-, tetra-, tri-, penta-, and hexa-nucleotide repeats were 22.86%, 11.98%, 11.58%, 6.65%, and 0.19%, respectively. Different classes of SSRs varied in their repeat number, with the highest being 42 for dinucleotides. Results reveal that repeat categories A, AC, AT, AAC, AGC, GTTT, CTTT, ATTT, and AACTG predominate on the Y chromosome. This study provides insight into the organization of cattle Y chromosome repetitive DNA, as well as information useful for developing more polymorphic cattle Y-chromosome-specific SSRs.

  4. Single nucleotide polymorphisms in an intergenic chromosome 2q region associated with tissue factor pathway inhibitor plasma levels and venous thromboembolism.

    PubMed

    Dennis, J; Truong, V; Aïssi, D; Medina-Rivera, A; Blankenberg, S; Germain, M; Lemire, M; Antounians, L; Civelek, M; Schnabel, R; Wells, P; Wilson, M D; Morange, P-E; Trégouët, D-A; Gagnon, F

    2016-10-01

    Essentials Tissue factor pathway inhibitor (TFPI) regulates the blood coagulation cascade. We replicated previously reported linkage of TFPI plasma levels to the chromosome 2q region. The putative causal locus, rs62187992, was associated with TFPI plasma levels and thrombosis. rs62187992 was marginally associated with TFPI expression in human aortic endothelial cells. Click to hear Ann Gil's presentation on new insights into thrombin activatable fibrinolysis inhibitor SUMMARY: Background Tissue factor pathway inhibitor (TFPI) regulates fibrin clot formation, and low TFPI plasma levels increase the risk of arterial thromboembolism and venous thromboembolism (VTE). TFPI plasma levels are also heritable, and a previous linkage scan implicated the chromosome 2q region, but no specific genes. Objectives To replicate the finding of the linkage region in an independent sample, and to identify the causal locus. Methods We first performed a linkage analysis of microsatellite markers and TFPI plasma levels in 251 individuals from the F5L Family Study, and replicated the finding of the linkage peak on chromosome 2q (LOD = 3.06). We next defined a follow-up region that included 112 603 single nucleotide polymorphisms (SNPs) under the linkage peak, and meta-analyzed associations between these SNPs and TFPI plasma levels across the F5L Family Study and the Marseille Thrombosis Association (MARTHA) Study, a study of 1033 unrelated VTE patients. SNPs with false discovery rate q-values of < 0.10 were tested for association with TFPI plasma levels in 892 patients with coronary artery disease in the AtheroGene Study. Results and Conclusions One SNP, rs62187992, was associated with TFPI plasma levels in all three samples (β = + 0.14 and P = 4.23 × 10 -6 combined; β = + 0.16 and P = 0.02 in the F5L Family Study; β = + 0.13 and P = 6.3 × 10 -4 in the MARTHA Study; β = + 0.17 and P = 0.03 in the AtheroGene Study), and contributed to the linkage peak in the F5L Family Study. rs

  5. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  6. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  7. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  8. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  9. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  10. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  11. Balinese Y-chromosome perspective on the peopling of Indonesia: genetic contributions from pre-neolithic hunter-gatherers, Austronesian farmers, and Indian traders.

    PubMed

    Karafet, Tatiana M; Lansing, J S; Redd, Alan J; Reznikova, Svetlana; Watkins, Joseph C; Surata, S P K; Arthawiguna, W A; Mayer, Laura; Bamshad, Michael; Jorde, Lynn B; Hammer, Michael F

    2005-02-01

    The island of Bali lies near the center of the southern chain of islands in the Indonesian archipelago, which served as a stepping-stone for early migrations of hunter-gatherers to Melanesia and Australia and for more recent migrations of Austronesian farmers from mainland Southeast Asia to the Pacific. Bali is the only Indonesian island with a population that currently practices the Hindu religion and preserves various other Indian cultural, linguistic, and artistic traditions (Lansing 1983). Here, we examine genetic variation on the Y chromosomes of 551 Balinese men to investigate the relative contributions of Austronesian farmers and pre-Neolithic hunter-gatherers to the contemporary Balinese paternal gene pool and to test the hypothesis of recent paternal gene flow from the Indian subcontinent. Seventy-one Y-chromosome binary polymorphisms (single nucleotide polymorphisms, SNPs) and 10 Y-chromosome-linked short tandem repeats (STRs) were genotyped on a sample of 1,989 Y chromosomes from 20 populations representing Indonesia (including Bali), southern China, Southeast Asia, South Asia, the Near East, and Oceania. SNP genotyping revealed 22 Balinese lineages, 3 of which (O-M95, O-M119, and O-M122) account for nearly 83.7% of Balinese Y chromosomes. Phylogeographic analyses suggest that all three major Y-chromosome haplogroups migrated to Bali with the arrival of Austronesian speakers; however, STR diversity patterns associated with these haplogroups are complex and may be explained by multiple waves of Austronesian expansion to Indonesia by different routes. Approximately 2.2% of contemporary Balinese Y chromosomes (i.e., K-M9*, K-M230, and M lineages) may represent the pre-Neolithic component of the Indonesian paternal gene pool. In contrast, eight other haplogroups (e.g., within H, J, L, and R), making up approximately 12% of the Balinese paternal gene pool, appear to have migrated to Bali from India. These results indicate that the Austronesian expansion had a

  12. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  13. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  14. Inter- and Intraspecies Phylogenetic Analyses Reveal Extensive X–Y Gene Conversion in the Evolution of Gametologous Sequences of Human Sex Chromosomes

    PubMed Central

    Trombetta, Beniamino; Sellitto, Daniele; Scozzari, Rosaria; Cruciani, Fulvio

    2014-01-01

    It has long been believed that the male-specific region of the human Y chromosome (MSY) is genetically independent from the X chromosome. This idea has been recently dismissed due to the discovery that X–Y gametologous gene conversion may occur. However, the pervasiveness of this molecular process in the evolution of sex chromosomes has yet to be exhaustively analyzed. In this study, we explored how pervasive X–Y gene conversion has been during the evolution of the youngest stratum of the human sex chromosomes. By comparing about 0.5 Mb of human–chimpanzee gametologous sequences, we identified 19 regions in which extensive gene conversion has occurred. From our analysis, two major features of these emerged: 1) Several of them are evolutionarily conserved between the two species and 2) almost all of the 19 hotspots overlap with regions where X–Y crossing-over has been previously reported to be involved in sex reversal. Furthermore, in order to explore the dynamics of X–Y gametologous conversion in recent human evolution, we resequenced these 19 hotspots in 68 widely divergent Y haplogroups and used publicly available single nucleotide polymorphism data for the X chromosome. We found that at least ten hotspots are still active in humans. Hence, the results of the interspecific analysis are consistent with the hypothesis of widespread reticulate evolution within gametologous sequences in the differentiation of hominini sex chromosomes. In turn, intraspecific analysis demonstrates that X–Y gene conversion may modulate human sex-chromosome-sequence evolution to a greater extent than previously thought. PMID:24817545

  15. Simultaneous determination of seven informative Y chromosome SNPs to differentiate East Asian, European, and African populations.

    PubMed

    Muro, Tomonori; Iida, Reiko; Fujihara, Junko; Yasuda, Toshihiro; Watanabe, Yukina; Imamura, Shinji; Nakamura, Hiroaki; Kimura-Kataoka, Kaori; Yuasa, Isao; Toga, Tomoko; Takeshita, Haruo

    2011-05-01

    Identification of the population origin of an individual is very useful for crime investigators who need to narrow down a suspect based on specimens left at a crime scene. Single nucleotide polymorphisms of the Y chromosome (Y-SNPs) are a class of markers of interest to forensic investigators because many of the markers indicate regional specificity, thus providing useful information about the geographic origin of a subject. We selected seven informative Y-SNPs (M168, M130, JST021355, M96, P126, P196, and P234) to differentiate the three major population groups (East Asian, European, and African) and used them to develop forensic application. SNP genotyping was carried out by multiplex PCR reaction and multiplex single base extension (MSBE) reaction followed by capillary electrophoresis of extension products. This method can be used to assign a haplogroup from both degraded male DNA samples and DNA samples containing a mixture of female and male DNA through PCR primers that generate small amplicons (less than about 150 bp) and are highly specific for targets on the Y chromosome. The allelic state of each marker was definitively determined from a total of 791 males from the three major population groups. As expected, samples from the three major population groups showed Y-haplogroups common in the region of provenance: Y haplogroups C, D, and O for East Asians; IJ and R1 for Europeans; and AB and E for Africans. Published by Elsevier Ireland Ltd.

  16. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  17. Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

    PubMed

    Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

    2013-12-01

    The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  18. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in

  19. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  20. DYZ1 copy number variation, Y chromosome polymorphism and early recurrent spontaneous abortion/early embryo growth arrest.

    PubMed

    Yan, Junhao; Fan, Lingling; Zhao, Yueran; You, Li; Wang, Laicheng; Zhao, Han; Li, Yuan; Chen, Zi-Jiang

    2011-12-01

    To find the association between recurrent spontaneous abortion (RSA)/early embryo growth arrest and Y chromosome polymorphism. Peripheral blood samples of the male patients of big Y chromosome, small Y chromosome and other male patients whose partners suffered from unexplained RSA/early embryo growth arrest were collected. PCR and real-time fluorescent quantitative PCR were used to test the deletion and the copy number variation of DYZ1 region in Y chromosome of the patients. A total of 79 big Y chromosome patients (48 of whose partners suffered from RSA or early embryo growth arrest), 7 small Y chromosome patients, 106 other male patients whose partners had suffered from unexplained RSA or early embryo growth arrest, and 100 normal male controls were enrolled. There was no fraction deletion of DYZ1 detected both in big Y patients and in normal men. Of RSA patients, 1 case showed deletion of 266bp from the gene locus 25-290bp, and 2 cases showed deletion of 773bp from 1347 to 2119bp. Of only 7 small Y chromosome patients, 2 cases showed deletion of 266bp from 25 to 290bp, and 4 cases showed deletion of 773bp from 1347 to 2119bp and 275bp from 3128 to 3420bp. The mean of DYZ1 copies was 3900 in normal control men; the mean in big Y patients was 5571, in RSA patients was 2655, and in small Y patients was 1059. All of the others were significantly different (P<0.01) compared with normal control men, which meant that DYZ1 copy number in normal control men was less than that of big Y chromosome patients, and was more than that of unexplained early RSA patients and small Y patients. The integrity and copy number variation of DYZ1 are closely related to the Y chromosome length under microscope. The cause of RSA/early embryo growth arrest in some couples may be the increase (big Y patients) or decrease of DYZ1 copy number in the husbands' Y chromosome. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  1. DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

    PubMed

    Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

    2013-07-15

    Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Quantitative Analysis of Single-Nucleotide Polymorphism for Rapid Detection of TR34/L98H- and TR46/Y121F/T289A-Positive Aspergillus fumigatus Isolates Obtained from Patients in Iran from 2010 to 2014

    PubMed Central

    Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.

    2015-01-01

    We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide

  3. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  4. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  5. Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

    PubMed

    Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

    2008-04-15

    The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

  6. Peopling of the North Circumpolar Region--insights from Y chromosome STR and SNP typing of Greenlanders.

    PubMed

    Olofsson, Jill Katharina; Pereira, Vania; Børsting, Claus; Morling, Niels

    2015-01-01

    The human population in Greenland is characterized by migration events of Paleo- and Neo-Eskimos, as well as admixture with Europeans. In this study, the Y-chromosomal variation in male Greenlanders was investigated in detail by typing 73 Y-chromosomal single nucleotide polymorphisms (Y-SNPs) and 17 Y-chromosomal short tandem repeats (Y-STRs). Approximately 40% of the analyzed Greenlandic Y chromosomes were of European origin (I-M170, R1a-M513 and R1b-M343). Y chromosomes of European origin were mainly found in individuals from the west and south coasts of Greenland, which is in agreement with the historic records of the geographic placements of European settlements in Greenland. Two Inuit Y-chromosomal lineages, Q-M3 (xM19, M194, L663, SA01 and L766) and Q-NWT01 (xM265) were found in 23% and 31% of the male Greenlanders, respectively. The time to the most recent common ancestor (TMRCA) of the Q-M3 lineage of the Greenlanders was estimated to be between 4,400 and 10,900 years ago (y. a.) using two different methods. This is in agreement with the theory that the North Circumpolar Region was populated via a second expansion of humans in the North American continent. The TMRCA of the Q-NWT01 (xM265) lineage in Greenland was estimated to be between 7,000 and 14,300 y. a. using two different methods, which is older than the previously reported TMRCA of this lineage in other Inuit populations. Our results indicate that Inuit individuals carrying the Q-NWT01 (xM265) lineage may have their origin in the northeastern parts of North America and could be descendants of the Dorset culture. This in turn points to the possibility that the current Inuit population in Greenland is comprised of individuals of both Thule and Dorset descent.

  7. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    PubMed Central

    2010-01-01

    Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP) markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD) and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB) from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large chromosomal regions. The

  8. Globally dispersed Y chromosomal haplotypes in wild and domestic sheep.

    PubMed

    Meadows, J R S; Hanotte, O; Drögemüller, C; Calvo, J; Godfrey, R; Coltman, D; Maddox, J F; Marzanov, N; Kantanen, J; Kijas, J W

    2006-10-01

    To date, investigations of genetic diversity and the origins of domestication in sheep have utilised autosomal microsatellites and variation in the mitochondrial genome. We present the first analysis of both domestic and wild sheep using genetic markers residing on the ovine Y chromosome. Analysis of a single nucleotide polymorphism (oY1) in the SRY promoter region revealed that allele A-oY1 was present in all wild bighorn sheep (Ovis canadensis), two subspecies of thinhorn sheep (Ovis dalli), European Mouflon (Ovis musimon) and the Barbary (Ammontragis lervia). A-oY1 also had the highest frequency (71.4%) within 458 domestic sheep drawn from 65 breeds sampled from Africa, Asia, Australia, the Caribbean, Europe, the Middle East and Central Asia. Sequence analysis of a second locus, microsatellite SRYM18, revealed a compound repeat array displaying fixed differences, which identified bighorn and thinhorn sheep as distinct from the European Mouflon and domestic animals. Combined genotypic data identified 11 male-specific haplotypes that represented at least two separate lineages. Investigation of the geographical distribution of each haplotype revealed that one (H6) was both very common and widespread in the global sample of domestic breeds. The remaining haplotypes each displayed more restricted and informative distributions. For example, H5 was likely founded following the domestication of European breeds and was used to trace the recent transportation of animals to both the Caribbean and Australia. A high rate of Y chromosomal dispersal appears to have taken place during the development of domestic sheep as only 12.9% of the total observed variation was partitioned between major geographical regions.

  9. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  10. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  11. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  12. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

    PubMed Central

    Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

    2007-01-01

    Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

  13. Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

    PubMed

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

  14. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    PubMed

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  15. Genetic Diversity and Differentiation in Urban and Indigenous Populations of Mexico: Patterns of Mitochondrial DNA and Y-Chromosome Lineages.

    PubMed

    González-Sobrino, Blanca Z; Pintado-Cortina, Ana P; Sebastián-Medina, Leticia; Morales-Mandujano, Fabiola; Contreras, Alejandra V; Aguilar, Yasnaya E; Chávez-Benavides, Juan; Carrillo-Rodríguez, Aurelio; Silva-Zolezzi, Irma; Medrano-González, Luis

    2016-01-01

    Aside from the admixture between indigenous people and people from overseas, populations in Mexico changed drastically after the Spanish conquest of the sixteenth century, forming an intricate history that has been underutilized in understanding the genetic population structure of Mexicans. To infer historical processes of isolation, dispersal, and assimilation, we examined the phylogeography of mitochondrial (mt) DNA and Y-chromosome lineages in 3,026 individuals from 10 urban and nine indigenous populations by identifying single nucleotide polymorphisms. A geographic array with a predominance of Amerindian lineages was observed for mtDNA, with northern indigenous populations being divergent from the central and southern indigenous populations; urban populations showed low differentiation with isolation by distance. Y-chromosome variation distinguished urban and indigenous populations through the Amerindian haplogroup Q frequency. The MtDNA and the Y-chromosome together primarily distinguished urban and indigenous populations, with different geographic arrays for both. Gene flow across geographical distance and between the urban and indigenous realms appears to have altered the pre-Hispanic phylogeography in central and southern Mexico, mainly by displacement of women, while maintaining the indigenous isolation in the north, southeast, and Zapotec regions. Most Amerindian mtDNA diversity currently occurs in urban populations and appears to be reduced among indigenous people.

  16. Diachronic investigations of mitochondrial and Y-chromosomal genetic markers in pre-Columbian Andean highlanders from South Peru.

    PubMed

    Fehren-Schmitz, Lars; Warnberg, Ole; Reindel, Markus; Seidenberg, Verena; Tomasto-Cagigao, Elsa; Isla-Cuadrado, Johny; Hummel, Susanne; Herrmann, Bernd

    2011-03-01

    This study examines the reciprocal effects of cultural evolution, and population dynamics in pre-Columbian southern Peru by the analysis of DNA from pre-Columbian populations that lived in the fringe area between the Andean highlands and the Pacific coast. The main objective is to reveal whether the transition from the Middle Horizon (MH: 650-1000 AD) to the Late Intermediate Period (LIP: 1000-1400 AD) was accompanied or influenced by population dynamic processes. Tooth samples from 90 individuals from several archaeological sites, dating to the MH and LIP, in the research area were collected to analyse mitochodrial, and Y-chromosomal genetic markers. Coding region polymorphisms were successfully analysed and replicated for 72 individuals, as were control region sequences for 65 individuals and Y-chromosomal single nucleotide polymorphisms (SNPs) for 19 individuals, and these were compared to a large set of ancient and modern indigenous South American populations. The diachronic comparison of the upper valley samples from both time periods reveals no genetic discontinuities accompanying the cultural dynamic processes. A high genetic affinity for other ancient and modern highland populations can be observed, suggesting genetic continuity in the Andean highlands at the latest from the MH. A significant matrilineal differentiation to ancient Peruvian coastal populations can be observed suggesting a differential population history. © 2010 The Authors Annals of Human Genetics © 2010 Blackwell Publishing Ltd/University College London.

  17. Y chromosome STR typing in crime casework.

    PubMed

    Roewer, Lutz

    2009-01-01

    Since the beginning of the nineties the field of forensic Y chromosome analysis has been successfully developed to become commonplace in laboratories working in crime casework all over the world. The ability to identify male-specific DNA renders highly variable Y-chromosomal polymorphisms, the STR sequences, an invaluable addition to the standard panel of autosomal loci used in forensic genetics. The male-specificity makes the Y chromosome especially useful in cases of male/female cell admixture, namely in sexual assault cases. On the other hand, the haploidy and patrilineal inheritance complicates the interpretation of a Y-STR match, because male relatives share for several generations an identical Y-STR profile. Since paternal relatives tend to live in the geographic and cultural territory of their ancestors, the Y chromosome analysis has a potential to make inferences on the population of origin of a given DNA profile. This review addresses the fields of application of Y chromosome haplotyping, the interpretation of results, databasing efforts and population genetics aspects.

  18. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  19. Chromosome 17: association of a large inversion polymorphism with corticosteroid response in asthma.

    PubMed

    Tantisira, Kelan G; Lazarus, Ross; Litonjua, Augusto A; Klanderman, Barbara; Weiss, Scott T

    2008-08-01

    A 900-kb inversion exists within a large region of conserved linkage disequilibrium (LD) on chromosome 17. CRHR1 is located within the inversion region and associated with inhaled corticosteroid response in asthma. We hypothesized that CRHR1 variants are in LD with the inversion, supporting a potential role for natural selection in the genetic response to corticosteroids. We genotyped six single nucleotide polymorphisms (SNPs) spanning chromosome 17: 40,410,565-42,372,240, including four SNPs defining inversion status. Similar allele frequencies and strong LD were noted between the inversion and a CRHR1 SNP previously associated with lung function response to inhaled corticosteroids. Each inversion-defining SNP was strongly associated with inhaled corticosteroid response in adult asthma (P values 0.002-0.005). The CRHR1 response to inhaled corticosteroids may thus be explained by natural selection resulting from inversion status or by long-range LD with another gene. Additional pharmacogenetic investigations into regions of chromosomal diversity, including copy number variation and inversions, are warranted.

  20. Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

    PubMed

    Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

    2016-06-01

    Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

  1. Using Y-Chromosomal Haplogroups in Genetic Association Studies and Suggested Implications.

    PubMed

    Erzurumluoglu, A Mesut; Baird, Denis; Richardson, Tom G; Timpson, Nicholas J; Rodriguez, Santiago

    2018-01-22

    Y-chromosomal (Y-DNA) haplogroups are more widely used in population genetics than in genetic epidemiology, although associations between Y-DNA haplogroups and several traits, including cardiometabolic traits, have been reported. In apparently homogeneous populations defined by principal component analyses, there is still Y-DNA haplogroup variation which will result from population history. Therefore, hidden stratification and/or differential phenotypic effects by Y-DNA haplogroups could exist. To test this, we hypothesised that stratifying individuals according to their Y-DNA haplogroups before testing for associations between autosomal single nucleotide polymorphisms (SNPs) and phenotypes will yield difference in association. For proof of concept, we derived Y-DNA haplogroups from 6537 males from two epidemiological cohorts, Avon Longitudinal Study of Parents and Children (ALSPAC) ( n = 5080; 816 Y-DNA SNPs) and the 1958 Birth Cohort ( n = 1457; 1849 Y-DNA SNPs), and studied the robust associations between 32 SNPs and body mass index (BMI), including SNPs in or near Fat Mass and Obesity-associated protein ( FTO ) which yield the strongest effects. Overall, no association was replicated in both cohorts when Y-DNA haplogroups were considered and this suggests that, for BMI at least, there is little evidence of differences in phenotype or SNP association by Y-DNA structure. Further studies using other traits, phenome-wide association studies (PheWAS), other haplogroups and/or autosomal SNPs are required to test the generalisability and utility of this approach.

  2. Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

    PubMed

    Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

  3. Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

    PubMed Central

    Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

  4. [Identification of single nucleotide polymorphisms related to frailty].

    PubMed

    Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

    2018-04-07

    The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Dispersals of the Siberian Y-chromosome haplogroup Q in Eurasia.

    PubMed

    Huang, Yun-Zhi; Pamjav, Horolma; Flegontov, Pavel; Stenzl, Vlastimil; Wen, Shao-Qing; Tong, Xin-Zhu; Wang, Chuan-Chao; Wang, Ling-Xiang; Wei, Lan-Hai; Gao, Jing-Yi; Jin, Li; Li, Hui

    2018-02-01

    The human Y-chromosome has proven to be a powerful tool for tracing the paternal history of human populations and genealogical ancestors. The human Y-chromosome haplogroup Q is the most frequent haplogroup in the Americas. Previous studies have traced the origin of haplogroup Q to the region around Central Asia and Southern Siberia. Although the diversity of haplogroup Q in the Americas has been studied in detail, investigations on the diffusion of haplogroup Q in Eurasia and Africa are still limited. In this study, we collected 39 samples from China and Russia, investigated 432 samples from previous studies of haplogroup Q, and analyzed the single nucleotide polymorphism (SNP) subclades Q1a1a1-M120, Q1a2a1-L54, Q1a1b-M25, Q1a2-M346, Q1a2a1a2-L804, Q1a2b2-F1161, Q1b1a-M378, and Q1b1a1-L245. Through NETWORK and BATWING analyses, we found that the subclades of haplogroup Q continued to disperse from Central Asia and Southern Siberia during the past 10,000 years. Apart from its migration through the Beringia to the Americas, haplogroup Q also moved from Asia to the south and to the west during the Neolithic period, and subsequently to the whole of Eurasia and part of Africa.

  6. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  7. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  8. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  9. Y-chromosomal haplogroup distribution in the Tuzla Canton of Bosnia and Herzegovina: A concordance study using four different in silico assignment algorithms based on Y-STR data.

    PubMed

    Dogan, S; Babic, N; Gurkan, C; Goksu, A; Marjanovic, D; Hadziavdic, V

    2016-12-01

    Y-chromosomal haplogroups are sets of ancestrally related paternal lineages, traditionally assigned by the use of Y-chromosomal single nucleotide polymorphism (Y-SNP) markers. An increasingly popular and a less labor-intensive alternative approach has been Y-chromosomal haplogroup assignment based on already available Y-STR data using a variety of different algorithms. In the present study, such in silico haplogroup assignments were made based on 23-loci Y-STR data for 100 unrelated male individuals from the Tuzla Canton, Bosnia and Herzegovina (B&H) using the following four different algorithms: Whit Athey's Haplogroup Predictor, Jim Cullen's World Haplogroup & Haplogroup-I Subclade Predictor, Vadim Urasin's YPredictor and the NevGen Y-DNA Haplogroup Predictor. Prior in-house assessment of these four different algorithms using a previously published dataset (n=132) from B&H with both Y-STR (12-loci) and Y-SNP data suggested haplogroup misassignment rates between 0.76% and 3.02%. Subsequent analyses with the Tuzla Canton population sample revealed only a few differences in the individual haplogroup assignments when using different algorithms. Nevertheless, the resultant Y-chromosomal haplogroup distribution by each method was very similar, where the most prevalent haplogroups observed were I, R and E with their sublineages I2a, R1a and E1b1b, respectively, which is also in accordance with the previously published Y-SNP data for the B&H population. In conclusion, results presented herein not only constitute a concordance study on the four most popular haplogroup assignment algorithms, but they also give a deeper insight into the inter-population differentiation in B&H on the basis of Y haplogroups for the first time. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  11. Chromosomal polymorphism in mammals: an evolutionary perspective.

    PubMed

    Dobigny, Gauthier; Britton-Davidian, Janice; Robinson, Terence J

    2017-02-01

    Although chromosome rearrangements (CRs) are central to studies of genome evolution, our understanding of the evolutionary consequences of the early stages of karyotypic differentiation (i.e. polymorphism), especially the non-meiotic impacts, is surprisingly limited. We review the available data on chromosomal polymorphisms in mammals so as to identify taxa that hold promise for developing a more comprehensive understanding of chromosomal change. In doing so, we address several key questions: (i) to what extent are mammalian karyotypes polymorphic, and what types of rearrangements are principally involved? (ii) Are some mammalian lineages more prone to chromosomal polymorphism than others? More specifically, do (karyotypically) polymorphic mammalian species belong to lineages that are also characterized by past, extensive karyotype repatterning? (iii) How long can chromosomal polymorphisms persist in mammals? We discuss the evolutionary implications of these questions and propose several research avenues that may shed light on the role of chromosome change in the diversification of mammalian populations and species. © 2015 Cambridge Philosophical Society.

  12. A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

    PubMed

    Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

    2012-05-01

    Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

  13. Development of a New Molecular Subtyping Tool for Salmonella enterica Serovar Enteritidis Based on Single Nucleotide Polymorphism Genotyping Using PCR

    PubMed Central

    Kelly, Hilary; Dupras, Andrée Ann; Belanger, Sebastien; Devenish, John

    2014-01-01

    The lack of a sufficiently discriminatory molecular subtyping tool for Salmonella enterica serovar Enteritidis has hindered source attribution efforts and impeded regulatory actions required to disrupt its food-borne transmission. The underlying biological reason for the ineffectiveness of current molecular subtyping tools such as pulsed-field gel electrophoresis (PFGE) and phage typing appears to be related to the high degree of clonality of S. Enteritidis. By interrogating the organism's genome, we previously identified single nucleotide polymorphisms (SNP) distributed throughout the chromosome and have designed a highly discriminatory PCR-based SNP typing test based on 60 polymorphic loci. The application of the SNP-PCR method to DNA samples from S. Enteritidis strains (n = 55) obtained from a variety of sources has led to the differentiation and clustering of the S. Enteritidis isolates into 12 clades made up of 2 to 9 isolates per clade. Significantly, the SNP-PCR assay was able to further differentiate predominant PFGE types (e.g., XAI.0003) and phage types (e.g., phage type 8) into smaller subsets. The SNP-PCR subtyping test proved to be an accurate, precise, and quantitative tool for evaluating the relationships among the S. Enteritidis isolates tested in this study and should prove useful for clustering related S. Enteritidis isolates involved in outbreaks. PMID:25297333

  14. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    PubMed Central

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  15. Pasture names with Romance and Slavic roots facilitate dissection of Y chromosome variation in an exclusively German-speaking alpine region.

