Isolation of a yeast artificial chromosome contig spanning the Greig cephalopolysyndactyly syndrome (GCPS) gene region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vortkamp, A.; Gessler, M.; Le Paslier, D.

1994-08-01

Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.

Positional cloning of the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, R.F.; Korenblat, K.M.; Goate, A.M.

1994-09-01

Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less

High-resolution human/goat comparative map of the goat polled/intersex syndrome (PIS): the human homologue is contained in a human YAC from HSA3q23.

PubMed

Vaiman, D; Schibler, L; Oustry-Vaiman, A; Pailhoux, E; Goldammer, T; Stevanovic, M; Furet, J P; Schwerin, M; Cotinot, C; Fellous, M; Cribiu, E P

1999-02-15

The genetic and cytogenetic map around the chromosome 1 region shown to be linked with polledness and intersexuality (PIS) in the domestic goat (Capra hircus) was refined. For this purpose, a goat BAC library was systematically screened with primers from human coding sequences, scraped chromosome 1 DNA, bovine microsatellites from the region, and BAC ends. All the BACs (n = 30) were mapped by fluorescence in situ hybridization (FISH) on goat chromosome 1q41-q45. The genetic mapping of 30 new goat polymorphic markers, isolated from these BACs, made it possible to reduce the PIS interval to a region of less than 1 cM on goat chromosome 1q43. The PIS locus is now located between the two genes ATP1B and COP, which both map to 3q23 in humans. Genetic, cytogenetic, and comparative data suggest that the PIS region is now probably circumscribed to an approximately 1-Mb DNA segment for which construction of a BAC contig is in progress. In addition, a human YAC contig encompassing the blepharophimosis-ptosis-epicanthus-inversus region was mapped by FISH to goat chromosome 1q43. This human disease, mapped to HSA 3q23 and affecting the development and maintenance of ovarian function, could be a potential candidate for goat PIS. Copyright 1999 Academic Press.

The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Coillie, E.; Fiten, P.; Van Damme, J.

1997-03-01

Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genesmore » a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.« less

Contig Maps and Genomic Sequencing Identify Candidate Genes in the Usher 1C Locus

PubMed Central

Higgins, Michael J.; Day, Colleen D.; Smilinich, Nancy J.; Ni, L.; Cooper, Paul R.; Nowak, Norma J.; Davies, Chris; de Jong, Pieter J.; Hejtmancik, Fielding; Evans, Glen A.; Smith, Richard J.H.; Shows, Thomas B.

1998-01-01

Usher syndrome 1C (USH1C) is a congenital condition manifesting profound hearing loss, the absence of vestibular function, and eventual retinal degeneration. The USH1C locus has been mapped genetically to a 2- to 3-cM interval in 11p14–15.1 between D11S899 and D11S861. In an effort to identify the USH1C disease gene we have isolated the region between these markers in yeast artificial chromosomes (YACs) using a combination of STS content mapping and Alu–PCR hybridization. The YAC contig is ∼3.5 Mb and has located several other loci within this interval, resulting in the order CEN-LDHA-SAA1-TPH-D11S1310-(D11S1888/KCNC1)-MYOD1-D11S902D11S921-D11S1890-TEL. Subsequent haplotyping and homozygosity analysis refined the location of the disease gene to a 400-kb interval between D11S902 and D11S1890 with all affected individuals being homozygous for the internal marker D11S921. To facilitate gene identification, the critical region has been converted into P1 artificial chromosome (PAC) clones using sequence-tagged sites (STSs) mapped to the YAC contig, Alu–PCR products generated from the YACs, and PAC end probes. A contig of >50 PAC clones has been assembled between D11S1310 and D11S1890, confirming the order of markers used in haplotyping. Three PAC clones representing nearly two-thirds of the USH1C critical region have been sequenced. PowerBLAST analysis identified six clusters of expressed sequence tags (ESTs), two known genes (BIR,SUR1) mapped previously to this region, and a previously characterized but unmapped gene NEFA (DNA binding/EF hand/acidic amino-acid-rich). GRAIL analysis identified 11 CpG islands and 73 exons of excellent quality. These data allowed the construction of a transcription map for the USH1C critical region, consisting of three known genes and six or more novel transcripts. Based on their map location, these loci represent candidate disease loci for USH1C. The NEFA gene was assessed as the USH1C locus by the sequencing of an amplified NEFA

Analysis of complex repeat sequences within the spinal muscular atrophy (SMA) candidate region in 5q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, K.E.; Morrison, K.E.; Daniels, R.I.

1994-09-01

We previously reported that the 400 kb interval flanked the polymorphic loci D5S435 and D5S557 contains blocks of a chromosome 5 specific repeat. This interval also defines the SMA candidate region by genetic analysis of recombinant families. A YAC contig of 2-3 Mb encompassing this area has been constructed and a 5.5 kb conserved fragment, isolated from a YAC end clone within the above interval, was used to obtain cDNAs from both fetal and adult brain libraries. We describe the identification of cDNAs with stretches of high DNA sequence homology to exons of {beta} glucuronidase on human chromosome 7. Themore » cDNAs map both to the candidate region and to an area of 5p using FISH and deletion hybrid analysis. Hybridization to bacteriophage and cosmid clones from the YACs localizes the {beta} glucuronidase related sequences within the 400 kb region of the YAC contig. The cDNAs show a polymorphic pattern on hybridization to genomic BamH1 fragments in the size range of 10-250 kb. Further analysis using YAC fragmentation vectors is being used to determine how these {beta} glucuronidase related cDNAs are distributed within 5q13. Dinucleotide repeats within the region are being investigated to determine linkage disequilibrium with the disease locus.« less

Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

PubMed

Fedosyuk, Halyna; Peterson, Kenneth R

2007-01-01

A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hellsten, E.; Vesa, J.; Peltonen, L.

Infantile neuronal ceroid lipofuscinosis (INCL, CLN1) is a neurodegenerative disorder in which the biochemical defect is unknown. We earlier assigned the disease locus to chromosome 1p32 in the immediate vicinity of the highly informative HY-TM1 marker by linkage and linkage disequilibrium analysis. Here we report the construction of PFGE maps on the CLN1 region covering a total of 4 Mb of this relatively poorly mapped chromosomal region. We established the order of loci at 1p32 as tel-D1S57-L-myc-HY-TM1-rlf-COL9A2-D1S193-D1S62-D1S211-cen by combining data obtained from analysis of a chromosome 1 somatic cell hybrid panel, PFGE, and interphase FISH. We isolated YACs and constructedmore » two separate YAC contigs, the loci L-myc, HY-TM1, rlf, and COL9A2 being present on a 1000-kb contig and the markers D1S193, D1S62, and D1S211 on a YAC contig spanning a maximum of 860 kb. Within the 1000-kb contig we were able to identify five CpG islands in addition to those associated with the earlier cloned genes. The YAC contigs as well as the physical map provide us with tools for the identification of the INCL gene. 36 refs., 4 figs., 3 tabs.« less

The influence of convection drying on the physicochemical properties of yacón (Smallanthus sonchifolius)

NASA Astrophysics Data System (ADS)

Salinas, Juan Gabriel; Alvarado, Juan Antonio; Bergenståhl, Björn; Tornberg, Eva

2018-04-01

Yacón root is a natural source of fructans, which has many potential benefits. Convective drying has been applied to increase the shelf life of yacón roots. However, this processing may lead to detrimental effects on the physicochemical functionality. The drying was investigated using different conditions (drying temperatures of 45 °C, 50 °C and 55 °C at a drying air velocity of 2 m/s and 60 °C at a drying air velocity of 2 m/s, 3 m/s and 4 m/s). The dried samples were compared to the original yacón with regard to their physicochemical properties. From all the properties that were studied, the color of the dried material and the elastic modulus of the reconstituted yacón were the most important properties being minimized respectively. The results of this investigation indicate that the best drying conditions, where the physicochemical properties of the samples are kept closest to the original material, are obtained either by using temperatures of 55 °C and 2 m/s or using higher temperatures but increasing the air velocity.

The nature of youth care tasks in families experiencing chronic illness/disability: development of the Youth Activities of Caregiving Scale (YACS).

PubMed

Ireland, Michael James; Pakenham, Kenneth Ian

2010-07-01

The purpose of this study was to develop an empirically derived multi-item scale of care tasks performed by young people in the context of family illness/disability: the Youth Activities of Caregiving Scale (YACS). A total of 135 youngsters aged 10-24 years with an ill/disabled family member completed questionnaires. Factor analyses performed on the YACS yielded four factors, instrumental care, social/emotional care, personal/intimate care and domestic/household care, accounting for 57.78% of the variance. The internal reliabilities of all factors ranged from 0.74 to 0.92. Higher scores on the YACS related to higher youth age and several caregiving context variables (i.e. household type [single or dual-parent household], relationship with care-recipient and perceived choice in caregiving). Higher scores on the YACS also related to care-recipient illness/disability variables (onset, functional impairment, prognosis, predictability and illness/disability type). Strong positive correlations between the YACS and a conceptually related measure of young caregiving experiences provided good convergent validity data. Criterion validity was established with evidence that the YACS predicted youth adjustment in the domains of health and prosocial behaviour.

Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington's Disease Mice.

PubMed

Berggren, Kiersten L; Lu, Zhen; Fox, Julia A; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H

2016-01-01

Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington's disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363-74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Female neonatal mice were supplemented daily from days 10-17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later.

YAC128 Huntington's disease transgenic mice show enhanced short-term hippocampal synaptic plasticity early in the course of the disease.

PubMed

Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana

2014-09-18

Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder. Copyright © 2014 Elsevier B.V. All rights reserved.

Report of the Fourth International Workshop on human X chromosome mapping 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlessinger, D.; Mandel, J.L.; Monaco, A.P.

1993-12-31

Vigorous interactive efforts by the X chromosome community have led to accelerated mapping in the last six months. Seventy-five participants from 12 countries around the globe contributed progress reports to the Fourth International X Chromosome Workshop, at St. Louis, MO, May 9-12, 1993. It became clear that well over half the chromosome is now covered by YAC contigs that are being extended, verified, and aligned by their content of STSs and other markers placed by cytogenetic or linkage mapping techniques. The major aim of the workshop was to assemble the consensus map that appears in this report, summarizing both consensusmore » order and YAC contig information.« less

The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geraghty, M.T.; Brody, L.C.; Martin, L.S.

1993-05-01

Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington’s Disease Mice

PubMed Central

Berggren, Kiersten L.; Lu, Zhen; Fox, Julia A.; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H.

2016-01-01

Background: Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington’s disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363–74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. Objective: To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Methods: Female neonatal mice were supplemented daily from days 10–17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Results: Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Conclusions: Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later. PMID:27079948

Cellular, Molecular and Functional Characterisation of YAC Transgenic Mouse Models of Friedreich Ataxia

PubMed Central

Anjomani Virmouni, Sara; Sandi, Chiranjeevi; Al-Mahdawi, Sahar; Pook, Mark A.

2014-01-01

Background Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC) transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats), YG8R (90 and 190 GAA repeats) and YG22R (190 GAA repeats). Methodology/Principal Findings We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH) analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R. Conclusions/Significance Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy. PMID:25198290

Changes in the striatal proteome of YAC128Q mice exhibit gene-environment interactions between mutant huntingtin and manganese.

PubMed

Wegrzynowicz, Michal; Holt, Hunter K; Friedman, David B; Bowman, Aaron B

2012-02-03

Huntington's disease (HD) is a neurodegenerative disorder caused by expansion of a CAG repeat within the Huntingtin (HTT) gene, though the clinical presentation of disease and age-of-onset are strongly influenced by ill-defined environmental factors. We recently reported a gene-environment interaction wherein expression of mutant HTT is associated with neuroprotection against manganese (Mn) toxicity. Here, we are testing the hypothesis that this interaction may be manifested by altered protein expression patterns in striatum, a primary target of both neurodegeneration in HD and neurotoxicity of Mn. To this end, we compared striatal proteomes of wild-type and HD (YAC128Q) mice exposed to vehicle or Mn. Principal component analysis of proteomic data revealed that Mn exposure disrupted a segregation of WT versus mutant proteomes by the major principal component observed in vehicle-exposed mice. Identification of altered proteins revealed novel markers of Mn toxicity, particularly proteins involved in glycolysis, excitotoxicity, and cytoskeletal dynamics. In addition, YAC128Q-dependent changes suggest that axonal pathology may be an early feature in HD pathogenesis. Finally, for several proteins, genotype-specific responses to Mn were observed. These differences include increased sensitivity to exposure in YAC128Q mice (UBQLN1) and amelioration of some mutant HTT-induced alterations (SAE1, ENO1). We conclude that the interaction of Mn and mutant HTT may suppress proteomic phenotypes of YAC128Q mice, which could reveal potential targets in novel treatment strategies for HD.

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

IGF-1 intranasal administration rescues Huntington's disease phenotypes in YAC128 mice.

PubMed

Lopes, Carla; Ribeiro, Márcio; Duarte, Ana I; Humbert, Sandrine; Saudou, Frederic; Pereira de Almeida, Luís; Hayden, Michael; Rego, A Cristina

2014-06-01

Huntington's disease (HD) is an autosomal dominant disease caused by an expansion of CAG repeats in the gene encoding for huntingtin. Brain metabolic dysfunction and altered Akt signaling pathways have been associated with disease progression. Nevertheless, conflicting results persist regarding the role of insulin-like growth factor-1 (IGF-1)/Akt pathway in HD. While high plasma levels of IGF-1 correlated with cognitive decline in HD patients, other data showed protective effects of IGF-1 in HD striatal neurons and R6/2 mice. Thus, in the present study, we investigated motor phenotype, peripheral and central metabolic profile, and striatal and cortical signaling pathways in YAC128 mice subjected to intranasal administration of recombinant human IGF-1 (rhIGF-1) for 2 weeks, in order to promote IGF-1 delivery to the brain. We show that IGF-1 supplementation enhances IGF-1 cortical levels and improves motor activity and both peripheral and central metabolic abnormalities in YAC128 mice. Moreover, decreased Akt activation in HD mice brain was ameliorated following IGF-1 administration. Upregulation of Akt following rhIGF-1 treatment occurred concomitantly with increased phosphorylation of mutant huntingtin on Ser421. These data suggest that intranasal administration of rhIGF-1 ameliorates HD-associated glucose metabolic brain abnormalities and mice phenotype.

CAR: contig assembly of prokaryotic draft genomes using rearrangements.

PubMed

Lu, Chin Lung; Chen, Kun-Tze; Huang, Shih-Yuan; Chiu, Hsien-Tai

2014-11-28

Next generation sequencing technology has allowed efficient production of draft genomes for many organisms of interest. However, most draft genomes are just collections of independent contigs, whose relative positions and orientations along the genome being sequenced are unknown. Although several tools have been developed to order and orient the contigs of draft genomes, more accurate tools are still needed. In this study, we present a novel reference-based contig assembly (or scaffolding) tool, named as CAR, that can efficiently and more accurately order and orient the contigs of a prokaryotic draft genome based on a reference genome of a related organism. Given a set of contigs in multi-FASTA format and a reference genome in FASTA format, CAR can output a list of scaffolds, each of which is a set of ordered and oriented contigs. For validation, we have tested CAR on a real dataset composed of several prokaryotic genomes and also compared its performance with several other reference-based contig assembly tools. Consequently, our experimental results have shown that CAR indeed performs better than all these other reference-based contig assembly tools in terms of sensitivity, precision and genome coverage. CAR serves as an efficient tool that can more accurately order and orient the contigs of a prokaryotic draft genome based on a reference genome. The web server of CAR is freely available at http://genome.cs.nthu.edu.tw/CAR/ and its stand-alone program can also be downloaded from the same website.

Physical and transcriptional map in the CMT 1A region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chevillard, C.; Passage, E.; Cudrey, C.

1994-09-01

The Charcot-Marie-Tooth disease type 1A (CMT1A) has been mapped to the proximal short arm of chromosome 17. CMT1A is the most frequent of the motor and sensory peripheral neuropathies and is associated with a duplication of a 1.5 Mb fragment in proximal 17p12. Several groups have proposed that the gene coding for peripheral myelin protein-22 (PMP-22) as the candidate gene for CMT1A. We have recently published a {open_quote}MegaYAC{close_quote} contig of 6 Mb which covers the CMT1A critical region. In order to isolate new genes localized in this region, we used a {open_quote}physical trapping {close_quote} strategy derived from the direct cDNAmore » selection technique developed by Parimoo et al. This approach has allowed us to construct cDNA {open_quotes}minilibraries{close_quotes} using YAC DNA from the CMT1A region. One of the clones in these minilibraries has been mapped back to the CMT1A duplication. Other potentially interesting clones are in the process of further characterization. Furthermore, we have mapped several Genethon microsatellites in the 6 Mb YAC contig and some are located in the CMT1A duplicated region. These highly polymorphic markers should prove useful for diagnostic testing in CMT1A.« less

Shotgun Protein Sequencing with Meta-contig Assembly*

PubMed Central

Guthals, Adrian; Clauser, Karl R.; Bandeira, Nuno

2012-01-01

Full-length de novo sequencing from tandem mass (MS/MS) spectra of unknown proteins such as antibodies or proteins from organisms with unsequenced genomes remains a challenging open problem. Conventional algorithms designed to individually sequence each MS/MS spectrum are limited by incomplete peptide fragmentation or low signal to noise ratios and tend to result in short de novo sequences at low sequencing accuracy. Our shotgun protein sequencing (SPS) approach was developed to ameliorate these limitations by first finding groups of unidentified spectra from the same peptides (contigs) and then deriving a consensus de novo sequence for each assembled set of spectra (contig sequences). But whereas SPS enables much more accurate reconstruction of de novo sequences longer than can be recovered from individual MS/MS spectra, it still requires error-tolerant matching to homologous proteins to group smaller contig sequences into full-length protein sequences, thus limiting its effectiveness on sequences from poorly annotated proteins. Using low and high resolution CID and high resolution HCD MS/MS spectra, we address this limitation with a Meta-SPS algorithm designed to overlap and further assemble SPS contigs into Meta-SPS de novo contig sequences extending as long as 100 amino acids at over 97% accuracy without requiring any knowledge of homologous protein sequences. We demonstrate Meta-SPS using distinct MS/MS data sets obtained with separate enzymatic digestions and discuss how the remaining de novo sequencing limitations relate to MS/MS acquisition settings. PMID:22798278

Shotgun protein sequencing with meta-contig assembly.

PubMed

Guthals, Adrian; Clauser, Karl R; Bandeira, Nuno

2012-10-01

Full-length de novo sequencing from tandem mass (MS/MS) spectra of unknown proteins such as antibodies or proteins from organisms with unsequenced genomes remains a challenging open problem. Conventional algorithms designed to individually sequence each MS/MS spectrum are limited by incomplete peptide fragmentation or low signal to noise ratios and tend to result in short de novo sequences at low sequencing accuracy. Our shotgun protein sequencing (SPS) approach was developed to ameliorate these limitations by first finding groups of unidentified spectra from the same peptides (contigs) and then deriving a consensus de novo sequence for each assembled set of spectra (contig sequences). But whereas SPS enables much more accurate reconstruction of de novo sequences longer than can be recovered from individual MS/MS spectra, it still requires error-tolerant matching to homologous proteins to group smaller contig sequences into full-length protein sequences, thus limiting its effectiveness on sequences from poorly annotated proteins. Using low and high resolution CID and high resolution HCD MS/MS spectra, we address this limitation with a Meta-SPS algorithm designed to overlap and further assemble SPS contigs into Meta-SPS de novo contig sequences extending as long as 100 amino acids at over 97% accuracy without requiring any knowledge of homologous protein sequences. We demonstrate Meta-SPS using distinct MS/MS data sets obtained with separate enzymatic digestions and discuss how the remaining de novo sequencing limitations relate to MS/MS acquisition settings.

Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

PubMed

Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

2013-01-01

Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Characterisation of the Nevoid basal cell carcinoma (Gorlin`s) syndrome (NBCCS) gene region on chromosome 9q22-q31

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, D.J.; Digweed, M.; Sperling, K.

1994-09-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominantly inherited malignancy-associated disease of unknown etiology. The gene has been mapped to chromosome 9q22-q31 by us and other groups, using linkage analysis and loss of heterozygosity studies. Subsequent linkage and haplotype analyses from 133 meioses in NBCCS families has refined the position of the gene between D9S12 and D9S287. Since the gene for Fanconi`s Anaemia type C (FAAC) has been assigned to the same 9q region, we have performed linkage analysis between FACC and NBCCCS in NBCCS families. No recombination has been observed between NBCCS and FACC and maximum lodmore » scores of 34.98 and 11.94 occur for both diseases at the markers D9S196/D9S197. Southern blot analysis using an FACC cDNA probe has revealed no detectable rearrangements in our NBCCS patients. We have established a YAC contig spanning the region from D9S12 to D9S176 and STS content mapping in 22 YACs has allowed the ordering of 12 loci in the region, including the xeroderma pigmentosum type A (XPAC) gene, as follows: D9S151/D9S12P1 - D9S12P2 - D9S197 - D9S196 - D9S280 - FACC - D9S287/XPAC - D9S180 - D9S6 - D9S176. Using the contig we have been able to eliminate the {alpha}1 type XV collagen gene and the markers D9S119 and D9S297 from the NBCCS candidate region. Twelve YACs have been used to screen a chromosome 9 cosmid library and more than 1000 cosmids from the region have been identified to be used for the construction of a cosmid contig. A selection of these cosmids will be used for the isolation of coding sequencing from the region.« less

Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library.

PubMed

Nakamura, S; Asakawa, S; Ohmido, N; Fukui, K; Shimizu, N; Kawasaki, S

1997-05-01

We constructed a rice Bacterial Artificial Chromosome (BAC) library from green leaf protoplasts of the cultivar Shimokita harboring the rice blast resistance gene Pi-ta. The average insert size of 155 kb and the library size of seven genome equivalents make it one of the most comprehensive BAC libraries available, and larger than many plant YAC libraries. The library clones were plated on seven high density membranes of microplate size, enabling efficient colony identification in colony hybridization experiments. Seven percent of clones carried chloroplast DNA. By probing with markers close to the blast resistance genes Pi-ta2(closely linked to Pi-ta) and Pi-b, respectively located in the centromeric region of chromosome 12 and near the telomeric end of chromosome 2, on average 2.2 +/- 1.3 and 8.0 +/- 2.6 BAC clones/marker were isolated. Differences in chromosomal structures may contribute to this wide variation in yield. A contig of about 800 kb, consisting of 19 clones, was constructed in the Pi-ta2 region. This region had a high frequency of repetitive sequences. To circumvent this difficulty, we devised a "two-step walking" method. The contig spanned a 300 kb region between markers located at 0 cM and 0.3 cM from Pi-ta. The ratio of physical to genetic distances (> 1,000 kb/cM) was more than three times larger than the average of rice (300 kb/cM). The low recombination rate and high frequency of repetitive sequences may also be related to the near centromeric character of this region. Fluorescent in situ hybridization (FISH) with a BAC clone from the Pi-b region yielded very clear signals on the long arm of chromosome 2, while a clone from the Pi-ta2 region showed various cross-hybridizing signals near the centromeric regions of all chromosomes.

Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

PubMed

Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

1998-01-01

Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

Physical mapping of the torsion dystonia region of human chromosome 9q34

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozelius, L.J.; Hewett, J.; Shalish, C.

1994-09-01

Torsion dystonia is a syndrome characterized by loss of voluntary movements appearing as sustained muscle contractions and/or abnormal postures. The DYT1 gene is responsible for a subtype of torsion dystonia in which onset of symptoms tends to occur in a limb at an early age (mean 13 years) and to progress to a generalized state. Expression of the disease gene follows an autosomal dominant mode of inheritance with reduced penetrance. We initially mapped this gene to human chromosome 9q34 and have now defined its location to a < 1 cM region near the ASS locus based on historic recombination eventsmore » around a founder mutation in the Ashkenazic Jewish population. Using the CEPH YAC library and a chromosome 9 flow-sorted YAC library, we have generated a YAC contig spanning about 500 kb of this region. These YACs are being used to identify cosmids by direct hybridization to chromosome 9-specific cosmid libraries. Cosmids are being aligned by restriction digest patterns and by hybridization with oligonucleotide repeat probes. In addition, the cosmids are being {open_quotes}trapped{close_quotes} by exon amplification and these exons used to screen cDNA libraries. Thus far we have identified several candidate transcripts in this region.« less

Detection of a megabase deletion in a patient with brachio-oto-renal syndrome (BOR) and tricho-rhino-phalangeal syndrome (TRPS): Implications for mapping and cloning the BOR gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Wells, D.E.; Wagner, M.J.

