Isolation of a yeast artificial chromosome contig spanning the Greig cephalopolysyndactyly syndrome (GCPS) gene region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vortkamp, A.; Gessler, M.; Le Paslier, D.

1994-08-01

Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.

The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Coillie, E.; Fiten, P.; Van Damme, J.

1997-03-01

Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genesmore » a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hellsten, E.; Vesa, J.; Peltonen, L.

Infantile neuronal ceroid lipofuscinosis (INCL, CLN1) is a neurodegenerative disorder in which the biochemical defect is unknown. We earlier assigned the disease locus to chromosome 1p32 in the immediate vicinity of the highly informative HY-TM1 marker by linkage and linkage disequilibrium analysis. Here we report the construction of PFGE maps on the CLN1 region covering a total of 4 Mb of this relatively poorly mapped chromosomal region. We established the order of loci at 1p32 as tel-D1S57-L-myc-HY-TM1-rlf-COL9A2-D1S193-D1S62-D1S211-cen by combining data obtained from analysis of a chromosome 1 somatic cell hybrid panel, PFGE, and interphase FISH. We isolated YACs and constructedmore » two separate YAC contigs, the loci L-myc, HY-TM1, rlf, and COL9A2 being present on a 1000-kb contig and the markers D1S193, D1S62, and D1S211 on a YAC contig spanning a maximum of 860 kb. Within the 1000-kb contig we were able to identify five CpG islands in addition to those associated with the earlier cloned genes. The YAC contigs as well as the physical map provide us with tools for the identification of the INCL gene. 36 refs., 4 figs., 3 tabs.« less

Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus

PubMed Central

Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.

1998-01-01

Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA

The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Brody, L.C.; Martin, L.S.

1993-05-01

Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

Report of the Fourth International Workshop on human X chromosome mapping 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlessinger, D.; Mandel, J.L.; Monaco, A.P.

1993-12-31

Vigorous interactive efforts by the X chromosome community have led to accelerated mapping in the last six months. Seventy-five participants from 12 countries around the globe contributed progress reports to the Fourth International X Chromosome Workshop, at St. Louis, MO, May 9-12, 1993. It became clear that well over half the chromosome is now covered by YAC contigs that are being extended, verified, and aligned by their content of STSs and other markers placed by cytogenetic or linkage mapping techniques. The major aim of the workshop was to assemble the consensus map that appears in this report, summarizing both consensusmore » order and YAC contig information.« less

Positional cloning of the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, R.F.; Korenblat, K.M.; Goate, A.M.

1994-09-01

Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less

Physical and transcriptional map in the CMT 1A region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chevillard, C.; Passage, E.; Cudrey, C.

1994-09-01

The Charcot-Marie-Tooth disease type 1A (CMT1A) has been mapped to the proximal short arm of chromosome 17. CMT1A is the most frequent of the motor and sensory peripheral neuropathies and is associated with a duplication of a 1.5 Mb fragment in proximal 17p12. Several groups have proposed that the gene coding for peripheral myelin protein-22 (PMP-22) as the candidate gene for CMT1A. We have recently published a {open_quote}MegaYAC{close_quote} contig of 6 Mb which covers the CMT1A critical region. In order to isolate new genes localized in this region, we used a {open_quote}physical trapping {close_quote} strategy derived from the direct cDNAmore » selection technique developed by Parimoo et al. This approach has allowed us to construct cDNA {open_quotes}minilibraries{close_quotes} using YAC DNA from the CMT1A region. One of the clones in these minilibraries has been mapped back to the CMT1A duplication. Other potentially interesting clones are in the process of further characterization. Furthermore, we have mapped several Genethon microsatellites in the 6 Mb YAC contig and some are located in the CMT1A duplicated region. These highly polymorphic markers should prove useful for diagnostic testing in CMT1A.« less

The influence of convection drying on the physicochemical properties of yacón (Smallanthus sonchifolius)

NASA Astrophysics Data System (ADS)

Salinas, Juan Gabriel; Alvarado, Juan Antonio; Bergenståhl, Björn; Tornberg, Eva

2018-04-01

Yacón root is a natural source of fructans, which has many potential benefits. Convective drying has been applied to increase the shelf life of yacón roots. However, this processing may lead to detrimental effects on the physicochemical functionality. The drying was investigated using different conditions (drying temperatures of 45 °C, 50 °C and 55 °C at a drying air velocity of 2 m/s and 60 °C at a drying air velocity of 2 m/s, 3 m/s and 4 m/s). The dried samples were compared to the original yacón with regard to their physicochemical properties. From all the properties that were studied, the color of the dried material and the elastic modulus of the reconstituted yacón were the most important properties being minimized respectively. The results of this investigation indicate that the best drying conditions, where the physicochemical properties of the samples are kept closest to the original material, are obtained either by using temperatures of 55 °C and 2 m/s or using higher temperatures but increasing the air velocity.

The nature of youth care tasks in families experiencing chronic illness/disability: development of the Youth Activities of Caregiving Scale (YACS).

PubMed

Ireland, Michael James; Pakenham, Kenneth Ian

2010-07-01

The purpose of this study was to develop an empirically derived multi-item scale of care tasks performed by young people in the context of family illness/disability: the Youth Activities of Caregiving Scale (YACS). A total of 135 youngsters aged 10-24 years with an ill/disabled family member completed questionnaires. Factor analyses performed on the YACS yielded four factors, instrumental care, social/emotional care, personal/intimate care and domestic/household care, accounting for 57.78% of the variance. The internal reliabilities of all factors ranged from 0.74 to 0.92. Higher scores on the YACS related to higher youth age and several caregiving context variables (i.e. household type [single or dual-parent household], relationship with care-recipient and perceived choice in caregiving). Higher scores on the YACS also related to care-recipient illness/disability variables (onset, functional impairment, prognosis, predictability and illness/disability type). Strong positive correlations between the YACS and a conceptually related measure of young caregiving experiences provided good convergent validity data. Criterion validity was established with evidence that the YACS predicted youth adjustment in the domains of health and prosocial behaviour.

High-resolution human/goat comparative map of the goat polled/intersex syndrome (PIS): the human homologue is contained in a human YAC from HSA3q23.

PubMed

Vaiman, D; Schibler, L; Oustry-Vaiman, A; Pailhoux, E; Goldammer, T; Stevanovic, M; Furet, J P; Schwerin, M; Cotinot, C; Fellous, M; Cribiu, E P

1999-02-15

The genetic and cytogenetic map around the chromosome 1 region shown to be linked with polledness and intersexuality (PIS) in the domestic goat (Capra hircus) was refined. For this purpose, a goat BAC library was systematically screened with primers from human coding sequences, scraped chromosome 1 DNA, bovine microsatellites from the region, and BAC ends. All the BACs (n = 30) were mapped by fluorescence in situ hybridization (FISH) on goat chromosome 1q41-q45. The genetic mapping of 30 new goat polymorphic markers, isolated from these BACs, made it possible to reduce the PIS interval to a region of less than 1 cM on goat chromosome 1q43. The PIS locus is now located between the two genes ATP1B and COP, which both map to 3q23 in humans. Genetic, cytogenetic, and comparative data suggest that the PIS region is now probably circumscribed to an approximately 1-Mb DNA segment for which construction of a BAC contig is in progress. In addition, a human YAC contig encompassing the blepharophimosis-ptosis-epicanthus-inversus region was mapped by FISH to goat chromosome 1q43. This human disease, mapped to HSA 3q23 and affecting the development and maintenance of ovarian function, could be a potential candidate for goat PIS. Copyright 1999 Academic Press.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC

Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington's Disease Mice.

PubMed

Berggren, Kiersten L; Lu, Zhen; Fox, Julia A; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H

2016-01-01

Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington's disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363-74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Female neonatal mice were supplemented daily from days 10-17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later.

YAC128 Huntington's disease transgenic mice show enhanced short-term hippocampal synaptic plasticity early in the course of the disease.

PubMed

Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana

2014-09-18

Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder. Copyright © 2014 Elsevier B.V. All rights reserved.

Analysis of complex repeat sequences within the spinal muscular atrophy (SMA) candidate region in 5q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, K.E.; Morrison, K.E.; Daniels, R.I.

1994-09-01

We previously reported that the 400 kb interval flanked the polymorphic loci D5S435 and D5S557 contains blocks of a chromosome 5 specific repeat. This interval also defines the SMA candidate region by genetic analysis of recombinant families. A YAC contig of 2-3 Mb encompassing this area has been constructed and a 5.5 kb conserved fragment, isolated from a YAC end clone within the above interval, was used to obtain cDNAs from both fetal and adult brain libraries. We describe the identification of cDNAs with stretches of high DNA sequence homology to exons of {beta} glucuronidase on human chromosome 7. Themore » cDNAs map both to the candidate region and to an area of 5p using FISH and deletion hybrid analysis. Hybridization to bacteriophage and cosmid clones from the YACs localizes the {beta} glucuronidase related sequences within the 400 kb region of the YAC contig. The cDNAs show a polymorphic pattern on hybridization to genomic BamH1 fragments in the size range of 10-250 kb. Further analysis using YAC fragmentation vectors is being used to determine how these {beta} glucuronidase related cDNAs are distributed within 5q13. Dinucleotide repeats within the region are being investigated to determine linkage disequilibrium with the disease locus.« less

Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington’s Disease Mice

PubMed Central

Berggren, Kiersten L.; Lu, Zhen; Fox, Julia A.; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H.

2016-01-01

Background: Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington’s disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363–74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. Objective: To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Methods: Female neonatal mice were supplemented daily from days 10–17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Results: Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Conclusions: Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later. PMID:27079948

Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

PubMed

Fedosyuk, Halyna; Peterson, Kenneth R

2007-01-01

A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

Cellular, Molecular and Functional Characterisation of YAC Transgenic Mouse Models of Friedreich Ataxia

PubMed Central

Anjomani Virmouni, Sara; Sandi, Chiranjeevi; Al-Mahdawi, Sahar; Pook, Mark A.

2014-01-01

Background Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC) transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats), YG8R (90 and 190 GAA repeats) and YG22R (190 GAA repeats). Methodology/Principal Findings We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH) analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R. Conclusions/Significance Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy. PMID:25198290

Changes in the striatal proteome of YAC128Q mice exhibit gene-environment interactions between mutant huntingtin and manganese.

PubMed

Wegrzynowicz, Michal; Holt, Hunter K; Friedman, David B; Bowman, Aaron B

2012-02-03

Huntington's disease (HD) is a neurodegenerative disorder caused by expansion of a CAG repeat within the Huntingtin (HTT) gene, though the clinical presentation of disease and age-of-onset are strongly influenced by ill-defined environmental factors. We recently reported a gene-environment interaction wherein expression of mutant HTT is associated with neuroprotection against manganese (Mn) toxicity. Here, we are testing the hypothesis that this interaction may be manifested by altered protein expression patterns in striatum, a primary target of both neurodegeneration in HD and neurotoxicity of Mn. To this end, we compared striatal proteomes of wild-type and HD (YAC128Q) mice exposed to vehicle or Mn. Principal component analysis of proteomic data revealed that Mn exposure disrupted a segregation of WT versus mutant proteomes by the major principal component observed in vehicle-exposed mice. Identification of altered proteins revealed novel markers of Mn toxicity, particularly proteins involved in glycolysis, excitotoxicity, and cytoskeletal dynamics. In addition, YAC128Q-dependent changes suggest that axonal pathology may be an early feature in HD pathogenesis. Finally, for several proteins, genotype-specific responses to Mn were observed. These differences include increased sensitivity to exposure in YAC128Q mice (UBQLN1) and amelioration of some mutant HTT-induced alterations (SAE1, ENO1). We conclude that the interaction of Mn and mutant HTT may suppress proteomic phenotypes of YAC128Q mice, which could reveal potential targets in novel treatment strategies for HD.

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

IGF-1 intranasal administration rescues Huntington's disease phenotypes in YAC128 mice.

PubMed

Lopes, Carla; Ribeiro, Márcio; Duarte, Ana I; Humbert, Sandrine; Saudou, Frederic; Pereira de Almeida, Luís; Hayden, Michael; Rego, A Cristina

2014-06-01

Huntington's disease (HD) is an autosomal dominant disease caused by an expansion of CAG repeats in the gene encoding for huntingtin. Brain metabolic dysfunction and altered Akt signaling pathways have been associated with disease progression. Nevertheless, conflicting results persist regarding the role of insulin-like growth factor-1 (IGF-1)/Akt pathway in HD. While high plasma levels of IGF-1 correlated with cognitive decline in HD patients, other data showed protective effects of IGF-1 in HD striatal neurons and R6/2 mice. Thus, in the present study, we investigated motor phenotype, peripheral and central metabolic profile, and striatal and cortical signaling pathways in YAC128 mice subjected to intranasal administration of recombinant human IGF-1 (rhIGF-1) for 2 weeks, in order to promote IGF-1 delivery to the brain. We show that IGF-1 supplementation enhances IGF-1 cortical levels and improves motor activity and both peripheral and central metabolic abnormalities in YAC128 mice. Moreover, decreased Akt activation in HD mice brain was ameliorated following IGF-1 administration. Upregulation of Akt following rhIGF-1 treatment occurred concomitantly with increased phosphorylation of mutant huntingtin on Ser421. These data suggest that intranasal administration of rhIGF-1 ameliorates HD-associated glucose metabolic brain abnormalities and mice phenotype.

CAR: contig assembly of prokaryotic draft genomes using rearrangements.

PubMed

Lu, Chin Lung; Chen, Kun-Tze; Huang, Shih-Yuan; Chiu, Hsien-Tai

2014-11-28

Next generation sequencing technology has allowed efficient production of draft genomes for many organisms of interest. However, most draft genomes are just collections of independent contigs, whose relative positions and orientations along the genome being sequenced are unknown. Although several tools have been developed to order and orient the contigs of draft genomes, more accurate tools are still needed. In this study, we present a novel reference-based contig assembly (or scaffolding) tool, named as CAR, that can efficiently and more accurately order and orient the contigs of a prokaryotic draft genome based on a reference genome of a related organism. Given a set of contigs in multi-FASTA format and a reference genome in FASTA format, CAR can output a list of scaffolds, each of which is a set of ordered and oriented contigs. For validation, we have tested CAR on a real dataset composed of several prokaryotic genomes and also compared its performance with several other reference-based contig assembly tools. Consequently, our experimental results have shown that CAR indeed performs better than all these other reference-based contig assembly tools in terms of sensitivity, precision and genome coverage. CAR serves as an efficient tool that can more accurately order and orient the contigs of a prokaryotic draft genome based on a reference genome. The web server of CAR is freely available at http://genome.cs.nthu.edu.tw/CAR/ and its stand-alone program can also be downloaded from the same website.

COCACOLA: binning metagenomic contigs using sequence COmposition, read CoverAge, CO-alignment and paired-end read LinkAge.

PubMed

Lu, Yang Young; Chen, Ting; Fuhrman, Jed A; Sun, Fengzhu

2017-03-15

The advent of next-generation sequencing technologies enables researchers to sequence complex microbial communities directly from the environment. Because assembly typically produces only genome fragments, also known as contigs, instead of an entire genome, it is crucial to group them into operational taxonomic units (OTUs) for further taxonomic profiling and down-streaming functional analysis. OTU clustering is also referred to as binning. We present COCACOLA, a general framework automatically bin contigs into OTUs based on sequence composition and coverage across multiple samples. The effectiveness of COCACOLA is demonstrated in both simulated and real datasets in comparison with state-of-art binning approaches such as CONCOCT, GroopM, MaxBin and MetaBAT. The superior performance of COCACOLA relies on two aspects. One is using L 1 distance instead of Euclidean distance for better taxonomic identification during initialization. More importantly, COCACOLA takes advantage of both hard clustering and soft clustering by sparsity regularization. In addition, the COCACOLA framework seamlessly embraces customized knowledge to facilitate binning accuracy. In our study, we have investigated two types of additional knowledge, the co-alignment to reference genomes and linkage of contigs provided by paired-end reads, as well as the ensemble of both. We find that both co-alignment and linkage information further improve binning in the majority of cases. COCACOLA is scalable and faster than CONCOCT, GroopM, MaxBin and MetaBAT. The software is available at https://github.com/younglululu/COCACOLA . fsun@usc.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Shotgun Protein Sequencing with Meta-contig Assembly*

PubMed Central

Guthals, Adrian; Clauser, Karl R.; Bandeira, Nuno

2012-01-01

Full-length de novo sequencing from tandem mass (MS/MS) spectra of unknown proteins such as antibodies or proteins from organisms with unsequenced genomes remains a challenging open problem. Conventional algorithms designed to individually sequence each MS/MS spectrum are limited by incomplete peptide fragmentation or low signal to noise ratios and tend to result in short de novo sequences at low sequencing accuracy. Our shotgun protein sequencing (SPS) approach was developed to ameliorate these limitations by first finding groups of unidentified spectra from the same peptides (contigs) and then deriving a consensus de novo sequence for each assembled set of spectra (contig sequences). But whereas SPS enables much more accurate reconstruction of de novo sequences longer than can be recovered from individual MS/MS spectra, it still requires error-tolerant matching to homologous proteins to group smaller contig sequences into full-length protein sequences, thus limiting its effectiveness on sequences from poorly annotated proteins. Using low and high resolution CID and high resolution HCD MS/MS spectra, we address this limitation with a Meta-SPS algorithm designed to overlap and further assemble SPS contigs into Meta-SPS de novo contig sequences extending as long as 100 amino acids at over 97% accuracy without requiring any knowledge of homologous protein sequences. We demonstrate Meta-SPS using distinct MS/MS data sets obtained with separate enzymatic digestions and discuss how the remaining de novo sequencing limitations relate to MS/MS acquisition settings. PMID:22798278

Shotgun protein sequencing with meta-contig assembly.

PubMed

Guthals, Adrian; Clauser, Karl R; Bandeira, Nuno

2012-10-01

Full-length de novo sequencing from tandem mass (MS/MS) spectra of unknown proteins such as antibodies or proteins from organisms with unsequenced genomes remains a challenging open problem. Conventional algorithms designed to individually sequence each MS/MS spectrum are limited by incomplete peptide fragmentation or low signal to noise ratios and tend to result in short de novo sequences at low sequencing accuracy. Our shotgun protein sequencing (SPS) approach was developed to ameliorate these limitations by first finding groups of unidentified spectra from the same peptides (contigs) and then deriving a consensus de novo sequence for each assembled set of spectra (contig sequences). But whereas SPS enables much more accurate reconstruction of de novo sequences longer than can be recovered from individual MS/MS spectra, it still requires error-tolerant matching to homologous proteins to group smaller contig sequences into full-length protein sequences, thus limiting its effectiveness on sequences from poorly annotated proteins. Using low and high resolution CID and high resolution HCD MS/MS spectra, we address this limitation with a Meta-SPS algorithm designed to overlap and further assemble SPS contigs into Meta-SPS de novo contig sequences extending as long as 100 amino acids at over 97% accuracy without requiring any knowledge of homologous protein sequences. We demonstrate Meta-SPS using distinct MS/MS data sets obtained with separate enzymatic digestions and discuss how the remaining de novo sequencing limitations relate to MS/MS acquisition settings.

The Langer-Giedion syndrome: Molecular dissection of a contiguous gene syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luedecke, H.J.; Pillo, B.L.; Nardmann, J.

The tricho-rhino-phalangeal syndromes TRPS I and II, which are characterized by craniofacial dysmorphism and skeletal abnormalities, are caused by genetic defects in 8q24.1. The presence of multiple exostoses (EXT) distinguishes TRPS II (Langer-Giedion syndrome, LGS) from TRPS I. Multiple exostoses also occur as an autosomal dominant trait displaying genetic heterogeneity. One of the EXT loci maps to 8q24.1. Previously, we had determined a probe order (cen-D8S50-D8S98-D8S51-D8S67-D8S43-tel) for the Langer-Giedion syndrome chromosome region. The shortest region of deletion overlap in LGS patients is defined by D8S51 and D8S67. Interestingly, a patient with TRPS I and a large deletion was found tomore » be intact for these two loci, but deleted for more proximal loci. We have now constructed a complete yeast artificial chromosome (YAC) contig for the entire LGCR. Some of these YACs were used to perform fluorescence in situ hybridization analyses in patients with chromosomal abnormalities associated with TRPS I, TRPS II and EXT. One YAC containing D8S98 spans the translocation breakpoint in a patient with TRPS I and (8;18)(q24.11;q13.3;q21.13). The translocation breakpoint in a patient with TRPS II and t(4;8)(p15.3;q24.1) is covered by a D8S67 YAC. Interestingly, this YAC also spans the inversion breakpoint in a patient with EXT and inv(8)(p23;q24.1). The data indicate that most of the putative TRPS I gene is located between D8S98 and D8S51, that the putative EXT gene maps to D8S67, and that both genes are 1.5 Mbp apart. We are currently analyzing putative gene sequences in the vicinity of the chromosomal breakpoints.« less

Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

PubMed

Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

2013-01-01

Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Characterisation of the Nevoid basal cell carcinoma (Gorlin`s) syndrome (NBCCS) gene region on chromosome 9q22-q31

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, D.J.; Digweed, M.; Sperling, K.

1994-09-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominantly inherited malignancy-associated disease of unknown etiology. The gene has been mapped to chromosome 9q22-q31 by us and other groups, using linkage analysis and loss of heterozygosity studies. Subsequent linkage and haplotype analyses from 133 meioses in NBCCS families has refined the position of the gene between D9S12 and D9S287. Since the gene for Fanconi`s Anaemia type C (FAAC) has been assigned to the same 9q region, we have performed linkage analysis between FACC and NBCCCS in NBCCS families. No recombination has been observed between NBCCS and FACC and maximum lodmore » scores of 34.98 and 11.94 occur for both diseases at the markers D9S196/D9S197. Southern blot analysis using an FACC cDNA probe has revealed no detectable rearrangements in our NBCCS patients. We have established a YAC contig spanning the region from D9S12 to D9S176 and STS content mapping in 22 YACs has allowed the ordering of 12 loci in the region, including the xeroderma pigmentosum type A (XPAC) gene, as follows: D9S151/D9S12P1 - D9S12P2 - D9S197 - D9S196 - D9S280 - FACC - D9S287/XPAC - D9S180 - D9S6 - D9S176. Using the contig we have been able to eliminate the {alpha}1 type XV collagen gene and the markers D9S119 and D9S297 from the NBCCS candidate region. Twelve YACs have been used to screen a chromosome 9 cosmid library and more than 1000 cosmids from the region have been identified to be used for the construction of a cosmid contig. A selection of these cosmids will be used for the isolation of coding sequencing from the region.« less

Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library.

PubMed

Nakamura, S; Asakawa, S; Ohmido, N; Fukui, K; Shimizu, N; Kawasaki, S

1997-05-01

We constructed a rice Bacterial Artificial Chromosome (BAC) library from green leaf protoplasts of the cultivar Shimokita harboring the rice blast resistance gene Pi-ta. The average insert size of 155 kb and the library size of seven genome equivalents make it one of the most comprehensive BAC libraries available, and larger than many plant YAC libraries. The library clones were plated on seven high density membranes of microplate size, enabling efficient colony identification in colony hybridization experiments. Seven percent of clones carried chloroplast DNA. By probing with markers close to the blast resistance genes Pi-ta2(closely linked to Pi-ta) and Pi-b, respectively located in the centromeric region of chromosome 12 and near the telomeric end of chromosome 2, on average 2.2 +/- 1.3 and 8.0 +/- 2.6 BAC clones/marker were isolated. Differences in chromosomal structures may contribute to this wide variation in yield. A contig of about 800 kb, consisting of 19 clones, was constructed in the Pi-ta2 region. This region had a high frequency of repetitive sequences. To circumvent this difficulty, we devised a "two-step walking" method. The contig spanned a 300 kb region between markers located at 0 cM and 0.3 cM from Pi-ta. The ratio of physical to genetic distances (> 1,000 kb/cM) was more than three times larger than the average of rice (300 kb/cM). The low recombination rate and high frequency of repetitive sequences may also be related to the near centromeric character of this region. Fluorescent in situ hybridization (FISH) with a BAC clone from the Pi-b region yielded very clear signals on the long arm of chromosome 2, while a clone from the Pi-ta2 region showed various cross-hybridizing signals near the centromeric regions of all chromosomes.

Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

PubMed

Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

1998-01-01

Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

Physical mapping of the torsion dystonia region of human chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozelius, L.J.; Hewett, J.; Shalish, C.

1994-09-01

Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

Detection of a megabase deletion in a patient with brachio-oto-renal syndrome (BOR) and tricho-rhino-phalangeal syndrome (TRPS): Implications for mapping and cloning the BOR gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Wells, D.E.; Wagner, M.J.

Genetic linkage analysis has previously mapped the locus for the autosomal dominant disorder branchio-oto-renal syndrome (BOR) to the pericentric region of chromosome 8q. A YAC contig spanning the putative BOR region, from D8S543 to D8S541, was constructed and confirmed by sequence-tagged site content mapping using microsatellite markers and by DNA hybridization analysis. YACs spanning the BOR interval were used as fluorescence in situ hybridization probes on a cell line from a patient with BO and tricho-rhino-phalangeal syndrome I that involves a chromosome 8q rearrangement. In addition to the cytogenetically defined direct insertion of material from 8q13.3-q21.13 into 8q24.11, a previouslymore » unidentified deletion of just under one megabase was found in 8q13.3. These data narrowed the most likely location of the BOR gene to a region corresponding to the proximal two-thirds of YAC 869E10 between D8S543 and D8S279. 23 refs., 3 figs.« less

Physical and genetic mapping of the CMT4A locus and exclusion of PMP-2 as the defect in CMT4A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Othmane, K.B.; Loeb, D.; Roses, A.D.

1995-07-20

We have previously localized one form of the autosomal recessive Charcot-Marie-Tooth disease type 4 (CMT4A) to a 5-cM region of chromosome 8q13-q21. We now report the formation of a 7-Bp YAC contig spanning the region. This contig was used to map nine additional microsatellites and six STSs to this region, and subsequent haplotype analysis has narrowed the CMT4A flanking interval to less than 1 cM. In addition, using SSCP and our physical map, we have demonstrated that the myelin protein PMP-2, mapped by FISH to this region, is not the defect in CMT4A. 27 refs., 3 figs., 1 tab.

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Simplifier: a web tool to eliminate redundant NGS contigs.

PubMed

Ramos, Rommel Thiago Jucá; Carneiro, Adriana Ribeiro; Azevedo, Vasco; Schneider, Maria Paula; Barh, Debmalya; Silva, Artur

2012-01-01

Modern genomic sequencing technologies produce a large amount of data with reduced cost per base; however, this data consists of short reads. This reduction in the size of the reads, compared to those obtained with previous methodologies, presents new challenges, including a need for efficient algorithms for the assembly of genomes from short reads and for resolving repetitions. Additionally after abinitio assembly, curation of the hundreds or thousands of contigs generated by assemblers demands considerable time and computational resources. We developed Simplifier, a stand-alone software that selectively eliminates redundant sequences from the collection of contigs generated by ab initio assembly of genomes. Application of Simplifier to data generated by assembly of the genome of Corynebacterium pseudotuberculosis strain 258 reduced the number of contigs generated by ab initio methods from 8,004 to 5,272, a reduction of 34.14%; in addition, N50 increased from 1 kb to 1.5 kb. Processing the contigs of Escherichia coli DH10B with Simplifier reduced the mate-paired library 17.47% and the fragment library 23.91%. Simplifier removed redundant sequences from datasets produced by assemblers, thereby reducing the effort required for finalization of genome assembly in tests with data from Prokaryotic organisms. Simplifier is available at http://www.genoma.ufpa.br/rramos/softwares/simplifier.xhtmlIt requires Sun jdk 6 or higher.

Identification of a YAC spanning the translocation breakpoints in uterine leiomyomata, pulmonary chondroid hamartoma, and lipoma: Physical mapping of the 12q14-q15 breakpoint region in uterine leiomyomata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fejzo, M.S.; Yoon, S.J.; Kucherlapati, R.S.

1995-03-20

Uterine leiomyomata are the most common tumors in women and can cause abnormal uterine bleeding, pelvic pain, and infertility. Approximately 200,000 hysterectomies are performed annually in the U.S. to relieve patients of the medical sequelae of these benign neoplasms. Our efforts have focused on cloning the t(12;14)(q14-q15;q23-q24) breakpoint in uterine leiomyoma to further our understanding of the biology of these tumors. Thirty-nine YACs and six cosmids mapping to 12q14-q15 have been mapped by fluorescence in situ hybridization to tumor metaphase chromosomes containing a t(12;14). One YAC spanned the translocation breakpoint and was mapped to tumor metaphases from a pulmonary chondroidmore » hamartoma containing a t(12;14)(q14-q15;q23-q24) and a lipoma containing a t(12;15)(q15;q24); this YAC also spanned the breakpoint in these two tumors, suggesting that the same gene on chromosome 12 may be involved in the pathobiology of these distinct benign neoplasms. 41 refs., 2 figs., 1 tab.« less

Recombinational and physical mapping of the locus for primary open-angle glaucoma (GLC1A) on chromosome 1q23-q25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belmouden, A.; Adam, M.F.; De Dinechin, S.D.

1997-02-01

Primary open-angle glaucoma (POAG) is a leading cause of irreversible blindness in industrialized countries. A locus for juvenile-onset POAG, GLC1A, has been mapped to 1q21-q31 in a 9-cM interval. With recombinant haplotypes, we have now reduced the GLC1A interval to a maximum of 3 cM, between the D1S452/NGA1/D1S210 and NGA5 loci. These loci are 2.8 Mb apart on a 4.7-Mb contig that we have completed between the D1S2851 and D1S218 loci and that includes 96 YAC clones and 48 STSs. The new GLC1A interval itself is now covered by 25 YACs, 30 STSs, and 16 restriction enzyme site landmarks. Themore » lack of a NotI site suggests that the region has few CpG islands and a low gene content. This is compatible with its predominant cytogenetic location on the 1q24 G-band. Finally, we have excluded important candidate genes, including genes coding for three ATPases (AMB1, ATP2B4, ATPlA2), an ion channel (VDAC4), antithrombine III (AT3), and prostaglandin synthase (PTGS2). Our results provide a basis to identify the GLC1A gene. 59 refs., 3 figs., 3 tabs.« less

A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

PubMed

Pedersen, Carsten; Wu, Boqian; Giese, Henriette

2002-11-01

A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

A contiguous clone map over 3 Mb on the long arm of chromosome 11 across a balanced translocation associated with schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, K.L.; Shibasaki, Yoshiro; Devon, R.S.

1995-08-10

Forty-nine clones derived by microdissection of a schizophrenia-associated t(1;11)(q42.1;q14.3) breakpoint region have been assigned by somatic cell hybrid mapping to seven discrete intervals on the long arm of human chromosome 11. Eleven of the clones were shown to map to a small region immediately distal to the translocation breakpoint on 11q. A 3-Mb contiguous clone map of this region was established by isolation of corresponding YAC recombinants. The contig was oriented and shown to traverse the translocation breakpoint by FISH and microsatellite marker analysis. This contig will facilitate the isolation of candidate sequences whose expression may be affected by themore » translocation. 28 refs., 4 figs., 3 tabs.« less

Greig syndrome: Analysis of the GL13 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grzeschik, K.H.; Gessler, M.; Heid, C.

1994-09-01

Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

Delimitation of duplicated segments and identification of their parental origin in two partial chromosome 3p duplications.

PubMed

Antonini, Sylvie; Kim, Chong A; Sugayama, Sofia M; Vianna-Morgante, Angela M

2002-11-22

Two chromosome 3 short arm duplications identified through G-banding were further investigated using fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR) of microsatellite markers, aiming at mapping breakpoints and disclosing mechanisms of origin of these chromosome aberrations. Patient 1 was found to be a mosaic: a 3p12 --> 3p21 duplication was observed in most of his cells, and a normal cell line occurred with a frequency of about 3% in blood. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the short-arm duplication. Using FISH of short-arm sequences, the YAC 961_h_3 was shown to contain the proximal breakpoint (3p12.1 or 3p12.2), and the distal breakpoint was located between the YACs 729_c_3 and 806_h_2, which are adjacent in the WC 3.10 contig (3p21.1). In Patient 2, G-banding indicated a 3p21 --> 3p24 duplication, without mosaicism. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the duplication of short-arm sequences. FISH of chromosome 3 sequences showed that the YAC 749_a_7 spanned the proximal breakpoint (3p21.33). The distal breakpoint mapped to the interval between YACs 932_b_6 (3p24.3) and 909_b_6 (3p25). In both cases, microsatellite genotyping pointed to a rearrangement between paternal sister chromatids. Copyright 2002 Wiley-Liss, Inc.

ESTminer: a Web interface for mining EST contig and cluster databases.

PubMed

Huang, Yecheng; Pumphrey, Janie; Gingle, Alan R

2005-03-01

ESTminer is a Web application and database schema for interactive mining of expressed sequence tag (EST) contig and cluster datasets. The Web interface contains a query frame that allows the selection of contigs/clusters with specific cDNA library makeup or a threshold number of members. The results are displayed as color-coded tree nodes, where the color indicates the fractional size of each cDNA library component. The nodes are expandable, revealing library statistics as well as EST or contig members, with links to sequence data, GenBank records or user configurable links. Also, the interface allows 'queries within queries' where the result set of a query is further filtered by the subsequent query. ESTminer is implemented in Java/JSP and the package, including MySQL and Oracle schema creation scripts, is available from http://cggc.agtec.uga.edu/Data/download.asp agingle@uga.edu.

Cloning of the anhidrotic ectodermal dysplasia gene: Identification of cDNAs associated with CpG islands mapped near translocation breakpoint in two female patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, A.K.; Schlessinger, D.; Kere, J.

1994-09-01

The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less

AAV-dominant negative tumor necrosis factor (DN-TNF) gene transfer to the striatum does not rescue medium spiny neurons in the YAC128 mouse model of Huntington's disease.

PubMed

Alto, Laura Taylor; Chen, Xi; Ruhn, Kelly A; Treviño, Isaac; Tansey, Malú G

2014-01-01

CNS inflammation is a hallmark of neurodegenerative disease, and recent studies suggest that the inflammatory response may contribute to neuronal demise. In particular, increased tumor necrosis factor (TNF) signaling is implicated in the pathology of both Parkinson's disease (PD) and Alzheimer's disease (AD). We have previously shown that localized gene delivery of dominant negative TNF to the degenerating brain region can limit pathology in animal models of PD and AD. TNF is upregulated in Huntington's disease (HD), like in PD and AD, but it is unknown whether TNF signaling contributes to neuronal degeneration in HD. We used in vivo gene delivery to test whether selective reduction of soluble TNF signaling could attenuate medium spiny neuron (MSN) degeneration in the YAC128 transgenic (TG) mouse model of Huntington's disease (HD). AAV vectors encoding cDNA for dominant-negative tumor necrosis factor (DN-TNF) or GFP (control) were injected into the striatum of young adult wild type WT and YAC128 TG mice and achieved 30-50% target coverage. Expression of dominant negative TNF protein was confirmed immunohistologically and biochemically and was maintained as mice aged to one year, but declined significantly over time. However, the extent of striatal DN-TNF gene transfer achieved in our studies was not sufficient to achieve robust effects on neuroinflammation, rescue degenerating MSNs or improve motor function in treated mice. Our findings suggest that alternative drug delivery strategies should be explored to determine whether greater target coverage by DN-TNF protein might afford some level of neuroprotection against HD-like pathology and/or that soluble TNF signaling may not be the primary driver of striatal neuroinflammation and MSN loss in YAC128 TG mice.

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

PubMed

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

Genes in FRA16D and FRA7G Mutated in Prostate Cancer.

DTIC Science & Technology

1999-06-01

Huang H, Nelson M , Smith DI. Cloning and characterization of keratin 21 (K21) highly induced by histone deacetylase inhibitors during differentiation...A395. Kawakami M , Hartmann L, Huntley B, Smith DI, Shridhar V. Allele loss on 16q in high-grade invasive epithelial ovarian cancer. Amer. J. Hum...CEN m N CO o < 1 WC7.7 I-- CD co r-- Q CO CO CD CO Q _L_ 921B4 912D9 _1_ 887 D11 WC7.6 A GAP BETWEEN YAC CONTIGS tu O CD

CSAR-web: a web server of contig scaffolding using algebraic rearrangements.

PubMed

Chen, Kun-Tze; Lu, Chin Lung

2018-05-04

CSAR-web is a web-based tool that allows the users to efficiently and accurately scaffold (i.e. order and orient) the contigs of a target draft genome based on a complete or incomplete reference genome from a related organism. It takes as input a target genome in multi-FASTA format and a reference genome in FASTA or multi-FASTA format, depending on whether the reference genome is complete or incomplete, respectively. In addition, it requires the users to choose either 'NUCmer on nucleotides' or 'PROmer on translated amino acids' for CSAR-web to identify conserved genomic markers (i.e. matched sequence regions) between the target and reference genomes, which are used by the rearrangement-based scaffolding algorithm in CSAR-web to order and orient the contigs of the target genome based on the reference genome. In the output page, CSAR-web displays its scaffolding result in a graphical mode (i.e. scalable dotplot) allowing the users to visually validate the correctness of scaffolded contigs and in a tabular mode allowing the users to view the details of scaffolds. CSAR-web is available online at http://genome.cs.nthu.edu.tw/CSAR-web.

In Vivo MRI Evidence that Neuropathology is Attenuated by Cognitive Enrichment in the Yac128 Huntington's Disease Mouse Model.

PubMed

Steventon, Jessica J; Harrison, David J; Trueman, Rebecca C; Rosser, Anne E; Jones, Derek K; Brooks, Simon P

2015-01-01

Environmental enrichment has been shown to improve symptoms and reduce neuropathology in mouse models of Huntington's disease (HD); however results are limited to ex vivo techniques with associated shortcomings. In-vivo magnetic resonance imaging (MRI) can overcome some of the shortcomings and is applied for the first time here to assess the effect of a cognitive intervention in a mouse model of HD. We aimed to investigate whether in-vivo high-field MRI can detect a disease-modifying effect in tissue macrostructure following a cognitive enrichment regime. YAC128 transgenic and wild type mice were exposed to cognitive enrichment throughout their lifetime. At 20-months old, mice were scanned with a T2-weighted MRI sequence and a region-of-interest (ROI) approach was used to examine structural changes. Locomotor activity and performance on the rotarod and serial discrimination watermaze task were assessed to measure motor and cognitive function respectively. Mice exposed to cognitive enrichment were more active and able to stay on a rotating rod longer compared to control mice, with comparable rotarod performance between HD enriched mice and wild-type mice. YAC128 mice demonstrated cognitive impairments which were not improved by cognitive enrichment. In-vivo MRI revealed a reduction in the degree of caudate-putamen atrophy in the enriched HD mice. We provide in vivo evidence of a beneficial effect of environmental enrichment on neuropathology and motor function in a HD mouse model. This demonstrates the efficacy of MRI in a model of HD and provides the basis for an in-vivo non-destructive outcome measure necessary for longitudinal study designs to understand the effect of enrichment with disease progression.

CoMet: a workflow using contig coverage and composition for binning a metagenomic sample with high precision.