    PubMed

    Niederstätter, Harald; Rampl, Gerhard; Erhart, Daniel; Pitterl, Florian; Oberacher, Herbert; Neuhuber, Franz; Hausner, Isolde; Gassner, Christoph; Schennach, Harald; Berger, Burkhard; Parson, Walther

    2012-01-01

    The small alpine district of East Tyrol (Austria) has an exceptional demographic history. It was contemporaneously inhabited by members of the Romance, the Slavic and the Germanic language groups for centuries. Since the Late Middle Ages, however, the population of the principally agrarian-oriented area is solely Germanic speaking. Historic facts about East Tyrol's colonization are rare, but spatial density-distribution analysis based on the etymology of place-names has facilitated accurate spatial mapping of the various language groups' former settlement regions. To test for present-day Y chromosome population substructure, molecular genetic data were compared to the information attained by the linguistic analysis of pasture names. The linguistic data were used for subdividing East Tyrol into two regions of former Romance (A) and Slavic (B) settlement. Samples from 270 East Tyrolean men were genotyped for 17 Y-chromosomal microsatellites (Y-STRs) and 27 single nucleotide polymorphisms (Y-SNPs). Analysis of the probands' surnames revealed no evidence for spatial genetic structuring. Also, spatial autocorrelation analysis did not indicate significant correlation between genetic (Y-STR haplotypes) and geographic distance. Haplogroup R-M17 chromosomes, however, were absent in region A, but constituted one of the most frequent haplogroups in region B. The R-M343 (R1b) clade showed a marked and complementary frequency distribution pattern in these two regions. To further test East Tyrol's modern Y-chromosomal landscape for geographic patterning attributable to the early history of settlement in this alpine area, principal coordinates analysis was performed. The Y-STR haplotypes from region A clearly clustered with those of Romance reference populations and the samples from region B matched best with Germanic speaking reference populations. The combined use of onomastic and molecular genetic data revealed and mapped the marked structuring of the distribution of Y

  16. Pasture Names with Romance and Slavic Roots Facilitate Dissection of Y Chromosome Variation in an Exclusively German-Speaking Alpine Region

    PubMed Central

    Niederstätter, Harald; Rampl, Gerhard; Erhart, Daniel; Pitterl, Florian; Oberacher, Herbert; Neuhuber, Franz; Hausner, Isolde; Gassner, Christoph; Schennach, Harald; Berger, Burkhard; Parson, Walther

    2012-01-01

    The small alpine district of East Tyrol (Austria) has an exceptional demographic history. It was contemporaneously inhabited by members of the Romance, the Slavic and the Germanic language groups for centuries. Since the Late Middle Ages, however, the population of the principally agrarian-oriented area is solely Germanic speaking. Historic facts about East Tyrol's colonization are rare, but spatial density-distribution analysis based on the etymology of place-names has facilitated accurate spatial mapping of the various language groups' former settlement regions. To test for present-day Y chromosome population substructure, molecular genetic data were compared to the information attained by the linguistic analysis of pasture names. The linguistic data were used for subdividing East Tyrol into two regions of former Romance (A) and Slavic (B) settlement. Samples from 270 East Tyrolean men were genotyped for 17 Y-chromosomal microsatellites (Y-STRs) and 27 single nucleotide polymorphisms (Y-SNPs). Analysis of the probands' surnames revealed no evidence for spatial genetic structuring. Also, spatial autocorrelation analysis did not indicate significant correlation between genetic (Y-STR haplotypes) and geographic distance. Haplogroup R-M17 chromosomes, however, were absent in region A, but constituted one of the most frequent haplogroups in region B. The R-M343 (R1b) clade showed a marked and complementary frequency distribution pattern in these two regions. To further test East Tyrol's modern Y-chromosomal landscape for geographic patterning attributable to the early history of settlement in this alpine area, principal coordinates analysis was performed. The Y-STR haplotypes from region A clearly clustered with those of Romance reference populations and the samples from region B matched best with Germanic speaking reference populations. The combined use of onomastic and molecular genetic data revealed and mapped the marked structuring of the distribution of Y

  17. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

    PubMed

    Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

    2010-01-01

    Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

  18. Single nucleotide polymorphism in the tumor necrosis factor-alpha gene affects inflammatory bowel diseases risk

    PubMed Central

    Ferguson, Lynnette R; Huebner, Claudia; Petermann, Ivonne; Gearry, Richard B; Barclay, Murray L; Demmers, Pieter; McCulloch, Alan; Han, Dug Yeo

    2008-01-01

    AIM: To investigate the role that single nucleotide polymorphisms (SNPs) in the promoter of the tumour necrosis factor-alpha (TNF-α) gene play in the risk of inflammatory bowel diseases (IBDs) in a New Zealand population, in the context of international studies. METHODS: DNA samples from 388 patients with Crohn’s disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis (IC) and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common polymorphisms in the TNF-α receptor: -238 G→A, -308 G→A and -857C→T, using a TaqmanR assay. A meta-analysis was performed on the data obtained on these polymorphisms combined with that from other published studies. RESULTS: Individuals carrying the -308 G/A allele had a significantly (OR = 1.91, χ2 = 17.36, P < 0.0001) increased risk of pancolitis, and a 1.57-fold increased risk (OR = 1.57, χ2 = 4.34, P = 0.037) of requiring a bowel resection in UC. Carrying the -857 C/T variant decreased the risk of ileocolonic CD (OR = 0.56, χ2 = 4.32, P = 0.037), and the need for a bowel resection (OR = 0.59, χ2 = 4.85, P = 0.028). The risk of UC was reduced in individuals who were smokers at diagnosis, (OR = 0.48, χ2 = 4.86, P = 0.028). CONCLUSION: TNF-α is a key cytokine known to play a role in inflammatory response, and the locus for the gene is found in the IBD3 region on chromosome 6p21, known to be associated with an increased risk for IBD. The -308 G/A SNP in the TNF-α promoter is functional, and may account in part for the increased UC risk associated with the IBD3 genomic region. The -857 C/T SNP may decrease IBD risk in certain groups. Pharmaco- or nutrigenomic approaches may be desirable for individuals with such affected genotypes. PMID:18698679

  19. Identification of single nucleotide polymorphism in ginger using expressed sequence tags

    PubMed Central

    Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

    2009-01-01

    Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

  20. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

    2010-12-01

    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  1. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  2. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  3. Investigation of extended Y chromosome STR haplotypes in Sardinia.

    PubMed

    Lacerenza, D; Aneli, S; Di Gaetano, C; Critelli, R; Piazza, A; Matullo, G; Culigioni, C; Robledo, R; Robino, C; Calò, C

    2017-03-01

    Y-chromosomal variation of selected single nucleotide polymorphisms (SNPs) and 32 short tandem repeat (STR) loci was evaluated in Sardinia in three open population groups (Northern Sardinia, n=40; Central Sardinia, n=56; Southern Sardinia, n=91) and three isolates (Desulo, n=34; Benetutti, n=45, Carloforte, n=42). The tested Y-STRs consisted of Yfiler ® Plus markers and the seven rapidly mutating (RM) loci not included in the YFiler ® Plus kit (DYF399S1, DYF403S1ab, DYF404S1, DYS526ab, DYS547, DYS612, and DYS626). As expected, inclusion of additional Y-STR loci increased haplotype diversity (h), though complete differentiation of male lineages was impossible even by means of RM Y-STRs (h=0.99997). Analysis of molecular variance indicated that the three open populations were fairly homogeneous, whereas signs of genetic heterogeneity could be detected when the three isolates were also included in the analysis. Multidimensional scaling analysis showed that, even for extended haplotypes including RM Y-STR markers, Sardinians were clearly differentiated from populations of the Italian peninsula and Sicily. The only exception was represented by the Carloforte sample that, in accordance with its peculiar population history, clustered with Northern/Central Italian populations. The introduction of extended forensic Y-STR panels, including highly variable RM Y-STR markers, is expected to reduce the impact of population structure on haplotype frequency estimations. However, our results show that the availability of geographically detailed reference databases is still important for the assessment of the evidential value of a Y-haplotype match. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    PubMed

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  5. Reconstructing population histories from single nucleotide polymorphism data.

    PubMed

    Sirén, Jukka; Marttinen, Pekka; Corander, Jukka

    2011-01-01

    Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.

  6. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    PubMed Central

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  7. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

    PubMed

    Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

    2017-01-01

    Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  9. VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism.

    PubMed

    Kim, HyoYoung; Sung, Samsun; Cho, Seoae; Kim, Tae-Hun; Seo, Kangseok; Kim, Heebal

    2014-12-01

    Copy number variation (CNV) or single nucleotide phlyorphism (SNP) is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP) to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i) the enrichment of genome contents in CNV; ii) the physical distribution of CNV or SNP on chromosomes; iii) the distribution of log2 ratio of CNVs with criteria of interested; iv) the number of CNV or SNP per binning unit; v) the distribution of homozygosity of SNP genotype; and vi) cytomap of genes within CNV or SNP region.

  10. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

    2013-01-01

    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  11. Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

    PubMed

    Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

  12. N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

    PubMed Central

    Hein, David W.

    2009-01-01

    Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

  13. Toward optimal set of single nucleotide polymorphism investigation before IVF.

    PubMed

    Ivanov, A V; Dedul, A G; Fedotov, Y N; Komlichenko, E V

    2016-10-01

    At present, the patient preparation for IVF needs to undergo a series of planned tests, including the genotyping of single nucleotide polymorphism (SNP) alleles of some genes. In former USSR countries, such investigation was not included in overwhelming majority of health insurance programs and paid by patient. In common, there are prerequisites to the study of more than 50 polymorphisms. An important faced task is to determine the optimal panel for SNP genotyping in terms of price/number of SNP. During 2009-2015 in the University Hospital of St. Petersburg State University, blood samples were analyzed from 550 women with different reproductive system disorders preparing for IVF and 46 healthy women in control group. In total, 28 SNP were analyzed in the genes of thrombophilia factors, folic acid cycle, detoxification system, and the renin-angiotensin system. The method used was real-time PCR. A significant increase in the frequency of pathological alleles of some polymorphisms in patients with habitual failure of IVF was shown, compared with the control group. As a result, two options defined panels for optimal typing SNP before IVF were composed. Standard panel includes 8 SNP, 5 in thromborhilic factors, and 3 in folic acid cycle genes. They are 20210 G > A of FII gene, R506Q G > A of FV gene (mutation Leiden), -675 5G > 4G of PAI-I gene, L33P T > C of ITGB3 gene, -455 G > A of FGB gene, 667 C > T of MTHFR gene, 2756 A > G of MTR gene, and 66 A > G of MTRR gene. Extended panel of 15 SNP also includes 807 C > T of ITGA2 gene, T154M C > T of GP1BA gene, second polymorphism 1298 A > C in MTHFR gene, polymorphisms of the renin-angiotensin gene AGT M235T T > C and -1166 A > C of AGTR1 gene, polymorphisms I105V A > G and A114V C > T of detoxification system gene GSTP. The results of SNP genotyping can be adjusted for treatment tactics and IVF, and also medical support getting pregnant. The success rate of

  14. Prediction of the Y-Chromosome Haplogroups Within a Recently Settled Turkish Population in Sarajevo, Bosnia and Herzegovina.

    PubMed

    Doğan, Serkan; Doğan, Gŭlşen; Ašić, Adna; Besić, Larisa; Klimenta, Biljana; Hukić, Mirsada; Turan, Yusuf; Primorac, Dragan; Marjanović, Damir

    2016-04-01

    Analysis of Y-chromosome haplogroup distribution is widely used when investigating geographical clustering of different populations, which is why it plays an important role in population genetics, human migration patterns and even in forensic investigations. Individual determination of these haplogroups is mostly based on the analysis of single nucleotide polymorphism (SNP) markers located in the non-recombining part of Y-chromosome (NRY). On the other hand, the number of forensic and anthropology studies investigating short tandem repeats on the Y-chromosome (Y-STRs) increases rapidly every year. During the last few years, these markers have been successfully used as haplogroup prediction methods, which is why they have been used in this study. Previously obtained Y-STR haplotypes (23 loci) from 100 unrelated Turkish males recently settled in Sarajevo were used for the determination of haplogroups via 'Whit Athey's Haplogroup Predictor' software. The Bayesian probability of 90 of the studied haplotypes is greater than 92.2% and ranges from 51.4% to 84.3% for the remaining 10 haplotypes. A distribution of 17 different haplogroups was found, with the Y- haplogroup J2a being most prevalent, having been found in 26% of all the samples, whereas R1b, G2a and R1a were less prevalent, covering a range of 10% to 15% of all the samples. Together, these four haplogroups account for 63% of all Y-chromosomes. Eleven haplogroups (E1b1b, G1, I1, I2a, I2b, J1, J2b, L, Q, R2, and T) range from 2% to 5%, while E1b1a and N are found in 1% of all samples. Obtained results indicate that a large majority of the Turkish paternal line belongs to West Asia, Europe Caucasus, Western Europe, Northeast Europe, Middle East, Russia, Anatolia, and Black Sea Y-chromosome lineages. As the distribution of Y-chromosome haplogroups is consistent with the previously published data for the Turkish population residing in Turkey, it was concluded that the analyzed population could also be recognized as

  15. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  16. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    PubMed

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  17. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  18. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  19. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

    2013-09-01

    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  20. Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

    PubMed Central

    Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

    2015-01-01

    Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

  1. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Genetics of recurrent early-onset major depression (GenRED): significant linkage on chromosome 15q25-q26 after fine mapping with single nucleotide polymorphism markers.

    PubMed

    Levinson, Douglas F; Evgrafov, Oleg V; Knowles, James A; Potash, James B; Weissman, Myrna M; Scheftner, William A; Depaulo, J Raymond; Crowe, Raymond R; Murphy-Eberenz, Kathleen; Marta, Diana H; McInnis, Melvin G; Adams, Philip; Gladis, Madeline; Miller, Erin B; Thomas, Jo; Holmans, Peter

    2007-02-01

    The authors studied a dense map of single nucleotide polymorphism (SNP) DNA markers on chromosome 15q25-q26 to maximize the informativeness of genetic linkage analyses in a region where they previously reported suggestive evidence for linkage of recurrent early-onset major depressive disorder. In 631 European-ancestry families with multiple cases of recurrent early-onset major depressive disorder, 88 SNPs were genotyped, and multipoint allele-sharing linkage analyses were carried out. Marker-marker linkage disequilibrium was minimized, and a simulation study with founder haplotypes from these families suggested that linkage scores were not inflated by linkage disequilibrium. The dense SNP map increased the information content of the analysis from around 0.7 to over 0.9. The maximum evidence for linkage was the Z likelihood ratio score statistic of Kong and Cox (Z(LR))=4.69 at 109.8 cM. The exact p value was below the genomewide significance threshold. By contrast, in the genome scan with microsatellite markers at 9 cM spacing, the maximum Z(LR) for European-ancestry families was 3.43 (106.53 cM). It was estimated that the linked locus or loci in this region might account for a 20% or less populationwide increase in risk to siblings of cases. This region has produced modestly positive evidence for linkage to depression and related traits in other studies. These results suggest that DNA sequence variations in one or more genes in the 15q25-q26 region can increase susceptibility to major depression and that efforts are warranted to identify these genes.

  3. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  4. Wavelet-based identification of DNA focal genomic aberrations from single nucleotide polymorphism arrays

    PubMed Central

    2011-01-01

    Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311

  5. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

    PubMed

    Multani, Shaleen; Saranath, Dhananjaya

    2016-11-01

    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  6. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    PubMed

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  7. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  8. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    PubMed

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  9. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  10. A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

    PubMed

    Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

    2005-02-01

    A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

  11. Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

    PubMed Central

    Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

  12. Correlations between ACE single nucleotide polymorphisms and prognosis of patients with septic shock.

    PubMed

    Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min

    2017-04-30

    The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).

  13. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  14. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    NASA Astrophysics Data System (ADS)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  15. Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

    PubMed Central

    Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

    2000-01-01

    Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

  16. Identification of Genetic Variation on the Horse Y Chromosome and the Tracing of Male Founder Lineages in Modern Breeds

    PubMed Central

    Wallner, Barbara; Vogl, Claus; Shukla, Priyank; Burgstaller, Joerg P.; Druml, Thomas; Brem, Gottfried

    2013-01-01

    The paternally inherited Y chromosome displays the population genetic history of males. While modern domestic horses (Equus caballus) exhibit abundant diversity within maternally inherited mitochondrial DNA, no significant Y-chromosomal sequence diversity has been detected. We used high throughput sequencing technology to identify the first polymorphic Y-chromosomal markers useful for tracing paternal lines. The nucleotide variability of the modern horse Y chromosome is extremely low, resulting in six haplotypes (HT), all clearly distinct from the Przewalski horse (E. przewalskii). The most widespread HT1 is ancestral and the other five haplotypes apparently arose on the background of HT1 by mutation or gene conversion after domestication. Two haplotypes (HT2 and HT3) are widely distributed at high frequencies among modern European horse breeds. Using pedigree information, we trace the distribution of Y-haplotype diversity to particular founders. The mutation leading to HT3 occurred in the germline of the famous English Thoroughbred stallion “Eclipse” or his son or grandson and its prevalence demonstrates the influence of this popular paternal line on modern sport horse breeds. The pervasive introgression of Thoroughbred stallions during the last 200 years to refine autochthonous breeds has strongly affected the distribution of Y-chromosomal variation in modern horse breeds and has led to the replacement of autochthonous Y chromosomes. Only a few northern European breeds bear unique variants at high frequencies or fixed within but not shared among breeds. Our Y-chromosomal data complement the well established mtDNA lineages and document the male side of the genetic history of modern horse breeds and breeding practices. PMID:23573227

  17. Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism

    PubMed Central

    Hurles, Matthew E.; Veitia, Reiner; Arroyo, Eduardo; Armenteros, Manuel; Bertranpetit, Jaume; Pérez-Lezaun, Anna; Bosch, Elena; Shlumukova, Maria; Cambon-Thomsen, Anne; McElreavey, Ken; López de Munain, Adolfo; Röhl, Arne; Wilson, Ian J.; Singh, Lalji; Pandya, Arpita; Santos, Fabrício R.; Tyler-Smith, Chris; Jobling, Mark A.

    1999-01-01

    Summary We have examined the worldwide distribution of a Y-chromosomal base-substitution polymorphism, the T/C transition at SRY-2627, where the T allele defines haplogroup 22; sequencing of primate homologues shows that the ancestral state cannot be determined unambiguously but is probably the C allele. Of 1,191 human Y chromosomes analyzed, 33 belong to haplogroup 22. Twenty-nine come from Iberia, and the highest frequencies are in Basques (11%; n=117) and Catalans (22%; n=32). Microsatellite and minisatellite (MSY1) diversity analysis shows that non-Iberian haplogroup-22 chromosomes are not significantly different from Iberian ones. The simplest interpretation of these data is that haplogroup 22 arose in Iberia and that non-Iberian cases reflect Iberian emigrants. Several different methods were used to date the origin of the polymorphism: microsatellite data gave ages of 1,650, 2,700, 3,100, or 3,450 years, and MSY1 gave ages of 1,000, 2,300, or 2,650 years, although 95% confidence intervals on all of these figures are wide. The age of the split between Basque and Catalan haplogroup-22 chromosomes was calculated as only 20% of the age of the lineage as a whole. This study thus provides evidence for direct or indirect gene flow over the substantial linguistic barrier between the Indo-European and non–Indo-European–speaking populations of the Catalans and the Basques, during the past few thousand years. PMID:10521311

  18. A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

    PubMed

    Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

    2006-04-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

  19. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  20. Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

    PubMed

    Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

    2017-05-01

    The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

  1. A domesticated transposon mediates the effects of a single-nucleotide polymorphism responsible for enhanced muscle growth.

    PubMed

    Butter, Falk; Kappei, Dennis; Buchholz, Frank; Vermeulen, Michiel; Mann, Matthias

    2010-04-01

    Single-nucleotide polymorphisms (SNPs) in the regulatory regions of the genome can have a profound impact on phenotype. The G3072A polymorphism in intron 3 of insulin-like growth factor 2 (IGF2) is implicated in higher muscle content and reduced fat in European pigs and is bound by a putative repressor. Here, we identify this repressor--which we call muscle growth regulator (MGR)--by using a DNA protein interaction screen based on quantitative mass spectrometry. MGR has a bipartite nuclear localization signal, two BED-type zinc fingers and is highly conserved between placental mammals. Surprisingly, the gene is located in an intron and belongs to the hobo-Ac-Tam3 transposase superfamily, suggesting regulatory use of a formerly parasitic element. In transactivation assays, MGR differentially represses the expression of the two SNP variants. Knockdown of MGR in C2C12 myoblast cells upregulates Igf2 expression and mild overexpression retards growth. Thus, MGR is the repressor responsible for enhanced muscle growth in the IGF2 G3072A polymorphism in commercially bred pigs.

  2. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  3. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  5. Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis

    PubMed Central

    Pucholt, Pascal; Wright, Alison E.; Conze, Lei Liu; Mank, Judith E.; Berlin, Sofia

    2017-01-01

    Abstract Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. PMID:28453634

  6. Single nucleotide polymorphisms of DNA repair genes as predictors of radioresponse.

    PubMed

    Parliament, Matthew B; Murray, David

    2010-10-01

    Radiation therapy is a key modality in the treatment of cancer. Substantial progress has been made in unraveling the molecular events which underpin the responses of malignant and surrounding normal tissues to ionizing radiation. An understanding of the genes involved in processes such as DNA double-strand break repair, DNA damage response, cell-cycle control, apoptosis, cellular antioxidant defenses, and cytokine production, has evolved toward examination of how genetic variants, most often, single nucleotide polymorphisms (SNPs), may influence interindividual radioresponse. Experimental approaches, such as candidate SNP-association studies, genome-wide association studies, and massively parallel sequencing are being proposed to address these questions. We present a focused review of the evidence supporting an association between SNPs in DNA repair genes and radioresponse in normal tissues and tumors. Although preliminary results indicate possible associations, there are methodological weaknesses in many of the studies, and independent validation of SNPs as biomarkers of radioresponse in much larger cohorts will likely require research cooperation through international consortia. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

    PubMed

    Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

    2012-01-01

    PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

  8. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    PubMed Central

    Chao, Shiaoman; Singh, Ravi P.; Sorrells, Mark E.

    2017-01-01

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS) for identifying loci associated with the Ug99 stem rust resistance (SR) in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT). Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP) chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR) assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat. PMID:28241006

  9. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    PubMed

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  10. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  11. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    PubMed

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  12. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    PubMed Central

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay

  13. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    PubMed

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

  14. Two Y-chromosome-specific restriction fragment length polymorphisms (DYS11 and DYZ8) in Italian and Greek migrants to Australia.

    PubMed

    Mitchell, R J; Earl, L; Williams, J W

    1993-06-01

    The part of the Y chromosome not involved in recombination has been found to exhibit an extremely low frequency of DNA restriction fragment length polymorphisms (RFLPs) compared with either the X chromosome or autosomes. Also, the few Y-chromosome-specific RFLPs that have been identified have rarely been examined in more than one population. In this study two Y-chromosome-specific RFLPs at loci DYS11 and DYZ8 are examined in Italian and Greek migrants to Australia. The frequency of the rarer (8.5-kb) TaqI allele at DYS11 was 21% in Italians and even greater (34%) in Greeks. There is an inverse relationship between the frequency of the 8.5-kb allele and latitude on the Italian mainland; the regional variation (based on subject's birthplace in Italy) was significant (p < 0.01). The incidence of the 8.5-kb allele in southern Italy may reflect Greek colonization during pre-Roman times when this region was part of Magna Graecia. The frequency of the variant TaqI allele (7, 4 kb) at the DYZ8 locus is much higher in both Greeks and Italians (31% in each) than in Germans (5%), the only previously examined population. DYZ8 shows considerably less variation than DYS11 across the regional divisions of both Greece and Italy. The present findings, when added to the few other data available, indicate that these two Y-chromosome-specific loci are useful markers for investigating population affinities through the paternal line. Also, heterogeneity at these two loci (and added to that at the DYS1 locus) suggests that Mediterranean populations, compared with other groups, exhibit a high level of diversity of Y-chromosome-specific RFLPs.

  15. Investigation into the sequence structure of 23 Y chromosomal STR loci using massively parallel sequencing.

    PubMed

    Kwon, So Yeun; Lee, Hwan Young; Kim, Eun Hye; Lee, Eun Young; Shin, Kyoung-Jin

    2016-11-01

    Next-generation sequencing (NGS) can produce massively parallel sequencing (MPS) data for many targeted regions with a high depth of coverage, suggesting its successful application to the amplicons of forensic genetic markers. In the present study, we evaluated the practical utility of MPS in Y-chromosome short tandem repeat (Y-STR) analysis using a multiplex polymerase chain reaction (PCR) system. The multiplex PCR system simultaneously amplified 24 Y-chromosomal markers, including the PowerPlex ® Y23 loci (DYS19, DYS385ab, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS481, DYS533, DYS549, DYS570, DYS576, DYS635, DYS643, and YGATAH4) and the M175 marker with the small-sized amplicons ranging from 85 to 253bp. The barcoded libraries for the amplicons of the 24 Y-chromosomal markers were produced using a simplified PCR-based library preparation method and successfully sequenced using MPS on a MiSeq ® System with samples from 250 unrelated Korean males. The genotyping concordance between MPS and the capillary electrophoresis (CE) method, as well as the sequence structure of the 23 Y-STRs, were investigated. Three samples exhibited discordance between the MPS and CE results at DYS385, DYS439, and DYS576. There were 12 Y-STR loci that showed sequence variations in the alleles by a fragment size determination, and the most varied alleles occurred in DYS389II with a different sequence structure in the repeat region. The largest increase in gene diversity between the CE and MPS results was in DYS437 at +34.41%. Single nucleotide polymorphisms (SNPs), insertions, and deletions (indels) were observed in the flanking regions of DYS481, DYS576, and DYS385, respectively. Stutter and noise ratios of the 23 Y-STRs using the developed MPS system were also investigated. Based on these results, the MPS analysis system used in this study could facilitate the investigation into the sequences of the 23 Y-STRs in forensic

  16. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Association of MTHFR polymorphisms and chromosomal abnormalities in leukemia.

    PubMed

    Sinthuwiwat, Thivaratana; Poowasanpetch, Phanasit; Wongngamrungroj, Angsana; Soonklang, Kamonwan; Promso, Somying; Auewarakul, Chirayu; Tocharoentanaphol, Chintana

    2012-01-01

    Genetic variation in MTHFR gene might explain the interindividual differences in the reduction of DNA repaired and the increase of chromosome breakage and damage. Nowadays, chromosomal rearrangement is recognized as a major cause of lymphoid malignancies. In addition, the association of MTHFR polymorphisms with aneuploidy was found in several studies, making the MTHFR gene as a good candidate for leukemia etiology. Therefore, in this study, we investigated the common sequence variation, 677C>T and 1298A>C in the MTHFR gene of 350 fixed cell specimens archived after chromosome analysis. The distribution of the MTHFR polymorphisms frequency was compared in leukemic patients with structural chromosome abnormality and chromosome aneuploidy, as well as in those with no evidence of chromosome abnormalities. We observed a significant decrease in the distribution of T allele in 677C>T polymorphisms among patients with chromosomal abnormalities including both structural aberration and aneuploidy. The same significance result also found in patients with structural aberration when compare with the normal karyotype patients. Suggesting that polymorphism in the MTHFR gene was involved in chromosome abnormalities of leukemia. However, further investigation on the correlation with the specific types of chromosomal aberrations is needed.

  18. Y-chromosome evolution: emerging insights into processes of Y-chromosome degeneration.

    PubMed

    Bachtrog, Doris

    2013-02-01

    The human Y chromosome is intriguing not only because it harbours the master-switch gene that determines gender but also because of its unusual evolutionary history. The Y chromosome evolved from an autosome, and its evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species and in plants have shed light on the current gene content of the Y chromosome, its origins and its long-term fate. Furthermore, comparative analysis of young and old Y chromosomes has given further insights into the evolutionary and molecular forces triggering Y-chromosome degeneration and into the evolutionary destiny of the Y chromosome.

  19. The Guppy Sex Chromosome System and the Sexually Antagonistic Polymorphism Hypothesis for Y Chromosome Recombination Suppression

    PubMed Central

    Charlesworth, Deborah

    2018-01-01

    Sex chromosomes regularly evolve suppressed recombination, distinguishing them from other chromosomes, and the reason for this has been debated for many years. It is now clear that non-recombining sex-linked regions have arisen in different ways in different organisms. A major hypothesis is that a sex-determining gene arises on a chromosome and that sexually antagonistic (SA) selection (sometimes called intra-locus sexual conflict) acting at a linked gene has led to the evolution of recombination suppression in the region, to reduce the frequency of low fitness recombinant genotypes produced. The sex chromosome system of the guppy (Poecilia reticulata) is often cited as supporting this hypothesis because SA selection has been demonstrated to act on male coloration in natural populations of this fish, and probably contributes to maintaining polymorphisms for the genetic factors involved. I review classical genetic and new molecular genetic results from the guppy, and other fish, including approaches for identifying the genome regions carrying sex-determining loci, and suggest that the guppy may exemplify a recently proposed route to sex chromosome evolution. PMID:29783761

  20. Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

    2012-04-01

    A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

  1. Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. II. Cloning of resistance gene analogs from single chromosomes.

    PubMed

    Huang, D; Wu, W; Lu, L

    2004-05-01

    Amplification of resistance gene analogs (RGAs) is both a useful method for acquiring DNA markers closely linked to disease resistance (R) genes and a potential approach for the rapid cloning of R genes in plants. However, the screening of target sequences from among the numerous amplified RGAs can be very laborious. The amplification of RGAs from specific chromosomes could greatly reduce the number of RGAs to be screened and, consequently, speed up the identification of target RGAs. We have developed two methods for amplifying RGAs from single chromosomes. Method 1 uses products of Sau3A linker adaptor-mediated PCR (LAM-PCR) from a single chromosome as the templates for RGA amplification, while Method 2 directly uses a single chromosomal DNA molecule as the template. Using a pair of degenerate primers designed on the basis of the conserved nucleotide-binding-site motifs in many R genes, RGAs were successfully amplified from single chromosomes of pomelo using both these methods. Sequencing and cluster analysis of RGA clones obtained from single chromosomes revealed the number, type and organization of R-gene clusters on the chromosomes. We suggest that Method 1 is suitable for analyzing chromosomes that are unidentifiable under a microscope, while Method 2 is more appropriate when chromosomes can be clearly identified.

  2. Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

    PubMed

    Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

    2013-03-28

    Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

  3. Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

    PubMed

    Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

    2001-11-14

    The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

  4. Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease

    PubMed Central

    Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.