Genetic linkage analysis has previously mapped the locus for the autosomal dominant disorder branchio-oto-renal syndrome (BOR) to the pericentric region of chromosome 8q. A YAC contig spanning the putative BOR region, from D8S543 to D8S541, was constructed and confirmed by sequence-tagged site content mapping using microsatellite markers and by DNA hybridization analysis. YACs spanning the BOR interval were used as fluorescence in situ hybridization probes on a cell line from a patient with BO and tricho-rhino-phalangeal syndrome I that involves a chromosome 8q rearrangement. In addition to the cytogenetically defined direct insertion of material from 8q13.3-q21.13 into 8q24.11, a previouslymore » unidentified deletion of just under one megabase was found in 8q13.3. These data narrowed the most likely location of the BOR gene to a region corresponding to the proximal two-thirds of YAC 869E10 between D8S543 and D8S279. 23 refs., 3 figs.« less

Physical and genetic mapping of the CMT4A locus and exclusion of PMP-2 as the defect in CMT4A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Othmane, K.B.; Loeb, D.; Roses, A.D.

1995-07-20

We have previously localized one form of the autosomal recessive Charcot-Marie-Tooth disease type 4 (CMT4A) to a 5-cM region of chromosome 8q13-q21. We now report the formation of a 7-Bp YAC contig spanning the region. This contig was used to map nine additional microsatellites and six STSs to this region, and subsequent haplotype analysis has narrowed the CMT4A flanking interval to less than 1 cM. In addition, using SSCP and our physical map, we have demonstrated that the myelin protein PMP-2, mapped by FISH to this region, is not the defect in CMT4A. 27 refs., 3 figs., 1 tab.

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Simplifier: a web tool to eliminate redundant NGS contigs.

PubMed

Ramos, Rommel Thiago Jucá; Carneiro, Adriana Ribeiro; Azevedo, Vasco; Schneider, Maria Paula; Barh, Debmalya; Silva, Artur

2012-01-01

Modern genomic sequencing technologies produce a large amount of data with reduced cost per base; however, this data consists of short reads. This reduction in the size of the reads, compared to those obtained with previous methodologies, presents new challenges, including a need for efficient algorithms for the assembly of genomes from short reads and for resolving repetitions. Additionally after abinitio assembly, curation of the hundreds or thousands of contigs generated by assemblers demands considerable time and computational resources. We developed Simplifier, a stand-alone software that selectively eliminates redundant sequences from the collection of contigs generated by ab initio assembly of genomes. Application of Simplifier to data generated by assembly of the genome of Corynebacterium pseudotuberculosis strain 258 reduced the number of contigs generated by ab initio methods from 8,004 to 5,272, a reduction of 34.14%; in addition, N50 increased from 1 kb to 1.5 kb. Processing the contigs of Escherichia coli DH10B with Simplifier reduced the mate-paired library 17.47% and the fragment library 23.91%. Simplifier removed redundant sequences from datasets produced by assemblers, thereby reducing the effort required for finalization of genome assembly in tests with data from Prokaryotic organisms. Simplifier is available at http://www.genoma.ufpa.br/rramos/softwares/simplifier.xhtmlIt requires Sun jdk 6 or higher.

Identification of a YAC spanning the translocation breakpoints in uterine leiomyomata, pulmonary chondroid hamartoma, and lipoma: Physical mapping of the 12q14-q15 breakpoint region in uterine leiomyomata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fejzo, M.S.; Yoon, S.J.; Kucherlapati, R.S.

1995-03-20

Uterine leiomyomata are the most common tumors in women and can cause abnormal uterine bleeding, pelvic pain, and infertility. Approximately 200,000 hysterectomies are performed annually in the U.S. to relieve patients of the medical sequelae of these benign neoplasms. Our efforts have focused on cloning the t(12;14)(q14-q15;q23-q24) breakpoint in uterine leiomyoma to further our understanding of the biology of these tumors. Thirty-nine YACs and six cosmids mapping to 12q14-q15 have been mapped by fluorescence in situ hybridization to tumor metaphase chromosomes containing a t(12;14). One YAC spanned the translocation breakpoint and was mapped to tumor metaphases from a pulmonary chondroidmore » hamartoma containing a t(12;14)(q14-q15;q23-q24) and a lipoma containing a t(12;15)(q15;q24); this YAC also spanned the breakpoint in these two tumors, suggesting that the same gene on chromosome 12 may be involved in the pathobiology of these distinct benign neoplasms. 41 refs., 2 figs., 1 tab.« less

A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

PubMed

Pedersen, Carsten; Wu, Boqian; Giese, Henriette

2002-11-01

A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

A contiguous clone map over 3 Mb on the long arm of chromosome 11 across a balanced translocation associated with schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, K.L.; Shibasaki, Yoshiro; Devon, R.S.

1995-08-10

Forty-nine clones derived by microdissection of a schizophrenia-associated t(1;11)(q42.1;q14.3) breakpoint region have been assigned by somatic cell hybrid mapping to seven discrete intervals on the long arm of human chromosome 11. Eleven of the clones were shown to map to a small region immediately distal to the translocation breakpoint on 11q. A 3-Mb contiguous clone map of this region was established by isolation of corresponding YAC recombinants. The contig was oriented and shown to traverse the translocation breakpoint by FISH and microsatellite marker analysis. This contig will facilitate the isolation of candidate sequences whose expression may be affected by themore » translocation. 28 refs., 4 figs., 3 tabs.« less

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

The photoreceptor cell-specific nuclear receptor gene (PNR) accounts for retinitis pigmentosa in the Crypto-Jews from Portugal (Marranos), survivors from the Spanish Inquisition.

PubMed

Gerber, S; Rozet, J M; Takezawa, S I; dos Santos, L C; Lopes, L; Gribouval, O; Penet, C; Perrault, I; Ducroq, D; Souied, E; Jeanpierre, M; Romana, S; Frézal, J; Ferraz, F; Yu-Umesono, R; Munnich, A; Kaplan, J

2000-09-01

The last Crypto-Jews (Marranos) are the survivors of Spanish Jews who were persecuted in the late fifteenth century, escaped to Portugal and were forced to convert to save their lives. Isolated groups still exist in mountainous areas such as Belmonte in the Beira-Baixa province of Portugal. We report here the genetic study of a highly consanguineous endogamic population of Crypto-Jews of Belmonte affected with autosomal recessive retinitis pigmentosa (RP). A genome-wide search for homozygosity allowed us to localize the disease gene to chromosome 15q22-q24 (Zmax=2.95 at theta=0 at the D15S131 locus). Interestingly, the photoreceptor cell-specific nuclear receptor (PNR) gene, the expression of which is restricted to the outer nuclear layer of retinal photoreceptor cells, was found to map to the YAC contig encompassing the disease locus. A search for mutations allowed us to ascribe the RP of Crypto-Jews of Belmonte to a homozygous missense mutation in the PNR gene. Preliminary haplotype studies support the view that this mutation is relatively ancient but probably occurred after the population settled in Belmonte.

Delimitation of duplicated segments and identification of their parental origin in two partial chromosome 3p duplications.

PubMed

Antonini, Sylvie; Kim, Chong A; Sugayama, Sofia M; Vianna-Morgante, Angela M

2002-11-22

Two chromosome 3 short arm duplications identified through G-banding were further investigated using fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR) of microsatellite markers, aiming at mapping breakpoints and disclosing mechanisms of origin of these chromosome aberrations. Patient 1 was found to be a mosaic: a 3p12 --> 3p21 duplication was observed in most of his cells, and a normal cell line occurred with a frequency of about 3% in blood. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the short-arm duplication. Using FISH of short-arm sequences, the YAC 961_h_3 was shown to contain the proximal breakpoint (3p12.1 or 3p12.2), and the distal breakpoint was located between the YACs 729_c_3 and 806_h_2, which are adjacent in the WC 3.10 contig (3p21.1). In Patient 2, G-banding indicated a 3p21 --> 3p24 duplication, without mosaicism. In situ hybridization of chromosome 3 short- and long-arm libraries confirmed the duplication of short-arm sequences. FISH of chromosome 3 sequences showed that the YAC 749_a_7 spanned the proximal breakpoint (3p21.33). The distal breakpoint mapped to the interval between YACs 932_b_6 (3p24.3) and 909_b_6 (3p25). In both cases, microsatellite genotyping pointed to a rearrangement between paternal sister chromatids. Copyright 2002 Wiley-Liss, Inc.

ESTminer: a Web interface for mining EST contig and cluster databases.

PubMed

Huang, Yecheng; Pumphrey, Janie; Gingle, Alan R

2005-03-01

ESTminer is a Web application and database schema for interactive mining of expressed sequence tag (EST) contig and cluster datasets. The Web interface contains a query frame that allows the selection of contigs/clusters with specific cDNA library makeup or a threshold number of members. The results are displayed as color-coded tree nodes, where the color indicates the fractional size of each cDNA library component. The nodes are expandable, revealing library statistics as well as EST or contig members, with links to sequence data, GenBank records or user configurable links. Also, the interface allows 'queries within queries' where the result set of a query is further filtered by the subsequent query. ESTminer is implemented in Java/JSP and the package, including MySQL and Oracle schema creation scripts, is available from http://cggc.agtec.uga.edu/Data/download.asp agingle@uga.edu.

Cloning of the anhidrotic ectodermal dysplasia gene: Identification of cDNAs associated with CpG islands mapped near translocation breakpoint in two female patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, A.K.; Schlessinger, D.; Kere, J.

1994-09-01

The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less

AAV-dominant negative tumor necrosis factor (DN-TNF) gene transfer to the striatum does not rescue medium spiny neurons in the YAC128 mouse model of Huntington's disease.

PubMed

Alto, Laura Taylor; Chen, Xi; Ruhn, Kelly A; Treviño, Isaac; Tansey, Malú G

2014-01-01

CNS inflammation is a hallmark of neurodegenerative disease, and recent studies suggest that the inflammatory response may contribute to neuronal demise. In particular, increased tumor necrosis factor (TNF) signaling is implicated in the pathology of both Parkinson's disease (PD) and Alzheimer's disease (AD). We have previously shown that localized gene delivery of dominant negative TNF to the degenerating brain region can limit pathology in animal models of PD and AD. TNF is upregulated in Huntington's disease (HD), like in PD and AD, but it is unknown whether TNF signaling contributes to neuronal degeneration in HD. We used in vivo gene delivery to test whether selective reduction of soluble TNF signaling could attenuate medium spiny neuron (MSN) degeneration in the YAC128 transgenic (TG) mouse model of Huntington's disease (HD). AAV vectors encoding cDNA for dominant-negative tumor necrosis factor (DN-TNF) or GFP (control) were injected into the striatum of young adult wild type WT and YAC128 TG mice and achieved 30-50% target coverage. Expression of dominant negative TNF protein was confirmed immunohistologically and biochemically and was maintained as mice aged to one year, but declined significantly over time. However, the extent of striatal DN-TNF gene transfer achieved in our studies was not sufficient to achieve robust effects on neuroinflammation, rescue degenerating MSNs or improve motor function in treated mice. Our findings suggest that alternative drug delivery strategies should be explored to determine whether greater target coverage by DN-TNF protein might afford some level of neuroprotection against HD-like pathology and/or that soluble TNF signaling may not be the primary driver of striatal neuroinflammation and MSN loss in YAC128 TG mice.

Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

PubMed

Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

1998-08-01

Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

Genes in FRA16D and FRA7G Mutated in Prostate Cancer.

DTIC Science & Technology

1999-06-01

Huang H, Nelson M , Smith DI. Cloning and characterization of keratin 21 (K21) highly induced by histone deacetylase inhibitors during differentiation...A395. Kawakami M , Hartmann L, Huntley B, Smith DI, Shridhar V. Allele loss on 16q in high-grade invasive epithelial ovarian cancer. Amer. J. Hum...CEN m N CO o < 1 WC7.7 I-- CD co r-- Q CO CO CD CO Q _L_ 921B4 912D9 _1_ 887 D11 WC7.6 A GAP BETWEEN YAC CONTIGS tu O CD

CSAR-web: a web server of contig scaffolding using algebraic rearrangements.

PubMed

Chen, Kun-Tze; Lu, Chin Lung

2018-05-04

CSAR-web is a web-based tool that allows the users to efficiently and accurately scaffold (i.e. order and orient) the contigs of a target draft genome based on a complete or incomplete reference genome from a related organism. It takes as input a target genome in multi-FASTA format and a reference genome in FASTA or multi-FASTA format, depending on whether the reference genome is complete or incomplete, respectively. In addition, it requires the users to choose either 'NUCmer on nucleotides' or 'PROmer on translated amino acids' for CSAR-web to identify conserved genomic markers (i.e. matched sequence regions) between the target and reference genomes, which are used by the rearrangement-based scaffolding algorithm in CSAR-web to order and orient the contigs of the target genome based on the reference genome. In the output page, CSAR-web displays its scaffolding result in a graphical mode (i.e. scalable dotplot) allowing the users to visually validate the correctness of scaffolded contigs and in a tabular mode allowing the users to view the details of scaffolds. CSAR-web is available online at http://genome.cs.nthu.edu.tw/CSAR-web.

In Vivo MRI Evidence that Neuropathology is Attenuated by Cognitive Enrichment in the Yac128 Huntington's Disease Mouse Model.

PubMed

Steventon, Jessica J; Harrison, David J; Trueman, Rebecca C; Rosser, Anne E; Jones, Derek K; Brooks, Simon P

2015-01-01

Environmental enrichment has been shown to improve symptoms and reduce neuropathology in mouse models of Huntington's disease (HD); however results are limited to ex vivo techniques with associated shortcomings. In-vivo magnetic resonance imaging (MRI) can overcome some of the shortcomings and is applied for the first time here to assess the effect of a cognitive intervention in a mouse model of HD. We aimed to investigate whether in-vivo high-field MRI can detect a disease-modifying effect in tissue macrostructure following a cognitive enrichment regime. YAC128 transgenic and wild type mice were exposed to cognitive enrichment throughout their lifetime. At 20-months old, mice were scanned with a T2-weighted MRI sequence and a region-of-interest (ROI) approach was used to examine structural changes. Locomotor activity and performance on the rotarod and serial discrimination watermaze task were assessed to measure motor and cognitive function respectively. Mice exposed to cognitive enrichment were more active and able to stay on a rotating rod longer compared to control mice, with comparable rotarod performance between HD enriched mice and wild-type mice. YAC128 mice demonstrated cognitive impairments which were not improved by cognitive enrichment. In-vivo MRI revealed a reduction in the degree of caudate-putamen atrophy in the enriched HD mice. We provide in vivo evidence of a beneficial effect of environmental enrichment on neuropathology and motor function in a HD mouse model. This demonstrates the efficacy of MRI in a model of HD and provides the basis for an in-vivo non-destructive outcome measure necessary for longitudinal study designs to understand the effect of enrichment with disease progression.

CoMet: a workflow using contig coverage and composition for binning a metagenomic sample with high precision.

PubMed

Herath, Damayanthi; Tang, Sen-Lin; Tandon, Kshitij; Ackland, David; Halgamuge, Saman Kumara

2017-12-28

In metagenomics, the separation of nucleotide sequences belonging to an individual or closely matched populations is termed binning. Binning helps the evaluation of underlying microbial population structure as well as the recovery of individual genomes from a sample of uncultivable microbial organisms. Both supervised and unsupervised learning methods have been employed in binning; however, characterizing a metagenomic sample containing multiple strains remains a significant challenge. In this study, we designed and implemented a new workflow, Coverage and composition based binning of Metagenomes (CoMet), for binning contigs in a single metagenomic sample. CoMet utilizes coverage values and the compositional features of metagenomic contigs. The binning strategy in CoMet includes the initial grouping of contigs in guanine-cytosine (GC) content-coverage space and refinement of bins in tetranucleotide frequencies space in a purely unsupervised manner. With CoMet, the clustering algorithm DBSCAN is employed for binning contigs. The performances of CoMet were compared against four existing approaches for binning a single metagenomic sample, including MaxBin, Metawatt, MyCC (default) and MyCC (coverage) using multiple datasets including a sample comprised of multiple strains. Binning methods based on both compositional features and coverages of contigs had higher performances than the method which is based only on compositional features of contigs. CoMet yielded higher or comparable precision in comparison to the existing binning methods on benchmark datasets of varying complexities. MyCC (coverage) had the highest ranking score in F1-score. However, the performances of CoMet were higher than MyCC (coverage) on the dataset containing multiple strains. Furthermore, CoMet recovered contigs of more species and was 18 - 39% higher in precision than the compared existing methods in discriminating species from the sample of multiple strains. CoMet resulted in higher precision

U50: A New Metric for Measuring Assembly Output Based on Non-Overlapping, Target-Specific Contigs.

PubMed

Castro, Christina J; Ng, Terry Fei Fan

2017-11-01

Advances in next-generation sequencing technologies enable routine genome sequencing, generating millions of short reads. A crucial step for full genome analysis is the de novo assembly, and currently, performance of different assembly methods is measured by a metric called N 50 . However, the N 50 value can produce skewed, inaccurate results when complex data are analyzed, especially for viral and microbial datasets. To provide a better assessment of assembly output, we developed a new metric called U 50 . The U 50 identifies unique, target-specific contigs by using a reference genome as baseline, aiming at circumventing some limitations that are inherent to the N 50 metric. Specifically, the U 50 program removes overlapping sequence of multiple contigs by utilizing a mask array, so the performance of the assembly is only measured by unique contigs. We compared simulated and real datasets by using U 50 and N 50 , and our results demonstrated that U 50 has the following advantages over N 50 : (1) reducing erroneously large N 50 values due to a poor assembly, (2) eliminating overinflated N 50 values caused by large measurements from overlapping contigs, (3) eliminating diminished N 50 values caused by an abundance of small contigs, and (4) allowing comparisons across different platforms or samples based on the new percentage-based metric UG 50 %. The use of the U 50 metric allows for a more accurate measure of assembly performance by analyzing only the unique, non-overlapping contigs. In addition, most viral and microbial sequencing have high background noise (i.e., host and other non-targets), which contributes to having a skewed, misrepresented N 50 value-this is corrected by U 50 . Also, the UG 50 % can be used to compare assembly results from different samples or studies, the cross-comparisons of which cannot be performed with N 50 .

Educational NASA Computational and Scientific Studies (enCOMPASS)

NASA Technical Reports Server (NTRS)

Memarsadeghi, Nargess

2013-01-01

Educational NASA Computational and Scientific Studies (enCOMPASS) is an educational project of NASA Goddard Space Flight Center aimed at bridging the gap between computational objectives and needs of NASA's scientific research, missions, and projects, and academia's latest advances in applied mathematics and computer science. enCOMPASS achieves this goal via bidirectional collaboration and communication between NASA and academia. Using developed NASA Computational Case Studies in university computer science/engineering and applied mathematics classes is a way of addressing NASA's goals of contributing to the Science, Technology, Education, and Math (STEM) National Objective. The enCOMPASS Web site at http://encompass.gsfc.nasa.gov provides additional information. There are currently nine enCOMPASS case studies developed in areas of earth sciences, planetary sciences, and astrophysics. Some of these case studies have been published in AIP and IEEE's Computing in Science and Engineering magazines. A few university professors have used enCOMPASS case studies in their computational classes and contributed their findings to NASA scientists. In these case studies, after introducing the science area, the specific problem, and related NASA missions, students are first asked to solve a known problem using NASA data and past approaches used and often published in a scientific/research paper. Then, after learning about the NASA application and related computational tools and approaches for solving the proposed problem, students are given a harder problem as a challenge for them to research and develop solutions for. This project provides a model for NASA scientists and engineers on one side, and university students, faculty, and researchers in computer science and applied mathematics on the other side, to learn from each other's areas of work, computational needs and solutions, and the latest advances in research and development. This innovation takes NASA science and

CBrowse: a SAM/BAM-based contig browser for transcriptome assembly visualization and analysis.

PubMed

Li, Pei; Ji, Guoli; Dong, Min; Schmidt, Emily; Lenox, Douglas; Chen, Liangliang; Liu, Qi; Liu, Lin; Zhang, Jie; Liang, Chun

2012-09-15

To address the impending need for exploring rapidly increased transcriptomics data generated for non-model organisms, we developed CBrowse, an AJAX-based web browser for visualizing and analyzing transcriptome assemblies and contigs. Designed in a standard three-tier architecture with a data pre-processing pipeline, CBrowse is essentially a Rich Internet Application that offers many seamlessly integrated web interfaces and allows users to navigate, sort, filter, search and visualize data smoothly. The pre-processing pipeline takes the contig sequence file in FASTA format and its relevant SAM/BAM file as the input; detects putative polymorphisms, simple sequence repeats and sequencing errors in contigs and generates image, JSON and database-compatible CSV text files that are directly utilized by different web interfaces. CBowse is a generic visualization and analysis tool that facilitates close examination of assembly quality, genetic polymorphisms, sequence repeats and/or sequencing errors in transcriptome sequencing projects. CBrowse is distributed under the GNU General Public License, available at http://bioinfolab.muohio.edu/CBrowse/ liangc@muohio.edu or liangc.mu@gmail.com; glji@xmu.edu.cn Supplementary data are available at Bioinformatics online.

An integrated genetic and physical map of the autosomal recessive polycystic kidney disease region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lens, X.M.; Onuchic, L.F.; Daoust, M.

1997-05-01

Autosomal recessive polycystic kidney disease is one of the most common hereditary renal cystic diseases in children. Genetic studies have recently assigned the only known locus for this disorder, PKHD1, to chromosome 6p21-p12. We have generated a YAC contig that spans {approximately}5 cM of this region, defined by the markers D6S1253-D6S295, and have mapped 43 sequence-tagged sites (STS) within this interval. This set includes 20 novel STSs, which define 12 unique positions in the region, and three ESTs. A minimal set of two YACs spans the segment D6S465-D6S466, which contains PKHD1, and estimates of their sizes based on information inmore » public databases suggest that the size of the critical region is <3.1 Mb. Twenty-eight STSs map to this interval, giving an average STS density of <1/150 kb. These resources will be useful for establishing a complete trancription map of the PKHD1 region. 10 refs., 1 fig., 1 tab.« less

The Langer-Giedion syndrome: Molecular dissection of a contiguous gene syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luedecke, H.J.; Pillo, B.L.; Nardmann, J.

The tricho-rhino-phalangeal syndromes TRPS I and II, which are characterized by craniofacial dysmorphism and skeletal abnormalities, are caused by genetic defects in 8q24.1. The presence of multiple exostoses (EXT) distinguishes TRPS II (Langer-Giedion syndrome, LGS) from TRPS I. Multiple exostoses also occur as an autosomal dominant trait displaying genetic heterogeneity. One of the EXT loci maps to 8q24.1. Previously, we had determined a probe order (cen-D8S50-D8S98-D8S51-D8S67-D8S43-tel) for the Langer-Giedion syndrome chromosome region. The shortest region of deletion overlap in LGS patients is defined by D8S51 and D8S67. Interestingly, a patient with TRPS I and a large deletion was found tomore » be intact for these two loci, but deleted for more proximal loci. We have now constructed a complete yeast artificial chromosome (YAC) contig for the entire LGCR. Some of these YACs were used to perform fluorescence in situ hybridization analyses in patients with chromosomal abnormalities associated with TRPS I, TRPS II and EXT. One YAC containing D8S98 spans the translocation breakpoint in a patient with TRPS I and (8;18)(q24.11;q13.3;q21.13). The translocation breakpoint in a patient with TRPS II and t(4;8)(p15.3;q24.1) is covered by a D8S67 YAC. Interestingly, this YAC also spans the inversion breakpoint in a patient with EXT and inv(8)(p23;q24.1). The data indicate that most of the putative TRPS I gene is located between D8S98 and D8S51, that the putative EXT gene maps to D8S67, and that both genes are 1.5 Mbp apart. We are currently analyzing putative gene sequences in the vicinity of the chromosomal breakpoints.« less

Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin

USDA-ARS?s Scientific Manuscript database

Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin. This study included 2 submissions with a total of 9.8 million bp of assembled contigs....

Anchoring and ordering NGS contig assemblies by population sequencing (POPSEQ)

PubMed Central

Mascher, Martin; Muehlbauer, Gary J; Rokhsar, Daniel S; Chapman, Jarrod; Schmutz, Jeremy; Barry, Kerrie; Muñoz-Amatriaín, María; Close, Timothy J; Wise, Roger P; Schulman, Alan H; Himmelbach, Axel; Mayer, Klaus FX; Scholz, Uwe; Poland, Jesse A; Stein, Nils; Waugh, Robbie

2013-01-01

Next-generation whole-genome shotgun assemblies of complex genomes are highly useful, but fail to link nearby sequence contigs with each other or provide a linear order of contigs along individual chromosomes. Here, we introduce a strategy based on sequencing progeny of a segregating population that allows de novo production of a genetically anchored linear assembly of the gene space of an organism. We demonstrate the power of the approach by reconstructing the chromosomal organization of the gene space of barley, a large, complex and highly repetitive 5.1 Gb genome. We evaluate the robustness of the new assembly by comparison to a recently released physical and genetic framework of the barley genome, and to various genetically ordered sequence-based genotypic datasets. The method is independent of the need for any prior sequence resources, and will enable rapid and cost-efficient establishment of powerful genomic information for many species. PMID:23998490

Genetic and physical mapping at the limb-girdle muscular dystrophy locus (LGMD2B) on chromosome 2p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bashir, R.; Keers, S.; Strachan, T.