PubMed

Herath, Damayanthi; Tang, Sen-Lin; Tandon, Kshitij; Ackland, David; Halgamuge, Saman Kumara

2017-12-28

In metagenomics, the separation of nucleotide sequences belonging to an individual or closely matched populations is termed binning. Binning helps the evaluation of underlying microbial population structure as well as the recovery of individual genomes from a sample of uncultivable microbial organisms. Both supervised and unsupervised learning methods have been employed in binning; however, characterizing a metagenomic sample containing multiple strains remains a significant challenge. In this study, we designed and implemented a new workflow, Coverage and composition based binning of Metagenomes (CoMet), for binning contigs in a single metagenomic sample. CoMet utilizes coverage values and the compositional features of metagenomic contigs. The binning strategy in CoMet includes the initial grouping of contigs in guanine-cytosine (GC) content-coverage space and refinement of bins in tetranucleotide frequencies space in a purely unsupervised manner. With CoMet, the clustering algorithm DBSCAN is employed for binning contigs. The performances of CoMet were compared against four existing approaches for binning a single metagenomic sample, including MaxBin, Metawatt, MyCC (default) and MyCC (coverage) using multiple datasets including a sample comprised of multiple strains. Binning methods based on both compositional features and coverages of contigs had higher performances than the method which is based only on compositional features of contigs. CoMet yielded higher or comparable precision in comparison to the existing binning methods on benchmark datasets of varying complexities. MyCC (coverage) had the highest ranking score in F1-score. However, the performances of CoMet were higher than MyCC (coverage) on the dataset containing multiple strains. Furthermore, CoMet recovered contigs of more species and was 18 - 39% higher in precision than the compared existing methods in discriminating species from the sample of multiple strains. CoMet resulted in higher precision

U50: A New Metric for Measuring Assembly Output Based on Non-Overlapping, Target-Specific Contigs.

PubMed

Castro, Christina J; Ng, Terry Fei Fan

2017-11-01

Advances in next-generation sequencing technologies enable routine genome sequencing, generating millions of short reads. A crucial step for full genome analysis is the de novo assembly, and currently, performance of different assembly methods is measured by a metric called N 50 . However, the N 50 value can produce skewed, inaccurate results when complex data are analyzed, especially for viral and microbial datasets. To provide a better assessment of assembly output, we developed a new metric called U 50 . The U 50 identifies unique, target-specific contigs by using a reference genome as baseline, aiming at circumventing some limitations that are inherent to the N 50 metric. Specifically, the U 50 program removes overlapping sequence of multiple contigs by utilizing a mask array, so the performance of the assembly is only measured by unique contigs. We compared simulated and real datasets by using U 50 and N 50 , and our results demonstrated that U 50 has the following advantages over N 50 : (1) reducing erroneously large N 50 values due to a poor assembly, (2) eliminating overinflated N 50 values caused by large measurements from overlapping contigs, (3) eliminating diminished N 50 values caused by an abundance of small contigs, and (4) allowing comparisons across different platforms or samples based on the new percentage-based metric UG 50 %. The use of the U 50 metric allows for a more accurate measure of assembly performance by analyzing only the unique, non-overlapping contigs. In addition, most viral and microbial sequencing have high background noise (i.e., host and other non-targets), which contributes to having a skewed, misrepresented N 50 value-this is corrected by U 50 . Also, the UG 50 % can be used to compare assembly results from different samples or studies, the cross-comparisons of which cannot be performed with N 50 .

CBrowse: a SAM/BAM-based contig browser for transcriptome assembly visualization and analysis.

PubMed

Li, Pei; Ji, Guoli; Dong, Min; Schmidt, Emily; Lenox, Douglas; Chen, Liangliang; Liu, Qi; Liu, Lin; Zhang, Jie; Liang, Chun

2012-09-15

To address the impending need for exploring rapidly increased transcriptomics data generated for non-model organisms, we developed CBrowse, an AJAX-based web browser for visualizing and analyzing transcriptome assemblies and contigs. Designed in a standard three-tier architecture with a data pre-processing pipeline, CBrowse is essentially a Rich Internet Application that offers many seamlessly integrated web interfaces and allows users to navigate, sort, filter, search and visualize data smoothly. The pre-processing pipeline takes the contig sequence file in FASTA format and its relevant SAM/BAM file as the input; detects putative polymorphisms, simple sequence repeats and sequencing errors in contigs and generates image, JSON and database-compatible CSV text files that are directly utilized by different web interfaces. CBowse is a generic visualization and analysis tool that facilitates close examination of assembly quality, genetic polymorphisms, sequence repeats and/or sequencing errors in transcriptome sequencing projects. CBrowse is distributed under the GNU General Public License, available at http://bioinfolab.muohio.edu/CBrowse/ liangc@muohio.edu or liangc.mu@gmail.com; glji@xmu.edu.cn Supplementary data are available at Bioinformatics online.

An integrated genetic and physical map of the autosomal recessive polycystic kidney disease region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lens, X.M.; Onuchic, L.F.; Daoust, M.

1997-05-01

Autosomal recessive polycystic kidney disease is one of the most common hereditary renal cystic diseases in children. Genetic studies have recently assigned the only known locus for this disorder, PKHD1, to chromosome 6p21-p12. We have generated a YAC contig that spans {approximately}5 cM of this region, defined by the markers D6S1253-D6S295, and have mapped 43 sequence-tagged sites (STS) within this interval. This set includes 20 novel STSs, which define 12 unique positions in the region, and three ESTs. A minimal set of two YACs spans the segment D6S465-D6S466, which contains PKHD1, and estimates of their sizes based on information inmore » public databases suggest that the size of the critical region is <3.1 Mb. Twenty-eight STSs map to this interval, giving an average STS density of <1/150 kb. These resources will be useful for establishing a complete trancription map of the PKHD1 region. 10 refs., 1 fig., 1 tab.« less

Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin

USDA-ARS?s Scientific Manuscript database

Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin. This study included 2 submissions with a total of 9.8 million bp of assembled contigs....

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)

PubMed Central

Mascher, Martin; Muehlbauer, Gary J; Rokhsar, Daniel S; Chapman, Jarrod; Schmutz, Jeremy; Barry, Kerrie; Muñoz-Amatriaín, María; Close, Timothy J; Wise, Roger P; Schulman, Alan H; Himmelbach, Axel; Mayer, Klaus FX; Scholz, Uwe; Poland, Jesse A; Stein, Nils; Waugh, Robbie

2013-01-01

Next-generation whole-genome shotgun assemblies of complex genomes are highly useful, but fail to link nearby sequence contigs with each other or provide a linear order of contigs along individual chromosomes. Here, we introduce a strategy based on sequencing progeny of a segregating population that allows de novo production of a genetically anchored linear assembly of the gene space of an organism. We demonstrate the power of the approach by reconstructing the chromosomal organization of the gene space of barley, a large, complex and highly repetitive 5.1 Gb genome. We evaluate the robustness of the new assembly by comparison to a recently released physical and genetic framework of the barley genome, and to various genetically ordered sequence-based genotypic datasets. The method is independent of the need for any prior sequence resources, and will enable rapid and cost-efficient establishment of powerful genomic information for many species. PMID:23998490

Genetic and physical mapping at the limb-girdle muscular dystrophy locus (LGMD2B) on chromosome 2p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bashir, R.; Keers, S.; Strachan, T.

1996-04-01

The limb-girdle muscular dystrophies (LGMD) are a genetically heterogeneous group of disorders, different forms of which have been mapped to at least six distinct genetic loci. We have mapped to at least six distinct genetic loci. We have mapped an autosomal recessive form of LGMD (LGMD2B) to chromosome 2p13. Two other conditions have been shown to map to this region or to the homologous region in mouse: a gene for a form of autosomal recessive distal muscular dystrophy, Miyoshi myopathy, shows linkage to the same markers on chromosome 2p as LGMD2B, and an autosomal recessive mouse mutation mnd2, in whichmore » there is rapidly progressive paralysis and muscle atrophy, has been mapped to mouse chromosome 6 to a region showing conserved synteny with human chromosome 2p12-p13. We have assembled a 6-cM YAC contig spanning the LGMD2B locus and have mapped seven genes and 13 anonymous polymorphic microsatellites to it. Using haplotype analysis in the linked families, we have narrowed our region of interest to a 0-cM interval between D2S2113 and D2S145, which does not overlap with the critical region for mnd2 in mouse. Use of these most closely linked markers will help to determine the relationship between LGMD2B and Miyoshi myopathy. YACs selected from our contig will be the starting point for the cloning of the LGMD2B gene and thereby establish the biological basis for this form of muscular dystrophy and its relationship with the other limb-girdle muscular dystrophies. 26 refs., 6 figs.« less

Improved assemblies using a source-agnostic pipeline for MetaGenomic Assembly by Merging (MeGAMerge) of contigs

DOE PAGES

Scholz, Matthew; Lo, Chien -Chi; Chain, Patrick S. G.

2014-10-01

Assembly of metagenomic samples is a very complex process, with algorithms designed to address sequencing platform-specific issues, (read length, data volume, and/or community complexity), while also faced with genomes that differ greatly in nucleotide compositional biases and in abundance. To address these issues, we have developed a post-assembly process: MetaGenomic Assembly by Merging (MeGAMerge). We compare this process to the performance of several assemblers, using both real, and in-silico generated samples of different community composition and complexity. MeGAMerge consistently outperforms individual assembly methods, producing larger contigs with an increased number of predicted genes, without replication of data. MeGAMerge contigs aremore » supported by read mapping and contig alignment data, when using synthetically-derived and real metagenomic data, as well as by gene prediction analyses and similarity searches. Ultimately, MeGAMerge is a flexible method that generates improved metagenome assemblies, with the ability to accommodate upcoming sequencing platforms, as well as present and future assembly algorithms.« less

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

Sequence analysis and transcript identification within 1.5 MB of DNA deleted together with the NDP and MAO genes in atypical Norrie disease patients presenting with a profound phenotype.

PubMed

Suárez-Merino, B; Bye, J; McDowall, J; Ross, M; Craig, I W

2001-06-01

Mutations at the Norrie disease gene locus, NDP, manifest in a broad range of defects. These range from a relatively mild, late-onset, exudative vitreoretinopathy to congenital blindness and sensorineural deafness combined, in some cases, with mental retardation. In addition, extensive deletions involving the NDP locus, located at Xp11.3, the adjacent monoamine oxidadase genes MAOA and MAOB, and additional material, result in a more severe pattern of symptoms. The phenotypes include all or some of the following; mental retardation, involuntary movements, hypertensive crises and hypogonadism. We extended an existing YAC contig to embrace the boundaries of three of the largest deletions and converted this into four PAC contigs. Computer analysis and experimental data have resulted in the identification of several putative loci, including a phosphatase inhibitor 2-like gene (dJ154.1) and a 250-bp sequence which resembles a homeobox domain (dA113.3), 1.2 Mb and 400 kb respectively from the MAO/NDP cluster. The pattern of expression of dJ154.1 suggests that it may represent an important factor contributing to the complex phenotypes of these deletion patients. Hum Mutat 17:523, 2001. Copyright 2001 Wiley-Liss, Inc.

Anchoring 9,371 Maize Expressed Sequence Tagged Unigenes to the Bacterial Artificial Chromosome Contig Map by Two-Dimensional Overgo Hybridization1

PubMed Central

Gardiner, Jack; Schroeder, Steven; Polacco, Mary L.; Sanchez-Villeda, Hector; Fang, Zhiwei; Morgante, Michele; Landewe, Tim; Fengler, Kevin; Useche, Francisco; Hanafey, Michael; Tingey, Scott; Chou, Hugh; Wing, Rod; Soderlund, Carol; Coe, Edward H.

2004-01-01

Our goal is to construct a robust physical map for maize (Zea mays) comprehensively integrated with the genetic map. We have used a two-dimensional 24 × 24 overgo pooling strategy to anchor maize expressed sequence tagged (EST) unigenes to 165,888 bacterial artificial chromosomes (BACs) on high-density filters. A set of 70,716 public maize ESTs seeded derivation of 10,723 EST unigene assemblies. From these assemblies, 10,642 overgo sequences of 40 bp were applied as hybridization probes. BAC addresses were obtained for 9,371 overgo probes, representing an 88% success rate. More than 96% of the successful overgo probes identified two or more BACs, while 5% identified more than 50 BACs. The majority of BACs identified (79%) were hybridized with one or two overgos. A small number of BACs hybridized with eight or more overgos, suggesting that these BACs must be gene rich. Approximately 5,670 overgos identified BACs assembled within one contig, indicating that these probes are highly locus specific. A total of 1,795 megabases (Mb; 87%) of the total 2,050 Mb in BAC contigs were associated with one or more overgos, which are serving as sequence-tagged sites for single nucleotide polymorphism development. Overgo density ranged from less than one overgo per megabase to greater than 20 overgos per megabase. The majority of contigs (52%) hit by overgos contained three to nine overgos per megabase. Analysis of approximately 1,022 Mb of genetically anchored BAC contigs indicates that 9,003 of the total 13,900 overgo-contig sites are genetically anchored. Our results indicate overgos are a powerful approach for generating gene-specific hybridization probes that are facilitating the assembly of an integrated genetic and physical map for maize. PMID:15020742

Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Pandolfo, M.

1994-09-01

Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

Mapping of the 3q27 region involved in Dup(3q) syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rizzu, P.; Baldini, A.; Overhauser, J.

1994-09-01

The duplication 3q syndrome is characterized by partial trisomy of a segment of the long arm of chromosome 3. We have previously found that 3q26.3-3q27 is the minimal region of trisomy overlap. This critical region (CR) is delimited by two patient chromosome breakpoints, approximately 10 cM apart. In order to identify the gene(s) responsible for the Dup(3q) phenotype, we are generating a physical map of the region and identifying expressed sequences. First, we have generated a cytological map using two- and three-color fluorescence in situ hybridization on metaphase and interphase chromosomes. Results allowed us to determine the centromere-telomere orientation, ordermore » and relative distances of six cosmid clones mapped to the CR. Because some of the markers used are part of the consensus chromosome 3 map, our data were easily integrated with existing mapping information. Subsequently, we have included in the map YAC clones positive for polymorphic PCR markers identified by CEPH-Genethon, as well as newly isolated YACs. We have assigned them to the critical region 7 of the Genethon polymorphic markers and linked them to three YAC contigs. Currently our map includes two of the five genes known to map in this region. Interestingly, we found that these two functionally related genes (kininogen and histidin-rich glycoprotein) map to the same 1 Mb genomic fragment. As the physical map is being constructed we are searching for expressed sequences. Positive cDNAs have been found and their characterization is in progress. In conclusion, we will present an integrated map of 3q27 that includes genetic, physical and cytological information as well as gene annotation. As Dup(3q) syndrome is likely to be a contiguous gene syndrome, such a map will be necessary for our understanding of this multiple congenital anomaly.« less

A 405-kb cosmid contig and HindIII restriction map of the progressive myoclonus epilepsy type 1 (EPM1) candidate region in 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafreniere, R.G.; Rouleau, G.A.; De Jong, P.J.

1995-09-01

As a step toward identifying the molecular defect in patients afflicted with progressive myoclonus epilepsy type 1 (EPM1), we have assembled a cosmid contig of the candidate EPM1 region in 21q22.3. The contig constitutes a collection of 87 different cosmids spanning 405 kb based on a derived HindIII restriction map. Potential CpG-rich islands have been identified based on the restriction map generated from eight different rare-cutting enzymes. This contig contains the genetic material required for the isolation of expressed sequences and the identification of the gene defective in EPM1 and possibly other disorders mapping to this region. 15 refs., 1more » fig.« less

Physical mapping of the Gorlin syndrome region on 9q22 by pulsed field gel electrophoresis (PFGE) and FISH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levanat, S.; Gailani, M.; Dean, M.

1994-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by basal cell carcinomas, medulloblastomas, and ovarian fibromas, as well as widespread developmental defects. Linkage and tumor deletion studies localized the gene for this syndrome to the 3 cM region on chromosome 9q22 between D9S196 and D9S180. Several groups have constructed YAC contigs of this region, but many of the YACs are known to contain rearrangements. Mapping by PGE and FISH is useful in further characterization of the relationship between physical distance and genetic distance. We isolated seven cosmids mapping to this region (D9S180, D9S196, D9S287, Col 15A1, XPA and two newmore » anonymous cosmids). FISH gave a distance between D9S196 and D9S180 of at least 2 Mb and showed that Col15A1, previously considered as a candidate gene, mapped a few hundred kb distal to S180. For PFGE, DNA blocks from normal and 20 Gorlin syndrome patients were digested with 5 restriction enzymes and probed with single copy fragments of the seven cosmids. No aberrant bands have been identified in patients. Non-overlapping Not I fragments from these seven markers totalled 2.3 kb. Given an average gene density, a region of this size would contain 50-100 genes.« less

The gene for autosomal dominant cerebellar ataxia type II is located in a 5-cM region in 3p12-p13: genetic and physical mapping of the SCA7 locus.

PubMed

David, G; Giunti, P; Abbas, N; Coullin, P; Stevanin, G; Horta, W; Gemmill, R; Weissenbach, J; Wood, N; Cunha, S; Drabkin, H; Harding, A E; Agid, Y; Brice, A

1996-12-01

Two families with autosomal dominant cerebellar ataxia with pigmentary macular dystrophy (ADCA type II) were investigated. Analysis of 23 parent-child couples demonstrated the existence of marked anticipation, greater in paternal than in maternal transmissions, with earlier age at onset and a more rapid clinical course in successive generations. Clinical analysis revealed the presence of a great variability in age at onset, initial symptom, and associated signs, confirming the characteristic clinical heterogeneity of ADCA type II. The gene for ADCA type II previously was mapped to the spinocerebellar ataxia 7 (SCA7) locus on chromosome 3p12-p21.1. Linkage analysis of the two new families of different geographic origin confirmed the characteristic genetic homogeneity of ADCA type II, distinguishing it from ADCA type I. Haplotype analysis permitted refinement of the SCA7 region to the 5-cM interval between markers D3S1312 and D3S1600 on chromosome 3p12-p13. Eighteen sequence-tagged sites were used for the construction of an integrated map of the candidate region, based on a YACs contig. The entire candidate region is contained in a single nonchimeric YAC of 660 kb. The probable involvement of a CAG trinucleotide expansion, suggested by previous studies, should greatly facilitate the identification of the gene for ADCA type II.

The gene for autosomal dominant cerebellar ataxia type II is located in a 5-cM region in 3p12-p13: genetic and physical mapping of the SCA7 locus.

PubMed Central

David, G.; Giunti, P.; Abbas, N.; Coullin, P.; Stevanin, G.; Horta, W.; Gemmill, R.; Weissenbach, J.; Wood, N.; Cunha, S.; Drabkin, H.; Harding, A. E.; Agid, Y.; Brice, A.

1996-01-01

Two families with autosomal dominant cerebellar ataxia with pigmentary macular dystrophy (ADCA type II) were investigated. Analysis of 23 parent-child couples demonstrated the existence of marked anticipation, greater in paternal than in maternal transmissions, with earlier age at onset and a more rapid clinical course in successive generations. Clinical analysis revealed the presence of a great variability in age at onset, initial symptom, and associated signs, confirming the characteristic clinical heterogeneity of ADCA type II. The gene for ADCA type II previously was mapped to the spinocerebellar ataxia 7 (SCA7) locus on chromosome 3p12-p21.1. Linkage analysis of the two new families of different geographic origin confirmed the characteristic genetic homogeneity of ADCA type II, distinguishing it from ADCA type I. Haplotype analysis permitted refinement of the SCA7 region to the 5-cM interval between markers D3S1312 and D3S1600 on chromosome 3p12-p13. Eighteen sequence-tagged sites were used for the construction of an integrated map of the candidate region, based on a YACs contig. The entire candidate region is contained in a single nonchimeric YAC of 660 kb. The probable involvement of a CAG trinucleotide expansion, suggested by previous studies, should greatly facilitate the identification of the gene for ADCA type II. PMID:8940279

A high-resolution whole genome radiation hybrid map of human chromosome 17q22-q25.3 across the genes for GH and TK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foster, J.W.; Schafer, A.J.; Critcher, R.

1996-04-15

We have constructed a whole genome radiation hybrid (WG-RH) map across a region of human chromosome 17q, from growth hormone (GH) to thymidine kinase (TK). A panel of 128 WG-RH hybrid cell lines generated by X-irradiation and fusion has been tested for the retention of 39 sequence-tagged site (STS) markers by the polymerase chain reaction. This genome mapping technique has allowed the integration of existing VNTR and microsatellite markers with additional new markers and existing STS markers previously mapped to this region by other means. The WG-RH map includes eight expressed sequence tag (EST) and three anonymous markers developed formore » this study, together with 23 anonymous microsatellites and five existing ESTs. Analysis of these data resulted in a high-density comprehensive map across this region of the genome. A subset of these markers has been used to produce a framework map consisting of 20 loci ordered with odds greater than 1000:1. The markers are of sufficient density to build a YAC contig across this region based on marker content. We have developed sequence tags for both ends of a 2.1-Mb YAC and mapped these using the WG-RH panel, allowing a direct comparison of cRay{sub 6000} to physical distance. 31 refs., 3 figs., 2 tabs.« less

Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

PubMed

Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

1999-06-01

Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Low-frequency chimeric yeast artificial chromosome libraries from flow-sorted human chromosomes 16 and 21.

PubMed Central

McCormick, M K; Campbell, E; Deaven, L; Moyzis, R

1993-01-01

Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075

Mapping of the chromosome 1p36 region surrounding the Charcot-Marie-Tooth disease type 2A locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denton, P.; Gere, S.; Wolpert, C.

1994-09-01

Charcot-Marie-Tooth (CMT) disease is the most common inherited peripheral neuropathy. Although CMT2 is clinically indistinguishable from CMT1, the two forms can be differentiated by pathological and neurophysiological methods. We have established one locus, CMT2A on chromosome 1p36, and have established genetic heterogeneity. This locus maps to the region of the deletions associated with neuroblastoma. We have now identified an additional 11 CMT2 families. Three families are linked to chromosome 1p36 while six families are excluded from this region. Another six families are currently under analysis and collection. To date the CMT2A families represent one third of those CMT2 families examined.more » We have established a microdissection library of the 1p36 region which is currently being characterized for microsatellite repeats and STSs using standard hybridization techniques and a modified degenerate primer method. In addition, new markers (D1S253, D1S450, D1S489, D1S503, GATA27E04, and GATA4H04) placed in this region are being mapped using critical recombinants in the CEPH reference pedigrees. Fluorescent in situ hybridization (FISH) has been used to confirm mapping. A YAC contig is being assembled from the CEPH megabase library using STSs to isolate key YACs which are extended by vectorette end clone and Alu-PCR. These findings suggest that the CMT2 phenotype is secondary to at least two different genes and demonstrates further heterogeneity in the CMT phenotype.« less

A 2.5-Mb contig constructed from Angus, Longhorn and horned Hereford DNA spanning the polled interval on bovine chromosome 1.

PubMed

Wunderlich, K R; Abbey, C A; Clayton, D R; Song, Y; Schein, J E; Georges, M; Coppieters, W; Adelson, D L; Taylor, J F; Davis, S L; Gill, C A

2006-12-01

The polled locus has been mapped by genetic linkage analysis to the proximal region of bovine chromosome 1. As an intermediate step in our efforts to identify the polled locus and the underlying causative mutation for the polled phenotype, we have constructed a BAC-based physical map of the interval containing the polled locus. Clones containing genes and markers in the critical interval were isolated from the TAMBT (constructed from Angus and Longhorn genomic DNA) and CHORI-240 (constructed from horned Hereford genomic DNA) BAC libraries and ordered based on fingerprinting and the presence or absence of 80 STS markers. A single contig spanning 2.5 Mb was assembled. Comparison of the physical order of STSs to the corresponding region of human chromosome 21 revealed the same order of genes within the polled critical interval. This contig of overlapping BAC clones from horned and polled breeds is a useful resource for SNP discovery and characterization of positional candidate genes.

Physical mapping of chromosome 12q breakpoints in lipoma, pleomorphic salivary gland adenoma, uterine leiomyoma, and myxoid liposarcoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoenmakers, E.F.P.M.; Kools, P.F.J.; Mols, R.

1994-03-15

The authors report here the physical mapping of recurrent chromosome 12q13-q15 breakpoints in cell lines derived from primary myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands. In fluorescence in situ hybridization (FISH) experiments, they first mapped the position of the chromosome 12 translocation breakpoint in uterine leiomyoma cell line LM-30.1/SV40 relative to loci COL2A1, D12S4, D12S17, D12S6, D12S19, D12S8, and D12S7. It mapped between linkage probes CRI-C86 (D12S19) and p7G11 (D12S8). They then isolated YAC clones using CRI-C86- and p7G11-derived sequence-tagged sites, constructed corresponding YAC contigs of 310 and 800 kb, respectively, and a mixture ofmore » them was used to routinely study the various tumor cell lines by FISH analysis. The chromosome 12 breakpoints of all tumor cell lines tested mapped between cosmids LLNL12NCO1-98C10 and LLNL12NCO1-113D12. None of the breakpoints appeared to map within any of the isolated YAC clones. Furthermore, FISH analysis using cosmid LLNL12-NCO1-144G3, which maps at the CHOP locus, revealed that the chromosome 12 breakpoints in all cell lines of the three benign solid tumors that were tested were located distal to the chromosome 12 translocation breakpoint with the CHOP gene in myxoid liposarcoma cells with t(12;16). In conclusion, the studies seem to indicate that the chromosome 12 breakpoints of myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands are all clustered within the 7-cM interval between D12S19 and D12S8, with those of the benign solid tumors distal to CHOP. Finally, the MYF5 gene mapped telomeric to LLNL12NCO1-113D12, and the MIP gene mapped centromeric to the chromosome 12 translocation breakpoint in myxoid liposarcoma cells. 56 refs., 5 figs., 3 tabs.« less

Cross-species bacterial artificial chromosome (BAC) library screening via overgo-based hybridization and BAC-contig mapping of a yield enhancement quantitative trait locus (QTL) yld1.1 in the Malaysian wild rice Oryza rufipogon.

PubMed

Song, Beng-Kah; Nadarajah, Kalaivani; Romanov, Michael N; Ratnam, Wickneswari

2005-01-01

The construction of BAC-contig physical maps is an important step towards a partial or ultimate genome sequence analysis. Here, we describe our initial efforts to apply an overgo approach to screen a BAC library of the Malaysian wild rice species, Oryza rufipogon. Overgo design is based on repetitive element masking and sequence uniqueness, and uses short probes (approximately 40 bp), making this method highly efficient and specific. Pairs of 24-bp oligos that contain an 8-bp overlap were developed from the publicly available genomic sequences of the cultivated rice, O. sativa, to generate 20 overgo probes for a 1-Mb region that encompasses a yield enhancement QTL yld1.1 in O. rufipogon. The advantages of a high similarity in melting temperature, hybridization kinetics and specific activities of overgos further enabled a pooling strategy for library screening by filter hybridization. Two pools of ten overgos each were hybridized to high-density filters representing the O. rufipogon genomic BAC library. These screening tests succeeded in providing 69 PCR-verified positive hits from a total of 23,040 BAC clones of the entire O. rufipogon library. A minimal tilling path of clones was generated to contribute to a fully covered BAC-contig map of the targeted 1-Mb region. The developed protocol for overgo design based on O. sativa sequences as a comparative genomic framework, and the pooled overgo hybridization screening technique are suitable means for high-resolution physical mapping and the identification of BAC candidates for sequencing.

NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

PubMed Central

Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

2000-01-01

Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

Empowering Youth to Take Charge of School Wellness

ERIC Educational Resources Information Center

Hughes, Luanne J.; Savoca, LeeAnne; Grenci, Alexandra

2015-01-01

Youth Advisory Councils (YACs) ensure that students are represented in school wellness discussions. YACs empower students to present ideas, insights, and input on nutrition and physical activity; work alongside peers to assess wellness needs; and develop recommendations for enhancing/expanding the school wellness environment. YACs provide a…

DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

PubMed

Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

2010-05-07

Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

Long-range restriction map of human chromosome 22q11-22q12 between the lambda immunoglobulin locus and the Ewing sarcoma breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDermid, H.E.; Budarf, M.L.; Emanuel, B.S.

1993-11-01

A long-range restriction map of the region between the immunoglobulin lambda locus and the Ewing sarcoma breakpoint has been constructed using the rare-cutting enzymes NotI, NruI, AscI, and BsiWI. The map spans approximately 11,000 kb and represents about one-fifth of the long arm of chromosome 22. Thirty-nine markers, including seven NotI junction clones as well as numerous genes and anonymous sequences, were mapped to the region with a somatic cell hybrid panel. These probes were then used to produce the map. The seven NotI junction clones each identified a possible CpG island. The breakpoints of the RAJ5 hybrid and themore » Ewing sarcoma t(11;22) were also localized in the resulting map. This physical map will be useful in studying chromosomal rearrangements in the region, as well as providing the details to examine the fidelity of the YAC and cosmid contigs currently under construction. Comparisons of this physical map to genetic and radiation hybrid maps are discussed. 52 refs., 7 figs., 3 tabs.« less

Rapid determination of yunaconitine and related alkaloids in aconites and aconite-containing drugs by ultra high-performance liquid chromatography-tandem mass spectrometry.

PubMed

Song, Long; Zhang, Hong; Liu, Xin; Zhao, Zhi-Li; Chen, Shi-Lin; Wang, Zheng-Tao; Xu, Hong-Xi

2012-12-01

Yunaconitine (YAC) is a toxic aconite alkaloid that is considered to be a hidden aconite poison since it is frequently found in body fluids from aconite poisoning patients, but has not been well studied in commonly used herbal drugs. In this paper, a rapid and sensitive ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) detection combined with microwave-assisted extraction (MAE) was developed for high throughput simultaneous determination of YAC and six other toxic aconite alkaloids in 31 samples of crude, processed aconites and aconite-containing drugs. The optimized method showed excellent linearity, precision, accuracy and recovery for all target compounds with short run time. YAC was detected in some samples with contents from 0.015 to 10.41 mg/g. This is the first report on the determination of YAC in Radix Aconiti, Radix Aconiti Kusnezoffii and aconite-containing drugs. This newly developed method facilitates the rapid screening of YAC and related toxic aconite alkaloids and allows YAC to be used as a chemical marker for the quality control of aconites and aconite-containing drugs. Copyright © 2012 John Wiley & Sons, Ltd.

ScaffoldScaffolder: solving contig orientation via bidirected to directed graph reduction.

PubMed

Bodily, Paul M; Fujimoto, M Stanley; Snell, Quinn; Ventura, Dan; Clement, Mark J

2016-01-01

The contig orientation problem, which we formally define as the MAX-DIR problem, has at times been addressed cursorily and at times using various heuristics. In setting forth a linear-time reduction from the MAX-CUT problem to the MAX-DIR problem, we prove the latter is NP-complete. We compare the relative performance of a novel greedy approach with several other heuristic solutions. Our results suggest that our greedy heuristic algorithm not only works well but also outperforms the other algorithms due to the nature of scaffold graphs. Our results also demonstrate a novel method for identifying inverted repeats and inversion variants, both of which contradict the basic single-orientation assumption. Such inversions have previously been noted as being difficult to detect and are directly involved in the genetic mechanisms of several diseases. http://bioresearch.byu.edu/scaffoldscaffolder. paulmbodily@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

Progress towards mapping the constitutional t(11:22) breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnoski, B.L.; Emanuel, B.S.; Bell, C.J.

1994-09-01

The reciprocal t(11;22)(q23;q11) is the most frequent, recurrent, non-Robertsonian, constitutional translocation in humans. Balanced carriers of this rearrangement are phenotypically normal, but are at risk for producing abnormal offspring with the Supernumerary der(22)t(11;22) Syndrome. Further, a recent report of association between t(11;22) balanced translocation carriers and breast cancer, suggests the involvement of genes on 11q and/or 22q in breast cancer tumorigenesis. Studies are in progress to examine the similarity between 11q23 and 22q11 breakpoints in multiple families with the constitutional t(11;22). A 750 kb YAC, which contains markers known to flank the 11q23 breakpoint, was identified in CEPH/Genethon database. FISHmore » with this YAC to two independent t(11;22) cell lines demonstrates signal on both derivative chromosomes. Numerous YACs containing BCRL2, the closest marker proximal to the breakpoint, were identified. Analysis of these YACs to determine which contain the actual breakpoint sequences is complicated by the presence of a duplicated segment of 22q11 which contains a GGTL and a BCRL locus. Sequences homologous to these loci are present at several other locations in 22q11. The BCRL positive YACs were analyzed by Southern hybridization under conditions which distinguish the four members of the BCR/BCRL family. FISH of total yeast DNA plus YAC DNA labeled by nick translation, or biotin-labeled inter-Alu PCR products confirmed the localization of these YACs to 22q11. Additional FISH with these YACS to metaphase spreads prepared from balanced t(11;22) carriers confirm that these clones span the breakpoint, and will allow rapid isolation and definition of the genetic region adjacent to the t(11;22) breakpoint.« less

Using in situ hybridization and PFGE Southern hybridization to detect translocation breakpoints in a BOR/TRPS patient cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Sapru, M.; Smith, D.

Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder characterized by ear malformations, cervical fistulae, hearing loss and renal abnormalities. We have integrated the Genethon YAC contig maps with additional markers in the chromosome 8q region genetically linked by a unique patient cell line. This cell line is from a patient who has both the branchio-oto-renal syndrome and tricho-rhino-phalangeal syndrome (TRPS). High resolution cytogenetics demonstrated a direct insertion of materials from 8q13.3q21.13 to 8q24.11. TRPS has been previously linked to deletions involving 8q24.11-q24.13. The rearrangement in this patient suggests that TRPS results from loss of gene function due to insertion atmore » the 8q24.11 breakpoint and the possible location for the BOR gene is at either of the two breakpoints of 8q13.3 and 8q21.13. We have constructed cosmid contigs in 8q24.11. In situ hybridization with cosmids mapped to these locations as probes has helped to narrow down the breakpoints. Combinations of cosmids on either side or overlapping the 8q24.11 breakpoint show split signals on one chromosome 8q arm due to insertion of the materials from the proximal region. Cosmids mapped to the TRPS deletion region have been used to hybridize to pulsed field gel genomic blots of DNA from the patient cell line and detected rearranged genomic fragments. Both in situ hybridization and genomic PFGE Southern blot will be used to precisely locate the breakpoints.« less

A post-assembly genome-improvement toolkit (PAGIT) to obtain annotated genomes from contigs.

PubMed

Swain, Martin T; Tsai, Isheng J; Assefa, Samual A; Newbold, Chris; Berriman, Matthew; Otto, Thomas D

2012-06-07

Genome projects now produce draft assemblies within weeks owing to advanced high-throughput sequencing technologies. For milestone projects such as Escherichia coli or Homo sapiens, teams of scientists were employed to manually curate and finish these genomes to a high standard. Nowadays, this is not feasible for most projects, and the quality of genomes is generally of a much lower standard. This protocol describes software (PAGIT) that is used to improve the quality of draft genomes. It offers flexible functionality to close gaps in scaffolds, correct base errors in the consensus sequence and exploit reference genomes (if available) in order to improve scaffolding and generating annotations. The protocol is most accessible for bacterial and small eukaryotic genomes (up to 300 Mb), such as pathogenic bacteria, malaria and parasitic worms. Applying PAGIT to an E. coli assembly takes ∼24 h: it doubles the average contig size and annotates over 4,300 gene models.

Construction of human chromosome 21-specific yeast artificial chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCormick, M.K.; Shero, J.H.; Hieter, P.A.

1989-12-01

Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less

Recombination walking: genetic selection of clones from pooled libraries of yeast artificial chromosomes by homologous recombination.

PubMed Central

Miller, A M; Savinelli, E A; Couture, S M; Hannigan, G M; Han, Z; Selden, R F; Treco, D A

1993-01-01

Recombination walking is based on the genetic selection of specific human clones from a yeast artificial chromosome (YAC) library by homologous recombination. The desired clone is selected from a pooled (unordered) YAC library, eliminating labor-intensive steps typically used in organizing and maintaining ordered YAC libraries. Recombination walking represents an efficient approach to library screening and is well suited for chromosome-walking approaches to the isolation of genes associated with common diseases. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8367472

Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.; Yan, D.; McHenry, C.

1994-09-01

Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice

PubMed Central

Vidal, Ruben; Sammeta, Neeraja; Garringer, Holly J.; Sambamurti, Kumar; Miravalle, Leticia; Lamb, Bruce T.; Ghetti, Bernardino

2012-01-01

Genetically engineered mice have been generated to model cerebral β-amyloidosis, one of the hallmarks of Alzheimer disease (AD) pathology, based on the overexpression of a mutated cDNA of the amyloid-β precursor protein (AβPP) or by knock-in of the murine Aβpp gene alone or with presenilin1 mutations. Here we describe the generation and initial characterization of a new mouse line based on the presence of 2 copies of the human genomic region encoding the wild-type AβPP and the L166P presenilin 1 mutation. At ∼6 mo of age, double-mutant mice develop amyloid pathology, with signs of neuritic dystrophy, intracellular Aβ accumulation, and glial inflammation, an increase in AβPP C-terminal fragments, and an 8 times increase in Aβ42 levels with a 40% decrease in Aβ40 levels, leading to a significant increase (14 times) of Aβ42/Aβ40 ratios, with minimal effects on presenilin or the Notch1 pathway in the brain. We conclude that in mice, neither mutations in AβPP nor overexpression of an AβPP isoform are a prerequisite for Aβ pathology. This model will allow the study of AD pathogenesis and testing of therapeutic strategies in a more relevant environment without experimental artifacts due to the overexpression of a single-mutant AβPP isoform using exogenous promoters.—Vidal, R., Sammeta, N., Garringer, H. J., Sambamurti, K., Miravalle, L., Lamb B. T., Ghetti, B. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice. PMID:22459153

Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dry, K.L.; Aldred, M.A.; Hardwick, L.J.

1994-09-01

Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willard, H.F.; Cremers, F.; Mandel, J.L.

A high-quality integrated genetic and physical map of the X chromosome from telomere to telomere, based primarily on YACs formatted with probes and STSs, is increasingly close to reality. At the Fifth International X Chromosome Workshop, organized by A.M. Poustka and D. Schlessinger in Heidelberg, Germany, April 24--27, 1994, substantial progress was recorded on extension and refinement of the physical map, on the integration of genetic and cytogenetic data, on attempts to use the map to direct gene searches, and on nascent large-scale sequencing efforts. This report summarizes physical and genetic mapping information presented at the workshop and/or published sincemore » the reports of the fourth International X Chromosome Workshop. The principle aim of the workshop was to derive a consensus map of the chromosome, in terms of physical contigs emphasizing the location of genes and microsatellite markers. The resulting map is presented and updates previous versions. This report also updates the list of highly informative microsatellites. The text highlights the working state of the map, the genes known to reside on the X, and the progress toward integration of various types of data.« less

The photoreceptor cell-specific nuclear receptor gene (PNR) accounts for retinitis pigmentosa in the Crypto-Jews from Portugal (Marranos), survivors from the Spanish Inquisition.

PubMed

Gerber, S; Rozet, J M; Takezawa, S I; dos Santos, L C; Lopes, L; Gribouval, O; Penet, C; Perrault, I; Ducroq, D; Souied, E; Jeanpierre, M; Romana, S; Frézal, J; Ferraz, F; Yu-Umesono, R; Munnich, A; Kaplan, J

2000-09-01

The last Crypto-Jews (Marranos) are the survivors of Spanish Jews who were persecuted in the late fifteenth century, escaped to Portugal and were forced to convert to save their lives. Isolated groups still exist in mountainous areas such as Belmonte in the Beira-Baixa province of Portugal. We report here the genetic study of a highly consanguineous endogamic population of Crypto-Jews of Belmonte affected with autosomal recessive retinitis pigmentosa (RP). A genome-wide search for homozygosity allowed us to localize the disease gene to chromosome 15q22-q24 (Zmax=2.95 at theta=0 at the D15S131 locus). Interestingly, the photoreceptor cell-specific nuclear receptor (PNR) gene, the expression of which is restricted to the outer nuclear layer of retinal photoreceptor cells, was found to map to the YAC contig encompassing the disease locus. A search for mutations allowed us to ascribe the RP of Crypto-Jews of Belmonte to a homozygous missense mutation in the PNR gene. Preliminary haplotype studies support the view that this mutation is relatively ancient but probably occurred after the population settled in Belmonte.

The t(9;14)(p13;q32) chromosomal translocation associated with lymphoplasmacytoid lymphoma involves the PAX-5 gene.