    2013-01-01

    Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889

  5. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    PubMed

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  6. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  7. Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

    PubMed Central

    2012-01-01

    Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron

  8. Recent Sex Chromosome Divergence despite Ancient Dioecy in the Willow Salix viminalis.

    PubMed

    Pucholt, Pascal; Wright, Alison E; Conze, Lei Liu; Mank, Judith E; Berlin, Sofia

    2017-08-01

    Sex chromosomes can evolve when recombination is halted between a pair of chromosomes, and this can lead to degeneration of the sex-limited chromosome. In the early stages of differentiation sex chromosomes are homomorphic, and even though homomorphic sex chromosomes are very common throughout animals and plants, we know little about the evolutionary forces shaping these types of sex chromosomes. We used DNA- and RNA-Seq data from females and males to explore the sex chromosomes in the female heterogametic willow, Salix viminalis, a species with ancient dioecy but with homomorphic sex chromosomes. We detected no major sex differences in read coverage in the sex determination (SD) region, indicating that the W region has not significantly degenerated. However, single nucleotide polymorphism densities in the SD region are higher in females compared with males, indicating very recent recombination suppression, followed by the accumulation of sex-specific single nucleotide polymorphisms. Interestingly, we identified two female-specific scaffolds that likely represent W-chromosome-specific sequence. We show that genes located in the SD region display a mild excess of male-biased expression in sex-specific tissue, and we use allele-specific gene expression analysis to show that this is the result of masculinization of expression on the Z chromosome rather than degeneration of female-expression on the W chromosome. Together, our results demonstrate that insertion of small DNA fragments and accumulation of sex-biased gene expression can occur before the detectable decay of the sex-limited chromosome. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    PubMed

    Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

    2015-03-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  10. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

    PubMed Central

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

    2015-01-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  11. Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

    PubMed

    Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

    2017-05-01

    Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

  12. The Y-Chromosome Tree Bursts into Leaf: 13,000 High-Confidence SNPs Covering the Majority of Known Clades

    PubMed Central

    Hallast, Pille; Batini, Chiara; Zadik, Daniel; Maisano Delser, Pierpaolo; Wetton, Jon H.; Arroyo-Pardo, Eduardo; Cavalleri, Gianpiero L.; de Knijff, Peter; Destro Bisol, Giovanni; Dupuy, Berit Myhre; Eriksen, Heidi A.; Jorde, Lynn B.; King, Turi E.; Larmuseau, Maarten H.; López de Munain, Adolfo; López-Parra, Ana M.; Loutradis, Aphrodite; Milasin, Jelena; Novelletto, Andrea; Pamjav, Horolma; Sajantila, Antti; Schempp, Werner; Sears, Matt; Tolun, Aslıhan; Tyler-Smith, Chris; Van Geystelen, Anneleen; Watkins, Scott; Winney, Bruce; Jobling, Mark A.

    2015-01-01

    Many studies of human populations have used the male-specific region of the Y chromosome (MSY) as a marker, but MSY sequence variants have traditionally been subject to ascertainment bias. Also, dating of haplogroups has relied on Y-specific short tandem repeats (STRs), involving problems of mutation rate choice, and possible long-term mutation saturation. Next-generation sequencing can ascertain single nucleotide polymorphisms (SNPs) in an unbiased way, leading to phylogenies in which branch-lengths are proportional to time, and allowing the times-to-most-recent-common-ancestor (TMRCAs) of nodes to be estimated directly. Here we describe the sequencing of 3.7 Mb of MSY in each of 448 human males at a mean coverage of 51×, yielding 13,261 high-confidence SNPs, 65.9% of which are previously unreported. The resulting phylogeny covers the majority of the known clades, provides date estimates of nodes, and constitutes a robust evolutionary framework for analyzing the history of other classes of mutation. Different clades within the tree show subtle but significant differences in branch lengths to the root. We also apply a set of 23 Y-STRs to the same samples, allowing SNP- and STR-based diversity and TMRCA estimates to be systematically compared. Ongoing purifying selection is suggested by our analysis of the phylogenetic distribution of nonsynonymous variants in 15 MSY single-copy genes. PMID:25468874

  13. Single-feature polymorphism discovery in the barley transcriptome

    PubMed Central

    Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

    2005-01-01

    A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

  14. A pseudoautosomal random amplified polymorphic DNA marker for the sex chromosomes of Silene dioica.

    PubMed Central

    Di Stilio, V S; Kesseli, R V; Mulcahy, D L

    1998-01-01

    The segregation pattern of an 810-bp random amplified polymorphic DNA (RAPD) band in the F1 and backcross generations of a Silene dioica (L.) Clairv. family provides evidence that this molecular marker is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The marker was found through a combination of bulked segregant analysis (BSA) and RAPD techniques. Recombination rates between this pseudoautosomal marker and the differentiating portion of the Y chromosome are 15% in both generations. Alternative explanations involving nondisjunction or autosomal inheritance are presented and discussed. Chromosome counts provide evidence against the nondisjunction hypothesis, and probability calculations argue against the possibility of autosomal inheritance. This constitutes the first report of a pseudoautosomal DNA marker for plant sex chromosomes. PMID:9691057

  15. A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

    PubMed Central

    Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

    2006-01-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

  16. High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets.

    PubMed

    Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W

    2014-09-01

    A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

  17. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  18. Cigarettes, genetic background, and menopausal timing: the presence of single nucleotide polymorphisms in cytochrome P450 genes is associated with increased risk of natural menopause in European-American smokers.

    PubMed

    Butts, Samantha F; Sammel, Mary D; Greer, Christine; Rebbeck, Timothy R; Boorman, David W; Freeman, Ellen W

    2014-07-01

    This study aims to evaluate associations between variations in genes involved in the metabolism of environmental chemicals and steroid hormones and risk of menopause in smokers. Survival analysis was performed on 410 eligible participants from the Penn Ovarian Aging study (ongoing for 14 years), a cohort study of late-reproductive-age women. Single nucleotide polymorphisms at the following loci were studied: COMT Val158Met, CYP1B1*4 Asn452Ser, CYP1B1*3 Leu432Val, and CYP3A4*1B. Significant interactions between smoking and single nucleotide polymorphisms were observed in European-American carriers of CYP3A4*1B and CYP1B1*3, supporting a greater risk of menopause entry compared with those not carrying these alleles. Among CYP1B1*3 carriers, smokers had a greater risk of menopause entry than nonsmokers (adjusted hazard ratio [HR], 2.26; 95% CI, 1.4-3.67; median time to menopause, 10.42 and 11.07 y, respectively). No association between smoking and menopause was identified in CYP1B1 wild types. Among CYP3A4*1B carriers, smokers were at greater risk for menopause entry than nonsmokers (adjusted HR, 15.1; 95% CI, 3.31-69.2; median time to menopause, 11.36 and 13.91 y, respectively). Risk of menopause entry in CYP3A4 wild types who smoked was far lower (adjusted HR, 1.59; 95% CI, 1.03-2.44). Heavily smoking CYP1B1*3 carriers (adjusted HR, 3.0; 95% CI, 1.54-5.84; median time to menopause, 10.41 y) and heavily smoking CYP3A4*1B carriers (adjusted HR, 17.79; 95% CI, 3.21-98.65; median time to menopause, 5.09 y) had the greatest risk of menopause entry. Our finding that the risk of menopause entry in European-American smokers varies depending on genetic background represents a novel gene-environment interaction in reproductive aging.

  19. [Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

    PubMed

    Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

    2012-06-01

    To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

  20. Estimation of linkage disequilibrium and interspecific gene flow in Ficedula flycatchers by a newly developed 50k single-nucleotide polymorphism array

    PubMed Central

    Kawakami, Takeshi; Backström, Niclas; Burri, Reto; Husby, Arild; Olason, Pall; Rice, Amber M; Ålund, Murielle; Qvarnström, Anna; Ellegren, Hans

    2014-01-01

    With the access to draft genome sequence assemblies and whole-genome resequencing data from population samples, molecular ecology studies will be able to take truly genome-wide approaches. This now applies to an avian model system in ecological and evolutionary research: Old World flycatchers of the genus Ficedula, for which we recently obtained a 1.1 Gb collared flycatcher genome assembly and identified 13 million single-nucleotide polymorphism (SNP)s in population resequencing of this species and its sister species, pied flycatcher. Here, we developed a custom 50K Illumina iSelect flycatcher SNP array with markers covering 30 autosomes and the Z chromosome. Using a number of selection criteria for inclusion in the array, both genotyping success rate and polymorphism information content (mean marker heterozygosity = 0.41) were high. We used the array to assess linkage disequilibrium (LD) and hybridization in flycatchers. Linkage disequilibrium declined quickly to the background level at an average distance of 17 kb, but the extent of LD varied markedly within the genome and was more than 10-fold higher in ‘genomic islands’ of differentiation than in the rest of the genome. Genetic ancestry analysis identified 33 F1 hybrids but no later-generation hybrids from sympatric populations of collared flycatchers and pied flycatchers, contradicting earlier reports of backcrosses identified from much fewer number of markers. With an estimated divergence time as recently as <1 Ma, this suggests strong selection against F1 hybrids and unusually rapid evolution of reproductive incompatibility in an avian system. PMID:24784959

  1. SiNoPsis: Single Nucleotide Polymorphisms selection and promoter profiling.

    PubMed

    Boloc, Daniel; Rodríguez, Natalia; Gassó, Patricia; Abril, Josep F; Bernardo, Miquel; Lafuente, Amalia; Mas, Sergi

    2017-09-14

    The selection of a Single Nucleotide Polymorphism (SNP) using bibliographic methods can be a very time-consuming task. Moreover, a SNP selected in this way may not be easily visualized in its genomic context by a standard user hoping to correlate it with other valuable information. Here we propose a web form built on top of Circos that can assist SNP-centred screening, based on their location in the genome and the regulatory modules they can disrupt. Its use may allow researchers to prioritize SNPs in genotyping and disease studies. SiNoPsis is bundled as a web portal. It focuses on the different structures involved in the genomic expression of a gene, especially those found in the core promoter upstream region. These structures include transcription factor binding sites (for promoter and enhancer signals), histones, and promoter flanking regions. Additionally, the tool provides eQTL and linkage disequilibrium (LD) properties for a given SNP query, yielding further clues about other indirectly associated SNPs. Possible disruptions of the aforementioned structures affecting gene transcription are reported using multiple resource databases. SiNoPsis has a simple user-friendly interface, which allows single queries by gene symbol, genomic coordinates, Ensembl gene identifiers, RefSeq transcript identifiers and SNPs. It is the only portal providing useful SNP selection based on regulatory modules and LD with functional variants in both textual and graphic modes (by properly defining the arguments and parameters needed to run Circos). SiNoPsis is freely available at https://compgen.bio.ub.edu/SiNoPsis /. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  2. Genetics and the history of the Samaritans: Y-chromosomal microsatellites and genetic affinity between Samaritans and Cohanim.

    PubMed

    Oefner, Peter J; Hölzi, Georg; Shen, Piedong; Shpirer, Isaac; Gefel, Dov; Lavi, Tal; Woolf, Eilon; Cohen, Jonathan; Cinnioglu, Cengiz; Underhill, Peter A; Rosenberg, Noah A; Hochrein, Jochen; Granka, Julie M; Hillel, Jossi; Feldman, Marcus W

    2013-12-01

    The Samaritans are a group of some 750 indigenous Middle Eastern people, about half of whom live in Holon, a suburb of Tel Aviv, and the other half near Nablus. The Samaritan population is believed to have numbered more than a million in late Roman times but less than 150 in 1917. The ancestry of the Samaritans has been subject to controversy from late Biblical times to the present. In this study, liquid chromatography/electrospray ionization/quadrupole ion trap mass spectrometry was used to allelotype 13 Y-chromosomal and 15 autosomal microsatellites in a sample of 12 Samaritans chosen to have as low a level of relationship as possible, and 461 Jews and non-Jews. Estimation of genetic distances between the Samaritans and seven Jewish and three non-Jewish populations from Israel, as well as populations from Africa, Pakistan, Turkey, and Europe, revealed that the Samaritans were closely related to Cohanim. This result supports the position of the Samaritans that they are descendants from the tribes of Israel dating to before the Assyrian exile in 722-720 BCE. In concordance with previously published single-nucleotide polymorphism haplotypes, each Samaritan family, with the exception of the Samaritan Cohen lineage, was observed to carry a distinctive Y-chromosome short tandem repeat haplotype that was not more than one mutation removed from the six-marker Cohen modal haplotype. Copyright © 2014 Wayne State University Press, Detroit, Michigan 48201-1309.

  3. Prenatal Diagnosis of DNA Copy Number Variations by Genomic Single-Nucleotide Polymorphism Array in Fetuses with Congenital Heart Defects.

    PubMed

    Tang, Shaohua; Lv, Jiaojiao; Chen, Xiangnan; Bai, Lili; Li, Huanzheng; Chen, Chong; Wang, Ping; Xu, Xueqin; Lu, Jianxin

    2016-01-01

    To evaluate the usefulness of single-nucleotide polymorphism (SNP) array for prenatal genetic diagnosis of congenital heart defect (CHD), we used this approach to detect clinically significant copy number variants (CNVs) in fetuses with CHDs. A HumanCytoSNP-12 array was used to detect genomic samples obtained from 39 fetuses that exhibited cardiovascular abnormalities on ultrasound and had a normal karyotype. The relationship between CNVs and CHDs was identified by using genotype-phenotype comparisons and searching of chromosomal databases. All clinically significant CNVs were confirmed by real-time PCR. CNVs were detected in 38/39 (97.4%) fetuses: variants of unknown significance were detected in 2/39 (5.1%), and clinically significant CNVs were identified in 7/39 (17.9%). In 3 of the 7 fetuses with clinically significant CNVs, 3 rare and previously undescribed CNVs were detected, and these CNVs encompassed the CHD candidate genes FLNA (Xq28 dup), BCOR (Xp11.4 dup), and RBL2 (16q12.2 del). Compared with conventional cytogenetic genomics, SNP array analysis provides significantly improved detection of submicroscopic genomic aberrations in pregnancies with CHDs. Based on these results, we propose that genomic SNP array is an effective method which could be used in the prenatal diagnostic test to assist genetic counseling for pregnancies with CHDs. © 2015 S. Karger AG, Basel.

  4. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  5. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    PubMed

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  6. Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

    PubMed

    Gehring, I; Geider, K

    2012-07-01

    Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

  7. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    PubMed

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

  8. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  9. Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr) in human poliovirus receptor gene.

    PubMed

    Nandi, Shyam Sundar; Sharma, Deepa Kailash; Deshpande, Jagadish M

    2016-07-01

    It is important to understand the role of cell surface receptors in susceptibility to infectious diseases. CD155 a member of the immunoglobulin super family, serves as the poliovirus receptor (PVR). Heterozygous (Ala67Thr) polymorphism in CD155 has been suggested as a risk factor for paralytic outcome of poliovirus infection. The present study pertains to the development of a screening test to detect the single nucleotide (SNP) polymorphism in the CD155 gene. New primers were designed for PCR, sequencing and SNP analysis of Exon2 of CD155 gene. DNAs extracted from either whole blood (n=75) or cells from oral cavity (n=75) were used for standardization and validation of the SNP assay. DNA sequencing was used as the gold standard method. A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150) of DNA samples tested by both SNP detection assay and sequencing. The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

  10. Gene-chromosome locations of neuropsychiatric diseases.

    PubMed

    Shapshak, Paul; Somboonwit, Charurut; Sinnott, John; Commins, Deborah; Singer, Elyse; Levine, Andrew

    2011-01-01

    A number of genes are involved in various neuropsychiatric disorders. A comprehensive compilation of these genes is important for a better understanding of these diseases. We report an online file that lists genes by chromosome number and location. This is useful for the rapid examination of chromosome bands for genes involved in these diseases. This is not an exhaustive list and does not include single nucleotide polymorphism (SNP) results for genes that are currently being examined by genome wide association studies (GWAS) and other molecular methodologies. The database is available for free at http://www.bioinformation.net/007/paul.xls.

  11. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    PubMed

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Single Nucleotide Polymorphism (SNP)-Strings: An Alternative Method for Assessing Genetic Associations

    PubMed Central

    Goodin, Douglas S.; Khankhanian, Pouya

    2014-01-01

    Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that

  13. The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

    PubMed

    Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

    2018-03-01

    Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

  14. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    PubMed

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  15. Characterization of frequencies and distribution of single nucleotide insertions/deletions in the human genome.

    PubMed

    Tan, Ene-Choo; Li, Haixia

    2006-07-19

    Most of the studies on single nucleotide variations are on substitutions rather than insertions/deletions. In this study, we examined the distribution and characteristics of single nucleotide insertions/deletions (SNindels), using data available from dbSNP for all the human chromosomes. There are almost 300,000 SNindels in the database, of which only 0.8% are validated. They occur at the frequency of 0.887 per 10 kb on average for the whole genome, or approximately 1 for every 11,274 bp. More than half occur in regions with mononucleotide repeats the longest of which is 47 bases. Overall the mononucleotide repeats involving C and G are much shorter than those for A and T. About 12% are surrounded by palindromes. There is general correlation between chromosome size and total number for each chromosome. Inter-chromosomal variation in density ranges from 0.6 to 21.7 per kilobase. The overall spectrum shows very high proportion of SNindel of types -/A and -/T at over 81%. The proportion of -/A and -/T SNindels for each chromosome is correlated to its AT content. Less than half of the SNindels are within or near known genes and even fewer (<0.183%) in coding regions, and more than 1.4% of -/C and -/G are in coding compared to 0.2% for -/A and -/T types. SNindels of -/A and -/T types make up 80% of those found within untranslated regions but less than 40% of those within coding regions. A separate analysis using the subset of 2324 validated SNindels showed slightly less AT bias of 74%, SNindels not within mononucleotide repeats showed even less AT bias at 58%. Density of validated SNindels is 0.007/10 kb overall and 90% are found within or near genes. Among all chromosomes, Y has the lowest numbers and densities for all SNindels, validated SNindels, and SNindels not within repeats.

  16. Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

    PubMed

    Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

    2010-05-01

    Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

  17. Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

    PubMed

    Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

    2009-06-15

    DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

  18. Testing the hypothesis of an ancient Roman soldier origin of the Liqian people in northwest China: a Y-chromosome perspective.

    PubMed

    Zhou, Ruixia; An, Lizhe; Wang, Xunling; Shao, Wei; Lin, Gonghua; Yu, Weiping; Yi, Lin; Xu, Shijian; Xu, Jiujin; Xie, Xiaodong

    2007-01-01

    The Liqian people in north China are well known because of the controversial hypothesis of an ancient Roman mercenary origin. To test this hypothesis, 227 male individuals representing four Chinese populations were analyzed at 12 short tandem repeat (STR) loci and 12 single nucleotide polymorphisms (SNP). At the haplogroup levels, 77% Liqian Y chromosomes were restricted to East Asia. Principal component (PC) and multidimensional scaling (MDS) analysis suggests that the Liqians are closely related to Chinese populations, especially Han Chinese populations, whereas they greatly deviate from Central Asian and Western Eurasian populations. Further phylogenetic and admixture analysis confirmed that the Han Chinese contributed greatly to the Liqian gene pool. The Liqian and the Yugur people, regarded as kindred populations with common origins, present an underlying genetic difference in a median-joining network. Overall, a Roman mercenary origin could not be accepted as true according to paternal genetic variation, and the current Liqian population is more likely to be a subgroup of the Chinese majority Han.

  19. [Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

    PubMed

    Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

    2008-08-01

    To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

  20. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  1. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (Ppolymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.

  2. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  3. Y chromosome evolution: emerging insights into processes of Y chromosome degeneration

    PubMed Central

    Bachtrog, Doris

    2014-01-01

    The human Y chromosome is intriguing not only because it harbours the master-switch gene determining gender but also because of its unusual evolutionary trajectory. Previously an autosome, Y chromosome evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species as well as in plants have shed light on the current gene content of the Y, its origins and its long-term fate. Comparative analysis of young and old Y chromosomes have given further insights into the evolutionary and molecular forces triggering Y degeneration and its evolutionary destiny. PMID:23329112

  4. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  5. Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

    PubMed

    Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

    2003-09-30

    Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

  6. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    PubMed Central

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  7. SNPHunter: a bioinformatic software for single nucleotide polymorphism data acquisition and management.

    PubMed

    Wang, Lin; Liu, Simin; Niu, Tianhua; Xu, Xin

    2005-03-18

    Single nucleotide polymorphisms (SNPs) provide an important tool in pinpointing susceptibility genes for complex diseases and in unveiling human molecular evolution. Selection and retrieval of an optimal SNP set from publicly available databases have emerged as the foremost bottlenecks in designing large-scale linkage disequilibrium studies, particularly in case-control settings. We describe the architectural structure and implementations of a novel software program, SNPHunter, which allows for both ad hoc-mode and batch-mode SNP search, automatic SNP filtering, and retrieval of SNP data, including physical position, function class, flanking sequences at user-defined lengths, and heterozygosity from NCBI dbSNP. The SNP data extracted from dbSNP via SNPHunter can be exported and saved in plain text format for further down-stream analyses. As an illustration, we applied SNPHunter for selecting SNPs for 10 major candidate genes for type 2 diabetes, including CAPN10, FABP4, IL6, NOS3, PPARG, TNF, UCP2, CRP, ESR1, and AR. SNPHunter constitutes an efficient and user-friendly tool for SNP screening, selection, and acquisition. The executable and user's manual are available at http://www.hsph.harvard.edu/ppg/software.htm

  8. Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

    PubMed

    Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

    2015-03-15

    A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p polymorphism in SERPINA9 was associated with incident stroke in Whites and Blacks, even after taking into account traditional risk factors. The idea that ischemic stroke and CHD may share some common genetic factors, such as variation in SERPINA9, should be investigated in other studies. Copyright 2008 S. Karger AG, Basel.

  10. A novel approach to exploring potential interactions among single-nucleotide polymorphisms of inflammation genes in gliomagenesis: an exploratory case-only study.

    PubMed

    Amirian, E Susan; Scheurer, Michael E; Liu, Yanhong; D'Amelio, Anthony M; Houlston, Richard S; Etzel, Carol J; Shete, Sanjay; Swerdlow, Anthony J; Schoemaker, Minouk J; McKinney, Patricia A; Fleming, Sarah J; Muir, Kenneth R; Lophatananon, Artitaya; Bondy, Melissa L

    2011-08-01

    Despite extensive research on the topic, glioma etiology remains largely unknown. Exploration of potential interactions between single-nucleotide polymorphisms (SNP) of immune genes is a promising new area of glioma research. The case-only study design is a powerful and efficient design for exploring possible multiplicative interactions between factors that are independent of one another. The purpose of our study was to use this exploratory design to identify potential pair wise SNP-SNP interactions from genes involved in several different immune-related pathways for investigation in future studies. The study population consisted of two case groups: 1,224 histologic confirmed, non-Hispanic white glioma cases from the United States and a validation population of 634 glioma cases from the United Kingdom. Polytomous logistic regression, in which one SNP was coded as the outcome and the other SNP was included as the exposure, was utilized to calculate the ORs of the likelihood of cases simultaneously having the variant alleles of two different SNPs. Potential interactions were examined only between SNPs located in different genes or chromosomes. Using this data mining strategy, we found 396 significant SNP-SNP interactions among polymorphisms of immune-related genes that were present in both the U.S. and U.K. study populations. This exploratory study was conducted for the purpose of hypothesis generation, and thus has provided several new hypotheses that can be tested using traditional case-control study designs to obtain estimates of risk. This is the first study, to our knowledge, to take this novel approach to identifying SNP-SNP interactions relevant to glioma etiology. ©2011 AACR.

  11. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    NASA Astrophysics Data System (ADS)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  12. Single nucleotide polymorphisms in Plasmodium falciparum V type H(+) pyrophosphatase gene (pfvp2) and their associations with pfcrt and pfmdr1 polymorphisms.

    PubMed

    Jovel, Irina Tatiana; Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Malmberg, Maja; Mårtensson, Andreas; Kaneko, Akira; Zakeri, Sedigheh; Murillo, Claribel; Nosten, Francois; Björkman, Anders; Ursing, Johan

    2014-06-01

    Chloroquine resistance in Plasmodium falciparum malaria has been associated with pfcrt 76T (chloroquine resistance transporter gene) and pfmdr1 86Y (multidrug resistance gene 1) alleles. Pfcrt 76T enables transport of protonated chloroquine out of the parasites digestive vacuole resulting in a loss of hydrogen ions (H(+)). V type H(+) pyrophosphatase (PfVP2) is thought to pump H(+) into the digestive vacuole. This study aimed to describe the geographic distribution of single nucleotide polymorphisms in pfvp2 and their possible associations with pfcrt and pfmdr1 polymorphisms. Blood samples from 384 patients collected (1981-2009) in Honduras (n=35), Colombia (n=50), Liberia (n=50), Guinea Bissau (n=50), Tanzania (n=50), Iran (n=50), Thailand (n=49) and Vanuatu (n=50) were analysed. The pfcrt 72-76 haplotype, pfmdr1 copy numbers, pfmdr1 N86Y and pfvp2 V405I, K582R and P711S alleles were identified using PCR based methods. Pfvp2 was amplified in 344 samples. The pfvp2 allele proportions were V405 (97%), 405I (3%), K582 (99%), 582R (1%), P711 (97%) and 711S (3%). The number of patients with any of pfvp2 405I, 582R and/or 711S were as follows: Honduras (2/30), Colombia (0/46), Liberia (7/48), Guinea-Bissau (4/50), Tanzania (3/48), Iran (3/50), Thailand (1/49) and Vanuatu (0/31). The alleles were most common in Liberia (P=0.01) and Liberia+Guinea-Bissau (P=0.01). The VKP haplotype was found in 189/194 (97%) and 131/145 (90%) samples harbouring pfcrt 76T and pfcrt K76 respectively (P=0.007). The VKP haplotype was dominant. Most pfvp2 405I, 582R and 711S SNPs were seen where CQ resistance was not highly prevalent at the time of blood sampling possibly due to greater genetic variation prior to the bottle neck event of spreading CQ resistance. The association between the pfvp2 VKP haplotype and pfcrt 76T, which may indicate that pfvp2 is involved in CQ resistance, should therefore be interpreted with caution. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    PubMed

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    PubMed

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

  15. Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

    PubMed

    Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

    2018-01-01

    Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In

  16. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

    PubMed

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

    2017-07-01

    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  18. Rapid single nucleotide polymorphism detection for personalized medicine applications using planar waveguide fluorescence sensors

    NASA Astrophysics Data System (ADS)

    Herron, James N.; Tolley, Samuel E.; Smith, Richard; Christensen, Douglas A.

    2006-02-01

    Personalized medicine is an emerging field in which clinical diagnostics information about a patient's genotype or phenotype is used to optimize his/her pharmacotherapy. This article evaluates whether planar waveguide fluorescent sensors are suitable for determining such information from patient testing in point-of-care (POC) settings. The model system was Long QT Syndrome, a congenital disease associated with single nucleotide polymorphisms (SNPs) in genes encoding for cardiac ion channels. Three different SNP assay formats were examined: DNA/DNA hybridization, DNA/PNA hybridization (PNA: "peptide nucleic acid"), and single base extension (SBEX). Although DNA/DNA hybridization produced a strong intensity-time response for both wildtype and SNP analytes in a 5-min assay at 32°C, their hybridization rates differed by only 32.7%, which was insufficient for clinical decision-making. Much better differentiation of the two rates was observed at 53°C, where the wildtype's hybridization rate was two-thirds of its maximum value, while that of the SNP was essentially zero. Such all-or-nothing resolution would be adequate for clinical decision-making; however, the elevated temperature and precise temperature control would be hard to achieve in a POC setting. Results from DNA/PNA hybridization studies were more promising. Nearly 20-fold discrimination between wildtype and SNP hybridization rates was observed in a 5-min assay at 30°C, although the low ionic strength conditions required necessitated a de-salting step between sample preparation and SNP detection. SBEX was the most promising of the three, determining the absolute identity of the suspected polymorphism in a 5-min assay at 40°C.

  19. A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

    PubMed

    Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

    2017-01-01

    A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

  20. Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

    PubMed

    Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

    2014-06-01

    Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0

  1. Y-chromosome lineages in Cabo Verde Islands witness the diverse geographic origin of its first male settlers.

    PubMed

    Gonçalves, Rita; Rosa, Alexandra; Freitas, Ana; Fernandes, Ana; Kivisild, Toomas; Villems, Richard; Brehm, António

    2003-11-01

    The Y-chromosome haplogroup composition of the population of the Cabo Verde Archipelago was profiled by using 32 single-nucleotide polymorphism markers and compared with potential source populations from Iberia, west Africa, and the Middle East. According to the traditional view, the major proportion of the founding population of Cabo Verde was of west African ancestry with the addition of a minor fraction of male colonizers from Europe. Unexpectedly, more than half of the paternal lineages (53.5%) of Cabo Verdeans clustered in haplogroups I, J, K, and R1, which are characteristic of populations of Europe and the Middle East, while being absent in the probable west African source population of Guiné-Bissau. Moreover, a high frequency of J* lineages in Cabo Verdeans relates them more closely to populations of the Middle East and probably provides the first genetic evidence of the legacy of the Jews. In addition, the considerable proportion (20.5%) of E3b(xM81) lineages indicates a possible gene flow from the Middle East or northeast Africa, which, at least partly, could be ascribed to the Sephardic Jews. In contrast to the predominance of west African mitochondrial DNA haplotypes in their maternal gene pool, the major west African Y-chromosome lineage E3a was observed only at a frequency of 15.9%. Overall, these results indicate that gene flow from multiple sources and various sex-specific patterns have been important in the formation of the genomic diversity in the Cabo Verde islands.

  2. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

  3. Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

    PubMed

    Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

    2017-03-01

    The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

  4. Effective detection of human leukocyte antigen risk alleles in celiac disease using tag single nucleotide polymorphisms.