1996-04-01

The limb-girdle muscular dystrophies (LGMD) are a genetically heterogeneous group of disorders, different forms of which have been mapped to at least six distinct genetic loci. We have mapped to at least six distinct genetic loci. We have mapped an autosomal recessive form of LGMD (LGMD2B) to chromosome 2p13. Two other conditions have been shown to map to this region or to the homologous region in mouse: a gene for a form of autosomal recessive distal muscular dystrophy, Miyoshi myopathy, shows linkage to the same markers on chromosome 2p as LGMD2B, and an autosomal recessive mouse mutation mnd2, in whichmore » there is rapidly progressive paralysis and muscle atrophy, has been mapped to mouse chromosome 6 to a region showing conserved synteny with human chromosome 2p12-p13. We have assembled a 6-cM YAC contig spanning the LGMD2B locus and have mapped seven genes and 13 anonymous polymorphic microsatellites to it. Using haplotype analysis in the linked families, we have narrowed our region of interest to a 0-cM interval between D2S2113 and D2S145, which does not overlap with the critical region for mnd2 in mouse. Use of these most closely linked markers will help to determine the relationship between LGMD2B and Miyoshi myopathy. YACs selected from our contig will be the starting point for the cloning of the LGMD2B gene and thereby establish the biological basis for this form of muscular dystrophy and its relationship with the other limb-girdle muscular dystrophies. 26 refs., 6 figs.« less

A candidate region for Nevoid Basal Cell Carcinoma Syndrome defined by genetic and physical mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wainwright, B.; Negus, K.; Berkman, J.

1994-09-01

Nevoid Basal Cell Carcinoma Syndrome (NBCCS, or Gorlin`s syndrome) is a cancer predisposition syndrome charcterized by multiple basal cell carcinomas (BCCs) and diverse developmental defects. The gene responsible for NBCCS, which is most likely to be a tumor suppressor gene, has previously been mapped to 9q22.3-q31 in a 12 cM interval between the microsatellite marker loci D9S12 and D9S109. Combined multipoint and haplotype analyses of Australian pedigrees has further refined the localization to a 2 cM interval between markers D9S196 and D9S180. Our loss of heterozygosity (LOH) studies from sporadic (n= 58) and familial (n=41) BCCs indicate that 50% havemore » deletions within the NBCCS candidate region. All LOH is consistent with the genetic mapping of the NBCCS locus. Additionally, one sporadic tumor indicates that the smallest region of overlap in the deletions is within the interval D9S287 (proximal) and D9S180 (distal). A series of YAC clones from within this region has been mapped by FISH to examine chimerism. These clones, which have been mapped with respect to one another, form a contig which encompasses the candidate region from D9S196 to D9S180.« less

Improved assemblies using a source-agnostic pipeline for MetaGenomic Assembly by Merging (MeGAMerge) of contigs

DOE PAGES

Scholz, Matthew; Lo, Chien -Chi; Chain, Patrick S. G.

2014-10-01

Assembly of metagenomic samples is a very complex process, with algorithms designed to address sequencing platform-specific issues, (read length, data volume, and/or community complexity), while also faced with genomes that differ greatly in nucleotide compositional biases and in abundance. To address these issues, we have developed a post-assembly process: MetaGenomic Assembly by Merging (MeGAMerge). We compare this process to the performance of several assemblers, using both real, and in-silico generated samples of different community composition and complexity. MeGAMerge consistently outperforms individual assembly methods, producing larger contigs with an increased number of predicted genes, without replication of data. MeGAMerge contigs aremore » supported by read mapping and contig alignment data, when using synthetically-derived and real metagenomic data, as well as by gene prediction analyses and similarity searches. Ultimately, MeGAMerge is a flexible method that generates improved metagenome assemblies, with the ability to accommodate upcoming sequencing platforms, as well as present and future assembly algorithms.« less

Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, W.M.; Dausman, J.; Beard, C.

Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protectionmore » analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.« less

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

ENCOMPASS: A SAGA based environment for the compositon of programs and specifications, appendix A

NASA Technical Reports Server (NTRS)

Terwilliger, Robert B.; Campbell, Roy H.

1985-01-01

ENCOMPASS is an example integrated software engineering environment being constructed by the SAGA project. ENCOMPASS supports the specification, design, construction and maintenance of efficient, validated, and verified programs in a modular programming language. The life cycle paradigm, schema of software configurations, and hierarchical library structure used by ENCOMPASS is presented. In ENCOMPASS, the software life cycle is viewed as a sequence of developments, each of which reuses components from the previous ones. Each development proceeds through the phases planning, requirements definition, validation, design, implementation, and system integration. The components in a software system are modeled as entities which have relationships between them. An entity may have different versions and different views of the same project are allowed. The simple entities supported by ENCOMPASS may be combined into modules which may be collected into projects. ENCOMPASS supports multiple programmers and projects using a hierarchical library system containing a workspace for each programmer; a project library for each project, and a global library common to all projects.

Encompassing Sexual Medicine within Psychiatry: Pros and Cons

ERIC Educational Resources Information Center

Segraves, Robert Taylor

2010-01-01

Objective: This article examines the positive and negative aspects of psychiatry encompassing sexual medicine within its purview. Methods: MEDLINE searches for the period between 1980 to the present were performed with the terms "psychiatry," "sexual medicine," and "sexual dysfunction." In addition, sexual medicine texts were reviewed for chapters…

Sequence analysis and transcript identification within 1.5 MB of DNA deleted together with the NDP and MAO genes in atypical Norrie disease patients presenting with a profound phenotype.

PubMed

Suárez-Merino, B; Bye, J; McDowall, J; Ross, M; Craig, I W

2001-06-01

Mutations at the Norrie disease gene locus, NDP, manifest in a broad range of defects. These range from a relatively mild, late-onset, exudative vitreoretinopathy to congenital blindness and sensorineural deafness combined, in some cases, with mental retardation. In addition, extensive deletions involving the NDP locus, located at Xp11.3, the adjacent monoamine oxidadase genes MAOA and MAOB, and additional material, result in a more severe pattern of symptoms. The phenotypes include all or some of the following; mental retardation, involuntary movements, hypertensive crises and hypogonadism. We extended an existing YAC contig to embrace the boundaries of three of the largest deletions and converted this into four PAC contigs. Computer analysis and experimental data have resulted in the identification of several putative loci, including a phosphatase inhibitor 2-like gene (dJ154.1) and a 250-bp sequence which resembles a homeobox domain (dA113.3), 1.2 Mb and 400 kb respectively from the MAO/NDP cluster. The pattern of expression of dJ154.1 suggests that it may represent an important factor contributing to the complex phenotypes of these deletion patients. Hum Mutat 17:523, 2001. Copyright 2001 Wiley-Liss, Inc.

Anchoring 9,371 Maize Expressed Sequence Tagged Unigenes to the Bacterial Artificial Chromosome Contig Map by Two-Dimensional Overgo Hybridization1

PubMed Central

Gardiner, Jack; Schroeder, Steven; Polacco, Mary L.; Sanchez-Villeda, Hector; Fang, Zhiwei; Morgante, Michele; Landewe, Tim; Fengler, Kevin; Useche, Francisco; Hanafey, Michael; Tingey, Scott; Chou, Hugh; Wing, Rod; Soderlund, Carol; Coe, Edward H.

2004-01-01

Our goal is to construct a robust physical map for maize (Zea mays) comprehensively integrated with the genetic map. We have used a two-dimensional 24 × 24 overgo pooling strategy to anchor maize expressed sequence tagged (EST) unigenes to 165,888 bacterial artificial chromosomes (BACs) on high-density filters. A set of 70,716 public maize ESTs seeded derivation of 10,723 EST unigene assemblies. From these assemblies, 10,642 overgo sequences of 40 bp were applied as hybridization probes. BAC addresses were obtained for 9,371 overgo probes, representing an 88% success rate. More than 96% of the successful overgo probes identified two or more BACs, while 5% identified more than 50 BACs. The majority of BACs identified (79%) were hybridized with one or two overgos. A small number of BACs hybridized with eight or more overgos, suggesting that these BACs must be gene rich. Approximately 5,670 overgos identified BACs assembled within one contig, indicating that these probes are highly locus specific. A total of 1,795 megabases (Mb; 87%) of the total 2,050 Mb in BAC contigs were associated with one or more overgos, which are serving as sequence-tagged sites for single nucleotide polymorphism development. Overgo density ranged from less than one overgo per megabase to greater than 20 overgos per megabase. The majority of contigs (52%) hit by overgos contained three to nine overgos per megabase. Analysis of approximately 1,022 Mb of genetically anchored BAC contigs indicates that 9,003 of the total 13,900 overgo-contig sites are genetically anchored. Our results indicate overgos are a powerful approach for generating gene-specific hybridization probes that are facilitating the assembly of an integrated genetic and physical map for maize. PMID:15020742

Cross-species bacterial artificial chromosome (BAC) library screening via overgo-based hybridization and BAC-contig mapping of a yield enhancement quantitative trait locus (QTL) yld1.1 in the Malaysian wild rice Oryza rufipogon.

PubMed

Song, Beng-Kah; Nadarajah, Kalaivani; Romanov, Michael N; Ratnam, Wickneswari

2005-01-01

The construction of BAC-contig physical maps is an important step towards a partial or ultimate genome sequence analysis. Here, we describe our initial efforts to apply an overgo approach to screen a BAC library of the Malaysian wild rice species, Oryza rufipogon. Overgo design is based on repetitive element masking and sequence uniqueness, and uses short probes (approximately 40 bp), making this method highly efficient and specific. Pairs of 24-bp oligos that contain an 8-bp overlap were developed from the publicly available genomic sequences of the cultivated rice, O. sativa, to generate 20 overgo probes for a 1-Mb region that encompasses a yield enhancement QTL yld1.1 in O. rufipogon. The advantages of a high similarity in melting temperature, hybridization kinetics and specific activities of overgos further enabled a pooling strategy for library screening by filter hybridization. Two pools of ten overgos each were hybridized to high-density filters representing the O. rufipogon genomic BAC library. These screening tests succeeded in providing 69 PCR-verified positive hits from a total of 23,040 BAC clones of the entire O. rufipogon library. A minimal tilling path of clones was generated to contribute to a fully covered BAC-contig map of the targeted 1-Mb region. The developed protocol for overgo design based on O. sativa sequences as a comparative genomic framework, and the pooled overgo hybridization screening technique are suitable means for high-resolution physical mapping and the identification of BAC candidates for sequencing.

Isolation of candidate genes of Friedreich`s ataxia on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Pandolfo, M.

1994-09-01

Friedreich`s ataxia (FRDA) is an autosomal recessive degenerative disease involving the central and peripheral nervous system and the heart. The mutated gene in FRDA has recently been localized within a 450 Kb interval on chromosome 9q13 between the markers D9S202/FR1/FR8. We have been able to confirm such localization for the disease gene by analysis of extended haplotype in consanguineous families. Cases of loss of marker homozygosity, which are likely to be due to ancient recombinations, have been found to involve D9S110, D9S15, and D9S111 on the telomeric side, and FR5 on the centromeric side, while homozygosity was always found formore » a core haplotype including D9S5, FD1, and D9S202. We constructed a YAC contig spanning the region between the telomeric markers and FR5, and cosmids have been obtained from the YACs. In order to isolate transcribed sequences from the FRDA candidate region we are utilizing a combination of approaches, including hybridization of YACs and cosmids to an arrayed human heart cDNA library, cDNA direct selection, and exon amplification. A transcribed sequence near the telomeric end of the region has been isolated by cDNA direct selection using pooled cosmids as genomic template and primary human heart, muscle, brain, liver and placenta cDNAs as cDNA source. We have shown this sequence to be the human equivalent of ZO-2, a tight junction protein previously described in the dog. No mutations of this gene have been found in FRDA subjects. Additional cDNA have recently been isolated and they are currently being evaluated.« less

Mapping of the 3q27 region involved in Dup(3q) syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rizzu, P.; Baldini, A.; Overhauser, J.

1994-09-01

The duplication 3q syndrome is characterized by partial trisomy of a segment of the long arm of chromosome 3. We have previously found that 3q26.3-3q27 is the minimal region of trisomy overlap. This critical region (CR) is delimited by two patient chromosome breakpoints, approximately 10 cM apart. In order to identify the gene(s) responsible for the Dup(3q) phenotype, we are generating a physical map of the region and identifying expressed sequences. First, we have generated a cytological map using two- and three-color fluorescence in situ hybridization on metaphase and interphase chromosomes. Results allowed us to determine the centromere-telomere orientation, ordermore » and relative distances of six cosmid clones mapped to the CR. Because some of the markers used are part of the consensus chromosome 3 map, our data were easily integrated with existing mapping information. Subsequently, we have included in the map YAC clones positive for polymorphic PCR markers identified by CEPH-Genethon, as well as newly isolated YACs. We have assigned them to the critical region 7 of the Genethon polymorphic markers and linked them to three YAC contigs. Currently our map includes two of the five genes known to map in this region. Interestingly, we found that these two functionally related genes (kininogen and histidin-rich glycoprotein) map to the same 1 Mb genomic fragment. As the physical map is being constructed we are searching for expressed sequences. Positive cDNAs have been found and their characterization is in progress. In conclusion, we will present an integrated map of 3q27 that includes genetic, physical and cytological information as well as gene annotation. As Dup(3q) syndrome is likely to be a contiguous gene syndrome, such a map will be necessary for our understanding of this multiple congenital anomaly.« less

A 405-kb cosmid contig and HindIII restriction map of the progressive myoclonus epilepsy type 1 (EPM1) candidate region in 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafreniere, R.G.; Rouleau, G.A.; De Jong, P.J.

1995-09-01

As a step toward identifying the molecular defect in patients afflicted with progressive myoclonus epilepsy type 1 (EPM1), we have assembled a cosmid contig of the candidate EPM1 region in 21q22.3. The contig constitutes a collection of 87 different cosmids spanning 405 kb based on a derived HindIII restriction map. Potential CpG-rich islands have been identified based on the restriction map generated from eight different rare-cutting enzymes. This contig contains the genetic material required for the isolation of expressed sequences and the identification of the gene defective in EPM1 and possibly other disorders mapping to this region. 15 refs., 1more » fig.« less

Physical mapping of the Gorlin syndrome region on 9q22 by pulsed field gel electrophoresis (PFGE) and FISH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levanat, S.; Gailani, M.; Dean, M.

1994-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by basal cell carcinomas, medulloblastomas, and ovarian fibromas, as well as widespread developmental defects. Linkage and tumor deletion studies localized the gene for this syndrome to the 3 cM region on chromosome 9q22 between D9S196 and D9S180. Several groups have constructed YAC contigs of this region, but many of the YACs are known to contain rearrangements. Mapping by PGE and FISH is useful in further characterization of the relationship between physical distance and genetic distance. We isolated seven cosmids mapping to this region (D9S180, D9S196, D9S287, Col 15A1, XPA and two newmore » anonymous cosmids). FISH gave a distance between D9S196 and D9S180 of at least 2 Mb and showed that Col15A1, previously considered as a candidate gene, mapped a few hundred kb distal to S180. For PFGE, DNA blocks from normal and 20 Gorlin syndrome patients were digested with 5 restriction enzymes and probed with single copy fragments of the seven cosmids. No aberrant bands have been identified in patients. Non-overlapping Not I fragments from these seven markers totalled 2.3 kb. Given an average gene density, a region of this size would contain 50-100 genes.« less

Recombinational and physical mapping of the locus for primary open-angle glaucoma (GLC1A) on chromosome 1q23-q25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belmouden, A.; Adam, M.F.; De Dinechin, S.D.

1997-02-01

Primary open-angle glaucoma (POAG) is a leading cause of irreversible blindness in industrialized countries. A locus for juvenile-onset POAG, GLC1A, has been mapped to 1q21-q31 in a 9-cM interval. With recombinant haplotypes, we have now reduced the GLC1A interval to a maximum of 3 cM, between the D1S452/NGA1/D1S210 and NGA5 loci. These loci are 2.8 Mb apart on a 4.7-Mb contig that we have completed between the D1S2851 and D1S218 loci and that includes 96 YAC clones and 48 STSs. The new GLC1A interval itself is now covered by 25 YACs, 30 STSs, and 16 restriction enzyme site landmarks. Themore » lack of a NotI site suggests that the region has few CpG islands and a low gene content. This is compatible with its predominant cytogenetic location on the 1q24 G-band. Finally, we have excluded important candidate genes, including genes coding for three ATPases (AMB1, ATP2B4, ATPlA2), an ion channel (VDAC4), antithrombine III (AT3), and prostaglandin synthase (PTGS2). Our results provide a basis to identify the GLC1A gene. 59 refs., 3 figs., 3 tabs.« less

The gene for autosomal dominant cerebellar ataxia type II is located in a 5-cM region in 3p12-p13: genetic and physical mapping of the SCA7 locus.

PubMed

David, G; Giunti, P; Abbas, N; Coullin, P; Stevanin, G; Horta, W; Gemmill, R; Weissenbach, J; Wood, N; Cunha, S; Drabkin, H; Harding, A E; Agid, Y; Brice, A

1996-12-01

Two families with autosomal dominant cerebellar ataxia with pigmentary macular dystrophy (ADCA type II) were investigated. Analysis of 23 parent-child couples demonstrated the existence of marked anticipation, greater in paternal than in maternal transmissions, with earlier age at onset and a more rapid clinical course in successive generations. Clinical analysis revealed the presence of a great variability in age at onset, initial symptom, and associated signs, confirming the characteristic clinical heterogeneity of ADCA type II. The gene for ADCA type II previously was mapped to the spinocerebellar ataxia 7 (SCA7) locus on chromosome 3p12-p21.1. Linkage analysis of the two new families of different geographic origin confirmed the characteristic genetic homogeneity of ADCA type II, distinguishing it from ADCA type I. Haplotype analysis permitted refinement of the SCA7 region to the 5-cM interval between markers D3S1312 and D3S1600 on chromosome 3p12-p13. Eighteen sequence-tagged sites were used for the construction of an integrated map of the candidate region, based on a YACs contig. The entire candidate region is contained in a single nonchimeric YAC of 660 kb. The probable involvement of a CAG trinucleotide expansion, suggested by previous studies, should greatly facilitate the identification of the gene for ADCA type II.

The gene for autosomal dominant cerebellar ataxia type II is located in a 5-cM region in 3p12-p13: genetic and physical mapping of the SCA7 locus.

PubMed Central

David, G.; Giunti, P.; Abbas, N.; Coullin, P.; Stevanin, G.; Horta, W.; Gemmill, R.; Weissenbach, J.; Wood, N.; Cunha, S.; Drabkin, H.; Harding, A. E.; Agid, Y.; Brice, A.

1996-01-01

Two families with autosomal dominant cerebellar ataxia with pigmentary macular dystrophy (ADCA type II) were investigated. Analysis of 23 parent-child couples demonstrated the existence of marked anticipation, greater in paternal than in maternal transmissions, with earlier age at onset and a more rapid clinical course in successive generations. Clinical analysis revealed the presence of a great variability in age at onset, initial symptom, and associated signs, confirming the characteristic clinical heterogeneity of ADCA type II. The gene for ADCA type II previously was mapped to the spinocerebellar ataxia 7 (SCA7) locus on chromosome 3p12-p21.1. Linkage analysis of the two new families of different geographic origin confirmed the characteristic genetic homogeneity of ADCA type II, distinguishing it from ADCA type I. Haplotype analysis permitted refinement of the SCA7 region to the 5-cM interval between markers D3S1312 and D3S1600 on chromosome 3p12-p13. Eighteen sequence-tagged sites were used for the construction of an integrated map of the candidate region, based on a YACs contig. The entire candidate region is contained in a single nonchimeric YAC of 660 kb. The probable involvement of a CAG trinucleotide expansion, suggested by previous studies, should greatly facilitate the identification of the gene for ADCA type II. PMID:8940279

A high-resolution whole genome radiation hybrid map of human chromosome 17q22-q25.3 across the genes for GH and TK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foster, J.W.; Schafer, A.J.; Critcher, R.

1996-04-15

We have constructed a whole genome radiation hybrid (WG-RH) map across a region of human chromosome 17q, from growth hormone (GH) to thymidine kinase (TK). A panel of 128 WG-RH hybrid cell lines generated by X-irradiation and fusion has been tested for the retention of 39 sequence-tagged site (STS) markers by the polymerase chain reaction. This genome mapping technique has allowed the integration of existing VNTR and microsatellite markers with additional new markers and existing STS markers previously mapped to this region by other means. The WG-RH map includes eight expressed sequence tag (EST) and three anonymous markers developed formore » this study, together with 23 anonymous microsatellites and five existing ESTs. Analysis of these data resulted in a high-density comprehensive map across this region of the genome. A subset of these markers has been used to produce a framework map consisting of 20 loci ordered with odds greater than 1000:1. The markers are of sufficient density to build a YAC contig across this region based on marker content. We have developed sequence tags for both ends of a 2.1-Mb YAC and mapped these using the WG-RH panel, allowing a direct comparison of cRay{sub 6000} to physical distance. 31 refs., 3 figs., 2 tabs.« less

Greig syndrome: Analysis of the GL13 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grzeschik, K.H.; Gessler, M.; Heid, C.

1994-09-01

Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

PubMed

Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

1999-06-01

Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

COCACOLA: binning metagenomic contigs using sequence COmposition, read CoverAge, CO-alignment and paired-end read LinkAge.

PubMed

Lu, Yang Young; Chen, Ting; Fuhrman, Jed A; Sun, Fengzhu

2017-03-15

The advent of next-generation sequencing technologies enables researchers to sequence complex microbial communities directly from the environment. Because assembly typically produces only genome fragments, also known as contigs, instead of an entire genome, it is crucial to group them into operational taxonomic units (OTUs) for further taxonomic profiling and down-streaming functional analysis. OTU clustering is also referred to as binning. We present COCACOLA, a general framework automatically bin contigs into OTUs based on sequence composition and coverage across multiple samples. The effectiveness of COCACOLA is demonstrated in both simulated and real datasets in comparison with state-of-art binning approaches such as CONCOCT, GroopM, MaxBin and MetaBAT. The superior performance of COCACOLA relies on two aspects. One is using L 1 distance instead of Euclidean distance for better taxonomic identification during initialization. More importantly, COCACOLA takes advantage of both hard clustering and soft clustering by sparsity regularization. In addition, the COCACOLA framework seamlessly embraces customized knowledge to facilitate binning accuracy. In our study, we have investigated two types of additional knowledge, the co-alignment to reference genomes and linkage of contigs provided by paired-end reads, as well as the ensemble of both. We find that both co-alignment and linkage information further improve binning in the majority of cases. COCACOLA is scalable and faster than CONCOCT, GroopM, MaxBin and MetaBAT. The software is available at https://github.com/younglululu/COCACOLA . fsun@usc.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Low-frequency chimeric yeast artificial chromosome libraries from flow-sorted human chromosomes 16 and 21.

PubMed Central

McCormick, M K; Campbell, E; Deaven, L; Moyzis, R

1993-01-01

Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075

Mapping of the chromosome 1p36 region surrounding the Charcot-Marie-Tooth disease type 2A locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denton, P.; Gere, S.; Wolpert, C.

1994-09-01

Charcot-Marie-Tooth (CMT) disease is the most common inherited peripheral neuropathy. Although CMT2 is clinically indistinguishable from CMT1, the two forms can be differentiated by pathological and neurophysiological methods. We have established one locus, CMT2A on chromosome 1p36, and have established genetic heterogeneity. This locus maps to the region of the deletions associated with neuroblastoma. We have now identified an additional 11 CMT2 families. Three families are linked to chromosome 1p36 while six families are excluded from this region. Another six families are currently under analysis and collection. To date the CMT2A families represent one third of those CMT2 families examined.more » We have established a microdissection library of the 1p36 region which is currently being characterized for microsatellite repeats and STSs using standard hybridization techniques and a modified degenerate primer method. In addition, new markers (D1S253, D1S450, D1S489, D1S503, GATA27E04, and GATA4H04) placed in this region are being mapped using critical recombinants in the CEPH reference pedigrees. Fluorescent in situ hybridization (FISH) has been used to confirm mapping. A YAC contig is being assembled from the CEPH megabase library using STSs to isolate key YACs which are extended by vectorette end clone and Alu-PCR. These findings suggest that the CMT2 phenotype is secondary to at least two different genes and demonstrates further heterogeneity in the CMT phenotype.« less

Identification and characterization of a new multigene family in the human MHC: A candidate autoimmune disease susceptibility element (3.8-1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, J.M.; Venditti, C.P.; Chorney, M.J.