PubMed

Iida, S; Rao, P H; Nallasivam, P; Hibshoosh, H; Butler, M; Louie, D C; Dyomin, V; Ohno, H; Chaganti, R S; Dalla-Favera, R

1996-12-01

The t(9;14)(p13;q32) translocation is associated with approximately 50% of lymphoplasmacytoid lymphoma (LPL), a subtype of B-cell non-Hodgkin's lymphoma (NHL). We cloned the chromosomal breakpoint of der (14) from an LPL case (1052) and showed that it involved a junction between 9p13 and the switch micro region of the Ig heavy chain locus (IgH) on 14q32. Using a YAC contig spanning 1.5 megabase (Mb), we determined that the 9p13 breakpoint in one case (1052) mapped within a 270-kb restriction fragment containing two previously reported 9p breakpoints associated with a alpha-heavy chain disease case (MAL) and KI-1 positive diffuse large cell lymphoma (DLCL) cell line (KIS-1). The same fragment also contained the PAX-5 gene which encodes a B-cell specific transcription factor involved in the control of B-cell proliferation and differentiation. The breakpoints of KIS-1 and 1052 were mapped within the 5' noncoding region of PAX-5, while the 9p13 breakpoint of MAL mapped 230 to 270 kb upstream to PAX-5. In all three cases, the translocation caused the juxtaposition of the PAX-5 gene to the IgH locus in the opposite direction of transcription. When compared with six other DLCL cell lines lacking t(9;14)(p13;q32), the KIS-1 cell line showed an 11-fold overexpression of PAX-5 mRNA and a significantly reduced expression of the p53 gene, which is normally regulated by PAX-5. Moreover, metaphase and interphase fluorescence in situ hybridization (FISH) analysis using a YAC clone spanning 1 Mb including the PAX-5 as a probe identified chromosomal translocations in 5 of 7 cases carrying 9p13 translocations. These findings suggest that the PAX-5 gene is the target of the t(9;14) in LPL whereby its expression may be deregulated by juxtaposition to IgH regulatory elements, thus contributing to lymphomagenesis.

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

PubMed

Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

2011-11-25

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

PubMed Central

2011-01-01

Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2

Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyer, G.S.; Funanage, V.L.; Proujansky, R.

1996-05-15

Creatine and creatine phosphate act as a buffer system for the regeneration of ATP in tissues with fluctuating energy demands. Following reports of the cloning of a creatine transporter in rat, rabbit, and human, we cloned and sequenced a creatine transporter from a human intestinal cDNA library. PCR amplification of genomic DNAs from somatic cell hybrid panels localized two creatine transporter (CT) genes: CT1 to Xq26-q28 and CT2 to 16p11.2. Refinement of CT1 to Xq28 was confirmed by FISH. Identification of CT2 sequences in YACs and cosmid contigs that had been ordered on human chromosome 16 enabled its assignment tomore » the proximal end of 16p11.2. Sequencing of the CT2 gene identified sequence differences between CT1 and CT2 transcripts that were utilized to determine that CT2 is expressed in testis only. CT2 is the most proximally identified gene on chromosome 16p to date. The existence of an autosomal, testis-specific form of the human creatine transporter gene suggests that creatine transporter activity is critical for normal function of spermatazoa following meiosis. 17 refs., 2 figs., 2 tabs.« less

The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

1996-04-15

We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

Identification of a region of homozygous deletion in cervical carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aburatani, H.; Housman, D.E.; Wang, Y.

1994-09-01

To identify the possible location of a tumor suppressor gene (TSG) for cervical carcinoma, we have scanned the tumor DNAs for homozygous deletion by Representational Difference Analysis (RDA). Matched pairs of tumor and normal DNA were restriction digested and PCR-amplified. The tumor DNA amplicon was used as a driver for subtraction to identify DNA fragments homozygously deleted in tumor DNA. We analysed 6 cervical cancer specimens (5 cell lines, 1 fresh tumor). Four out of 6 analyses produced difference products present only in normal DNA, which were either hemizygously or homozygously deleted in tumor DNA. The two samples which failedmore » to produce any difference products were cell lines established from dysplasia patients, on which genetic changes might be minimal. One cervical carcinoma cell line CC6 produced 11 difference products deleted homozygously, all of which are clustered in 3p12-13 region. The proximal short arm of chromosome 3 is known to have a high incidence of L.O.H. in cervical carcinoma and thus may be a locus for TSG. A 4 Mb YAC contig has been established over the deletion and its characterization is under way to facilitate the identification of possible TSGs in this region.« less

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

A comprehensive map of the porcine genome.

PubMed

Rohrer, G A; Alexander, L J; Hu, Z; Smith, T P; Keele, J W; Beattie, C W

1996-05-01

We report the highest density genetic linkage map for a livestock species produced to date. Three published maps for Sus scrofa were merged by genotyping virtually every publicly available microsatellite across a single reference population to yield 1042 linked loci, 536 of which are novel assignments, spanning 2286.2 cM (average interval 2.23 cM) in 19 linkage groups (18 autosomal and X chromosomes, n = 19). Linkage groups were constructed de novo and mapped by locus content to avoid propagation of errors in older genotypes. The physical and genetic maps were integrated with 123 informative loci assigned previously by fluorescence in situ hybridization (FISH). Fourteen linkage groups span the entire length of each chromosome. Coverage of chromosomes 11, 12, 15, and 18 will be evaluated as more markers are physically assigned. Marker-deficient regions were identified only on 11q1.7-qter and 14 cen-q1.2. Recombination rates (cM/Mbp) varied between and within chromosomes. Short chromosomal arms recombined at higher rates than long arms, and recombination was more frequent in telomeric regions than in pericentric regions. The high-resolution comprehensive map has the marker density needed to identify quantitative trait loci (QTL), implement marker-assisted selection or introgression and YAC contig construction or chromosomal microdissection.

Prokaryotic Contig Annotation Pipeline Server: Web Application for a Prokaryotic Genome Annotation Pipeline Based on the Shiny App Package.

PubMed

Park, Byeonghyeok; Baek, Min-Jeong; Min, Byoungnam; Choi, In-Geol

2017-09-01

Genome annotation is a primary step in genomic research. To establish a light and portable prokaryotic genome annotation pipeline for use in individual laboratories, we developed a Shiny app package designated as "P-CAPS" (Prokaryotic Contig Annotation Pipeline Server). The package is composed of R and Python scripts that integrate publicly available annotation programs into a server application. P-CAPS is not only a browser-based interactive application but also a distributable Shiny app package that can be installed on any personal computer. The final annotation is provided in various standard formats and is summarized in an R markdown document. Annotation can be visualized and examined with a public genome browser. A benchmark test showed that the annotation quality and completeness of P-CAPS were reliable and compatible with those of currently available public pipelines.

An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint.

PubMed

van Brabant, A J; Buchanan, C D; Charboneau, E; Fangman, W L; Brewer, B J

2001-04-01

Checkpoint controls coordinate entry into mitosis with the completion of DNA replication. Depletion of nucleotide precursors by treatment with the drug hydroxyurea triggers such a checkpoint response. However, it is not clear whether the signal for this hydroxyurea-induced checkpoint pathway is the presence of unreplicated DNA, or rather the persistence of single-stranded or damaged DNA. In a yeast artificial chromosome (YAC) we have engineered an approximately 170 kb region lacking efficient replication origins that allows us to explore the specific effects of unreplicated DNA on cell cycle progression. Replication of this YAC extends the length of S phase and causes cells to engage an S/M checkpoint. In the absence of Rad9 the YAC becomes unstable, undergoing deletions within the origin-free region.

Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.

PubMed

Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo

2008-03-01

Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.

Hatch cover

NASA Technical Reports Server (NTRS)

Allton, Charles S. (Inventor); Okane, James H. (Inventor)

1989-01-01

This invention relates to a hatch and more particularly to a hatch for a space vehicle where the hatch has a low volume sweep and can be easily manipulated from either side of the hatch. The hatch system includes an elliptical opening in a bulkhead and an elliptical hatch member. The hatch cover system includes an elliptical port opening in a housing and an elliptical cover member supported centrally by a rotational bearing for rotation about a rotational axis normal to the cover member and by pivot pins in a gimbal member for pivotal movement about axes perpendicular to the rotational axis. Arm members support the gimbal member pivotally by pivot members so that upon rotation and manipulation the cover member can be articulatedly moved from a closed position to the port opening to an out of the way position with a minimum of volume sweep by the cover member.

Estimating Cloud Cover

ERIC Educational Resources Information Center

Moseley, Christine

2007-01-01

The purpose of this activity was to help students understand the percentage of cloud cover and make more accurate cloud cover observations. Students estimated the percentage of cloud cover represented by simulated clouds and assigned a cloud cover classification to those simulations. (Contains 2 notes and 3 tables.)

Cover/Frequency (CF)

Treesearch

John F. Caratti

2006-01-01

The FIREMON Cover/Frequency (CF) method is used to assess changes in plant species cover and frequency for a macroplot. This method uses multiple quadrats to sample within-plot variation and quantify statistically valid changes in plant species cover, height, and frequency over time. Because it is difficult to estimate cover in quadrats for larger plants, this method...

Evapotranspiration (ET) covers.

PubMed

Rock, Steve; Myers, Bill; Fiedler, Linda

2012-01-01

Evapotranspiration (ET) cover systems are increasingly being used at municipal solid waste (MSW) landfills, hazardous waste landfills, at industrial monofills, and at mine sites. Conventional cover systems use materials with low hydraulic permeability (barrier layers) to minimize the downward migration of water from the surface to the waste (percolation), ET cover systems use water balance components to minimize percolation. These cover systems rely on soil to capture and store precipitation until it is either transpired through vegetation or evaporated from the soil surface. Compared to conventional membrane or compacted clay cover systems, ET cover systems are expected to cost less to construct. They are often aesthetic because they employ naturalized vegetation, require less maintenance once the vegetative system is established, including eliminating mowing, and may require fewer repairs than a barrier system. All cover systems should consider the goals of the cover in terms of protectiveness, including the pathways of risk from contained material, the lifecycle of the containment system. The containment system needs to be protective of direct contact of people and animals with the waste, prevent surface and groundwater water pollution, and minimize release of airborne contaminants. While most containment strategies have been based on the dry tomb strategy of keeping waste dry, there are some sites where adding or allowing moisture to help decompose organic waste is the current plan. ET covers may work well in places where complete exclusion of precipitation is not needed. The U.S. EPA Alternative Cover Assessment Program (ACAP), USDOE, the Nuclear Regulatory Commission, and others have researched ET cover design and efficacy, including the history of their use, general considerations in their design, performance, monitoring, cost, current status, limitations on their use, and project specific examples. An on-line database has been developed with information

Multiple layer insulation cover

DOEpatents

Farrell, James J.; Donohoe, Anthony J.

1981-11-03

A multiple layer insulation cover for preventing heat loss in, for example, a greenhouse, is disclosed. The cover is comprised of spaced layers of thin foil covered fabric separated from each other by air spaces. The spacing is accomplished by the inflation of spaced air bladders which are integrally formed in the cover and to which the layers of the cover are secured. The bladders are inflated after the cover has been deployed in its intended use to separate the layers of the foil material. The sizes of the material layers are selected to compensate for sagging across the width of the cover so that the desired spacing is uniformly maintained when the cover has been deployed. The bladders are deflated as the cover is stored thereby expediting the storage process and reducing the amount of storage space required.

Exploring variation-aware contig graphs for (comparative) metagenomics using MaryGold

PubMed Central

Nijkamp, Jurgen F.; Pop, Mihai; Reinders, Marcel J. T.; de Ridder, Dick

2013-01-01

Motivation: Although many tools are available to study variation and its impact in single genomes, there is a lack of algorithms for finding such variation in metagenomes. This hampers the interpretation of metagenomics sequencing datasets, which are increasingly acquired in research on the (human) microbiome, in environmental studies and in the study of processes in the production of foods and beverages. Existing algorithms often depend on the use of reference genomes, which pose a problem when a metagenome of a priori unknown strain composition is studied. In this article, we develop a method to perform reference-free detection and visual exploration of genomic variation, both within a single metagenome and between metagenomes. Results: We present the MaryGold algorithm and its implementation, which efficiently detects bubble structures in contig graphs using graph decomposition. These bubbles represent variable genomic regions in closely related strains in metagenomic samples. The variation found is presented in a condensed Circos-based visualization, which allows for easy exploration and interpretation of the found variation. We validated the algorithm on two simulated datasets containing three respectively seven Escherichia coli genomes and showed that finding allelic variation in these genomes improves assemblies. Additionally, we applied MaryGold to publicly available real metagenomic datasets, enabling us to find within-sample genomic variation in the metagenomes of a kimchi fermentation process, the microbiome of a premature infant and in microbial communities living on acid mine drainage. Moreover, we used MaryGold for between-sample variation detection and exploration by comparing sequencing data sampled at different time points for both of these datasets. Availability: MaryGold has been written in C++ and Python and can be downloaded from http://bioinformatics.tudelft.nl/software Contact: d.deridder@tudelft.nl PMID:24058058

The European sea bass Dicentrarchus labrax genome puzzle: comparative BAC-mapping and low coverage shotgun sequencing

PubMed Central

2010-01-01

Background Food supply from the ocean is constrained by the shortage of domesticated and selected fish. Development of genomic models of economically important fishes should assist with the removal of this bottleneck. European sea bass Dicentrarchus labrax L. (Moronidae, Perciformes, Teleostei) is one of the most important fishes in European marine aquaculture; growing genomic resources put it on its way to serve as an economic model. Results End sequencing of a sea bass genomic BAC-library enabled the comparative mapping of the sea bass genome using the three-spined stickleback Gasterosteus aculeatus genome as a reference. BAC-end sequences (102,690) were aligned to the stickleback genome. The number of mappable BACs was improved using a two-fold coverage WGS dataset of sea bass resulting in a comparative BAC-map covering 87% of stickleback chromosomes with 588 BAC-contigs. The minimum size of 83 contigs covering 50% of the reference was 1.2 Mbp; the largest BAC-contig comprised 8.86 Mbp. More than 22,000 BAC-clones aligned with both ends to the reference genome. Intra-chromosomal rearrangements between sea bass and stickleback were identified. Size distributions of mapped BACs were used to calculate that the genome of sea bass may be only 1.3 fold larger than the 460 Mbp stickleback genome. Conclusions The BAC map is used for sequencing single BACs or BAC-pools covering defined genomic entities by second generation sequencing technologies. Together with the WGS dataset it initiates a sea bass genome sequencing project. This will allow the quantification of polymorphisms through resequencing, which is important for selecting highly performing domesticated fish. PMID:20105308

A candidate region for Nevoid Basal Cell Carcinoma Syndrome defined by genetic and physical mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wainwright, B.; Negus, K.; Berkman, J.

1994-09-01

Nevoid Basal Cell Carcinoma Syndrome (NBCCS, or Gorlin`s syndrome) is a cancer predisposition syndrome charcterized by multiple basal cell carcinomas (BCCs) and diverse developmental defects. The gene responsible for NBCCS, which is most likely to be a tumor suppressor gene, has previously been mapped to 9q22.3-q31 in a 12 cM interval between the microsatellite marker loci D9S12 and D9S109. Combined multipoint and haplotype analyses of Australian pedigrees has further refined the localization to a 2 cM interval between markers D9S196 and D9S180. Our loss of heterozygosity (LOH) studies from sporadic (n= 58) and familial (n=41) BCCs indicate that 50% havemore » deletions within the NBCCS candidate region. All LOH is consistent with the genetic mapping of the NBCCS locus. Additionally, one sporadic tumor indicates that the smallest region of overlap in the deletions is within the interval D9S287 (proximal) and D9S180 (distal). A series of YAC clones from within this region has been mapped by FISH to examine chimerism. These clones, which have been mapped with respect to one another, form a contig which encompasses the candidate region from D9S196 to D9S180.« less

Regional gene mapping using mixed radiation hybrids and reverse chromosome painting.

PubMed

Lin, J Y; Bedford, J S

1997-11-01

We describe a new approach for low-resolution physical mapping using pooled DNA probe from mixed (non-clonal) populations of human-CHO cell hybrids and reverse chromosome painting. This mapping method is based on a process in which the human chromosome fragments bearing a complementing gene were selectively retained in a large non-clonal population of CHO-human hybrid cells during a series of 12- to 15-Gy gamma irradiations each followed by continuous growth selection. The location of the gene could then be identified by reverse chromosome painting on normal human metaphase spreads using biotinylated DNA from this population of "enriched" hybrid cells. We tested the validity of this method by correctly mapping the complementing human HPRT gene, whose location is well established. We then demonstrated the method's usefulness by mapping the chromosome location of a human gene which complemented the defect responsible for the hypersensitivity to ionizing radiation in CHO irs-20 cells. This method represents an efficient alternative to conventional concordance analysis in somatic cell hybrids where detailed chromosome analysis of numerous hybrid clones is necessary. Using this approach, it is possible to localize a gene for which there is no prior sequence or linkage information to a subchromosomal region, thus facilitating association with known mapping landmarks (e.g. RFLP, YAC or STS contigs) for higher-resolution mapping.

The Friedreich ataxia critical region spans a 150-kb interval on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Patel, P.I.

1995-11-01

By analysis of crossovers in key recombinant families and by homozygosity analysis of inbred families, the Friedreich ataxia (FRDA) locus was localized in a 300-kb interval between the X104 gene and the microsatellite marker FR8 (D9S888). By homology searches of the sequence databases, we identified X104 as the human tight junction protein ZO-2 gene. We generated a large-scale physical map of the FRDA region by pulsed-field gel electrophoresis analysis of genomic DNA and of three YAC clones derived from different libraries, and we constructed an uninterrupted cosmid contig spanning the FRDA locus. The cAMP-dependent protein kinase {gamma}-catalytic subunit gene wasmore » identified within the critical FRDA interval, but it was excluded as candidate because of its biological properties and because of lack of mutations in FRDA patients. Six new polymorphic markers were isolated between FR2 (D9S886) and FR8 (D9S888), which were used for homozygosity analysis in a family in which parents of an affected child are distantly related. An ancient recombination involving the centromeric FRDA flanking markers had been previously demonstrated in this family. Homozygosity analysis indicated that the FRDA gene is localized in the telomeric 150 kb of the FR2-FR8 interval. 17 refs., 3 figs., 1 tab.« less

Mekong Land Cover Dasboard: Regional Land Cover Mointoring Systems

NASA Astrophysics Data System (ADS)

Saah, D. S.; Towashiraporn, P.; Aekakkararungroj, A.; Phongsapan, K.; Triepke, J.; Maus, P.; Tenneson, K.; Cutter, P. G.; Ganz, D.; Anderson, E.

2016-12-01

SERVIR-Mekong, a USAID-NASA partnership, helps decision makers in the Lower Mekong Region utilize GIS and Remote Sensing information to inform climate related activities. In 2015, SERVIR-Mekong conducted a geospatial needs assessment for the Lower Mekong countries which included individual country consultations. The team found that many countries were dependent on land cover and land use maps for land resource planning, quantifying ecosystem services, including resilience to climate change, biodiversity conservation, and other critical social issues. Many of the Lower Mekong countries have developed national scale land cover maps derived in part from remote sensing products and geospatial technologies. However, updates are infrequent and classification systems do not always meet the needs of key user groups. In addition, data products stop at political boundaries and are often not accessible making the data unusable across country boundaries and with resource management partners. Many of these countries rely on global land cover products to fill the gaps of their national efforts, compromising consistency between data and policies. These gaps in national efforts can be filled by a flexible regional land cover monitoring system that is co-developed by regional partners with the specific intention of meeting national transboundary needs, for example including consistent forest definitions in transboundary watersheds. Based on these facts, key regional stakeholders identified a need for a land cover monitoring system that will produce frequent, high quality land cover maps using a consistent regional classification scheme that is compatible with national country needs. SERVIR-Mekong is currently developing a solution that leverages recent developments in remote sensing science and technology, such as Google Earth Engine (GEE), and working together with production partners to develop a system that will use a common set of input data sources to generate high

Land cover mapping of North and Central America—Global Land Cover 2000

USGS Publications Warehouse

Latifovic, Rasim; Zhu, Zhi-Liang

2004-01-01

The Land Cover Map of North and Central America for the year 2000 (GLC 2000-NCA), prepared by NRCan/CCRS and USGS/EROS Data Centre (EDC) as a regional component of the Global Land Cover 2000 project, is the subject of this paper. A new mapping approach for transforming satellite observations acquired by the SPOT4/VGTETATION (VGT) sensor into land cover information is outlined. The procedure includes: (1) conversion of daily data into 10-day composite; (2) post-seasonal correction and refinement of apparent surface reflectance in 10-day composite images; and (3) extraction of land cover information from the composite images. The pre-processing and mosaicking techniques developed and used in this study proved to be very effective in removing cloud contamination, BRDF effects, and noise in Short Wave Infra-Red (SWIR). The GLC 2000-NCA land cover map is provided as a regional product with 28 land cover classes based on modified Federal Geographic Data Committee/Vegetation Classification Standard (FGDC NVCS) classification system, and as part of a global product with 22 land cover classes based on Land Cover Classification System (LCCS) of the Food and Agriculture Organisation. The map was compared on both areal and per-pixel bases over North and Central America to the International Geosphere–Biosphere Programme (IGBP) global land cover classification, the University of Maryland global land cover classification (UMd) and the Moderate Resolution Imaging Spectroradiometer (MODIS) Global land cover classification produced by Boston University (BU). There was good agreement (79%) on the spatial distribution and areal extent of forest between GLC 2000-NCA and the other maps, however, GLC 2000-NCA provides additional information on the spatial distribution of forest types. The GLC 2000-NCA map was produced at the continental level incorporating specific needs of the region.

Myeloid- and lymphoid-specific breakpoint cluster regions in chromosome band 13q14 in acute leukemia.

PubMed

Coignet, L J; Lima, C S; Min, T; Streubel, B; Swansbury, J; Telford, N; Swanton, S; Bowen, A; Nagai, M; Catovsky, D; Fonatsch, C; Dyer, M J

1999-07-01

Abnormalities of chromosome band 13q14 occur in hematologic malignancies of all lineages and at all stages of differentiation. Unlike other chromosomal translocations, which are usually specific for a given lineage, the chromosomal translocation t(12;13)(p12;q14) has been observed in both B-cell and T-cell precursor acute lymphoblastic leukemia (BCP-, TCP-ALL), in differentiated and undifferentiated acute myeloblastic leukemia (AML), and in chronic myeloid leukemia (CML) at progression to blast crisis. The nature of these translocations and their pathologic consequences remain unknown. To begin to define the gene(s) involved on chromosome 13, we have performed fluorescence in situ hybridization (FISH) using a panel of YACs from the region, on a series of 10 cases of acute leukemia with t(12;13)(p12;q14) and 1 case each with "variant" translocations including t(12;13)(q21;q14), t(10;13)(q24;q14) and t(9;13)(p21;q14). In 8/13 cases/cell lines, the 13q14 break fell within a single 1.4 Mb CEPH MegaYAC. This YAC fell immediately telomeric of the forkhead (FKHR) gene, which is disrupted in the t(2;13)(q35;q14) seen in pediatric alveolar rhabdomyosarcoma. Seven of the 8 cases with breaks in this YAC were AML. In 4/13 cases, the 13q14 break fell within a 1.7-Mb YAC located about 3 Mb telomeric of the retinoblastoma (RB1) gene: all 4 cases were ALL. One case of myelodysplastic syndrome exhibited a break within 13q12, adjacent to the BRCA2 gene. These data indicate the presence of myeloid- and lymphoid-specific breakpoint cluster regions within chromosome band 13q14 in acute leukemia.

Cloning a balanced t(9;11)(p24;q23.1) chromosomal translocation breakpoint segregating with bipolar affective disorder in a small pedigree

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, D.J.; Baysal, B.E.; Gollin, S.M.

A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less

Process for Assembly and Transformation into Saccharomyces cerevisiae of a Synthetic Yeast Artificial Chromosome Containing a Multigene Cassette to Express Enzymes That Enhance Xylose Utilization Designed for an Automated Platform.

PubMed

Hughes, Stephen R; Cox, Elby J; Bang, Sookie S; Pinkelman, Rebecca J; López-Núñez, Juan Carlos; Saha, Badal C; Qureshi, Nasib; Gibbons, William R; Fry, Michelle R; Moser, Bryan R; Bischoff, Kenneth M; Liu, Siqing; Sterner, David E; Butt, Tauseef R; Riedmuller, Steven B; Jones, Marjorie A; Riaño-Herrera, Néstor M

2015-12-01

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system in yeast and to design an assembly process suitable for an automated platform. Expression of XI and XKS from the YAC was confirmed by Western blot and PCR analyses. The recombinant and wild-type strains showed similar growth on plates containing hexose sugars, but only recombinant grew on D-xylose and L-arabinose plates. In glucose fermentation, doubling time (4.6 h) and ethanol yield (0.44 g ethanol/g glucose) of recombinant were comparable to wild type (4.9 h and 0.44 g/g). In whole-corn hydrolysate, ethanol yield (0.55 g ethanol/g [glucose + xylose]) and xylose utilization (38%) for recombinant were higher than for wild type (0.47 g/g and 12%). In hydrolysate from spent coffee grounds, yield was 0.46 g ethanol/g (glucose + xylose), and xylose utilization was 93% for recombinant. These results indicate introducing a YAC expressing XI and XKS enhanced xylose utilization without affecting integrity of the host strain, and the process provides a potential platform for automated synthesis of a YAC for expression of multiple optimized genes to improve yeast strains. © 2015 Society for Laboratory Automation and Screening.

Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

PubMed Central

Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

1998-01-01

In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

Deep, Staged Transcriptomic Resources for the Novel Coleopteran Models Atrachya menetriesi and Callosobruchus maculatus

PubMed Central

Conrads, Kai H.; Roth, Siegfried; Lynch, Jeremy A.

2016-01-01

Despite recent efforts to sample broadly across metazoan and insect diversity, current sequence resources in the Coleoptera do not adequately describe the diversity of the clade. Here we present deep, staged transcriptomic data for two coleopteran species, Atrachya menetriesi (Faldermann 1835) and Callosobruchus maculatus (Fabricius 1775). Our sampling covered key stages in ovary and early embryonic development in each species. We utilized this data to build combined assemblies for each species which were then analysed in detail. The combined A. menetriesi assembly consists of 228,096 contigs with an N50 of 1,598 bp, while the combined C. maculatus assembly consists of 128,837 contigs with an N50 of 2,263 bp. For these assemblies, 34.6% and 32.4% of contigs were identified using Blast2GO, and 97% and 98.3% of the BUSCO set of metazoan orthologs were present, respectively. We also carried out manual annotation of developmental signalling pathways and found that nearly all expected genes were present in each transcriptome. Our analyses show that both transcriptomes are of high quality. Lastly, we performed read mapping utilising our timed, stage specific RNA samples to identify differentially expressed contigs. The resources presented here will provide a firm basis for a variety of experimentation, both in developmental biology and in comparative genomic studies. PMID:27907180

Deep, Staged Transcriptomic Resources for the Novel Coleopteran Models Atrachya menetriesi and Callosobruchus maculatus.

PubMed

Benton, Matthew A; Kenny, Nathan J; Conrads, Kai H; Roth, Siegfried; Lynch, Jeremy A

2016-01-01

Despite recent efforts to sample broadly across metazoan and insect diversity, current sequence resources in the Coleoptera do not adequately describe the diversity of the clade. Here we present deep, staged transcriptomic data for two coleopteran species, Atrachya menetriesi (Faldermann 1835) and Callosobruchus maculatus (Fabricius 1775). Our sampling covered key stages in ovary and early embryonic development in each species. We utilized this data to build combined assemblies for each species which were then analysed in detail. The combined A. menetriesi assembly consists of 228,096 contigs with an N50 of 1,598 bp, while the combined C. maculatus assembly consists of 128,837 contigs with an N50 of 2,263 bp. For these assemblies, 34.6% and 32.4% of contigs were identified using Blast2GO, and 97% and 98.3% of the BUSCO set of metazoan orthologs were present, respectively. We also carried out manual annotation of developmental signalling pathways and found that nearly all expected genes were present in each transcriptome. Our analyses show that both transcriptomes are of high quality. Lastly, we performed read mapping utilising our timed, stage specific RNA samples to identify differentially expressed contigs. The resources presented here will provide a firm basis for a variety of experimentation, both in developmental biology and in comparative genomic studies.

Multidecadal Changes in Near-Global Cloud Cover and Estimated Cloud Cover Radiative Forcing

NASA Technical Reports Server (NTRS)

Norris, Joel

2005-01-01

The first paper was Multidecadal changes in near-global cloud cover and estimated cloud cover radiative forcing, by J. R. Norris (2005, J. Geophys. Res. - Atmos., 110, D08206, doi: lO.l029/2004JD005600). This study examined variability in zonal mean surface-observed upper-level (combined midlevel and high-level) and low-level cloud cover over land during 1971-1 996 and over ocean during 1952-1997. These data were averaged from individual synoptic reports in the Extended Edited Cloud Report Archive (EECRA). Although substantial interdecadal variability is present in the time series, long-term decreases in upper-level cloud cover occur over land and ocean at low and middle latitudes in both hemispheres. Near-global upper-level cloud cover declined by 1.5%-sky-cover over land between 1971 and 1996 and by 1.3%-sky-cover over ocean between 1952 and 1997. Consistency between EECRA upper-level cloud cover anomalies and those from the International Satellite Cloud Climatology Project (ISCCP) during 1984-1 997 suggests the surface-observed trends are real. The reduction in surface-observed upper-level cloud cover between the 1980s and 1990s is also consistent with the decadal increase in all-sky outgoing longwave radiation reported by the Earth Radiation Budget Satellite (EMS). Discrepancies occur between time series of EECRA and ISCCP low-level cloud cover due to identified and probable artifacts in satellite and surface cloud data. Radiative effects of surface-observed cloud cover anomalies, called "cloud cover radiative forcing (CCRF) anomalies," are estimated based on a linear relationship to climatological cloud radiative forcing per unit cloud cover. Zonal mean estimated longwave CCRF has decreased over most of the globe. Estimated shortwave CCRF has become slightly stronger over northern midlatitude oceans and slightly weaker over northern midlatitude land areas. A long-term decline in the magnitude of estimated shortwave CCRF occurs over low-latitude land and ocean

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

Genes in one megabase of the HLA class I region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, H.; Fan, Wu-Fang; Xu, Hongxia

1993-11-15

To define the gene content of the HLA class I region, cDNA selection was applied to three overlapping yeast artificial chromosomes (YACs) that spanned 1 megabase (Mb) of this region of the human major histocompatibility complex. These YACs extended from the region centromeric to HLA-E to the region telomeric to HLA-F. In additions to the recognized class I genes and pseudogenes and the anonymous non-class-I genes described recently by the authors and others, 20 additional anonymous cDNA clones were identified from this 1-Mb region. They also identified a long repetitive DNA element in the region between HLA-B and HLA-E. Homologuesmore » of this outside of the HLA complex. The portion of the HLA class I region represented by these YACs shows an average gene density as high as the class II and class III regions. Thus, the high gene density portion of the HLA complex is extended to more than 3 Mb.« less

Cover Your Cough

MedlinePlus

... KB] Spanish [153 KB] Cover Your Cough, Flyer & Poster for Health Care Settings Flyer : English Portuguese [268 ... KB] Chinese [246 KB] Cover Your Cough, Flyer & Poster for Community and Public Settings Flyer : English Portuguese [ ...

What Medicare Covers

MedlinePlus

... your Medicare coverage — Original Medicare or a Medicare Advantage Plan (Part C). What Part A covers Medicare ... health plans cover Medicare health plans include Medicare Advantage, Medical Savings Account (MSA), Medicare Cost plans, PACE, ...

Dimer covering and percolation frustration.

PubMed

Haji-Akbari, Amir; Haji-Akbari, Nasim; Ziff, Robert M

2015-09-01

Covering a graph or a lattice with nonoverlapping dimers is a problem that has received considerable interest in areas, such as discrete mathematics, statistical physics, chemistry, and materials science. Yet, the problem of percolation on dimer-covered lattices has received little attention. In particular, percolation on lattices that are fully covered by nonoverlapping dimers has not evidently been considered. Here, we propose a procedure for generating random dimer coverings of a given lattice. We then compute the bond percolation threshold on random and ordered coverings of the square and the triangular lattices on the remaining bonds connecting the dimers. We obtain p_{c}=0.367713(2) and p_{c}=0.235340(1) for random coverings of the square and the triangular lattices, respectively. We observe that the percolation frustration induced as a result of dimer covering is larger in the low-coordination-number square lattice. There is also no relationship between the existence of long-range order in a covering of the square lattice and its percolation threshold. In particular, an ordered covering of the square lattice, denoted by shifted covering in this paper, has an unusually low percolation threshold and is topologically identical to the triangular lattice. This is in contrast to the other ordered dimer coverings considered in this paper, which have higher percolation thresholds than the random covering. In the case of the triangular lattice, the percolation thresholds of the ordered and random coverings are very close, suggesting the lack of sensitivity of the percolation threshold to microscopic details of the covering in highly coordinated networks.

Mean species cover: a harmonized indicator of shrub cover for forest inventories

Treesearch

Iciar Alberdi; Sonia Condés; Ronald E. Mcroberts; Susanne Winter

2018-01-01

Because shrub cover is related to many forest ecosystem functions, it is one of the most relevant variables for describing these communities. Nevertheless, a harmonized indicator of shrub cover for large-scale reporting is lacking. The aims of the study were threefold: to define a shrub indicator that can be used by European countries for harmonized shrub cover...

Features of the organization of bread wheat chromosome 5BS based on physical mapping.

PubMed

Salina, Elena A; Nesterov, Mikhail A; Frenkel, Zeev; Kiseleva, Antonina A; Timonova, Ekaterina M; Magni, Federica; Vrána, Jan; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Korol, Abraham; Sergeeva, Ekaterina M

2018-02-09

The IWGSC strategy for construction of the reference sequence of the bread wheat genome is based on first obtaining physical maps of the individual chromosomes. Our aim is to develop and use the physical map for analysis of the organization of the short arm of wheat chromosome 5B (5BS) which bears a number of agronomically important genes, including genes conferring resistance to fungal diseases. A physical map of the 5BS arm (290 Mbp) was constructed using restriction fingerprinting and LTC software for contig assembly of 43,776 BAC clones. The resulting physical map covered ~ 99% of the 5BS chromosome arm (111 scaffolds, N50 = 3.078 Mb). SSR, ISBP and zipper markers were employed for anchoring the BAC clones, and from these 722 novel markers were developed based on previously obtained data from partial sequencing of 5BS. The markers were mapped using a set of Chinese Spring (CS) deletion lines, and F2 and RICL populations from a cross of CS and CS-5B dicoccoides. Three approaches have been used for anchoring BAC contigs on the 5BS chromosome, including clone-by-clone screening of BACs, GenomeZipper analysis, and comparison of BAC-fingerprints with in silico fingerprinting of 5B pseudomolecules of T. dicoccoides. These approaches allowed us to reach a high level of BAC contig anchoring: 96% of 5BS BAC contigs were located on 5BS. An interesting pattern was revealed in the distribution of contigs along the chromosome. Short contigs (200-999 kb) containing markers for the regions interrupted by tandem repeats, were mainly localized to the 5BS subtelomeric block; whereas the distribution of larger 1000-3500 kb contigs along the chromosome better correlated with the distribution of the regions syntenic to rice, Brachypodium, and sorghum, as detected by the Zipper approach. The high fingerprinting quality, LTC software and large number of BAC clones selected by the informative markers in screening of the 43,776 clones allowed us to significantly increase the

Cover crops for Alabama

USDA-ARS?s Scientific Manuscript database

Cover crops are grown to benefit the following crop as well as to improve the soil, but they are normally not intended for harvest. Selecting the right cover crops for farming operations can improve yields, soil and water conservation and quality, and economic productivity. Properly managed cover ...

Land-cover change detection

USGS Publications Warehouse

Chen, Xuexia; Giri, Chandra; Vogelmann, James

2012-01-01

Land cover is the biophysical material on the surface of the earth. Land-cover types include grass, shrubs, trees, barren, water, and man-made features. Land cover changes continuously.  The rate of change can be either dramatic and abrupt, such as the changes caused by logging, hurricanes and fire, or subtle and gradual, such as regeneration of forests and damage caused by insects (Verbesselt et al., 2001).  Previous studies have shown that land cover has changed dramatically during the past sevearal centuries and that these changes have severely affected our ecosystems (Foody, 2010; Lambin et al., 2001). Lambin and Strahlers (1994b) summarized five types of cause for land-cover changes: (1) long-term natural changes in climate conditions, (2) geomorphological and ecological processes, (3) human-induced alterations of vegetation cover and landscapes, (4) interannual climate variability, and (5) human-induced greenhouse effect.  Tools and techniques are needed to detect, describe, and predict these changes to facilitate sustainable management of natural resources.

Isolation of expressed sequences from the region commonly deleted in Velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirotkin, H.; Morrow, B.; DasGupta, R.

Velo-cardio-facial syndrome (VCFS) is a relatively common autosomal dominant genetic disorder characterized by cleft palate, cardiac abnormalities, learning disabilities and a characteristic facial dysmorphology. Most VCFS patients have interstitial deletions of 22q11 of 1-2 mb. In an effort to isolate the gene(s) responsible for VCFS we have utilized a hybrid selection protocol to recover expressed sequences from three non-overlapping YACs comprising almost 1 mb of the commonly deleted region. Total yeast genomic DNA or isolated YAC DNA was immobilized on Hybond-N filters, blocked with yeast and human ribosomal and human repetitive sequences and hybridized with a mixture of random primedmore » short fragment cDNA libraries. Six human short fragment libraries derived from total fetus, fetal brain, adult brain, testes, thymus and spleen have been used for the selections. Short fragment cDNAs retained on the filter were passed through a second round of selection and cloned into lambda gt10. cDNAs shown to originate from the YACs and from chromosome 22 are being used to isolate full length cDNAs. Three genes known to be present on these YACs, catechol-O-methyltransferase, tuple 1 and clathrin heavy chain have been recovered. Additionally, a gene related to the murine p120 gene and a number of novel short cDNAs have been isolated. The role of these genes in VCFS is being investigated.« less

The gene for creatine kinase, mitochondrial 2 (sarcomeric; CKMT2), maps to chromosome 5q13. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, I.; Devaud, C.; Cherif, D.

1993-10-01

YAC clones for the creatine kinase, mitochrondial 2 (sarcomeric; CKMT2), gene were isolated. One of these YACs was localized on chromosome 5q13.3 by fluorescence in situ hybridization. A polymorphic dinucleotide repeat (heterozygosity 0.77) was identified within the seventh intron of the CKMT2 gene. Genotyping of CEPH families allowed positioning of CKMT2 on the multipoint map of chromosome 5 between D5S424 and D5S428, distal to spinal muscular atrophy (SMA) (5q12-q14). 8 refs., 1 fig., 2 tabs.

Thematic accuracy of the National Land Cover Database (NLCD) 2001 land cover for Alaska

USGS Publications Warehouse

Selkowitz, D.J.; Stehman, S.V.

2011-01-01

The National Land Cover Database (NLCD) 2001 Alaska land cover classification is the first 30-m resolution land cover product available covering the entire state of Alaska. The accuracy assessment of the NLCD 2001 Alaska land cover classification employed a geographically stratified three-stage sampling design to select the reference sample of pixels. Reference land cover class labels were determined via fixed wing aircraft, as the high resolution imagery used for determining the reference land cover classification in the conterminous U.S. was not available for most of Alaska. Overall thematic accuracy for the Alaska NLCD was 76.2% (s.e. 2.8%) at Level II (12 classes evaluated) and 83.9% (s.e. 2.1%) at Level I (6 classes evaluated) when agreement was defined as a match between the map class and either the primary or alternate reference class label. When agreement was defined as a match between the map class and primary reference label only, overall accuracy was 59.4% at Level II and 69.3% at Level I. The majority of classification errors occurred at Level I of the classification hierarchy (i.e., misclassifications were generally to a different Level I class, not to a Level II class within the same Level I class). Classification accuracy was higher for more abundant land cover classes and for pixels located in the interior of homogeneous land cover patches. ?? 2011.