    PubMed

    Monsuur, Alienke J; de Bakker, Paul I W; Zhernakova, Alexandra; Pinto, Dalila; Verduijn, Willem; Romanos, Jihane; Auricchio, Renata; Lopez, Ana; van Heel, David A; Crusius, J Bart A; Wijmenga, Cisca

    2008-05-28

    The HLA genes, located in the MHC region on chromosome 6p21.3, play an important role in many autoimmune disorders, such as celiac disease (CD), type 1 diabetes (T1D), rheumatoid arthritis, multiple sclerosis, psoriasis and others. Known HLA variants that confer risk to CD, for example, include DQA1*05/DQB1*02 (DQ2.5) and DQA1*03/DQB1*0302 (DQ8). To diagnose the majority of CD patients and to study disease susceptibility and progression, typing these strongly associated HLA risk factors is of utmost importance. However, current genotyping methods for HLA risk factors involve many reactions, and are complicated and expensive. We sought a simple experimental approach using tagging SNPs that predict the CD-associated HLA risk factors. Our tagging approach exploits linkage disequilibrium between single nucleotide polymorphism (SNPs) and the CD-associated HLA risk factors DQ2.5 and DQ8 that indicate direct risk, and DQA1*0201/DQB1*0202 (DQ2.2) and DQA1*0505/DQB1*0301 (DQ7) that attribute to the risk of DQ2.5 to CD. To evaluate the predictive power of this approach, we performed an empirical comparison of the predicted DQ types, based on these six tag SNPs, with those executed with current validated laboratory typing methods of the HLA-DQA1 and -DQB1 genes in three large cohorts. The results were validated in three European celiac populations. Using this method, only six SNPs were needed to predict the risk types carried by >95% of CD patients. We determined that for this tagging approach the sensitivity was >0.991, specificity >0.996 and the predictive value >0.948. Our results show that this tag SNP method is very accurate and provides an excellent basis for population screening for CD. This method is broadly applicable in European populations.

  5. Cigarettes, genetic background, and menopausal timing: the presence of single nucleotide polymorphisms in cytochrome P450 genes is associated with increased risk of natural menopause in European-American smokers

    PubMed Central

    Butts, Samantha F.; Sammel, Mary D.; Greer, Christine; Rebbeck, Timothy R.; Boorman, David W.; Freeman, Ellen W.

    2016-01-01

    Objective This study aims to evaluate associations between variations in genes involved in the metabolism of environmental chemicals and steroid hormones and risk of menopause in smokers. Methods Survival analysis was performed on 410 eligible participants from the Penn Ovarian Aging study (ongoing for 14 years), a cohort study of late-reproductive-age women. Single nucleotide polymorphisms at the following loci were studied: COMT Val158Met, CYP1B1*4 Asn452Ser, CYP1B1*3 Leu432Val, and CYP3A4*1B. Results Significant interactions between smoking and single nucleotide polymorphisms were observed in European-American carriers of CYP3A4*1B and CYP1B1*3, supporting a greater risk of menopause entry compared with those not carrying these alleles. Among CYP1B1*3 carriers, smokers had a greater risk of menopause entry than nonsmokers (adjusted hazard ratio [HR], 2.26; 95% CI, 1.4–3.67; median time to menopause, 10.42 and 11.07 y, respectively). No association between smoking and menopause was identified in CYP1B1 wild types. Among CYP3A4*1B carriers, smokers were at greater risk for menopause entry than nonsmokers (adjusted HR, 15.1; 95% CI, 3.31–69.2; median time to menopause, 11.36 and 13.91 y, respectively). Risk of menopause entry in CYP3A4 wild types who smoked was far lower (adjusted HR, 1.59; 95% CI, 1.03–2.44). Heavily smoking CYP1B1*3 carriers (adjusted HR, 3.0; 95% CI, 1.54–5.84; median time to menopause, 10.41 y) and heavily smoking CYP3A4*1B carriers (adjusted HR, 17.79; 95% CI, 3.21–98.65; median time to menopause, 5.09 y) had the greatest risk of menopause entry. Conclusions Our finding that the risk of menopause entry in European-American smokers varies depending on genetic background represents a novel gene-environment interaction in reproductive aging. PMID:24448104

  6. Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.

    PubMed

    Martínez-Herrero, Sonia; Martínez, Alfredo

    2013-04-01

    The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

  7. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  8. Single-Nucleotide Polymorphisms Reveal Spatial Diversity Among Clones of Yersinia pestis During Plague Outbreaks in Colorado and the Western United States.

    PubMed

    Lowell, Jennifer L; Antolin, Michael F; Andersen, Gary L; Hu, Ping; Stokowski, Renee P; Gage, Kenneth L

    2015-05-01

    In western North America, plague epizootics caused by Yersinia pestis appear to sweep across landscapes, primarily infecting and killing rodents, especially ground squirrels and prairie dogs. During these epizootics, the risk of Y. pestis transmission to humans is highest. While empirical models that include climatic conditions and densities of rodent hosts and fleas can predict when epizootics are triggered, bacterial transmission patterns across landscapes, and the scale at which Y. pestis is maintained in nature during inter-epizootic periods, are poorly defined. Elucidating the spatial extent of Y. pestis clones during epizootics can determine whether bacteria are propagated across landscapes or arise independently from local inter-epizootic maintenance reservoirs. We used DNA microarray technology to identify single-nucleotide polymorphisms (SNPs) in 34 Y. pestis isolates collected in the western United States from 1980 to 2006, 21 of which were collected during plague epizootics in Colorado. Phylogenetic comparisons were used to elucidate the hypothesized spread of Y. pestis between the mountainous Front Range and the eastern plains of northern Colorado during epizootics. Isolates collected from across the western United States were included for regional comparisons. By identifying SNPs that mark individual clones, our results strongly suggest that Y. pestis is maintained locally and that widespread epizootic activity is caused by multiple clones arising independently at small geographic scales. This is in contrast to propagation of individual clones being transported widely across landscapes. Regionally, our data are consistent with the notion that Y. pestis diversifies at relatively local scales following long-range translocation events. We recommend that surveillance and prediction by public health and wildlife management professionals focus more on models of local or regional weather patterns and ecological factors that may increase risk of widespread

  9. Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

    PubMed

    Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

    2015-09-25

    ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

  10. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  11. Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

    PubMed Central

    2013-01-01

    Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

  12. Human Chromosome Y and Haplogroups; introducing YDHS Database.

    PubMed

    Tiirikka, Timo; Moilanen, Jukka S

    2015-12-01

    As the high throughput sequencing efforts generate more biological information, scientists from different disciplines are interpreting the polymorphisms that make us unique. In addition, there is an increasing trend in general public to research their own genealogy, find distant relatives and to know more about their biological background. Commercial vendors are providing analyses of mitochondrial and Y-chromosomal markers for such purposes. Clearly, an easy-to-use free interface to the existing data on the identified variants would be in the interest of general public and professionals less familiar with the field. Here we introduce a novel metadatabase YDHS that aims to provide such an interface for Y-chromosomal DNA (Y-DNA) haplogroups and sequence variants. The database uses ISOGG Y-DNA tree as the source of mutations and haplogroups and by using genomic positions of the mutations the database links them to genes and other biological entities. YDHS contains analysis tools for deeper Y-SNP analysis. YDHS addresses the shortage of Y-DNA related databases. We have tested our database using a set of different cases from literature ranging from infertility to autism. The database is at http://www.semanticgen.net/ydhs Y-chromosomal DNA (Y-DNA) haplogroups and sequence variants have not been in the scientific limelight, excluding certain specialized fields like forensics, mainly because there is not much freely available information or it is scattered in different sources. However, as we have demonstrated Y-SNPs do play a role in various cases on the haplogroup level and it is possible to create a free Y-DNA dedicated bioinformatics resource.

  13. Continent-Wide Decoupling of Y-Chromosomal Genetic Variation from Language and Geography in Native South Americans

    PubMed Central

    Gusmão, Leonor; Gomes, Veronica; González, Miguel; Corach, Daniel; Sala, Andrea; Alechine, Evguenia; Palha, Teresinha; Santos, Ney; Ribeiro-dos-Santos, Andrea; Geppert, Maria; Willuweit, Sascha; Nagy, Marion; Zweynert, Sarah; Baeta, Miriam; Núñez, Carolina; Martínez-Jarreta, Begoña; González-Andrade, Fabricio; Fagundes de Carvalho, Elizeu; da Silva, Dayse Aparecida; Builes, Juan José; Turbón, Daniel; Lopez Parra, Ana Maria; Arroyo-Pardo, Eduardo; Toscanini, Ulises; Borjas, Lisbeth; Barletta, Claudia; Ewart, Elizabeth; Santos, Sidney; Krawczak, Michael

    2013-01-01

    Numerous studies of human populations in Europe and Asia have revealed a concordance between their extant genetic structure and the prevailing regional pattern of geography and language. For native South Americans, however, such evidence has been lacking so far. Therefore, we examined the relationship between Y-chromosomal genotype on the one hand, and male geographic origin and linguistic affiliation on the other, in the largest study of South American natives to date in terms of sampled individuals and populations. A total of 1,011 individuals, representing 50 tribal populations from 81 settlements, were genotyped for up to 17 short tandem repeat (STR) markers and 16 single nucleotide polymorphisms (Y-SNPs), the latter resolving phylogenetic lineages Q and C. Virtually no structure became apparent for the extant Y-chromosomal genetic variation of South American males that could sensibly be related to their inter-tribal geographic and linguistic relationships. This continent-wide decoupling is consistent with a rapid peopling of the continent followed by long periods of isolation in small groups. Furthermore, for the first time, we identified a distinct geographical cluster of Y-SNP lineages C-M217 (C3*) in South America. Such haplotypes are virtually absent from North and Central America, but occur at high frequency in Asia. Together with the locally confined Y-STR autocorrelation observed in our study as a whole, the available data therefore suggest a late introduction of C3* into South America no more than 6,000 years ago, perhaps via coastal or trans-Pacific routes. Extensive simulations revealed that the observed lack of haplogroup C3* among extant North and Central American natives is only compatible with low levels of migration between the ancestor populations of C3* carriers and non-carriers. In summary, our data highlight the fact that a pronounced correlation between genetic and geographic/cultural structure can only be expected under very specific

  14. Single Nucleotide Variations of the Human GR Gene Manifested as Pathologic Mutations or Polymorphisms.

    PubMed

    Kino, Tomoshige

    2018-05-11

    The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.

  15. Association of Toll-like receptor 3 and Toll-like receptor 9 single-nucleotide polymorphisms with hepatitis C virus persistence among Egyptians.

    PubMed

    Hamdy, Shaimaa; Osman, Ahmed M; Zakaria, Zainab A; Galal, Iman; Sobhy, Maha; Hashem, Mohamed; Allam, Walaa R; Abdel-Samiee, Mohamed; Rewisha, Eman; Waked, Imam; Abdelwahab, Sayed F

    2018-06-02

    Toll-like receptors (TLRs) give the innate immune system a considerable specificity for a large range of pathogens. TLR3 detects dsRNA of viruses while TLR9 recognizes bacterial and viral unmethylated CpG motifs. This study examined whether there is a potential association between single-nucleotide polymorphisms (SNPs) in the TLR3.rs3775290 (c.1377C/T), TLR9.rs5743836 (-1237T→C) and TLR9.rs352140 (G2848A) genes and HCV infection among Egyptian patients and healthcare workers (HCWs). We enrolled 546 subjects (409 HCWs and 137 patients) divided into four groups: group 1 included 265 seronegative, aviremic subjects; group 2 included 25 seronegative, viremic subjects; group 3 included 87 subjects with spontaneously resolved HCV infection; and group 4 included 169 chronic HCV patients. All subjects were genotyped for TLR3.rs3775290, TLR9.rs5743836 and TLR9.rs352140 SNPs by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. TLR3.rs3775290 "CC" genotype was associated with chronic HCV infection, where there was a significantly greater frequency of this genotype among chronic patients when compared to subjects with spontaneously resolved infection (63.9% vs. 51.9%; p = 0.033; OR = 1.639 and 95% CI = 0.94-2.84). However, this SNP did not correlate with the HCV RNA load among the chronic subjects (p > 0.05). There was no significant difference in TLR9.rs5743836 and TLR9.rs352140 genotype distribution between groups (p > 0.05). Lack of association between the three SNPs was found, as the three SNPs are located on two different chromosomes. In conclusion, the TLR3.rs3775290 "CC" genotype was associated with HCV chronicity, while the TLR9 gene may not play a major role in HCV infection.

  16. Origins of domestic dog in southern East Asia is supported by analysis of Y-chromosome DNA.

    PubMed

    Ding, Z-L; Oskarsson, M; Ardalan, A; Angleby, H; Dahlgren, L-G; Tepeli, C; Kirkness, E; Savolainen, P; Zhang, Y-P

    2012-05-01

    Global mitochondrial DNA (mtDNA) data indicates that the dog originates from domestication of wolf in Asia South of Yangtze River (ASY), with minor genetic contributions from dog-wolf hybridisation elsewhere. Archaeological data and autosomal single nucleotide polymorphism data have instead suggested that dogs originate from Europe and/or South West Asia but, because these datasets lack data from ASY, evidence pointing to ASY may have been overlooked. Analyses of additional markers for global datasets, including ASY, are therefore necessary to test if mtDNA phylogeography reflects the actual dog history and not merely stochastic events or selection. Here, we analyse 14,437 bp of Y-chromosome DNA sequence in 151 dogs sampled worldwide. We found 28 haplotypes distributed in five haplogroups. Two haplogroups were universally shared and included three haplotypes carried by 46% of all dogs, but two other haplogroups were primarily restricted to East Asia. Highest genetic diversity and virtually complete phylogenetic coverage was found within ASY. The 151 dogs were estimated to originate from 13-24 wolf founders, but there was no indication of post-domestication dog-wolf hybridisations. Thus, Y-chromosome and mtDNA data give strikingly similar pictures of dog phylogeography, most importantly that roughly 50% of the gene pools are shared universally but only ASY has nearly the full range of genetic diversity, such that the gene pools in all other regions may derive from ASY. This corroborates that ASY was the principal, and possibly sole region of wolf domestication, that a large number of wolves were domesticated, and that subsequent dog-wolf hybridisation contributed modestly to the dog gene pool.

  17. Origins of domestic dog in Southern East Asia is supported by analysis of Y-chromosome DNA

    PubMed Central

    Ding, Z-L; Oskarsson, M; Ardalan, A; Angleby, H; Dahlgren, L-G; Tepeli, C; Kirkness, E; Savolainen, P; Zhang, Y-P

    2012-01-01

    Global mitochondrial DNA (mtDNA) data indicates that the dog originates from domestication of wolf in Asia South of Yangtze River (ASY), with minor genetic contributions from dog–wolf hybridisation elsewhere. Archaeological data and autosomal single nucleotide polymorphism data have instead suggested that dogs originate from Europe and/or South West Asia but, because these datasets lack data from ASY, evidence pointing to ASY may have been overlooked. Analyses of additional markers for global datasets, including ASY, are therefore necessary to test if mtDNA phylogeography reflects the actual dog history and not merely stochastic events or selection. Here, we analyse 14 437 bp of Y-chromosome DNA sequence in 151 dogs sampled worldwide. We found 28 haplotypes distributed in five haplogroups. Two haplogroups were universally shared and included three haplotypes carried by 46% of all dogs, but two other haplogroups were primarily restricted to East Asia. Highest genetic diversity and virtually complete phylogenetic coverage was found within ASY. The 151 dogs were estimated to originate from 13–24 wolf founders, but there was no indication of post-domestication dog–wolf hybridisations. Thus, Y-chromosome and mtDNA data give strikingly similar pictures of dog phylogeography, most importantly that roughly 50% of the gene pools are shared universally but only ASY has nearly the full range of genetic diversity, such that the gene pools in all other regions may derive from ASY. This corroborates that ASY was the principal, and possibly sole region of wolf domestication, that a large number of wolves were domesticated, and that subsequent dog–wolf hybridisation contributed modestly to the dog gene pool. PMID:22108628

  18. Non-pathological complete paternal uniparental isodisomy of chromosome 2 revealed in a maternity testing case.

    PubMed

    Chen, Man; Jiang, Jian; Li, Chen; Ren, He; Chen, Wei; Liu, Zhiyong; Cheng, Feng; Zhao, Jing; Chen, Tong; Chen, Chuguang; Yan, Jiangwei

    2018-05-25

    We present a duo paternity test case to assess the biological relationship between a woman and her female child. After analyzing 57 autosomal and 19 X-chromosomal short tandem repeat loci, mother-daughter exclusions were discovered at four loci, which were all located on chromosome 2. Further testing of whole-genome single nucleotide polymorphisms confirmed that the daughter had complete uniparental disomy (UPD) of chromosome 2. This study presents a cautionary case demonstrating that hasty decisions of parentage exclusion should not be made when genetic markers on the same chromosome do not conform to Mendel's laws due to UPD.

  19. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

    PubMed

    Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

    2015-04-01

    Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

  1. The Geographic Distribution of Human Y Chromosome Variation

    PubMed Central

    Hammer, M. F.; Spurdle, A. B.; Karafet, T.; Bonner, M. R.; Wood, E. T.; Novelletto, A.; Malaspina, P.; Mitchell, R. J.; Horai, S.; Jenkins, T.; Zegura, S. L.

    1997-01-01

    We examined variation on the nonrecombining portion of the human Y chromosome to investigate human evolution during the last 200,000 years. The Y-specific polymorphic sites included the Y Alu insertional polymorphism or ``YAP'' element (DYS287), the poly(A) tail associated with the YAP element, three point mutations in close association with the YAP insertion site, an A-G polymorphic transition (DYS271), and a tetranucleotide microsatellite (DYS19). Global variation at the five bi-allelic sites (DYS271, DYS287, and the three point mutations) gave rise to five ``YAP haplotypes'' in 60 populations from Africa, Europe, Asia, Australasia, and the New World (n = 1500). Combining the multi-allelic variation at the microsatellite loci (poly(A) tail and DYS19) with the YAP haplotypes resulted in a total of 27 ``combination haplotypes''. All five of the YAP haplotypes and 21 of the 27 combination haplotypes were found in African populations, which had greater haplotype diversity than did populations from other geographical locations. Only subsets of the five YAP haplotypes were found outside of Africa. Patterns of observed variation were compatible with a variety of hypotheses, including multiple human migrations and range expansions. PMID:9055088

  2. Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

    PubMed Central

    Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

    2011-01-01

    Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

  3. Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

    PubMed Central

    Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

    2014-01-01

    Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

  4. Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.

    PubMed

    Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N

    2013-01-01

    Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

  5. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

    PubMed

    Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

    2005-05-01

    Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their

  7. Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

    PubMed Central

    Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

    2007-01-01

    The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

  8. Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

    2008-11-01

    Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

  9. Cell Line Controls for the Genotyping of a Spectrum of Human Single Nucleotide Polymorphisms in the Clinical Laboratory.

    PubMed

    Kimbacher, Christine; Paar, Christian; Freystetter, Andrea; Berg, Joerg

    2018-05-01

    Genotyping for clinically important single nucleotide polymorphisms (SNPs) is performed by many clinical routine laboratories. To support testing, quality controls and reference materials are needed. Those may be derived from residual patient samples, left over samples of external quality assurance schemes, plasmid DNA or DNA from cell lines. DNAs from cell lines are commutable and available in large amounts. DNA from 38 cell lines were examined for suitability as controls in 11 SNP assays that are frequently used in a clinical routine laboratory: FV (1691G>A), FII (20210G>A), PAI-1 4G/5G polymorphism, MTHFR (677C>T, 1298A>C), HFE (H63D, S65C, C282Y), APOE (E2, E3, E4), LPH (-13910C>T), UGT1A1 (*28, *36, *37), TPMT (*2, *3A, *3B, *3C), VKORC1 (-1639G>A, 1173C>T), CYP2C9 (*2, *3, *5). Genotyping was performed by real-time PCR with melting curve analysis and confirmed by bi-directional sequencing. We find an almost complete spectrum of genotypic constellations within these 38 cell lines. About 12 cell lines appear sufficient as genotypic controls for the 11 SNP assays by covering almost all of the genotypes. However, hetero- and homozygous genotypes for FII and the alleles TPMT*2, UGT1A1*37 and CYP2C9*5 were not detected in any of the cell lines. DNA from most of the examined cell lines appear suitable as quality controls for these SNP assays in the laboratory routine, as to the implementation of those assays or to prepare samples for quality assurance schemes. Our study may serve as a pilot to further characterize these cell lines to arrive at the status of reference materials.

  10. Ancient Male Recombination Shaped Genetic Diversity of Neo-Y Chromosome in Drosophila albomicans.

    PubMed

    Satomura, Kazuhiro; Tamura, Koichiro

    2016-02-01

    Researchers studying Y chromosome evolution have drawn attention to neo-Y chromosomes in Drosophila species due to their resembling the initial stage of Y chromosome evolution. In the studies of neo-Y chromosome of Drosophila miranda, the extremely low genetic diversity observed suggested various modes of natural selection acting on the nonrecombining genome. However, alternative possibility may come from its peculiar origin from a single chromosomal fusion event with male achiasmy, which potentially caused and maintained the low genetic diversity of the neo-Y chromosome. Here, we report a real case where a neo-Y chromosome is in transition from an autosome to a typical Y chromosome. The neo-Y chromosome of Drosophila albomicans harbored a rich genetic diversity comparable to its gametologous neo-X chromosome and an autosome in the same genome. Analyzing sequence variations in 53 genes and measuring recombination rates between pairs of loci by cross experiments, we elucidated the evolutionary scenario of the neo-Y chromosome of D. albomicans having high genetic diversity without assuming selective force, i.e., it originated from a single chromosomal fusion event, experienced meiotic recombination during the initial stage of evolution and diverged from neo-X chromosome by the suppression of recombination tens or a few hundreds of thousand years ago. Consequently, the observed high genetic diversity on the neo-Y chromosome suggested a strong effect of meiotic recombination to introduce genetic variations into the newly arisen sex chromosome. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Turner syndrome and genetic polymorphism: a systematic review

    PubMed Central

    de Marqui, Alessandra Bernadete Trovó

    2015-01-01

    Objective: To present the main results of the literature on genetic polymorphisms in Turner syndrome and their association with the clinical signs and the etiology of this chromosomal disorder. Data sources: The review was conducted in the PubMed database without any time limit, using the terms Turner syndrome and genetic polymorphism. A total of 116 articles were found, and based on the established inclusion and exclusion criteria 17 were selected for the review. Data synthesis: The polymorphisms investigated in patients with Turner syndrome were associated with growth deficit, causing short stature, low bone mineral density, autoimmunity and cardiac abnormalities, which are frequently found in patients with Turner syndrome. The role of single nucleotide polymorphisms in the etiology of Turner syndrome, i.e., in chromosomal nondisjunction, was also confirmed. Conclusions: Genetic polymorphisms appear to be associated with Turner syndrome. However, in view of the small number of published studies and their contradictory findings, further studies in different populations are needed in order to clarify the role of genetic variants in the clinical signs and etiology of the Turner syndrome. PMID:25765448

  12. Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

    PubMed Central

    Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

    2006-01-01

    Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

  13. Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations.

    PubMed

    Kawasaki, Eiji; Awata, Takuya; Ikegami, Hiroshi; Kobayashi, Tetsuro; Maruyama, Taro; Nakanishi, Koji; Shimada, Akira; Uga, Miho; Uga, Mho; Kurihara, Susumu; Kawabata, Yumiko; Tanaka, Shoichiro; Kanazawa, Yasuhiko; Lee, Inkyu; Eguchi, Katsumi

    2006-03-15

    The protein tyrosine phosphatase, nonreceptor 22 gene (PTPN22) maps to human chromosome 1p13.3-p13.1 and encodes an important negative regulator of T-cell activation, lymphoid-specific phosphatase (Lyp). Recently, the minor allele of a single-nucleotide polymorphism (SNP) at nucleotide position 1858 (rs2476601, +1858C > T) was found to be associated with type 1 diabetes. However, the degree of the association is variable among ethnic populations, suggesting the presence of other disease-associated variants in PTPN22. To examine this possibility, we carried out a systemic search for PTPN22 using direct sequencing of PCR-amplified products in the Japanese population. Association and linkage studies were also conducted in 1,690 Japanese samples, 180 Korean samples, and 472 Caucasian samples from 95 nuclear families. We identified five novel SNPs, but not the +1858C > T SNP. Of these two frequent SNPs, -1123G > C, and +2740C > T were in strong linkage disequilibrium (LD), and the -1123G > C promoter SNP was associated with acute-onset but not slow-onset type 1 diabetes in the Japanese population (odds ratio [OR] = 1.42, 95% CI = 1.07-1.89, P = 0.015). This association was observed also in Korean patients with type 1 diabetes (Mantel-Haenszel chi2= 6.543, P = 0.0105, combined OR = 1.41 95% CI = 1.09-1.82). Furthermore, the affected family-based control (AFBAC) association test and the transmission disequilibrium analysis of multiplex families of European descent from the British Diabetes Association (BDA) Warren Repository indicated that the association was stronger in -1123G > C compared to +1858C > T. In conclusion, the type 1 diabetes association with PTPN22 is confirmed, but it cannot be attributed solely to the +1858C > T variant. The promoter -1123G > C SNP is a more likely causative variant in PTPN22. 2006 Wiley-Liss, Inc.

  14. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

    PubMed

    Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

    2016-04-01

    Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

  15. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  16. Diagnosis of intrachromosomal amplification of chromosome 21 (iAMP21) by molecular cytogenetics in pediatric acute lymphoblastic leukemia.

    PubMed

    Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine

    2015-10-01

    Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile.

  17. p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

    PubMed

    Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

    2017-05-01

    The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16

  18. L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

    PubMed Central

    Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

    2001-01-01

    A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

  19. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  20. Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppies.

    PubMed

    Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine

    2010-03-01

    Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.

  1. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  2. Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

    PubMed

    Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

    2016-05-01

    To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

  3. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    PubMed

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

    PubMed Central

    Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

    2012-01-01

    We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

  5. Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

    PubMed

    Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

    2015-05-01

    Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology

  6. The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.

    PubMed

    Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning

    2017-11-01

    Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

    PubMed

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

    2011-05-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

  8. Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

    PubMed Central

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

    2011-01-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

  9. Y-SNPs haplotype diversity in four Chinese cattle breeds.

    PubMed

    Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke

    2013-01-01

    To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).

  10. TNF-alpha single nucleotide polymorphisms in atopic dermatitis.

    PubMed

    Behniafard, Nasrin; Gharagozlou, Mohammad; Farhadi, Elham; Khaledi, Mojdeh; Sotoudeh, Soheila; Darabi, Behzad; Fathi, Seid Mohammad; Gholizadeh Moghaddam, Zahra; Mahmoudi, Mahdi; Aghamohammadi, Asghar; Amirzargar, Ali Akbar; Rezaei, Nima

    2012-01-01

    Tumor necrosis factor-alpha (TNF-α) could be considered as potential biomarkers in atopic dermatitis (AD), while its level could be influenced by cytokine single gene polymorphisms (SNP). This study was performed in 89 pediatric patients with AD and 137 controls to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence-specific primers method. The highest positive allelic association that made the patients susceptible to AD was seen for TNF-α -238/G (p<0.001) and TNF-α -308/G (p = 0.003). The GG genotypes at TNF-α -238 and TNF-α -308, were both significantly higher in the patients with AD, compared to the controls (p<0.01). The GG haplotype at TNF-α (-308,-238) was seen in 92.7% of the patients, which was significantly higher than the controls (p<0.001), while a negative haplotypic association with AD was seen for TNF-α (-308, -238) AG and GA (p<0.01). This study showed that the AG genotype of TNF-α -308, associated with a high production of cytokines, was significantly decreased in patients with AD, while the low-producing GG genotype, which could lead to low production of TNF-α, was over-expressed in the atopic patients.

  11. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  12. A single nucleotide polymorphism genotyping platform for the authentication of patient derived xenografts.

    PubMed

    El-Hoss, Jad; Jing, Duohui; Evans, Kathryn; Toscan, Cara; Xie, Jinhan; Lee, Hyunjoo; Taylor, Renea A; Lawrence, Mitchell G; Risbridger, Gail P; MacKenzie, Karen L; Sutton, Rosemary; Lock, Richard B

    2016-09-13

    Patient derived xenografts (PDXs) have become a vital, frequently used, component of anti-cancer drug development. PDXs can be serially passaged in vivo for years, and shared across laboratories. As a consequence, the potential for mis-identification and cross-contamination is possible, yet authentication of PDXs appears limited. We present a PDX Authentication System (PAS), by combining a commercially available OpenArray assay of single nucleotide polymorphisms (SNPs) with in-house R studio programs, to validate PDXs established in individual mice from acute lymphoblastic leukemia biopsies. The PAS is sufficiently robust to identify contamination at levels as low as 3%, similar to the gold standard of short tandem repeat (STR) profiling. We have surveyed a panel of PDXs established from 73 individual leukemia patients, and found that the PAS provided sufficient discriminatory power to identify each xenograft. The identified SNP-discrepant PDXs demonstrated distinct gene expression profiles, indicating a risk of contamination for PDXs at high passage number. The PAS also allows for the authentication of tumor cells with complex karyotypes from solid tumors including prostate cancer and Ewing's sarcoma. This study highlights the demands of authenticating PDXs for cancer research, and evaluates a reliable authentication platform that utilizes a commercially available and cost-effective system.