1994-09-01

An association between idiopathic hemochromatosis (HFE) and the HLA-A3 locus has been previously well-established. In an attempt to identify potential HFE candidate genes, a genomic DNA fragment distal to the HLA-A9 breakpoint was used to screen a B cell cDNA library; a member (3.8-1) of a new multigene family, composed of five distinct genomic cross-reactive fragments, was identified. Clone 3.8-1 represents the 3{prime} end of 9.6 kb transcript which is expressed in multiple tissues including the spleen, thymus, lung and kidney. Sequencing and genome database analysis indicate that 3.8-1 is unique, with no homology to any known entries. The genomicmore » residence of 3-8.1, defined by polymorphism analysis and physical mapping using YAC clones, appears to be absent from the genomes of higher primates, although four other cross-reactivities are maintained. The absence of this gene as well as other probes which map in the TNF to HLA-B interval, suggest that this portion of the human HMC, located between the Class I and Class III regions, arose in humans as the result of a post-speciation insertional event. The large size of the 3.8-1 gene and the possible categorization of 3.8-1 as a human-specific gene are significant given the genetic data that place an autoimmune susceptibility element for IDDM and myasthenia gravis in the precise region where this gene resides. In an attempt to isolate the 5{prime} end of this large transcript, we have constructed a cosmid contig which encompasses the genomic locus of this gene and are progressively isolating coding sequences by exon trapping.« less

A 2.5-Mb contig constructed from Angus, Longhorn and horned Hereford DNA spanning the polled interval on bovine chromosome 1.

PubMed

Wunderlich, K R; Abbey, C A; Clayton, D R; Song, Y; Schein, J E; Georges, M; Coppieters, W; Adelson, D L; Taylor, J F; Davis, S L; Gill, C A

2006-12-01

The polled locus has been mapped by genetic linkage analysis to the proximal region of bovine chromosome 1. As an intermediate step in our efforts to identify the polled locus and the underlying causative mutation for the polled phenotype, we have constructed a BAC-based physical map of the interval containing the polled locus. Clones containing genes and markers in the critical interval were isolated from the TAMBT (constructed from Angus and Longhorn genomic DNA) and CHORI-240 (constructed from horned Hereford genomic DNA) BAC libraries and ordered based on fingerprinting and the presence or absence of 80 STS markers. A single contig spanning 2.5 Mb was assembled. Comparison of the physical order of STSs to the corresponding region of human chromosome 21 revealed the same order of genes within the polled critical interval. This contig of overlapping BAC clones from horned and polled breeds is a useful resource for SNP discovery and characterization of positional candidate genes.

Genomic Anatomy of a Premier Major Histocompatibility Complex Paralogous Region on Chromosome 1q21–q22

PubMed Central

Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi

2001-01-01

Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under

Physical mapping of chromosome 12q breakpoints in lipoma, pleomorphic salivary gland adenoma, uterine leiomyoma, and myxoid liposarcoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoenmakers, E.F.P.M.; Kools, P.F.J.; Mols, R.

1994-03-15

The authors report here the physical mapping of recurrent chromosome 12q13-q15 breakpoints in cell lines derived from primary myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands. In fluorescence in situ hybridization (FISH) experiments, they first mapped the position of the chromosome 12 translocation breakpoint in uterine leiomyoma cell line LM-30.1/SV40 relative to loci COL2A1, D12S4, D12S17, D12S6, D12S19, D12S8, and D12S7. It mapped between linkage probes CRI-C86 (D12S19) and p7G11 (D12S8). They then isolated YAC clones using CRI-C86- and p7G11-derived sequence-tagged sites, constructed corresponding YAC contigs of 310 and 800 kb, respectively, and a mixture ofmore » them was used to routinely study the various tumor cell lines by FISH analysis. The chromosome 12 breakpoints of all tumor cell lines tested mapped between cosmids LLNL12NCO1-98C10 and LLNL12NCO1-113D12. None of the breakpoints appeared to map within any of the isolated YAC clones. Furthermore, FISH analysis using cosmid LLNL12-NCO1-144G3, which maps at the CHOP locus, revealed that the chromosome 12 breakpoints in all cell lines of the three benign solid tumors that were tested were located distal to the chromosome 12 translocation breakpoint with the CHOP gene in myxoid liposarcoma cells with t(12;16). In conclusion, the studies seem to indicate that the chromosome 12 breakpoints of myxoid liposarcoma, lipoma, uterine leiomyoma, and pleomorphic adenoma of the salivary glands are all clustered within the 7-cM interval between D12S19 and D12S8, with those of the benign solid tumors distal to CHOP. Finally, the MYF5 gene mapped telomeric to LLNL12NCO1-113D12, and the MIP gene mapped centromeric to the chromosome 12 translocation breakpoint in myxoid liposarcoma cells. 56 refs., 5 figs., 3 tabs.« less

NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

PubMed Central

Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

2000-01-01

Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

Empowering Youth to Take Charge of School Wellness

ERIC Educational Resources Information Center

Hughes, Luanne J.; Savoca, LeeAnne; Grenci, Alexandra

2015-01-01

Youth Advisory Councils (YACs) ensure that students are represented in school wellness discussions. YACs empower students to present ideas, insights, and input on nutrition and physical activity; work alongside peers to assess wellness needs; and develop recommendations for enhancing/expanding the school wellness environment. YACs provide a…

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

PubMed

Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

2010-05-07

Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

Long-range restriction map of human chromosome 22q11-22q12 between the lambda immunoglobulin locus and the Ewing sarcoma breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDermid, H.E.; Budarf, M.L.; Emanuel, B.S.

1993-11-01

A long-range restriction map of the region between the immunoglobulin lambda locus and the Ewing sarcoma breakpoint has been constructed using the rare-cutting enzymes NotI, NruI, AscI, and BsiWI. The map spans approximately 11,000 kb and represents about one-fifth of the long arm of chromosome 22. Thirty-nine markers, including seven NotI junction clones as well as numerous genes and anonymous sequences, were mapped to the region with a somatic cell hybrid panel. These probes were then used to produce the map. The seven NotI junction clones each identified a possible CpG island. The breakpoints of the RAJ5 hybrid and themore » Ewing sarcoma t(11;22) were also localized in the resulting map. This physical map will be useful in studying chromosomal rearrangements in the region, as well as providing the details to examine the fidelity of the YAC and cosmid contigs currently under construction. Comparisons of this physical map to genetic and radiation hybrid maps are discussed. 52 refs., 7 figs., 3 tabs.« less

Rapid determination of yunaconitine and related alkaloids in aconites and aconite-containing drugs by ultra high-performance liquid chromatography-tandem mass spectrometry.

PubMed

Song, Long; Zhang, Hong; Liu, Xin; Zhao, Zhi-Li; Chen, Shi-Lin; Wang, Zheng-Tao; Xu, Hong-Xi

2012-12-01

Yunaconitine (YAC) is a toxic aconite alkaloid that is considered to be a hidden aconite poison since it is frequently found in body fluids from aconite poisoning patients, but has not been well studied in commonly used herbal drugs. In this paper, a rapid and sensitive ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) detection combined with microwave-assisted extraction (MAE) was developed for high throughput simultaneous determination of YAC and six other toxic aconite alkaloids in 31 samples of crude, processed aconites and aconite-containing drugs. The optimized method showed excellent linearity, precision, accuracy and recovery for all target compounds with short run time. YAC was detected in some samples with contents from 0.015 to 10.41 mg/g. This is the first report on the determination of YAC in Radix Aconiti, Radix Aconiti Kusnezoffii and aconite-containing drugs. This newly developed method facilitates the rapid screening of YAC and related toxic aconite alkaloids and allows YAC to be used as a chemical marker for the quality control of aconites and aconite-containing drugs. Copyright © 2012 John Wiley & Sons, Ltd.

ScaffoldScaffolder: solving contig orientation via bidirected to directed graph reduction.

PubMed

Bodily, Paul M; Fujimoto, M Stanley; Snell, Quinn; Ventura, Dan; Clement, Mark J

2016-01-01

The contig orientation problem, which we formally define as the MAX-DIR problem, has at times been addressed cursorily and at times using various heuristics. In setting forth a linear-time reduction from the MAX-CUT problem to the MAX-DIR problem, we prove the latter is NP-complete. We compare the relative performance of a novel greedy approach with several other heuristic solutions. Our results suggest that our greedy heuristic algorithm not only works well but also outperforms the other algorithms due to the nature of scaffold graphs. Our results also demonstrate a novel method for identifying inverted repeats and inversion variants, both of which contradict the basic single-orientation assumption. Such inversions have previously been noted as being difficult to detect and are directly involved in the genetic mechanisms of several diseases. http://bioresearch.byu.edu/scaffoldscaffolder. paulmbodily@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Progress towards mapping the constitutional t(11:22) breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnoski, B.L.; Emanuel, B.S.; Bell, C.J.

1994-09-01

The reciprocal t(11;22)(q23;q11) is the most frequent, recurrent, non-Robertsonian, constitutional translocation in humans. Balanced carriers of this rearrangement are phenotypically normal, but are at risk for producing abnormal offspring with the Supernumerary der(22)t(11;22) Syndrome. Further, a recent report of association between t(11;22) balanced translocation carriers and breast cancer, suggests the involvement of genes on 11q and/or 22q in breast cancer tumorigenesis. Studies are in progress to examine the similarity between 11q23 and 22q11 breakpoints in multiple families with the constitutional t(11;22). A 750 kb YAC, which contains markers known to flank the 11q23 breakpoint, was identified in CEPH/Genethon database. FISHmore » with this YAC to two independent t(11;22) cell lines demonstrates signal on both derivative chromosomes. Numerous YACs containing BCRL2, the closest marker proximal to the breakpoint, were identified. Analysis of these YACs to determine which contain the actual breakpoint sequences is complicated by the presence of a duplicated segment of 22q11 which contains a GGTL and a BCRL locus. Sequences homologous to these loci are present at several other locations in 22q11. The BCRL positive YACs were analyzed by Southern hybridization under conditions which distinguish the four members of the BCR/BCRL family. FISH of total yeast DNA plus YAC DNA labeled by nick translation, or biotin-labeled inter-Alu PCR products confirmed the localization of these YACs to 22q11. Additional FISH with these YACS to metaphase spreads prepared from balanced t(11;22) carriers confirm that these clones span the breakpoint, and will allow rapid isolation and definition of the genetic region adjacent to the t(11;22) breakpoint.« less

Compound heterozygosity of SHOX-encompassing and downstream PAR1 deletions results in Langer mesomelic dysplasia (LMD).

PubMed

Campos-Barros, Angel; Benito-Sanz, Sara; Ross, Judith L; Zinn, Andrew R; Heath, Karen E

2007-05-01

We present the clinical and molecular characteristics of a multi-generation family in which the proband presented with clinical features of Langer mesomelic dysplasia (LMD) whilst different family members had a diagnosis of Léri-Weill dyschondrosteosis (LWD) and/or pseudoachondroplasia (PSACH). In the LMD proband two different deletions were identified in the pseudoautosomal 1 region (PAR1) of the X and Y chromosomes: a SHOX-encompassing deletion inherited from his father and a downstream PAR1 deletion, which did not include SHOX, inherited from his mother. The individuals with PSACH features presented the previously described G719D mutation in the C-terminal globular domain of the cartilage oligomeric matrix protein gene (COMP). The LMD proband described here represents the first LMD case due to compound heterozygosity for deletions of the two different PAR1 regions, SHOX-encompassing and downstream from SHOX, that have been shown to be implicated in the pathogenesis of LWD and LMD.

Development of an Encompassing Questionnaire for Evaluating the Outcomes Following Total Knee Arthroplasty.

PubMed

Chughtai, Morad; Khlopas, Anton; Thomas, Melbin; Gwam, Chukwuweike U; Jauregui, Julio J; Elmallah, Randa K; Roche, Martin; Delanois, Ronald E

2017-01-10

There are many standardized scales and questionnaires used to evaluate TKA patients; however, individually they do not always assess patients adequately. Consequently, many are used in combinations to provide a thorough evaluation. However, this leads to redundancy, confusion, and an excessive patient time-burden. Therefore, the purpose of this study was to develop a usable combined knee questionnaire that combines questions in a non-redundant manner. Specifically, we aimed to: 1) create a combined knee questionnaire that encompasses questions from multiple systems, while eliminating redundancy; 2) correlate the new system with the existing validated questionnaires; and 3) determine the length of time it takes to administer this new questionnaire. In a previous study, it was determined that the six most commonly cited validated systems to assess the knee were the: Knee Society Score (KSS), The Western Ontario and McMaster Universities Arthritis Index (WOMAC), Knee injury and Osteoarthritis Outcome Score (KOOS), Lower Extremity Functional Scale (LEFS), Activity Rating Scale (ARS), and Short-Form-36 (SF-36). Therefore, we ensured that the new questionnaire encompassed all elements of these systems. After development of the combined questionnaire, we co-administered it to 20 subjects alongside the above validated questionnaires. We then transposed the corresponding answers from the combined questionnaire to each selected validated system to perform an intra-class correlation analysis. In addition, we recorded the length of time it took to administer the new questionnaire and compared it to the time it took to administer the individual validated questionnaires. Intra-class correlation analysis demonstrated statistically significant positive correlations between the KSS, WOMAC, KOOS, LEFS, ARS, SF-36, and the corresponding questions in the combined questionnaire. The mean length of time it took to administer the combined questionnaire (mean, 10.1 minutes, range, 6.6 to

Selecting single model in combination forecasting based on cointegration test and encompassing test.

PubMed

Jiang, Chuanjin; Zhang, Jing; Song, Fugen

2014-01-01

Combination forecasting takes all characters of each single forecasting method into consideration, and combines them to form a composite, which increases forecasting accuracy. The existing researches on combination forecasting select single model randomly, neglecting the internal characters of the forecasting object. After discussing the function of cointegration test and encompassing test in the selection of single model, supplemented by empirical analysis, the paper gives the single model selection guidance: no more than five suitable single models can be selected from many alternative single models for a certain forecasting target, which increases accuracy and stability.

Differential Chromatin Structure Encompassing Replication Origins in Transformed and Normal Cells

PubMed Central

Di Paola, Domenic; Rampakakis, Emmanouil; Chan, Man Kid

2012-01-01

This study examines the chromatin structure encompassing replication origins in transformed and normal cells. Analysis of the global levels of histone H3 acetylated at K9&14 (open chromatin) and histone H3 trimethylated at K9 (closed chromatin) revealed a higher ratio of open to closed chromatin in the transformed cells. Also, the trithorax and polycomb group proteins, Brg-1 and Bmi-1, respectively, were overexpressed and more abundantly bound to chromatin in the transformed cells. Quantitative comparative analyses of episomal and in situ chromosomal replication origin activity as well as chromatin immunoprecipitation (ChIP) assays, using specific antibodies targeting members of the pre-replication complex (pre-RC) as well as open/closed chromatin markers encompassing both episomal and chromosomal origins, revealed that episomal origins had similar levels of in vivo activity, nascent DNA abundance, pre-RC protein association, and elevated open chromatin structure at the origin in both cell types. In contrast, the chromosomal origins corresponding to 20mer1, 20mer2, and c-myc displayed a 2- to 3-fold higher activity and pre-RC protein abundance as well as higher ratios of open to closed chromatin and of Brg-1 to Bmi-1 in the transformed cells, whereas the origin associated with the housekeeping lamin B2 gene exhibited similar levels of activity, pre-RC protein abundance, and higher ratios of open to closed chromatin and of Brg-1 to Bmi-1 in both cell types. Nucleosomal positioning analysis, using an MNase-Southern blot assay, showed that all the origin regions examined were situated within regions of inconsistently positioned nucleosomes, with the nucleosomes being spaced farther apart from each other prior to the onset of S phase in both cell types. Overall, the results indicate that cellular transformation is associated with differential epigenetic regulation, whereby chromatin structure is more open, rendering replication origins more accessible to initiator

Using in situ hybridization and PFGE Southern hybridization to detect translocation breakpoints in a BOR/TRPS patient cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, J.Z.; Sapru, M.; Smith, D.

Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder characterized by ear malformations, cervical fistulae, hearing loss and renal abnormalities. We have integrated the Genethon YAC contig maps with additional markers in the chromosome 8q region genetically linked by a unique patient cell line. This cell line is from a patient who has both the branchio-oto-renal syndrome and tricho-rhino-phalangeal syndrome (TRPS). High resolution cytogenetics demonstrated a direct insertion of materials from 8q13.3q21.13 to 8q24.11. TRPS has been previously linked to deletions involving 8q24.11-q24.13. The rearrangement in this patient suggests that TRPS results from loss of gene function due to insertion atmore » the 8q24.11 breakpoint and the possible location for the BOR gene is at either of the two breakpoints of 8q13.3 and 8q21.13. We have constructed cosmid contigs in 8q24.11. In situ hybridization with cosmids mapped to these locations as probes has helped to narrow down the breakpoints. Combinations of cosmids on either side or overlapping the 8q24.11 breakpoint show split signals on one chromosome 8q arm due to insertion of the materials from the proximal region. Cosmids mapped to the TRPS deletion region have been used to hybridize to pulsed field gel genomic blots of DNA from the patient cell line and detected rearranged genomic fragments. Both in situ hybridization and genomic PFGE Southern blot will be used to precisely locate the breakpoints.« less

A post-assembly genome-improvement toolkit (PAGIT) to obtain annotated genomes from contigs.

PubMed

Swain, Martin T; Tsai, Isheng J; Assefa, Samual A; Newbold, Chris; Berriman, Matthew; Otto, Thomas D

2012-06-07

Genome projects now produce draft assemblies within weeks owing to advanced high-throughput sequencing technologies. For milestone projects such as Escherichia coli or Homo sapiens, teams of scientists were employed to manually curate and finish these genomes to a high standard. Nowadays, this is not feasible for most projects, and the quality of genomes is generally of a much lower standard. This protocol describes software (PAGIT) that is used to improve the quality of draft genomes. It offers flexible functionality to close gaps in scaffolds, correct base errors in the consensus sequence and exploit reference genomes (if available) in order to improve scaffolding and generating annotations. The protocol is most accessible for bacterial and small eukaryotic genomes (up to 300 Mb), such as pathogenic bacteria, malaria and parasitic worms. Applying PAGIT to an E. coli assembly takes ∼24 h: it doubles the average contig size and annotates over 4,300 gene models.

Construction of human chromosome 21-specific yeast artificial chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCormick, M.K.; Shero, J.H.; Hieter, P.A.

1989-12-01

Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less

Selecting Single Model in Combination Forecasting Based on Cointegration Test and Encompassing Test

PubMed Central

Jiang, Chuanjin; Zhang, Jing; Song, Fugen

2014-01-01

Combination forecasting takes all characters of each single forecasting method into consideration, and combines them to form a composite, which increases forecasting accuracy. The existing researches on combination forecasting select single model randomly, neglecting the internal characters of the forecasting object. After discussing the function of cointegration test and encompassing test in the selection of single model, supplemented by empirical analysis, the paper gives the single model selection guidance: no more than five suitable single models can be selected from many alternative single models for a certain forecasting target, which increases accuracy and stability. PMID:24892061

Recombination walking: genetic selection of clones from pooled libraries of yeast artificial chromosomes by homologous recombination.

PubMed Central

Miller, A M; Savinelli, E A; Couture, S M; Hannigan, G M; Han, Z; Selden, R F; Treco, D A

1993-01-01

Recombination walking is based on the genetic selection of specific human clones from a yeast artificial chromosome (YAC) library by homologous recombination. The desired clone is selected from a pooled (unordered) YAC library, eliminating labor-intensive steps typically used in organizing and maintaining ordered YAC libraries. Recombination walking represents an efficient approach to library screening and is well suited for chromosome-walking approaches to the isolation of genes associated with common diseases. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8367472

End-to-end network models encompassing terrestrial, wireless, and satellite components

NASA Astrophysics Data System (ADS)

Boyarko, Chandler L.; Britton, John S.; Flores, Phil E.; Lambert, Charles B.; Pendzick, John M.; Ryan, Christopher M.; Shankman, Gordon L.; Williams, Ramon P.

2004-08-01

Development of network models that reflect true end-to-end architectures such as the Transformational Communications Architecture need to encompass terrestrial, wireless and satellite component to truly represent all of the complexities in a world wide communications network. Use of best-in-class tools including OPNET, Satellite Tool Kit (STK), Popkin System Architect and their well known XML-friendly definitions, such as OPNET Modeler's Data Type Description (DTD), or socket-based data transfer modules, such as STK/Connect, enable the sharing of data between applications for more rapid development of end-to-end system architectures and a more complete system design. By sharing the results of and integrating best-in-class tools we are able to (1) promote sharing of data, (2) enhance the fidelity of our results and (3) allow network and application performance to be viewed in the context of the entire enterprise and its processes.

The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice

PubMed Central

Vidal, Ruben; Sammeta, Neeraja; Garringer, Holly J.; Sambamurti, Kumar; Miravalle, Leticia; Lamb, Bruce T.; Ghetti, Bernardino

2012-01-01

Genetically engineered mice have been generated to model cerebral β-amyloidosis, one of the hallmarks of Alzheimer disease (AD) pathology, based on the overexpression of a mutated cDNA of the amyloid-β precursor protein (AβPP) or by knock-in of the murine Aβpp gene alone or with presenilin1 mutations. Here we describe the generation and initial characterization of a new mouse line based on the presence of 2 copies of the human genomic region encoding the wild-type AβPP and the L166P presenilin 1 mutation. At ∼6 mo of age, double-mutant mice develop amyloid pathology, with signs of neuritic dystrophy, intracellular Aβ accumulation, and glial inflammation, an increase in AβPP C-terminal fragments, and an 8 times increase in Aβ42 levels with a 40% decrease in Aβ40 levels, leading to a significant increase (14 times) of Aβ42/Aβ40 ratios, with minimal effects on presenilin or the Notch1 pathway in the brain. We conclude that in mice, neither mutations in AβPP nor overexpression of an AβPP isoform are a prerequisite for Aβ pathology. This model will allow the study of AD pathogenesis and testing of therapeutic strategies in a more relevant environment without experimental artifacts due to the overexpression of a single-mutant AβPP isoform using exogenous promoters.—Vidal, R., Sammeta, N., Garringer, H. J., Sambamurti, K., Miravalle, L., Lamb B. T., Ghetti, B. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice. PMID:22459153

Towards isolation of the gene for X-linked retinitis pigmentosa (RP3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dry, K.L.; Aldred, M.A.; Hardwick, L.J.

1994-09-01

Until recently the region of interest containing the gene for X-linked retinitis pigmentosa (RP3) was thought to lie between CYBB (Xp21.1) and the proximal end of the deletion in patient BB (JBBprox). This region was thought to span 100-150 kb. Here we present new mapping data to show that the distance between the 5{prime} (most proximal) end of CYBB and JBBprox is only 50 kb. Recently Roux et al. (1994) have described the isolation of a gene within this region but this showed no disease-associated changes. Further evidence from mapping the deletion in patient NF (who suffered from McLead`s syndromemore » and CGD but not RP) and from linkage analysis of our RP3 families with a new dinucleotide repeat suggests that the gene must extend proximally from JBBprox. In order to extend the region of search we have constructed a YAC contig spanning 800 kb to OTC. We are continuing our search for the RP3 gene using a variety of strategies including exon trapping and cDNA enrichment as well as direct screening of cDNA libraries with subclones from this region.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willard, H.F.; Cremers, F.; Mandel, J.L.

A high-quality integrated genetic and physical map of the X chromosome from telomere to telomere, based primarily on YACs formatted with probes and STSs, is increasingly close to reality. At the Fifth International X Chromosome Workshop, organized by A.M. Poustka and D. Schlessinger in Heidelberg, Germany, April 24--27, 1994, substantial progress was recorded on extension and refinement of the physical map, on the integration of genetic and cytogenetic data, on attempts to use the map to direct gene searches, and on nascent large-scale sequencing efforts. This report summarizes physical and genetic mapping information presented at the workshop and/or published sincemore » the reports of the fourth International X Chromosome Workshop. The principle aim of the workshop was to derive a consensus map of the chromosome, in terms of physical contigs emphasizing the location of genes and microsatellite markers. The resulting map is presented and updates previous versions. This report also updates the list of highly informative microsatellites. The text highlights the working state of the map, the genes known to reside on the X, and the progress toward integration of various types of data.« less

Deletion of Xpter encompassing the SHOX gene and PAR1 region in familial patients with Leri-Weill Dyschondrosteosis syndrome.

PubMed

Mutesa, L; Vanbellinghen, J F; Hellin, A C; Segers, K; Jamar, M; Pierquin, G; Bours, V

2009-01-01

Heterozygote deletions or mutations of pseudoautosomal 1 region (PAR1) encompassing the short stature homeobox-containing (SHOX) gene cause Leri-Weill Dyschondrosteosis (LWD), which is a dominantly inherited osteochondroplasia characterized by short stature with mesomelic shortening of the upper and lower limbs and Madelung deformity of the wrists. SHOX is expressed by both sex chromosomes in males and females and plays an important role in bone growth and development. Clinically, the LWD expression is variable and more severe in females than males due to sex differences in oestrogen levels. Here, we report two familial cases of LWD with a large Xp terminal deletion (approximately 943 kb) of distal PAR1 encompassing the SHOX gene. In addition, the proband had mental retardation which appeared to be from recessive inheritance in the family.

The t(9;14)(p13;q32) chromosomal translocation associated with lymphoplasmacytoid lymphoma involves the PAX-5 gene.