Hatch Cover Slides Through Hatch

NASA Technical Reports Server (NTRS)

Alton, Charles; Okane, James H.

1989-01-01

Hatch cover for pressurized vessel provides tight seal but opened quickly from either side. In opening or closing, cover sweeps out relatively little volume within vessel, so it does not hinder movement of people or objects from vessel to outside or placement of people or objects near hatch. Cover uses internal pressure to create seal when closed. Design of cover eliminates leakage paths, and cover immune to hazards of sudden decompression or jamming when bolts and latches fail.

MagnaportheDB: a federated solution for integrating physical and genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea.

PubMed

Martin, Stanton L; Blackmon, Barbara P; Rajagopalan, Ravi; Houfek, Thomas D; Sceeles, Robert G; Denn, Sheila O; Mitchell, Thomas K; Brown, Douglas E; Wing, Rod A; Dean, Ralph A

2002-01-01

We have created a federated database for genome studies of Magnaporthe grisea, the causal agent of rice blast disease, by integrating end sequence data from BAC clones, genetic marker data and BAC contig assembly data. A library of 9216 BAC clones providing >25-fold coverage of the entire genome was end sequenced and fingerprinted by HindIII digestion. The Image/FPC software package was then used to generate an assembly of 188 contigs covering >95% of the genome. The database contains the results of this assembly integrated with hybridization data of genetic markers to the BAC library. AceDB was used for the core database engine and a MySQL relational database, populated with numerical representations of BAC clones within FPC contigs, was used to create appropriately scaled images. The database is being used to facilitate sequencing efforts. The database also allows researchers mapping known genes or other sequences of interest, rapid and easy access to the fundamental organization of the M.grisea genome. This database, MagnaportheDB, can be accessed on the web at http://www.cals.ncsu.edu/fungal_genomics/mgdatabase/int.htm.

A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B-cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5.

PubMed

Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N

1998-04-17

B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.

Silostop Bunker Covers

USDA-ARS?s Scientific Manuscript database

The quality of the seal provided by the plastic cover is a key issue for minimizing losses in bunker and pile silos. Most bunker covers are 6 to 8 mil polyethylene sheets held in place by tires or tire sidewalls. Frequently there are problems with spoilage at the shoulders (i.e., against the walls),...

Structural analysis of the HLA-A/HLA-F subregion: Precise localization of two new multigene families closely associated with the HLA class I sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pichon, L.; Carn, G.; Bouric, P.

1996-03-01

Positional cloning strategies for the hemochromatosis gene have previously concentrated on a target area restricted to a maximum genomic expanse of 400 kb around the HLA-A and HLA-F loci. Recently, the candidate region has been extended to 2-3 Mb on the distal side of the MHC. In this study, 10 coding sequences [hemochromatosis candidate genes (HCG) I to X] were isolated by cDNA selection using YACs covering the HLA-A/HLA-F subregion. Two of these (HCG II and HCG IV) belong to multigene families, as well as other sequences already described in this region, i.e., P5, pMC 6.7, and HLA class I.more » Fingerprinting of the four YACSs overlapping the region was performed and allowed partial localization of the different multigene family sequences on each YAC without defining their exact positions. Fingerprinting on cosmids isolated from the ICRF chromosome 6-specific cosmid library allowed more precise localization of the redundant sequences in all of the multigene families and revealed their apparent organization in clusters. Further examination of these intertwined sequences demonstrated that this structural organization resulted from a succession of complex phenomena, including duplications and contractions. This study presents a precise description of the structural organization of the HLA-A/HLA-F region and a determination of the sequences involved in the megabase size polymorphism observed among the A3, A24, and A31 haplotypes. 29 refs., 2 figs., 2 tabs.« less

Monthly fractional green vegetation cover associated with land cover classes of the conterminous USA

USGS Publications Warehouse

Gallo, Kevin P.; Tarpley, Dan; Mitchell, Ken; Csiszar, Ivan; Owen, Timothy W.; Reed, Bradley C.

2001-01-01

The land cover classes developed under the coordination of the International Geosphere-Biosphere Programme Data and Information System (IGBP-DIS) have been analyzed for a study area that includes the Conterminous United States and portions of Mexico and Canada. The 1-km resolution data have been analyzed to produce a gridded data set that includes within each 20-km grid cell: 1) the three most dominant land cover classes, 2) the fractional area associated with each of the three dominant classes, and 3) the fractional area covered by water. Additionally, the monthly fraction of green vegetation cover (fgreen) associated with each of the three dominant land cover classes per grid cell was derived from a 5-year climatology of 1-km resolution NOAA-AVHRR data. The variables derived in this study provide a potential improvement over the use of monthly fgreen linked to a single land cover class per model grid cell.

Histaminergic regulation of natural killer cell-mediated clearance of tumour cells in mice.

PubMed

Asea, A; Hermodsson, S; Hellstrand, K

1996-01-01

Treatment of Swiss albino mice with histamine enhanced the clearance of natural killer (NK)-cell sensitive YAC-1 lymphoma and B16/F10 melanoma cells from lung tissue in vivo, but did not affect the elimination of NK-cell-insensitive P815 mastocytoma cells. The effect of histamine was apparently mediated by H2-type histamine receptors (H2R) since it was blocked by ranitidine, and H2R antagonist. Histamine did not affect clearance of tumour cells in animals depleted of NK cells in vivo by treatment with antibodies to asialo-GM1 or NK1.1. The effect of histamine was time-dependent: pretreatment with histamine for 3 h significantly augmented the clearance of YAC-1 cells, whereas, pretreatment with histamine for 5 min was ineffective. Histamine potentiated the anti-tumour properties of NK-cell activators such as interleukin-2 (IL-2) or interferon-alpha (IFN-alpha) in vivo. None of these lymphokines significantly affected the clearance of YAC-1 cells unless animals were concomitantly treated with histamine. Treatment with ranitidine alone reduced the in vivo clearance of YAC-1 cells from lungs but did not affect the clearance of NK-cell-insensitive P815 cells. Effects of ranitidine on NK-cell function in vivo were not shared by a chemical control to ranitidine, AH20239AA, thus indicating that the inhibition of NK-cells results from H2R antagonism rather than non-specific toxicity. It is concluded that histaminergic mechanisms may be involved in the regulation of NK cell function in vivo.

A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

PubMed Central

Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

2006-01-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

PubMed

Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

2006-03-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

Sequence independent amplification of DNA

DOEpatents

Bohlander, S.K.

1998-03-24

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

Sequence independent amplification of DNA

DOEpatents

Bohlander, Stefan K.

1998-01-01

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

Completion of the National Land Cover Database (NLCD) 1992-2001 Land Cover Change Retrofit Product

EPA Science Inventory

The Multi-Resolution Land Characteristics Consortium has supported the development of two national digital land cover products: the National Land Cover Dataset (NLCD) 1992 and National Land Cover Database (NLCD) 2001. Substantial differences in imagery, legends, and methods betwe...

Climate Impacts of Cover Crops

NASA Astrophysics Data System (ADS)

Lombardozzi, D.; Wieder, W. R.; Bonan, G. B.; Morris, C. K.; Grandy, S.

2016-12-01

Cover crops are planted in agricultural rotation with the intention of protecting soil rather than harvest. Cover crops have numerous environmental benefits that include preventing soil erosion, increasing soil fertility, and providing weed and pest control- among others. In addition to localized environmental benefits, cover crops can have important regional or global biogeochemical impacts by increasing soil organic carbon, changing emissions of greenhouse trace gases like nitrous oxide and methane, and reducing hydrologic nitrogen losses. Cover crops may additionally affect climate by changing biogeophysical processes, like albedo and latent heat flux, though these potential changes have not yet been evaluated. Here we use the coupled Community Atmosphere Model (CAM5) - Community Land Model (CLM4.5) to test how planting cover crops in the United States may change biogeophysical fluxes and climate. We present seasonal changes in albedo, heat fluxes, evaporative partitioning, radiation, and the resulting changes in temperature. Preliminary analyses show that during seasons when cover crops are planted, latent heat flux increases and albedo decreases, changing the evaporative fraction and surface temperatures. Understanding both the biogeophysical changes caused by planting cover crops in this study and the biogeochemical changes found in other studies will give a clearer picture of the overall impacts of cover crops on climate and atmospheric chemistry, informing how this land use strategy will impact climate in the future.

Cover crops and N credits

USDA-ARS?s Scientific Manuscript database

Cover crops often provide many short- and long-term benefits to cropping systems. Legume cover crops can significantly reduce the N fertilizer requirement of non-legume cash crops that follow. The objectives of this presentation were to: I) educate stakeholders about the potential benefits of cover ...

Forest service contributions to the national land cover database (NLCD): Tree Canopy Cover Production

Treesearch

Bonnie Ruefenacht; Robert Benton; Vicky Johnson; Tanushree Biswas; Craig Baker; Mark Finco; Kevin Megown; John Coulston; Ken Winterberger; Mark Riley

2015-01-01

A tree canopy cover (TCC) layer is one of three elements in the National Land Cover Database (NLCD) 2011 suite of nationwide geospatial data layers. In 2010, the USDA Forest Service (USFS) committed to creating the TCC layer as a member of the Multi-Resolution Land Cover (MRLC) consortium. A general methodology for creating the TCC layer was reported at the 2012 FIA...

Completion of the National Land Cover Database (NLCD) 1992–2001 Land Cover Change Retrofit product

USGS Publications Warehouse

Fry, J.A.; Coan, Michael; Homer, Collin G.; Meyer, Debra K.; Wickham, J.D.

2009-01-01

The Multi-Resolution Land Characteristics Consortium has supported the development of two national digital land cover products: the National Land Cover Dataset (NLCD) 1992 and National Land Cover Database (NLCD) 2001. Substantial differences in imagery, legends, and methods between these two land cover products must be overcome in order to support direct comparison. The NLCD 1992-2001 Land Cover Change Retrofit product was developed to provide more accurate and useful land cover change data than would be possible by direct comparison of NLCD 1992 and NLCD 2001. For the change analysis method to be both national in scale and timely, implementation required production across many Landsat Thematic Mapper (TM) and Enhanced Thematic Mapper Plus (ETM+) path/rows simultaneously. To meet these requirements, a hybrid change analysis process was developed to incorporate both post-classification comparison and specialized ratio differencing change analysis techniques. At a resolution of 30 meters, the completed NLCD 1992-2001 Land Cover Change Retrofit product contains unchanged pixels from the NLCD 2001 land cover dataset that have been cross-walked to a modified Anderson Level I class code, and changed pixels labeled with a 'from-to' class code. Analysis of the results for the conterminous United States indicated that about 3 percent of the land cover dataset changed between 1992 and 2001.

77 FR 48733 - Transitional Program for Covered Business Method Patents-Definitions of Covered Business Method...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-14

... Office 37 CFR Part 42 Transitional Program for Covered Business Method Patents--Definitions of Covered Business Method Patent and Technological Invention; Final Rule #0;#0;Federal Register / Vol. 77 , No. 157... Business Method Patents-- Definitions of Covered Business Method Patent and Technological Invention AGENCY...

ENGINEERING BULLETIN: LANDFILL COVERS

EPA Science Inventory

Landfill covers are used at Superfund sites to minimize surface water infiltration and control gas migration. In many cases covers are used in conjunction with other waste treatment technologies, such as slurry walls, ground water pump-and-treat systems, and gas collection. This ...

Automatic design of magazine covers

NASA Astrophysics Data System (ADS)

Jahanian, Ali; Liu, Jerry; Tretter, Daniel R.; Lin, Qian; Damera-Venkata, Niranjan; O'Brien-Strain, Eamonn; Lee, Seungyon; Fan, Jian; Allebach, Jan P.

2012-03-01

In this paper, we propose a system for automatic design of magazine covers that quantifies a number of concepts from art and aesthetics. Our solution to automatic design of this type of media has been shaped by input from professional designers, magazine art directors and editorial boards, and journalists. Consequently, a number of principles in design and rules in designing magazine covers are delineated. Several techniques are derived and employed in order to quantify and implement these principles and rules in the format of a software framework. At this stage, our framework divides the task of design into three main modules: layout of magazine cover elements, choice of color for masthead and cover lines, and typography of cover lines. Feedback from professional designers on our designs suggests that our results are congruent with their intuition.

National land-cover pattern data

Treesearch

Kurt H. Riitters; James D. Wickham; James E. Vogelmann; K. Bruce Jones

2000-01-01

Land cover and its spatial patterns are key ingredients in ecological studies that consider large regions and the impacts of human activities. Because humanity is a principal driver of land-cover change over large regions (Turner et al. 1990), land-cover data provide direct measures of human activity, and both direct and indirect measures of ecological conditions...

Gainesville's urban forest canopy cover

Treesearch

Francisco Escobedo; Jennifer A. Seitz; Wayne Zipperer

2009-01-01

Ecosystem benefits from trees are linked directly to the amount of healthy urban forest canopy cover. Urban forest cover is dynamic and changes over time due to factors such as urban development, windstorms, tree removals, and growth. The amount of a city's canopy cover depends on its land use, climate, and people's preferences. This fact sheet examines how...

MODIS Snow-Cover Products

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.; Riggs, George A.; Salomonson, Vinvent V.; DiGirolamo, Nicolo; Bayr, Klaus J.; Houser, Paul (Technical Monitor)

2001-01-01

On December 18, 1999, the Terra satellite was launched with a complement of five instruments including the Moderate Resolution Imaging Spectroradiometer (MODIS). Many geophysical products are derived from MODIS data including global snow-cover products. These products have been available through the National Snow and Ice Data Center (NSIDC) Distributed Active Archive Center (DAAC) since September 13, 2000. MODIS snow-cover products represent potential improvement to the currently available operation products mainly because the MODIS products are global and 500-m resolution, and have the capability to separate most snow and clouds. Also the snow-mapping algorithms are automated which means that a consistent data set is generated for long-term climates studies that require snow-cover information. Extensive quality assurance (QA) information is stored with the product. The snow product suite starts with a 500-m resolution swath snow-cover map which is gridded to the Integerized Sinusoidal Grid to produce daily and eight-day composite tile products. The sequence then proceeds to a climate-modeling grid product at 5-km spatial resolution, with both daily and eight-day composite products. A case study from March 6, 2000, involving MODIS data and field and aircraft measurements, is presented. Near-term enhancements include daily snow albedo and fractional snow cover.

Mapping land cover through time with the Rapid Land Cover Mapper—Documentation and user manual

USGS Publications Warehouse

Cotillon, Suzanne E.; Mathis, Melissa L.

2017-02-15

The Rapid Land Cover Mapper is an Esri ArcGIS® Desktop add-in, which was created as an alternative to automated or semiautomated mapping methods. Based on a manual photo interpretation technique, the tool facilitates mapping over large areas and through time, and produces time-series raster maps and associated statistics that characterize the changing landscapes. The Rapid Land Cover Mapper add-in can be used with any imagery source to map various themes (for instance, land cover, soils, or forest) at any chosen mapping resolution. The user manual contains all essential information for the user to make full use of the Rapid Land Cover Mapper add-in. This manual includes a description of the add-in functions and capabilities, and step-by-step procedures for using the add-in. The Rapid Land Cover Mapper add-in was successfully used by the U.S. Geological Survey West Africa Land Use Dynamics team to accurately map land use and land cover in 17 West African countries through time (1975, 2000, and 2013).

46 CFR 171.117 - Dead covers.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 7 2011-10-01 2011-10-01 false Dead covers. 171.117 Section 171.117 Shipping COAST... Dead covers. (a) Except as provided in paragraph (b) of this section, each port light with the sill located below the margin line must have a hinged, inside dead cover. (b) The dead cover on a port light...

46 CFR 171.117 - Dead covers.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 7 2014-10-01 2014-10-01 false Dead covers. 171.117 Section 171.117 Shipping COAST... Dead covers. (a) Except as provided in paragraph (b) of this section, each port light with the sill located below the margin line must have a hinged, inside dead cover. (b) The dead cover on a port light...

46 CFR 171.117 - Dead covers.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 7 2013-10-01 2013-10-01 false Dead covers. 171.117 Section 171.117 Shipping COAST... Dead covers. (a) Except as provided in paragraph (b) of this section, each port light with the sill located below the margin line must have a hinged, inside dead cover. (b) The dead cover on a port light...

46 CFR 171.117 - Dead covers.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 7 2012-10-01 2012-10-01 false Dead covers. 171.117 Section 171.117 Shipping COAST... Dead covers. (a) Except as provided in paragraph (b) of this section, each port light with the sill located below the margin line must have a hinged, inside dead cover. (b) The dead cover on a port light...

46 CFR 171.117 - Dead covers.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Dead covers. 171.117 Section 171.117 Shipping COAST... Dead covers. (a) Except as provided in paragraph (b) of this section, each port light with the sill located below the margin line must have a hinged, inside dead cover. (b) The dead cover on a port light...

MODIS Snow-Cover Products

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.; Riggs, George A.; Salomonson, Vincent V.; DiGirolamo, Nicole E.; Bayr, Klaus J.; Houser, Paul R. (Technical Monitor)

2002-01-01

On December 18, 1999, the Terra satellite was launched with a complement of five instruments including the Moderate Resolution Imaging Spectroradiometer (MODIS). Many geophysical products are derived from MODIS data including global snow-cover products. MODIS snow and ice products have been available through the National Snow and Ice Data Center (NSIDC) Distributed Active Archive Center (DAAC) since September 13, 2000. MODIS snow-cover products represent potential improvement to or enhancement of the currently-available operational products mainly because the MODIS products are global and 500-m resolution, and have the capability to separate most snow and clouds. Also the snow-mapping algorithms are automated which means that a consistent data set may be generated for long-term climate studies that require snow-cover information. Extensive quality assurance (QA) information is stored with the products. The MODIS snow product suite begins with a 500-m resolution, 2330-km swath snow-cover map which is then gridded to an integerized sinusoidal grid to produce daily and 8-day composite tile products. The sequence proceeds to a climate-modeling grid (CMG) product at about 5.6-km spatial resolution, with both daily and 8-day composite products. Each pixel of the CMG contains fraction of snow cover from 40 - 100%. Measured errors of commission in the CMG are low, for example, on the continent of Australia in the spring, they vary from 0.02 - 0.10%. Near-term enhancements include daily snow albedo and fractional snow cover. A case study from March 6, 2000, involving MODIS data and field and aircraft measurements, is presented to show some early validation work.

Treatment with the MAO-A inhibitor clorgyline elevates monoamine neurotransmitter levels and improves affective phenotypes in a mouse model of Huntington disease.

PubMed

Garcia-Miralles, Marta; Ooi, Jolene; Ferrari Bardile, Costanza; Tan, Liang Juin; George, Maya; Drum, Chester L; Lin, Rachel Yanping; Hayden, Michael R; Pouladi, Mahmoud A

2016-04-01

Abnormal monoamine oxidase A and B (MAO-A/B) activity and an imbalance in monoamine neurotransmitters have been suggested to underlie the pathobiology of depression, a major psychiatric symptom observed in patients with neurodegenerative diseases, such as Huntington disease (HD). Increased MAO-A/B activity has been observed in brain tissue from patients with HD and in human and rodent HD neural cells. Using the YAC128 mouse model of HD, we studied the effect of an irreversible MAO-A inhibitor, clorgyline, on the levels of select monoamine neurotransmitters associated with affective function. We observed a decrease in striatal levels of the MAO-A/B substrates, dopamine and norepinephrine, in YAC128 HD mice compared with wild-type mice, which was accompanied by increased anxiety- and depressive-like behaviour at five months of age. Treatment for 26 days with clorgyline restored dopamine, serotonin, and norepinephrine neurotransmitter levels in the striatum and reduced anxiety- and depressive-like behaviour in YAC128 HD mice. This study supports a potential therapeutic use for MAO-A inhibitors in the treatment of depression and anxiety in patients with HD. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Optimal shortening of uniform covering arrays

PubMed Central

Rangel-Valdez, Nelson; Avila-George, Himer; Carrizalez-Turrubiates, Oscar

2017-01-01

Software test suites based on the concept of interaction testing are very useful for testing software components in an economical way. Test suites of this kind may be created using mathematical objects called covering arrays. A covering array, denoted by CA(N; t, k, v), is an N × k array over Zv={0,…,v-1} with the property that every N × t sub-array covers all t-tuples of Zvt at least once. Covering arrays can be used to test systems in which failures occur as a result of interactions among components or subsystems. They are often used in areas such as hardware Trojan detection, software testing, and network design. Because system testing is expensive, it is critical to reduce the amount of testing required. This paper addresses the Optimal Shortening of Covering ARrays (OSCAR) problem, an optimization problem whose objective is to construct, from an existing covering array matrix of uniform level, an array with dimensions of (N − δ) × (k − Δ) such that the number of missing t-tuples is minimized. Two applications of the OSCAR problem are (a) to produce smaller covering arrays from larger ones and (b) to obtain quasi-covering arrays (covering arrays in which the number of missing t-tuples is small) to be used as input to a meta-heuristic algorithm that produces covering arrays. In addition, it is proven that the OSCAR problem is NP-complete, and twelve different algorithms are proposed to solve it. An experiment was performed on 62 problem instances, and the results demonstrate the effectiveness of solving the OSCAR problem to facilitate the construction of new covering arrays. PMID:29267343

7 CFR 65.135 - Covered commodity.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., PEANUTS, AND GINSENG General Provisions Definitions § 65.135 Covered commodity. (a) Covered commodity... nuts; (6) Pecans; and (7) Ginseng. (b) Covered commodities are excluded from this part if the commodity...

7 CFR 65.135 - Covered commodity.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., PEANUTS, AND GINSENG General Provisions Definitions § 65.135 Covered commodity. (a) Covered commodity... nuts; (6) Pecans; and (7) Ginseng. (b) Covered commodities are excluded from this part if the commodity...

7 CFR 65.135 - Covered commodity.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., PEANUTS, AND GINSENG General Provisions Definitions § 65.135 Covered commodity. (a) Covered commodity... nuts; (6) Pecans; and (7) Ginseng. (b) Covered commodities are excluded from this part if the commodity...

7 CFR 65.135 - Covered commodity.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., PEANUTS, AND GINSENG General Provisions Definitions § 65.135 Covered commodity. (a) Covered commodity... nuts; (6) Pecans; and (7) Ginseng. (b) Covered commodities are excluded from this part if the commodity...

[Snow cover pollution monitoring in Ufa].

PubMed

Daukaev, R A; Suleĭmanov, R A

2008-01-01

The paper presents the results of examining the snow cover polluted with heavy metals in the large industrial town of Ufa. The level of man-caused burden on the snow cover of the conventional parts of the town was estimated and compared upon exposure to a wide range of snow cover pollutants. The priority snow cover pollutants were identified among the test heavy metals.

Pin-Retraction Mechanism On Quick-Release Cover

NASA Technical Reports Server (NTRS)

Macmartin, Malcolm

1994-01-01

Quick-release cover includes pin-retraction mechanism releasing cover quickly from lower of two sets of pin connections holding cover. Cover released at top by pulling lever as described in "Lever-Arm Pin Puller" (NPO-18788). Removal of cover begins when technician or robot pulls upper-pin-release lever. Cover swings downward until tabs on lower pins are pulled through slots in their receptacles. Lower pins are then free.

Wheelspace windage cover plate for turbine

DOEpatents

Lathrop, Norman Douglas

2002-01-01

Windage cover plates are secured between the wheels and spacer of a turbine rotor to prevent hot flow path gas ingestion into the wheelspace cavities. Each cover plate includes a linear, axially extending body curved circumferentially with a radially outwardly directed wall at one axial end. The wall defines a axially opening recess for receiving a dovetail lug. The cover plate includes an axially extending tongue received in a circumferential groove of the spacer. The cover plate is secured with the tongue in the groove and dovetail lug in the recess. Lap joints between circumferentially adjacent cover plates are provided.

Vegetative covers for waste containment.

PubMed

Rock, Steven A

2003-01-01

Disposal of municipal and hazardous waste in the United States is primarily accomplished by containment in lined and capped landfills. Evapotranspiration cover systems offer an alternative to conventional landfill cap systems. These covers work on completely different principles than traditional covers do, and that difference may slow understanding and acceptance by site owners, regulators, and stakeholders. This chapter provides an introduction to this alternative technique and explains some of the common concerns regarding its implementation.

Forest Cover Estimation in Ireland Using Radar Remote Sensing: A Comparative Analysis of Forest Cover Assessment Methodologies.

PubMed

Devaney, John; Barrett, Brian; Barrett, Frank; Redmond, John; O Halloran, John

2015-01-01

Quantification of spatial and temporal changes in forest cover is an essential component of forest monitoring programs. Due to its cloud free capability, Synthetic Aperture Radar (SAR) is an ideal source of information on forest dynamics in countries with near-constant cloud-cover. However, few studies have investigated the use of SAR for forest cover estimation in landscapes with highly sparse and fragmented forest cover. In this study, the potential use of L-band SAR for forest cover estimation in two regions (Longford and Sligo) in Ireland is investigated and compared to forest cover estimates derived from three national (Forestry2010, Prime2, National Forest Inventory), one pan-European (Forest Map 2006) and one global forest cover (Global Forest Change) product. Two machine-learning approaches (Random Forests and Extremely Randomised Trees) are evaluated. Both Random Forests and Extremely Randomised Trees classification accuracies were high (98.1-98.5%), with differences between the two classifiers being minimal (<0.5%). Increasing levels of post classification filtering led to a decrease in estimated forest area and an increase in overall accuracy of SAR-derived forest cover maps. All forest cover products were evaluated using an independent validation dataset. For the Longford region, the highest overall accuracy was recorded with the Forestry2010 dataset (97.42%) whereas in Sligo, highest overall accuracy was obtained for the Prime2 dataset (97.43%), although accuracies of SAR-derived forest maps were comparable. Our findings indicate that spaceborne radar could aid inventories in regions with low levels of forest cover in fragmented landscapes. The reduced accuracies observed for the global and pan-continental forest cover maps in comparison to national and SAR-derived forest maps indicate that caution should be exercised when applying these datasets for national reporting.

Forest Cover Estimation in Ireland Using Radar Remote Sensing: A Comparative Analysis of Forest Cover Assessment Methodologies

PubMed Central

Devaney, John; Barrett, Brian; Barrett, Frank; Redmond, John; O`Halloran, John

2015-01-01

Quantification of spatial and temporal changes in forest cover is an essential component of forest monitoring programs. Due to its cloud free capability, Synthetic Aperture Radar (SAR) is an ideal source of information on forest dynamics in countries with near-constant cloud-cover. However, few studies have investigated the use of SAR for forest cover estimation in landscapes with highly sparse and fragmented forest cover. In this study, the potential use of L-band SAR for forest cover estimation in two regions (Longford and Sligo) in Ireland is investigated and compared to forest cover estimates derived from three national (Forestry2010, Prime2, National Forest Inventory), one pan-European (Forest Map 2006) and one global forest cover (Global Forest Change) product. Two machine-learning approaches (Random Forests and Extremely Randomised Trees) are evaluated. Both Random Forests and Extremely Randomised Trees classification accuracies were high (98.1–98.5%), with differences between the two classifiers being minimal (<0.5%). Increasing levels of post classification filtering led to a decrease in estimated forest area and an increase in overall accuracy of SAR-derived forest cover maps. All forest cover products were evaluated using an independent validation dataset. For the Longford region, the highest overall accuracy was recorded with the Forestry2010 dataset (97.42%) whereas in Sligo, highest overall accuracy was obtained for the Prime2 dataset (97.43%), although accuracies of SAR-derived forest maps were comparable. Our findings indicate that spaceborne radar could aid inventories in regions with low levels of forest cover in fragmented landscapes. The reduced accuracies observed for the global and pan-continental forest cover maps in comparison to national and SAR-derived forest maps indicate that caution should be exercised when applying these datasets for national reporting. PMID:26262681

10 CFR 950.14 - Standby Support Contract: Covered events, exclusions, covered delay and covered cost provisions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... environmental laws or regulations such as those related to pollution abatement or human health and the... a covered event(s) is determined to be the cause of delay in attainment of full power operation...

10 CFR 950.14 - Standby Support Contract: Covered events, exclusions, covered delay and covered cost provisions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... environmental laws or regulations such as those related to pollution abatement or human health and the... a covered event(s) is determined to be the cause of delay in attainment of full power operation...

10 CFR 950.14 - Standby Support Contract: Covered events, exclusions, covered delay and covered cost provisions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... environmental laws or regulations such as those related to pollution abatement or human health and the... a covered event(s) is determined to be the cause of delay in attainment of full power operation...

10 CFR 950.14 - Standby Support Contract: Covered events, exclusions, covered delay and covered cost provisions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... environmental laws or regulations such as those related to pollution abatement or human health and the... a covered event(s) is determined to be the cause of delay in attainment of full power operation...

COVER (cover of vaccination evaluated rapidly): description of the England and Wales scheme.

PubMed

Begg, N T; Gill, O N; White, J M

1989-03-01

The COVER scheme, a method for the rapid evaluation of vaccine coverage in England and Wales, is described. The primary aim of the scheme is to improve cover by providing health district vaccination programme coordinators with relevant timely information. Quarterly data were obtained from, analysed and promptly fed back to, 126 health districts on cohorts of children who had recently attained the target ages for receiving the selected sentinel vaccines; 18 months for third diphtheria and third pertussis and 2 years for measles. Although the data suggested that vaccination cover is improving, national performance still falls well short of 90%, the 1990 target set by the World Health Organisation for countries in Europe.

Covered Bridge Security Manual

Treesearch

Brett Phares; Terry Wipf; Ryan Sievers; Travis Hosteng

2013-01-01

The design, construction, and use of covered timber bridges is all but a lost art in these days of pre-stressed concrete, high-performance steel, and the significant growth both in the volume and size of vehicles. Furthermore, many of the existing covered timber bridges are preserved only because of their status on the National Registry of Historic Places or the...

Astrobiology of Antarctic ice Covered Lakes

NASA Astrophysics Data System (ADS)

Doran, P. T.; Fritsen, C. H.

2005-12-01

Antarctica contains a number of permanently ice-covered lakes which have often been used as analogs of purported lakes on Mars in the past. Antarctic subglacial lakes, such as Lake Vostok, have also been viewed as excellent analogs for an ice covered ocean on the Jovian moon Europa, and to a lesser extend on Mars. Lakes in the McMurdo Dry Valleys of East Antarctica have ice covers that range from 3 to 20 meters thick. Water salinities range from fresh to hypersaline. The thinner ice-covered lakes have a well-documented ecology that relies on the limited available nutrients and the small amount of light energy that penetrates the ice covers. The thickest ice-covered lake (Lake Vida in Victoria Valley) has a brine beneath 20 m of ice that is 7 times sea water and maintains a temperature below -10 degrees Celsius. This lake is vastly different from the thinner ice-covered lakes in that there is no communication with the atmosphere. The permanent ice cover is so thick, that summer melt waters can not access the sub-ice brine and so the ice grows from the top up, as well as from the bottom down. Brine trapped beneath the ice is believed to be ancient, stranded thousands of years ago when the ice grew thick enough to isolate it from the surface. We view Lake Vida as an excellent analog for the last aquatic ecosystem to have existed on Mars under a planetary cooling. If, as evidence is now increasingly supporting, standing bodies of water existed on Mars in the past, their fate under a cooling would be to go through a stage of permanent ice cover establishment, followed by a thickening of that ice cover until the final stage just prior to a cold extinction would be a Lake Vida-like lake. If dust storms or mass movements covered these ancient lakes, remnants may well be in existence in the subsurface today. A NASA Astrobiology Science and Technology for Exploring Planets (ASTEP) project will drill the Lake Vida ice cover and access the brine and sediments beneath in

Sensitivity of selected landscape pattern metrics to land-cover misclassification and differences in land-cover composition

Treesearch

James D. Wickham; Robert V. O' Neill; Kurt H. Riitters; Timothy G. Wade; K. Bruce Jones

1997-01-01

Calculation of landscape metrics from land-cover data is becoming increasingly common. Some studies have shown that these measurements are sensitive to differences in land-cover composition, but none are known to have tested also their a sensitivity to land-cover misclassification. An error simulation model was written to test the sensitivity of selected land-scape...

THE ALTERNATIVE COVERS ASSESSMENT PROGRAM (ACAP)

EPA Science Inventory

Alternative covers attempt to achieve equivalent performance to conventional impermeable covers through an action that has been described as 'sponge and pump'. In this type of cover system, the soil and plants absorb moisture from precipitation, store it in the plant and soil str...

Comparative Genome Sequence Analysis of the Bpa/Str Region in Mouse and Man

PubMed Central

Mallon, A.-M.; Platzer, M.; Bate, R.; Gloeckner, G.; Botcherby, M.R.M.; Nordsiek, G.; Strivens, M.A.; Kioschis, P.; Dangel, A.; Cunningham, D.; Straw, R.N.A.; Weston, P.; Gilbert, M.; Fernando, S.; Goodall, K.; Hunter, G.; Greystrong, J.S.; Clarke, D.; Kimberley, C.; Goerdes, M.; Blechschmidt, K.; Rump, A.; Hinzmann, B.; Mundy, C.R.; Miller, W.; Poustka, A.; Herman, G.E.; Rhodes, M.; Denny, P.; Rosenthal, A.; Brown, S.D.M.

2000-01-01

The progress of human and mouse genome sequencing programs presages the possibility of systematic cross-species comparison of the two genomes as a powerful tool for gene and regulatory element identification. As the opportunities to perform comparative sequence analysis emerge, it is important to develop parameters for such analyses and to examine the outcomes of cross-species comparison. Our analysis used gene prediction and a database search of 430 kb of genomic sequence covering the Bpa/Str region of the mouse X chromosome, and 745 kb of genomic sequence from the homologous human X chromosome region. We identified 11 genes in mouse and 13 genes and two pseudogenes in human. In addition, we compared the mouse and human sequences using pairwise alignment and searches for evolutionary conserved regions (ECRs) exceeding a defined threshold of sequence identity. This approach aided the identification of at least four further putative conserved genes in the region. Comparative sequencing revealed that this region is a mosaic in evolutionary terms, with considerably more rearrangement between the two species than realized previously from comparative mapping studies. Surprisingly, this region showed an extremely high LINE and low SINE content, low G+C content, and yet a relatively high gene density, in contrast to the low gene density usually associated with such regions. [The sequence data described in this paper have been submitted to EMBL under the following accession nos.: Mouse Genomic Sequence: Mouse contig A (AL021127), Mouse contig B (AL049866), BAC41M10 (AL136328), PAC303O11(AL136329). Human Genomic Sequence: Human contig 1 (U82671, U82670), Human contig 2 (U82695).] PMID:10854409

Integrated physical map of bread wheat chromosome arm 7DS to facilitate gene cloning and comparative studies.

PubMed

Tulpová, Zuzana; Luo, Ming-Cheng; Toegelová, Helena; Visendi, Paul; Hayashi, Satomi; Vojta, Petr; Paux, Etienne; Kilian, Andrzej; Abrouk, Michaël; Bartoš, Jan; Hajdúch, Marián; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2018-03-08

Bread wheat (Triticum aestivum L.) is a staple food for a significant part of the world's population. The growing demand on its production can be satisfied by improving yield and resistance to biotic and abiotic stress. Knowledge of the genome sequence would aid in discovering genes and QTLs underlying these traits and provide a basis for genomics-assisted breeding. Physical maps and BAC clones associated with them have been valuable resources from which to generate a reference genome of bread wheat and to assist map-based gene cloning. As a part of a joint effort coordinated by the International Wheat Genome Sequencing Consortium, we have constructed a BAC-based physical map of bread wheat chromosome arm 7DS consisting of 895 contigs and covering 94% of its estimated length. By anchoring BAC contigs to one radiation hybrid map and three high resolution genetic maps, we assigned 73% of the assembly to a distinct genomic position. This map integration, interconnecting a total of 1713 markers with ordered and sequenced BAC clones from a minimal tiling path, provides a tool to speed up gene cloning in wheat. The process of physical map assembly included the integration of the 7DS physical map with a whole-genome physical map of Aegilops tauschii and a 7DS Bionano genome map, which together enabled efficient scaffolding of physical-map contigs, even in the non-recombining region of the genetic centromere. Moreover, this approach facilitated a comparison of bread wheat and its ancestor at BAC-contig level and revealed a reconstructed region in the 7DS pericentromere. Copyright © 2018. Published by Elsevier B.V.

Land cover trends dataset, 1973-2000

USGS Publications Warehouse

Soulard, Christopher E.; Acevedo, William; Auch, Roger F.; Sohl, Terry L.; Drummond, Mark A.; Sleeter, Benjamin M.; Sorenson, Daniel G.; Kambly, Steven; Wilson, Tamara S.; Taylor, Janis L.; Sayler, Kristi L.; Stier, Michael P.; Barnes, Christopher A.; Methven, Steven C.; Loveland, Thomas R.; Headley, Rachel; Brooks, Mark S.

2014-01-01

The U.S. Geological Survey Land Cover Trends Project is releasing a 1973–2000 time-series land-use/land-cover dataset for the conterminous United States. The dataset contains 5 dates of land-use/land-cover data for 2,688 sample blocks randomly selected within 84 ecological regions. The nominal dates of the land-use/land-cover maps are 1973, 1980, 1986, 1992, and 2000. The land-use/land-cover maps were classified manually from Landsat Multispectral Scanner, Thematic Mapper, and Enhanced Thematic Mapper Plus imagery using a modified Anderson Level I classification scheme. The resulting land-use/land-cover data has a 60-meter resolution and the projection is set to Albers Equal-Area Conic, North American Datum of 1983. The files are labeled using a standard file naming convention that contains the number of the ecoregion, sample block, and Landsat year. The downloadable files are organized by ecoregion, and are available in the ERDAS IMAGINETM (.img) raster file format.

Continental estimates of forest cover and forest cover changes in the dry ecosystems of Africa between 1990 and 2000

PubMed Central

Bodart, Catherine; Brink, Andreas B; Donnay, François; Lupi, Andrea; Mayaux, Philippe; Achard, Frédéric

2013-01-01

Aim This study provides regional estimates of forest cover in dry African ecoregions and the changes in forest cover that occurred there between 1990 and 2000, using a systematic sample of medium-resolution satellite imagery which was processed consistently across the continent. Location The study area corresponds to the dry forests and woodlands of Africa between the humid forests and the semi-arid regions. This area covers the Sudanian and Zambezian ecoregions. Methods A systematic sample of 1600 Landsat satellite imagery subsets, each 20 km × 20 km in size, were analysed for two reference years: 1990 and 2000. At each sample site and for both years, dense tree cover, open tree cover, other wooded land and other vegetation cover were identified from the analysis of satellite imagery, which comprised multidate segmentation and automatic classification steps followed by visual control by national forestry experts. Results Land cover and land-cover changes were estimated at continental and ecoregion scales and compared with existing pan-continental, regional and local studies. The overall accuracy of our land-cover maps was estimated at 87%. Between 1990 and 2000, 3.3 million hectares (Mha) of dense tree cover, 5.8 Mha of open tree cover and 8.9 Mha of other wooded land were lost, with a further 3.9 Mha degraded from dense to open tree cover. These results are substantially lower than the 34 Mha of forest loss reported in the FAO's 2010 Global Forest Resources Assessment for the same period and area. Main conclusions Our method generates the first consistent and robust estimates of forest cover and change in dry Africa with known statistical precision at continental and ecoregion scales. These results reduce the uncertainty regarding vegetation cover and its dynamics in these previously poorly studied ecosystems and provide crucial information for both science and environmental policies. PMID:23935237

49 CFR 193.2167 - Covered systems.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 3 2013-10-01 2013-10-01 false Covered systems. 193.2167 Section 193.2167...: FEDERAL SAFETY STANDARDS Design Impoundment Design and Capacity § 193.2167 Covered systems. A covered impounding system is prohibited except for concrete wall designed tanks where the concrete wall is an outer...