  13. Association between CFH Y402H Polymorphism and Age Related Macular Degeneration in North Indian Cohort

    PubMed Central

    Gupta, Amod; Prabhakar, Sudesh; Singh, Ramandeep; Sharma, Suresh Kumar; Chen, Wei

    2013-01-01

    The purpose of the study was to determine serum complement factor H (CFH) levels in patients of age related macular degeneration (AMD) and examine its association with CFH Y402H polymorphism. 115 AMD patients and 61 normal controls were recruited in this study. The single nucleotide polymorphism was assayed by real time PCR and serum CFH levels were measured by ELISA and standardized to total serum protein. Chi-square test was applied to polymorphism analysis while Mann Whitney U-statistic for CFH-levels. Mendelian randomization approach was used for determining causal relationship. The genotype frequency differed between the AMD patients (TT- 18.3%, TC-41.3% and CC-40.4%) and controls (TT-76.3%, TC-13.6%, and CC-10.1%) (p = 0001). The frequency of alleles was also significantly different when AMD (T-39% and C-61%) was compared to controls (T-83% and C-17%) (p = 0.0001). Level of serum CFH was significantly lower in AMD patients as compared to normal controls (p = 0.001). Our data showed that the CFH Y402H polymorphism is a risk factor for AMD in the North Indian population. Mendelian randomization approach revealed that CFH Y402H polymorphism affects AMD risk through the modification of CFH serum levels. PMID:23922956

  14. The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

    PubMed Central

    Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

    2007-01-01

    Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

  15. Pharmacological and electrophysiological characterization of nine, single nucleotide polymorphisms of the hERG-encoded potassium channel

    PubMed Central

    Männikkö, R; Overend, G; Perrey, C; Gavaghan, CL; Valentin, J-P; Morten, J; Armstrong, M; Pollard, CE

    2010-01-01

    Background and purpose: Potencies of compounds blocking KV11.1 [human ether-ago-go-related gene (hERG)] are commonly assessed using cell lines expressing the Caucasian wild-type (WT) variant. Here we tested whether such potencies would be different for hERG single nucleotide polymorphisms (SNPs). Experimental approach: SNPs (R176W, R181Q, Del187-189, P347S, K897T, A915V, P917L, R1047L, A1116V) and a binding-site mutant (Y652A) were expressed in Tet-On CHO-K1 cells. Potencies [mean IC50; lower/upper 95% confidence limit (CL)] of 48 hERG blockers was estimated by automated electrophysiology [IonWorks™ HT (IW)]. In phase one, rapid potency comparison of each WT-SNP combination was made for each compound. In phase two, any compound-SNP combinations from phase one where the WT upper/lower CL did not overlap with those of the SNPs were re-examined. Electrophysiological WT and SNP parameters were determined using conventional electrophysiology. Key results: IW detected the expected sixfold potency decrease for propafenone in Y652A. In phase one, the WT lower/upper CL did not overlap with those of the SNPs for 77 compound-SNP combinations. In phase two, 62/77 cases no longer yielded IC50 values with non-overlapping CLs. For seven of the remaining 15 cases, there were non-overlapping CLs but in the opposite direction. For the eight compound-SNP combinations with non-overlapping CLs in the same direction as for phase 1, potencies were never more than twofold apart. The only statistically significant electrophysiological difference was the voltage dependence of activation of R1047L. Conclusion and implications: Potencies of hERG channel blockers defined using the Caucasian WT sequence, in this in vitro assay, were representative of potencies for common SNPs. This article is part of a themed section on QT safety. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2010 PMID:19673885

  16. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  17. Single Nucleotide Polymorphism Array Analysis of Bone Marrow Failure Patients Reveals Characteristic Patterns of Genetic Changes

    PubMed Central

    Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica

    2013-01-01

    Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929

  18. Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

    PubMed

    Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

    2014-01-01

    The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

  19. Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

    PubMed Central

    Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

    2015-01-01

    The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

  20. Diagnosis of intrachromosomal amplification of chromosome 21 (iAMP21) by molecular cytogenetics in pediatric acute lymphoblastic leukemia

    PubMed Central

    Duployez, Nicolas; Boudry-Labis, Elise; Decool, Gauthier; Grzych, Guillaume; Grardel, Nathalie; Abou Chahla, Wadih; Preudhomme, Claude; Roche-Lestienne, Catherine

    2015-01-01

    Key Clinical Message Intrachromosomal amplification of chromosome 21 (iAMP21) defines a distinct cytogenetic subgroup of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) with poor prognosis that should be investigated in routine practice. Single-nucleotide polymorphism (SNP)-array provides a useful method to detect such cases showing a highly characteristic profile. PMID:26509013

  1. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    PubMed Central

    Galipeau, Jacques; Nooka, Ajay K.

    2013-01-01

    The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

  2. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  3. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  4. Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks

    NASA Astrophysics Data System (ADS)

    Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.

    2017-05-01

    Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

  5. The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

    PubMed Central

    Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

    2018-01-01

    Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

  6. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms.

    PubMed

    Lin, Wei-Jye; Salton, Stephen R

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  7. Highlights from the functional single nucleotide polymorphisms associated with human muscle size and strength or FAMuSS study.

    PubMed

    Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  8. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    PubMed Central

    Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711

  9. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

    PubMed

    Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

    2006-08-15

    Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

  10. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    PubMed

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  11. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  12. Megabase-Scale Inversion Polymorphism in the Wild Ancestor of Maize

    PubMed Central

    Fang, Zhou; Pyhäjärvi, Tanja; Weber, Allison L.; Dawe, R. Kelly; Glaubitz, Jeffrey C.; González, José de Jesus Sánchez; Ross-Ibarra, Claudia; Doebley, John; Morrell, Peter L.; Ross-Ibarra, Jeffrey

    2012-01-01

    Chromosomal inversions are thought to play a special role in local adaptation, through dramatic suppression of recombination, which favors the maintenance of locally adapted alleles. However, relatively few inversions have been characterized in population genomic data. On the basis of single-nucleotide polymorphism (SNP) genotyping across a large panel of Zea mays, we have identified an ∼50-Mb region on the short arm of chromosome 1 where patterns of polymorphism are highly consistent with a polymorphic paracentric inversion that captures >700 genes. Comparison to other taxa in Zea and Tripsacum suggests that the derived, inverted state is present only in the wild Z. mays subspecies parviglumis and mexicana and is completely absent in domesticated maize. Patterns of polymorphism suggest that the inversion is ancient and geographically widespread in parviglumis. Cytological screens find little evidence for inversion loops, suggesting that inversion heterozygotes may suffer few crossover-induced fitness consequences. The inversion polymorphism shows evidence of adaptive evolution, including a strong altitudinal cline, a statistical association with environmental variables and phenotypic traits, and a skewed haplotype frequency spectrum for inverted alleles. PMID:22542971

  13. Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

    PubMed Central

    Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

    2016-01-01

    Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

  14. ENGINES: exploring single nucleotide variation in entire human genomes.

    PubMed

    Amigo, Jorge; Salas, Antonio; Phillips, Christopher

    2011-04-19

    Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to the web interface is granted from

  15. Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

    PubMed

    Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

    2018-06-07

    Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

  16. The pig X and Y Chromosomes: structure, sequence, and evolution

    PubMed Central

    Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris

    2016-01-01

    We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630

  17. Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

    PubMed

    Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

    2016-01-01

    Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

  18. The Effective Mutation Rate at Y Chromosome Short Tandem Repeats, with Application to Human Population-Divergence Time

    PubMed Central

    Zhivotovsky, Lev A.; Underhill, Peter A.; Cinnioğlu, Cengiz; Kayser, Manfred; Morar, Bharti; Kivisild, Toomas; Scozzari, Rosaria; Cruciani, Fulvio; Destro-Bisol, Giovanni; Spedini, Gabriella; Chambers, Geoffrey K.; Herrera, Rene J.; Yong, Kiau Kiun; Gresham, David; Tournev, Ivailo; Feldman, Marcus W.; Kalaydjieva, Luba

    2004-01-01

    We estimate an effective mutation rate at an average Y chromosome short-tandem repeat locus as 6.9×10-4 per 25 years, with a standard deviation across loci of 5.7×10-4, using data on microsatellite variation within Y chromosome haplogroups defined by unique-event polymorphisms in populations with documented short-term histories, as well as comparative data on worldwide populations at both the Y chromosome and various autosomal loci. This value is used to estimate the times of the African Bantu expansion, the divergence of Polynesian populations (the Maoris, Cook Islanders, and Samoans), and the origin of Gypsy populations from Bulgaria. PMID:14691732

  19. PERB11 (MIC): a polymorphic MHC gene is expressed in skin and single nucleotide polymorphisms are associated with psoriasis

    PubMed Central

    Tay, G K; Hui, J; Gaudieri, S; Schmitt-Egenolf, M; Martinez, O P; Leelayuwat, C; Williamson, J F; Eiermann, T H; Dawkins, R L

    2000-01-01

    The susceptibility genes for psoriasis remain to be identified. At least one of these must be in the major histocompatibility complex (MHC) to explain associations with alleles at human leucocyte antigen (HLA)-A, -B, -C, -DR, -DQ and C4. In fact, most of these alleles are components of just two ancestral haplotypes (AHs) designated 13.1 and 57.1. Although relevant MHC gene(s) could be within a region of at least 4 Mb, most studies have favoured the area near HLA-B and -C. This region contains a large number of non-HLA genes, many of which are duplicated and polymorphic. Members of one such gene family, PERB11.1 and PERB11.2, are expressed in the skin and are encoded in the region between tumour necrosis factor and HLA-B. To investigate the relationship of PERB11.1 alleles to psoriasis, sequence based typing was performed on 97 patients classified according to age of onset and family history. The frequency of the PERB11.1*06 allele is 44% in type I psoriasis but only 7% in controls (Pc = 0.003 by Fisher's exact test, two-tailed). The major determinant of this association is a single nucleotide polymorphism (SNP) within intron 4. In normal and affected skin, expression of PERB11 is mainly in the basal layer of the epidermis including ducts and follicles. PERB11 is also present in the upper keratin layers but there is relative deficiency in the intermediate layers. These findings suggest a possible role for PERB11 and other MHC genes in the pathogenesis of psoriasis. PMID:10691930

  20. Y-chromosome microdeletions are not associated with SHOX haploinsufficiency.

    PubMed

    Chianese, C; Lo Giacco, D; Tüttelmann, F; Ferlin, A; Ntostis, P; Vinci, S; Balercia, G; Ars, E; Ruiz-Castañé, E; Giglio, S; Forti, G; Kliesch, S; Krausz, C

    2013-11-01

    assess whether the SHOX duplications found in the two men with Y-chromosome microdeletions and a normal karyotype represent a neutral polymorphism or are actually associated with the presence of the microdeletion. Men suffering from infertility due to the presence of Y-chromosome microdeletions can resort to artificial reproductive technology (ART) to father their biological children. However, infertile couples must be aware of the risks implied and this makes genetic counseling a crucial step in the patient's management. This study does not confirm previous alarming data that showed an association between Y-chromosome microdeletions and SHOX haploinsufficiency. Our results imply that deletion carriers have no augmented risk of SHOX-related pathologies (short stature and skeletal anomalies) and indicate that there is no need for radical changes in genetic counseling of Yq microdeletion carriers attempting ART, since the only risk established so far for their male offspring remains impaired spermatogenesis. This work was supported by the Italian Ministry of University (grant PRIN 2010-2012 to C.K.), Tuscan Regional Health Research Program ('Progetto Salute 2009') to G.F., the Spanish Ministry of Health (grant FIS-11/02254) and the European Union 'Reprotrain' Marie Curie Network (project number: 289880 to C.K.). The authors declare that no conflicting interests exist.

  1. [Turner syndrome and genetic polymorphism: a systematic review].

    PubMed

    Trovó de Marqui, Alessandra Bernadete

    2015-01-01

    To present the main results of the literature on genetic polymorphisms in Turner Syndrome and their association with the clinical signs and the etiology of this chromosomal disorder. The review was conducted in the PubMed database without any time limit, using the terms Turner syndrome and genetic polymorphism. A total of 116 articles were found, and based on the established inclusion and exclusion criteria 17 were selected for the review. The polymorphisms investigated in patients with Turner Syndrome were associated with growth deficit, causing short stature, low bone mineral density, autoimmunity and cardiac abnormalities, which are frequently found in patients with Turner Syndrome. The role of single nucleotide polymorphisms (SNPs) in the etiology of Turner syndrome, i.e., in chromosomal nondisjunction, was also confirmed. Genetic polymorphisms appear to be associated with Turner Syndrome. However, in view of the small number of published studies and their contradictory findings, further studies in different populations are needed in order to clarify the role of genetic variants in the clinical signs and etiology of the Turner Syndrome. Copyright © 2015 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

  2. Directional migration in the Hindu castes: inferences from mitochondrial, autosomal and Y-chromosomal data.

    PubMed

    Wooding, Stephen; Ostler, Christopher; Prasad, B V Ravi; Watkins, W Scott; Sung, Sandy; Bamshad, Mike; Jorde, Lynn B

    2004-08-01

    Genetic, ethnographic, and historical evidence suggests that the Hindu castes have been highly endogamous for several thousand years and that, when movement between castes does occur, it typically consists of females joining castes of higher social status. However, little is known about migration rates in these populations or the extent to which migration occurs between caste groups of low, middle, and high social status. To investigate these aspects of migration, we analyzed the largest collection of genetic markers collected to date in Hindu caste populations. These data included 45 newly typed autosomal short tandem repeat polymorphisms (STRPs), 411 bp of mitochondrial DNA sequence, and 43 Y-chromosomal single-nucleotide polymorphisms that were assayed in more than 200 individuals of known caste status sampled in Andrah Pradesh, in South India. Application of recently developed likelihood-based analyses to this dataset enabled us to obtain genetically derived estimates of intercaste migration rates. STRPs indicated migration rates of 1-2% per generation between high-, middle-, and low-status caste groups. We also found support for the hypothesis that rates of gene flow differ between maternally and paternally inherited genes. Migration rates were substantially higher in maternally than in paternally inherited markers. In addition, while prevailing patterns of migration involved movement between castes of similar rank, paternally inherited markers in the low-status castes were most likely to move into high-status castes. Our findings support earlier evidence that the caste system has been a significant, long-term source of population structuring in South Indian Hindu populations, and that patterns of migration differ between males and females. Copyright 2004 Springer-Verlag

  3. High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula

    PubMed Central

    Bosch, Elena; Calafell, Francesc; Comas, David; Oefner, Peter J.; Underhill, Peter A.; Bertranpetit, Jaume

    2001-01-01

    In the present study we have analyzed 44 Y-chromosome biallelic polymorphisms in population samples from northwestern (NW) Africa and the Iberian Peninsula, which allowed us to place each chromosome unequivocally in a phylogenetic tree based on >150 polymorphisms. The most striking results are that contemporary NW African and Iberian populations were found to have originated from distinctly different patrilineages and that the Strait of Gibraltar seems to have acted as a strong (although not complete) barrier to gene flow. In NW African populations, an Upper Paleolithic colonization that probably had its origin in eastern Africa contributed 75% of the current gene pool. In comparison, ∼78% of contemporary Iberian Y chromosomes originated in an Upper Paleolithic expansion from western Asia, along the northern rim of the Mediterranean basin. Smaller contributions to these gene pools (constituting 13% of Y chromosomes in NW Africa and 10% of Y chromosomes in Iberia) came from the Middle East during the Neolithic and, during subsequent gene flow, from Sub-Saharan to NW Africa. Finally, bidirectional gene flow across the Strait of Gibraltar has been detected: the genetic contribution of European Y chromosomes to the NW African gene pool is estimated at 4%, and NW African populations may have contributed 7% of Iberian Y chromosomes. The Islamic rule of Spain, which began in a.d. 711 and lasted almost 8 centuries, left only a minor contribution to the current Iberian Y-chromosome pool. The high-resolution analysis of the Y chromosome allows us to separate successive migratory components and to precisely quantify each historical layer. PMID:11254456

  4. Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

    PubMed

    Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

    2017-03-08

    EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

  5. Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

    PubMed

    Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

    2010-04-27

    To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be

  6. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.

    PubMed

    Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed

    2016-10-17

    Preterm birth (PTB), birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 %) of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  7. No association of the neuropeptide Y (Leu7Pro) and ghrelin gene (Arg51Gln, Leu72Met, Gln90Leu) single nucleotide polymorphisms with eating disorders.

    PubMed

    Kindler, Jochen; Bailer, Ursula; de Zwaan, Martina; Fuchs, Karoline; Leisch, Friedrich; Grün, Bettina; Strnad, Alexandra; Stojanovic, Mirjana; Windisch, Julia; Lennkh-Wolfsberg, Claudia; El-Giamal, Nadja; Sieghart, Werner; Kasper, Siegfried; Aschauer, Harald

    2011-06-01

    Genetic factors likely contribute to the biological vulnerability of eating disorders. Case-control association study on one neuropeptide Y gene (Leu7Pro) polymorphism and three ghrelin gene (Arg51Gln, Leu72Met and Gln90Leu) polymorphisms. 114 eating disorder patients (46 with anorexia nervosa, 30 with bulimia nervosa, 38 with binge eating disorder) and 164 healthy controls were genotyped. No differences were detected between patients and controls for any of the four polymorphisms in allele frequency and genotype distribution (P > 0.05). Allele frequencies and genotypes had no significant influence on body mass index (P > 0.05) in eating disorder patients. Positive findings of former case-control studies of associations between ghrelin gene polymorphisms and eating disorders could not be replicated. Neuropeptide Y gene polymorphisms have not been investigated in eating disorders before.

  8. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  9. Genome-wide profiling of chromosomal alterations in renal cell carcinoma using high-density single nucleotide polymorphism arrays

    PubMed Central

    Chen, Meng; Ye, Yuanqing; Yang, Hushan; Tamboli, Pheroze; Matin, Surena; Tannir, Nizar M.; Wood, Christopher G.; Gu, Jian; Wu, Xifeng

    2009-01-01

    Purpose The identification of genetic aberrations may help understand the mechanisms of tumorigenesis and has important implications in diagnosis, prognosis, and treatment. Methods We applied Illumina's 317K high-density SNP-arrays to profile chromosomal aberrations in clear cell renal cell carcinoma (ccRCC) from 80 patients and analyzed the association of LOH/amplification events with clinicopathological characteristics and telomere length. Results The most common loss of heterozygosity (LOH) were 3p (69 cases) including 38 whole 3p arm losses, 30 large fragment LOH (spanning 3p21-36), and 1 interstitial LOH (spanning 3p12-14, 3p21-22, 3p24.1-24.2, and 3p24.3), followed by chromosome losses at 8p12-pter, 6q23.3-27, 14q24.1-qter, 9q32-qter, 10q22.3-qter, 9p13.3-pter, 4q28.3-qter, and 13q12.1-21.1. We also found several smallest overlapping regions of LOH that contained tumor suppressor genes. One smallest LOH in 8p12 had a size of 0.29 Mb and only contained one gene (NRG1). The most frequent chromosome gains were at 5q (32 cases), including 10 whole 5q amplification, 21 large amplifications encompassing 5q32-ter, and 1 focal amplification in 5q35.3 (0.42 Mb). The other common chromosome gains were 1q25.1-qter, 7q21.13-qter, 8q24.12-qter, and whole 7p arm. Significant associations of LOH at 9p, 9q, 14q, and 18q were observed with higher nuclear grade. Significant associations with tumor stage were observed for LOH at 14q, 18p, and 21q. Finally, we found that tumors with LOH at 2q, 6p, 6q, 9p, 9q, and 17p had significantly shorter telomere length than those without LOH. Conclusion This is the first study to use Illumina's SNP-CGH array that provides a close estimate of the size and frequency of chromosome LOH and amplifications of ccRCC. The identified regions and genes may become diagnostic and prognostic biomarkers as well as potential targets of therapy. PMID:19521957

  10. First Polish DNA "manhunt"--an application of Y-chromosome STRs.

    PubMed

    Dettlaff-Kakol, A; Pawlowski, R

    2002-10-01

    This study presents the application of Y-chromosomal STR polymorphisms to male identification in the case of a serial rapist and woman murderer in Poland. Since August 1996 a rapist from Swinoujscie (northwest Poland) committed at least 14 rapes. In the year 2000 he brutally raped 8 young girls and murdered a 22-year-old girl. DNA profiles obtained from semen stains left at the scenes of crime gave information that one and the same man had committed all the rapes. The Y-chromosome haplotype (9 loci) obtained was used for the elimination process of 421 suspects. One man was found who had an identical DNA profile in all Y-chromosome STR loci analysed and possessed common alleles in 9 out of 10 autosomal loci, strongly suggesting that the real rapist and the typed man were closely related males. Analysis of reference DNA obtained from the man's brother revealed an identical DNA STR profile to that identified at the crime scenes. To the best of our knowledge this is the first case in Poland and probably in Eastern Europe where DNA typing of a large population was used to identify the offender.

  11. Identification of one polymorphism from the PAPP-A2 gene associated to fertility in Romosinuano beef heifers raised under a subtropical environment

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to identify single nucleotide polymorphisms (SNP) associated to fertility in female cows raised under a subtropical environment. Re-sequencing of 9 genes associated to GH-IGF endocrine pathway located in bovine chromosome 5, identified 75 SNP useful for associative ge...

  12. Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

    PubMed Central

    Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

    2011-01-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

  13. Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

    PubMed

    Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

    2011-05-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

  14. Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

    PubMed Central

    Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

    2009-01-01

    The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

  15. Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

    PubMed

    Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

    2016-04-28

    The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

  16. A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

    PubMed Central

    Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

    2012-01-01

    Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

  17. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

    PubMed Central

    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

    2014-01-01

    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

  18. Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.

    PubMed

    Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C

    2008-04-01

    Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (<25.0 kg/m(2), 25.0-29.9 kg/m(2), >30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.

  19. Comprehensive mutation analysis of 17 Y-chromosomal short tandem repeat polymorphisms included in the AmpFlSTR Yfiler PCR amplification kit.

    PubMed

    Goedbloed, Miriam; Vermeulen, Mark; Fang, Rixun N; Lembring, Maria; Wollstein, Andreas; Ballantyne, Kaye; Lao, Oscar; Brauer, Silke; Krüger, Carmen; Roewer, Lutz; Lessig, Rüdiger; Ploski, Rafal; Dobosz, Tadeusz; Henke, Lotte; Henke, Jürgen; Furtado, Manohar R; Kayser, Manfred

    2009-11-01

    The Y-chromosomal short tandem repeat (Y-STR) polymorphisms included in the AmpFlSTR Yfiler polymerase chain reaction amplification kit have become widely used for forensic and evolutionary applications where a reliable knowledge on mutation properties is necessary for correct data interpretation. Therefore, we investigated the 17 Yfiler Y-STRs in 1,730-1,764 DNA-confirmed father-son pairs per locus and found 84 sequence-confirmed mutations among the 29,792 meiotic transfers covered. Of the 84 mutations, 83 (98.8%) were single-repeat changes and one (1.2%) was a double-repeat change (ratio, 1:0.01), as well as 43 (51.2%) were repeat gains and 41 (48.8%) repeat losses (ratio, 1:0.95). Medians from Bayesian estimation of locus-specific mutation rates ranged from 0.0003 for DYS448 to 0.0074 for DYS458, with a median rate across all 17 Y-STRs of 0.0025. The mean age (at the time of son's birth) of fathers with mutations was with 34.40 (+/-11.63) years higher than that of fathers without ones at 30.32 (+/-10.22) years, a difference that is highly statistically significant (p < 0.001). A Poisson-based modeling revealed that the Y-STR mutation rate increased with increasing father's age on a statistically significant level (alpha = 0.0294, 2.5% quantile = 0.0001). From combining our data with those previously published, considering all together 135,212 meiotic events and 331 mutations, we conclude for the Yfiler Y-STRs that (1) none had a mutation rate of >1%, 12 had mutation rates of >0.1% and four of <0.1%, (2) single-repeat changes were strongly favored over multiple-repeat ones for all loci but 1 and (3) considerable variation existed among loci in the ratio of repeat gains versus losses. Our finding of three Y-STR mutations in one father-son pair (and two pairs with two mutations each) has consequences for determining the threshold of allelic differences to conclude exclusion constellations in future applications of Y-STRs in paternity testing and pedigree analyses.

  20. Population genetic implications from sequence variation in four Y chromosome genes.

    PubMed

    Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J

    2000-06-20

    Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.

  1. Association between MTHFR 1298A>C polymorphism and spontaneous abortion with fetal chromosomal aneuploidy.

    PubMed

    Kim, Shin Young; Park, So Yeon; Choi, Ji Won; Kim, Do Jin; Lee, Shin Yeong; Lim, Ji Hyae; Han, Jung Yeol; Ryu, Hyun Mee; Kim, Min Hyoung

    2011-10-01

    PROBLEM  Polymorphisms in genes involved in folate metabolism are commonly associated with defects in folate-dependent homocysteine metabolism, which can result in DNA hypomethylation and chromosome nondisjunction. This prospective study aimed to investigate the associations between MTHFR 677C>T, MTHFR 1298A>C, MTR 2756A>G, MTRR 66A>G, and CBS 844ins68 polymorphisms and spontaneous abortion (SA) with fetal chromosomal aneuploidy. METHOD OF STUDY  Subjects included 33 SA with normal fetal karyotype, 24 SA with fetal chromosomal aneuploidy and 155 normal controls. Polymorphisms were genotyped by PCR-RFLP and QF-PCR analysis. RESULTS  The frequencies of MTHFR 1298AC and combined 1298AC/CC genotypes were higher in SA with fetal chromosomal aneuploidy than in controls. The 1298C allele frequency was also significantly higher in SA with fetal chromosomal aneuploidy than in controls. Moreover, the 1298C allele frequency was higher in SA with fetal chromosomal aneuploidy than in SA with normal fetal karyotype. The combined 1298AC/CC genotype was significantly associated with the risk of SA with fetal chromosomal aneuploidy compared with that of the 1298AA genotype (adjusted OR = 2.93, 95% CI: 1.11-7.69). There was no association between SA with fetal chromosomal aneuploidy and other polymorphisms. CONCLUSIONS  Our findings indicate that MTHFR 1298A>C polymorphism may be an independent risk factor for SA with fetal chromosomal aneuploidy. © 2011 John Wiley & Sons A/S.

  2. Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

    PubMed Central

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-01-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  3. Mammalian X homolog acts as sex chromosome in lacertid lizards

    PubMed Central

    Rovatsos, M; Vukić, J; Kratochvíl, L

    2016-01-01

    Among amniotes, squamate reptiles are especially variable in their mechanisms of sex determination; however, based largely on cytogenetic data, some lineages possess highly evolutionary stable sex chromosomes. The still very limited knowledge of the genetic content of squamate sex chromosomes precludes a reliable reconstruction of the evolutionary history of sex determination in this group and consequently in all amniotes. Female heterogamety with a degenerated W chromosome typifies the lizards of the family Lacertidae, the widely distributed Old World clade including several hundreds of species. From the liver transcriptome of the lacertid Takydromus sexlineatus female, we selected candidates for Z-specific genes as the loci lacking single-nucleotide polymorphisms. We validated the candidate genes through the comparison of the copy numbers in the female and male genomes of T. sexlineatus and another lacertid species, Lacerta agilis, by quantitative PCR that also proved to be a reliable technique for the molecular sexing of the studied species. We suggest that this novel approach is effective for the detection of Z-specific and X-specific genes in lineages with degenerated W, respectively Y chromosomes. The analyzed gene content of the Z chromosome revealed that lacertid sex chromosomes are not homologous with those of other reptiles including birds, but instead the genes have orthologs in the X-conserved region shared by viviparous mammals. It is possible that this part of the vertebrate genome was independently co-opted for the function of sex chromosomes in viviparous mammals and lacertids because of its content of genes involved in gonad differentiation. PMID:26980341

  4. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  5. Large-Scale Development of Cost-Effective Single-Nucleotide Polymorphism Marker Assays for Genetic Mapping in Pigeonpea and Comparative Mapping in Legumes

    PubMed Central

    Saxena, Rachit K.; Varma Penmetsa, R.; Upadhyaya, Hari D.; Kumar, Ashish; Carrasquilla-Garcia, Noelia; Schlueter, Jessica A.; Farmer, Andrew; Whaley, Adam M.; Sarma, Birinchi K.; May, Gregory D.; Cook, Douglas R.; Varshney, Rajeev K.

    2012-01-01

    Single-nucleotide polymorphisms (SNPs, >2000) were discovered by using RNA-seq and allele-specific sequencing approaches in pigeonpea (Cajanus cajan). For making the SNP genotyping cost-effective, successful competitive allele-specific polymerase chain reaction (KASPar) assays were developed for 1616 SNPs and referred to as PKAMs (pigeonpea KASPar assay markers). Screening of PKAMs on 24 genotypes [23 from cultivated species and 1 wild species (Cajanus scarabaeoides)] defined a set of 1154 polymorphic markers (77.4%) with a polymorphism information content (PIC) value from 0.04 to 0.38. One thousand and ninety-four PKAMs showed polymorphisms between parental lines of the reference mapping population (C. cajan ICP 28 × C. scarabaeoides ICPW 94). By using high-quality marker genotyping data on 167 F2 lines from the population, a comprehensive genetic map comprising 875 PKAMs with an average inter-marker distance of 1.11 cM was developed. Previously mapped 35 simple sequence repeat markers were integrated into the PKAM map and an integrated genetic map of 996.21 cM was constructed. Mapped PKAMs showed a higher degree of synteny with the genome of Glycine max followed by Medicago truncatula and Lotus japonicus and least with Vigna unguiculata. These PKAMs will be useful for genetics research and breeding applications in pigeonpea and for utilizing genome information from other legume species. PMID:23103470

  6. Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

    PubMed

    Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

    2014-12-01

    In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  7. Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

    PubMed

    Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

    2014-02-01

    Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

  8. Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

    PubMed Central

    Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

    2001-01-01

    We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

  9. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    PubMed

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  10. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

    2015-01-01

    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

  11. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    PubMed Central

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  12. Helicobacter Pylori Serology in Relation to Hepatitis C Virus Infection and IL28B Single Nucleotide Polymorphism

    PubMed Central

    Gutwerk, Alexander; Wex, Thomas; Stein, Kerstin; Langner, Cosima; Canbay, Ali; Malfertheiner, Peter

    2018-01-01

    The aim of the study was to evaluate the serological rate of Helicobacter pylori (H. pylori) infection in patients with chronic hepatitis C virus (HCV) infection and determine any correlations with liver damage and IL28B single-nucleotide polymorphism (SNP). One hundred eighty-nine patients with chronic HCV infection were included in the study, and H. pylori status was defined based on anti-H. pylori-IgG or anti-CagA-IgG antibodies using enzyme-linked immunosorbent assay (ELISA). Liver damage was assessed using histology or transient elastography. IL28B C/T polymorphism (rs12979860) was evaluated in circulating blood cells using a PCR-based restriction fragment length polymorphism assay. Overall H. pylori serology was positive in 38.1% of our HCV-infected subjects. Among those, the anti-CagA-IgG positivity rate was 43.1% and was within the range of previously described populations of the same region. Highest prevalence of H. pylori was found in patients between 31 and 40 years compared to other age subgroups. The seropositivity rate was higher in the non-cirrhotic group than the cirrhotic one (45.4% vs. 20.0%, p < 0.05). No difference was found in IL28B genotype between H. pylori-positive and -negative cohorts. However, we observed a trend for the lower anti-CagA-IgG expression level in relation to the IL28B T-allele. Our results do not support an association between HCV and H. pylori infection. Whether IL28B SNP has a functional role in modulation of serological response to H. pylori CagA needs further investigation. PMID:29510558

  13. Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

    PubMed Central

    Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

    2007-01-01

    Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

  14. The Regulated Secretory Pathway and Human Disease: Insights from Gene Variants and Single Nucleotide Polymorphisms

    PubMed Central

    Lin, Wei-Jye; Salton, Stephen R.