PubMed

Iida, S; Rao, P H; Nallasivam, P; Hibshoosh, H; Butler, M; Louie, D C; Dyomin, V; Ohno, H; Chaganti, R S; Dalla-Favera, R

1996-12-01

The t(9;14)(p13;q32) translocation is associated with approximately 50% of lymphoplasmacytoid lymphoma (LPL), a subtype of B-cell non-Hodgkin's lymphoma (NHL). We cloned the chromosomal breakpoint of der (14) from an LPL case (1052) and showed that it involved a junction between 9p13 and the switch micro region of the Ig heavy chain locus (IgH) on 14q32. Using a YAC contig spanning 1.5 megabase (Mb), we determined that the 9p13 breakpoint in one case (1052) mapped within a 270-kb restriction fragment containing two previously reported 9p breakpoints associated with a alpha-heavy chain disease case (MAL) and KI-1 positive diffuse large cell lymphoma (DLCL) cell line (KIS-1). The same fragment also contained the PAX-5 gene which encodes a B-cell specific transcription factor involved in the control of B-cell proliferation and differentiation. The breakpoints of KIS-1 and 1052 were mapped within the 5' noncoding region of PAX-5, while the 9p13 breakpoint of MAL mapped 230 to 270 kb upstream to PAX-5. In all three cases, the translocation caused the juxtaposition of the PAX-5 gene to the IgH locus in the opposite direction of transcription. When compared with six other DLCL cell lines lacking t(9;14)(p13;q32), the KIS-1 cell line showed an 11-fold overexpression of PAX-5 mRNA and a significantly reduced expression of the p53 gene, which is normally regulated by PAX-5. Moreover, metaphase and interphase fluorescence in situ hybridization (FISH) analysis using a YAC clone spanning 1 Mb including the PAX-5 as a probe identified chromosomal translocations in 5 of 7 cases carrying 9p13 translocations. These findings suggest that the PAX-5 gene is the target of the t(9;14) in LPL whereby its expression may be deregulated by juxtaposition to IgH regulatory elements, thus contributing to lymphomagenesis.

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

PubMed

Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

2011-11-25

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as

Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

PubMed Central

2011-01-01

Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2

Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes.

PubMed

Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

2014-04-01

Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader-Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion.

Newly Elaborated Multipurpose Polymer Electrolyte Encompassing RTILs for Smart Energy-Efficient Devices.

PubMed

Nair, Jijeesh R; Porcarelli, Luca; Bella, Federico; Gerbaldi, Claudio

2015-06-17

Profoundly ion-conducting, self-standing, and tack-free ethylene oxide-based polymer electrolytes encompassing a room-temperature ionic liquid (RTIL) with specific amounts of lithium salt are successfully prepared via a rapid and easily upscalable process including a UV irradiation step. All prepared materials are thoroughly characterized in terms of their physical, chemical, and morphological properties and eventually galvanostatically cycled in lab-scale lithium batteries (LIBs) exploiting a novel direct polymerization procedure to get intimate electrode/electrolyte interfacial characteristics. The promising multipurpose characteristics of the newly elaborated materials are demonstrated by testing them in dye-sensitized solar cells (DSSCs), where the introduction of the iodine/iodide-based redox mediator in the polymer matrix assured the functioning of a lab-scale test cell with conversion efficiency exceeding 6% at 1 sun. The reported results enlighten the promising prospects of the material to be successfully implemented as stable, durable, and efficient electrolyte in next-generation energy conversion and storage devices.

Cultural Respect Encompassing Simulation Training: Being Heard About Health Through Broadband

PubMed Central

Min-Yu Lau, Phyllis; Woodward-Kron, Robyn; Livesay, Karen; Elliott, Kristine; Nicholson, Patricia

2016-01-01

Background Cultural Respect Encompassing Simulation Training (CREST) is a learning program that uses simulation to provide health professional students and practitioners with strategies to communicate sensitively with culturally and linguistically diverse (CALD) patients. It consists of training modules with a cultural competency evaluation framework and CALD simulated patients to interact with trainees in immersive simulation scenarios. The aim of this study was to test the feasibility of expanding the delivery of CREST to rural Australia using live video streaming; and to investigate the fidelity of cultural sensitivity – defined within the process of cultural competency which includes awareness, knowledge, skills, encounters and desire – of the streamed simulations. Design and Methods In this mixed-methods evaluative study, health professional trainees were recruited at three rural academic campuses and one rural hospital to pilot CREST sessions via live video streaming and simulation from the city campus in 2014. Cultural competency, teaching and learning evaluations were conducted. Results Forty-five participants rated 26 reliable items before and after each session and reported statistically significant improvement in 4 of 5 cultural competency domains, particularly in cultural skills (P<0.05). Qualitative data indicated an overall acknowledgement amongst participants of the importance of communication training and the quality of the simulation training provided remotely by CREST. Conclusions Cultural sensitivity education using live video-streaming and simulation can contribute to health professionals’ learning and is effective in improving cultural competency. CREST has the potential to be embedded within health professional curricula across Australian universities to address issues of health inequalities arising from a lack of cultural sensitivity training. Significance for public health There are significant health inequalities for migrant

Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyer, G.S.; Funanage, V.L.; Proujansky, R.

1996-05-15

Creatine and creatine phosphate act as a buffer system for the regeneration of ATP in tissues with fluctuating energy demands. Following reports of the cloning of a creatine transporter in rat, rabbit, and human, we cloned and sequenced a creatine transporter from a human intestinal cDNA library. PCR amplification of genomic DNAs from somatic cell hybrid panels localized two creatine transporter (CT) genes: CT1 to Xq26-q28 and CT2 to 16p11.2. Refinement of CT1 to Xq28 was confirmed by FISH. Identification of CT2 sequences in YACs and cosmid contigs that had been ordered on human chromosome 16 enabled its assignment tomore » the proximal end of 16p11.2. Sequencing of the CT2 gene identified sequence differences between CT1 and CT2 transcripts that were utilized to determine that CT2 is expressed in testis only. CT2 is the most proximally identified gene on chromosome 16p to date. The existence of an autosomal, testis-specific form of the human creatine transporter gene suggests that creatine transporter activity is critical for normal function of spermatazoa following meiosis. 17 refs., 2 figs., 2 tabs.« less

The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

1996-04-15

We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

Identification of a region of homozygous deletion in cervical carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aburatani, H.; Housman, D.E.; Wang, Y.

1994-09-01

To identify the possible location of a tumor suppressor gene (TSG) for cervical carcinoma, we have scanned the tumor DNAs for homozygous deletion by Representational Difference Analysis (RDA). Matched pairs of tumor and normal DNA were restriction digested and PCR-amplified. The tumor DNA amplicon was used as a driver for subtraction to identify DNA fragments homozygously deleted in tumor DNA. We analysed 6 cervical cancer specimens (5 cell lines, 1 fresh tumor). Four out of 6 analyses produced difference products present only in normal DNA, which were either hemizygously or homozygously deleted in tumor DNA. The two samples which failedmore » to produce any difference products were cell lines established from dysplasia patients, on which genetic changes might be minimal. One cervical carcinoma cell line CC6 produced 11 difference products deleted homozygously, all of which are clustered in 3p12-13 region. The proximal short arm of chromosome 3 is known to have a high incidence of L.O.H. in cervical carcinoma and thus may be a locus for TSG. A 4 Mb YAC contig has been established over the deletion and its characterization is under way to facilitate the identification of possible TSGs in this region.« less

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

A comprehensive map of the porcine genome.

PubMed

Rohrer, G A; Alexander, L J; Hu, Z; Smith, T P; Keele, J W; Beattie, C W

1996-05-01

We report the highest density genetic linkage map for a livestock species produced to date. Three published maps for Sus scrofa were merged by genotyping virtually every publicly available microsatellite across a single reference population to yield 1042 linked loci, 536 of which are novel assignments, spanning 2286.2 cM (average interval 2.23 cM) in 19 linkage groups (18 autosomal and X chromosomes, n = 19). Linkage groups were constructed de novo and mapped by locus content to avoid propagation of errors in older genotypes. The physical and genetic maps were integrated with 123 informative loci assigned previously by fluorescence in situ hybridization (FISH). Fourteen linkage groups span the entire length of each chromosome. Coverage of chromosomes 11, 12, 15, and 18 will be evaluated as more markers are physically assigned. Marker-deficient regions were identified only on 11q1.7-qter and 14 cen-q1.2. Recombination rates (cM/Mbp) varied between and within chromosomes. Short chromosomal arms recombined at higher rates than long arms, and recombination was more frequent in telomeric regions than in pericentric regions. The high-resolution comprehensive map has the marker density needed to identify quantitative trait loci (QTL), implement marker-assisted selection or introgression and YAC contig construction or chromosomal microdissection.

Automated SNP detection from a large collection of white spruce expressed sequences: contributing factors and approaches for the categorization of SNPs

PubMed Central

Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean

2006-01-01

Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate

ESTree db: a Tool for Peach Functional Genomics

PubMed Central

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-01-01

Background The ESTree db represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. Results The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. Conclusion The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig. PMID:16351742

ESTree db: a tool for peach functional genomics.

PubMed

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-12-01

The ESTree db http://www.itb.cnr.it/estree/ represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig.

Prokaryotic Contig Annotation Pipeline Server: Web Application for a Prokaryotic Genome Annotation Pipeline Based on the Shiny App Package.

PubMed

Park, Byeonghyeok; Baek, Min-Jeong; Min, Byoungnam; Choi, In-Geol

2017-09-01

Genome annotation is a primary step in genomic research. To establish a light and portable prokaryotic genome annotation pipeline for use in individual laboratories, we developed a Shiny app package designated as "P-CAPS" (Prokaryotic Contig Annotation Pipeline Server). The package is composed of R and Python scripts that integrate publicly available annotation programs into a server application. P-CAPS is not only a browser-based interactive application but also a distributable Shiny app package that can be installed on any personal computer. The final annotation is provided in various standard formats and is summarized in an R markdown document. Annotation can be visualized and examined with a public genome browser. A benchmark test showed that the annotation quality and completeness of P-CAPS were reliable and compatible with those of currently available public pipelines.

A new bidirectional heteroassociative memory encompassing correlational, competitive and topological properties.

PubMed

Chartier, Sylvain; Giguère, Gyslain; Langlois, Dominic

2009-01-01

In this paper, we present a new recurrent bidirectional model that encompasses correlational, competitive and topological model properties. The simultaneous use of many classes of network behaviors allows for the unsupervised learning/categorization of perceptual patterns (through input compression) and the concurrent encoding of proximities in a multidimensional space. All of these operations are achieved within a common learning operation, and using a single set of defining properties. It is shown that the model can learn categories by developing prototype representations strictly from exposition to specific exemplars. Moreover, because the model is recurrent, it can reconstruct perfect outputs from incomplete and noisy patterns. Empirical exploration of the model's properties and performance shows that its ability for adequate clustering stems from: (1) properly distributing connection weights, and (2) producing a weight space with a low dispersion level (or higher density). In addition, since the model uses a sparse representation (k-winners), the size of topological neighborhood can be fixed, and no longer requires a decrease through time as was the case with classic self-organizing feature maps. Since the model's learning and transmission parameters are independent from learning trials, the model can develop stable fixed points in a constrained topological architecture, while being flexible enough to learn novel patterns.

An origin-deficient yeast artificial chromosome triggers a cell cycle checkpoint.

PubMed

van Brabant, A J; Buchanan, C D; Charboneau, E; Fangman, W L; Brewer, B J

2001-04-01

Checkpoint controls coordinate entry into mitosis with the completion of DNA replication. Depletion of nucleotide precursors by treatment with the drug hydroxyurea triggers such a checkpoint response. However, it is not clear whether the signal for this hydroxyurea-induced checkpoint pathway is the presence of unreplicated DNA, or rather the persistence of single-stranded or damaged DNA. In a yeast artificial chromosome (YAC) we have engineered an approximately 170 kb region lacking efficient replication origins that allows us to explore the specific effects of unreplicated DNA on cell cycle progression. Replication of this YAC extends the length of S phase and causes cells to engage an S/M checkpoint. In the absence of Rad9 the YAC becomes unstable, undergoing deletions within the origin-free region.

Distinct regulatory functions of SLP-76 and MIST in NK cell cytotoxicity and IFN-gamma production.

PubMed

Hidano, Shinya; Sasanuma, Hiroki; Ohshima, Keiko; Seino, Ken-ichiro; Kumar, Lalit; Hayashi, Katsuhiko; Hikida, Masaki; Kurosaki, Tomohiro; Taniguchi, Masaru; Geha, Raif S; Kitamura, Daisuke; Goitsuka, Ryo

2008-03-01

Activation of NK cells is triggered by multiple receptors. We demonstrate here that SLP-76 is required for CD16- and NKG2D-mediated NK cell cytotoxicity, while MIST negatively regulates these responses in an SLP-76-dependent manner. Exceptionally, MIST acts as a positive regulator of cytotoxicity against YAC-1 cells, although SLP-76 plays a more key role. SLP-76 acts as a dominant positive regulator for both NKG2D-mediated and YAC-1 cell-triggered IFN-gamma production. Although NKG2D-mediated IFN-gamma production depends on phospholipase C (PLC) gamma 2, YAC-1 cell-triggered IFN-gamma production is PLC gamma 2- and Syk/ZAP-70 independent and nuclear factor-kappa B mediated. SLP-76 is required for this process in the presence of MIST but is dispensable in the absence of MIST. Thus, YAC-1 cell-triggered NKG2D-independent IFN-gamma production appears to be regulated by SLP-76-dependent and -independent pathways, in which the latter is negatively regulated by MIST. Taken together, these results suggest that SLP-76 and MIST distinctly but interactively regulate NK cell cytotoxicity and IFN-gamma production.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC

Trauma Associated Sleep Disorder: A Proposed Parasomnia Encompassing Disruptive Nocturnal Behaviors, Nightmares, and REM without Atonia in Trauma Survivors

PubMed Central

Mysliwiec, Vincent; O'Reilly, Brian; Polchinski, Jason; Kwon, Herbert P.; Germain, Anne; Roth, Bernard J.

2014-01-01

Study Objectives: To characterize the clinical, polysomnographic and treatment responses of patients with disruptive nocturnal behaviors (DNB) and nightmares following traumatic experiences. Methods: A case series of four young male, active duty U.S. Army Soldiers who presented with DNB and trauma related nightmares. Patients underwent a clinical evaluation in a sleep medicine clinic, attended overnight polysomnogram (PSG) and received treatment. We report pertinent clinical and PSG findings from our patients and review prior literature on sleep disturbances in trauma survivors. Results: DNB ranged from vocalizations, somnambulism to combative behaviors that injured bed partners. Nightmares were replays of the patient's traumatic experiences. All patients had REM without atonia during polysomnography; one patient had DNB and a nightmare captured during REM sleep. Prazosin improved DNB and nightmares in all patients. Conclusions: We propose Trauma associated Sleep Disorder (TSD) as a unique sleep disorder encompassing the clinical features, PSG findings, and treatment responses of patients with DNB, nightmares, and REM without atonia after trauma. Citation: Mysliwiec V, O'Reilly B, Polchinski J, Kwon HP, Germain A, Roth BJ. Trauma associated sleep disorder: a proposed parasomnia encompassing disruptive nocturnal behaviors, nightmares, and REM without atonia in trauma survivors. J Clin Sleep Med 2014;10(10):1143-1148. PMID:25317096

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

PubMed

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Exploring variation-aware contig graphs for (comparative) metagenomics using MaryGold

PubMed Central

Nijkamp, Jurgen F.; Pop, Mihai; Reinders, Marcel J. T.; de Ridder, Dick

2013-01-01

Motivation: Although many tools are available to study variation and its impact in single genomes, there is a lack of algorithms for finding such variation in metagenomes. This hampers the interpretation of metagenomics sequencing datasets, which are increasingly acquired in research on the (human) microbiome, in environmental studies and in the study of processes in the production of foods and beverages. Existing algorithms often depend on the use of reference genomes, which pose a problem when a metagenome of a priori unknown strain composition is studied. In this article, we develop a method to perform reference-free detection and visual exploration of genomic variation, both within a single metagenome and between metagenomes. Results: We present the MaryGold algorithm and its implementation, which efficiently detects bubble structures in contig graphs using graph decomposition. These bubbles represent variable genomic regions in closely related strains in metagenomic samples. The variation found is presented in a condensed Circos-based visualization, which allows for easy exploration and interpretation of the found variation. We validated the algorithm on two simulated datasets containing three respectively seven Escherichia coli genomes and showed that finding allelic variation in these genomes improves assemblies. Additionally, we applied MaryGold to publicly available real metagenomic datasets, enabling us to find within-sample genomic variation in the metagenomes of a kimchi fermentation process, the microbiome of a premature infant and in microbial communities living on acid mine drainage. Moreover, we used MaryGold for between-sample variation detection and exploration by comparing sequencing data sampled at different time points for both of these datasets. Availability: MaryGold has been written in C++ and Python and can be downloaded from http://bioinformatics.tudelft.nl/software Contact: d.deridder@tudelft.nl PMID:24058058

Regional gene mapping using mixed radiation hybrids and reverse chromosome painting.

PubMed

Lin, J Y; Bedford, J S

1997-11-01

We describe a new approach for low-resolution physical mapping using pooled DNA probe from mixed (non-clonal) populations of human-CHO cell hybrids and reverse chromosome painting. This mapping method is based on a process in which the human chromosome fragments bearing a complementing gene were selectively retained in a large non-clonal population of CHO-human hybrid cells during a series of 12- to 15-Gy gamma irradiations each followed by continuous growth selection. The location of the gene could then be identified by reverse chromosome painting on normal human metaphase spreads using biotinylated DNA from this population of "enriched" hybrid cells. We tested the validity of this method by correctly mapping the complementing human HPRT gene, whose location is well established. We then demonstrated the method's usefulness by mapping the chromosome location of a human gene which complemented the defect responsible for the hypersensitivity to ionizing radiation in CHO irs-20 cells. This method represents an efficient alternative to conventional concordance analysis in somatic cell hybrids where detailed chromosome analysis of numerous hybrid clones is necessary. Using this approach, it is possible to localize a gene for which there is no prior sequence or linkage information to a subchromosomal region, thus facilitating association with known mapping landmarks (e.g. RFLP, YAC or STS contigs) for higher-resolution mapping.

The Friedreich ataxia critical region spans a 150-kb interval on chromosome 9q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montermini, L.; Zara, F.; Patel, P.I.

1995-11-01

By analysis of crossovers in key recombinant families and by homozygosity analysis of inbred families, the Friedreich ataxia (FRDA) locus was localized in a 300-kb interval between the X104 gene and the microsatellite marker FR8 (D9S888). By homology searches of the sequence databases, we identified X104 as the human tight junction protein ZO-2 gene. We generated a large-scale physical map of the FRDA region by pulsed-field gel electrophoresis analysis of genomic DNA and of three YAC clones derived from different libraries, and we constructed an uninterrupted cosmid contig spanning the FRDA locus. The cAMP-dependent protein kinase {gamma}-catalytic subunit gene wasmore » identified within the critical FRDA interval, but it was excluded as candidate because of its biological properties and because of lack of mutations in FRDA patients. Six new polymorphic markers were isolated between FR2 (D9S886) and FR8 (D9S888), which were used for homozygosity analysis in a family in which parents of an affected child are distantly related. An ancient recombination involving the centromeric FRDA flanking markers had been previously demonstrated in this family. Homozygosity analysis indicated that the FRDA gene is localized in the telomeric 150 kb of the FR2-FR8 interval. 17 refs., 3 figs., 1 tab.« less

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

PubMed Central

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

Myeloid- and lymphoid-specific breakpoint cluster regions in chromosome band 13q14 in acute leukemia.

PubMed

Coignet, L J; Lima, C S; Min, T; Streubel, B; Swansbury, J; Telford, N; Swanton, S; Bowen, A; Nagai, M; Catovsky, D; Fonatsch, C; Dyer, M J

1999-07-01

Abnormalities of chromosome band 13q14 occur in hematologic malignancies of all lineages and at all stages of differentiation. Unlike other chromosomal translocations, which are usually specific for a given lineage, the chromosomal translocation t(12;13)(p12;q14) has been observed in both B-cell and T-cell precursor acute lymphoblastic leukemia (BCP-, TCP-ALL), in differentiated and undifferentiated acute myeloblastic leukemia (AML), and in chronic myeloid leukemia (CML) at progression to blast crisis. The nature of these translocations and their pathologic consequences remain unknown. To begin to define the gene(s) involved on chromosome 13, we have performed fluorescence in situ hybridization (FISH) using a panel of YACs from the region, on a series of 10 cases of acute leukemia with t(12;13)(p12;q14) and 1 case each with "variant" translocations including t(12;13)(q21;q14), t(10;13)(q24;q14) and t(9;13)(p21;q14). In 8/13 cases/cell lines, the 13q14 break fell within a single 1.4 Mb CEPH MegaYAC. This YAC fell immediately telomeric of the forkhead (FKHR) gene, which is disrupted in the t(2;13)(q35;q14) seen in pediatric alveolar rhabdomyosarcoma. Seven of the 8 cases with breaks in this YAC were AML. In 4/13 cases, the 13q14 break fell within a 1.7-Mb YAC located about 3 Mb telomeric of the retinoblastoma (RB1) gene: all 4 cases were ALL. One case of myelodysplastic syndrome exhibited a break within 13q12, adjacent to the BRCA2 gene. These data indicate the presence of myeloid- and lymphoid-specific breakpoint cluster regions within chromosome band 13q14 in acute leukemia.

Cloning a balanced t(9;11)(p24;q23.1) chromosomal translocation breakpoint segregating with bipolar affective disorder in a small pedigree

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, D.J.; Baysal, B.E.; Gollin, S.M.

A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less

Process for Assembly and Transformation into Saccharomyces cerevisiae of a Synthetic Yeast Artificial Chromosome Containing a Multigene Cassette to Express Enzymes That Enhance Xylose Utilization Designed for an Automated Platform.

PubMed

Hughes, Stephen R; Cox, Elby J; Bang, Sookie S; Pinkelman, Rebecca J; López-Núñez, Juan Carlos; Saha, Badal C; Qureshi, Nasib; Gibbons, William R; Fry, Michelle R; Moser, Bryan R; Bischoff, Kenneth M; Liu, Siqing; Sterner, David E; Butt, Tauseef R; Riedmuller, Steven B; Jones, Marjorie A; Riaño-Herrera, Néstor M

2015-12-01

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system in yeast and to design an assembly process suitable for an automated platform. Expression of XI and XKS from the YAC was confirmed by Western blot and PCR analyses. The recombinant and wild-type strains showed similar growth on plates containing hexose sugars, but only recombinant grew on D-xylose and L-arabinose plates. In glucose fermentation, doubling time (4.6 h) and ethanol yield (0.44 g ethanol/g glucose) of recombinant were comparable to wild type (4.9 h and 0.44 g/g). In whole-corn hydrolysate, ethanol yield (0.55 g ethanol/g [glucose + xylose]) and xylose utilization (38%) for recombinant were higher than for wild type (0.47 g/g and 12%). In hydrolysate from spent coffee grounds, yield was 0.46 g ethanol/g (glucose + xylose), and xylose utilization was 93% for recombinant. These results indicate introducing a YAC expressing XI and XKS enhanced xylose utilization without affecting integrity of the host strain, and the process provides a potential platform for automated synthesis of a YAC for expression of multiple optimized genes to improve yeast strains. © 2015 Society for Laboratory Automation and Screening.

Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

PubMed Central

Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

1998-01-01

In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

Genes in one megabase of the HLA class I region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, H.; Fan, Wu-Fang; Xu, Hongxia

1993-11-15

To define the gene content of the HLA class I region, cDNA selection was applied to three overlapping yeast artificial chromosomes (YACs) that spanned 1 megabase (Mb) of this region of the human major histocompatibility complex. These YACs extended from the region centromeric to HLA-E to the region telomeric to HLA-F. In additions to the recognized class I genes and pseudogenes and the anonymous non-class-I genes described recently by the authors and others, 20 additional anonymous cDNA clones were identified from this 1-Mb region. They also identified a long repetitive DNA element in the region between HLA-B and HLA-E. Homologuesmore » of this outside of the HLA complex. The portion of the HLA class I region represented by these YACs shows an average gene density as high as the class II and class III regions. Thus, the high gene density portion of the HLA complex is extended to more than 3 Mb.« less

Extending Bell's beables to encompass dissipation, decoherence, and the quantum-to-classical transition through quantum trajectories

NASA Astrophysics Data System (ADS)

Lorenzen, F.; de Ponte, M. A.; Moussa, M. H. Y.

2009-09-01

In this paper, employing the Itô stochastic Schrödinger equation, we extend Bell’s beable interpretation of quantum mechanics to encompass dissipation, decoherence, and the quantum-to-classical transition through quantum trajectories. For a particular choice of the source of stochasticity, the one leading to a dissipative Lindblad-type correction to the Hamiltonian dynamics, we find that the diffusive terms in Nelsons stochastic trajectories are naturally incorporated into Bohm’s causal dynamics, yielding a unified Bohm-Nelson theory. In particular, by analyzing the interference between quantum trajectories, we clearly identify the decoherence time, as estimated from the quantum formalism. We also observe the quantum-to-classical transition in the convergence of the infinite ensemble of quantum trajectories to their classical counterparts. Finally, we show that our extended beables circumvent the problems in Bohm’s causal dynamics regarding stationary states in quantum mechanics.