49 CFR 193.2167 - Covered systems.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 3 2011-10-01 2011-10-01 false Covered systems. 193.2167 Section 193.2167...: FEDERAL SAFETY STANDARDS Design Impoundment Design and Capacity § 193.2167 Covered systems. A covered impounding system is prohibited except for concrete wall designed tanks where the concrete wall is an outer...

49 CFR 193.2167 - Covered systems.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 3 2012-10-01 2012-10-01 false Covered systems. 193.2167 Section 193.2167...: FEDERAL SAFETY STANDARDS Design Impoundment Design and Capacity § 193.2167 Covered systems. A covered impounding system is prohibited except for concrete wall designed tanks where the concrete wall is an outer...

Effect of prostaglandin E2 on cytotoxic activity and granzyme A protease release by murine adherent IL-2 activated killer cells.

PubMed

Vaillier, D; Daculsi, R; Gualde, N

1994-04-01

The effects of prostaglandin E2 (PGE2) have been studied on a highly purified population of murine IL-2 activated killer cells obtained by selecting plastic-adherent splenocytes (AK cells) after incubation with high doses of recombinant IL-2. AK cells were highly cytotoxic for YAC-1 target cells. The cytotoxic activity was detectable at one hour after initiation of the cytotoxic assay and then increased with time. Cytotoxic activity of AK cells was inhibited by the addition of PGE2 or forskolin during the cytotoxic assay. When AK cells were generated in the presence of PGE2, the yielding cytotoxic activity was lower than the one expressed by "regular" AK cells but were insensitive to the inhibitory effect of PGE2 even if their lytic capability was still suppressed by forskolin. The presence of PGE2 during the AK cell culture had no effect on the cellular proliferation. Moreover, using tetrazolium-based colorimetric assay which reflects the cellular activation, it was observed that AK cells cultured in presence of PGE2 had an increased capacity to cleave the tetrazolium salt to formazan. Since the cytotoxic activity of killer cells is related to expression of serine esterase enzymes we evaluated the effects of PGE2 on serine esterase (Granzyme A) release after one hour of incubation of AK cells either alone or in presence of PGE2, YAC-1 cells or both. We observed that (i) AK cells spontaneously release granzyme A, (ii) the level of granzyme A was significantly increased when AK cells were incubated either with YAC-1 cells or PGE2 but did not change when YAC-1 cells and PGE2 were both associated with AK cells.

A globally complete map of supraglacial debris cover and a new toolkit for debris cover research

NASA Astrophysics Data System (ADS)

Herreid, Sam; Pellicciotti, Francesca

2017-04-01

A growing canon of literature is focused on resolving the processes and implications of debris cover on glaciers. However, this work is often confined to a handful of glaciers that were likely selected based on criteria optimizing their suitability to test a specific hypothesis or logistical ease. The role of debris cover in a glacier system is likely to not go overlooked in forthcoming research, yet the magnitude of this role at a global scale has not yet been fully described. Here, we present a map of debris cover for all glacierized regions on Earth including the Greenland Ice Sheet using 30 m Landsat data. This dataset will begin to open a wider context to the high quality, localized findings from the debris-covered glacier research community and help inform large-scale modeling efforts. A global map of debris cover also facilitates analysis attempting to isolate first order geomorphological and climate controls of supraglacial debris production. Furthering the objective of expanding the inclusion of debris cover in forthcoming research, we also present an under development suite of open-source, Python based tools. Requiring minimal and often freely available input data, we have automated the mapping of: i) debris cover, ii) ice cliffs, iii) debris cover evolution over the Landsat era and iv) glacier flow instabilities from altered debris structures. At the present time, debris extent is the only globally complete quantity but with the expanding repository of high quality global datasets and further tool development minimizing manual tasks and computational cost, we foresee all of these tools being applied globally in the near future.

Tools to covisualize and coanalyze proteomic data with genomes and transcriptomes: validation of genes and alternative mRNA splicing.

PubMed

Pang, Chi Nam Ignatius; Tay, Aidan P; Aya, Carlos; Twine, Natalie A; Harkness, Linda; Hart-Smith, Gene; Chia, Samantha Z; Chen, Zhiliang; Deshpande, Nandan P; Kaakoush, Nadeem O; Mitchell, Hazel M; Kassem, Moustapha; Wilkins, Marc R

2014-01-03

Direct links between proteomic and genomic/transcriptomic data are not frequently made, partly because of lack of appropriate bioinformatics tools. To help address this, we have developed the PG Nexus pipeline. The PG Nexus allows users to covisualize peptides in the context of genomes or genomic contigs, along with RNA-seq reads. This is done in the Integrated Genome Viewer (IGV). A Results Analyzer reports the precise base position where LC-MS/MS-derived peptides cover genes or gene isoforms, on the chromosomes or contigs where this occurs. In prokaryotes, the PG Nexus pipeline facilitates the validation of genes, where annotation or gene prediction is available, or the discovery of genes using a "virtual protein"-based unbiased approach. We illustrate this with a comprehensive proteogenomics analysis of two strains of Campylobacter concisus . For higher eukaryotes, the PG Nexus facilitates gene validation and supports the identification of mRNA splice junction boundaries and splice variants that are protein-coding. This is illustrated with an analysis of splice junctions covered by human phosphopeptides, and other examples of relevance to the Chromosome-Centric Human Proteome Project. The PG Nexus is open-source and available from https://github.com/IntersectAustralia/ap11_Samifier. It has been integrated into Galaxy and made available in the Galaxy tool shed.

29 CFR 1918.31 - Hatch coverings.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 29 Labor 7 2011-07-01 2011-07-01 false Hatch coverings. 1918.31 Section 1918.31 Labor Regulations...) SAFETY AND HEALTH REGULATIONS FOR LONGSHORING Working Surfaces § 1918.31 Hatch coverings. (a) No cargo... partially opened intermediate deck unless either the hatch at that deck is sufficiently covered or an...

29 CFR 1918.31 - Hatch coverings.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 7 2010-07-01 2010-07-01 false Hatch coverings. 1918.31 Section 1918.31 Labor Regulations...) SAFETY AND HEALTH REGULATIONS FOR LONGSHORING Working Surfaces § 1918.31 Hatch coverings. (a) No cargo... partially opened intermediate deck unless either the hatch at that deck is sufficiently covered or an...

29 CFR 1918.31 - Hatch coverings.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 29 Labor 7 2013-07-01 2013-07-01 false Hatch coverings. 1918.31 Section 1918.31 Labor Regulations...) SAFETY AND HEALTH REGULATIONS FOR LONGSHORING Working Surfaces § 1918.31 Hatch coverings. (a) No cargo... partially opened intermediate deck unless either the hatch at that deck is sufficiently covered or an...

29 CFR 1918.31 - Hatch coverings.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 7 2014-07-01 2014-07-01 false Hatch coverings. 1918.31 Section 1918.31 Labor Regulations...) SAFETY AND HEALTH REGULATIONS FOR LONGSHORING Working Surfaces § 1918.31 Hatch coverings. (a) No cargo... partially opened intermediate deck unless either the hatch at that deck is sufficiently covered or an...

29 CFR 1918.31 - Hatch coverings.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 7 2012-07-01 2012-07-01 false Hatch coverings. 1918.31 Section 1918.31 Labor Regulations...) SAFETY AND HEALTH REGULATIONS FOR LONGSHORING Working Surfaces § 1918.31 Hatch coverings. (a) No cargo... partially opened intermediate deck unless either the hatch at that deck is sufficiently covered or an...

Managing cover crops: an economic perspective

USDA-ARS?s Scientific Manuscript database

Common reasons given by producers as to why they do not adopt cover crops are related to economics: time, labor, and cost required for planting and managing cover crops. While many of the agronomic benefits of cover crops directly relate to economics, there are costs associated with adopting the pra...

VEGETATIVE COVERS FOR WASTE CONTAINMENT

EPA Science Inventory

Disposal of municipal ahd hazardous waste in the United States is primarily accomplished by containment in lined and capped landfills. Evapotranspiration cover systems offer an alternative to conventional landfill cap systems. These covers work on completely different principles ...

Snow cover in the Siberian forest-steppe

NASA Technical Reports Server (NTRS)

Zykov, I. V.

1985-01-01

A study is made of the snow cover on an experimental agricultural station in Mariinsk in the winter of 1945 to 1946. Conditions of snow cover formation, and types and indicators of snow cover are discussed. Snow cover structure and conditions and nature of thawing are described.

10 CFR 950.22 - Covered event determination.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Covered event determination. 950.22 Section 950.22 Energy... Covered event determination. (a) Completeness review. Upon notification of a covered event from the... with paragraph (c) of this section. (b) Covered Event Determination. The Claims Administrator shall...

10 CFR 950.22 - Covered event determination.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 4 2011-01-01 2011-01-01 false Covered event determination. 950.22 Section 950.22 Energy... Covered event determination. (a) Completeness review. Upon notification of a covered event from the... with paragraph (c) of this section. (b) Covered Event Determination. The Claims Administrator shall...

10 CFR 950.22 - Covered event determination.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 4 2012-01-01 2012-01-01 false Covered event determination. 950.22 Section 950.22 Energy... Covered event determination. (a) Completeness review. Upon notification of a covered event from the... with paragraph (c) of this section. (b) Covered Event Determination. The Claims Administrator shall...

10 CFR 950.22 - Covered event determination.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 4 2013-01-01 2013-01-01 false Covered event determination. 950.22 Section 950.22 Energy... Covered event determination. (a) Completeness review. Upon notification of a covered event from the... with paragraph (c) of this section. (b) Covered Event Determination. The Claims Administrator shall...

10 CFR 950.22 - Covered event determination.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 4 2014-01-01 2014-01-01 false Covered event determination. 950.22 Section 950.22 Energy... Covered event determination. (a) Completeness review. Upon notification of a covered event from the... with paragraph (c) of this section. (b) Covered Event Determination. The Claims Administrator shall...

An information hidden model holding cover distributions

NASA Astrophysics Data System (ADS)

Fu, Min; Cai, Chao; Dai, Zuxu

2018-03-01

The goal of steganography is to embed secret data into a cover so no one apart from the sender and intended recipients can find the secret data. Usually, the way the cover changing was decided by a hidden function. There were no existing model could be used to find an optimal function which can greatly reduce the distortion the cover suffered. This paper considers the cover carrying secret message as a random Markov chain, taking the advantages of a deterministic relation between initial distributions and transferring matrix of the Markov chain, and takes the transferring matrix as a constriction to decrease statistical distortion the cover suffered in the process of information hiding. Furthermore, a hidden function is designed and the transferring matrix is also presented to be a matrix from the original cover to the stego cover. Experiment results show that the new model preserves a consistent statistical characterizations of original and stego cover.

Land Cover Characterization Program

USGS Publications Warehouse

,

1997-01-01

(2) identify sources, develop procedures, and organize partners to deliver data and information to meet user requirements. The LCCP builds on the heritage and success of previous USGS land use and land cover programs and projects. It will be compatible with current concepts of government operations, the changing needs of the land use and land cover data users, and the technological tools with which the data are applied.

WATER COOLED RETORT COVER

DOEpatents

Ash, W.J.; Pozzi, J.F.

1962-05-01

A retort cover is designed for use in the production of magnesium metal by the condensation of vaporized metal on a collecting surface. The cover includes a condensing surface, insulating means adjacent to the condensing surface, ind a water-cooled means for the insulating means. The irrangement of insulation and the cooling means permits the magnesium to be condensed at a high temperature and in massive nonpyrophoric form. (AEC)

On numerically pluricanonical cyclic coverings

NASA Astrophysics Data System (ADS)

Kulikov, V. S.; Kharlamov, V. M.

2014-10-01

We investigate some properties of cyclic coverings f\\colon Y\\to X (where X is a complex surface of general type) branched along smooth curves B\\subset X that are numerically equivalent to a multiple of the canonical class of X. Our main results concern coverings of surfaces of general type with p_g=0 and Miyaoka-Yau surfaces. In particular, such coverings provide new examples of multi-component moduli spaces of surfaces with given Chern numbers and new examples of surfaces that are not deformation equivalent to their complex conjugates.

A comparative analysis of the Global Land Cover 2000 and MODIS land cover data sets

USGS Publications Warehouse

Giri, C.; Zhu, Z.; Reed, B.

2005-01-01

Accurate and up-to-date global land cover data sets are necessary for various global change research studies including climate change, biodiversity conservation, ecosystem assessment, and environmental modeling. In recent years, substantial advancement has been achieved in generating such data products. Yet, we are far from producing geospatially consistent high-quality data at an operational level. We compared the recently available Global Land Cover 2000 (GLC-2000) and MODerate resolution Imaging Spectrometer (MODIS) global land cover data to evaluate the similarities and differences in methodologies and results, and to identify areas of spatial agreement and disagreement. These two global land cover data sets were prepared using different data sources, classification systems, and methodologies, but using the same spatial resolution (i.e., 1 km) satellite data. Our analysis shows a general agreement at the class aggregate level except for savannas/shrublands, and wetlands. The disagreement, however, increases when comparing detailed land cover classes. Similarly, percent agreement between the two data sets was found to be highly variable among biomes. The identified areas of spatial agreement and disagreement will be useful for both data producers and users. Data producers may use the areas of spatial agreement for training area selection and pay special attention to areas of disagreement for further improvement in future land cover characterization and mapping. Users can conveniently use the findings in the areas of agreement, whereas users might need to verify the informaiton in the areas of disagreement with the help of secondary information. Learning from past experience and building on the existing infrastructure (e.g., regional networks), further research is necessary to (1) reduce ambiguity in land cover definitions, (2) increase availability of improved spatial, spectral, radiometric, and geometric resolution satellite data, and (3) develop advanced

49 CFR 826.3 - Proceedings covered.

Code of Federal Regulations, 2014 CFR

2014-10-01

....” For the Board, the type of proceeding covered includes (but may not be limited to) aviation enforcement cases appealed to the Board under sections 501, 609, 611 and 901 of the Federal Aviation Act (49 U... believes the proceeding is covered by the Act; whether the procedure is covered will then be an issue for...

49 CFR 826.3 - Proceedings covered.

Code of Federal Regulations, 2013 CFR

2013-10-01

....” For the Board, the type of proceeding covered includes (but may not be limited to) aviation enforcement cases appealed to the Board under sections 501, 609, 611 and 901 of the Federal Aviation Act (49 U... believes the proceeding is covered by the Act; whether the procedure is covered will then be an issue for...

Developed land cover of Puerto Rico

Treesearch

William A. Gould; Sebastian Martinuzzi; Olga M. Ramos Gonzalez

2008-01-01

This map shows the distribution of developed land cover in Puerto Rico (Martinuzzi et al. 2007). Developed land cover refers to urban, built-up and non-vegetated areas that result from human activity. These typically include built structures, concrete, asphalt, and other infrastructure. The developed land cover was estimated using Landsat 7 ETM+ satellite images pan...

21 CFR 880.6185 - Cast cover.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cast cover. 880.6185 Section 880.6185 Food and....6185 Cast cover. (a) Identification. A cast cover is a device intended for medical purposes that is made of waterproof material and placed over a cast to protect it from getting wet during a shower or a...

Measuring and analyzing urban tree cover

Treesearch

David J. Nowak; Rowan A. Rowntree; E. Gregory McPherson; Susan M. Sisinni; Esther R. Kirkmann; Jack C. Stevens

1996-01-01

Measurement of city tree cover can aid in urban vegetation planning, management, and research by revealing characteristics of vegetation across a city. Urban tree cover in the United States ranges from 0.4% in Lancaster, California, to 55% in Baton Rouge, Louisiana. Two important factors that affect the amount of urban tree cover are the natural environment and land...

Quantization of noncompact coverings and its physical applications

NASA Astrophysics Data System (ADS)

Ivankov, Petr

2018-02-01

A rigorous algebraic definition of noncommutative coverings is developed. In the case of commutative algebras this definition is equivalent to the classical definition of topological coverings of locally compact spaces. The theory has following nontrivial applications: • Coverings of continuous trace algebras, • Coverings of noncommutative tori, • Coverings of the quantum SU(2) group, • Coverings of foliations, • Coverings of isospectral deformations of Spin - manifolds. The theory supplies the rigorous definition of noncommutative Wilson lines.

21 CFR 882.5250 - Burr hole cover.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Burr hole cover. 882.5250 Section 882.5250 Food... DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5250 Burr hole cover. (a) Identification. A burr hole cover is a plastic or metal device used to cover or plug holes drilled into the skull...

21 CFR 882.5250 - Burr hole cover.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Burr hole cover. 882.5250 Section 882.5250 Food... DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5250 Burr hole cover. (a) Identification. A burr hole cover is a plastic or metal device used to cover or plug holes drilled into the skull...

21 CFR 882.5250 - Burr hole cover.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Burr hole cover. 882.5250 Section 882.5250 Food... DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5250 Burr hole cover. (a) Identification. A burr hole cover is a plastic or metal device used to cover or plug holes drilled into the skull...

Outdoor adventure therapy to increase physical activity in young adult cancer survivors.

PubMed

Gill, Elizabeth; Goldenberg, Marni; Starnes, Heather; Phelan, Suzanne

2016-01-01

Despite the health benefits of physical activity (PA), limited research has examined PA interventions in young adult cancer survivors (YACS). This study used a two-group parallel design to examine the effects of a 7-day outdoor adventure camp vs. waitlist control on PA levels among YACS. Secondary aims examined effects on sedentary behavior and PA correlates. 50 camp and 66 control participants were assessed at baseline, end of camp, and 3 months. Intent-to-treat analyses indicated that, relative to baseline, camp participants had significantly (p = 0.0001) greater increases in PA than controls during camp (+577 vs. +9 minutes/week) and 3 months post-camp (+133 vs. -75 minutes/week, p = 0.001). Camp participants also reported significantly greater improvements in TV viewing (p = 0.001), hours sitting (p = 0.001), PA variety (p = 0.0001), barriers to PA (p = 0.007), and enjoyment of structured activities (p = 0.04) during camp but not 3 months post-camp. A week-long outdoor adventure therapy camp increased PA levels during camp and 3 months after camp termination, although effects were attenuated over time. Outdoor adventure therapy camps may increase PA and its correlates in YACS, but future research should explore methods to promote sustained PA after camp termination.

Midwest Cover Crops Field Guide

USDA-ARS?s Scientific Manuscript database

Producers who want to prevent soil erosion, improve nutrient cycling, sustain their soils, and protect/maintain the environment have been returning to a very old practice: planting cover crops. Cover crops are effective tools for reducing soil erosion and increasing nutrient recycling on farmlands, ...

Assessing uncertainties in land cover projections.

PubMed

Alexander, Peter; Prestele, Reinhard; Verburg, Peter H; Arneth, Almut; Baranzelli, Claudia; Batista E Silva, Filipe; Brown, Calum; Butler, Adam; Calvin, Katherine; Dendoncker, Nicolas; Doelman, Jonathan C; Dunford, Robert; Engström, Kerstin; Eitelberg, David; Fujimori, Shinichiro; Harrison, Paula A; Hasegawa, Tomoko; Havlik, Petr; Holzhauer, Sascha; Humpenöder, Florian; Jacobs-Crisioni, Chris; Jain, Atul K; Krisztin, Tamás; Kyle, Page; Lavalle, Carlo; Lenton, Tim; Liu, Jiayi; Meiyappan, Prasanth; Popp, Alexander; Powell, Tom; Sands, Ronald D; Schaldach, Rüdiger; Stehfest, Elke; Steinbuks, Jevgenijs; Tabeau, Andrzej; van Meijl, Hans; Wise, Marshall A; Rounsevell, Mark D A

2017-02-01

Understanding uncertainties in land cover projections is critical to investigating land-based climate mitigation policies, assessing the potential of climate adaptation strategies and quantifying the impacts of land cover change on the climate system. Here, we identify and quantify uncertainties in global and European land cover projections over a diverse range of model types and scenarios, extending the analysis beyond the agro-economic models included in previous comparisons. The results from 75 simulations over 18 models are analysed and show a large range in land cover area projections, with the highest variability occurring in future cropland areas. We demonstrate systematic differences in land cover areas associated with the characteristics of the modelling approach, which is at least as great as the differences attributed to the scenario variations. The results lead us to conclude that a higher degree of uncertainty exists in land use projections than currently included in climate or earth system projections. To account for land use uncertainty, it is recommended to use a diverse set of models and approaches when assessing the potential impacts of land cover change on future climate. Additionally, further work is needed to better understand the assumptions driving land use model results and reveal the causes of uncertainty in more depth, to help reduce model uncertainty and improve the projections of land cover. © 2016 John Wiley & Sons Ltd.

Modeling of Passive Forces of Machine Tool Covers

NASA Astrophysics Data System (ADS)

Kolar, Petr; Hudec, Jan; Sulitka, Matej

The passive forces acting against the drive force are phenomena that influence dynamical properties and precision of linear axes equipped with feed drives. Covers are one of important sources of passive forces in machine tools. The paper describes virtual evaluation of cover passive forces using the cover complex model. The model is able to compute interaction between flexible cover segments and sealing wiper. The result is deformation of cover segments and wipers which is used together with measured friction coefficient for computation of cover total passive force. This resulting passive force is dependent on cover position. Comparison of computational results and measurement on the real cover is presented in the paper.

Regulatory guidance on soil cover systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kane, J.D.

1991-12-31

The US Nuclear Regulatory Commission (NRC) in September 1991, completed revisions to 14 sections of the Standard Review Plan (SRP) for the Review of a License Application for a Low-Level Radioactive Waste Disposal Facility. The major purposes of the SRP are to ensure the quality and uniformity of the NRC staff`s safety reviews, and to present a well-defined base from which to evaluate the acceptability of information and data provided in the Safety Analysis Report (SAR) portion of the license application. SRP 3.2, entitled, Design Considerations for Normal and Abnormal/Accident Conditions, was one of the sections that was revised bymore » the NRC staff. This revision was completed to provide additional regulatory guidance on the important considerations that need to be addressed for the proper design and construction of soil cover systems that are to be placed over the LLW. The cover system over the waste is acknowledged to be one of the most important engineered barriers for the long-term stable performance of the disposal facility. The guidance in revised SRP 3.2 summarizes the previous efforts and recommendations of the US Army Corps of Engineers (COE), and a peer review panel on the placement of soil cover systems. NRC published these efforts in NUREG/CR-5432. The discussions in this paper highlight selected recommendations on soil cover issues that the NRC staff considers important for ensuring the safe, long-term performance of the soil cover systems. The development phases to be discussed include: (1) cover design; (2) cover material selection; (3) laboratory and field testing; (4) field placement control and acceptance; and (5) penetrations through the constructed covers.« less

Mapping of Micro-Tom BAC-End Sequences to the Reference Tomato Genome Reveals Possible Genome Rearrangements and Polymorphisms

PubMed Central

Asamizu, Erika; Shirasawa, Kenta; Hirakawa, Hideki; Sato, Shusei; Tabata, Satoshi; Yano, Kentaro; Ariizumi, Tohru; Shibata, Daisuke; Ezura, Hiroshi

2012-01-01

A total of 93,682 BAC-end sequences (BESs) were generated from a dwarf model tomato, cv. Micro-Tom. After removing repetitive sequences, the BESs were similarity searched against the reference tomato genome of a standard cultivar, “Heinz 1706.” By referring to the “Heinz 1706” physical map and by eliminating redundant or nonsignificant hits, 28,804 “unique pair ends” and 8,263 “unique ends” were selected to construct hypothetical BAC contigs. The total physical length of the BAC contigs was 495, 833, 423 bp, covering 65.3% of the entire genome. The average coverage of euchromatin and heterochromatin was 58.9% and 67.3%, respectively. From this analysis, two possible genome rearrangements were identified: one in chromosome 2 (inversion) and the other in chromosome 3 (inversion and translocation). Polymorphisms (SNPs and Indels) between the two cultivars were identified from the BLAST alignments. As a result, 171,792 polymorphisms were mapped on 12 chromosomes. Among these, 30,930 polymorphisms were found in euchromatin (1 per 3,565 bp) and 140,862 were found in heterochromatin (1 per 2,737 bp). The average polymorphism density in the genome was 1 polymorphism per 2,886 bp. To facilitate the use of these data in Micro-Tom research, the BAC contig and polymorphism information are available in the TOMATOMICS database. PMID:23227037

Use of Genome Sequence Information for Meat Quality Trait QTL Mining for Causal Genes and Mutations on Pig Chromosome 17

PubMed Central

Hu, Zhi-Liang; Ramos, Antonio M.; Humphray, Sean J.; Rogers, Jane; Reecy, James M.; Rothschild, Max F.

2011-01-01

The newly available pig genome sequence has provided new information to fine map quantitative trait loci (QTL) in order to eventually identify causal variants. With targeted genomic sequencing efforts, we were able to obtain high quality BAC sequences that cover a region on pig chromosome 17 where a number of meat quality QTL have been previously discovered. Sequences from 70 BAC clones were assembled to form an 8-Mbp contig. Subsequently, we successfully mapped five previously identified QTL, three for meat color and two for lactate related traits, to the contig. With an additional 25 genetic markers that were identified by sequence comparison, we were able to carry out further linkage disequilibrium analysis to narrow down the genomic locations of these QTL, which allowed identification of the chromosomal regions that likely contain the causative variants. This research has provided one practical approach to combine genetic and molecular information for QTL mining. PMID:22303339

Utilizing Multiple Datasets for Snow Cover Mapping

NASA Technical Reports Server (NTRS)

Tait, Andrew B.; Hall, Dorothy K.; Foster, James L.; Armstrong, Richard L.

1999-01-01

Snow-cover maps generated from surface data are based on direct measurements, however they are prone to interpolation errors where climate stations are sparsely distributed. Snow cover is clearly discernable using satellite-attained optical data because of the high albedo of snow, yet the surface is often obscured by cloud cover. Passive microwave (PM) data is unaffected by clouds, however, the snow-cover signature is significantly affected by melting snow and the microwaves may be transparent to thin snow (less than 3cm). Both optical and microwave sensors have problems discerning snow beneath forest canopies. This paper describes a method that combines ground and satellite data to produce a Multiple-Dataset Snow-Cover Product (MDSCP). Comparisons with current snow-cover products show that the MDSCP draws together the advantages of each of its component products while minimizing their potential errors. Improved estimates of the snow-covered area are derived through the addition of two snow-cover classes ("thin or patchy" and "high elevation" snow cover) and from the analysis of the climate station data within each class. The compatibility of this method for use with Moderate Resolution Imaging Spectroradiometer (MODIS) data, which will be available in 2000, is also discussed. With the assimilation of these data, the resolution of the MDSCP would be improved both spatially and temporally and the analysis would become completely automated.

The Regional Land Cover Monitoring System: Building regional capacity through innovative land cover mapping approaches

NASA Astrophysics Data System (ADS)

Saah, D.; Tenneson, K.; Hanh, Q. N.; Aekakkararungroj, A.; Aung, K. S.; Goldstein, J.; Cutter, P. G.; Maus, P.; Markert, K. N.; Anderson, E.; Ellenburg, W. L.; Ate, P.; Flores Cordova, A. I.; Vadrevu, K.; Potapov, P.; Phongsapan, K.; Chishtie, F.; Clinton, N.; Ganz, D.

2017-12-01

Earth observation and Geographic Information System (GIS) tools, products, and services are vital to support the environmental decision making by governmental institutions, non-governmental agencies, and the general public. At the heart of environmental decision making is the monitoring land cover and land use change (LCLUC) for land resource planning and for ecosystem services, including biodiversity conservation and resilience to climate change. A major challenge for monitoring LCLUC in developing regions, such as Southeast Asia, is inconsistent data products at inconsistent intervals that have different typologies across the region and are typically made in without stakeholder engagement or input. Here we present the Regional Land Cover Monitoring System (RLCMS), a novel land cover mapping effort for Southeast Asia, implemented by SERVIR-Mekong, a joint NASA-USAID initiative that brings Earth observations to improve environmental decision making in developing countries. The RLCMS focuses on mapping biophysical variables (e.g. canopy cover, tree height, or percent surface water) at an annual interval and in turn using those biophysical variables to develop land cover maps based on stakeholder definitions of land cover classes. This allows for flexible and consistent land cover classifications that can meet the needs of different institutions across the region. Another component of the RLCMS production is the stake-holder engagement through co-development. Institutions that directly benefit from this system have helped drive the development for regional needs leading to services for their specific uses. Examples of services for regional stakeholders include using the RLCMS to develop maps using the IPCC classification scheme for GHG emission reporting and developing custom annual maps as an input to hydrologic modeling/flood forecasting systems. In addition to the implementation of this system and the service stemming from the RLCMS in Southeast Asia, it is

Shuttle landing facility cloud cover study: Climatological analysis and two tenths cloud cover rule evaluation

NASA Technical Reports Server (NTRS)

Atchison, Michael K.; Schumann, Robin; Taylor, Greg; Warburton, John; Wheeler, Mark; Yersavich, Ann

1993-01-01

The two-tenths cloud cover rule in effect for all End Of Mission (EOM) STS landings at the Kennedy Space Center (KSC) states: 'for scattered cloud layers below 10,000 feet, cloud cover must be observed to be less than or equal to 0.2 at the de-orbit burn go/no-go decision time (approximately 90 minutes before landing time)'. This rule was designed to protect against a ceiling (below 10,000 feet) developing unexpectedly within the next 90 minutes (i.e., after the de-orbit burn decision and before landing). The Applied Meteorological Unit (AMU) developed and analyzed a database of cloud cover amounts and weather conditions at the Shuttle Landing Facility for a five-year (1986-1990) period. The data indicate the best time to land the shuttle at KSC is during the summer while the worst time is during the winter. The analysis also shows the highest frequency of landing opportunities occurs for the 0100-0600 UTC and 1300-1600 UTC time periods. The worst time of the day to land a shuttle is near sunrise and during the afternoon. An evaluation of the two-tenths cloud cover rule for most data categorizations has shown that there is a significant difference in the proportions of weather violations one and two hours subsequent to initial conditions of 0.2 and 0.3 cloud cover. However, for May, Oct., 700 mb northerly wind category, 1500 UTC category, and 1600 UTC category there is some evidence that the 0.2 cloud cover rule may be overly conservative. This possibility requires further investigation. As a result of these analyses, the AMU developed nomograms to help the Spaceflight Meteorological Group (SMG) and the Cape Canaveral Forecast Facility (CCFF) forecast cloud cover for EOM and Return to Launch Site (RTLS) at KSC. Future work will include updating the two tenths database, further analysis of the data for several categorizations, and developing a proof of concept artificial neural network to provide forecast guidance of weather constraint violations for shuttle

[Innovative ET cover system and its hydrologic evaluation].

PubMed

Liu, Chuan-shun; Cai, Jun-xiong; Wang, Jing-zhai; Rong, Yu

2010-07-01

The evapotranspiration (ET) cover system,as an alternative cover system of landfill, has been used in many remediation projects since 2003. It is an inexpensive, practical,and easily maintained biological system, but is mainly favorable in arid and semiarid sites due to limited water-holding capacity of the single loam layer and limited transpiration of grass. To improve the effectiveness of percolation control, an innovative scheme of ET was suggested in this paper: (1) a clay liner was added under the single loam layer to increase the water-holding capacity; (2) combined vegetation consisting of shrub and grass was used to replace the grass cover. Hydrologic evaluation of conventional cover,ET cover and the innovative ET cover under the same condition was performed using the computer program HELP, which showed the performance of the innovative ET cover is obviously superior to that of ET cover and conventional cover.

10 CFR 950.14 - Standby Support Contract: Covered events, exclusions, covered delay and covered cost provisions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... include a provision setting forth the type of events that are covered events under the contract. The type...) Litigation in State, Federal, local, or tribal courts, including appeals of Commission decisions related to..., including but not limited to the following types of events: (i) The sponsor's failure to comply with...

Potential for Monitoring Snow Cover in Boreal Forests by Combining MODIS Snow Cover and AMSR-E SWE Maps

NASA Technical Reports Server (NTRS)

Riggs, George A.; Hall, Dorothy K.; Foster, James L.

2009-01-01

Monitoring of snow cover extent and snow water equivalent (SWE) in boreal forests is important for determining the amount of potential runoff and beginning date of snowmelt. The great expanse of the boreal forest necessitates the use of satellite measurements to monitor snow cover. Snow cover in the boreal forest can be mapped with either the Moderate Resolution Imaging Spectroradiometer (MODIS) or the Advanced Microwave Scanning Radiometer for EOS (AMSR-E) microwave instrument. The extent of snow cover is estimated from the MODIS data and SWE is estimated from the AMSR-E. Environmental limitations affect both sensors in different ways to limit their ability to detect snow in some situations. Forest density, snow wetness, and snow depth are factors that limit the effectiveness of both sensors for snow detection. Cloud cover is a significant hindrance to monitoring snow cover extent Using MODIS but is not a hindrance to the use of the AMSR-E. These limitations could be mitigated by combining MODIS and AMSR-E data to allow for improved interpretation of snow cover extent and SWE on a daily basis and provide temporal continuity of snow mapping across the boreal forest regions in Canada. The purpose of this study is to investigate if temporal monitoring of snow cover using a combination of MODIS and AMSR-E data could yield a better interpretation of changing snow cover conditions. The MODIS snow mapping algorithm is based on snow detection using the Normalized Difference Snow Index (NDSI) and the Normalized Difference Vegetation Index (NDVI) to enhance snow detection in dense vegetation. (Other spectral threshold tests are also used to map snow using MODIS.) Snow cover under a forest canopy may have an effect on the NDVI thus we use the NDVI in snow detection. A MODIS snow fraction product is also generated but not used in this study. In this study the NDSI and NDVI components of the snow mapping algorithm were calculated and analyzed to determine how they changed

Corrugated cover plate for flat plate collector

DOEpatents

Hollands, K. G. Terry; Sibbitt, Bruce

1978-01-01

A flat plate radiant energy collector is providing having a transparent cover. The cover has a V-corrugated shape which reduces the amount of energy reflected by the cover away from the flat plate absorber of the collector.

ESTIMATING IMPERVIOUS COVER FROM REGIONALLY AVAILABLE DATA

EPA Science Inventory

The objective of this study is to compare and evaluate the reliability of different approaches for estimating impervious cover including three empirical formulations for estimating impervious cover from population density data, estimation from categorized land cover data, and to ...

Border Lakes land-cover classification

Treesearch

Marvin Bauer; Brian Loeffelholz; Doug Shinneman

2009-01-01

This document contains metadata and description of land-cover classification of approximately 5.1 million acres of land bordering Minnesota, U.S.A. and Ontario, Canada. The classification focused on the separation and identification of specific forest-cover types. Some separation of the nonforest classes also was performed. The classification was derived from multi-...

Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

PubMed Central

Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

1995-01-01

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morrow, B.; Carlson, C.; Gupta, R.D.

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

Run for cover! What's covering your greenhouse and how is it affecting seedling growth?

Treesearch

Jeremy R. Pinto; Kas Dumroese; John D. Marshall

2006-01-01

Analysis of seedling growth characteristics between two greenhouse cover types, old fiberglass and new polycarbonate, shows significant differences in height and sturdiness coefficients in ponderosa pine (Pinus ponderosa) seedlings. Three rates of nitrogen (N) application (20, 40, and 60 mg) indicate that seedling growth will increase under both cover types, but may...

Genomic Anatomy of a Premier Major Histocompatibility Complex Paralogous Region on Chromosome 1q21–q22

PubMed Central

Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi

2001-01-01

Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under

Satellite Snow-Cover Mapping: A Brief Review

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.

1995-01-01

Satellite snow mapping has been accomplished since 1966, initially using data from the reflective part of the electromagnetic spectrum, and now also employing data from the microwave part of the spectrum. Visible and near-infrared sensors can provide excellent spatial resolution from space enabling detailed snow mapping. When digital elevation models are also used, snow mapping can provide realistic measurements of snow extent even in mountainous areas. Passive-microwave satellite data permit global snow cover to be mapped on a near-daily basis and estimates of snow depth to be made, but with relatively poor spatial resolution (approximately 25 km). Dense forest cover limits both techniques and optical remote sensing is limited further by cloudcover conditions. Satellite remote sensing of snow cover with imaging radars is still in the early stages of research, but shows promise at least for mapping wet or melting snow using C-band (5.3 GHz) synthetic aperture radar (SAR) data. Observing System (EOS) Moderate Resolution Imaging Spectroradiometer (MODIS) data beginning with the launch of the first EOS platform in 1998. Digital maps will be produced that will provide daily, and maximum weekly global snow, sea ice and lake ice cover at 1-km spatial resolution. Statistics will be generated on the extent and persistence of snow or ice cover in each pixel for each weekly map, cloudcover permitting. It will also be possible to generate snow- and ice-cover maps using MODIS data at 250- and 500-m resolution, and to study and map snow and ice characteristics such as albedo. been under development. Passive-microwave data offer the potential for determining not only snow cover, but snow water equivalent, depth and wetness under all sky conditions. A number of algorithms have been developed to utilize passive-microwave brightness temperatures to provide information on snow cover and water equivalent. The variability of vegetative Algorithms are being developed to map global snow

39 CFR 233.3 - Mail covers.

Code of Federal Regulations, 2011 CFR

2011-07-01

... transcription, photograph, photocopy or any other facsimile of the image of the outside cover, envelope, wrapper... Postal Inspection Service to transmit mail cover reports directly to the requesting authority. (j) Review...

39 CFR 233.3 - Mail covers.

Code of Federal Regulations, 2010 CFR

2010-07-01

... transcription, photograph, photocopy or any other facsimile of the image of the outside cover, envelope, wrapper... Postal Inspection Service to transmit mail cover reports directly to the requesting authority. (j) Review...

39 CFR 233.3 - Mail covers.

Code of Federal Regulations, 2013 CFR

2013-07-01

... transcription, photograph, photocopy or any other facsimile of the image of the outside cover, envelope, wrapper... Postal Inspection Service to transmit mail cover reports directly to the requesting authority. (j) Review...

39 CFR 233.3 - Mail covers.

Code of Federal Regulations, 2012 CFR

2012-07-01

... transcription, photograph, photocopy or any other facsimile of the image of the outside cover, envelope, wrapper... Postal Inspection Service to transmit mail cover reports directly to the requesting authority. (j) Review...

39 CFR 233.3 - Mail covers.

Code of Federal Regulations, 2014 CFR

2014-07-01

... transcription, photograph, photocopy or any other facsimile of the image of the outside cover, envelope, wrapper... Postal Inspection Service to transmit mail cover reports directly to the requesting authority. (j) Review...

Field Water Balance of Landfill Final Covers

EPA Science Inventory

Landfill covers are critical to waste containment, yet field performance of specific cover designs has not been well documented and seldom been compared in side-by-side testing. A study was conducted to assess the ability of landfill final covers to control percolation into unde...

Covered bridge manual

DOT National Transportation Integrated Search

2005-04-01

This manual provides guidance to those involved with all aspects of the work, from initial inspection and evaluation, through the engineering of rehabilitation, to construction issues. Broadly speaking, this manual covers general terminology and hist...

High Potential Source for Biomass Degradation Enzyme Discovery and Environmental Aspects Revealed through Metagenomics of Indian Buffalo Rumen

PubMed Central

Singh, K. M.; Reddy, Bhaskar; Patel, Dishita; Patel, A. K.; Patel, J. B.; Joshi, C. G.