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269

  15. Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

    PubMed

    Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

    2014-07-01

    Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. Identification of polymorphisms associated with production traits on chicken (Gallus gallus) chromosome 4.

    PubMed

    Pértille, F; Zanella, R; Felício, A M; Ledur, M C; Peixoto, J O; Coutinho, L L

    2015-09-09

    Genetic selection for production traits has resulted in a rapid improvement in animal performance and development. Previous studies have mapped quantitative trait loci for body weight at 35 and 41 days, and drum and thigh yield, onto chicken chromosome 4. We investigated this region for single nucleotide polymorphisms and their associations with important economic traits. Three positional candidate genes were studied: KLF3 (Krüeppel-like factor 3), SLIT2 (Slit homolog 2), and PPARGC1A (peroxisome proliferator-activated receptor gamma, coactivator 1 alpha). Fragment sequencing of these genes was conducted in 11 F1 animals, and one polymorphism in each gene was selected and genotyped in an F2 population (N = 276) and a paternal broiler line TT (N = 840). Associations were identified with growth, carcass, and fat traits in the F2 and the paternal line (P < 0.05). Using single markers in both the F2 and the TT line, KLF3 was associated with weight gain (P < 0.05), PPPARGC1A was associated with liver and wing-parts weights and yields (P < 0.05), and SLIT2 was associated with back yield (P < 0.05) and fat traits (P < 0.05). Using multiple markers, KLF3 lost its significance in both populations, and SLIT2 was associated with feed conversion only in the TT population (P < 0.05). The QTLs mapped in the F2 population could be partly explained by PPARGC1A and SLIT2, which were associated with body weight at 35 and 41 days, respectively, and with drum and thigh yield in the same population. The results of this study indicate the importance of these genes for production traits.

  17. Genetic affinity among five different population groups in India reflecting a Y-chromosome gene flow.

    PubMed

    Saha, Anjana; Sharma, Swarkar; Bhat, Audesh; Pandit, Awadesh; Bamezai, Ramesh

    2005-01-01

    Four binary polymorphisms and four multiallelic short tandem repeat (STR) loci from the nonrecombining region of the human Y-chromosome were typed in different Indian population groups from Uttar Pradeh (UP), Bihar (BI), Punjab (PUNJ), and Bengal (WB) speaking the Indo-Aryan dialects and from South India (SI) with the root in the Dravidian language. We identified four major haplogroups [(P) 1+, (C and F) 2+, (R1a) 3, (K) 26+] and 114 combinations of Y-STR haplotypes. Analyses of the haplogroups indicated no single origin from any lineage but a result of a conglomeration of different lineages from time to time. The phylogenetic analyses indicate a high degree of population admixture and a greater genetic proximity for the studied population groups when compared with other world populations.

  18. Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

    PubMed

    Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

    2013-10-01

    Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  19. High Density Single Nucleotide Polymorphism (SNP) Mapping and Quantitative Trait Loci (QTL) Analysis in a Biparental Spring Triticale Population Localized Major and Minor Effect Fusarium Head Blight Resistance and Associated Traits QTL

    PubMed Central

    Dhariwal, Raman; Fedak, George; Dion, Yves; Pozniak, Curtis; Laroche, André; Eudes, François; Randhawa, Harpinder Singh

    2018-01-01

    Triticale (xTriticosecale Wittmack) is an important feed crop which suffers severe yield, grade and end-use quality losses due to Fusarium head blight (FHB). Development of resistant triticale cultivars is hindered by lack of effective genetic resistance sources. To dissect FHB resistance, a doubled haploid spring triticale population produced from the cross TMP16315/AC Ultima using a microspore culture method, was phenotyped for FHB incidence, severity, visual rating index (VRI), deoxynivalenol (DON) and some associated traits (ergot, grain protein content, test weight, yield, plant height and lodging) followed by single nucleotide polymorphism (SNP) genotyping. A high-density map consisting of 5274 SNPs, mapped on all 21 chromosomes with a map density of 0.48 cM/SNP, was constructed. Together, 17 major quantitative trait loci were identified for FHB on chromosomes 1A, 2B, 3A, 4A, 4R, 5A, 5R and 6B; two of incidence loci (on 2B and 5R) also co-located with loci for severity and VRI, and two other loci of VRI (on 1A and 4R) with DON accumulation. Major and minor loci were also identified for all other traits in addition to many epistasis loci. This study provides new insight into the genetic basis of FHB resistance and their association with other traits in triticale. PMID:29304028

  20. The Y chromosome of the Atelidae family (Platyrrhini): study by chromosome microdissection.

    PubMed

    Gifalli-Iughetti, C; Koiffmann, C P

    2009-01-01

    In order to study the intergeneric variability of the Y chromosome, we describe the hybridization of the Y chromosome of Brachytelesarachnoides, obtained by microdissection, to metaphases of Atelesbelzebuthmarginatus, Lagothrixlagothricha, and Alouatta male specimens. Brachytelesarachnoides (Atelinae) has 62 chromosomes and a very small Y chromosome. Our results showed that the Brachytelesarachnoides Y chromosome probe hybridized to Lagothrixlagothricha metaphases yielding one hybridization signal on only the tiny Y chromosome, and when hybridized with Atelesbelzebuthmarginatus metaphases it yielded one hybridization signal on two thirds of the small acrocentric Y chromosome. However, no hybridization signal was observed in Alouatta metaphases (subfamily Alouattinae), a closely related genus in the Atelidae family. Furthermore, our data support a close phylogenetic relationship among Brachyteles, Ateles, and Lagothrix and their placement in the Atelinae subfamily, but exclude Alouatta from this group indicating its placement as basal to this group. Copyright 2009 S. Karger AG, Basel.

  1. Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

    PubMed

    Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

    2007-06-01

    The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

  2. Interspecific Y chromosome variation is sufficient to rescue hybrid male sterility and is influenced by the grandparental origin of the chromosomes.

    PubMed

    Araripe, L O; Tao, Y; Lemos, B

    2016-06-01

    Y chromosomes display population variation within and between species. Co-evolution within populations is expected to produce adaptive interactions between Y chromosomes and the rest of the genome. One consequence is that Y chromosomes from disparate populations could disrupt harmonious interactions between co-evolved genetic elements and result in reduced male fertility, sterility or inviability. Here we address the contribution of 'heterospecific Y chromosomes' to fertility in hybrid males carrying a homozygous region of Drosophila mauritiana introgressed in the Drosophila simulans background. In order to detect Y chromosome-autosome interactions, which may go unnoticed in a single-species background of autosomes, we constructed hybrid genotypes involving three sister species: Drosophila simulans, D. mauritiana, and D. sechellia. These engineered strains varied due to: (i) species origin of the Y chromosome (D. simulans or D. sechellia); (ii) location of the introgressed D. mauritiana segment on the D. simulans third chromosome, and (iii) grandparental genomic background (three genotypes of D. simulans). We find complex interactions between the species origin of the Y chromosome, the identity of the D. mauritiana segment and the grandparental genetic background donating the chromosomes. Unexpectedly, the interaction of the Y chromosome and one segment of D. mauritiana drastically reduced fertility in the presence of Ysim, whereas the fertility is partially rescued by the Y chromosome of D. sechellia when it descends from a specific grandparental genotype. The restoration of fertility occurs in spite of an autosomal and X-linked genome that is mostly of D. simulans origin. These results illustrate the multifactorial basis of genetic interactions involving the Y chromosome. Our study supports the hypothesis that the Y chromosome can contribute significantly to the evolution of reproductive isolation and highlights the conditional manifestation of infertility in

  3. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    PubMed

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  4. Clinical Significance of the Single Nucleotide Polymorphism TLR2 R753Q in Heart Transplant Recipients at Risk for Cytomegalovirus Disease

    PubMed Central

    Schneider, Martina; Matiqi, Teresa; Kundi, Michael; Rieder, Franz JJ; Andreas, Martin; Strassl, Robert; Zuckermann, Andreas; Jungbauer, Christof; Steininger, Christoph

    2017-01-01

    Background The Toll-like receptor 2 (TLR2) is a significant component of innate immunity against cytomegalovirus (CMV) infection but information on the clinical significance of the most common single nucleotide polymorphism (SNP) (R753Q) is conflicting. Objectives The inconsistent observations of the immunological and clinical significance of the TLR2 R753Q polymorphism for CMV infection indicates the influence of confounders. Study design The presence of the TLR2 polymorphism was determined by a genotyping assay of 175 HTX patients and 281 healthy blood donors and evaluated in relation to selected virological and clinical parameters. Results Relative frequency of TLR2 polymorphism was similar in HTX patients and blood donors (homozygous wild-type, 94.3% vs. 94.0%; heterozygous, 5.1% vs. 5.7%; homozygous mutated, <1%). CMV viremia was detectable in 108 (61.7%) of HTX patients. The TLR2 polymorphism was neither associated with occurrence or level of CMV infection nor with survival, graft failure or rejection, or CMV serostatus of patient before transplantation. Nevertheless, CMV viremia occurred in 83.1% of R+/D+, 77.1% of R+/D-, and 64.3% of R-/D+ patients. Time of first CMV viremia was in R-/D+ patients later than in CMV-seropositive patients (median, 182 days versus 23 days; P<0.001) corresponding to the duration of antiviral prophylaxis in R-/D+ patients. Conclusions The TLR2 R753Q polymorphism is extremely rare in the general population and HTX patients. Screening for this risk factor of CMV disease may not be cost-effective in contrast to testing for CMV viremia. PMID:27723526

  5. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    PubMed

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  6. Tourette's syndrome is not associated with interleukin-10 receptor 1 variants on chromosome 11q23.3.

    PubMed

    Kindler, Jochen; Schosser, Alexandra; Stamenkovic, Mara; Schloegelhofer, Monika; Leisch, Friedrich; Hornik, Kurt; Aschauer, Harald; Gasche, Christoph

    2008-01-15

    Interleukin-10 receptor 1 (IL-10R1) single nucleotide polymorphisms, located on chromosome 11q23 - a strong candidate for linkage with Tourette's syndrome (TS) - have been investigated for association with TS. DNA of 77 patients with a DSM-IV (Diagnostic and Statistical Manual IV) diagnosis of TS and 250 healthy controls was genotyped. IL-10R1 was not associated with TS.

  7. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data

    PubMed Central

    Zhang, Bo; Liu, Dajiang J.; Muscat, Joshua E.; Langan, Sara T.; Connor, James R.

    2017-01-01

    Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119–0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474–0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients’ survival in the TCGA data set of GBM. PMID:28358914

  8. Analysis of single nucleotide variants of HFE gene and association to survival in The Cancer Genome Atlas GBM data.

    PubMed

    Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R

    2017-01-01

    Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.

  9. Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

    PubMed

    Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

    2017-07-26

    Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

  10. Single nucleotide polymorphisms and microsatellites in the canine glutathione S-transferase pi 1 (GSTP1) gene promoter.

    PubMed

    Sacco, James; Mann, Sarah; Toral, Keller

    2017-01-01

    Genetic polymorphisms within the glutathione S-transferase P1 ( GSTP1 ) gene affect the elimination of toxic xenobiotics by the GSTP1 enzyme. In dogs, exposure to environmental chemicals that may be GSTP1 substrates is associated with cancer. The objectives of this study were to investigate the genetic variability in the GSTP1 promoter in a diverse population of 278 purebred dogs, compare the incidence of any variants found between breeds, and predict their effects on gene expression. To provide information on ancestral alleles, a number of wolves, coyotes, and foxes were also sequenced. Fifteen single nucleotide polymorphisms (SNPs) and two microsatellites were discovered. Three of these loci were only polymorphic in dogs while three other SNPs were unique to wolves and coyotes. The major allele at c.-46 is T in dogs but is C in the wild canids. The c.-185 delT variant was unique to dogs. The microsatellite located in the 5' untranslated region (5'UTR) was a highly polymorphic GCC tandem repeat, consisting of simple and compound alleles that varied in size from 10 to 22-repeat units. The most common alleles consisted of 11, 16, and 17-repeats. The 11-repeat allele was found in 10% of dogs but not in the other canids. Unequal recombination and replication slippage between similar and distinct alleles may be the mechanism for the multiple microsatellites observed. Twenty-eight haplotypes were constructed in the dog, and an additional 8 were observed in wolves and coyotes. While the most common haplotype acrossbreeds was the wild-type *1A(17), other prevalent haplotypes included *3A(11) in Greyhounds, *6A(16) in Labrador Retrievers, *9A(16) in Golden Retrievers, and *8A(19) in Standard Poodles. Boxers and Siberian Huskies exhibited minimal haplotypic diversity. Compared to the simple 16*1 allele, the compound 16*2 allele (found in 12% of dogs) may interfere with transcription factor binding and/or the stability of the GSTP1 transcript. Dogs and other canids exhibit

  11. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    PubMed Central

    Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

    2007-01-01

    Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic

  12. Interspecific Y chromosome variation is sufficient to rescue hybrid male sterility and is influenced by the grandparental origin of the chromosomes

    PubMed Central

    Araripe, L O; Tao, Y; Lemos, B

    2016-01-01

    Y chromosomes display population variation within and between species. Co-evolution within populations is expected to produce adaptive interactions between Y chromosomes and the rest of the genome. One consequence is that Y chromosomes from disparate populations could disrupt harmonious interactions between co-evolved genetic elements and result in reduced male fertility, sterility or inviability. Here we address the contribution of ‘heterospecific Y chromosomes' to fertility in hybrid males carrying a homozygous region of Drosophila mauritiana introgressed in the Drosophila simulans background. In order to detect Y chromosome–autosome interactions, which may go unnoticed in a single-species background of autosomes, we constructed hybrid genotypes involving three sister species: Drosophila simulans, D. mauritiana, and D. sechellia. These engineered strains varied due to: (i) species origin of the Y chromosome (D. simulans or D. sechellia); (ii) location of the introgressed D. mauritiana segment on the D. simulans third chromosome, and (iii) grandparental genomic background (three genotypes of D. simulans). We find complex interactions between the species origin of the Y chromosome, the identity of the D. mauritiana segment and the grandparental genetic background donating the chromosomes. Unexpectedly, the interaction of the Y chromosome and one segment of D. mauritiana drastically reduced fertility in the presence of Ysim, whereas the fertility is partially rescued by the Y chromosome of D. sechellia when it descends from a specific grandparental genotype. The restoration of fertility occurs in spite of an autosomal and X-linked genome that is mostly of D. simulans origin. These results illustrate the multifactorial basis of genetic interactions involving the Y chromosome. Our study supports the hypothesis that the Y chromosome can contribute significantly to the evolution of reproductive isolation and highlights the conditional manifestation of infertility in

  13. Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms.

    PubMed

    Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K

    2016-10-01

    Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.

  14. Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

    PubMed Central

    Lapitan Jr., Lorico D. S.; Guo, Yuan

    2015-01-01

    Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

  15. Associated analysis of single nucleotide polymorphisms found on exon 3 of the IGF-1 gene with Tibetan miniature pig growth traits.

    PubMed

    Yue, M; Tian, Y G; Wang, Y J; Gu, Y; Bayaer, N; Hu, Q; Gu, W W

    2014-02-27

    The IGF-1 gene is an important regulating factor that has a growth-promoting effect on growth hormone. The IGF-1 gene promotes muscle cell differentiation in the muscle cell formation process. The IGF-1 gene also regulates the growth of skeletal muscle during skeletal muscle growth. In addition, the IGF-1 gene plays an important role in the formation of mammals and poultry embryos, and the process of postnatal growth. The IGF-1 gene has been implicated as a candidate gene for the regulation of pig growth traits. We analyzed exon 3 of the IGF-1 gene polymorphism in Tibetan miniature pigs (N = 128) by polymerase chain reaction-single-strand conformation polymorphism and DNA sequencing. One single nucleotide polymorphism (T40C) was found on exon 3 of the IGF-1 gene. Statistical analysis of genotype frequencies revealed that the T allele was dominant in Tibetan miniature pigs at the T40C locus. The association analysis showed that the IGF-1 mutation had an effect on the body weight, body length, and chest circumference of pigs aged 6-8 months. In addition, the IGF-1 mutation had an effect on body weight in pigs aged 9-11 months (P < 0.05). We speculated that the pigs with the TT genotype grow more rapidly compared to those with the TC genotype. The TC genotype of the Tibetan miniature pig has a smaller body type. This information provides a theoretical basis for the genetic background of Tibetan miniature pigs.

  16. Polymorphic human somatostatin gene is located on chromosome 3.

    PubMed Central

    Naylor, S L; Sakaguchi, A Y; Shen, L P; Bell, G I; Rutter, W J; Shows, T B

    1983-01-01

    Somatostatin is a 14-amino-acid neuropeptide and hormone that inhibits the secretion of several peptide hormones. The human gene for somatostatin SST has been cloned, and the sequence has been determined. This clone was used as a probe in chromosome mapping studies to detect the human somatostatin sequence in human-rodent hybrids. Southern blot analysis of 41 hybrids, including some containing translocations of human chromosomes, placed SST in the q21 leads to qter region of chromosome 3. Human DNAs from unrelated individuals were screened for restriction fragment polymorphisms detectable by the somatostatin gene probe. Two polymorphisms were found: (i) an EcoRI variant located at the 3' end of the gene, found in Caucasian, U.S. Black, and Asian populations with a frequency of approximately 0.10 and (ii) a BamHI variant in the intron, which occurs in Caucasians at a frequency of 0.13. Images PMID:6133281

  17. A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

    PubMed Central

    Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

    2010-01-01

    Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

  18. Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls

    PubMed Central

    Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H. M.; Gurjar, Suraj K.; Gupta, I. D.; Verma, Archana

    2017-01-01

    Aim: This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Materials and Methods: Genomic DNA was isolated by phenol–chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. Results: The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5’UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. Conclusion: A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible. PMID:28344410

  19. Single-Nucleotide Polymorphism Markers from De-Novo Assembly of the Pomegranate Transcriptome Reveal Germplasm Genetic Diversity

    PubMed Central

    Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

    2014-01-01

    Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature. PMID:24558460

  20. Single-nucleotide polymorphism markers from de-novo assembly of the pomegranate transcriptome reveal germplasm genetic diversity.

    PubMed

    Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron

    2014-01-01

    Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature.

  1. [Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

    PubMed

    Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

    2014-07-01

    The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

  2. [Analysis on genetic polymorphism of 5 STR loci selected from X chromosome].

    PubMed

    Liu, Qi-ji; Gong, Yao-qin; Zhang, Xi-yu; Gao, Gui-min; Li, Jiang-xia; Guo, Yi-shou

    2005-02-01

    To select short tandem repeats(STR) from X chromosome. STR is a universal genetic marker that has changeable polymorphism and stable heredity in human genome. It is a specific DNA segment composed of 2-6 base pairs as its core sequence. It is an ideal DNA marker used in linkage analysis and gene mapping. In this study, 8 short tandem repeats were selected from two genomic clones on X chromosome by using BCM Search Launcher. Primers amplifying the STR loci were designed by using Primer 3.0 according to the unique sequence flanking the STRs. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five of these STRs were polymorphic. Chi-square test indicated that the distribution of genotypes agreed with Hardy-Weinberg equilibrium (P>0.05). Five polymorphic short tandem repeats have been identified on chromosome X and will be useful for linkage analysis and gene mapping.

  3. Genetic structure in contemporary south Tyrolean isolated populations revealed by analysis of Y-chromosome, mtDNA, and Alu polymorphisms.

    PubMed

    Pichler, Irene; Mueller, Jakob C; Stefanov, Stefan A; De Grandi, Alessandro; Volpato, Claudia Beu; Pinggera, Gerd K; Mayr, Agnes; Ogriseg, Martin; Ploner, Franz; Meitinger, Thomas; Pramstaller, Peter P

    2006-08-01

    Most of the inhabitants of South Tyrol in the eastern Italian Alps can be considered isolated populations because of their physical separation by mountain barriers and their sociocultural heritage. We analyzed the genetic structure of South Tyrolean populations using three types of genetic markers: Y-chromosome, mitochondrial DNA (mtDNA), and autosomal Alu markers. Using random samples taken from the populations of Val Venosta, Val Pusteria, Val Isarco, Val Badia, and Val Gardena, we calculated genetic diversity within and among the populations. Microsatellite diversity and unique event polymorphism diversity (on the Y chromosome) were substantially lower in the Ladin-speaking population of Val Badia compared to the neighboring German-speaking populations. In contrast, the genetic diversity of mtDNA haplotypes was lowest for the upper Val Venosta and Val Pusteria. These data suggest a low effective population size, or little admixture, for the gene pool of the Ladin-speaking population from Val Badia. Interestingly, this is more pronounced for Ladin males than for Ladin females. For the pattern of genetic Alu variation, both Ladin samples (Val Gardena and Val Badia) are among the samples with the lowest diversity. An admixture analysis of one German-speaking valley (Val Venosta) indicates a relatively high genetic contribution of Ladin origin. The reduced genetic diversity and a high genetic differentiation in the Rhaetoroman- and German-speaking South Tyrolean populations may constitute an important basis for future medical genetic research and gene mapping studies in South Tyrol.

  4. Adaptive divergence in the monkey flower Mimulus guttatus is maintained by a chromosomal inversion

    PubMed Central

    Twyford, Alex D.; Friedman, Jannice

    2015-01-01

    Organisms exhibit an incredible diversity of life history strategies as adaptive responses to environmental variation. The establishment of novel life history strategies involves multilocus polymorphisms, which will be challenging to establish in the face of gene flow and recombination. Theory predicts that adaptive allelic combinations may be maintained and spread if they occur in genomic regions of reduced recombination, such as chromosomal inversion polymorphisms, yet empirical support for this prediction is lacking. Here, we use genomic data to investigate the evolution of divergent adaptive ecotypes of the yellow monkey flower Mimulus guttatus. We show that a large chromosomal inversion polymorphism is the major region of divergence between geographically widespread annual and perennial ecotypes. In contrast, ∼40,000 single nucleotide polymorphisms in collinear regions of the genome show no signal of life history, revealing genomic patterns of diversity have been shaped by localized homogenizing gene flow and large‐scale Pleistocene range expansion. Our results provide evidence for an inversion capturing and protecting loci involved in local adaptation, while also explaining how adaptive divergence can occur with gene flow. PMID:25879251

  5. Isolation and characterization of Y chromosome sequences from the African malaria mosquito Anopheles gambiae.

    PubMed Central

    Krzywinski, Jaroslaw; Nusskern, Deborah R; Kern, Marcia K; Besansky, Nora J

    2004-01-01

    The karyotype of the African malaria mosquito Anopheles gambiae contains two pairs of autosomes and a pair of sex chromosomes. The Y chromosome, constituting approximately 10% of the genome, remains virtually unexplored, despite the recent completion of the A. gambiae genome project. Here we report the identification and characterization of Y chromosome sequences of total length approaching 150 kb. We developed 11 Y-specific PCR markers that consistently yielded male-specific products in specimens from both laboratory colony and natural populations. The markers are characterized by low sequence polymorphism in samples collected across Africa and by presence in more than one copy on the Y. Screening of the A. gambiae BAC library using these markers allowed detection of 90 Y-linked BAC clones. Analysis of the BAC sequences and other Y-derived fragments showed massive accumulation of a few transposable elements. Nevertheless, more complex sequences are apparently present on the Y; these include portions of an approximately 48-kb-long unmapped AAAB01008227 scaffold from the whole genome shotgun assembly. Anopheles Y appears not to harbor any of the genes identified in Drosophila Y. However, experiments suggest that one of the ORFs from the AAAB01008227 scaffold represents a fragment of a gene with male-specific expression. PMID:15082548

  6. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  7. Male chromosomal polymorphisms reduce cumulative live birth rate for IVF couples.

    PubMed

    Ni, Tianxiang; Li, Jing; Chen, Hong; Gao, Yuan; Gao, Xuan; Yan, Junhao; Chen, Zi-Jiang

    2017-08-01

    Chromosomal polymorphisms are associated with infertility, but their effects on assisted reproductive outcomes are still quite conflicting, especially after IVF treatment. This study evaluated the role of chromosomal polymorphisms of different genders in IVF pregnancy outcomes. Four hundred and twenty-five infertile couples undergoing IVF treatment were divided into three groups: 214 couples with normal chromosomes (group A, control group), 86 couples with female polymorphisms (group B), and 125 couples with male polymorphisms (group C). The pregnancy outcomes after the first and cumulative transfer cycles were analyzed, and the main outcome measures were live birth rate (LBR) after the first transfer cycle and cumulative LBR after a complete IVF cycle. Comparison of pregnancy outcomes after the first transfer cycle within group A, group B, and group C demonstrated a similar LBR as well as other rates of implantation, clinical pregnancy, early miscarriage, and ongoing pregnancy (P > 0.05). However, the analysis of cumulative pregnancy outcomes indicated that compared with group A, group C had a significantly lower LBR per cycle (80.4 vs 68.00%), for a rate ratio of 1.182 (95% CI 1.030 to 1.356, P = 0.01) and a significantly higher cumulative early miscarriage rate (EMR) among clinical pregnancies (7.2 vs 14.7%), for a rate ratio of 0.489 (95% CI 0.248 to 0.963, P = 0.035). Couples with chromosomal polymorphisms in only male partners have poor pregnancy outcomes after IVF treatment manifesting as high cumulative EMR and low LBR after a complete cycle.

  8. Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods.

    PubMed

    Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge

    2006-12-01

    The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

  9. Characterization of the OmyY1 region on the rainbow trout Y chromosome

    USGS Publications Warehouse

    Phillips, Ruth B.; DeKoning, Jenefer J.; Brunelli, Joseph P.; Faber-Hammond, Joshua J.; Hansen, John D.; Christensen, Kris A.; Renn, Suzy C.P.; Thorgaard, Gary H.

    2013-01-01

    We characterized the male-specific region on the Y chromosome of rainbow trout, which contains both sdY (the sex-determining gene) and the male-specific genetic marker, OmyY1. Several clones containing the OmyY1 marker were screened from a BAC library from a YY clonal line and found to be part of an 800 kb BAC contig. Using fluorescence in situ hybridization (FISH), these clones were localized to the end of the short arm of the Y chromosome in rainbow trout, with an additional signal on the end of the X chromosome in many cells. We sequenced a minimum tiling path of these clones using Illumina and 454 pyrosequencing. The region is rich in transposons and rDNA, but also appears to contain several single-copy protein-coding genes. Most of these genes are also found on the X chromosome; and in several cases sex-specific SNPs in these genes were identified between the male (YY) and female (XX) homozygous clonal lines. Additional genes were identified by hybridization of the BACs to the cGRASP salmonid 4x44K oligo microarray. By BLASTn evaluations using hypothetical transcripts of OmyY1-linked candidate genes as query against several EST databases, we conclude at least 12 of these candidate genes are likely functional, and expressed.

  10. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  11. Analysis of glutathione S-transferase Pi isoform (GSTP1) single-nucleotide polymorphisms and macular telangiectasia type 2.

    PubMed

    Szental, Joshua A; Baird, Paul N; Richardson, Andrea J; Islam, F M Amirul; Scholl, Hendrik P N; Charbel Issa, Peter; Holz, Frank G; Gillies, Mark; Guymer, Robyn H

    2010-12-01

    Recent imaging studies have suggested that macular pigment is decreased centrally in macular telangiectasia type 2 (MT2). The uptake of xanthophyll pigment into the macula is thought to be facilitated by a xanthophyll-binding protein (XBP). The Pi isoform of glutathione S-transferase (GSTP1) represents one such XBP with high binding affinity. This case-control study aimed to determine whether two common single-nucleotide polymorphisms (SNPs) of GSTP1 were associated with MT2. DNA samples from 39 cases and 21 controls were collected. Two polymorphic sites of Ile105Val and Ala114Val in exons 5 and 6 respectively, of the GSTP1 gene were analysed. Comparison of alleles and genotypes between cases and controls indicated that there were no statistically significant differences for either the Ile105Val SNP (P=0.43) or the Ala114Val SNP (P=0.85), or for any combinations; however, the homozygous at-risk genotype (GG) of the Ile105Val SNP was present in 8% of cases but absent in controls. This study found no statistically significant association between two common GSTP1 SNPs and MT2; however, a trend towards a greater frequency of the GG genotype of the Ile105Val SNP in cases is of great interest. The biological plausibility of disturbed macular pigment uptake in MT2 makes GSTP1 an excellent candidate gene. Further investigation is warranted in future studies of MT2.

  12. HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

    PubMed

    Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

    2007-04-04

    To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

  13. Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

    PubMed Central

    2011-01-01

    Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

  14. Absence of association of a single-nucleotide polymorphism in the TERT-CLPTM1L locus with age-related phenotypes in a large multicohort study: the HALCyon programme.