Isolation of expressed sequences from the region commonly deleted in Velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirotkin, H.; Morrow, B.; DasGupta, R.

Velo-cardio-facial syndrome (VCFS) is a relatively common autosomal dominant genetic disorder characterized by cleft palate, cardiac abnormalities, learning disabilities and a characteristic facial dysmorphology. Most VCFS patients have interstitial deletions of 22q11 of 1-2 mb. In an effort to isolate the gene(s) responsible for VCFS we have utilized a hybrid selection protocol to recover expressed sequences from three non-overlapping YACs comprising almost 1 mb of the commonly deleted region. Total yeast genomic DNA or isolated YAC DNA was immobilized on Hybond-N filters, blocked with yeast and human ribosomal and human repetitive sequences and hybridized with a mixture of random primedmore » short fragment cDNA libraries. Six human short fragment libraries derived from total fetus, fetal brain, adult brain, testes, thymus and spleen have been used for the selections. Short fragment cDNAs retained on the filter were passed through a second round of selection and cloned into lambda gt10. cDNAs shown to originate from the YACs and from chromosome 22 are being used to isolate full length cDNAs. Three genes known to be present on these YACs, catechol-O-methyltransferase, tuple 1 and clathrin heavy chain have been recovered. Additionally, a gene related to the murine p120 gene and a number of novel short cDNAs have been isolated. The role of these genes in VCFS is being investigated.« less

The gene for creatine kinase, mitochondrial 2 (sarcomeric; CKMT2), maps to chromosome 5q13. 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, I.; Devaud, C.; Cherif, D.

1993-10-01

YAC clones for the creatine kinase, mitochrondial 2 (sarcomeric; CKMT2), gene were isolated. One of these YACs was localized on chromosome 5q13.3 by fluorescence in situ hybridization. A polymorphic dinucleotide repeat (heterozygosity 0.77) was identified within the seventh intron of the CKMT2 gene. Genotyping of CEPH families allowed positioning of CKMT2 on the multipoint map of chromosome 5 between D5S424 and D5S428, distal to spinal muscular atrophy (SMA) (5q12-q14). 8 refs., 1 fig., 2 tabs.

Histaminergic regulation of natural killer cell-mediated clearance of tumour cells in mice.

PubMed

Asea, A; Hermodsson, S; Hellstrand, K

1996-01-01

Treatment of Swiss albino mice with histamine enhanced the clearance of natural killer (NK)-cell sensitive YAC-1 lymphoma and B16/F10 melanoma cells from lung tissue in vivo, but did not affect the elimination of NK-cell-insensitive P815 mastocytoma cells. The effect of histamine was apparently mediated by H2-type histamine receptors (H2R) since it was blocked by ranitidine, and H2R antagonist. Histamine did not affect clearance of tumour cells in animals depleted of NK cells in vivo by treatment with antibodies to asialo-GM1 or NK1.1. The effect of histamine was time-dependent: pretreatment with histamine for 3 h significantly augmented the clearance of YAC-1 cells, whereas, pretreatment with histamine for 5 min was ineffective. Histamine potentiated the anti-tumour properties of NK-cell activators such as interleukin-2 (IL-2) or interferon-alpha (IFN-alpha) in vivo. None of these lymphokines significantly affected the clearance of YAC-1 cells unless animals were concomitantly treated with histamine. Treatment with ranitidine alone reduced the in vivo clearance of YAC-1 cells from lungs but did not affect the clearance of NK-cell-insensitive P815 cells. Effects of ranitidine on NK-cell function in vivo were not shared by a chemical control to ranitidine, AH20239AA, thus indicating that the inhibition of NK-cells results from H2R antagonism rather than non-specific toxicity. It is concluded that histaminergic mechanisms may be involved in the regulation of NK cell function in vivo.

A Segment of the Apospory-Specific Genomic Region Is Highly Microsyntenic Not Only between the Apomicts Pennisetum squamulatum and Buffelgrass, But Also with a Rice Chromosome 11 Centromeric-Proximal Genomic Region1[W

PubMed Central

Gualtieri, Gustavo; Conner, Joann A.; Morishige, Daryl T.; Moore, L. David; Mullet, John E.; Ozias-Akins, Peggy

2006-01-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory. PMID:16415213

A segment of the apospory-specific genomic region is highly microsyntenic not only between the apomicts Pennisetum squamulatum and buffelgrass, but also with a rice chromosome 11 centromeric-proximal genomic region.

PubMed

Gualtieri, Gustavo; Conner, Joann A; Morishige, Daryl T; Moore, L David; Mullet, John E; Ozias-Akins, Peggy

2006-03-01

Bacterial artificial chromosome (BAC) clones from apomicts Pennisetum squamulatum and buffelgrass (Cenchrus ciliaris), isolated with the apospory-specific genomic region (ASGR) marker ugt197, were assembled into contigs that were extended by chromosome walking. Gene-like sequences from contigs were identified by shotgun sequencing and BLAST searches, and used to isolate orthologous rice contigs. Additional gene-like sequences in the apomicts' contigs were identified by bioinformatics using fully sequenced BACs from orthologous rice contigs as templates, as well as by interspecies, whole-contig cross-hybridizations. Hierarchical contig orthology was rapidly assessed by constructing detailed long-range contig molecular maps showing the distribution of gene-like sequences and markers, and searching for microsyntenic patterns of sequence identity and spatial distribution within and across species contigs. We found microsynteny between P. squamulatum and buffelgrass contigs. Importantly, this approach also enabled us to isolate from within the rice (Oryza sativa) genome contig Rice A, which shows the highest microsynteny and is most orthologous to the ugt197-containing C1C buffelgrass contig. Contig Rice A belongs to the rice genome database contig 77 (according to the current September 12, 2003, rice fingerprint contig build) that maps proximal to the chromosome 11 centromere, a feature that interestingly correlates with the mapping of ASGR-linked BACs proximal to the centromere or centromere-like sequences. Thus, relatedness between these two orthologous contigs is supported both by their molecular microstructure and by their centromeric-proximal location. Our discoveries promote the use of a microsynteny-based positional-cloning approach using the rice genome as a template to aid in constructing the ASGR toward the isolation of genes underlying apospory.

Sequence independent amplification of DNA

DOEpatents

Bohlander, S.K.

1998-03-24

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

Sequence independent amplification of DNA

DOEpatents

Bohlander, Stefan K.

1998-01-01

The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

Deletion 1q43 encompassing only CHRM3 in a patient with autistic disorder.

PubMed

Petersen, Andrea Klunder; Ahmad, Ausaf; Shafiq, Mustafa; Brown-Kipphut, Brigette; Fong, Chin-To; Anwar Iqbal, M

2013-02-01

Deletions on the distal portion of the long arm of chromosome 1 result in complex and highly variable clinical phenotypes which include intellectual disability, autism, seizures, microcephaly/craniofacial dysmorphology, corpus callosal agenesis/hypogenesis, cardiac and genital anomalies, hand and foot abnormalities and short stature. Genotype-phenotype correlation reported a minimum region of 2 Mb at 1q43-q44. We report on a 3 ½ year old male patient diagnosed with autistic disorder who has social withdrawal, eating problems, repetitive stereotypic behaviors including self-injurious head banging and hair pulling, and no seizures, anxiety, or mood swings. Array comparative genomic hybridization (aCGH) showed an interstitial deletion of 473 kb at 1q43 region (239,412,391-239,885,394; NCBI build37/hg19) harboring only CHRM3 (Acetylcholine Receptor, Muscarinic, 3; OMIM: 118494). Recently, another case with a de novo interstitial deletion of 911 kb at 1q43 encompassing three genes including CHRM3 was reported. The M3 muscarinic receptor influences a multitude of central and peripheral nervous system processes via its interaction with acetylcholine and may be an important modulator of behavior, learning and memory. We propose CHRM3 as a candidate gene responsible for our patient's specific phenotype as well as the overlapping phenotypic features of other patients with 1q43 or 1q43-q44 deletions. Copyright © 2013. Published by Elsevier Masson SAS.

Treatment with the MAO-A inhibitor clorgyline elevates monoamine neurotransmitter levels and improves affective phenotypes in a mouse model of Huntington disease.

PubMed

Garcia-Miralles, Marta; Ooi, Jolene; Ferrari Bardile, Costanza; Tan, Liang Juin; George, Maya; Drum, Chester L; Lin, Rachel Yanping; Hayden, Michael R; Pouladi, Mahmoud A

2016-04-01

Abnormal monoamine oxidase A and B (MAO-A/B) activity and an imbalance in monoamine neurotransmitters have been suggested to underlie the pathobiology of depression, a major psychiatric symptom observed in patients with neurodegenerative diseases, such as Huntington disease (HD). Increased MAO-A/B activity has been observed in brain tissue from patients with HD and in human and rodent HD neural cells. Using the YAC128 mouse model of HD, we studied the effect of an irreversible MAO-A inhibitor, clorgyline, on the levels of select monoamine neurotransmitters associated with affective function. We observed a decrease in striatal levels of the MAO-A/B substrates, dopamine and norepinephrine, in YAC128 HD mice compared with wild-type mice, which was accompanied by increased anxiety- and depressive-like behaviour at five months of age. Treatment for 26 days with clorgyline restored dopamine, serotonin, and norepinephrine neurotransmitter levels in the striatum and reduced anxiety- and depressive-like behaviour in YAC128 HD mice. This study supports a potential therapeutic use for MAO-A inhibitors in the treatment of depression and anxiety in patients with HD. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Effect of prostaglandin E2 on cytotoxic activity and granzyme A protease release by murine adherent IL-2 activated killer cells.

PubMed

Vaillier, D; Daculsi, R; Gualde, N

1994-04-01

The effects of prostaglandin E2 (PGE2) have been studied on a highly purified population of murine IL-2 activated killer cells obtained by selecting plastic-adherent splenocytes (AK cells) after incubation with high doses of recombinant IL-2. AK cells were highly cytotoxic for YAC-1 target cells. The cytotoxic activity was detectable at one hour after initiation of the cytotoxic assay and then increased with time. Cytotoxic activity of AK cells was inhibited by the addition of PGE2 or forskolin during the cytotoxic assay. When AK cells were generated in the presence of PGE2, the yielding cytotoxic activity was lower than the one expressed by "regular" AK cells but were insensitive to the inhibitory effect of PGE2 even if their lytic capability was still suppressed by forskolin. The presence of PGE2 during the AK cell culture had no effect on the cellular proliferation. Moreover, using tetrazolium-based colorimetric assay which reflects the cellular activation, it was observed that AK cells cultured in presence of PGE2 had an increased capacity to cleave the tetrazolium salt to formazan. Since the cytotoxic activity of killer cells is related to expression of serine esterase enzymes we evaluated the effects of PGE2 on serine esterase (Granzyme A) release after one hour of incubation of AK cells either alone or in presence of PGE2, YAC-1 cells or both. We observed that (i) AK cells spontaneously release granzyme A, (ii) the level of granzyme A was significantly increased when AK cells were incubated either with YAC-1 cells or PGE2 but did not change when YAC-1 cells and PGE2 were both associated with AK cells.

Genome Dynamics and Evolution of the Mla (Powdery Mildew) Resistance Locus in BarleyW⃞

PubMed Central

Wei, Fusheng; Wing, Rod A.; Wise, Roger P.

2002-01-01

Genes that confer defense against pathogens often are clustered in the genome and evolve via diverse mechanisms. To evaluate the organization and content of a major defense gene complex in cereals, we determined the complete sequence of a 261-kb BAC contig from barley cv Morex that spans the Mla (powdery mildew) resistance locus. Among the 32 predicted genes on this contig, 15 are associated with plant defense responses; 6 of these are associated with defense responses to powdery mildew disease but function in different signaling pathways. The Mla region is organized as three gene-rich islands separated by two nested complexes of transposable elements and a 45-kb gene-poor region. A heterochromatic-like region is positioned directly proximal to Mla and is composed of a gene-poor core with 17 families of diverse tandem repeats that overlap a hypermethylated, but transcriptionally active, gene-dense island. Paleontology analysis of long terminal repeat retrotransposons indicates that the present Mla region evolved over a period of >7 million years through a variety of duplication, inversion, and transposon-insertion events. Sequence-based recombination estimates indicate that R genes positioned adjacent to nested long terminal repeat retrotransposons, such as Mla, do not favor recombination as a means of diversification. We present a model for the evolution of the Mla region that encompasses several emerging features of large cereal genomes. PMID:12172030

Outdoor adventure therapy to increase physical activity in young adult cancer survivors.

PubMed

Gill, Elizabeth; Goldenberg, Marni; Starnes, Heather; Phelan, Suzanne

2016-01-01

Despite the health benefits of physical activity (PA), limited research has examined PA interventions in young adult cancer survivors (YACS). This study used a two-group parallel design to examine the effects of a 7-day outdoor adventure camp vs. waitlist control on PA levels among YACS. Secondary aims examined effects on sedentary behavior and PA correlates. 50 camp and 66 control participants were assessed at baseline, end of camp, and 3 months. Intent-to-treat analyses indicated that, relative to baseline, camp participants had significantly (p = 0.0001) greater increases in PA than controls during camp (+577 vs. +9 minutes/week) and 3 months post-camp (+133 vs. -75 minutes/week, p = 0.001). Camp participants also reported significantly greater improvements in TV viewing (p = 0.001), hours sitting (p = 0.001), PA variety (p = 0.0001), barriers to PA (p = 0.007), and enjoyment of structured activities (p = 0.04) during camp but not 3 months post-camp. A week-long outdoor adventure therapy camp increased PA levels during camp and 3 months after camp termination, although effects were attenuated over time. Outdoor adventure therapy camps may increase PA and its correlates in YACS, but future research should explore methods to promote sustained PA after camp termination.

Trauma associated sleep disorder: a proposed parasomnia encompassing disruptive nocturnal behaviors, nightmares, and REM without atonia in trauma survivors.

PubMed

Mysliwiec, Vincent; O'Reilly, Brian; Polchinski, Jason; Kwon, Herbert P; Germain, Anne; Roth, Bernard J

2014-10-15

To characterize the clinical, polysomnographic and treatment responses of patients with disruptive nocturnal behaviors (DNB) and nightmares following traumatic experiences. A case series of four young male, active duty U.S. Army Soldiers who presented with DNB and trauma related nightmares. Patients underwent a clinical evaluation in a sleep medicine clinic, attended overnight polysomnogram (PSG) and received treatment. We report pertinent clinical and PSG findings from our patients and review prior literature on sleep disturbances in trauma survivors. DNB ranged from vocalizations, somnambulism to combative behaviors that injured bed partners. Nightmares were replays of the patient's traumatic experiences. All patients had REM without atonia during polysomnography; one patient had DNB and a nightmare captured during REM sleep. Prazosin improved DNB and nightmares in all patients. We propose Trauma associated Sleep Disorder (TSD) as a unique sleep disorder encompassing the clinical features, PSG findings, and treatment responses of patients with DNB, nightmares, and REM without atonia after trauma.

Groundwater-Surface water interaction in agricultural watershed that encompasses dense network of High Capacity wells

NASA Astrophysics Data System (ADS)

Talib, A.; Desai, A. R.

2017-12-01

The Central Sands region of Wisconsin is characterized by productive trout streams, lakes, farmland and forest. However, stream channelization, past wetland drainage, and ground water withdrawals have disrupted the hydrology of this Central Sands region. Climatically driven conditions in last decade (2000-2008) alone are unable to account for the severely depressed water levels. Increased interception and evapotranspiration from afforested areas in central sand Wisconsin may also be culprit for reduced water recharge. Hence, there is need to study the cumulative effects of changing precipitation patterns, groundwater withdrawals, and forest evapotranspiration to improve projections of the future of lake levels and water availability in this region. Here, the SWAT-MODFLOW coupled model approach was applied at large spatio-temporal scale. The coupled model fully integrates a watershed model (SWAT) with a groundwater flow model (MODFLOW). Surface water and ground water flows were simulated integratively at daily time step to estimate the groundwater discharge to the stream network in Central Sands that encompasses high capacity wells. The model was calibrated (2010-2013) and validated (2014-2017) based on streamflow, groundwater extraction, and water table elevation. As the long-term trends in some of the primary drivers is presently ambiguous in Central Sands under future climate, as is the case for total precipitation or timing of precipitation, we relied on a sensitivity student to quantitatively access how primary and secondary drivers may influence future net groundwater recharge. We demonstrate how such an approach could then be coupled with decision-making models to evaluate the effectiveness of groundwater withdrawal policies under a changing climate.

High Potential Source for Biomass Degradation Enzyme Discovery and Environmental Aspects Revealed through Metagenomics of Indian Buffalo Rumen

PubMed Central

Singh, K. M.; Reddy, Bhaskar; Patel, Dishita; Patel, A. K.; Patel, J. B.; Joshi, C. G.

2014-01-01

The complex microbiomes of the rumen functions as an effective system for plant cell wall degradation, and biomass utilization provide genetic resource for degrading microbial enzymes that could be used in the production of biofuel. Therefore the buffalo rumen microbiota was surveyed using shot gun sequencing. This metagenomic sequencing generated 3.9 GB of sequences and data were assembled into 137270 contiguous sequences (contigs). We identified potential 2614 contigs encoding biomass degrading enzymes including glycoside hydrolases (GH: 1943 contigs), carbohydrate binding module (CBM: 23 contigs), glycosyl transferase (GT: 373 contigs), carbohydrate esterases (CE: 259 contigs), and polysaccharide lyases (PE: 16 contigs). The hierarchical clustering of buffalo metagenomes demonstrated the similarities and dissimilarity in microbial community structures and functional capacity. This demonstrates that buffalo rumen microbiome was considerably enriched in functional genes involved in polysaccharide degradation with great prospects to obtain new molecules that may be applied in the biofuel industry. PMID:25136572

Short read Illumina data for the de novo assembly of a non-model snail species transcriptome (Radix balthica, Basommatophora, Pulmonata), and a comparison of assembler performance

PubMed Central

2011-01-01

Background Until recently, read lengths on the Solexa/Illumina system were too short to reliably assemble transcriptomes without a reference sequence, especially for non-model organisms. However, with read lengths up to 100 nucleotides available in the current version, an assembly without reference genome should be possible. For this study we created an EST data set for the common pond snail Radix balthica by Illumina sequencing of a normalized transcriptome. Performance of three different short read assemblers was compared with respect to: the number of contigs, their length, depth of coverage, their quality in various BLAST searches and the alignment to mitochondrial genes. Results A single sequencing run of a normalized RNA pool resulted in 16,923,850 paired end reads with median read length of 61 bases. The assemblies generated by VELVET, OASES, and SeqMan NGEN differed in the total number of contigs, contig length, the number and quality of gene hits obtained by BLAST searches against various databases, and contig performance in the mt genome comparison. While VELVET produced the highest overall number of contigs, a large fraction of these were of small size (< 200bp), and gave redundant hits in BLAST searches and the mt genome alignment. The best overall contig performance resulted from the NGEN assembly. It produced the second largest number of contigs, which on average were comparable to the OASES contigs but gave the highest number of gene hits in two out of four BLAST searches against different reference databases. A subsequent meta-assembly of the four contig sets resulted in larger contigs, less redundancy and a higher number of BLAST hits. Conclusion Our results document the first de novo transcriptome assembly of a non-model species using Illumina sequencing data. We show that de novo transcriptome assembly using this approach yields results useful for downstream applications, in particular if a meta-assembly of contig sets is used to increase contig

Localization of a translocation breakpoint involved in Smith-Lemli-Opitz syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alley, T.L.; Gray, B.A.; Lee, S.

1994-09-01

Smith-Lemli-Opitz syndrome (SLOS) is a multiple congenital anomaly/mental retardation syndrome, with features including toe syndactyly, genital anomalies, unusual facies, and occasional organ malformations. The gene(s) for this autosomal recessive disorder has not been mapped. Recent biochemical studies suggest that the defect may involve the penultimate step in cholesterol synthesis, as patients have low serum cholesterol and increased 7-dehydrocholesterol (7-DHC) levels. However, the enzyme putatively involved (7-DHC reductase) has not been isolated. We identified an SLOS patient with a de novo balanced chromosome translocation [t(7;20)(q32.1;q13.2)], and we propose that the translocation interrupts one of the patient`s SLOS alleles. We are pursuingmore » positional cloning to identify the SLOS gene. Using fluorescence in situ hybridization (FISH), we recently identified a chromosome 7 yeast artificial chromosome (YAC) that spans the breakpoint and places it onto physical and genetic maps. We are in the process of narrowing this region via overlapping YACs and YAC subclones, from which we will isolate candidate cDNAs. Any candidate gene disrupted by the translocation and mutated on the other allele will be proven to be the SLOS gene. Functional analysis of an SLOS cDNA may also determine its relationship to cholesterol metabolism and the observed biochemical abnormalities.« less

Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability

PubMed Central

Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

2014-01-01

Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome. PMID:23695276

Large deletions encompassing the TCOF1 and CAMK2A genes are responsible for Treacher Collins syndrome with intellectual disability.

PubMed

Vincent, Marie; Collet, Corinne; Verloes, Alain; Lambert, Laetitia; Herlin, Christian; Blanchet, Catherine; Sanchez, Elodie; Drunat, Séverine; Vigneron, Jacqueline; Laplanche, Jean-Louis; Puechberty, Jacques; Sarda, Pierre; Geneviève, David

2014-01-01

Mandibulofacial dysostosis is part of a clinically and genetically heterogeneous group of disorders of craniofacial development, which lead to malar and mandibular hypoplasia. Treacher Collins syndrome is the major cause of mandibulofacial dysostosis and is due to mutations in the TCOF1 gene. Usually patients with Treacher Collins syndrome do not present with intellectual disability. Recently, the EFTUD2 gene was identified in patients with mandibulofacial dysostosis associated with microcephaly, intellectual disability and esophageal atresia. We report on two patients presenting with mandibulofacial dysostosis characteristic of Treacher Collins syndrome, but associated with unexpected intellectual disability, due to a large deletion encompassing several genes including the TCOF1 gene. We discuss the involvement of the other deleted genes such as CAMK2A or SLC6A7 in the cognitive development delay of the patients reported, and we propose the systematic investigation for 5q32 deletion when intellectual disability is associated with Treacher Collins syndrome.

Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.; Yan, D.; McHenry, C.

1994-09-01

Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

PubMed

Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

1996-11-01

Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and

Constraining eye movement in individuals with Parkinson's disease during walking turns.

PubMed

Ambati, V N Pradeep; Saucedo, Fabricio; Murray, Nicholas G; Powell, Douglas W; Reed-Jones, Rebecca J

2016-10-01

Walking and turning is a movement that places individuals with Parkinson's disease (PD) at increased risk for fall-related injury. However, turning is an essential movement in activities of daily living, making up to 45 % of the total steps taken in a given day. Hypotheses regarding how turning is controlled suggest an essential role of anticipatory eye movements to provide feedforward information for body coordination. However, little research has investigated control of turning in individuals with PD with specific consideration for eye movements. The purpose of this study was to examine eye movement behavior and body segment coordination in individuals with PD during walking turns. Three experimental groups, a group of individuals with PD, a group of healthy young adults (YAC), and a group of healthy older adults (OAC), performed walking and turning tasks under two visual conditions: free gaze and fixed gaze. Whole-body motion capture and eye tracking characterized body segment coordination and eye movement behavior during walking trials. Statistical analysis revealed significant main effects of group (PD, YAC, and OAC) and visual condition (free and fixed gaze) on timing of segment rotation and horizontal eye movement. Within group comparisons, revealed timing of eye and head movement was significantly different between the free and fixed gaze conditions for YAC (p < 0.001) and OAC (p < 0.05), but not for the PD group (p > 0.05). In addition, while intersegment timings (reflecting segment coordination) were significantly different for YAC and OAC during free gaze (p < 0.05), they were not significantly different in PD. These results suggest individuals with PD do not make anticipatory eye and head movements ahead of turning and that this may result in altered segment coordination during turning. As such, eye movements may be an important addition to training programs for those with PD, possibly promoting better coordination during turning and

Screening white spot syndrome virus (WSSV)-resistant molecular markers from Fenneropenaeus chinensis

NASA Astrophysics Data System (ADS)

Wu, Yingying; Meng, Xianhong; Kong, Jie; Luan, Sheng; Luo, Kun; Wang, Qingyin; Zheng, Yongyun

2017-02-01

White spot syndrome virus (WSSV)-resistant molecular markers were screened from the selectively bred new variety `Huanghai No. 2' of Fenneropenaeus chinensis using unlabeled-probe high-resolution melting (HRM) technique. After the artificial infection with WSSV, the first 96 dead shrimps and the last 96 surviving shrimps were collected, representing WSSV-susceptible and -resistant populations, respectively. The genotypes at well-developed 39 single nucleotide polymorphisms (SNPs) loci were obtained. As revealed in the Chi-square test, 3 SNPs, genotype A/A of contig C364-89AT, genotype A/A of C2635-527CA and genotype C/T of contig C12355-592CT, were positively correlated with disease-resistance traits. Other 2 SNPs, genotype G/G of contig C283-145AG and genotype C/C of contig C12355-592CT, were negatively correlated. Moreover, analysis with BlastX program for disease-resistant SNPs indicated that 3 contigs, Contig283, Contig364 and Contig12355, matched to the functional genes of effector caspase of Penaeus monodon, peptide transporter family 1-like protein, and 40S ribosomal protein S2 of Perca flavescens with high sequence similarity. The results will be helpful to provide theoretical and technical supports for molecular marker-assisted selective breeding of F. chinensis.