2014-01-01

The complex microbiomes of the rumen functions as an effective system for plant cell wall degradation, and biomass utilization provide genetic resource for degrading microbial enzymes that could be used in the production of biofuel. Therefore the buffalo rumen microbiota was surveyed using shot gun sequencing. This metagenomic sequencing generated 3.9 GB of sequences and data were assembled into 137270 contiguous sequences (contigs). We identified potential 2614 contigs encoding biomass degrading enzymes including glycoside hydrolases (GH: 1943 contigs), carbohydrate binding module (CBM: 23 contigs), glycosyl transferase (GT: 373 contigs), carbohydrate esterases (CE: 259 contigs), and polysaccharide lyases (PE: 16 contigs). The hierarchical clustering of buffalo metagenomes demonstrated the similarities and dissimilarity in microbial community structures and functional capacity. This demonstrates that buffalo rumen microbiome was considerably enriched in functional genes involved in polysaccharide degradation with great prospects to obtain new molecules that may be applied in the biofuel industry. PMID:25136572

A Citizen's Guide to Evapotranspiration Covers

EPA Pesticide Factsheets

This guide explains Evapotranspiration Covers which are Evapotranspiration (ET) covers are a type of cap placed over contaminated material, such as soil, landfill waste, or mining tailings, to prevent water from reaching it.

Updating the 2001 National Land Cover Database land cover classification to 2006 by using Landsat imagery change detection methods

USGS Publications Warehouse

Xian, George; Homer, Collin G.; Fry, Joyce

2009-01-01

The recent release of the U.S. Geological Survey (USGS) National Land Cover Database (NLCD) 2001, which represents the nation's land cover status based on a nominal date of 2001, is widely used as a baseline for national land cover conditions. To enable the updating of this land cover information in a consistent and continuous manner, a prototype method was developed to update land cover by an individual Landsat path and row. This method updates NLCD 2001 to a nominal date of 2006 by using both Landsat imagery and data from NLCD 2001 as the baseline. Pairs of Landsat scenes in the same season in 2001 and 2006 were acquired according to satellite paths and rows and normalized to allow calculation of change vectors between the two dates. Conservative thresholds based on Anderson Level I land cover classes were used to segregate the change vectors and determine areas of change and no-change. Once change areas had been identified, land cover classifications at the full NLCD resolution for 2006 areas of change were completed by sampling from NLCD 2001 in unchanged areas. Methods were developed and tested across five Landsat path/row study sites that contain several metropolitan areas including Seattle, Washington; San Diego, California; Sioux Falls, South Dakota; Jackson, Mississippi; and Manchester, New Hampshire. Results from the five study areas show that the vast majority of land cover change was captured and updated with overall land cover classification accuracies of 78.32%, 87.5%, 88.57%, 78.36%, and 83.33% for these areas. The method optimizes mapping efficiency and has the potential to provide users a flexible method to generate updated land cover at national and regional scales by using NLCD 2001 as the baseline.

Absence of snow cover reduces understory plant cover and alters plant community composition in boreal forests.

PubMed

Kreyling, Juergen; Haei, Mahsa; Laudon, Hjalmar

2012-02-01

Snow regimes affect biogeochemistry of boreal ecosystems and are altered by climate change. The effects on plant communities, however, are largely unexplored despite their influence on relevant processes. Here, the impact of snow cover on understory community composition and below-ground production in a boreal Picea abies forest was investigated using a long-term (8-year) snow cover manipulation experiment consisting of the treatments: snow removal, increased insulation (styrofoam pellets), and control. The snow removal treatment caused longer (118 vs. 57 days) and deeper soil frost (mean minimum temperature -5.5 vs. -2.2°C) at 10 cm soil depth in comparison to control. Understory species composition was strongly altered by the snow cover manipulations; vegetation cover declined by more than 50% in the snow removal treatment. In particular, the dominant dwarf shrub Vaccinium myrtillus (-82%) and the most abundant mosses Pleurozium schreberi (-74%) and Dicranum scoparium (-60%) declined strongly. The C:N ratio in V. myrtillus leaves and plant available N in the soil indicated no altered nitrogen nutrition. Fine-root biomass in summer, however, was negatively affected by the reduced snow cover (-50%). Observed effects are attributed to direct frost damage of roots and/ or shoots. Besides the obvious relevance of winter processes on plant ecology and distribution, we propose that shifts in the vegetation caused by frost damage may be an important driver of the reported alterations in biogeochemistry in response to altered snow cover. Understory plant performance clearly needs to be considered in the biogeochemistry of boreal systems in the face of climate change.

On twelve types of covering-based rough sets.

PubMed

Safari, Samira; Hooshmandasl, Mohammad Reza

2016-01-01

Covering approximation spaces are a generalization of equivalence-based rough set theories. In this paper, we will consider twelve types of covering based approximation operators by combining four types of covering lower approximation operators and three types of covering upper approximation operators. Then, we will study the properties of these new pairs and show they have most of the common properties among existing covering approximation pairs. Finally, the relation between these new pairs is studied.

46 CFR 111.30-11 - Deck coverings.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 46 Shipping 4 2013-10-01 2013-10-01 false Deck coverings. 111.30-11 Section 111.30-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Switchboards § 111.30-11 Deck coverings. Non-conducting deck coverings, such as non-conducting...

46 CFR 111.30-11 - Deck coverings.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Deck coverings. 111.30-11 Section 111.30-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Switchboards § 111.30-11 Deck coverings. Non-conducting deck coverings, such as non-conducting...

46 CFR 111.30-11 - Deck coverings.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 46 Shipping 4 2014-10-01 2014-10-01 false Deck coverings. 111.30-11 Section 111.30-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Switchboards § 111.30-11 Deck coverings. Non-conducting deck coverings, such as non-conducting...

46 CFR 111.30-11 - Deck coverings.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 4 2011-10-01 2011-10-01 false Deck coverings. 111.30-11 Section 111.30-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Switchboards § 111.30-11 Deck coverings. Non-conducting deck coverings, such as non-conducting...

46 CFR 111.30-11 - Deck coverings.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 46 Shipping 4 2012-10-01 2012-10-01 false Deck coverings. 111.30-11 Section 111.30-11 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Switchboards § 111.30-11 Deck coverings. Non-conducting deck coverings, such as non-conducting...

Indicators: Lakeshore Habitat/Riparian Vegetative Cover

EPA Pesticide Factsheets

Riparian and lakeshore vegetative cover consist of the vegetation corridor alongside streams, rivers, and lakes. Vegetative cover refers to overhanging or submerged tree limbs, shrubs, and other plants growing along the shore of the waterbody.

MODIS Vegetative Cover Conversion and Vegetation Continuous Fields

NASA Astrophysics Data System (ADS)

Carroll, Mark; Townshend, John; Hansen, Matthew; DiMiceli, Charlene; Sohlberg, Robert; Wurster, Karl

Land cover change occurs at various spatial and temporal scales. For example, large-scale mechanical removal of forests for agro-industrial activities contrasts with the small-scale clearing of subsistence farmers. Such dynamics vary in spatial extent and rate of land conversion. Such changes are attributable to both natural and anthropogenic factors. For example, lightning- or human-ignited fires burn millions of acres of land surface each year. Further, land cover conversion requires ­contrasting with the land cover modification. In the first instance, the dynamic represents extensive categorical change between two land cover types. Land cover modification mechanisms such as selective logging and woody encroachment depict changes within a given land cover type rather than a conversion from one land cover type to another. This chapter describes the production of two standard MODIS land products used to document changes in global land cover. The Vegetative Cover Conversion (VCC) product is designed primarily to serve as a global alarm for areas where land cover change occurs rapidly (Zhan et al. 2000). The Vegetation Continuous Fields (VCF) product is designed to continuously ­represent ground cover as a proportion of basic vegetation traits. Terra's launch in December 1999 afforded a new opportunity to observe the entire Earth every 1.2 days at 250-m spatial resolution. The MODIS instrument's appropriate spatial and ­temporal resolutions provide the opportunity to substantially improve the characterization of the land surface and changes occurring thereupon (Townshend et al. 1991).

49 CFR 1560.111 - Covered airport operators.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 9 2014-10-01 2014-10-01 false Covered airport operators. 1560.111 Section 1560... Transmission of Secure Flight Passenger Data for Watch List Matching § 1560.111 Covered airport operators. (a) Applicability. This section applies to a covered airport operator that has a program approved by TSA through...

49 CFR 1560.111 - Covered airport operators.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 9 2011-10-01 2011-10-01 false Covered airport operators. 1560.111 Section 1560... Transmission of Secure Flight Passenger Data for Watch List Matching § 1560.111 Covered airport operators. (a) Applicability. This section applies to a covered airport operator that has a program approved by TSA through...

49 CFR 1560.111 - Covered airport operators.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 49 Transportation 9 2013-10-01 2013-10-01 false Covered airport operators. 1560.111 Section 1560... Transmission of Secure Flight Passenger Data for Watch List Matching § 1560.111 Covered airport operators. (a) Applicability. This section applies to a covered airport operator that has a program approved by TSA through...

49 CFR 1560.111 - Covered airport operators.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 9 2010-10-01 2010-10-01 false Covered airport operators. 1560.111 Section 1560... Transmission of Secure Flight Passenger Data for Watch List Matching § 1560.111 Covered airport operators. (a) Applicability. This section applies to a covered airport operator that has a program approved by TSA through...

49 CFR 1560.111 - Covered airport operators.

Code of Federal Regulations, 2012 CFR

2012-10-01

... 49 Transportation 9 2012-10-01 2012-10-01 false Covered airport operators. 1560.111 Section 1560... Transmission of Secure Flight Passenger Data for Watch List Matching § 1560.111 Covered airport operators. (a) Applicability. This section applies to a covered airport operator that has a program approved by TSA through...

Spatio-temporal change in forest cover and carbon storage considering actual and potential forest cover in South Korea.

PubMed

Nam, Kijun; Lee, Woo-Kyun; Kim, Moonil; Kwak, Doo-Ahn; Byun, Woo-Hyuk; Yu, Hangnan; Kwak, Hanbin; Kwon, Taesung; Sung, Joohan; Chung, Dong-Jun; Lee, Seung-Ho

2015-07-01

This study analyzes change in carbon storage by applying forest growth models and final cutting age to actual and potential forest cover for six major tree species in South Korea. Using National Forest Inventory data, the growth models were developed to estimate mean diameter at breast height, tree height, and number of trees for Pinus densiflora, Pinus koraiensis, Pinus rigida, Larix kaempferi, Castanea crenata and Quercus spp. stands. We assumed that actual forest cover in a forest type map will change into potential forest covers according to the Hydrological and Thermal Analogy Groups model. When actual forest cover reaches the final cutting age, forest volume and carbon storage are estimated by changed forest cover and its growth model. Forest volume between 2010 and 2110 would increase from 126.73 to 157.33 m(3) hm(-2). Our results also show that forest cover, volume, and carbon storage could abruptly change by 2060. This is attributed to the fact that most forests are presumed to reach final cutting age. To avoid such dramatic change, a regeneration and yield control scheme should be prepared and implemented in a way that ensures balance in forest practice and yield.

Short read Illumina data for the de novo assembly of a non-model snail species transcriptome (Radix balthica, Basommatophora, Pulmonata), and a comparison of assembler performance

PubMed Central

2011-01-01

Background Until recently, read lengths on the Solexa/Illumina system were too short to reliably assemble transcriptomes without a reference sequence, especially for non-model organisms. However, with read lengths up to 100 nucleotides available in the current version, an assembly without reference genome should be possible. For this study we created an EST data set for the common pond snail Radix balthica by Illumina sequencing of a normalized transcriptome. Performance of three different short read assemblers was compared with respect to: the number of contigs, their length, depth of coverage, their quality in various BLAST searches and the alignment to mitochondrial genes. Results A single sequencing run of a normalized RNA pool resulted in 16,923,850 paired end reads with median read length of 61 bases. The assemblies generated by VELVET, OASES, and SeqMan NGEN differed in the total number of contigs, contig length, the number and quality of gene hits obtained by BLAST searches against various databases, and contig performance in the mt genome comparison. While VELVET produced the highest overall number of contigs, a large fraction of these were of small size (< 200bp), and gave redundant hits in BLAST searches and the mt genome alignment. The best overall contig performance resulted from the NGEN assembly. It produced the second largest number of contigs, which on average were comparable to the OASES contigs but gave the highest number of gene hits in two out of four BLAST searches against different reference databases. A subsequent meta-assembly of the four contig sets resulted in larger contigs, less redundancy and a higher number of BLAST hits. Conclusion Our results document the first de novo transcriptome assembly of a non-model species using Illumina sequencing data. We show that de novo transcriptome assembly using this approach yields results useful for downstream applications, in particular if a meta-assembly of contig sets is used to increase contig

Reusable pipe flange covers

DOEpatents

Holden, James Elliott; Perez, Julieta

2001-01-01

A molded, flexible pipe flange cover for temporarily covering a pipe flange and a pipe opening includes a substantially round center portion having a peripheral skirt portion depending from the center portion, the center portion adapted to engage a front side of the pipe flange and to seal the pipe opening. The peripheral skirt portion is formed to include a plurality of circumferentially spaced tabs, wherein free ends of the flexible tabs are formed with respective through passages adapted to receive a drawstring for pulling the tabs together on a back side of the pipe flange.

45 CFR 162.923 - Requirements for covered entities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 1 2011-10-01 2011-10-01 false Requirements for covered entities. 162.923 Section... Requirements for covered entities. (a) General rule. Except as otherwise provided in this part, if a covered entity conducts, with another covered entity that is required to comply with a transaction standard...

45 CFR 162.923 - Requirements for covered entities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Requirements for covered entities. 162.923 Section... Requirements for covered entities. (a) General rule. Except as otherwise provided in this part, if a covered entity conducts, with another covered entity that is required to comply with a transaction standard...

10 CFR 950.31 - Covered event dispute resolution.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Covered event dispute resolution. 950.31 Section 950.31... § 950.31 Covered event dispute resolution. (a) If a sponsor disagrees with the Covered Event...) days of receipt of the Covered Event Determination, deliver to the Claims Administrator written notice...

10 CFR 950.31 - Covered event dispute resolution.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 4 2013-01-01 2013-01-01 false Covered event dispute resolution. 950.31 Section 950.31... § 950.31 Covered event dispute resolution. (a) If a sponsor disagrees with the Covered Event...) days of receipt of the Covered Event Determination, deliver to the Claims Administrator written notice...

10 CFR 950.31 - Covered event dispute resolution.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 4 2014-01-01 2014-01-01 false Covered event dispute resolution. 950.31 Section 950.31... § 950.31 Covered event dispute resolution. (a) If a sponsor disagrees with the Covered Event...) days of receipt of the Covered Event Determination, deliver to the Claims Administrator written notice...

10 CFR 950.31 - Covered event dispute resolution.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 4 2012-01-01 2012-01-01 false Covered event dispute resolution. 950.31 Section 950.31... § 950.31 Covered event dispute resolution. (a) If a sponsor disagrees with the Covered Event...) days of receipt of the Covered Event Determination, deliver to the Claims Administrator written notice...

10 CFR 950.31 - Covered event dispute resolution.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 4 2011-01-01 2011-01-01 false Covered event dispute resolution. 950.31 Section 950.31... § 950.31 Covered event dispute resolution. (a) If a sponsor disagrees with the Covered Event...) days of receipt of the Covered Event Determination, deliver to the Claims Administrator written notice...

Seasonal land-cover regions of the United States

USGS Publications Warehouse

Loveland, Thomas R.; Merchant, James W.; Brown, Jesslyn F.; Ohlen, Donald O.; Reed, Bradley C.; Olson, Paul; Hutchinson, John

1995-01-01

Global-change investigations have been hindered by deficiencies in the availability and quality of land-cover data. The U.S. Geological Survey and the University of Nebraska-Lincoln have collaborated on the development of a new approach to land-cover characterization that attempts to address requirements of the global-change research community and others interested in regional patterns of land cover. An experimental 1 -kilometer-resolution database of land-cover characteristics for the coterminous U.S. has been prepared to test and evaluate the approach. Using multidate Advanced Very High Resolution Radiometer (AVHRR) satellite data complemented by elevation, climate, ecoregions, and other digital spatial datasets, the authors define 152, seasonal land-cover regions. The regionalization is based on a taxonomy of areas with respect to data on land cover, seasonality or phenology, and relative levels of primary production. The resulting database consists of descriptions of the vegetation, land cover, and seasonal, spectral, and site characteristics for each region. These data are used in the construction of an illustrative 1:7,500,000-scaIe map of the seasonal land-cover regions as well as of smaller-scale maps portraying general land cover and seasonality. The seasonal land-cover characteristics database can also be tailored to provide a broad range of other landscape parameters useful in national and global-scale environmental modeling and assessment.

Towards realistic Holocene land cover scenarios: integration of archaeological, palynological and geomorphological records and comparison to global land cover scenarios.

NASA Astrophysics Data System (ADS)

De Brue, Hanne; Verstraeten, Gert; Broothaerts, Nils; Notebaert, Bastiaan

2016-04-01

Accurate and spatially explicit landscape reconstructions for distinct time periods in human history are essential for the quantification of the effect of anthropogenic land cover changes on, e.g., global biogeochemical cycles, ecology, and geomorphic processes, and to improve our understanding of interaction between humans and the environment in general. A long-term perspective covering Mid and Late Holocene land use changes is recommended in this context, as it provides a baseline to evaluate human impact in more recent periods. Previous efforts to assess the evolution and intensity of agricultural land cover in past centuries or millennia have predominantly focused on palynological records. An increasing number of quantitative techniques has been developed during the last two decades to transfer palynological data to land cover estimates. However, these techniques have to deal with equifinality issues and, furthermore, do not sufficiently allow to reconstruct spatial patterns of past land cover. On the other hand, several continental and global databases of historical anthropogenic land cover changes based on estimates of global population and the required agricultural land per capita have been developed in the past decennium. However, at such long temporal and spatial scales, reconstruction of past anthropogenic land cover intensities and spatial patterns necessarily involves many uncertainties and assumptions as well. Here, we present a novel approach that combines archaeological, palynological and geomorphological data for the Dijle catchment in the central Belgium Loess Belt in order to arrive at more realistic Holocene land cover histories. Multiple land cover scenarios (> 60.000) are constructed using probabilistic rules and used as input into a sediment delivery model (WaTEM/SEDEM). Model outcomes are confronted with a detailed geomorphic dataset on Holocene sediment fluxes and with REVEALS based estimates of vegetation cover using palynological data from

46 CFR 127.440 - Operability of window coverings.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Operability of window coverings. 127.440 Section 127.440... ARRANGEMENTS Construction of Windows, Visibility, and Operability of Coverings § 127.440 Operability of window coverings. Any covering or protection placed over a window or porthole that could be used as a means of...

The National Land Cover Database

USGS Publications Warehouse

Homer, Collin G.; Fry, Joyce A.; Barnes, Christopher A.

2012-01-01

The National Land Cover Database (NLCD) serves as the definitive Landsat-based, 30-meter resolution, land cover database for the Nation. NLCD provides spatial reference and descriptive data for characteristics of the land surface such as thematic class (for example, urban, agriculture, and forest), percent impervious surface, and percent tree canopy cover. NLCD supports a wide variety of Federal, State, local, and nongovernmental applications that seek to assess ecosystem status and health, understand the spatial patterns of biodiversity, predict effects of climate change, and develop land management policy. NLCD products are created by the Multi-Resolution Land Characteristics (MRLC) Consortium, a partnership of Federal agencies led by the U.S. Geological Survey. All NLCD data products are available for download at no charge to the public from the MRLC Web site: http://www.mrlc.gov.

Land cover changes in central Sonora Mexico

Treesearch

Diego Valdez-Zamudio; Alejandro Castellanos-Villegas; Stuart Marsh

2000-01-01

Remote sensing techniques have been demonstrated to be very effective tools to help detect, analyze, and evaluate land cover changes in natural areas of the world. Changes in land cover can generally be attributed to either natural or anthropogenic forces. Multitemporal satellite imagery and airborne videography were used to detect, analyze, and evaluate land cover...

Localization of a translocation breakpoint involved in Smith-Lemli-Opitz syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alley, T.L.; Gray, B.A.; Lee, S.

1994-09-01

Smith-Lemli-Opitz syndrome (SLOS) is a multiple congenital anomaly/mental retardation syndrome, with features including toe syndactyly, genital anomalies, unusual facies, and occasional organ malformations. The gene(s) for this autosomal recessive disorder has not been mapped. Recent biochemical studies suggest that the defect may involve the penultimate step in cholesterol synthesis, as patients have low serum cholesterol and increased 7-dehydrocholesterol (7-DHC) levels. However, the enzyme putatively involved (7-DHC reductase) has not been isolated. We identified an SLOS patient with a de novo balanced chromosome translocation [t(7;20)(q32.1;q13.2)], and we propose that the translocation interrupts one of the patient`s SLOS alleles. We are pursuingmore » positional cloning to identify the SLOS gene. Using fluorescence in situ hybridization (FISH), we recently identified a chromosome 7 yeast artificial chromosome (YAC) that spans the breakpoint and places it onto physical and genetic maps. We are in the process of narrowing this region via overlapping YACs and YAC subclones, from which we will isolate candidate cDNAs. Any candidate gene disrupted by the translocation and mutated on the other allele will be proven to be the SLOS gene. Functional analysis of an SLOS cDNA may also determine its relationship to cholesterol metabolism and the observed biochemical abnormalities.« less

AsMA journal covers, a history.

PubMed

Day, Pamela C

2014-01-01

The cover of our journal has changed quite often over the years. As we look forward to changing the name and design of the journal, it seems appropriate to reflect on the previous journal titles and covers. A brief history follows.

Modeling percent tree canopy cover: a pilot study

Treesearch

John W. Coulston; Gretchen G. Moisen; Barry T. Wilson; Mark V. Finco; Warren B. Cohen; C. Kenneth Brewer

2012-01-01

Tree canopy cover is a fundamental component of the landscape, and the amount of cover influences fire behavior, air pollution mitigation, and carbon storage. As such, efforts to empirically model percent tree canopy cover across the United States are a critical area of research. The 2001 national-scale canopy cover modeling and mapping effort was completed in 2006,...

Cloud cover models derived from satellite radiation measurements

NASA Technical Reports Server (NTRS)

Bean, S. J.; Somerville, P. N.

1979-01-01

Using daily measurement of day and night infrared and incoming and absorbed solar radiation obtained from a TIROS satellite over a period of approximately 45 months, and integrated over 2.5 degree latitude-longitude grids, the proportion of cloud cover over each grid each day was derived for the entire period. For each of four three-month periods, estimates a and b of the two parameters of the best-fit beta distribution were obtained for each grid location. The (a,b) plane was divided into a number of regions. All the geographical locations whose (a,b) estimates were in the same region in the (a,b) plane were said to have the same cloud cover type for that season. For each season, the world was thus divided into separate cloud cover types. Using estimates of mean cloud cover for each season, the world was again divided into separate cloud cover types. The process was repeated for standard deviations. Thus for each season, three separate cloud cover models were obtained using the criteria of shape of frequency distribution, mean cloud cover, and variability of cloud cover. The cloud cover statistics were derived from once-a-day, near-local-noon satellite radiation measurements.

Intercomparison of Satellite-Derived Snow-Cover Maps

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.; Tait, Andrew B.; Foster, James L.; Chang, Alfred T. C.; Allen, Milan

1999-01-01

In anticipation of the launch of the Earth Observing System (EOS) Terra, and the PM-1 spacecraft in 1999 and 2000, respectively, efforts are ongoing to determine errors of satellite-derived snow-cover maps. EOS Moderate Resolution Imaging Spectroradiometer (MODIS) and Advanced Microwave Scanning Radiometer-E (AMSR-E) snow-cover products will be produced. For this study we compare snow maps covering the same study area acquired from different sensors using different snow- mapping algorithms. Four locations are studied: 1) southern Saskatchewan; 2) a part of New England (New Hampshire, Vermont and Massachusetts) and eastern New York; 3) central Idaho and western Montana; and 4) parts of North and South Dakota. Snow maps were produced using a prototype MODIS snow-mapping algorithm used on Landsat Thematic Mapper (TM) scenes of each study area at 30-m and when the TM data were degraded to 1 -km resolution. National Operational Hydrologic Remote Sensing Center (NOHRSC) 1 -km resolution snow maps were also used, as were snow maps derived from 1/2 deg. x 1/2 deg. resolution Special Sensor Microwave Imager (SSM/1) data. A land-cover map derived from the International Geosphere-Biosphere Program (IGBP) land-cover map of North America was also registered to the scenes. The TM, NOHRSC and SSM/I snow maps, and land-cover maps were compared digitally. In most cases, TM-derived maps show less snow cover than the NOHRSC and SSM/I maps because areas of incomplete snow cover in forests (e.g., tree canopies, branches and trunks) are seen in the TM data, but not in the coarser-resolution maps. The snow maps generally agree with respect to the spatial variability of the snow cover. The 30-m resolution TM data provide the most accurate snow maps, and are thus used as the baseline for comparison with the other maps. Comparisons show that the percent change in amount of snow cover relative to the 3 0-m resolution TM maps is lowest using the TM I -km resolution maps, ranging from 0 to 40

49 CFR 633.11 - Covered projects.

Code of Federal Regulations, 2010 CFR

2010-10-01

..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the... 49 Transportation 7 2010-10-01 2010-10-01 false Covered projects. 633.11 Section 633.11...

49 CFR 633.11 - Covered projects.

Code of Federal Regulations, 2012 CFR

2012-10-01

..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the... 49 Transportation 7 2012-10-01 2012-10-01 false Covered projects. 633.11 Section 633.11...

49 CFR 633.11 - Covered projects.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the... 49 Transportation 7 2013-10-01 2013-10-01 false Covered projects. 633.11 Section 633.11...

49 CFR 633.11 - Covered projects.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the... 49 Transportation 7 2014-10-01 2014-10-01 false Covered projects. 633.11 Section 633.11...

49 CFR 633.11 - Covered projects.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., DEPARTMENT OF TRANSPORTATION PROJECT MANAGEMENT OVERSIGHT Project Management Oversight Services § 633.11 Covered projects. The Administrator may contract for project management oversight services when the... 49 Transportation 7 2011-10-01 2011-10-01 false Covered projects. 633.11 Section 633.11...

49 CFR 1016.103 - Proceedings covered.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 8 2010-10-01 2010-10-01 false Proceedings covered. 1016.103 Section 1016.103 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION BOARD, DEPARTMENT... BY PARTIES TO BOARD ADJUDICATORY PROCEEDINGS General Provisions § 1016.103 Proceedings covered. (a...

49 CFR 1016.103 - Proceedings covered.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 49 Transportation 8 2011-10-01 2011-10-01 false Proceedings covered. 1016.103 Section 1016.103 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION BOARD, DEPARTMENT... BY PARTIES TO BOARD ADJUDICATORY PROCEEDINGS General Provisions § 1016.103 Proceedings covered. (a...

Fish assemblage responses to forest cover

Treesearch

Chris L. Burcher; Matthew E. McTammany; E. Fred Benfield; Gene S. Helfman

2008-01-01

We investigated whether fish assemblage structure in southern Appalachian streams differed with historical and contemporary forest cover. We compared fish assemblages in 2nd?4th order streams draining watersheds that had increased forest cover between 1950 and 1993 (i.e., reforesting watersheds).

Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

PubMed

Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

1996-11-01

Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and

Constraining eye movement in individuals with Parkinson's disease during walking turns.

PubMed

Ambati, V N Pradeep; Saucedo, Fabricio; Murray, Nicholas G; Powell, Douglas W; Reed-Jones, Rebecca J

2016-10-01

Walking and turning is a movement that places individuals with Parkinson's disease (PD) at increased risk for fall-related injury. However, turning is an essential movement in activities of daily living, making up to 45 % of the total steps taken in a given day. Hypotheses regarding how turning is controlled suggest an essential role of anticipatory eye movements to provide feedforward information for body coordination. However, little research has investigated control of turning in individuals with PD with specific consideration for eye movements. The purpose of this study was to examine eye movement behavior and body segment coordination in individuals with PD during walking turns. Three experimental groups, a group of individuals with PD, a group of healthy young adults (YAC), and a group of healthy older adults (OAC), performed walking and turning tasks under two visual conditions: free gaze and fixed gaze. Whole-body motion capture and eye tracking characterized body segment coordination and eye movement behavior during walking trials. Statistical analysis revealed significant main effects of group (PD, YAC, and OAC) and visual condition (free and fixed gaze) on timing of segment rotation and horizontal eye movement. Within group comparisons, revealed timing of eye and head movement was significantly different between the free and fixed gaze conditions for YAC (p < 0.001) and OAC (p < 0.05), but not for the PD group (p > 0.05). In addition, while intersegment timings (reflecting segment coordination) were significantly different for YAC and OAC during free gaze (p < 0.05), they were not significantly different in PD. These results suggest individuals with PD do not make anticipatory eye and head movements ahead of turning and that this may result in altered segment coordination during turning. As such, eye movements may be an important addition to training programs for those with PD, possibly promoting better coordination during turning and

Timely precipitation drives cover crop outcomes

USDA-ARS?s Scientific Manuscript database

Cover crops can expand ecosystem services, though sound management recommendations for their use within semi-arid cropping systems is currently constrained by a lack of information. This study was conducted to determine agroecosystem responses to late-summer seeded cover crops under no-till managem...

Screening white spot syndrome virus (WSSV)-resistant molecular markers from Fenneropenaeus chinensis

NASA Astrophysics Data System (ADS)

Wu, Yingying; Meng, Xianhong; Kong, Jie; Luan, Sheng; Luo, Kun; Wang, Qingyin; Zheng, Yongyun

2017-02-01

White spot syndrome virus (WSSV)-resistant molecular markers were screened from the selectively bred new variety `Huanghai No. 2' of Fenneropenaeus chinensis using unlabeled-probe high-resolution melting (HRM) technique. After the artificial infection with WSSV, the first 96 dead shrimps and the last 96 surviving shrimps were collected, representing WSSV-susceptible and -resistant populations, respectively. The genotypes at well-developed 39 single nucleotide polymorphisms (SNPs) loci were obtained. As revealed in the Chi-square test, 3 SNPs, genotype A/A of contig C364-89AT, genotype A/A of C2635-527CA and genotype C/T of contig C12355-592CT, were positively correlated with disease-resistance traits. Other 2 SNPs, genotype G/G of contig C283-145AG and genotype C/C of contig C12355-592CT, were negatively correlated. Moreover, analysis with BlastX program for disease-resistant SNPs indicated that 3 contigs, Contig283, Contig364 and Contig12355, matched to the functional genes of effector caspase of Penaeus monodon, peptide transporter family 1-like protein, and 40S ribosomal protein S2 of Perca flavescens with high sequence similarity. The results will be helpful to provide theoretical and technical supports for molecular marker-assisted selective breeding of F. chinensis.

Vegetative soil covers for hazardous waste landfills

NASA Astrophysics Data System (ADS)

Peace, Jerry L.

Shallow land burial has been the preferred method for disposing of municipal and hazardous wastes in the United States because it is the simplest, cheapest, and most cost-effective method of disposal. Arid and semiarid regions of the western United States have received considerable attention over the past two decades in reference to hazardous, radioactive, and mixed waste disposal. Disposal is based upon the premise that low mean annual precipitation, high evapotranspiration, and low or negligible recharge, favor waste isolation from the environment for long periods of time. The objective of this study is to demonstrate that containment of municipal and hazardous wastes in arid and semiarid environments can be accomplished effectively without traditional, synthetic materials and complex, multi-layer systems. This research demonstrates that closure covers utilizing natural soils and native vegetation i.e., vegetative soil covers, will meet the technical equivalency criteria prescribed by the U.S. Environmental Protection Agency for hazardous waste landfills. Vegetative soil cover design combines layers of natural soil, native plant species, and climatic conditions to form a sustainable, functioning ecosystem that maintains the natural water balance. In this study, percolation through a natural analogue and an engineered cover is simulated using the one-dimensional, numerical code UNSAT-H. UNSAT-H is a Richards' equation-based model that simulates soil water infiltration, unsaturated flow, redistribution, evaporation, plant transpiration, and deep percolation. This study incorporates conservative, site-specific soil hydraulic and vegetation parameters. Historical meteorological data from 1919 to 1996 are used to simulate percolation through the natural analogue and an engineered cover, with and without vegetation. This study indicates that a 1 m (3 ft) cover is the minimum design thickness necessary to meet the U.S. Environmental Protection Agency

Molecular definition of breakpoints associated with human Xq isochromosomes: Implications for mechanisms of formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolff, D.J.; Miller, A.P.; Schwartz, S.

1996-01-01

To test the centromere misdivision model of isochromosome formation, we have defined the breakpoints of cytogenetically monocentric and dicentric Xq isochromosomes (i(Xq)) from Turner syndrome probands, using FISH with cosmids and YACs derived from a contig spanning proximal Xp. Seven different pericentromeric breakpoints were identified, with 10 of 11 of the i(Xq)s containing varying amounts of material from Xp. Only one of the eight cytogenetically monocentric i(Xq)s demonstrated a single alpha-satellite (DXZ1) signal, consistent with classical models involving centromere misdivision. The remaining seven were inconsistent with such a model and had breakpoints that spanned proximal Xp11.21: one was between DXZ1more » and the most proximal marker, ZXDA; one occurred between the duplicated genes, ZXDA and ZXDB; two were {approximately}2 Mb from DXZ1; two were adjacent to ALAS2 located 3.5 Mb from DXZ1; and the largest had a breakpoint just distal to DXS1013E, indicating the inclusion of 8 Mb of Xp DNA between centromeres. The three cytologically dicentric i(Xq)s had breakpoints distal to DXS423E in Xp11.22 and therefore contained {ge}12 Mb of DNA between centromeres. These data demonstrate that the majority of breakpoints resulting in i(Xq) formation are in band Xp11.2 and not in the centromere itself. Therefore, we hypothesize that the predominant mechanism of i(Xq) formation involves sequences in the proximal short arm that are prone to breakage and reunion events between sister chromatids or homologous X chromosomes. 39 refs., 4 figs., 2 tabs.« less

A cloud cover model based on satellite data

NASA Technical Reports Server (NTRS)

Somerville, P. N.; Bean, S. J.

1980-01-01

A model for worldwide cloud cover using a satellite data set containing infrared radiation measurements is proposed. The satellite data set containing day IR, night IR and incoming and absorbed solar radiation measurements on a 2.5 degree latitude-longitude grid covering a 45 month period was converted to estimates of cloud cover. The global area was then classified into homogeneous cloud cover regions for each of the four seasons. It is noted that the developed maps can be of use to the practicing climatologist who can obtain a considerable amount of cloud cover information without recourse to large volumes of data.

7 CFR 353.4 - Products covered.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 5 2012-01-01 2012-01-01 false Products covered. 353.4 Section 353.4 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EXPORT CERTIFICATION § 353.4 Products covered. Plants and plant products when...

7 CFR 353.4 - Products covered.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 5 2010-01-01 2010-01-01 false Products covered. 353.4 Section 353.4 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EXPORT CERTIFICATION § 353.4 Products covered. Plants and plant products when...

Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, W.M.; Dausman, J.; Beard, C.

Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protectionmore » analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.« less

Climatological determinants of woody cover in Africa.

PubMed

Good, Stephen P; Caylor, Kelly K

2011-03-22

Determining the factors that influence the distribution of woody vegetation cover and resolving the sensitivity of woody vegetation cover to shifts in environmental forcing are critical steps necessary to predict continental-scale responses of dryland ecosystems to climate change. We use a 6-year satellite data record of fractional woody vegetation cover and an 11-year daily precipitation record to investigate the climatological controls on woody vegetation cover across the African continent. We find that-as opposed to a relationship with only mean annual rainfall-the upper limit of fractional woody vegetation cover is strongly influenced by both the quantity and intensity of rainfall events. Using a set of statistics derived from the seasonal distribution of rainfall, we show that areas with similar seasonal rainfall totals have higher fractional woody cover if the local rainfall climatology consists of frequent, less intense precipitation events. Based on these observations, we develop a generalized response surface between rainfall climatology and maximum woody vegetation cover across the African continent. The normalized local gradient of this response surface is used as an estimator of ecosystem vegetation sensitivity to climatological variation. A comparison between predicted climate sensitivity patterns and observed shifts in both rainfall and vegetation during 2009 reveals both the importance of rainfall climatology in governing how ecosystems respond to interannual fluctuations in climate and the utility of our framework as a means to forecast continental-scale patterns of vegetation shifts in response to future climate change.

Replacing fallow by cover crops: economic sustainability

NASA Astrophysics Data System (ADS)

Gabriel, José Luis; Garrido, Alberto; Quemada, Miguel

2013-04-01

Replacing fallow by cover crops in intensive fertilized systems has been demonstrated as an efficient tool for reducing nitrate leaching. However, despite the evident environmental services provided and the range of agronomic benefits documented in the literature, farmers' adoption of this new technology is still limited because they are either unwilling or unable, although adoption reluctance is frequently rooted in low economic profitability, low water se efficiency or poor knowledge. Economic analyses permit a comparison between the profit that farmers obtain from agricultural products and the cost of adopting specific agricultural techniques. The goal of this study was to evaluate the economic impact of replacing the usual winter fallow with cover crops (barley (Hordeum vulgare L., cv. Vanessa), vetch (Vicia villosa L., cv. Vereda) and rapeseed (Brassica napus L., cv. Licapo)) in irrigated maize systems and variable Mediterranean weather conditions using stochastic Monte-Carlo simulations of key farms' financial performance indicators. The three scenarios studied for each cover crop were: i) just leaving the cover crop residue in the ground, ii) leaving the cover crop residue but reduce following maize fertilization according to the N available from the previous cover crop and iii) selling the cover crop residue for animal feeding. All the scenarios were compared with respect to a typical maize-fallow rotation. With observed data from six different years and in various field trials, looking for different weather conditions, probability distribution functions of maize yield, cover crop biomass production and N fertilizer saving was fitted. Based in statistical sources maize grain price, different forage prices and the cost of fertilizer were fitted to probability distribution functions too. As result, introducing a cover crop involved extra costs with respect to fallow as the initial investment, because new seed, herbicide or extra field operations. Additional

Completion of the 2011 National Land Cover Database for the Conterminous United States – Representing a Decade of Land Cover Change Information

EPA Science Inventory

The National Land Cover Database (NLCD) provides nationwide data on land cover and land cover change at the native 30-m spatial resolution of the Landsat Thematic Mapper (TM). The database is designed to provide five-year cyclical updating of United States land cover and associat...

14 CFR 14.02 - Proceedings covered.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 14 Aeronautics and Space 1 2014-01-01 2014-01-01 false Proceedings covered. 14.02 Section 14.02 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES RULES IMPLEMENTING THE EQUAL ACCESS TO JUSTICE ACT OF 1980 General Provisions § 14.02 Proceedings covered. (a) The...

14 CFR 14.02 - Proceedings covered.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Proceedings covered. 14.02 Section 14.02 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES RULES IMPLEMENTING THE EQUAL ACCESS TO JUSTICE ACT OF 1980 General Provisions § 14.02 Proceedings covered. (a) The...

14 CFR 14.02 - Proceedings covered.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Proceedings covered. 14.02 Section 14.02 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES RULES IMPLEMENTING THE EQUAL ACCESS TO JUSTICE ACT OF 1980 General Provisions § 14.02 Proceedings covered. (a) The...

14 CFR 14.02 - Proceedings covered.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 14 Aeronautics and Space 1 2013-01-01 2013-01-01 false Proceedings covered. 14.02 Section 14.02 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES RULES IMPLEMENTING THE EQUAL ACCESS TO JUSTICE ACT OF 1980 General Provisions § 14.02 Proceedings covered. (a) The...

14 CFR 14.02 - Proceedings covered.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 14 Aeronautics and Space 1 2012-01-01 2012-01-01 false Proceedings covered. 14.02 Section 14.02 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES RULES IMPLEMENTING THE EQUAL ACCESS TO JUSTICE ACT OF 1980 General Provisions § 14.02 Proceedings covered. (a) The...