    PubMed

    Alfred, Tamuno; Ben-Shlomo, Yoav; Cooper, Rachel; Hardy, Rebecca; Cooper, Cyrus; Deary, Ian J; Elliott, Jane; Gunnell, David; Harris, Sarah E; Kivimaki, Mika; Kumari, Meena; Martin, Richard M; Power, Chris; Sayer, Avan Aihie; Starr, John M; Kuh, Diana; Day, Ian N M

    2011-06-01

    Several age-related traits are associated with shorter telomeres, the structures that cap the end of linear chromosomes. A common polymorphism near the telomere maintenance gene TERT has been associated with several cancers, but relationships with other aging traits such as physical capability have not been reported. As part of the Healthy Ageing across the Life Course (HALCyon) collaborative research programme, men and women aged between 44 and 90 years from nine UK cohorts were genotyped for the single-nucleotide polymorphism (SNP) rs401681. We then investigated relationships between the SNP and 30 age-related phenotypes, including cognitive and physical capability, blood lipid levels and lung function, pooling within-study genotypic effects in meta-analyses. No significant associations were found between the SNP and any of the cognitive performance tests (e.g. pooled beta per T allele for word recall z-score = 0.02, 95% CI: -0.01 to 0.04, P-value = 0.12, n = 18,737), physical performance tests (e.g. pooled beta for grip strength = -0.02, 95% CI: -0.045 to 0.006, P-value = 0.14, n = 11,711), blood pressure, lung function or blood test measures. Similarly, no differences in observations were found when considering follow-up measures of cognitive or physical performance after adjusting for its measure at an earlier assessment. The lack of associations between SNP rs401681 and a wide range of age-related phenotypes investigated in this large multicohort study suggests that while this SNP may be associated with cancer, it is not an important contributor to other markers of aging. © 2011 The Authors. Aging Cell © 2011 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

  15. Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

    PubMed

    Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

    2017-01-01

    Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

  16. Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

    PubMed

    Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

    2008-08-01

    Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

  17. Single nucleotide polymorphisms typing of Mycobacterium leprae reveals focal transmission of leprosy in high endemic regions of India.

    PubMed

    Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U

    2013-11-01

    Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  18. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

    PubMed

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

    2013-12-01

    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  19. The association of phosphatase and tensin homolog deleted on chromosome 10 polymorphisms and lifestyle habits with colorectal cancer risk in a Chinese population.

    PubMed

    Jing, Fangyuan; Mao, Yingying; Zhang, Zhenyu; Li, Yingjun; Cai, Shaofang; Li, Qilong; Ma, Xinyuan; Jin, Mingjuan; Chen, Kun

    2014-09-01

    The PI3K signaling pathway plays an important role in the development of colorectal cancer (CRC) and other neoplasm. Somatic phosphatase and tensin homolog deleted on chromosome 10 (PTEN) mutations and deletions or epigenetic silencing have been observed in multiple tumor types including CRC. To assess the association of PTEN polymorphisms and lifestyle habits with CRC risk in Chinese population, we carried out a case-control study which included 545 cases and 522 controls. In the present study, we genotyped eight single-nucleotide polymorphisms (SNPs) in PTEN and found that rs11202607 was associated with increased CRC risk (odds ratio (OR) = 1.40, 95 % confidence interval (CI) = 1.04-1.90). Stratification analysis by lifestyle habits showed a stronger association between rs11202607 and CRC risk among never tea drinkers than that among tea-drinkers (OR = 2.04, 95 % CI 1.29-3.22), and significant additive interaction between rs10490920 and tea drinking status was observed. Our study provided the evidence of an association between PTEN polymorphisms and the risk of CRC and significant additive interaction between PTEN polymorphism and tea drinking. Studies with larger sample size and further investigations into the mechanism are warranted to clarify the role of PTEN in colorectal carcinogenesis and the association between PTEN genetic variations, environment exposure, and CRC risk.

  20. Convergent evolution of Y chromosome gene content in flies.

    PubMed

    Mahajan, Shivani; Bachtrog, Doris

    2017-10-04

    Sex-chromosomes have formed repeatedly across Diptera from ordinary autosomes, and X-chromosomes mostly conserve their ancestral genes. Y-chromosomes are characterized by abundant gene-loss and an accumulation of repetitive DNA, yet the nature of the gene repertoire of fly Y-chromosomes is largely unknown. Here we trace gene-content evolution of Y-chromosomes across 22 Diptera species, using a subtraction pipeline that infers Y genes from male and female genome, and transcriptome data. Few genes remain on old Y-chromosomes, but the number of inferred Y-genes varies substantially between species. Young Y-chromosomes still show clear evidence of their autosomal origins, but most genes on old Y-chromosomes are not simply remnants of genes originally present on the proto-sex-chromosome that escaped degeneration, but instead were recruited secondarily from autosomes. Despite almost no overlap in Y-linked gene content in different species with independently formed sex-chromosomes, we find that Y-linked genes have evolved convergent gene functions associated with testis expression. Thus, male-specific selection appears as a dominant force shaping gene-content evolution of Y-chromosomes across fly species.While X-chromosome gene content tends to be conserved, Y-chromosome evolution is dynamic and difficult to reconstruct. Here, Mahajan and Bachtrog use a subtraction pipeline to identify Y-linked genes in 22 Diptera species, revealing patterns of Y-chromosome gene-content evolution.

  1. Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

    PubMed

    Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

    2014-10-24

    Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

  2. Chromosome-scale selective sweeps shape Caenorhabditis elegans genomic diversity

    PubMed Central

    Andersen, Erik C.; Gerke, Justin P.; Shapiro, Joshua A.; Crissman, Jonathan R.; Ghosh, Rajarshi; Bloom, Joshua S.; Félix, Marie-Anne; Kruglyak, Leonid

    2011-01-01

    The nematode Caenorhabditis elegans is central to research in molecular, cell, and developmental biology, but nearly all of this research has been conducted on a single strain. Comparatively little is known about the population genomic and evolutionary history of this species. We characterized C. elegans genetic variation by high-throughput selective sequencing of a worldwide collection of 200 wild strains, identifying 41,188 single nucleotide polymorphisms. Unexpectedly, C. elegans genome variation is dominated by a set of commonly shared haplotypes on four of the six chromosomes, each spanning many megabases. Population-genetic modeling shows that this pattern was generated by chromosome-scale selective sweeps that have reduced variation worldwide; at least one of these sweeps likely occurred in the past few hundred years. These sweeps, which we hypothesize to be a result of human activity, have dramatically reshaped the global C. elegans population in the recent past. PMID:22286215

  3. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    PubMed

    Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

    2015-01-01

    Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  4. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    PubMed

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  5. Population Genetics of Verticillium dahliae in Iran Based on Microsatellite and Single Nucleotide Polymorphism Markers.

    PubMed

    Rafiei, Vahideh; Banihashemi, Ziaeddin; Bautista-Jalon, Laura S; Del Mar Jiménez-Gasco, Maria; Turgeon, B Gillian; Milgroom, Michael G

    2018-06-01

    Verticillium dahliae is a plant pathogenic fungus that reproduces asexually and its population structure is highly clonal. In the present study, 78 V. dahliae isolates from Iran were genotyped for mating type, single nucleotide polymorphisms (SNPs), and microsatellites to assign them to clonal lineages and to determine population genetic structure in Iran. The mating type of all isolates was MAT1-2. Based on neighbor-joining analysis and minimum spanning networks constructed from SNPs and microsatellite genotypes, respectively, all but four isolates were assigned to lineage 2B 824 ; four isolates were assigned to lineage 4B. The inferred coalescent genealogy of isolates in lineage 2B 824 showed a clear divergence into two clades that corresponded to geographic origin and host. Haplotypes of cotton and pistachio isolates sampled from central Iran were in one clade, and those of isolates from Prunus spp. sampled from northwestern Iran were in the other. The strong divergence in haplotypes between the two clades suggests that there were at least two separate introductions of lineage 2B 824 to different parts of Iran. Given the history of cotton and pistachio cultivation and Verticillium wilt in Iran, these results are consistent with the hypothesis that cotton was historically a likely source inoculum causing Verticillium wilt in pistachio.

  6. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.

    PubMed

    Anderson, Eric C; Ng, Thomas C

    2016-02-01

    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.

  7. Sequence conservation on the Y chromosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibson, L.H.; Yang-Feng, L.; Lau, C.

    The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less

  8. Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

    PubMed

    Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

    2016-11-20

    BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

  9. Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

    PubMed Central

    Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

    2016-01-01

    Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

  10. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  11. Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

    PubMed Central

    Bernardo, Amy N; Bradbury, Peter J; Ma, Hongxiang; Hu, Shengwa; Bowden, Robert L; Buckler, Edward S; Bai, Guihua

    2009-01-01

    Background Wheat (Triticum aestivum L.) is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb) and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP) is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85) were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat. PMID:19480702

  12. Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

    PubMed

    Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

    2017-04-01

    Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

  13. Dissecting tocopherols content in maize (Zea mays L.), using two segregating populations and high-density single nucleotide polymorphism markers

    PubMed Central

    2012-01-01

    Background Tocopherols, which are vitamin E compounds, play an important role in maintaining human health. Compared with other staple foods, maize grains contain high level of tocopherols. Results Two F2 populations (K22/CI7 and K22/Dan340, referred to as POP-1 and POP-2, respectively), which share a common parent (K22), were developed and genotyped using a GoldenGate assay containing 1,536 single nucleotide polymorphism (SNP) markers. An integrated genetic linkage map was constructed using 619 SNP markers, spanning a total of 1649.03 cM of the maize genome with an average interval of 2.67 cM. Seventeen quantitative trait loci (QTLs) for all the traits were detected in the first map and 13 in the second. In these two maps, QTLs for different traits were localized to the same genomic regions and some were co-located with candidate genes in the tocopherol biosynthesis pathway. Single QTL was responsible for 3.03% to 52.75% of the phenotypic variation and the QTLs in sum explained23.4% to 66.52% of the total phenotypic variation. A major QTL (qc5-1/qd5-1) affecting α-tocopherol (αT) was identified on chromosome 5 between the PZA03161.1 and PZA02068.1 in the POP-2. The QTL region was narrowed down from 18.7 Mb to 5.4 Mb by estimating the recombination using high-density markers of the QTL region. This allowed the identification of the candidate gene VTE4 which encodes γ-tocopherol methyltransferase, an enzyme that transforms γ-tocopherol (γT)to αT. Conclusions These results demonstrate that a few QTLs with major effects and several QTLs with medium to minor effects might contribute to the natural variation of tocopherols in maize grain. The high-density markers will help to fine map and identify the QTLs with major effects even in the preliminary segregating populations. Furthermore, this study provides a simple guide line for the breeders to improve traits that minimize the risk of malnutrition, especially in developing countries. PMID:23122295

  14. Long-Read Single Molecule Sequencing to Resolve Tandem Gene Copies: The Mst77Y Region on the Drosophila melanogaster Y Chromosome

    PubMed Central

    Krsticevic, Flavia J.; Schrago, Carlos G.; Carvalho, A. Bernardo

    2015-01-01

    The autosomal gene Mst77F of Drosophila melanogaster is essential for male fertility. In 2010, Krsticevic et al. (Genetics 184: 295−307) found 18 Y-linked copies of Mst77F (“Mst77Y”), which collectively account for 20% of the functional Mst77F-like mRNA. The Mst77Y genes were severely misassembled in the then-available genome assembly and were identified by cloning and sequencing polymerase chain reaction products. The genomic structure of the Mst77Y region and the possible existence of additional copies remained unknown. The recent publication of two long-read assemblies of D. melanogaster prompted us to reinvestigate this challenging region of the Y chromosome. We found that the Illumina Synthetic Long Reads assembly failed in the Mst77Y region, most likely because of its tandem duplication structure. The PacBio MHAP assembly of the Mst77Y region seems to be very accurate, as revealed by comparisons with the previously found Mst77Y genes, a bacterial artificial chromosome sequence, and Illumina reads of the same strain. We found that the Mst77Y region spans 96 kb and originated from a 3.4-kb transposition from chromosome 3L to the Y chromosome, followed by tandem duplications inside the Y chromosome and invasion of transposable elements, which account for 48% of its length. Twelve of the 18 Mst77Y genes found in 2010 were confirmed in the PacBio assembly, the remaining six being polymerase chain reaction−induced artifacts. There are several identical copies of some Mst77Y genes, coincidentally bringing the total copy number to 18. Besides providing a detailed picture of the Mst77Y region, our results highlight the utility of PacBio technology in assembling difficult genomic regions such as tandemly repeated genes. PMID:25858959

  15. Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

    PubMed

    Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

    2010-10-01

    The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

  16. A polymorphic pseudoautosomal boundary in the Carica papaya sex chromosomes.

    PubMed

    Lappin, Fiona M; Medert, Charles M; Hawkins, Kevin K; Mardonovich, Sandra; Wu, Meng; Moore, Richard C

    2015-08-01

    Sex chromosomes are defined by a non-recombining sex-determining region (SDR) flanked by one or two pseudoautosomal regions (PARs). The genetic composition and evolutionary dynamics of the PAR is also influenced by its linkage to the differentiated non-recombining SDR; however, understanding the effects of this linkage requires a precise definition of the PAR boundary. Here, we took a molecular population genetic approach to further refine the location of the PAR boundary of the evolutionary young sex chromosomes of the tropical plant, Carica papaya. We were able to map the position of the papaya PAR boundary A to a 100-kb region between two genetic loci approximately 2 Mb upstream of the previously genetically identified PAR boundary. Furthermore, this boundary is polymorphic within natural populations of papaya, with an approximately 100-130 kb expansion of the non-recombining SDR found in 16 % of individuals surveyed. The expansion of the PAR boundary in one Y haplotype includes at least one additional gene. Homologs of this gene are involved in male gametophyte and pollen development in other plant species.

  17. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    PubMed Central

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  18. Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

    PubMed Central

    Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

    2015-01-01

    Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

  19. Y chromosome evidence for Anglo-Saxon mass migration.

    PubMed

    Weale, Michael E; Weiss, Deborah A; Jager, Rolf F; Bradman, Neil; Thomas, Mark G

    2002-07-01

    British history contains several periods of major cultural change. It remains controversial as to how much these periods coincided with substantial immigration from continental Europe, even for those that occurred most recently. In this study, we examine genetic data for evidence of male immigration at particular times into Central England and North Wales. To do this, we used 12 biallelic polymorphisms and six microsatellite markers to define high-resolution Y chromosome haplotypes in a sample of 313 males from seven towns located along an east-west transect from East Anglia to North Wales. The Central English towns were genetically very similar, whereas the two North Welsh towns differed significantly both from each other and from the Central English towns. When we compared our data with an additional 177 samples collected in Friesland and Norway, we found that the Central English and Frisian samples were statistically indistinguishable. Using novel population genetic models that incorporate both mass migration and continuous gene flow, we conclude that these striking patterns are best explained by a substantial migration of Anglo-Saxon Y chromosomes into Central England (contributing 50%-100% to the gene pool at that time) but not into North Wales.

  20. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    PubMed Central

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  1. A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

    PubMed

    Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

    2013-12-04

    Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Binary and microsatellite polymorphisms of the Y-chromosome in the Mbenzele pygmies from the Central African Republic.

    PubMed

    Coia, Valentina; Caglià, Alessandra; Arredi, Barbara; Donati, Francesco; Santos, Fabrício R; Pandya, Arpita; Taglioli, Luca; Paoli, Giorgio; Pascali, Vincenzo; Spedini, Gabriella; Destro-Bisol, Giovanni; Tyler-Smith, Chris

    2004-01-01

    This study analyzes the variation of six binary polymorphisms and six microsatellites in the Mbenzele Pygmies from the Central African Republic. Five different haplogroups (B2b, E(xE3a), E3a, P and BR(xB2b,DE,P)) were observed, with frequencies ranging from 0.022 (haplogroup P) to 0.609 (haplogroup E3a). A comparison of haplogroup frequencies indicates a close genetic affinity between the Mbenzele and the Biaka Pygmies, a finding consistent with the common origin and the geographical proximity of the two populations. The haplogroups P, BR(xB2b,DE,P) and E(xE3a), which are rare in sub-Saharan Africa but common in western Eurasia, were observed with frequencies ranging from 0.022 (haplogroup P) to 0.087 (haplogroup E(xE3a)). Thirty different microsatellite haplotypes were detected, with frequencies ranging from 0.022 to 0.152. The Mbenzele share the highest percent of microsatellite haplotypes with the Biaka Pygmies. Five out seven haplotypes which are shared by the Mbenzele and Biaka Pygmies belong to haplogroup E3a, which suggests that they are of Bantu origin. The plot based on F(st) genetic distances calculated using microsatellite data provides a picture of population relationships which is in part congruent and in part complementary to that obtained using haplogroup frequencies. Finally, the Mbenzele and Biaka Pygmies were found to be markedly more genetically similar using Y-chromosomal than autosomal microsatellites. We suggest that this could be due to the higher phylogenetic stability of Y-chromosome and to the effect of the male-biased gene flow during the Bantu expansion. Copyright 2003 Wiley-Liss, Inc.

  3. [Relationship between single nucleotide polymorphisms in thiopurine methyltransferase gene and tolerance to thiopurines in acute leukemia].

    PubMed

    Ma, Xiao-li; Zhu, Ping; Wu, Min-yuan; Li, Zhi-gang; Hu, Ya-mei

    2003-12-01

    For the purpose of clarifying the influence of thiopurine methyltransferase (TPMT) gene single nucleotide polymorphisms (SNPs) on the efficacy of thiopurines and risk for its toxicity and therefore improving the safety and efficacy of thiopurines, the authors investigated TPMT genotype in acute leukemia in children who were intolerant to the treatment with 6-mercap topurine (6-MP). TPMT genotype was determined in an unrelated population of 250 Chinese healthy blood donors and 280 children with acute leukemia. TPMT genotyping assay was based on polymerase chain reaction (PCR), restriction digestion of PCR products, denaturing high-performance liquid chromatography (DHPLC) and direct DNA sequencing in the TPMT * 2 (G238C), TPMT * 3A (G460A, A719G) and TPMT * 3C (A719G). There were 10 TPMT * 1/TPMT * 3C heterozygotes in 280 children. The frequency of the polymorphism was 3.6%. All the involved alleles were TPMT * 3C. Of the 160 children acute leukemia evaluated, 45 (26%) were intolerant to 6-MP. Presentations included hepatotoxicity and hematological toxicity. Six out of 45 children were heterozygous, while the other 39 were wild type homozygous. Before dosage adjustments for thiopurine, the hematologic toxicity and hepatotoxicity in TPMT heterozygous individuals occurred more frequently than in homozygous. Therefore, cases of TPMT heterozygotes experienced more missed doses of 6-MP. TPMT genotype is associated with tolerance in acute leukemia in children. The heterozygote individuals have low TPMT activity. Therefore the frequencies of hemtopoietic toxicity and hepatoxicity are high after using 6-MP. Detection of SNPs in the TPMT genes is useful in identifying children before administration of 6-MP.

  4. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    PubMed

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. A selective sweep of >8 Mb on chromosome 26 in the Boxer genome.

    PubMed

    Quilez, Javier; Short, Andrea D; Martínez, Verónica; Kennedy, Lorna J; Ollier, William; Sanchez, Armand; Altet, Laura; Francino, Olga

    2011-07-01

    Modern dog breeds display traits that are either breed-specific or shared by a few breeds as a result of genetic bottlenecks during the breed creation process and artificial selection for breed standards. Selective sweeps in the genome result from strong selection and can be detected as a reduction or elimination of polymorphism in a given region of the genome. Extended regions of homozygosity, indicative of selective sweeps, were identified in a genome-wide scan dataset of 25 Boxers from the United Kingdom genotyped at ~20,000 single-nucleotide polymorphisms (SNPs). These regions were further examined in a second dataset of Boxers collected from a different geographical location and genotyped using higher density SNP arrays (~170,000 SNPs). A selective sweep previously associated with canine brachycephaly was detected on chromosome 1. A novel selective sweep of over 8 Mb was observed on chromosome 26 in Boxer and for a shorter region in English and French bulldogs. It was absent in 171 samples from eight other dog breeds and 7 Iberian wolf samples. A region of extended increased heterozygosity on chromosome 9 overlapped with a previously reported copy number variant (CNV) which was polymorphic in multiple dog breeds. A selective sweep of more than 8 Mb on chromosome 26 was identified in the Boxer genome. This sweep is likely caused by strong artificial selection for a trait of interest and could have inadvertently led to undesired health implications for this breed. Furthermore, we provide supporting evidence for two previously described regions: a selective sweep on chromosome 1 associated with canine brachycephaly and a CNV on chromosome 9 polymorphic in multiple dog breeds.

  6. Relationships between Podolic cattle breeds assessed by single nucleotide polymorphisms (SNPs) genotyping.

    PubMed

    Pariset, L; Mariotti, M; Nardone, A; Soysal, M I; Ozkan, E; Williams, J L; Dunner, S; Leveziel, H; Maróti-Agóts, A; Bodò, I; Valentini, A

    2010-12-01

    Italian Maremmana, Turkish Grey and Hungarian Grey breeds belong to the same Podolic group of cattle, have a similar conformation and recently experienced a similar demographic reduction. The aim of this study was to assess the relationship among the analysed Podolic breeds and to verify whether their genetic state reflects their history. To do so, approximately 100 single nucleotide polymorphisms (SNPs) were genotyped on individuals belonging to these breeds and compared to genotypes of individuals of two Italian beef breeds, Marchigiana and Piemontese, which underwent different selection and migration histories. Population genetic parameters such as allelic frequencies and heterozygosity values were assessed, genetic distances calculated and assignment test performed to evaluate the possibility of recent admixture between the populations. The data show that the physical similarity among the Podolic breeds examined, and particularly between Hungarian Grey and Maremmana cattle that experienced admixture in the recent past, is mainly morphological. The assignment of individuals from genotype data was achieved using Bayesian inference, confirming that the set of chosen SNPs is able to distinguish among the breeds and that the breeds are genetically distinct. Individuals of Turkish Grey breed were clearly assigned to their breed of origin for all clustering alternatives, showing that this breed can be differentiated from the others on the basis of the allelic frequencies. Remarkably, in the Turkish Grey there were differences observed between the population of Enez district, where in situ conservation studies are practised, and that of Bandirma district of Balikesir, where ex situ conservation studies are practised out of the original raising area. In conclusion, this study demonstrates that molecular data could be used to reveal an unbiased view of past events and provide the basis for a rational exploitation of livestock, suggesting appropriate cross-breeding plans

  7. EnsembleGASVR: a novel ensemble method for classifying missense single nucleotide polymorphisms.

    PubMed

    Rapakoulia, Trisevgeni; Theofilatos, Konstantinos; Kleftogiannis, Dimitrios; Likothanasis, Spiros; Tsakalidis, Athanasios; Mavroudi, Seferina

    2014-08-15

    Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem of missing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a two-step algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. Datasets and codes are freely available on the Web at http://prlab.ceid.upatras.gr/EnsembleGASVR/dataset-codes.zip. All the required information about the article is available through http

  8. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Non-synonymous single nucleotide polymorphisms in genes for immunoregulatory galectins: association of galectin-8 (F19Y) occurrence with autoimmune diseases in a Caucasian population.

    PubMed

    Pál, Zsuzsanna; Antal, Péter; Srivastava, Sanjeev Kumar; Hullám, Gábor; Semsei, Agnes F; Gál, János; Svébis, Mihály; Soós, Györgyi; Szalai, Csaba; André, Sabine; Gordeeva, Elena; Nagy, György; Kaltner, Herbert; Bovin, Nicolai V; Molnár, Mária Judit; Falus, András; Gabius, Hans-Joachim; Buzás, Edit Irén

    2012-10-01

    Galectins are potent immune regulators, with galectin-8 acting as a pro-apoptotic effector on synovial fluid cells and thymocytes and stimulator on T-cells. To set a proof-of-principle example for risk assessment in autoimmunity, and for a mutation affecting physiological galectin sensor functions, a polymorphism in the coding region of the galectin-8 gene (rs2737713; F19Y) was studied for its association with two autoimmune disorders, i.e. rheumatoid arthritis and myasthenia gravis. A case-control analysis and a related quantitative trait-association study were performed to investigate the association of this polymorphism in patients (myasthenia gravis 149, rheumatoid arthritis 214 and 134 as primary and repetitive cohorts, respectively) and 365 ethnically matched (Caucasian) healthy controls. Distribution was also investigated in patients grouped according to their antibody status and age at disease onset. Comparative testing for lectin activity was carried out in ELISA/ELLA-based binding tests with both wild-type and F19Y mutant galectin-8 from peripheral blood mononuclear cell lysates of healthy individuals with different genotypes as well as with recombinant wild-type and F19Y mutant galectin-8 proteins. A strong association was found for rheumatoid arthritis, and a mild one with myasthenia gravis. Furthermore, the presence of the sequence deviation also correlated with age at disease onset in the case of rheumatoid arthritis. The F19Y substitution did not appear to affect carbohydrate binding in solid-phase assays markedly. This is the first report of an association between a galectin-based polymorphism leading to a mutant protein and autoimmune diseases, with evidence for antagonistic pleiotropy. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Identification of Prostate Cancer Predisposition Genes on the Y Chromosome

    DTIC Science & Technology

    2017-10-01

    sequencing was submitted. We used available Utah data for ~1,000 Y chromosome SNPs on 80 high risk Y chromosomes and 150 low risk Y chromosomes with some Y...chromosome genotype data available . The set of ~1,000 SNPs was used to perform a phylogenetic analysis of the high vs low r isk Y chromosomes; some...SNPs on a set of 80 high risk Y chromosomes and a set of 150 low risk Y chromosomes with some Y chromosome genotype data available . We identified

  11. Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

    PubMed Central

    Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

    2017-01-01

    Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

  12. Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

    PubMed

    Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

    2006-06-01

    Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

  13. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  14. Clonal evolution through loss of chromosomes and subsequent polyploidization in chondrosarcoma.

    PubMed

    Olsson, Linda; Paulsson, Kajsa; Bovée, Judith V M G; Nord, Karolin H

    2011-01-01

    Near-haploid chromosome numbers have been found in less than 1% of cytogenetically reported tumors, but seem to be more common in certain neoplasms including the malignant cartilage-producing tumor chondrosarcoma. By a literature survey of published karyotypes from chondrosarcomas we could confirm that loss of chromosomes resulting in hyperhaploid-hypodiploid cells is common and that these cells may polyploidize. Sixteen chondrosarcomas were investigated by single nucleotide polymorphism (SNP) array and the majority displayed SNP patterns indicative of a hyperhaploid-hypodiploid origin, with or without subsequent polyploidization. Except for chromosomes 5, 7, 19, 20 and 21, autosomal loss of heterozygosity was commonly found, resulting from chromosome loss and subsequent duplication of monosomic chromosomes giving rise to uniparental disomy. Additional gains, losses and rearrangements of genetic material, and even repeated rounds of polyploidization, may affect chondrosarcoma cells resulting in highly complex karyotypes. Loss of chromosomes and subsequent polyploidization was not restricted to a particular chondrosarcoma subtype and, although commonly found in chondrosarcoma, binucleated cells did not seem to be involved in these events.

  15. Clonal Evolution through Loss of Chromosomes and Subsequent Polyploidization in Chondrosarcoma

    PubMed Central

    Olsson, Linda; Paulsson, Kajsa; Bovée, Judith V. M. G.; Nord, Karolin H.

    2011-01-01

    Near-haploid chromosome numbers have been found in less than 1% of cytogenetically reported tumors, but seem to be more common in certain neoplasms including the malignant cartilage-producing tumor chondrosarcoma. By a literature survey of published karyotypes from chondrosarcomas we could confirm that loss of chromosomes resulting in hyperhaploid-hypodiploid cells is common and that these cells may polyploidize. Sixteen chondrosarcomas were investigated by single nucleotide polymorphism (SNP) array and the majority displayed SNP patterns indicative of a hyperhaploid-hypodiploid origin, with or without subsequent polyploidization. Except for chromosomes 5, 7, 19, 20 and 21, autosomal loss of heterozygosity was commonly found, resulting from chromosome loss and subsequent duplication of monosomic chromosomes giving rise to uniparental disomy. Additional gains, losses and rearrangements of genetic material, and even repeated rounds of polyploidization, may affect chondrosarcoma cells resulting in highly complex karyotypes. Loss of chromosomes and subsequent polyploidization was not restricted to a particular chondrosarcoma subtype and, although commonly found in chondrosarcoma, binucleated cells did not seem to be involved in these events. PMID:21949816

  16. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  17. Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina

    PubMed Central

    Kovačević, Lejla; Fatur-Cerić, Vera; Hadžić, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

    2013-01-01

    Aim To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. Methods The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. Results The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. Conclusion This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis. PMID:23771760

  18. Haplotype data for 23 Y-chromosome markers in a reference sample from Bosnia and Herzegovina.

    PubMed

    Kovačević, Lejla; Fatur-Cerić, Vera; Hadzic, Negra; Čakar, Jasmina; Primorac, Dragan; Marjanović, Damir

    2013-06-01

    To detect polymorphisms of 23 Y-chromosomal short tandem repeat (STR) loci, including 6 new loci, in a reference database of male population of Bosnia and Herzegovina, as well as to assess the importance of increasing the number of Y-STR loci utilized in forensic DNA analysis. The reference sample consisted of 100 healthy, unrelated men originating from Bosnia and Herzegovina. Sample collection using buccal swabs was performed in all geographical regions of Bosnia and Herzegovina in the period from 2010 to 2011. DNA samples were typed for 23 Y STR loci, including 6 new loci: DYS576, DYS481, DYS549, DYS533, DYS570, and DYS643, which are included in the new PowerPlex® Y 23 amplification kit. The absolute frequency of generated haplotypes was calculated and results showed that 98 samples had unique Y 23 haplotypes, and that only two samples shared the same haplotype. The most polymorphic locus was DYS418, with 14 detected alleles and the least polymorphic loci were DYS389I, DYS391, DYS437, and DYS393. This study showed that by increasing the number of highly polymorphic Y STR markers, to include those tested in our analysis, leads to a reduction of repeating haplotypes, which is very important in the application of forensic DNA analysis.