Molecular definition of breakpoints associated with human Xq isochromosomes: Implications for mechanisms of formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolff, D.J.; Miller, A.P.; Schwartz, S.

1996-01-01

To test the centromere misdivision model of isochromosome formation, we have defined the breakpoints of cytogenetically monocentric and dicentric Xq isochromosomes (i(Xq)) from Turner syndrome probands, using FISH with cosmids and YACs derived from a contig spanning proximal Xp. Seven different pericentromeric breakpoints were identified, with 10 of 11 of the i(Xq)s containing varying amounts of material from Xp. Only one of the eight cytogenetically monocentric i(Xq)s demonstrated a single alpha-satellite (DXZ1) signal, consistent with classical models involving centromere misdivision. The remaining seven were inconsistent with such a model and had breakpoints that spanned proximal Xp11.21: one was between DXZ1more » and the most proximal marker, ZXDA; one occurred between the duplicated genes, ZXDA and ZXDB; two were {approximately}2 Mb from DXZ1; two were adjacent to ALAS2 located 3.5 Mb from DXZ1; and the largest had a breakpoint just distal to DXS1013E, indicating the inclusion of 8 Mb of Xp DNA between centromeres. The three cytologically dicentric i(Xq)s had breakpoints distal to DXS423E in Xp11.22 and therefore contained {ge}12 Mb of DNA between centromeres. These data demonstrate that the majority of breakpoints resulting in i(Xq) formation are in band Xp11.2 and not in the centromere itself. Therefore, we hypothesize that the predominant mechanism of i(Xq) formation involves sequences in the proximal short arm that are prone to breakage and reunion events between sister chromatids or homologous X chromosomes. 39 refs., 4 figs., 2 tabs.« less

Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

PubMed

Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

2009-07-01

Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

Urban Youth Knowledge and Attitudes Regarding Lead Poisoning.

PubMed

Bogar, Sandra; Szabo, Aniko; Woodruff, Shane; Johnson, Sheri

2017-12-01

Environmental health literacy (EHL) is a promising and evolving field of research that could benefit from youth engagement. Yet studies focused on youths' environmental health awareness and concerns are limited. For example, although lead exposure remains a threat to youth development in urban environments, no published studies have measured urban youth's knowledge of lead poisoning. A CBPR partnership established a youth advisory council (YAC) who helped to design, interpret and disseminate a mixed methods study exploring environmental health perceptions among urban youths ages 10-18. Surveys assessed awareness, attitudes, and knowledge regarding lead poisoning and five environmental health issues determined by the YAC. Focus group questions further contextualized youths' lead knowledge and understanding of youths' environmental health concerns. A majority of youth could identify specific sources of lead exposure but had minimal knowledge of prevention strategies, and focus group data revealed misinformation regarding lead sources and consequences. Survey and focus group respondents' level of awareness and concern regarding YAC-selected EH issues was high in comparison to lead poisoning. In particular, job opportunities and police brutality were endorsed as both neighborhood concerns and priorities. Awareness and knowledge of environmental health issues among urban youth have not been well described. These findings reinforce the importance of addressing problems of local relevance. Moving forward, lead poisoning prevention education for youth and youth EHL partnerships may benefit from incorporating an ecological approach wherein connections to the social and economic context are made explicit.

Production of a yeast artificial chromosome for stable expression of a synthetic xylose isomerase-xylulokinase polyprotein in a fuel ethanol yeast strain

USDA-ARS?s Scientific Manuscript database

Commercialization of fuel ethanol production from lignocellulosic biomass has focused on engineering the glucose-fermenting industrial yeast Saccharomyces cerevisiae to utilize pentose sugars. A yeast artificial chromosome (YAC) was engineered to contain a polyprotein gene construct expressing xylos...

Process for assembly and transformation into Saccharomyces cerevisiae of a synthetic yeast artificial chromosome containing a multigene cassette to express enzymes that enhance xylose utilization designed for an automated pla

USDA-ARS?s Scientific Manuscript database

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system ...

Transcriptome changes associated with Tomato spotted wilt virus infection in various life stages of its thrips vector, Frankliniella fusca (Hinds).

PubMed

Shrestha, Anita; Champagne, Donald E; Culbreath, Albert K; Rotenberg, Dorith; Whitfield, Anna E; Srinivasan, Rajagopalbabu

2017-08-01

Persistent propagative viruses maintain intricate interactions with their arthropod vectors. In this study, we investigated the transcriptome-level responses associated with a persistent propagative phytovirus infection in various life stages of its vector using an Illumina HiSeq sequencing platform. The pathosystem components included a Tospovirus, Tomato spotted wilt virus (TSWV), its insect vector, Frankliniella fusca (Hinds), and a plant host, Arachis hypogaea (L.). We assembled (de novo) reads from three developmental stage groups of virus-exposed and non-virus-exposed F. fusca into one transcriptome consisting of 72 366 contigs and identified 1161 differentially expressed (DE) contigs. The number of DE contigs was greatest in adults (female) (562) when compared with larvae (first and second instars) (395) and pupae (pre- and pupae) (204). Upregulated contigs in virus-exposed thrips had blastx annotations associated with intracellular transport and virus replication. Upregulated contigs were also assigned blastx annotations associated with immune responses, including apoptosis and phagocytosis. In virus-exposed larvae, Blast2GO analysis identified functional groups, such as multicellular development with downregulated contigs, while reproduction, embryo development and growth were identified with upregulated contigs in virus-exposed adults. This study provides insights into differences in transcriptome-level responses modulated by TSWV in various life stages of an important vector, F. fusca.

Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw.

PubMed

Jose, V Lyju; Appoothy, Thulasi; More, Ravi P; Arun, A Sha

2017-12-01

The rumen is a unique natural habitat, exhibiting an unparalleled genetic resource of fibrolytic enzymes of microbial origin that degrade plant polysaccharides. The objectives of this study were to identify the principal plant cell wall-degrading enzymes and the taxonomic profile of rumen microbial communities that are associated with it. The cattle rumen microflora and the carbohydrate-active enzymes were functionally classified through a whole metagenomic sequencing approach. Analysis of the assembled sequences by the Carbohydrate-active enzyme analysis Toolkit identified the candidate genes encoding fibrolytic enzymes belonging to different classes of glycoside hydrolases(11,010 contigs), glycosyltransferases (6366 contigs), carbohydrate esterases (4945 contigs), carbohydrate-binding modules (1975 contigs), polysaccharide lyases (480 contigs), and auxiliary activities (115 contigs). Phylogenetic analysis of CAZyme encoding contigs revealed that a significant proportion of CAZymes were contributed by bacteria belonging to genera Prevotella, Bacteroides, Fibrobacter, Clostridium, and Ruminococcus. The results indicated that the cattle rumen microbiome and the CAZymes are highly complex, structurally similar but compositionally distinct from other ruminants. The unique characteristics of rumen microbiota and the enzymes produced by resident microbes provide opportunities to improve the feed conversion efficiency in ruminants and serve as a reservoir of industrially important enzymes for cellulosic biofuel production.

Enhancement of antibody-dependent cellular cytotoxicity of cetuximab by a chimeric protein encompassing interleukin-15.

PubMed

Ochoa, Maria Carmen; Minute, Luna; López, Ascensión; Pérez-Ruiz, Elisabeth; Gomar, Celia; Vasquez, Marcos; Inoges, Susana; Etxeberria, Iñaki; Rodriguez, Inmaculada; Garasa, Saray; Mayer, Jan-Peter Andreas; Wirtz, Peter; Melero, Ignacio; Berraondo, Pedro

2018-01-01

Enhancement of antibody-dependent cellular cytotoxicity (ADCC) may potentiate the antitumor efficacy of tumor-targeted monoclonal antibodies. Increasing the numbers and antitumor activity of NK cells is a promising strategy to maximize the ADCC of standard-of-care tumor-targeted antibodies. For this purpose, we have preclinically tested a recombinant chimeric protein encompassing the sushi domain of the IL15Rα, IL-15, and apolipoprotein A-I (Sushi-IL15-Apo) as produced in CHO cells. The size-exclusion purified monomeric fraction of this chimeric protein was stable and retained the IL-15 and the sushi domain bioactivity as measured by CTLL-2 and Mo-7e cell proliferation and STAT5 phosphorylation in freshly isolated human NK and CD8 + T cells. On cell cultures, Sushi-IL15-Apo increases NK cell proliferation and survival as well as spontaneous and antibody-mediated cytotoxicity. Scavenger receptor class B type I (SR-B1) is the receptor for ApoA-I and is expressed on the surface of tumor cells. SR-B1 can adsorb the chimeric protein on tumor cells and can transpresent IL-15 to NK and CD8 + T cells. A transient NK-humanized murine model was developed to test the increase of ADCC attained by the chimeric protein in vivo . The EGFR + human colon cancer cell line HT-29 was intraperitoneally inoculated in immune-deficient Rag2 -/- γc -/- mice that were reconstituted with freshly isolated PBMCs and treated with the anti-EGFR mAb cetuximab. The combination of the Sushi-IL15-Apo protein and cetuximab reduced the number of remaining tumor cells in the peritoneal cavity and delayed tumor engraftment in the peritoneum. Furthermore, Sushi-IL15-Apo increased the anti-tumor effect of a murine anti-EGFR mAb in Rag1 -/- mice bearing subcutaneous MC38 colon cancer transfected to express EGFR. Thus, Sushi-IL15-Apo is a potent tool to increase the number and the activation of NK cells to promote the ADCC activity of antibodies targeting tumor antigens.

The canine sarcoglycan delta gene: BAC clone contig assembly, chromosome assignment and interrogation as a candidate gene for dilated cardiomyopathy in Dobermann dogs.

PubMed

Stabej, P; Leegwater, P A J; Imholz, S; Versteeg, S A; Zijlstra, C; Stokhof, A A; Domanjko-Petriè, A; van Oost, B A

2005-01-01

Dilated cardiomyopathy (DCM) is a common disease of the myocardium recognized in human, dog and experimental animals. Genetic factors are responsible for a large proportion of cases in humans, and 17 genes with DCM causing mutations have been identified. The genetic origin of DCM in the Dobermann dogs has been suggested, but no disease genes have been identified to date. In this paper, we describe the characterization and evaluation of the canine sarcoglycan delta (SGCD), a gene implicated in DCM in human and hamster. Bacterial artificial chromosomes (BACs) containing the canine SGCD gene were isolated with probes for exon 3 and exons 4-8 and were characterized by Southern blot analysis. BAC end sequences were obtained for four BACs. Three of the BACs overlapped and could be ordered relative to each other and the end sequences of all four BACs could be anchored on the preliminary assembly of the dog genome sequence (www. ensembl.org). One of the BACs of the partial contig was localized by fluorescent in situ hybridization to canine chromosome 4q22, in agreement with the dog genome sequence. Two highly informative polymorphic microsatellite markers in intron 7 of the SGCD gene were identified. In 25 DCM-affected and 13 non DCM-affected dogs seven different haplotypes could be distinguished. However, no association between any of the SGCD variants and the disease locus was apparent.

EULER-PCR: finishing experiments for repeat resolution.

PubMed

Mulyukov, Zufar; Pevzner, Pavel A

2002-01-01

Genomic sequencing typically generates a large collection of unordered contigs or scaffolds. Contig ordering (also known as gap closure) is a non-trivial algorithmic and experimental problem since even relatively simple-to-assemble bacterial genomes typically result in large set of contigs. Neighboring contigs maybe separated either by gaps in read coverage or by repeats. In the later case we say that the contigs are separated by pseudogaps, and we emphasize the important difference between gap closure and pseudogap closure. The existing gap closure approaches do not distinguish between gaps and pseudogaps and treat them in the same way. We describe a new fast strategy for closing pseudogaps (repeat resolution). Since in highly repetitive genomes, the number of pseudogaps may exceed the number of gaps by an order of magnitude, this approach provides a significant advantage over the existing gap closure methods.

Mutant prenyltransferase-like mitochondrial protein (PLMP) and mitochondrial abnormalities in kd/kd mice

PubMed Central

Peng, Min; Jarett, Leonard; Meade, Ray; Madaio, Michael P.; Hancock, Wayne W.; George, Alfred L.; Neilson, Eric G.; Gasser, David L.

2008-01-01

Background Mice that are homozygous for the kidney disease (kd) mutation are apparently healthy for the first 8 weeks of life, but spontaneously develop a severe form of interstitial nephritis that progresses to end-stage renal disease (ESRD) by 4 to 8 months of age. By testing for linkage to microsatellite markers, we previously localized the kd gene to a YAC/BAC contig. Methods The sequence of the entire critical region was examined, and candidate genes were identified. These candidate genes were sequenced in both mutant (kd/kd) mice and normal controls. The phenotype was further characterized by immunohistochemistry and electron microscopy. Transgenic mice were constructed that carried the wild-type allele of the prime candidate gene, and this transgene was transferred to a kd/kd background by breeding. Results We have obtained evidence that kd is a mutant allele of a novel gene for a prenyltransferase-like mitochondrial protein (PLMP). This gene is alternatively spliced, with the larger gene product having one domain that resembles transprenyltransferase and another that is similar to geranylgeranyl pyrophosphate synthase. The smaller gene product includes only the first domain. An antiserum to PLMP localizes to mitochondria, and ultrastructural defects are present in the mitochondria of renal tubular epithelial cells, and to a lesser extent, hepatocytes and heart cells from kd/kd mice. In a line of kd/kd mice that carried the wild-type PLMP allele as a transgene, only 1 out of 13 animals expressed the disease by 120 days of age. Conclusion The kd allele codes for a novel protein that localizes to the mitochondria, and the kd/kd mouse has dysmorphic mitochondria in the renal tubular epithelial cells. This mouse is therefore a unique animal model for studying mechanisms that lead to tubulointerstitial nephritis. PMID:15200409

The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

PubMed

Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

1992-05-01

Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

CD and NMR conformational studies of a peptide encompassing the Mid Loop interface of Ship2-Sam.

PubMed

Mercurio, Flavia A; Scognamiglio, Pasqualina L; Di Natale, Concetta; Marasco, Daniela; Pellecchia, Maurizio; Leone, Marilisa

2014-11-01

The lipid phosphatase Ship2 is a protein that intervenes in several diseases such as diabetes, cancer, neurodegeneration, and atherosclerosis. It is made up of a catalytic domain and several protein docking modules such as a C-terminal Sam (Sterile alpha motif) domain. The Sam domain of Ship2 (Ship2-Sam) binds to the Sam domains of the EphA2 receptor (EphA2-Sam) and the PI3K effector protein Arap3 (Arap3-Sam). These heterotypic Sam-Sam interactions occur through formation of dimers presenting the canonical "Mid Loop/End Helix" binding mode. The central region of Ship2-Sam, spanning the C-terminal end of α2, the α3 and α4 helices together with the α2α3 and α3α4 interhelical loops, forms the Mid Loop surface that is needed to bind partners Sam domains. A peptide encompassing most of the Ship2-Sam Mid Loop interface (Shiptide) capable of binding to both EphA2-Sam and Arap3-Sam, was previously identified. Here we investigated the conformational features of this peptide, through solution CD and NMR studies in different conditions. These studies reveal that the peptide is highly flexible in aqueous buffer, while it adopts a helical conformation in presence of 2,2,2-trifluoroethanol. The discovered structural insights and in particular the identification of a helical motif, may lead to the design of more constrained and possibly cell permeable Shiptide analogs that could work as efficient antagonists of Ship2-Sam heterotypic interactions and embrace therapeutic applications. © 2014 Wiley Periodicals, Inc.

The World Encompassed. Remarks at a Dinner in the Great Hall in Celebration of the Treasures of the Library of Congress (Washington, DC, March 19, 1981). The Center for the Book Viewpoint Series No. 6.

ERIC Educational Resources Information Center

Boorstin, Daniel J.

The theme for the celebration of the Library of Congress treasures, "The World Encompassed," is suggested by the title of a nephew's account of Sir Francis Drake's circumnavigation of the earth. This account is part of the Sir Francis Drake collection donated by patrons to the library. In April 1581, Drake was knighted by Queen Elizabeth…

A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-κB pathway in skeletal muscle.

PubMed

Laure, Lydie; Danièle, Nathalie; Suel, Laurence; Marchand, Sylvie; Aubert, Sophie; Bourg, Nathalie; Roudaut, Carinne; Duguez, Stéphanie; Bartoli, Marc; Richard, Isabelle

2010-10-01

A multiprotein complex encompassing a transcription regulator, cardiac ankyrin repeat protein (CARP), and the calpain 3 protease was identified in the N2A elastic region of the giant sarcomeric protein titin. The present study aimed to investigate the function(s) of this complex in the skeletal muscle. We demonstrate that CARP subcellular localization is controlled by the activity of calpain 3: the higher the calpain 3, the more important the sarcomeric retention of CARP. This regulation would occur through cleavage of the N-terminal end of CARP by the protease. We show that, upon CARP over-expression, the transcription factor nuclear factor NF-κB p65 DNA-binding activity decreases. Taken as a whole, CARP and its regulator calpain 3 appear to occupy a central position in the important cell fate-governing NF-κB pathway. Interestingly, the expression of the atrophying protein MURF1, one of NF-κB main targets, remains unchanged in presence of CARP, suggesting that the pathway encompassing calpain 3/CARP/NF-κB does not play a role in muscle atrophy. With NF-κB also having anti-apoptotic effects, the inability of calpain 3 to lower CARP-driven inhibition of NF-κB could reduce muscle cell survival, hence partly accounting for the dystrophic pattern observed in limb girdle muscular dystrophy 2A, a pathology resulting from the protease deficiency. © 2010 The Authors Journal compilation © 2010 FEBS.

Characterization of the reniform nematode genome by shotgun sequencing.

PubMed

Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Cseke, Sarah B; Buyyarapu, Ramesh; Mc Ewan, Robert; Gu, Yong Q; Lawrence, Kathy; Senwo, Zachary; Sripathi, Padmini; George, Pheba; Sharma, Govind C

2014-04-01

The reniform nematode (RN), a major agricultural pest particularly on cotton in the United States, is among the major plant-parasitic nematodes for which limited genomic information exists. In this study, over 380 Mb of sequence data were generated from pooled DNA of four adult female RNs and assembled into 67,317 contigs, including 25,904 (38.5%) predicted coding contigs and 41,413 (61.5%) noncoding contigs. Most of the characterized repeats were of low complexity (88.9%), and 0.9% of the contigs matched with 53.2% of GenBank ESTs. The most frequent Gene Ontology (GO) terms for molecular function and biological process were protein binding (32%) and embryonic development (20%). Further analysis showed that 741 (1.1%), 94 (0.1%), and 169 (0.25%) RN genomic contigs matched with 1328 (13.9%), 1480 (5.4%), and 1330 (7.4%) supercontigs of Meloidogyne incognita, Brugia malayi, and Pristionchus pacificus, respectively. Chromosome 5 of Caenorhabditis elegans had the highest number of hits to the RN contigs. Seven putative detoxification genes and three carbohydrate-active enzymes (CAZymes) involved in cell wall degradation were studied in more detail. Additionally, kinases, G protein-coupled receptors, and neuropeptides functioning in physiological, developmental, and regulatory processes were identified in the RN genome.

Feasibility of physical map construction from fingerprinted bacterial artificial chromosome libraries of polyploid plant species

PubMed Central

2010-01-01

Background The presence of closely related genomes in polyploid species makes the assembly of total genomic sequence from shotgun sequence reads produced by the current sequencing platforms exceedingly difficult, if not impossible. Genomes of polyploid species could be sequenced following the ordered-clone sequencing approach employing contigs of bacterial artificial chromosome (BAC) clones and BAC-based physical maps. Although BAC contigs can currently be constructed for virtually any diploid organism with the SNaPshot high-information-content-fingerprinting (HICF) technology, it is currently unknown if this is also true for polyploid species. It is possible that BAC clones from orthologous regions of homoeologous chromosomes would share numerous restriction fragments and be therefore included into common contigs. Because of this and other concerns, physical mapping utilizing the SNaPshot HICF of BAC libraries of polyploid species has not been pursued and the possibility of doing so has not been assessed. The sole exception has been in common wheat, an allohexaploid in which it is possible to construct single-chromosome or single-chromosome-arm BAC libraries from DNA of flow-sorted chromosomes and bypass the obstacles created by polyploidy. Results The potential of the SNaPshot HICF technology for physical mapping of polyploid plants utilizing global BAC libraries was evaluated by assembling contigs of fingerprinted clones in an in silico merged BAC library composed of single-chromosome libraries of two wheat homoeologous chromosome arms, 3AS and 3DS, and complete chromosome 3B. Because the chromosome arm origin of each clone was known, it was possible to estimate the fidelity of contig assembly. On average 97.78% or more clones, depending on the library, were from a single chromosome arm. A large portion of the remaining clones was shown to be library contamination from other chromosomes, a feature that is unavoidable during the construction of single

Amyloid Precursor Protein Haploinsufficiency Preferentially Mediates Brain Iron Accumulation in Mice Transgenic for The Huntington's Disease Mutation.

PubMed

Berggren, Kiersten; Agrawal, Sonal; Fox, Julia A; Hildenbrand, Justin; Nelson, Ryan; Bush, Ashley I; Fox, Jonathan H

2017-01-01

Huntington's disease (HD) is an autosomal dominant disorder caused by a CAG expansion in the huntingtin gene that results in expression of mutant huntingtin protein. Iron accumulates in HD brain neurons. Amyloid precursor protein (APP) promotes neuronal iron export. However, the role of APP in brain iron accumulation in HD is unclear. To determine the effects of APP insufficiency on HD in YAC128 mice. We crossed APP hemizygous mice (APP+/-) with YAC128 mice that are transgenic (Tg) for human mutant huntingtin (hmHTT) to generate APP+/+ hmHTT-/-, APP+/- hmHTT-/-, APP+/+ hmHTT+/- and APP+/- hmHTT+/- progeny. Mice were evaluated for behavioral, biochemical and neuropathology HD outcomes at 2-12 months of age. APP heterozygosity decreased cortical APP 25% and 60% in non-Tg and Tg mice, respectively. Cerebral and striatal iron levels were increased by APP knockdown in Tg mice only. Nest-building behavior was decreased in Tg mice; APP knockdown decreased nest building in non-Tg but not Tg mice. Rota-rod endurance was decreased in Tg mice. APP+/- hHTT+/- mice demonstrated additional decreases in rota-rod endurance from 4-10 months of age. Tg mice had smaller striatal volumes and fewer striatal neurons but were not affected by APP knockdown. APP heterozygosity results in greater decreases of cortical APP in Tg versus non-Tg mice. Mutant huntingtin transgenic mice develop brain iron accumulation as a result of greater suppression of APP levels. Elevated brain iron in Tg mice was associated with a decline in motor endurance consistent with a disease promoting effect of iron in the YAC128 model of human HD.

Overexpression of the human VPAC2 receptor in the suprachiasmatic nucleus alters the circadian phenotype of mice

PubMed Central

Shen, Sanbing; Spratt, Christopher; Sheward, W. John; Kallo, Imre; West, Katrine; Morrison, Christine F.; Coen, Clive W.; Marston, Hugh M.; Harmar, Anthony J.

2000-01-01

The neuropeptides vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) belong to a superfamily of structurally related peptide hormones that includes glucagon, glucagon-like peptides, secretin, and growth hormone-releasing hormone. Microinjection of VIP or PACAP into the rodent suprachiasmatic nucleus (SCN) phase shifts the circadian pacemaker and VIP antagonists, and antisense oligodeoxynucleotides have been shown to disrupt circadian function. VIP and PACAP have equal potency as agonists of the VPAC2 receptor (VPAC2R), which is expressed abundantly in the SCN, in a circadian manner. To determine whether manipulating the level of expression of the VPAC2R can influence the control of the circadian clock, we have created transgenic mice overexpressing the human VPAC2R gene from a yeast artificial chromosome (YAC) construct. The YAC was modified by a strategy using homologous recombination to introduce (i) the HA epitope tag sequence (from influenza virus hemagglutinin) at the carboxyl terminus of the VPAC2R protein, (ii) the lacZ reporter gene, and (iii) a conditional centromere, enabling YAC DNA to be amplified in culture in the presence of galactose. High levels of lacZ expression were detected in the SCN, habenula, pancreas, and testis of the transgenic mice, with lower levels in the olfactory bulb and various hypothalamic areas. Transgenic mice resynchronized more quickly than wild-type controls to an advance of 8 h in the light-dark (LD) cycle and exhibited a significantly shorter circadian period in constant darkness (DD). These data suggest that the VPAC2R can influence the rhythmicity and photic entrainment of the circadian clock. PMID:11027354

Transcriptome Sequencing and Developmental Regulation of Gene Expression in Anopheles aquasalis

PubMed Central

Silva, Maria C. P.; Lopes, Adriana R.; Barros, Michele S.; Sá-Nunes, Anderson; Kojin, Bianca B.; Carvalho, Eneas; Suesdek, Lincoln; Silva-Neto, Mário Alberto C.; James, Anthony A.; Capurro, Margareth L.