16 CFR 700.1 - Products covered.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., those agricultural products normally used for personal or household gardening (for example, to produce... 16 Commercial Practices 1 2014-01-01 2014-01-01 false Products covered. 700.1 Section 700.1... MAGNUSON-MOSS WARRANTY ACT INTERPRETATIONS OF MAGNUSON-MOSS WARRANTY ACT § 700.1 Products covered. (a) The...

16 CFR 700.1 - Products covered.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., those agricultural products normally used for personal or household gardening (for example, to produce... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Products covered. 700.1 Section 700.1... MAGNUSON-MOSS WARRANTY ACT INTERPRETATIONS OF MAGNUSON-MOSS WARRANTY ACT § 700.1 Products covered. (a) The...

16 CFR 700.1 - Products covered.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., those agricultural products normally used for personal or household gardening (for example, to produce... 16 Commercial Practices 1 2013-01-01 2013-01-01 false Products covered. 700.1 Section 700.1... MAGNUSON-MOSS WARRANTY ACT INTERPRETATIONS OF MAGNUSON-MOSS WARRANTY ACT § 700.1 Products covered. (a) The...

16 CFR 700.1 - Products covered.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., those agricultural products normally used for personal or household gardening (for example, to produce... 16 Commercial Practices 1 2011-01-01 2011-01-01 false Products covered. 700.1 Section 700.1... MAGNUSON-MOSS WARRANTY ACT INTERPRETATIONS OF MAGNUSON-MOSS WARRANTY ACT § 700.1 Products covered. (a) The...

"Lolita": Genealogy of a Cover Girl

ERIC Educational Resources Information Center

Savage, Shari L.

2015-01-01

At the publication of Vladimir Nabokov's controversial novel "Lolita" (1958), the author insisted that a girl never appear on the cover. This discourse analysis of 185 "Lolita" book covers, most of which feature a girl, considers the genealogy of "Lolita" in relation to representation, myth, and tacit knowledge…

Global, long-term Earth Science Data Records of forest cover, change, and fragmentation from Landsat: the Global Forest Cover Change Project

NASA Astrophysics Data System (ADS)

Sexton, J.; Huang, C.; Channan, S.; Feng, M.; Song, X.; Kim, D.; Song, D.; Vermote, E.; Masek, J.; Townshend, J. R.

2013-12-01

Monitoring, analysis, and management of forests require measurements of forest cover that are both spatio-temporally consistent and resolved globally at sub-hectare resolution. The Global Forest Cover Change project, a cooperation between the University of Maryland Global Land Cover Facility and NASA Goddard Space Flight Center, is providing the first long-term, sub-hectare, globally consistent data records of forest cover, change, and fragmentation in circa-1975, -1990, -2000, and -2005 epochs. These data are derived from the Global Land Survey collection of Landsat images in the respective epochs, atmospherically corrected to surface reflectance in 1990, 2000, and 2005 using the Landsat Ecosystem Disturbance Adaptive Processing System (LEDAPS) implementation of the 6S radiative transfer algorithm, with ancillary information from MODIS Land products, ASTER Global Digital Elevation Model (GDEM), and climatological data layers. Forest cover and change were estimated by a novel continuous-field approach, which produced for the 2000 and 2005 epochs the world's first global, 30-m resolution database of tree cover. Surface reflectance estimates were validated against coincident MODIS measurements, the results of which have been corroborated by subsequent, independent validations against measurements from AERONET sites. Uncertainties in tree- and forest-cover values were estimated in each pixel as a compounding of within-sample uncertainty and accuracy relative to a sample of independent measurements from small-footprint lidar. Accuracy of forest cover and change estimates was further validated relative to expert-interpreted high-resolution imagery, from which unbiased estimates of forest cover and change have been produced at national and eco-regional scales. These first-of-kind Earth Science Data Records--surface reflectance in 1990, 2000, and 2005 and forest cover, change, and fragmentation in and between 1975, 1990, 2000, and 2005--are hosted at native, Landsat

Lake Michigan Diversion Accounting land cover change estimation by use of the National Land Cover Dataset and raingage network partitioning analysis

USGS Publications Warehouse

Sharpe, Jennifer B.; Soong, David T.

2015-01-01

This study used the National Land Cover Dataset (NLCD) and developed an automated process for determining the area of the three land cover types, thereby allowing faster updating of future models, and for evaluating land cover changes by use of historical NLCD datasets. The study also carried out a raingage partitioning analysis so that the segmentation of land cover and rainfall in each modeled unit is directly applicable to the HSPF modeling. Historical and existing impervious, grass, and forest land acreages partitioned by percentages covered by two sets of raingages for the Lake Michigan diversion SCAs, gaged basins, and ungaged basins are presented.

Linking remote sensing, land cover and disease.

PubMed

Curran, P J; Atkinson, P M; Foody, G M; Milton, E J

2000-01-01

Land cover is a critical variable in epidemiology and can be characterized remotely. A framework is used to describe both the links between land cover and radiation recorded in a remotely sensed image, and the links between land cover and the disease carried by vectors. The framework is then used to explore the issues involved when moving from remotely sensed imagery to land cover and then to vector density/disease risk. This exploration highlights the role of land cover; the need to develop a sound knowledge of each link in the predictive sequence; the problematic mismatch between the spatial units of the remotely sensed and epidemiological data and the challenges and opportunities posed by adding a temporal mismatch between the remotely sensed and epidemiological data. The paper concludes with a call for both greater understanding of the physical components of the proposed framework and the utilization of optimized statistical tools as prerequisites to progress in this field.

Satellite assessment of increasing tree cover 1982-2016

NASA Astrophysics Data System (ADS)

Song, X. P.; Hansen, M.

2017-12-01

The Earth's vegetation has undergone dramatic changes as we enter the Anthropocene. Recent studies have quantified global forest cover dynamics and resulting biogeochemical and biophysical impacts to the climate for the post-2000 time period. However, long-term gradual changes in undisturbed forests are less well quantified. We mapped annual tree cover using satellite data and quantified tree cover change during 1982-2016. The dataset was produced by combining optical observations from multiple satellite sensors, including the Advanced Very High Resolution Radiometer, the Moderate Resolution Imaging Spectroradiometer, the Landsat Enhanced Thematic Mapper Plus and various very high spatial resolution sensors. Contrary to current understanding of forest area change, global tree cover increased by 7%. The overall net gain in tree cover is a result of net loss in the tropics overweighed by net gain in the subtropical, temperate and boreal zones. All mountain systems, regardless of climate domain, experienced increases in tree cover. Regional patterns of tree cover gain including eastern United States, eastern Europe and southern China, indicate profound influences of socioeconomic, political or land management changes in shaping long-term environmental change. Results provide the first comprehensive record of global tree cover dynamics over the past four decades and may be used to reduce uncertainties in the quantification of the global carbon cycle.

Consequences of land use and land cover change

USGS Publications Warehouse

Slonecker, E. Terrence; Barnes, Christopher; Karstensen, Krista; Milheim, Lesley E.; Roig-Silva, Coral M.

2013-01-01

The U.S. Geological Survey (USGS) Climate and Land Use Change Mission Area is one of seven USGS mission areas that focuses on making substantial scientific "...contributions to understanding how Earth systems interact, respond to, and cause global change". Using satellite and other remotely sensed data, USGS scientists monitor patterns of land cover change over space and time at regional, national, and global scales. These data are analyzed to understand the causes and consequences of changing land cover, such as economic impacts, effects on water quality and availability, the spread of invasive species, habitats and biodiversity, carbon fluctuations, and climate variability. USGS scientists are among the leaders in the study of land cover, which is a term that generally refers to the vegetation and artificial structures that cover the land surface. Examples of land cover include forests, grasslands, wetlands, water, crops, and buildings. Land use involves human activities that take place on the land. For example, "grass" is a land cover, whereas pasture and recreational parks are land uses that produce a cover of grass.

19 CFR 212.03 - Proceedings covered.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Proceedings covered. 212.03 Section 212.03 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT General Provisions § 212.03 Proceedings covered. (a) The Act...

19 CFR 212.03 - Proceedings covered.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 19 Customs Duties 3 2012-04-01 2012-04-01 false Proceedings covered. 212.03 Section 212.03 Customs... proceeding brought by the Commission upon its own complaint. (c) If a proceeding includes both matters covered by the Act and matters specifically excluded from coverage, any award made will include only fees...

19 CFR 212.03 - Proceedings covered.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 19 Customs Duties 3 2013-04-01 2013-04-01 false Proceedings covered. 212.03 Section 212.03 Customs... proceeding brought by the Commission upon its own complaint. (c) If a proceeding includes both matters covered by the Act and matters specifically excluded from coverage, any award made will include only fees...

19 CFR 212.03 - Proceedings covered.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 19 Customs Duties 3 2014-04-01 2014-04-01 false Proceedings covered. 212.03 Section 212.03 Customs... proceeding brought by the Commission upon its own complaint. (c) If a proceeding includes both matters covered by the Act and matters specifically excluded from coverage, any award made will include only fees...

19 CFR 212.03 - Proceedings covered.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 19 Customs Duties 3 2011-04-01 2011-04-01 false Proceedings covered. 212.03 Section 212.03 Customs... proceeding brought by the Commission upon its own complaint. (c) If a proceeding includes both matters covered by the Act and matters specifically excluded from coverage, any award made will include only fees...

18 CFR 46.5 - Covered entities.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Covered entities. 46.5... FOR PERSONS HOLDING INTERLOCKING POSITIONS § 46.5 Covered entities. Entities to which the general rule..., or a savings and loan association; (b) Any entity which is authorized by law to underwrite or...

18 CFR 46.5 - Covered entities.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Covered entities. 46.5... FOR PERSONS HOLDING INTERLOCKING POSITIONS § 46.5 Covered entities. Entities to which the general rule..., or a savings and loan association; (b) Any entity which is authorized by law to underwrite or...

Flow structure at an ice-covered river confluence

NASA Astrophysics Data System (ADS)

Martel, Nancy; Biron, Pascale; Buffin-Bélanger, Thomas

2017-04-01

River confluences are known to exhibit complex relationships between flow structure, sediment transport and bed-form development. Flow structure at these sites is influenced by the junction angle, the momentum flux ratio (Mr) and bed morphology. In cold regions where an ice cover is present for most of the winter period, the flow structure is also likely affected by the roughness effect of the ice. However, very few studies have examined the impact of an ice cover on the flow structure at a confluence. The aims of this study are (1) to describe the evolution of an ice cover at a river confluence and (2) to characterize and compare the flow structure at a river confluence with and without an ice cover. The field site is a medium-sized confluence (around 40 m wide) between the Mit is and Neigette Rivers in the Bas-Saint-Laurent region, Quebec (Canada). The confluence was selected because a thick ice cover is present for most of the winter allowing for safe field work. Two winter field campaigns were conducted in 2015 and 2016 to obtain ice cover measurements in addition to hydraulic and morphological measurements. Daily monitoring of the evolution of the ice cover was made with a Reconyx camera. Velocity profiles were collected with an acoustic Doppler current profiler (ADCP) to reconstruct the three-dimensional flow structure. Time series of photographs allow the evolution of the ice cover to be mapped, linking the processes leading to the formation of the primary ice cover for each year. The time series suggests that these processes are closely related with both confluence flow zones and hydro-climatic conditions. Results on the thickness of the ice cover from in situ measurements reveal that the ice thickness tends to be thinner at the center of the confluence where high turbulent exchanges take place. Velocity measurements reveal that the ice cover affects velocity profiles by moving the highest velocities towards the center of the profiles. A spatio

Alaska Interim Land Cover Mapping Program; final report

USGS Publications Warehouse

Fitzpatrick-Lins, Katherine; Doughty, E.F.; Shasby, Mark; Benjamin, Susan

1989-01-01

In 1985, the U.S. Geological Survey initiated a research project to develop an interim land cover data base for Alaska as an alternative to the nationwide Land Use and Land Cover Mapping Program. The Alaska Interim Land Cover Mapping Program was subsequently created to develop methods for producing a series of land cover maps that utilized the existing Landsat digital land cover classifications produced by and for the major land management agencies for mapping the vegetation of Alaska. The program was successful in producing digital land cover classifications and statistical summaries using a common statewide classification and in reformatting these data to produce l:250,000-scale quadrangle-based maps directly from the Scitex laser plotter. A Federal and State agency review of these products found considerable user support for the maps. Presently the Geological Survey is committed to digital processing of six to eight quadrangles each year.

EFFECTS OF LANDSCAPE CHARACTERISTICS ON LAND-COVER CLASS ACCURACY

EPA Science Inventory

Utilizing land-cover data gathered as part of the National Land-Cover Data (NLCD) set accuracy assessment, several logistic regression models were formulated to analyze the effects of patch size and land-cover heterogeneity on classification accuracy. Specific land-cover ...

Winter cover crop effect on corn seedling pathogens

USDA-ARS?s Scientific Manuscript database

Cover crops are an excellent management tool to improve the sustainability of agriculture. Winter rye cover crops have been used successfully in Iowa corn-soybean rotations. Unfortunately, winter rye cover crops occasionally reduce yields of the following corn crop. We hypothesize that one potential...

22 CFR 513.220 - Continuation of covered transactions.

Code of Federal Regulations, 2010 CFR

2010-04-01

... and participants shall not renew or extend covered transactions (other than no-cost time extensions... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Continuation of covered transactions. 513.220... Continuation of covered transactions. (a) Notwithstanding the debarment, suspension, proposed debarment under...

Bioactive Potential of Andean Fruits, Seeds, and Tubers.

PubMed

Campos, David; Chirinos, Rosana; Gálvez Ranilla, Lena; Pedreschi, Romina

2018-01-01

The Andes is considered the longest continental mountain range in the world. It covers 7000km long and about 200-700km wide and an average height of about 4000m. Very unique plant species are endemic of this area including fruits (e.g., lucuma, cherimoya, sweet pepino, sauco), roots and tubers (potatoes, sweet potatoes, yacón, chicuru, mashua, olluco, etc.), and seeds (quinoa, amaranth, tarwi, etc.). These crops have been used for centuries by the native population and relatively recently have gained the world attention due to the wide range of nutrients and/or phytochemicals they possess. In this chapter, main Andean fruits, seeds, and roots and tubers have been selected and detailed nutritional and functional information is provided. In addition, traditional and current uses are provided and their bioactive potential is reported based on published scientific literature. © 2018 Elsevier Inc. All rights reserved.

45 CFR 160.310 - Responsibilities of covered entities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Responsibilities of covered entities. 160.310... Responsibilities of covered entities. (a) Provide records and compliance reports. A covered entity must keep such... entity has complied or is complying with the applicable administrative simplification provisions. (b...

45 CFR 160.310 - Responsibilities of covered entities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 1 2011-10-01 2011-10-01 false Responsibilities of covered entities. 160.310... Responsibilities of covered entities. (a) Provide records and compliance reports. A covered entity must keep such... entity has complied or is complying with the applicable administrative simplification provisions. (b...

Patterns of crop cover under future climates.

PubMed

Porfirio, Luciana L; Newth, David; Harman, Ian N; Finnigan, John J; Cai, Yiyong

2017-04-01

We study changes in crop cover under future climate and socio-economic projections. This study is not only organised around the global and regional adaptation or vulnerability to climate change but also includes the influence of projected changes in socio-economic, technological and biophysical drivers, especially regional gross domestic product. The climatic data are obtained from simulations of RCP4.5 and 8.5 by four global circulation models/earth system models from 2000 to 2100. We use Random Forest, an empirical statistical model, to project the future crop cover. Our results show that, at the global scale, increases and decreases in crop cover cancel each other out. Crop cover in the Northern Hemisphere is projected to be impacted more by future climate than the in Southern Hemisphere because of the disparity in the warming rate and precipitation patterns between the two Hemispheres. We found that crop cover in temperate regions is projected to decrease more than in tropical regions. We identified regions of concern and opportunities for climate change adaptation and investment.

42 CFR 6.4 - Covered individuals.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Covered individuals. 6.4 Section 6.4 Public Health... COVERAGE OF CERTAIN GRANTEES AND INDIVIDUALS § 6.4 Covered individuals. (a) Officers and employees of a... if they meet the requirements of section 224(g)(5) of the Act. (c) An individual physician or other...

10 CFR 5.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 1 2011-01-01 2011-01-01 false Notice of covered programs. 5.600 Section 5.600 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES... shall periodically republish the notice of covered programs to reflect changes in covered programs...

10 CFR 5.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 1 2014-01-01 2014-01-01 false Notice of covered programs. 5.600 Section 5.600 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES... shall periodically republish the notice of covered programs to reflect changes in covered programs...

10 CFR 5.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Notice of covered programs. 5.600 Section 5.600 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES... shall periodically republish the notice of covered programs to reflect changes in covered programs...

10 CFR 5.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 1 2013-01-01 2013-01-01 false Notice of covered programs. 5.600 Section 5.600 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES... shall periodically republish the notice of covered programs to reflect changes in covered programs...

10 CFR 5.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 1 2012-01-01 2012-01-01 false Notice of covered programs. 5.600 Section 5.600 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES... shall periodically republish the notice of covered programs to reflect changes in covered programs...

Land Cover Indicators for U.S. National Climate Assessments

NASA Astrophysics Data System (ADS)

Channan, S.; Thomson, A. M.; Collins, K. M.; Sexton, J. O.; Torrens, P.; Emanuel, W. R.

2014-12-01

Land is a critical resource for human habitat and for the vast majority of human activities. Many natural resources are derived from terrestrial ecosystems or otherwise extracted from the landscape. Terrestrial biodiversity depends on land attributes as do people's perceptions of the value of land, including its value for recreation or tourism. Furthermore, land surface properties and processes affect weather and climate, and land cover change and land management affect emissions of greenhouse gases. Thus, land cover with its close association with climate is so pervasive that a land cover indicator is of fundamental importance to U.S. national climate assessments and related research. Moderate resolution remote sensing products (MODIS) were used to provide systematic data on annual distributions of land cover over the period 2001-2012. Selected Landsat observations and data products further characterize land cover at higher resolution. Here we will present the prototype for a suite of land cover indicators including land cover maps as well as charts depicting attributes such as composition by land cover class, statistical indicators of landscape characteristics, and tabular data summaries indispensable for communicating the status and trends of U.S. land cover at national, regional and state levels.

[Cover motifs of the Tidsskrift. A 14-year cavalcade].

PubMed

Nylenna, M

1998-12-10

In 1985 the Journal of the Norwegian Medical Association changed its cover policy, moving the table of contents inside the Journal and introducing cover illustrations. This article provides an analysis of all cover illustrations published over this 14-year period, 420 covers in all. There is a great variation in cover motifs and designs and a development towards more general motifs. The initial emphasis on historical and medical aspects is now less pronounced, while the use of works of art and nature motifs has increased, and the cover now more often has a direct bearing on the specific contents of the issue. Professor of medical history Oivind Larsen has photographed two thirds of the covers and contributed 95% of the inside essay-style reflections on the cover motif. Over the years, he has expanded the role of the historian of medicine disseminating knowledge to include that of the raconteur with a personal tone of voice. The Journal's covers are now one of its most characteristic features, emblematic of the Journal's ambition of standing for quality and timelessness vis-à-vis the news media, and of its aim of bridging the gap between medicine and the humanities.

Effect of litter, leaf cover and cover of basal internodes of the dominant species Molinia caerulea on seedling recruitment and established vegetation

NASA Astrophysics Data System (ADS)

Janeček, Štěpán; Lepš, Jan

2005-09-01

The effects of litter removal, leaf cover of established plants and cover of basal internodes of a dominant species Molinia caerulea on seedling germination and the dynamics of established plants were studied in a field experiment in an oligotrophic wet meadow. Although the negative influence of litter on total seedling number and seedling species composition was non-significant, litter significantly affected the dynamics of the established vegetation and caused inhibition of total leaf cover development. The effects of total leaf cover of established plants on seedling establishment changed during the vegetation season. Whereas the effect of total leaf cover was positive at the start and in the middle of the vegetation season, at the end the total leaf cover negatively affected seedling establishment. Both total leaf cover and cover of basal internodes affected seedling composition. Effects of these two variables were statistically separable suggesting that they are based on different mechanisms. The response of seedling establishment to these factors was species specific and, consequently, our data support the hypothesis that that biotically generated spatial heterogeneity can promote species co-existence through the differentiation of species regeneration niches.

Preheating Water In The Covers Of Solar Water Heaters

NASA Technical Reports Server (NTRS)

Bhandari, Pradeep

1995-01-01

Solar water heaters that include glass covers over absorber plates redesigned to increase efficiencies according to proposal. Redesign includes modification of single-layer glass cover into double-layer glass cover and addition of plumbing so cool water to be heated made to flow between layers of cover before entering absorber plate.

29 CFR 36.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 1 2014-07-01 2013-07-01 true Notice of covered programs. 36.600 Section 36.600 Labor Office of the Secretary of Labor NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

29 CFR 36.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 29 Labor 1 2013-07-01 2013-07-01 false Notice of covered programs. 36.600 Section 36.600 Labor Office of the Secretary of Labor NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

29 CFR 36.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Notice of covered programs. 36.600 Section 36.600 Labor Office of the Secretary of Labor NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

29 CFR 36.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 1 2012-07-01 2012-07-01 false Notice of covered programs. 36.600 Section 36.600 Labor Office of the Secretary of Labor NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

29 CFR 36.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 29 Labor 1 2011-07-01 2011-07-01 false Notice of covered programs. 36.600 Section 36.600 Labor Office of the Secretary of Labor NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

Differences in breeding bird assemblages related to reed canary grass cover cover and forest structure on the Upper Mississippi River

USGS Publications Warehouse

Kirsch, Eileen M.; Gray, Brian R.

2017-01-01

Floodplain forest of the Upper Mississippi River provides habitat for an abundant and diverse breeding bird community. However, reed canary grass Phalaris arundinacea invasion is a serious threat to the future condition of this forest. Reed canary grass is a well-known aggressive invader of wetland systems in the northern tier states of the conterminous United States. Aided by altered flow regimes and nutrient inputs from agriculture, reed canary grass has formed dense stands in canopy gaps and forest edges, retarding tree regeneration. We sampled vegetation and breeding birds in Upper Mississippi River floodplain forest edge and interior areas to 1) measure reed canary grass cover and 2) evaluate whether the breeding bird assemblage responded to differences in reed canary grass cover. Reed canary grass was found far into forest interiors, and its cover was similar between interior and edge sites. Bird assemblages differed between areas with more or less reed canary grass cover (.53% cover breakpoint). Common yellowthroat Geothlypis trichas, black-capped chickadee Parus atricapillus, and rose-breasted grosbeak Pheucticus ludovicianus were more common and American redstart Setophaga ruticilla, great crested flycatcher Myiarchus crinitus, and Baltimore oriole Icterus galbula were less common in sites with more reed canary grass cover. Bird diversity and abundance were similar between sites with different reed canary grass cover. A stronger divergence in bird assemblages was associated with ground cover ,15%, resulting from prolonged spring flooding. These sites hosted more prothonotary warbler Protonotaria citrea, but they had reduced bird abundance and diversity compared to other sites. Our results indicate that frequently flooded sites may be important for prothonotary warblers and that bird assemblages shift in response to reed canary grass invasion.

Accuracy assessment of percent canopy cover, cover type, and size class

Treesearch

H. T. Schreuder; S. Bain; R. C. Czaplewski

2003-01-01

Truth for vegetation cover percent and type is obtained from very large-scale photography (VLSP), stand structure as measured by size classes, and vegetation types from a combination of VLSP and ground sampling. We recommend using the Kappa statistic with bootstrap confidence intervals for overall accuracy, and similarly bootstrap confidence intervals for percent...

Development of a 30 m Spatial Resolution Land Cover of Canada: Contribution to the Harmonized North America Land Cover Dataset

NASA Astrophysics Data System (ADS)

Pouliot, D.; Latifovic, R.; Olthof, I.

2017-12-01

Land cover is needed for a large range of environmental applications regarding climate impacts and adaption, emergency response, wildlife habitat, air quality, water yield, etc. In Canada a 2008 user survey revealed that the most practical scale for provision of land cover data is 30 m, nationwide, with an update frequency of five years (Ball, 2008). In response to this need the Canada Centre for Remote Sensing has generated a 30 m land cover of Canada for the base year 2010 as part of a planned series of maps at the recommended five year update frequency. This land cover is the Canadian contribution to the North American Land Change Monitoring System initiative, which seeks to provide harmonized land cover across Canada, the United States, and Mexico. The methodology developed in this research utilized a combination of unsupervised and machine learning techniques to map land cover, blend results between mapping units, locally optimize results, and process some thematic attributes with specific features sets. Accuracy assessment with available field data shows it was on average 75% for the five study areas assessed. In this presentation an overview of the unique processing aspects, example results, and initial accuracy assessment will be discussed.

Live Load Testing of Historic Covered Timber Bridges

Treesearch

Travis Hosteng; James Wacker; Brent Phares

2013-01-01

The National Historic Covered Bridge Preservation Program (NHCBP), sponsored by the Federal Highway Administration (FHWA), is intended to preserve covered timber bridge structures nationwide. Today, less than 700 covered timber bridges still exist in the United States and of those many are closed to vehicular traffic. Furthermore, a large percentage of the remaining...

Partially covered metal stents have longer patency than uncovered and fully covered metal stents in the management of distal malignant biliary obstruction: a retrospective study.

PubMed

Yokota, Yudai; Fukasawa, Mitsuharu; Takano, Shinichi; Kadokura, Makoto; Shindo, Hiroko; Takahashi, Ei; Hirose, Sumio; Kawakami, Satoshi; Fukasawa, Yoshimitsu; Sato, Tadashi; Enomoto, Nobuyuki

2017-10-11

Self-expandable metal stents (SEMSs) are widely used for malignant biliary obstructions. Nitinol-covered SEMSs have been developed to improve stent patency. Currently, SEMSs may be uncovered, partially covered, or fully covered; however, there is no consensus on the best stent type for the management of malignant distal biliary obstruction (MDBO). Patients with unresectable MDBO receiving SEMS (Wallflex™) were retrospectively analyzed. Time to recurrent biliary obstruction (TRBO) and survival time were compared among the three types of SEMSs. Univariate and multivariate analyses were performed to identify risk factors for stent dysfunction. In total, 101 patients received SEMSs for unresectable MDBO (44 uncovered, 28 partially covered, and 29 fully covered SEMSs). Median survival time was 200, 168, and 276 days in the uncovered, partially covered, and fully covered SEMSs groups, respectively. There were no differences in survival among the three groups. Median TRBO was 199, 444, and 194 days in the uncovered, partially covered, and fully covered SEMSs groups, respectively. Partially covered SEMSs had longer TRBO than uncovered (p = 0.013) and fully covered (p = 0.010) SEMSs. Tumor ingrowth occurred only with uncovered SEMSs and stent migration occurred only with fully covered SEMSs. Multivariate analyses confirmed that partially covered SEMSs have lower risk of dysfunction. Partially covered SEMSs with a proximal uncovered flared end have longer patency than uncovered and fully covered SEMSs by preventing tumor ingrowth and stent migration.

Monitoring Areal Snow Cover Using NASA Satellite Imagery

NASA Technical Reports Server (NTRS)

Harshburger, Brian J.; Blandford, Troy; Moore, Brandon

2011-01-01

The objective of this project is to develop products and tools to assist in the hydrologic modeling process, including tools to help prepare inputs for hydrologic models and improved methods for the visualization of streamflow forecasts. In addition, this project will facilitate the use of NASA satellite imagery (primarily snow cover imagery) by other federal and state agencies with operational streamflow forecasting responsibilities. A GIS software toolkit for monitoring areal snow cover extent and producing streamflow forecasts is being developed. This toolkit will be packaged as multiple extensions for ArcGIS 9.x and an opensource GIS software package. The toolkit will provide users with a means for ingesting NASA EOS satellite imagery (snow cover analysis), preparing hydrologic model inputs, and visualizing streamflow forecasts. Primary products include a software tool for predicting the presence of snow under clouds in satellite images; a software tool for producing gridded temperature and precipitation forecasts; and a suite of tools for visualizing hydrologic model forecasting results. The toolkit will be an expert system designed for operational users that need to generate accurate streamflow forecasts in a timely manner. The Remote Sensing of Snow Cover Toolbar will ingest snow cover imagery from multiple sources, including the MODIS Operational Snowcover Data and convert them to gridded datasets that can be readily used. Statistical techniques will then be applied to the gridded snow cover data to predict the presence of snow under cloud cover. The toolbar has the ability to ingest both binary and fractional snow cover data. Binary mapping techniques use a set of thresholds to determine whether a pixel contains snow or no snow. Fractional mapping techniques provide information regarding the percentage of each pixel that is covered with snow. After the imagery has been ingested, physiographic data is attached to each cell in the snow cover image. This data

Urban Youth Knowledge and Attitudes Regarding Lead Poisoning.

PubMed

Bogar, Sandra; Szabo, Aniko; Woodruff, Shane; Johnson, Sheri

2017-12-01

Environmental health literacy (EHL) is a promising and evolving field of research that could benefit from youth engagement. Yet studies focused on youths' environmental health awareness and concerns are limited. For example, although lead exposure remains a threat to youth development in urban environments, no published studies have measured urban youth's knowledge of lead poisoning. A CBPR partnership established a youth advisory council (YAC) who helped to design, interpret and disseminate a mixed methods study exploring environmental health perceptions among urban youths ages 10-18. Surveys assessed awareness, attitudes, and knowledge regarding lead poisoning and five environmental health issues determined by the YAC. Focus group questions further contextualized youths' lead knowledge and understanding of youths' environmental health concerns. A majority of youth could identify specific sources of lead exposure but had minimal knowledge of prevention strategies, and focus group data revealed misinformation regarding lead sources and consequences. Survey and focus group respondents' level of awareness and concern regarding YAC-selected EH issues was high in comparison to lead poisoning. In particular, job opportunities and police brutality were endorsed as both neighborhood concerns and priorities. Awareness and knowledge of environmental health issues among urban youth have not been well described. These findings reinforce the importance of addressing problems of local relevance. Moving forward, lead poisoning prevention education for youth and youth EHL partnerships may benefit from incorporating an ecological approach wherein connections to the social and economic context are made explicit.

The potential of cover crops for improving soil function

NASA Astrophysics Data System (ADS)

Stoate, Chris; Crotty, Felicity

2017-04-01

Cover crops can be grown over the autumn and winter ensuring green cover throughout the year. They have been described as improving soil structure, reducing soil erosion and potentially even a form of grass weed control. These crops retain nutrients within the plant, potentially making them available for future crops, as well as increasing soil organic matter. Over the last three years, we have investigated how different cover crop regimes affect soil quality. Three separate experiments over each autumn/winter period have investigated how different cover crops affect soil biology, physics and chemistry, with each experiment building on the previous one. There have been significant effects of cover crops on soil structure, as well as significantly lower weed biomass and increased yields in the following crop - in comparison to bare stubble. For example, the effect of drilling the cover crops on soil structure in comparison to a bare stubble control that had not been driven on by machinery was quantified, and over the winter period the soil structure of the cover crop treatments changed, with compaction reduced in the cover crop treatments, whilst the bare stubble control remained unchanged. Weeds were found in significantly lower biomass in the cover crop mixes in comparison to the bare stubble control, and significantly lower weed biomass continued to be found in the following spring oat crop where the cover crops had been, indicating a weed suppressive effect that has a continued legacy in the following crop. The following spring oats have shown similar results in the last two years, with higher yields in the previous cover crop areas compared to the bare stubble controls. Overall, these results are indicating that cover crops have the potential to provide improvements to soil quality, reduce weeds and improve yields. We discuss the economic implications.

Covering All Options

ERIC Educational Resources Information Center

Kennedy, Mike

2011-01-01

The day a school opens its doors for the first time, the flooring will be new and untarnished. When the flooring is in such pristine condition, many flooring materials--carpeting, vinyl, terrazzo, wood or some other surface--will look good. But school and university planners who decide what kind of material covers the floors of their facilities…

Monitoring urban land cover change by updating the national land cover database impervious surface products

USGS Publications Warehouse

Xian, George Z.; Homer, Collin G.

2009-01-01

The U.S. Geological Survey (USGS) National Land Cover Database (NLCD) 2001 is widely used as a baseline for national land cover and impervious conditions. To ensure timely and relevant data, it is important to update this base to a more recent time period. A prototype method was developed to update the land cover and impervious surface by individual Landsat path and row. This method updates NLCD 2001 to a nominal date of 2006 by using both Landsat imagery and data from NLCD 2001 as the baseline. Pairs of Landsat scenes in the same season from both 2001 and 2006 were acquired according to satellite paths and rows and normalized to allow calculation of change vectors between the two dates. Conservative thresholds based on Anderson Level I land cover classes were used to segregate the change vectors and determine areas of change and no-change. Once change areas had been identified, impervious surface was estimated for areas of change by sampling from NLCD 2001 in unchanged areas. Methods were developed and tested across five Landsat path/row study sites that contain a variety of metropolitan areas. Results from the five study areas show that the vast majority of impervious surface changes associated with urban developments were accurately captured and updated. The approach optimizes mapping efficiency and can provide users a flexible method to generate updated impervious surface at national and regional scales.

Evaluating the national land cover database tree canopy and impervious cover estimates across the conterminous United States: a comparison with photo-interpreted estimates

Treesearch

David J. Nowak; Eric J. Greenfield

2010-01-01

The 2001 National Land Cover Database (NLCD) provides 30-m resolution estimates of percentage tree canopy and percentage impervious cover for the conterminous United States. Previous estimates that compared NLCD tree canopy and impervious cover estimates with photo-interpreted cover estimates within selected counties and places revealed that NLCD underestimates tree...

Production of a yeast artificial chromosome for stable expression of a synthetic xylose isomerase-xylulokinase polyprotein in a fuel ethanol yeast strain

USDA-ARS?s Scientific Manuscript database

Commercialization of fuel ethanol production from lignocellulosic biomass has focused on engineering the glucose-fermenting industrial yeast Saccharomyces cerevisiae to utilize pentose sugars. A yeast artificial chromosome (YAC) was engineered to contain a polyprotein gene construct expressing xylos...

29 CFR 4.110 - What contracts are covered.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true What contracts are covered. 4.110 Section 4.110 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Covered Contracts Generally § 4.110 What contracts are covered. The Act...

29 CFR 4.110 - What contracts are covered.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 1 2014-07-01 2013-07-01 true What contracts are covered. 4.110 Section 4.110 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Covered Contracts Generally § 4.110 What contracts are covered. The Act...

Enhanced Cover Assessment Project:Soil Manipulation and Revegetation Tests

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waugh, W. Joseph; Albright, Dr. Bill; Benson, Dr. Craig

2014-02-01

The U.S. Department of Energy Office of Legacy Management is evaluating methods to enhance natural changes that are essentially converting conventional disposal cell covers for uranium mill tailings into water balance covers. Conventional covers rely on a layer of compacted clayey soil to limit exhalation of radon gas and percolation of rainwater. Water balance covers rely on a less compacted soil “sponge” to store rainwater, and on soil evaporation and plant transpiration (evapotranspiration) to remove stored water and thereby limit percolation. Over time, natural soil-forming and ecological processes are changing conventional covers by increasing hydraulic conductivity, loosening compaction, and increasingmore » evapotranspiration. The rock armor on conventional covers creates a favorable habitat for vegetation by slowing soil evaporation, increasing soil water storage, and trapping dust and organic matter, thereby providing the water and nutrients needed for plant germination, survival, and sustainable transpiration. Goals and Objectives Our overall goal is to determine if allowing or enhancing these natural changes could improve cover performance and reduce maintenance costs over the long term. This test pad study focuses on cover soil hydrology and ecology. Companion studies are evaluating effects of natural and enhanced changes in covers on radon attenuation, erosion, and biointrusion. We constructed a test cover at the Grand Junction disposal site to evaluate soil manipulation and revegetation methods. The engineering design, construction, and properties of the test cover match the upper three layers of the nearby disposal cell cover: a 1-foot armoring of rock riprap, a 6-inch bedding layer of coarse sand and gravel, and a 2-foot protection layer of compacted fine soil. The test cover does not have a radon barrier—cover enhancement tests leave the radon barrier intact. We tested furrowing and ripping as means for creating depressions parallel to the

Tree Cover Mapping Tool—Documentation and user manual

USGS Publications Warehouse

Cotillon, Suzanne E.; Mathis, Melissa L.

2016-06-02

The Tree Cover Mapping (TCM) tool was developed by scientists at the U.S. Geological Survey Earth Resources Observation and Science Center to allow a user to quickly map tree cover density over large areas using visual interpretation of high resolution imagery within a geographic information system interface. The TCM tool uses a systematic sample grid to produce maps of tree cover. The TCM tool allows the user to define sampling parameters to estimate tree cover within each sample unit. This mapping method generated the first on-farm tree cover maps of vast regions of Niger and Burkina Faso. The approach contributes to implementing integrated landscape management to scale up re-greening and restore degraded land in the drylands of Africa. The TCM tool is easy to operate, practical, and can be adapted to many other applications such as crop mapping, settlements mapping, or other features. This user manual provides step-by-step instructions for installing and using the tool, and creating tree cover maps. Familiarity with ArcMap tools and concepts is helpful for using the tool.

Mathematical Foundation for Plane Covering Using Hexagons

NASA Technical Reports Server (NTRS)

Johnson, Gordon G.

1999-01-01

This work is to indicate the development and mathematical underpinnings of the algorithms previously developed for covering the plane and the addressing of the elements of the covering. The algorithms are of interest in that they provides a simple systematic way of increasing or decreasing resolution, in the sense that if we have the covering in place and there is an image superimposed upon the covering, then we may view the image in a rough form or in a very detailed form with minimal effort. Such ability allows for quick searches of crude forms to determine a class in which to make a detailed search. In addition, the addressing algorithms provide an efficient way to process large data sets that have related subsets. The algorithms produced were based in part upon the work of D. Lucas "A Multiplication in N Space" which suggested a set of three vectors, any two of which would serve as a bases for the plane and also that the hexagon is the natural geometric object to be used in a covering with a suggested bases. The second portion is a refinement of the eyeball vision system, the globular viewer.

The Thermal Collector With Varied Glass Covers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luminosu, I.; Pop, N.

2010-08-04

The thermal collector with varied glass covers represents an innovation realized in order to build a collector able to reach the desired temperature by collecting the solar radiation from the smallest surface, with the highest efficiency. In the case of the thermal collector with variable cover glasses, the number of the glass plates covering the absorber increases together with the length of the circulation pipe for the working fluid. The thermal collector with varied glass covers compared to the conventional collector better meet user requirements because: for the same temperature increase, has the collecting area smaller; for the same collectionmore » area, realizes the highest temperature increase and has the highest efficiency. This works is addressed to researchers in the solar energy and to engineers responsible with air-conditioning systems design or industrial and agricultural products drying.« less

The Thermal Collector With Varied Glass Covers

NASA Astrophysics Data System (ADS)

Luminosu, I.; Pop, N.

2010-08-01

The thermal collector with varied glass covers represents an innovation realized in order to build a collector able to reach the desired temperature by collecting the solar radiation from the smallest surface, with the highest efficiency. In the case of the thermal collector with variable cover glasses, the number of the glass plates covering the absorber increases together with the length of the circulation pipe for the working fluid. The thermal collector with varied glass covers compared to the conventional collector better meet user requirements because: for the same temperature increase, has the collecting area smaller; for the same collection area, realizes the highest temperature increase and has the highest efficiency. This works is addressed to researchers in the solar energy and to engineers responsible with air-conditioning systems design or industrial and agricultural products drying.

17 CFR 249.11 - Form R31 for reporting covered sales and covered round turn transactions under section 31 of the...

Code of Federal Regulations, 2013 CFR

2013-04-01

... sales and covered round turn transactions under section 31 of the Act. 249.11 Section 249.11 Commodity... Securities Exchanges § 249.11 Form R31 for reporting covered sales and covered round turn transactions under... number of round turn transactions in security futures that occurred on the exchange, had a charge date in...