  19. Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

    PubMed

    Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

    2010-09-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

  20. A Caenorhabditis elegans Wild Type Defies the Temperature–Size Rule Owing to a Single Nucleotide Polymorphism in tra-3

    PubMed Central

    Kammenga, Jan E; Doroszuk, Agnieszka; Riksen, Joost A. G; Hazendonk, Esther; Spiridon, Laurentiu; Petrescu, Andrei-Jose; Tijsterman, Marcel; Plasterk, Ronald H. A; Bakker, Jaap

    2007-01-01

    Ectotherms rely for their body heat on surrounding temperatures. A key question in biology is why most ectotherms mature at a larger size at lower temperatures, a phenomenon known as the temperature–size rule. Since temperature affects virtually all processes in a living organism, current theories to explain this phenomenon are diverse and complex and assert often from opposing assumptions. Although widely studied, the molecular genetic control of the temperature–size rule is unknown. We found that the Caenorhabditis elegans wild-type N2 complied with the temperature–size rule, whereas wild-type CB4856 defied it. Using a candidate gene approach based on an N2 × CB4856 recombinant inbred panel in combination with mutant analysis, complementation, and transgenic studies, we show that a single nucleotide polymorphism in tra-3 leads to mutation F96L in the encoded calpain-like protease. This mutation attenuates the ability of CB4856 to grow larger at low temperature. Homology modelling predicts that F96L reduces TRA-3 activity by destabilizing the DII-A domain. The data show that size adaptation of ectotherms to temperature changes may be less complex than previously thought because a subtle wild-type polymorphism modulates the temperature responsiveness of body size. These findings provide a novel step toward the molecular understanding of the temperature–size rule, which has puzzled biologists for decades. PMID:17335351

  1. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    PubMed Central

    Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

    2015-01-01

    Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

  2. Exploring single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes in the jellyfish (Rhopilema esculentum) by transcriptome sequencing.

    PubMed

    Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo

    2017-08-01

    In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. A new derived and highly polymorphic chromosomal race of Liolaemus monticola (Iguanidae) from the 'Norte Chico' of Chile.

    PubMed

    Lamborot, M

    1998-06-01

    A multiple Robertsonian fission chromosomal race of the Liolaemus monticola complex in Chile is described and is shown to be the most derived and the most complex among the Liolaemus examined thus far. The 29 karyotyped lizards analysed from the locality of Mina Hierro Viejo, Petorca, Provincia de Valparaiso, Chile, exhibited a diploid chromosomal number ranging from 42 to 44, and several polymorphisms. The polymorphisms included: a pair 1 fission; a pair 2 fission plus a pericentric inversion in one of the fission products, which moved the NOR and satellite from the tip of the long arm of the metacentric 2 to the short arm of the fission product; a fission in pair 3; a polymorphism for an enlarged chromosome pair 6; and a polymorphism for a pericentric inversion in pair 7. This population is fixed for a fission of chromosome pair 4. A total of 76% of the lizards analysed were polymorphic for one or more pairs of chromosomes. We have compared these data with other Liolaemus monticola chromosomal races and calculated the Hardy-Weinberg ratios for the polymorphic chromosome pairs in this Multiple-Fission race. Karyotypic differences between the Northern (2n = 38-40) and the Multiple-Fission (2n = 42-44) races were attributed mainly to Robertsonian fissions, an enlarged chromosome and pericentric inversions involving the macrochromosomes and one microchromosome pair.

  4. Multilocus patterns of polymorphism and selection across the X chromosome of Caenorhabditis remanei.

    PubMed

    Cutter, Asher D

    2008-03-01

    Natural selection and neutral processes such as demography, mutation, and gene conversion all contribute to patterns of polymorphism within genomes. Identifying the relative importance of these varied components in evolution provides the principal challenge for population genetics. To address this issue in the nematode Caenorhabditis remanei, I sampled nucleotide polymorphism at 40 loci across the X chromosome. The site-frequency spectrum for these loci provides no evidence for population size change, and one locus presents a candidate for linkage to a target of balancing selection. Selection for codon usage bias leads to the non-neutrality of synonymous sites, and despite its weak magnitude of effect (N(e)s approximately 0.1), is responsible for profound patterns of diversity and divergence in the C. remanei genome. Although gene conversion is evident for many loci, biased gene conversion is not identified as a significant evolutionary process in this sample. No consistent association is observed between synonymous-site diversity and linkage-disequilibrium-based estimators of the population recombination parameter, despite theoretical predictions about background selection or widespread genetic hitchhiking, but genetic map-based estimates of recombination are needed to rigorously test for a diversity-recombination relationship. Coalescent simulations also illustrate how a spurious correlation between diversity and linkage-disequilibrium-based estimators of recombination can occur, due in part to the presence of unbiased gene conversion. These results illustrate the influence that subtle natural selection can exert on polymorphism and divergence, in the form of codon usage bias, and demonstrate the potential of C. remanei for detecting natural selection from genomic scans of polymorphism.

  5. ESR1 single nucleotide polymorphisms predict breast cancer susceptibility in the central European Caucasian population.

    PubMed

    Lipphardt, Mark F; Deryal, Mustafa; Ong, Mei Fang; Schmidt, Werner; Mahlknecht, Ulrich

    2013-01-01

    Estrogen and progesterone hormones are key regulators of a wide variety of biological processes. In addition to their influence on reproduction, cell differentiation and apoptosis, they affect inflammatory response, cell metabolism and most importantly, they regulate physiological breast tissue proliferation and differentiation as well as the development and progression of breast cancer. In order to assess whether genetic variants in the steroid hormone receptor gene ESR1 (estrogen receptor alpha) had an effect on sporadic breast cancer susceptibility, we assessed 7 ESR1 single nucleotide polymorphisms (SNPs) for associations with breast cancer susceptibility and clinical parameters in 221 breast cancer patients and 221 controls, respectively. We identified ESR1 intron SNP +2464 C/T (rs3020314) and ESR1 intron SNP -4576 A/C (rs1514348) to correlate with breast cancer susceptibility and progesterone receptor expression status. Patients genotyped CT for ESR1 intron SNP +2464 (rs3020314) (p ≤ 0.045) or genotyped AC for ESR1 intron SNP -4576 (rs1514348) (p ≤ 0.000026) were identified to carry a significant risk as to the development of breast cancer in the Central European Caucasian population (both together: p ≤ 0.000488). Our study could confirm previous associations and revealed new associations of SNP rs1514348 with susceptibility to breast cancer and clinical outcome, which might be used as new additional SNP markers.

  6. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    PubMed

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  7. [Efficiency of 27-plex single nucleotide polymorphism multiplex system for ancestry inference in different populations].

    PubMed

    Feng, Xing-Ling; Sun, Qi-Fan; Liu, Hong; Wei, Yi-Liang; DU, Wei-An; Li, Cai-Xia; Chen, Ling; Liu, Chao

    2016-04-20

    To validate the efficiency of 27-plex single nucleotide polymorphism (SNP) multiplex system for ancestry inference. The 27-plex SNP system was validated for its sensitivity and species specificity. A total of 533 samples were collected from African, Southern Chinese Han, China's ethic minorities (Yi, Hui, Miao, Tibet, and Uygur), European, Central Asian, Western Asian, Southern Asian, Southeast Asian and South American populations for clustering analysis of the genotypes by citing 3 representative continental ancestral groups [East Asia (CHB), Europe (CEU), and Africa (YRI)] from HapMap database. The system sensitivity is 0.125 ng. Twenty and six genotypes were detected in chimpanzee and monkeys, respectively. Except in rs10496971, no more products were found in other animals. The system was capable of differentiating intercontinental populations but not of distinguishing between East Asian and Southeast Asian population or between Southern Chinese Han population and Chinese Ethnic populations (Hui, Miao, Yi and Tibet). This system achieved a 100% accuracy for intercontinental population source inference for 46 blind test samples. 27-plex SNPs multiplex system has a high sensitivity and species specificity and can correctly differentiate the ancestry origins of individuals from African, European and East Asian for criminal case investigation. But this system is not capable of distinguishing subpopulation groups and more specific ancestry-informative markers are needed to improve its recognition of Southeast Asian and Chinese ethnic populations.

  8. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

    PubMed

    Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

    2003-06-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

  9. Polymorphism in and localization of the gene LCP2 (SLP-76) to chromosome 5q33.1-qter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sunden, S.L.F.; Carr, L.L.; Clements, J.L.

    This report describes the localization of the human LCP2 gene to human chromosome 5q33.1-qter using single-stranded conformation polymorphisms analysis. This gene encodes an SH2 domain containing leukocyte protein of 76 kDa (SLP-76), which plays a functional role in T-cell activation. It remains to be determined whether mutations in this gene or translocations at this chromosome location are the genetic basis for various diseases, including lymphoblastic leukemia. 12 refs., 1 fig.

  10. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    PubMed

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  11. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

    PubMed

    Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

    2013-11-01

    Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

  12. Could single nucleotide polymorphisms influence on the efficacy of platelet-rich plasma in the treatment of sport injuries?

    PubMed Central

    Pruna, Ricard; Til, Lluis; Artells, Rosa

    2014-01-01

    Summary Platelet-rich plasma (PRP) is a new powerful biological tool in sports medicine, when used to treat tendon, ligament and muscle injuries. PRP is a fraction of autologous whole blood containing an increased number of platelets and a wide variety of cytokines that can improve and accelerate the healing of various tissues. An analysis of the literature shows promising pre-clinical results for PRP treatment, but there is a lack of solid clinical proof to support its use in sports medicine, and in fact, clinical findings on individual responses to PRP treatment are contradictory. These contradictions may be due to interindividual differences in the presence of single nucleotide polymorphisms (SNPs) in genes related to PRPs and/or their receptors. These SNPs can determine a greater or lesser response to this treatment and consequently a shorter or longer recovery time. We have focused our attention in the study of genes related to PRP with the aim to develope a genetic profile that will identify the individuals and injuries most likely to benefit from PRP treatment. PMID:24932449

  13. Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

    PubMed

    Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

    2010-08-02

    To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Ancestral Asian source(s) of new world Y-chromosome founder haplotypes.

    PubMed Central

    Karafet, T M; Zegura, S L; Posukh, O; Osipova, L; Bergen, A; Long, J; Goldman, D; Klitz, W; Harihara, S; de Knijff, P; Wiebe, V; Griffiths, R C; Templeton, A R; Hammer, M F

    1999-01-01

    Haplotypes constructed from Y-chromosome markers were used to trace the origins of Native Americans. Our sample consisted of 2,198 males from 60 global populations, including 19 Native American and 15 indigenous North Asian groups. A set of 12 biallelic polymorphisms gave rise to 14 unique Y-chromosome haplotypes that were unevenly distributed among the populations. Combining multiallelic variation at two Y-linked microsatellites (DYS19 and DXYS156Y) with the unique haplotypes results in a total of 95 combination haplotypes. Contra previous findings based on Y- chromosome data, our new results suggest the possibility of more than one Native American paternal founder haplotype. We postulate that, of the nine unique haplotypes found in Native Americans, haplotypes 1C and 1F are the best candidates for major New World founder haplotypes, whereas haplotypes 1B, 1I, and 1U may either be founder haplotypes and/or have arrived in the New World via recent admixture. Two of the other four haplotypes (YAP+ haplotypes 4 and 5) are probably present because of post-Columbian admixture, whereas haplotype 1G may have originated in the New World, and the Old World source of the final New World haplotype (1D) remains unresolved. The contrasting distribution patterns of the two major candidate founder haplotypes in Asia and the New World, as well as the results of a nested cladistic analysis, suggest the possibility of more than one paternal migration from the general region of Lake Baikal to the Americas. PMID:10053017

  15. The scale and nature of Viking settlement in Ireland from Y-chromosome admixture analysis.

    PubMed

    McEvoy, Brian; Brady, Claire; Moore, Laoise T; Bradley, Daniel G

    2006-12-01

    The Vikings (or Norse) played a prominent role in Irish history but, despite this, their genetic legacy in Ireland, which may provide insights into the nature and scale of their immigration, is largely unexplored. Irish surnames, some of which are thought to have Norse roots, are paternally inherited in a similar manner to Y-chromosomes. The correspondence of Scandinavian patrilineal ancestry in a cohort of Irish men bearing surnames of putative Norse origin was examined using both slow mutating unique event polymorphisms and relatively rapidly changing short tandem repeat Y-chromosome markers. Irish and Scandinavian admixture proportions were explored for both systems using six different admixture estimators, allowing a parallel investigation of the impact of method and marker type in Y-chromosome admixture analysis. Admixture proportion estimates in the putative Norse surname group were highly consistent and detected little trace of Scandinavian ancestry. In addition, there is scant evidence of Scandinavian Y-chromosome introgression in a general Irish population sample. Although conclusions are largely dependent on the accurate identification of Norse surnames, the findings are consistent with a relatively small number of Norse settlers (and descendents) migrating to Ireland during the Viking period (ca. AD 800-1200) suggesting that Norse colonial settlements might have been largely composed of indigenous Irish. This observation adds to previous genetic studies that point to a flexible Viking settlement approach across North Atlantic Europe.

  16. Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents.

    PubMed

    Ulloa, Mauricio; Hulse-Kemp, Amanda M; De Santiago, Luis M; Stelly, David M; Burke, John J

    2017-01-01

    High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement, especially in paleopolyploids with exceptionally complex genomes, eg, upland cotton ( Gossypium hirsutum L., "2n = 52"). Three independently developed intraspecific upland mapping populations were analyzed to generate 3 high-density genetic linkage single-nucleotide polymorphism (SNP) maps and a consensus map using the CottonSNP63K array. The populations consisted of a previously reported F 2 , a recombinant inbred line (RIL), and reciprocal RIL population, from "Phytogen 72" and "Stoneville 474" cultivars. The cluster file provided 7417 genotyped SNP markers, resulting in 26 linkage groups corresponding to the 26 chromosomes (c) of the allotetraploid upland cotton (AD) 1 arisen from the merging of 2 genomes ("A" Old World and "D" New World). Patterns of chromosome-specific recombination were largely consistent across mapping populations. The high-density genetic consensus map included 7244 SNP markers that spanned 3538 cM and comprised 3824 SNP bins, of which 1783 and 2041 were in the A t and D t subgenomes with 1825 and 1713 cM map lengths, respectively. Subgenome average distances were nearly identical, indicating that subgenomic differences in bin number arose due to the high numbers of SNPs on the D t subgenome. Examination of expected recombination frequency or crossovers (COs) on the chromosomes within each population of the 2 subgenomes revealed that COs were also not affected by the SNPs or SNP bin number in these subgenomes. Comparative alignment analyses identified historical ancestral A t -subgenomic translocations of c02 and c03, as well as of c04 and c05. The consensus map SNP sequences aligned with high congruency to the NBI assembly of Gossypium hirsutum . However, the genomic comparisons revealed evidence of additional

  17. Degeneration of the Y chromosome in evolutionary aging models

    NASA Astrophysics Data System (ADS)

    Lobo, M. P.; Onody, R. N.

    2005-06-01

    The Y chromosomes are genetically degenerated and do not recombine with their matching partners X. Recombination of XX pairs is pointed out as the key factor for the Y chromosome degeneration. However, there is an additional evolutionary force driving sex-chromosomes evolution. Here we show this mechanism by means of two different evolutionary models, in which sex chromosomes with non-recombining XX and XY pairs of chromosomes is considered. Our results show three curious effects. First, we observed that even when both XX and XY pairs of chromosomes do not recombine, the Y chromosomes still degenerate. Second, the accumulation of mutations on Y chromosomes followed a completely different pattern then those accumulated on X chromosomes. And third, the models may differ with respect to sexual proportion. These findings suggest that a more primeval mechanism rules the evolution of Y chromosomes due exclusively to the sex-chromosomes asymmetry itself, i.e., the fact that Y chromosomes never experience female bodies. Over aeons, natural selection favored X chromosomes spontaneously, even if at the very beginning of evolution, both XX and XY pairs of chromosomes did not recombine.

  18. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  20. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-01-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  1. How Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Act on Prosociality: The Mediation Role of Moral Evaluation.

    PubMed

    Shang, Siyuan; Wu, Nan; Su, Yanjie

    2017-01-01

    Prosociality is related to numerous positive outcomes, and mechanisms underlying individual differences in prosociality have been widely discussed. Recently, research has found converging evidence on the influence of the oxytocin receptor ( OXTR ) gene on prosociality. Meanwhile, moral reasoning, a key precursor for social behavior, has also been associated with variability in OXTR gene, thus the relationship between OXTR and prosociality is assumed to be mediated by moral evaluation. The current study examines the relationship in question, and includes gender as a potential moderator. Self-reported prosociality on Prosocial Tendencies Measure and evaluation on the moral acceptability of behaviors in stories from 790 Chinese adolescents (32.4% boys) were analyzed for the influence of their OXTR single nucleotide polymorphisms (SNPs). Results showed that SNP at site rs2254298 was indirectly associated with prosocial behaviors via moral evaluation of behaviors, and this effect was moderated by gender. Our findings suggest an indirect association between genetic variations in OXTR and prosociality through moral evaluation, indicating the potential pathway from genetic variability to prosociality through level of moral development. We also provide some evidence that the role of oxytocin system may to some extent depend on gender. These findings may promote our understanding of the genetic and biological roots of prosociality and morality.

  2. Evolutionary interaction between W/Y chromosome and transposable elements.

    PubMed

    Śliwińska, Ewa B; Martyka, Rafał; Tryjanowski, Piotr

    2016-06-01

    The W/Y chromosome is unique among chromosomes as it does not recombine in its mature form. The main side effect of cessation of recombination is evolutionary instability and degeneration of the W/Y chromosome, or frequent W/Y chromosome turnovers. Another important feature of W/Y chromosome degeneration is transposable element (TEs) accumulation. Transposon accumulation has been confirmed for all W/Y chromosomes that have been sequenced so far. Models of W/Y chromosome instability include the assemblage of deleterious mutations in protein coding genes, but do not include the influence of transposable elements that are accumulated gradually in the non-recombining genome. The multiple roles of genomic TEs, and the interactions between retrotransposons and genome defense proteins are currently being studied intensively. Small RNAs originating from retrotransposon transcripts appear to be, in some cases, the only mediators of W/Y chromosome function. Based on the review of the most recent publications, we present knowledge on W/Y evolution in relation to retrotransposable element accumulation.

  3. A single nucleotide polymorphism in MGEA5 encoding O-GlcNAc-selective N-acetyl-beta-D glucosaminidase is associated with type 2 diabetes in Mexican Americans.

    PubMed

    Lehman, Donna M; Fu, Dong-Jing; Freeman, Angela B; Hunt, Kelly J; Leach, Robin J; Johnson-Pais, Teresa; Hamlington, Jeanette; Dyer, Thomas D; Arya, Rector; Abboud, Hanna; Göring, Harald H H; Duggirala, Ravindranath; Blangero, John; Konrad, Robert J; Stern, Michael P

    2005-04-01

    Excess O-glycosylation of proteins by O-linked beta-N-acetylglucosamine (O-GlcNAc) may be involved in the pathogenesis of type 2 diabetes. The enzyme O-GlcNAc-selective N-acetyl-beta-d glucosaminidase (O-GlcNAcase) encoded by MGEA5 on 10q24.1-q24.3 reverses this modification by catalyzing the removal of O-GlcNAc. We have previously reported the linkage of type 2 diabetes and age at diabetes onset to an overlapping region on chromosome 10q in the San Antonio Family Diabetes Study (SAFADS). In this study, we investigated menangioma-expressed antigen-5 (MGEA5) as a positional candidate gene. Twenty-four single nucleotide polymorphisms (SNPs), identified by sequencing 44 SAFADS subjects, were genotyped in 436 individuals from 27 families whose data were used in the original linkage report. Association tests indicated significant association of a novel SNP with the traits diabetes (P = 0.0128, relative risk = 2.77) and age at diabetes onset (P = 0.0017). The associated SNP is located in intron 10, which contains an alternate stop codon and may lead to decreased expression of the 130-kDa isoform, the isoform predicted to contain the O-GlcNAcase activity. We investigated whether this variant was responsible for the original linkage signal. The variance attributed to this SNP accounted for approximately 25% of the logarithm of odds. These results suggest that this variant within the MGEA5 gene may increase diabetes risk in Mexican Americans.

  4. Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus.

    PubMed

    Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin

    2014-10-01

    Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.

  5. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing.

    PubMed

    Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.

  6. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

    PubMed Central

    Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770

  7. Differential occurrence of chromosome inversion polymorphisms among Muller's elements in three species of the tripunctata group of Drosophila, including a species with fast chromosomal evolution.

    PubMed

    Brianti, Mitsue T; Ananina, Galina; Klaczko, Louis B

    2013-01-01

    Detailed chromosome maps with reliable homologies among chromosomes of different species are the first step to study the evolution of the genetic architecture in any set of species. Here, we present detailed photo maps of the polytene chromosomes of three closely related species of the tripunctata group (subgenus Drosophila): Drosophila mediopunctata, D. roehrae, and D. unipunctata. We identified Muller's elements in each species, using FISH, establishing reliable chromosome homologies among species and D. melanogaster. The simultaneous analysis of chromosome inversions revealed a distribution pattern for the inversion polymorphisms among Muller's elements in the three species. Element E is the most polymorphic, with many inversions in each species. Element C follows; while the least polymorphic elements are B and D. While interesting, it remains to be determined how general this pattern is among species of the tripunctata group. Despite previous studies showing that D. mediopunctata and D. unipunctata are phylogenetically closer to each other than to D. roehrae, D. unipunctata shows rare karyotypic changes. It has two chromosome fusions: an additional heterochromatic chromosome pair and a pericentric inversion in the X chromosome. This especial conformation suggests a fast chromosomal evolution that deserves further study.

  8. Comparative Analyses of Single-Nucleotide Polymorphisms in the TNF Promoter Region Provide Further Validation for the Vervet Monkey Model of Obesity

    PubMed Central

    Gray, Stanton B; Howard, Timothy D; Langefeld, Carl D; Hawkins, Gregory A; Diallo, Abdoulaye F; Wagner, Janice D

    2009-01-01

    Tumor necrosis factor is a cytokine that plays critical roles in inflammation, the innate immune response, and a variety of other physiologic and pathophysiologic processes. In addition, TNF has recently been shown to mediate an intersection of chronic, low-grade inflammation and concurrent metabolic dysregulation associated with obesity and its comorbidities. As part of an ongoing initiative to further characterize vervet monkeys originating from St Kitts as an animal model of obesity and inflammation, we sequenced and genotyped the human ortholog vervet TNF gene and approximately 1 kb of the flanking 3′ and 5′ regions from 265 monkeys in a closed, pedigreed colony. This process revealed a total of 11 single-nucleotide polymorphisms (SNPs) and a single 4-bp insertion–deletion, with minor allele frequencies of 0.08 to 0.39. Many of these polymorphisms were in strong or complete linkage disequilibrium with each other, and all but 1 were contained within a single haplotype block, comprising 5 haplotypes with frequencies of 0.075 to 0.298. Using sequences from humans, chimpanzees, vervets, baboons, and rhesus macaques, phylogenetic shadowing of the TNF promoter region revealed that vervet SNPs, like the SNPs in related species, were clustered nonrandomly and nonuniformly around conserved transcription factor binding sites. These data, combined with previously defined heritable phenotypes, permit future association analyses in this nonhuman primate model and have great potential to help dissect the genetic and nongenetic contributions to complex diseases like obesity. More broadly, the sequence data and comparative analyses reported herein facilitates study of the evolution of regulatory sequences of inflammatory and immune-related genes. PMID:20034434

  9. Prenatal detection of fetal triploidy from cell-free DNA testing in maternal blood.

    PubMed

    Nicolaides, Kypros H; Syngelaki, Argyro; del Mar Gil, Maria; Quezada, Maria Soledad; Zinevich, Yana

    2014-01-01

    To investigate potential performance of cell-free DNA (cfDNA) testing in maternal blood in detecting fetal triploidy. Plasma and buffy coat samples obtained at 11-13 weeks' gestation from singleton pregnancies with diandric triploidy (n=4), digynic triploidy (n=4), euploid fetuses (n=48) were sent to Natera, Inc. (San Carlos, Calif., USA) for cfDNA testing. Multiplex polymerase chain reaction amplification of cfDNA followed by sequencing of single nucleotide polymorphic loci covering chromosomes 13, 18, 21, X, and Y was performed. Sequencing data were analyzed using the NATUS algorithm which identifies copy number for each of the five chromosomes. cfDNA testing provided a result in 44 (91.7%) of the 48 euploid cases and correctly predicted the fetal sex and the presence of two copies each of chromosome 21, 18 and 13. In diandric triploidy, cfDNA testing identified multiple paternal haplotypes (indicating fetal trisomy 21, trisomy 18 and trisomy 13) suggesting the presence of either triploidy or dizygotic twins. In digynic triploidy the fetal fraction corrected for maternal weight and gestational age was below the 0.5th percentile. cfDNA testing by targeted sequencing and allelic ratio analysis of single nucleotide polymorphisms covering chromosomes 21, 18, 13, X, and Y can detect diandric triploidy and raise the suspicion of digynic triploidy. © 2013 S. Karger AG, Basel.

  10. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on

  11. Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

    PubMed

    Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

    2016-06-01

    We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. mtDNA and Y-chromosome polymorphisms in four Native American populations from southern Mexico.

    PubMed Central

    Torroni, A.; Chen, Y. S.; Semino, O.; Santachiara-Beneceretti, A. S.; Scott, C. R.; Lott, M. T.; Winter, M.; Wallace, D. C.

    1994-01-01

    mtDNA sequence variation was examined in 60 Native Americans (Mixtecs from the Alta, Mixtecs from the Baja, Valley Zapotecs, and Highland Mixe) from southern Mexico by PCR amplification and high-resolution restriction endonuclease analysis. Four groups of mtDNA haplotypes (haplogroups A, B, C, and D) characterize Amerind populations, but only three (haplogroups A, B, and C) were observed in these Mexican populations. The comparison of their mtDNA variation with that observed in other populations from Mexico and Central America permits a clear distinction among the different Middle American tribes and raises questions about some of their linguistic affiliations. The males of these population samples were also analyzed for Y-chromosome RFLPs with the probes 49a, 49f, and 12f2. This analysis suggests that certain Y-chromosome haplotypes were brought from Asia during the colonization of the Americas, and a differential gene flow was introduced into Native American populations from European males and females. Images Figure 4 PMID:8304347

  13. Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    PubMed

    Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

    2012-01-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

  14. DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

    PubMed

    González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

    2006-03-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

  15. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    PubMed

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  16. Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

    PubMed

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

  17. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    PubMed

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P < 0.05) with multiple SNPs in the GRM8 gene and event-related theta power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  18. Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

    PubMed Central

    Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

    2015-01-01

    Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

  19. An Autosomal Factor from Drosophila Arizonae Restores Normal Spermatogenesis in Drosophila Mojavensis Males Carrying the D. Arizonae Y Chromosome

    PubMed Central

    Pantazidis, A. C.; Galanopoulos, V. K.; Zouros, E.

    1993-01-01

    Males of Drosophila mojavensis whose Y chromosome is replaced by the Y chromosome of the sibling species Drosophila arizonae are sterile. It is shown that genetic material from the fourth chromosome of D. arizonae is necessary and sufficient, in single dose, to restore fertility in these males. In introgression and mapping experiments this material segregates as a single Mendelian factor (sperm motility factor, SMF). Light and electron microscopy studies of spermatogenesis in D. mojavensis males whose Y chromosome is replaced by introgression with the Y chromosome of D. arizonae (these males are symbolized as mojY(a)) revealed postmeiotic abnormalities all of which are restored when the SMF of D. arizonae is co-introgressed (these males are symbolized as mojY(a)SMF(a)). The number of mature sperm per bundle in mojY(a)SMF(a) is slightly less than in pure D. mojavensis and is even smaller in males whose fertility is rescued by introgression of the entire fourth chromosome of D. arizonae. These observations establish an interspecific incompatibility between the Y chromosome and an autosomal factor (or more than one tightly linked factors) that can be useful for the study of the evolution of male hybrid sterility in Drosophila and the genetic control of spermatogenesis. PMID:8514139

  20. Association of ABCB1 and ABCG2 single nucleotide polymorphisms with clinical findings and response to chemotherapy treatments in Kurdish patients with breast cancer.

    PubMed

    Ghafouri, Houshiyar; Ghaderi, Bayazid; Amini, Sabrieh; Nikkhoo, Bahram; Abdi, Mohammad; Hoseini, Abdolhakim

    2016-06-01

    The possible interaction between gene polymorphisms and risk of cancer progression is very interesting. Polymorphisms in multi-drug resistance genes have an important role in response to anti-cancer drugs. The present study was aimed to evaluate the possible effects of ABCB1 C3435T and ABCG2 C421A single nucleotide polymorphisms on clinical and pathological outcomes of Kurdish patients with breast cancer. One hundred breast cancer patients and 200 healthy controls were enrolled in this case-control study. Clinical and pathological findings of all individuals were reported, and immunohistochemistry staining was used to assess the tissue expression of specific breast cancer proteins. The ABCB1 C3435T and ABCG2 C421 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). The distribution of different genotypes between patient and control groups was only significant for ABCG2 C421A. A allele of ABCG2 C421A polymorphisms were significantly higher in patients than in controls. Patients with AA genotype of ABCG2 C421A were at higher risk of progressing breast cancer. Patients with A allele of ABCG2 had complete response to chemotherapeutic agents. There was no statistically significant association between ABCB1 C3435T and ABCG2 C421A polymorphisms and tissue expression of ER, PR, Her2/neu, and Ki67. The ABCB1 C3435T has no correlation with clinical findings and treatment with chemotherapy drugs. The A allele of ABCG2 C421A may be a risk factor for progression of breast cancer in Kurdish patients. In addition, breast cancer patients with C allele of this polymorphism have weaker response to treatments with anthracyclines and Paclitaxol.