17 CFR 249.11 - Form R31 for reporting covered sales and covered round turn transactions under section 31 of the...

Code of Federal Regulations, 2010 CFR

2010-04-01

... sales and covered round turn transactions under section 31 of the Act. 249.11 Section 249.11 Commodity... Securities Exchanges § 249.11 Form R31 for reporting covered sales and covered round turn transactions under... number of round turn transactions in security futures that occurred on the exchange, had a charge date in...

17 CFR 249.11 - Form R31 for reporting covered sales and covered round turn transactions under section 31 of the...

Code of Federal Regulations, 2012 CFR

2012-04-01

... sales and covered round turn transactions under section 31 of the Act. 249.11 Section 249.11 Commodity... Securities Exchanges § 249.11 Form R31 for reporting covered sales and covered round turn transactions under... number of round turn transactions in security futures that occurred on the exchange, had a charge date in...

17 CFR 249.11 - Form R31 for reporting covered sales and covered round turn transactions under section 31 of the...

Code of Federal Regulations, 2011 CFR

2011-04-01

... sales and covered round turn transactions under section 31 of the Act. 249.11 Section 249.11 Commodity... Securities Exchanges § 249.11 Form R31 for reporting covered sales and covered round turn transactions under... number of round turn transactions in security futures that occurred on the exchange, had a charge date in...

17 CFR 249.11 - Form R31 for reporting covered sales and covered round turn transactions under section 31 of the...

Code of Federal Regulations, 2014 CFR

2014-04-01

... sales and covered round turn transactions under section 31 of the Act. 249.11 Section 249.11 Commodity... Securities Exchanges § 249.11 Form R31 for reporting covered sales and covered round turn transactions under... number of round turn transactions in security futures that occurred on the exchange, had a charge date in...

Process for assembly and transformation into Saccharomyces cerevisiae of a synthetic yeast artificial chromosome containing a multigene cassette to express enzymes that enhance xylose utilization designed for an automated pla

USDA-ARS?s Scientific Manuscript database

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...

Some new worldwide cloud-cover models

NASA Technical Reports Server (NTRS)

Bean, S. J.; Somerville, P. N.

1981-01-01

Using daily measurements of day and night infrared, and incoming and absorbed solar radiation obtained from a Tiros satellite over a period of approximately 45 months, and integrated over 2.5 deg latitude-longitude grids, the proportion of cloud cover over each grid each day was derived for the entire period. For each of four 3-month periods, for each grid location, estimates a and b of the two parameters of the best-fit beta distribution were obtained. The (a, b) plane was divided into a number of regions. All the geographical locations whose (a, b) estimates were in the same region in the (a, b) plane were said to have the same cloud cover type for that season. For each season, the world is thus divided into separate cloud-cover types.

Estimating The Effect of Biofuel on Land Cover Change Using Multi-Year Modis Land Cover Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Nagendra; Bhaduri, Budhendra L

2010-01-01

There has been a growing debate on the effects of the increase in demands of biofuels on land use land cover (LULC) change with apprehension in some quarters that the growing demand for bioenergy as a clean fuel will result in widespread direct and indirect LULC change. However estimating both direct and indirect LULC change is challenging and will require development of accurate high frequency, high resolution (temporal and spatial) land use land cover data as well as new LULC models which can be used to locate, quantify and predict these changes. To assess whether the demand for biofuel hasmore » caused significant LULC we used MODIS land cover data (MCD12Q1) from 2001 to 2008 along with cropland data layer (CDL) to estimate cropland and grassland changes in United States for the years 2002-2008 as well as its correlation with biofuel growth.« less

MODIS land cover uncertainty in regional climate simulations

NASA Astrophysics Data System (ADS)

Li, Xue; Messina, Joseph P.; Moore, Nathan J.; Fan, Peilei; Shortridge, Ashton M.

2017-12-01

MODIS land cover datasets are used extensively across the climate modeling community, but inherent uncertainties and associated propagating impacts are rarely discussed. This paper modeled uncertainties embedded within the annual MODIS Land Cover Type (MCD12Q1) products and propagated these uncertainties through the Regional Atmospheric Modeling System (RAMS). First, land cover uncertainties were modeled using pixel-based trajectory analyses from a time series of MCD12Q1 for Urumqi, China. Second, alternative land cover maps were produced based on these categorical uncertainties and passed into RAMS. Finally, simulations from RAMS were analyzed temporally and spatially to reveal impacts. Our study found that MCD12Q1 struggles to discriminate between grasslands and croplands or grasslands and barren in this study area. Such categorical uncertainties have significant impacts on regional climate model outputs. All climate variables examined demonstrated impact across the various regions, with latent heat flux affected most with a magnitude of 4.32 W/m2 in domain average. Impacted areas were spatially connected to locations of greater land cover uncertainty. Both biophysical characteristics and soil moisture settings in regard to land cover types contribute to the variations among simulations. These results indicate that formal land cover uncertainty analysis should be included in MCD12Q1-fed climate modeling as a routine procedure.

Tree and impervious cover in the United States

Treesearch

David J. Nowak; Eric J. Greenfield

2012-01-01

Using aerial photograph interpretation of circa 2005 imagery, percent tree canopy and impervious surface cover in the conterminous United States are estimated at 34.2% (standard error (SE) = 0.2%) and 2.4% (SE = 0.1%), respectively. Within urban/community areas, percent tree cover (35.1%, SE = 0.4%) is similar to the national value, but percent impervious cover is...

Transcriptome changes associated with Tomato spotted wilt virus infection in various life stages of its thrips vector, Frankliniella fusca (Hinds).

PubMed

Shrestha, Anita; Champagne, Donald E; Culbreath, Albert K; Rotenberg, Dorith; Whitfield, Anna E; Srinivasan, Rajagopalbabu

2017-08-01

Persistent propagative viruses maintain intricate interactions with their arthropod vectors. In this study, we investigated the transcriptome-level responses associated with a persistent propagative phytovirus infection in various life stages of its vector using an Illumina HiSeq sequencing platform. The pathosystem components included a Tospovirus, Tomato spotted wilt virus (TSWV), its insect vector, Frankliniella fusca (Hinds), and a plant host, Arachis hypogaea (L.). We assembled (de novo) reads from three developmental stage groups of virus-exposed and non-virus-exposed F. fusca into one transcriptome consisting of 72 366 contigs and identified 1161 differentially expressed (DE) contigs. The number of DE contigs was greatest in adults (female) (562) when compared with larvae (first and second instars) (395) and pupae (pre- and pupae) (204). Upregulated contigs in virus-exposed thrips had blastx annotations associated with intracellular transport and virus replication. Upregulated contigs were also assigned blastx annotations associated with immune responses, including apoptosis and phagocytosis. In virus-exposed larvae, Blast2GO analysis identified functional groups, such as multicellular development with downregulated contigs, while reproduction, embryo development and growth were identified with upregulated contigs in virus-exposed adults. This study provides insights into differences in transcriptome-level responses modulated by TSWV in various life stages of an important vector, F. fusca.

Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw.

PubMed

Jose, V Lyju; Appoothy, Thulasi; More, Ravi P; Arun, A Sha

2017-12-01

The rumen is a unique natural habitat, exhibiting an unparalleled genetic resource of fibrolytic enzymes of microbial origin that degrade plant polysaccharides. The objectives of this study were to identify the principal plant cell wall-degrading enzymes and the taxonomic profile of rumen microbial communities that are associated with it. The cattle rumen microflora and the carbohydrate-active enzymes were functionally classified through a whole metagenomic sequencing approach. Analysis of the assembled sequences by the Carbohydrate-active enzyme analysis Toolkit identified the candidate genes encoding fibrolytic enzymes belonging to different classes of glycoside hydrolases(11,010 contigs), glycosyltransferases (6366 contigs), carbohydrate esterases (4945 contigs), carbohydrate-binding modules (1975 contigs), polysaccharide lyases (480 contigs), and auxiliary activities (115 contigs). Phylogenetic analysis of CAZyme encoding contigs revealed that a significant proportion of CAZymes were contributed by bacteria belonging to genera Prevotella, Bacteroides, Fibrobacter, Clostridium, and Ruminococcus. The results indicated that the cattle rumen microbiome and the CAZymes are highly complex, structurally similar but compositionally distinct from other ruminants. The unique characteristics of rumen microbiota and the enzymes produced by resident microbes provide opportunities to improve the feed conversion efficiency in ruminants and serve as a reservoir of industrially important enzymes for cellulosic biofuel production.

Mapping Surface Cover Parameters Using Aggregation Rules and Remotely Sensed Cover Classes. Version 1.9

NASA Technical Reports Server (NTRS)

Arain, Altaf M.; Shuttleworth, W. James; Yang, Z-Liang; Michaud, Jene; Dolman, Johannes

1997-01-01

A coupled model, which combines the Biosphere-Atmosphere Transfer Scheme (BATS) with an advanced atmospheric boundary-layer model, was used to validate hypothetical aggregation rules for BATS-specific surface cover parameters. The model was initialized and tested with observations from the Anglo-Brazilian Amazonian Climate Observational Study and used to simulate surface fluxes for rain forest and pasture mixes at a site near Manaus in Brazil. The aggregation rules are shown to estimate parameters which give area-average surface fluxes similar to those calculated with explicit representation of forest and pasture patches for a range of meteorological and surface conditions relevant to this site, but the agreement deteriorates somewhat when there are large patch-to-patch differences in soil moisture. The aggregation rules, validated as above, were then applied to remotely sensed 1 km land cover data set to obtain grid-average values of BATS vegetation parameters for 2.8 deg x 2.8 deg and 1 deg x 1 deg grids within the conterminous United States. There are significant differences in key vegetation parameters (aerodynamic roughness length, albedo, leaf area index, and stomatal resistance) when aggregate parameters are compared to parameters for the single, dominant cover within the grid. However, the surface energy fluxes calculated by stand-alone BATS with the 2-year forcing, data from the International Satellite Land Surface Climatology Project (ISLSCP) CDROM were reasonably similar using aggregate-vegetation parameters and dominant-cover parameters, but there were some significant differences, particularly in the western USA.

49 CFR 179.103-2 - Manway cover.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) SPECIFICATIONS FOR TANK CARS Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.103-2 Manway cover. (a) The manway cover...

49 CFR 179.103-2 - Manway cover.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) SPECIFICATIONS FOR TANK CARS Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.103-2 Manway cover. (a) The manway cover...

49 CFR 179.103-2 - Manway cover.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) SPECIFICATIONS FOR TANK CARS Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.103-2 Manway cover. (a) The manway cover...

5 CFR 352.304 - International organizations covered.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false International organizations covered. 352... REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.304 International organizations covered. (a) An agency may detail or transfer an employee under this subpart...

Development of integral covers on solar cells

NASA Technical Reports Server (NTRS)

Stella, P.; Somberg, H.

1971-01-01

The electron-beam technique for evaporating a dielectric material onto solar cells is investigated. A process has been developed which will provide a highly transparent, low stress, 2 mil thick cover capable of withstanding conventional space type qualification tests including humidity, thermal shock, and thermal cycling. The covers have demonstrated the ability to withstand 10 to the 15th power 1 MeV electrons and UV irradiation with minor darkening. Investigation of the cell AR coating has produced a space qualifiable titanium oxide coating which will give an additional 6% current output over similar silicon oxide coated cells when covered by glass.

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Determinants of woody cover in African savannas

USGS Publications Warehouse

Sankaran, M.; Hanan, N.P.; Scholes, Robert J.; Ratnam, J.; Augustine, D.J.; Cade, B.S.; Gignoux, J.; Higgins, S.I.; Le, Roux X.; Ludwig, F.; Ardo, J.; Banyikwa, F.; Bronn, A.; Bucini, G.; Caylor, K.K.; Coughenour, M.B.; Diouf, A.; Ekaya, W.; Feral, C.J.; February, E.C.; Frost, P.G.H.; Hiernaux, P.; Hrabar, H.; Metzger, K.L.; Prins, H.H.T.; Ringrose, S.; Sea, W.; Tews, J.; Worden, J.; Zambatis, N.

2005-01-01

Savannas are globally important ecosystems of great significance to human economies. In these biomes, which are characterized by the co-dominance of trees and grasses, woody cover is a chief determinant of ecosystem properties 1-3. The availability of resources (water, nutrients) and disturbance regimes (fire, herbivory) are thought to be important in regulating woody cover1,2,4,5, but perceptions differ on which of these are the primary drivers of savanna structure. Here we show, using data from 854 sites across Africa, that maximum woody cover in savannas receiving a mean annual precipitation (MAP) of less than ???650 mm is constrained by, and increases linearly with, MAP. These arid and semi-arid savannas may be considered 'stable' systems in which water constrains woody cover and permits grasses to coexist, while fire, herbivory and soil properties interact to reduce woody cover below the MAP-controlled upper bound. Above a MAP of ???650 mm, savannas are 'unstable' systems in which MAP is sufficient for woody canopy closure, and disturbances (fire, herbivory) are required for the coexistence of trees and grass. These results provide insights into the nature of African savannas and suggest that future changes in precipitation 6 may considerably affect their distribution and dynamics. ?? 2005 Nature Publishing Group.

SPECIAL ANALYSIS OF OPERATIONAL STORMWATER RUNOFF COVERS OVER SLIT TRENCHES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collard, L; Luther Hamm, L

2008-12-18

Solid Waste Management (SWM) commissioned this Special Analysis (SA) to determine the effects of placing operational stormwater runoff covers (referred to as covers in the remainder of this document) over slit trench (ST) disposal units ST1 through ST7 (the center set of slit trenches). Previously the United States Department of Energy (DOE) entered into an agreement with the United States Environmental Protection Agency (EPA) and the South Carolina Department of Health and Environmental Control (SCDHEC) to place covers over Slit Trenches 1 and 2 to be able to continue disposing Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) solid wastemore » (see USDOE 2008). Because the covers changed the operating conditions, DOE Order 435.1 (DOE 1999) required that an SA be performed to assess the impact. This Special Analysis has been prepared to determine the effects of placing covers over slit trenches at about years 5, 10 and 15 of the 30-year operational period. Because some slit trenches have already been operational for about 15 years, results from analyzing covers at 5 years and 10 years provide trend analysis information only. This SA also examined alternatives of covering Slit Trenches 1 and 2 with one cover and Slit Trenches 3 and 4 with a second cover versus covering them all with a single cover. Based on modeling results, minimal differences exist between covering Slit Trench groups 1-2 and 3-4 with two covers or one large cover. This SA demonstrates that placement of covers over slit trenches will slow the subsequent release and transport of radionuclides in the vadose zone in the early time periods (from time of placement until about 100 years). Release and transport of some radionuclides in the vadose zone beyond 100 years were somewhat higher than for the case without covers. The sums-of-fractions (SOFs) were examined for the current waste inventory in ST1 and ST2 and for estimated inventories at closure for ST3 through ST7. In

Land cover mapping of Greater Mesoamerica using MODIS data

USGS Publications Warehouse

Giri, Chandra; Jenkins, Clinton N.

2005-01-01

A new land cover database of Greater Mesoamerica has been prepared using moderate resolution imaging spectroradiometer (MODIS, 500 m resolution) satellite data. Daily surface reflectance MODIS data and a suite of ancillary data were used in preparing the database by employing a decision tree classification approach. The new land cover data are an improvement over traditional advanced very high resolution radiometer (AVHRR) based land cover data in terms of both spatial and thematic details. The dominant land cover type in Greater Mesoamerica is forest (39%), followed by shrubland (30%) and cropland (22%). Country analysis shows forest as the dominant land cover type in Belize (62%), Cost Rica (52%), Guatemala (53%), Honduras (56%), Nicaragua (53%), and Panama (48%), cropland as the dominant land cover type in El Salvador (60.5%), and shrubland as the dominant land cover type in Mexico (37%). A three-step approach was used to assess the quality of the classified land cover data: (i) qualitative assessment provided good insight in identifying and correcting gross errors; (ii) correlation analysis of MODIS- and Landsat-derived land cover data revealed strong positive association for forest (r2 = 0.88), shrubland (r2 = 0.75), and cropland (r2 = 0.97) but weak positive association for grassland (r2 = 0.26); and (iii) an error matrix generated using unseen training data provided an overall accuracy of 77.3% with a Kappa coefficient of 0.73608. Overall, MODIS 500 m data and the methodology used were found to be quite useful for broad-scale land cover mapping of Greater Mesoamerica.

40 CFR 258.21 - Cover material requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... Section 258.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES CRITERIA FOR MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.21 Cover material requirements. (a... cover disposed solid waste with six inches of earthen material at the end of each operating day, or at...

40 CFR 258.21 - Cover material requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

... Section 258.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES CRITERIA FOR MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.21 Cover material requirements. (a... cover disposed solid waste with six inches of earthen material at the end of each operating day, or at...

Winter cover crops influence Amaranthus palmeri establishment

USDA-ARS?s Scientific Manuscript database

Winter cover crops were evaluated for their effect on Palmer amaranth (PA) suppression in cotton production. Cover crops examined included rye and four winter legumes: narrow-leaf lupine, crimson clover, Austrian winter pea, and cahaba vetch. Each legume was evaluated alone and in a mixture with rye...

Termination of cover crops using rollers/crimpers

USDA-ARS?s Scientific Manuscript database

An integral component of conservation agriculture systems is the use of a high-residue winter cover crop; however, terminating cover crops is an addition expense and planting into high-residue can be a challenge. An experiment was conducted using black oat (Avena strigosa Schreb.), rye (Secale cere...

Fluorescence imaging to quantify crop residue cover

NASA Technical Reports Server (NTRS)

Daughtry, C. S. T.; Mcmurtrey, J. E., III; Chappelle, E. W.

1994-01-01

Crop residues, the portion of the crop left in the field after harvest, can be an important management factor in controlling soil erosion. Methods to quantify residue cover are needed that are rapid, accurate, and objective. Scenes with known amounts of crop residue were illuminated with long wave ultraviolet (UV) radiation and fluorescence images were recorded with an intensified video camera fitted with a 453 to 488 nm band pass filter. A light colored soil and a dark colored soil were used as background for the weathered soybean stems. Residue cover was determined by counting the proportion of the pixels in the image with fluorescence values greater than a threshold. Soil pixels had the lowest gray levels in the images. The values of the soybean residue pixels spanned nearly the full range of the 8-bit video data. Classification accuracies typically were within 3(absolute units) of measured cover values. Video imaging can provide an intuitive understanding of the fraction of the soil covered by residue.

Completion of the 2011 National Land Cover Database for the conterminous United States – Representing a decade of land cover change information

USGS Publications Warehouse

Homer, Collin G.; Dewitz, Jon; Yang, Limin; Jin, Suming; Danielson, Patrick; Xian, George Z.; Coulston, John; Herold, Nathaniel; Wickham, James; Megown, Kevin

2015-01-01

The National Land Cover Database (NLCD) provides nationwide data on land cover and land cover change at the native 30-m spatial resolution of the Landsat Thematic Mapper (TM). The database is designed to provide five-year cyclical updating of United States land cover and associated changes. The recent release of NLCD 2011 products now represents a decade of consistently produced land cover and impervious surface for the Nation across three periods: 2001, 2006, and 2011 (Homer et al., 2007; Fry et al., 2011). Tree canopy cover has also been produced for 2011 (Coluston et al., 2012; Coluston et al., 2013). With the release of NLCD 2011, the database provides the ability to move beyond simple change detection to monitoring and trend assessments. NLCD 2011 represents the latest evolution of NLCD products, continuing its focus on consistency, production, efficiency, and product accuracy. NLCD products are designed for widespread application in biology, climate, education, land management, hydrology, environmental planning, risk and disease analysis, telecommunications and visualization, and are available for no cost at http://www.mrlc.gov. NLCD is produced by a Federal agency consortium called the Multi-Resolution Land Characteristics Consortium (MRLC) (Wickham et al., 2014). In the consortium arrangement, the U.S. Geological Survey (USGS) leads NLCD land cover and imperviousness production for the bulk of the Nation; the National Oceanic and Atmospheric Administration (NOAA) completes NLCD land cover for the conterminous U.S. (CONUS) coastal zones; and the U.S. Forest Service (USFS) designs and produces the NLCD tree canopy cover product. Other MRLC partners collaborate through resource or data contribution to ensure NLCD products meet their respective program needs (Wickham et al., 2014).

AVHRR channel selection for land cover classification

USGS Publications Warehouse

Maxwell, S.K.; Hoffer, R.M.; Chapman, P.L.

2002-01-01

Mapping land cover of large regions often requires processing of satellite images collected from several time periods at many spectral wavelength channels. However, manipulating and processing large amounts of image data increases the complexity and time, and hence the cost, that it takes to produce a land cover map. Very few studies have evaluated the importance of individual Advanced Very High Resolution Radiometer (AVHRR) channels for discriminating cover types, especially the thermal channels (channels 3, 4 and 5). Studies rarely perform a multi-year analysis to determine the impact of inter-annual variability on the classification results. We evaluated 5 years of AVHRR data using combinations of the original AVHRR spectral channels (1-5) to determine which channels are most important for cover type discrimination, yet stabilize inter-annual variability. Particular attention was placed on the channels in the thermal portion of the spectrum. Fourteen cover types over the entire state of Colorado were evaluated using a supervised classification approach on all two-, three-, four- and five-channel combinations for seven AVHRR biweekly composite datasets covering the entire growing season for each of 5 years. Results show that all three of the major portions of the electromagnetic spectrum represented by the AVHRR sensor are required to discriminate cover types effectively and stabilize inter-annual variability. Of the two-channel combinations, channels 1 (red visible) and 2 (near-infrared) had, by far, the highest average overall accuracy (72.2%), yet the inter-annual classification accuracies were highly variable. Including a thermal channel (channel 4) significantly increased the average overall classification accuracy by 5.5% and stabilized interannual variability. Each of the thermal channels gave similar classification accuracies; however, because of the problems in consistently interpreting channel 3 data, either channel 4 or 5 was found to be a more

Tree and impervious cover change in U.S

Treesearch

David J. Nowak; Eric J. Greenfield

2012-01-01

Paired aerial photographs were interpreted to assess recent changes in tree, impervious and other cover types in 20 U.S. cities as well as urban land within the conterminous United States. National results indicate that tree cover in urban areas of the United States is on the decline at a rate of about 7900 ha/yr or 4.0 million trees per year. Tree cover in 17 of the...

Recent land cover changes and sensitivity of the model simulations to various land cover datasets for China

NASA Astrophysics Data System (ADS)

Chen, Liang; Ma, Zhuguo; Mahmood, Rezaul; Zhao, Tianbao; Li, Zhenhua; Li, Yanping

2017-08-01

Reliable land cover data are important for improving numerical simulation by regional climate model, because the land surface properties directly affect climate simulation by partitioning of energy, water and momentum fluxes and by determining temperature and moisture at the interface between the land surface and atmosphere. China has experienced significant land cover change in recent decades and accurate representation of these changes is, hence, essential. In this study, we used a climate model to examine the changes experienced in the regional climate because of the different land cover data in recent decades. Three sets of experiments are performed using the same settings, except for the land use/cover (LC) data for the years 1990, 2000, 2009, and the model default LC data. Three warm season periods are selected, which represented a wet (1998), normal (2000) and a dry year (2011) for China in each set of experiment. The results show that all three sets of land cover experiments simulate a warm bias relative to the control with default LC data for near-surface temperature in summertime in most parts of China. It is especially noticeable in the southwest China and south of the Yangtze River, where significant changes of LC occurred. Deforestation in southwest China and to the south of Yangtze River in the experiment cases may have contributed to the negative precipitation bias relative to the control cases. Large LC changes in northwestern Tibetan Plateau for 2000 and 2009 datasets are also associated with changes in surface temperature, precipitation, and heat fluxes. Wind anomalies and energy budget changes are consistent with the precipitation and temperature changes.

21 CFR 882.5250 - Burr hole cover.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Burr hole cover. 882.5250 Section 882.5250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5250 Burr hole cover. (a...

21 CFR 882.5250 - Burr hole cover.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Burr hole cover. 882.5250 Section 882.5250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES NEUROLOGICAL DEVICES Neurological Therapeutic Devices § 882.5250 Burr hole cover. (a...

Areas of Indian Country Covered by the EPA Plan

EPA Pesticide Factsheets

Areas of Indian country covered by the EPA Plan for certification are those that are not covered by another EPA-approved certification plan.Most areas are NOT covered by an EPA-approved plan, so this new plan would apply to most locations.

41 CFR 301-11.538 - May we offer a lump sum payment to cover the income tax liability on the covered ITRA?

Code of Federal Regulations, 2010 CFR

2010-07-01

... payment to cover the income tax liability on the covered ITRA? 301-11.538 Section 301-11.538 Public... 1994 Agency Responsibilities § 301-11.538 May we offer a lump sum payment to cover the income tax... understands that he/she is responsible for any income taxes without further reimbursement. (See the...

41 CFR 301-11.638 - May we offer a lump sum payment to cover the income tax liability on the covered ITRA?

Code of Federal Regulations, 2010 CFR

2010-07-01

... payment to cover the income tax liability on the covered ITRA? 301-11.638 Section 301-11.638 Public... Thereafter Agency Responsibilities § 301-11.638 May we offer a lump sum payment to cover the income tax... understands that he/she is responsible for any income taxes without further reimbursement. See the...

Unusually Low Snow Cover in the U.S.

NASA Technical Reports Server (NTRS)

2002-01-01

New maps of snow cover produced by NASA's Terra satellite show that this year's snow line stayed farther north than normal. When combined with land surface temperature measurements, the observations confirm earlier National Oceanic and Atmospheric Administration reports that the United States was unusually warm and dry this past winter. The above map shows snow cover over the continental United States from February 2002 and is based on data acquired by the Moderate-Resolution Imaging Spectroradiometer (MODIS). The amount of land covered by snow during this period was much lower than usual. With the exception of the western mountain ranges and the Great Lakes region, the country was mostly snow free. The solid red line marks the average location of the monthly snow extent; white areas are snow-covered ground. Snow was mapped at approximately 5 kilometer pixel resolution on a daily basis and then combined, or composited, every eight days. If a pixel was at least 50 percent snow covered during all of the eight-day periods that month, it was mapped as snow covered for the whole month. For more information, images, and animations, read: Terra Satellite Data Confirm Unusually Warm, Dry U.S. Winter Image by Robert Simmon, based on data from the MODIS Snow/Ice Global Mapping Project

The canine sarcoglycan delta gene: BAC clone contig assembly, chromosome assignment and interrogation as a candidate gene for dilated cardiomyopathy in Dobermann dogs.

PubMed

Stabej, P; Leegwater, P A J; Imholz, S; Versteeg, S A; Zijlstra, C; Stokhof, A A; Domanjko-Petriè, A; van Oost, B A

2005-01-01

Dilated cardiomyopathy (DCM) is a common disease of the myocardium recognized in human, dog and experimental animals. Genetic factors are responsible for a large proportion of cases in humans, and 17 genes with DCM causing mutations have been identified. The genetic origin of DCM in the Dobermann dogs has been suggested, but no disease genes have been identified to date. In this paper, we describe the characterization and evaluation of the canine sarcoglycan delta (SGCD), a gene implicated in DCM in human and hamster. Bacterial artificial chromosomes (BACs) containing the canine SGCD gene were isolated with probes for exon 3 and exons 4-8 and were characterized by Southern blot analysis. BAC end sequences were obtained for four BACs. Three of the BACs overlapped and could be ordered relative to each other and the end sequences of all four BACs could be anchored on the preliminary assembly of the dog genome sequence (www. ensembl.org). One of the BACs of the partial contig was localized by fluorescent in situ hybridization to canine chromosome 4q22, in agreement with the dog genome sequence. Two highly informative polymorphic microsatellite markers in intron 7 of the SGCD gene were identified. In 25 DCM-affected and 13 non DCM-affected dogs seven different haplotypes could be distinguished. However, no association between any of the SGCD variants and the disease locus was apparent.

Merging the MODIS and NESDIS Monthly Snow-Cover Records to Study Decade-Scale Changes in Northern Hemisphere Snow Cover

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.; Foster, James L.; Robinson, David A.; Riggs, George A.

2004-01-01

A decade-scale record of Northern Hemisphere snow cover has been available from the National Oceanic and Atmospheric Administration (NOAA) National Environmental Satellite Data and Information Service (NESDIS) and has been reconstructed and validated by Rutgers University following adjustments for inconsistencies that were discovered in the early years of the data set. This record provides weekly, monthly (and, in recent years, daily) snow cover from 1966 to the present for the Northern Hemisphere. With the December 1999 launch of NASA's Earth observing System (EOS) Terra satellite, snow maps are being produced globally, using automated algorithms, on a daily, weekly and monthly basis from the Moderate-Resolution Imaging Spectroradiometer (MODIS) instrument. The resolution of the MODIS monthly snow maps (0.05deg or about 5 km) is an improvement over that of the NESDIS-derived monthly snow maps (>approx.10 km) the maps, it is necessary to study the datasets carefully to determine if it is possible to merge the datasets into a continuous record. The months in which data are available for both the NESDIS and MODIS maps (March 2000 to the present) will be compared quantitatively to analyze differences in North American and Eurasian snow cover. Results from the NESDIS monthly maps show that for North America (including all 12 months), there is a trend toward slightly less snow cover in each succeeding decade. Interannual snow-cover extent has varied significantly since 2000 as seen in both the NESDIS and MODIS maps. As the length of the satellite record increases through the MODIS era, and into the National Polar-orbiting Environmental Satellite System (NPOESS) era, it should become easier to identify trends in areal extent of snow cover, if present, that may have climatic significance. Thus it is necessary to analyze the validity of merging the NESDIS and MODIS, and, in the future, the NPOESS datasets for determination of long-term continuity in measurement of Northern

Managing cover crops on strawberry furrow bottoms

USDA-ARS?s Scientific Manuscript database

Bare furrows in strawberry fields with plastic mulch covered beds can lead to lots of soil erosion and runoff during winter rainy periods. This article describes how growers can plant and manage cover crops in these furrows to minimize runoff and soil erosion. This is based on on-going research at...

14 CFR 1253.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-01-01

... BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

44 CFR 19.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-10-01

... OF HOMELAND SECURITY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

Cover crop biomass harvest for bioenergy: implications for crop productivity

USDA-ARS?s Scientific Manuscript database

Winter cover crops, such as rye (Secale cereale), are usually used in conservation agriculture systems in the Southeast. Typically, the cover crop is terminated two to three weeks before planting the summer crop, with the cover biomass left on the soil surface as a mulch. However, these cover crops ...

Suppression of soilborne diseases of soybean with cover crops

USDA-ARS?s Scientific Manuscript database

Cover crops can foster the development of disease suppressive soils, and it has become common to use cover crops to manage soilborne diseases in high value crops. There is increasing interest in incorporating cover crops into agronomic systems in the Midwestern US for improving soil health. However,...

16 CFR 1611.2 - General description of products covered.

Code of Federal Regulations, 2014 CFR

2014-01-01

... REGULATIONS STANDARD FOR THE FLAMMABILITY OF VINYL PLASTIC FILM The Standard § 1611.2 General description of products covered. The material covered is nonrigid, unsupported, vinyl plastic film, including transparent... the scope of this standard. The vinyl plastic film covered by Commercial Standard 192-53, as...

16 CFR 1611.2 - General description of products covered.

Code of Federal Regulations, 2011 CFR

2011-01-01

... REGULATIONS STANDARD FOR THE FLAMMABILITY OF VINYL PLASTIC FILM The Standard § 1611.2 General description of products covered. The material covered is nonrigid, unsupported, vinyl plastic film, including transparent... the scope of this standard. The vinyl plastic film covered by Commercial Standard 192-53, as...

16 CFR 1611.2 - General description of products covered.

Code of Federal Regulations, 2012 CFR

2012-01-01

... REGULATIONS STANDARD FOR THE FLAMMABILITY OF VINYL PLASTIC FILM The Standard § 1611.2 General description of products covered. The material covered is nonrigid, unsupported, vinyl plastic film, including transparent... the scope of this standard. The vinyl plastic film covered by Commercial Standard 192-53, as...

16 CFR 1611.2 - General description of products covered.

Code of Federal Regulations, 2010 CFR

2010-01-01

... REGULATIONS STANDARD FOR THE FLAMMABILITY OF VINYL PLASTIC FILM The Standard § 1611.2 General description of products covered. The material covered is nonrigid, unsupported, vinyl plastic film, including transparent... the scope of this standard. The vinyl plastic film covered by Commercial Standard 192-53, as...

45 CFR 162.510 - Full implementation requirements: Covered entities.

Code of Federal Regulations, 2013 CFR

2013-10-01

... 45 Public Welfare 1 2013-10-01 2013-10-01 false Full implementation requirements: Covered entities. 162.510 Section 162.510 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATIVE DATA... Plans § 162.510 Full implementation requirements: Covered entities. (a) A covered entity must use an...

44 CFR 19.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-10-01

..., DEPARTMENT OF HOMELAND SECURITY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

6 CFR 17.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

45 CFR 2555.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-10-01

... COMMUNITY SERVICE NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

44 CFR 19.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-10-01

..., DEPARTMENT OF HOMELAND SECURITY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

14 CFR 1253.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

6 CFR 17.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

44 CFR 19.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-10-01

..., DEPARTMENT OF HOMELAND SECURITY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

45 CFR 2555.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-10-01

... COMMUNITY SERVICE NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

31 CFR 28.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

45 CFR 2555.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-10-01

... COMMUNITY SERVICE NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

6 CFR 17.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

14 CFR 1253.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

31 CFR 28.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

31 CFR 28.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

14 CFR 1253.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

6 CFR 17.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

6 CFR 17.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-01-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

31 CFR 28.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

44 CFR 19.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

..., DEPARTMENT OF HOMELAND SECURITY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Federal agency shall periodically republish the notice of covered programs to reflect changes in covered...

31 CFR 28.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Procedures... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

45 CFR 2555.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

... COMMUNITY SERVICE NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

45 CFR 2555.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-10-01

... COMMUNITY SERVICE NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

RSRM top hat cover simulator lightning test, volume 1

NASA Technical Reports Server (NTRS)

1990-01-01

The test sequence was to measure electric and magnetic fields induced inside a redesigned solid rocket motor case when a simulated lightning discharge strikes an exposed top hat cover simulator. The test sequence was conducted between 21 June and 17 July 1990. Thirty-six high rate-of-rise Marx generator discharges and eight high current bank discharges were injected onto three different test article configurations. Attach points included three locations on the top hat cover simulator and two locations on the mounting bolts. Top hat cover simulator and mounting bolt damage and grain cover damage was observed. Overall electric field levels were well below 30 kilowatts/meter. Electric field levels ranged from 184.7 to 345.9 volts/meter and magnetic field levels were calculated from 6.921 to 39.73 amperes/meter. It is recommended that the redesigned solid rocket motor top hat cover be used in Configuration 1 or Configuration 2 as an interim lightning protection device until a lightweight cover can be designed.

EULER-PCR: finishing experiments for repeat resolution.

PubMed

Mulyukov, Zufar; Pevzner, Pavel A

2002-01-01

Genomic sequencing typically generates a large collection of unordered contigs or scaffolds. Contig ordering (also known as gap closure) is a non-trivial algorithmic and experimental problem since even relatively simple-to-assemble bacterial genomes typically result in large set of contigs. Neighboring contigs maybe separated either by gaps in read coverage or by repeats. In the later case we say that the contigs are separated by pseudogaps, and we emphasize the important difference between gap closure and pseudogap closure. The existing gap closure approaches do not distinguish between gaps and pseudogaps and treat them in the same way. We describe a new fast strategy for closing pseudogaps (repeat resolution). Since in highly repetitive genomes, the number of pseudogaps may exceed the number of gaps by an order of magnitude, this approach provides a significant advantage over the existing gap closure methods.

General form of a cooperative gradual maximal covering location problem

NASA Astrophysics Data System (ADS)

Bagherinejad, Jafar; Bashiri, Mahdi; Nikzad, Hamideh

2018-07-01

Cooperative and gradual covering are two new methods for developing covering location models. In this paper, a cooperative maximal covering location-allocation model is developed (CMCLAP). In addition, both cooperative and gradual covering concepts are applied to the maximal covering location simultaneously (CGMCLP). Then, we develop an integrated form of a cooperative gradual maximal covering location problem, which is called a general CGMCLP. By setting the model parameters, the proposed general model can easily be transformed into other existing models, facilitating general comparisons. The proposed models are developed without allocation for physical signals and with allocation for non-physical signals in discrete location space. Comparison of the previously introduced gradual maximal covering location problem (GMCLP) and cooperative maximal covering location problem (CMCLP) models with our proposed CGMCLP model in similar data sets shows that the proposed model can cover more demands and acts more efficiently. Sensitivity analyses are performed to show the effect of related parameters and the model's validity. Simulated annealing (SA) and a tabu search (TS) are proposed as solution algorithms for the developed models for large-sized instances. The results show that the proposed algorithms are efficient solution approaches, considering solution quality and running time.

Crown cover chart for oak savannas. Forest Service technical brief

DOE Office of Scientific and Technical Information (OSTI.GOV)

Law, J.R.; Johnson, P.S.; Houf, G.

1994-07-01

Although oak savannas have been defined in many ways, they are characterized by scattered trees, largely comprised of oaks, and a sparse ground layer rich in grasses and forbs. The crown cover chart can be used to estimate the crown cover of trees as a percent of total area. Potential applications of the chart include monitoring changes in savanna crown cover, determining needed reductions in crown cover, and defining the savanna state. in restoring savannas that have grown into closed canopy stands, one can use the chart to estimate initial crown cover before restoration work is begun and again aftermore » crown cover has been reduced.« less

18 CFR 1317.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-04-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

45 CFR 618.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-10-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

13 CFR 113.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Nondiscrimination on the Basis of Sex in Education Programs or Activities Receiving Federal Financial Assistance... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

18 CFR 1317.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-04-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

32 CFR 196.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

36 CFR 1211.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... ADMINISTRATION GENERAL RULES NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

13 CFR 113.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Nondiscrimination on the Basis of Sex in Education Programs or Activities Receiving Federal Financial Assistance... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

18 CFR 1317.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-04-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

24 CFR 3.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Development NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

32 CFR 196.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

24 CFR 3.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Development NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

38 CFR 23.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (CONTINUED) NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

32 CFR 196.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

45 CFR 618.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-10-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

38 CFR 23.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... (CONTINUED) NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

45 CFR 618.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-10-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

13 CFR 113.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Nondiscrimination on the Basis of Sex in Education Programs or Activities Receiving Federal Financial Assistance... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

32 CFR 196.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-07-01

...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

13 CFR 113.600 - Notice of covered programs.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Nondiscrimination on the Basis of Sex in Education Programs or Activities Receiving Federal Financial Assistance... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

24 CFR 3.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-04-01

... Development NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

36 CFR 1211.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-07-01

... ADMINISTRATION GENERAL RULES NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

18 CFR 1317.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-04-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

45 CFR 618.600 - Notice of covered programs.

Code of Federal Regulations, 2011 CFR

2011-10-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

32 CFR 196.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

36 CFR 1211.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-07-01

... ADMINISTRATION GENERAL RULES NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING... periodically republish the notice of covered programs to reflect changes in covered programs. Copies of this...

13 CFR 113.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Nondiscrimination on the Basis of Sex in Education Programs or Activities Receiving Federal Financial Assistance... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

18 CFR 1317.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-04-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

24 CFR 3.600 - Notice of covered programs.

Code of Federal Regulations, 2012 CFR

2012-04-01

... Development NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

38 CFR 23.600 - Notice of covered programs.

Code of Federal Regulations, 2014 CFR

2014-07-01

... (CONTINUED) NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...

45 CFR 618.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-10-01

... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE... covered programs to reflect changes in covered programs. Copies of this notice also shall be made...

38 CFR 23.600 - Notice of covered programs.

Code of Federal Regulations, 2013 CFR

2013-07-01

... (CONTINUED) NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... republish the notice of covered programs to reflect changes in covered programs. Copies of this notice also...