2014-01-01

Background Anopheles aquasalis is a major malaria vector in coastal areas of South and Central America where it breeds preferentially in brackish water. This species is very susceptible to Plasmodium vivax and it has been already incriminated as responsible vector in malaria outbreaks. There has been no high-throughput investigation into the sequencing of An. aquasalis genes, transcripts and proteins despite its epidemiological relevance. Here we describe the sequencing, assembly and annotation of the An. aquasalis transcriptome. Methodology/Principal Findings A total of 419 thousand cDNA sequence reads, encompassing 164 million nucleotides, were assembled in 7544 contigs of ≥2 sequences, and 1999 singletons. The majority of the An. aquasalis transcripts encode proteins with their closest counterparts in another neotropical malaria vector, An. darlingi. Several analyses in different protein databases were used to annotate and predict the putative functions of the deduced An. aquasalis proteins. Larval and adult-specific transcripts were represented by 121 and 424 contig sequences, respectively. Fifty-one transcripts were only detected in blood-fed females. The data also reveal a list of transcripts up- or down-regulated in adult females after a blood meal. Transcripts associated with immunity, signaling networks and blood feeding and digestion are discussed. Conclusions/Significance This study represents the first large-scale effort to sequence the transcriptome of An. aquasalis. It provides valuable information that will facilitate studies on the biology of this species and may lead to novel strategies to reduce malaria transmission on the South American continent. The An. aquasalis transcriptome is accessible at http://exon.niaid.nih.gov/transcriptome/An_aquasalis/Anaquexcel.xlsx. PMID:25033462

First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

PubMed

Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F

2014-01-01

Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

First Report of a Deletion Encompassing an Entire Exon in the Homogentisate 1,2-Dioxygenase Gene Causing Alkaptonuria

PubMed Central

Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.

2014-01-01

Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259

The Transformative Power of Youth Action Coalition's Multimodal Arts-for-Change Programming

ERIC Educational Resources Information Center

Turner, K. C. Nat; Way, Kate; Gray, Robin R. R.

2013-01-01

This article analyzes the potential of a series of Youth Action Coalition's (YAC) Arts-for-Change (AfC) youth programs for literacy and identity development, as well as for engaging youth in addressing issues of social justice. Drawing primarily on transcripts of interviews, surveys, and participant-observation fieldnotes inventorying changes in…

Can Static Habitat Protection Encompass Critical Areas for Highly Mobile Marine Top Predators? Insights from Coastal East Africa.

PubMed

Pérez-Jorge, Sergi; Pereira, Thalia; Corne, Chloe; Wijtten, Zeno; Omar, Mohamed; Katello, Jillo; Kinyua, Mark; Oro, Daniel; Louzao, Maite

2015-01-01

Along the East African coast, marine top predators are facing an increasing number of anthropogenic threats which requires the implementation of effective and urgent conservation measures to protect essential habitats. Understanding the role that habitat features play on the marine top predator' distribution and abundance is a crucial step to evaluate the suitability of an existing Marine Protected Area (MPA), originally designated for the protection of coral reefs. We developed species distribution models (SDM) on the IUCN data deficient Indo-Pacific bottlenose dolphin (Tursiops aduncus) in southern Kenya. We followed a comprehensive ecological modelling approach to study the environmental factors influencing the occurrence and abundance of dolphins while developing SDMs. Through the combination of ensemble prediction maps, we defined recurrent, occasional and unfavourable habitats for the species. Our results showed the influence of dynamic and static predictors on the dolphins' spatial ecology: dolphins may select shallow areas (5-30 m), close to the reefs (< 500 m) and oceanic fronts (< 10 km) and adjacent to the 100 m isobath (< 5 km). We also predicted a significantly higher occurrence and abundance of dolphins within the MPA. Recurrent and occasional habitats were identified on large percentages on the existing MPA (47% and 57% using presence-absence and abundance models respectively). However, the MPA does not adequately encompass all occasional and recurrent areas and within this context, we propose to extend the MPA to incorporate all of them which are likely key habitats for the highly mobile species. The results from this study provide two key conservation and management tools: (i) an integrative habitat modelling approach to predict key marine habitats, and (ii) the first study evaluating the effectiveness of an existing MPA for marine mammals in the Western Indian Ocean.

Genome-wide loss of 5-hmC is a novel epigenetic feature of Huntington's disease.

PubMed

Wang, Fengli; Yang, Yeran; Lin, Xiwen; Wang, Jiu-Qiang; Wu, Yong-Sheng; Xie, Wenjuan; Wang, Dandan; Zhu, Shu; Liao, You-Qi; Sun, Qinmiao; Yang, Yun-Gui; Luo, Huai-Rong; Guo, Caixia; Han, Chunsheng; Tang, Tie-Shan

2013-09-15

5-Hydroxymethylcytosine (5-hmC) may represent a new epigenetic modification of cytosine. While the dynamics of 5-hmC during neurodevelopment have recently been reported, little is known about its genomic distribution and function(s) in neurodegenerative diseases such as Huntington's disease (HD). We here observed a marked reduction of the 5-hmC signal in YAC128 (yeast artificial chromosome transgene with 128 CAG repeats) HD mouse brain tissues when compared with age-matched wild-type (WT) mice, suggesting a deficiency of 5-hmC reconstruction in HD brains during postnatal development. Genome-wide distribution analysis of 5-hmC further confirmed the diminishment of the 5-hmC signal in striatum and cortex in YAC128 HD mice. General genomic features of 5-hmC are highly conserved, not being affected by either disease or brain regions. Intriguingly, we have identified disease-specific (YAC128 versus WT) differentially hydroxymethylated regions (DhMRs), and found that acquisition of DhmRs in gene body is a positive epigenetic regulator for gene expression. Ingenuity pathway analysis (IPA) of genotype-specific DhMR-annotated genes revealed that alternation of a number of canonical pathways involving neuronal development/differentiation (Wnt/β-catenin/Sox pathway, axonal guidance signaling pathway) and neuronal function/survival (glutamate receptor/calcium/CREB, GABA receptor signaling, dopamine-DARPP32 feedback pathway, etc.) could be important for the onset of HD. Our results indicate that loss of the 5-hmC marker is a novel epigenetic feature in HD, and that this aberrant epigenetic regulation may impair the neurogenesis, neuronal function and survival in HD brain. Our study also opens a new avenue for HD treatment; re-establishing the native 5-hmC landscape may have the potential to slow/halt the progression of HD.

Molecular analysis of the glucocerebrosidase gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winfield, S.L.; Martin, B.M.; Fandino, A.

1994-09-01

Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less

A novel humanized mouse model of Huntington disease for preclinical development of therapeutics targeting mutant huntingtin alleles.

PubMed

Southwell, Amber L; Skotte, Niels H; Villanueva, Erika B; Østergaard, Michael E; Gu, Xiaofeng; Kordasiewicz, Holly B; Kay, Chris; Cheung, Daphne; Xie, Yuanyun; Waltl, Sabine; Dal Cengio, Louisa; Findlay-Black, Hailey; Doty, Crystal N; Petoukhov, Eugenia; Iworima, Diepiriye; Slama, Ramy; Ooi, Jolene; Pouladi, Mahmoud A; Yang, X William; Swayze, Eric E; Seth, Punit P; Hayden, Michael R

2017-03-15

Huntington disease (HD) is a neurodegenerative disease caused by a mutation in the huntingtin (HTT) gene. HTT is a large protein, interacts with many partners and is involved in many cellular pathways, which are perturbed in HD. Therapies targeting HTT directly are likely to provide the most global benefit. Thus there is a need for preclinical models of HD recapitulating human HTT genetics. We previously generated a humanized mouse model of HD, Hu97/18, by intercrossing BACHD and YAC18 mice with knockout of the endogenous mouse HD homolog (Hdh). Hu97/18 mice recapitulate the genetics of HD, having two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of Caucasian descent. We have now generated a companion model, Hu128/21, by intercrossing YAC128 and BAC21 mice on the Hdh-/- background. Hu128/21 mice have two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of East Asian descent and in a minority of patients from other ethnic groups. Hu128/21 mice display a wide variety of HD-like phenotypes that are similar to YAC128 mice. Additionally, both transgenes in Hu128/21 mice match the human HTT exon 1 reference sequence. Conversely, the BACHD transgene carries a floxed, synthetic exon 1 sequence. Hu128/21 mice will be useful for investigations of human HTT that cannot be addressed in Hu97/18 mice, for developing therapies targeted to exon 1, and for preclinical screening of personalized HTT lowering therapies in HD patients of East Asian descent. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Optical Thin Film Coatings

DTIC Science & Technology

1981-06-01

implantation prevents the formation of CuO (which is thermally unstable), in favor of CuAlO2 which is a more stable oxide. This process may produce...coatings for Lambda Physik’s exclmer lasers. In-housp damage threshold tests are performed using either of two Nd:YAC lasers. One laser produces a

Characterisation of the transcriptome of a wild great tit Parus major population by next generation sequencing

PubMed Central

2011-01-01

Background The recent development of next generation sequencing technologies has made it possible to generate very large amounts of sequence data in species with little or no genome information. Combined with the large phenotypic databases available for wild and non-model species, these data will provide an unprecedented opportunity to "genomicise" ecological model organisms and establish the genetic basis of quantitative traits in natural populations. Results This paper describes the sequencing, de novo assembly and analysis from the transcriptome of eight tissues of ten wild great tits. Approximately 4.6 million sequences and 1.4 billion bases of DNA were generated and assembled into 95,979 contigs, one third of which aligned with known Taeniopygia guttata (zebra finch) and Gallus gallus (chicken) transcripts. The majority (78%) of the remaining contigs aligned within or very close to regions of the zebra finch genome containing known genes, suggesting that they represented precursor mRNA rather than untranscribed genomic DNA. More than 35,000 single nucleotide polymorphisms and 10,000 microsatellite repeats were identified. Eleven percent of contigs were expressed in every tissue, while twenty one percent of contigs were expressed in only one tissue. The function of those contigs with strong evidence for tissue specific expression and contigs expressed in every tissue was inferred from the gene ontology (GO) terms associated with these contigs; heart and pancreas had the highest number of highly tissue specific GO terms (21.4% and 28.5% respectively). Conclusions In summary, the transcriptomic data generated in this study will contribute towards efforts to assemble and annotate the great tit genome, as well as providing the markers required to perform gene mapping studies in wild populations. PMID:21635727

PAVE: program for assembling and viewing ESTs.

PubMed

Soderlund, Carol; Johnson, Eric; Bomhoff, Matthew; Descour, Anne

2009-08-26

New sequencing technologies are rapidly emerging. Many laboratories are simultaneously working with the traditional Sanger ESTs and experimenting with ESTs generated by the 454 Life Science sequencers. Though Sanger ESTs have been used to generate contigs for many years, no program takes full advantage of the 5' and 3' mate-pair information, hence, many tentative transcripts are assembled into two separate contigs. The new 454 technology has the benefit of high-throughput expression profiling, but introduces time and space problems for assembling large contigs. The PAVE (Program for Assembling and Viewing ESTs) assembler takes advantage of the 5' and 3' mate-pair information by requiring that the mate-pairs be assembled into the same contig and joined by n's if the two sub-contigs do not overlap. It handles the depth of 454 data sets by "burying" similar ESTs during assembly, which retains the expression level information while circumventing time and space problems. PAVE uses MegaBLAST for the clustering step and CAP3 for assembly, however it assembles incrementally to enforce the mate-pair constraint, bury ESTs, and reduce incorrect joins and splits. The PAVE data management system uses a MySQL database to store multiple libraries of ESTs along with their metadata; the management system allows multiple assemblies with variations on libraries and parameters. Analysis routines provide standard annotation for the contigs including a measure of differentially expressed genes across the libraries. A Java viewer program is provided for display and analysis of the results. Our results clearly show the benefit of using the PAVE assembler to explicitly use mate-pair information and bury ESTs for large contigs. The PAVE assembler provides a software package for assembling Sanger and/or 454 ESTs. The assembly software, data management software, Java viewer and user's guide are freely available.

Transcriptome Analysis of Sarracenia, an Insectivorous Plant

PubMed Central

Srivastava, Anuj; Rogers, Willie L.; Breton, Catherine M.; Cai, Liming; Malmberg, Russell L.

2011-01-01

Sarracenia species (pitcher plants) are carnivorous plants which obtain a portion of their nutrients from insects captured in the pitchers. To investigate these plants, we sequenced the transcriptome of two species, Sarracenia psittacina and Sarracenia purpurea, using Roche 454 pyrosequencing technology. We obtained 46 275 and 36 681 contigs by de novo assembly methods for S. psittacina and S. purpurea, respectively, and further identified 16 163 orthologous contigs between them. Estimation of synonymous substitution rates between orthologous and paralogous contigs indicates the events of genome duplication and speciation within the Sarracenia genus both occurred ∼2 million years ago. The ratios of synonymous and non-synonymous substitution rates indicated that 491 contigs have been under positive selection (Ka/Ks > 1). Significant proportions of these contigs were involved in functions related to binding activity. We also found that the greatest sequence similarity for both of these species was to Vitis vinifera, which is most consistent with a non-current classification of the order Ericales as an asterid. This study has provided new insights into pitcher plants and will contribute greatly to future research on this genus and its distinctive ecological adaptations. PMID:21676972

Transcriptome analysis of sarracenia, an insectivorous plant.

PubMed

Srivastava, Anuj; Rogers, Willie L; Breton, Catherine M; Cai, Liming; Malmberg, Russell L

2011-08-01

Sarracenia species (pitcher plants) are carnivorous plants which obtain a portion of their nutrients from insects captured in the pitchers. To investigate these plants, we sequenced the transcriptome of two species, Sarracenia psittacina and Sarracenia purpurea, using Roche 454 pyrosequencing technology. We obtained 46 275 and 36 681 contigs by de novo assembly methods for S. psittacina and S. purpurea, respectively, and further identified 16 163 orthologous contigs between them. Estimation of synonymous substitution rates between orthologous and paralogous contigs indicates the events of genome duplication and speciation within the Sarracenia genus both occurred ∼2 million years ago. The ratios of synonymous and non-synonymous substitution rates indicated that 491 contigs have been under positive selection (K(a)/K(s) > 1). Significant proportions of these contigs were involved in functions related to binding activity. We also found that the greatest sequence similarity for both of these species was to Vitis vinifera, which is most consistent with a non-current classification of the order Ericales as an asterid. This study has provided new insights into pitcher plants and will contribute greatly to future research on this genus and its distinctive ecological adaptations.

Effect of spaceflight on natural killer cell activity

NASA Technical Reports Server (NTRS)

Rykova, Marina P.; Sonnenfeld, Gerald; Lesniak, A. T.; Taylor, Gerald R.; Meshkov, Dimitrii O.; Mandel, Adrian D.; Medvedev, Andrei E.; Berry, Wallace D.; Fuchs, Boris B.; Konstantinova, Irina V.

1992-01-01

The effects of spaceflight on immune cell function were determined in rats flown on Cosmos 2044. Control groups included vivarium, synchronous, and antiorthostatically suspended rats. The ability of natural killer cells to lyse two different target cell lines was determined. Spleen and bone marrow cells obtained from flight rats showed significantly inhibited cytotoxicity for YAC-1 target cells compared with cells from synchronous control rats. This could have been due to exposure of the rats to microgravity. Antiorthostatic suspension did not affect the level of cytotoxicity from spleen cells of suspended rats for YAC-1 cells. On the other hand, cells from rats flown in space showed no significant differences from vivarium and synchronous control rats in cytotoxicity for K-562 target cells. Binding of natural killer cells to K-562 target cells was unaffected by spaceflight. Antiorthostatic suspension resulted in higher levels of cytotoxicity from spleen cells for Cr-51-labeled K-562 cells. The results indicate differential effects of spaceflight on function of natural killer cells. This shows that spaceflight has selective effects on the immune response.

Effect of Toxoplasma lysate antigen (TLA) on feline cytotoxicity against FeLV positive lymphoma cells.

PubMed

Yang, M P; Goitsuka, R; Ono, K; Suzuki, N; Hasegawa, A

1990-08-01

The cytotoxic activities of feline spleen cells treated with Toxoplasma lysate antigen (TLA) were assayed against feline leukemia virus (FeLV)-producing lymphoma. FL74 cells, and xenogeneic target lymphoma, mouse YAC-1 cells. The TLA treatments were performed in vivo alone, in vitro alone, and in vivo plus in vitro, respectively. In vivo plus in vitro treatments with TLA induced a marked augmentation in cytotoxic activity of spleen cells to FL74 cells. The treatment with TLA in vivo alone showed an enhancement of cytotoxic activity but in vitro alone did not. The cytotoxic effects of TLA-treated spleen cells obtained from the cats which had been previously immunized with live FL74 cells were similar to those of spleen cells from non-immunized cats treated with TLA. However, no increase of cytotoxicity was shown in the response to mouse YAC-1 cells regardless of TLA treatments. These results indicated that the in vivo TLA treatment augmented the cytotoxicity of feline spleen cells against FeLV-producing lymphoma cell.

Voluntary chronic exercise augments in vivo natural immunity in rats.

PubMed

Jonsdottir, I H; Asea, A; Hoffmann, P; Dahlgren, U I; Andersson, B; Hellstrand, K; Thorén, P

1996-05-01

The effect of chronic voluntary exercise on the immune response was studied in spontaneously hypertensive rats. Exercise consisted of voluntary running in wheels for 5 wk, and the mean running distance was 4.2 km/24 h. In vivo cytotoxicity was measured as clearance of injected 51Cr-labeled YAC-1 lymphoma cells from the lungs. The clearance of YAC-1 cells in vivo was significantly increased in runners compared with sedentary controls (P < 0.001). The total number of mononuclear cells in the spleen was significantly decreased in runners compared with controls. Analysis of splenic lymphocyte phenotypes revealed a significantly increased fraction of OX52+/CD5- natural killer cells in runners compared with sedentary controls. In contrast to changes in natural immunity, immunoglobulins G and M levels in serum, the antibody response to antigen in vivo, and the proliferation of splenic T cells in vitro were unchanged. Our data suggest that chronic voluntary exercise augments natural cytotoxicity mechanisms in vivo, whereas splenic T-cell proliferation and the antibody-mediated immune response remain unchanged.

Association of coral algal symbionts with a diverse viral community responsive to heat shock.

PubMed

Brüwer, Jan D; Agrawal, Shobhit; Liew, Yi Jin; Aranda, Manuel; Voolstra, Christian R

2017-08-17

Stony corals provide the structural foundation of coral reef ecosystems and are termed holobionts given they engage in symbioses, in particular with photosynthetic dinoflagellates of the genus Symbiodinium. Besides Symbiodinium, corals also engage with bacteria affecting metabolism, immunity, and resilience of the coral holobiont, but the role of associated viruses is largely unknown. In this regard, the increase of studies using RNA sequencing (RNA-Seq) to assess gene expression provides an opportunity to elucidate viral signatures encompassed within the data via careful delineation of sequence reads and their source of origin. Here, we re-analyzed an RNA-Seq dataset from a cultured coral symbiont (Symbiodinium microadriaticum, Clade A1) across four experimental treatments (control, cold shock, heat shock, dark shock) to characterize associated viral diversity, abundance, and gene expression. Our approach comprised the filtering and removal of host sequence reads, subsequent phylogenetic assignment of sequence reads of putative viral origin, and the assembly and analysis of differentially expressed viral genes. About 15.46% (123 million) of all sequence reads were non-host-related, of which <1% could be classified as archaea, bacteria, or virus. Of these, 18.78% were annotated as virus and comprised a diverse community consistent across experimental treatments. Further, non-host related sequence reads assembled into 56,064 contigs, including 4856 contigs of putative viral origin that featured 43 differentially expressed genes during heat shock. The differentially expressed genes included viral kinases, ubiquitin, and ankyrin repeat proteins (amongst others), which are suggested to help the virus proliferate and inhibit the algal host's antiviral response. Our results suggest that a diverse viral community is associated with coral algal endosymbionts of the genus Symbiodinium, which prompts further research on their ecological role in coral health and resilience.

A High-throughput AFLP-based Method for Constructing Integrated Genetic and Physical Maps: Progress Toward a Sorghum Genome Map

PubMed Central

Klein, Patricia E.; Klein, Robert R.; Cartinhour, Samuel W.; Ulanch, Paul E.; Dong, Jianmin; Obert, Jacque A.; Morishige, Daryl T.; Schlueter, Shannon D.; Childs, Kevin L.; Ale, Melissa; Mullet, John E.

2000-01-01

Sorghum is an important target for plant genomic mapping because of its adaptation to harsh environments, diverse germplasm collection, and value for comparing the genomes of grass species such as corn and rice. The construction of an integrated genetic and physical map of the sorghum genome (750 Mbp) is a primary goal of our sorghum genome project. To help accomplish this task, we have developed a new high-throughput PCR-based method for building BAC contigs and locating BAC clones on the sorghum genetic map. This task involved pooling 24,576 sorghum BAC clones (∼4× genome equivalents) in six different matrices to create 184 pools of BAC DNA. DNA fragments from each pool were amplified using amplified fragment length polymorphism (AFLP) technology, resolved on a LI-COR dual-dye DNA sequencing system, and analyzed using Bionumerics software. On average, each set of AFLP primers amplified 28 single-copy DNA markers that were useful for identifying overlapping BAC clones. Data from 32 different AFLP primer combinations identified ∼2400 BACs and ordered ∼700 BAC contigs. Analysis of a sorghum RIL mapping population using the same primer pairs located ∼200 of the BAC contigs on the sorghum genetic map. Restriction endonuclease fingerprinting of the entire collection of sorghum BAC clones was applied to test and extend the contigs constructed using this PCR-based methodology. Analysis of the fingerprint data allowed for the identification of 3366 contigs each containing an average of 5 BACs. BACs in ∼65% of the contigs aligned by AFLP analysis had sufficient overlap to be confirmed by DNA fingerprint analysis. In addition, 30% of the overlapping BACs aligned by AFLP analysis provided information for merging contigs and singletons that could not be joined using fingerprint data alone. Thus, the combination of fingerprinting and AFLP-based contig assembly and mapping provides a reliable, high-throughput method for building an integrated genetic and physical map

Penn State Scandal Encompasses Professors, Too

ERIC Educational Resources Information Center

Wilson, Robin

2012-01-01

While most of the national focus following charges of child sex abuse at Pennsylvania State University has centered on its coaches and administrators, the scandal has reached deep into the professoriate as well. Responding to constant questions has taken an emotional toll on the university's faculty members, who have been asked by neighbors,…

Structure and polymorphism of the mouse prion protein gene.

PubMed Central

Westaway, D; Cooper, C; Turner, S; Da Costa, M; Carlson, G A; Prusiner, S B

1994-01-01

Missense mutations in the prion protein (PrP) gene, overexpression of the cellular isoform of PrP (PrPC), and infection with prions containing the scrapie isoform of PrP (PrPSc) all cause neurodegenerative disease. To understand better the physiology and expression of PrPC, we retrieved mouse PrP gene (Prn-p) yeast artificial chromosome (YAC), cosmid, phage, and cDNA clones. Physical mapping positions Prn-p approximately 300 kb from ecotropic virus integration site number 4 (Evi-4), compatible with failure to detect recombination between Prn-p and Evi-4 in genetic crosses. The Prn-pa allele encompasses three exons, with exons 1 and 2 encoding the mRNA 5' untranslated region. Exon 2 has no equivalent in the Syrian hamster and human PrP genes. The Prn-pb gene shares this intron/exon structure but harbors an approximately 6-kb deletion within intron 2. While the Prn-pb open reading frame encodes two amino acid substitutions linked to prolonged scrapie incubation periods, a deletion of intron 2 sequences also characterizes inbred strains such as RIII/S and MOLF/Ei with shorter incubation periods, making a relationship between intron 2 size and scrapie pathogenesis unlikely. The promoter regions of a and b Prn-p alleles include consensus Sp1 and AP-1 sites, as well as other conserved motifs which may represent binding sites for as yet unidentified transcription factors. Images PMID:7912827

OSLay: optimal syntenic layout of unfinished assemblies.

PubMed

Richter, Daniel C; Schuster, Stephan C; Huson, Daniel H

2007-07-01

The whole genome shotgun approach to genome sequencing results in a collection of contigs that must be ordered and oriented to facilitate efficient gap closure. We present a new tool OSLay that uses synteny between matching sequences in a target assembly and a reference assembly to layout the contigs (or scaffolds) in the target assembly. The underlying algorithm is based on maximum weight matching. The tool provides an interactive visualization of the computed layout and the result can be imported into the assembly editing tool Consed to support the design of primer pairs for gap closure. To enhance efficiency in the gap closure phase of a genome project it is crucial to know which contigs are adjacent in the target genome. Related genome sequences can be used to layout contigs in an assembly. OSLay is freely available from: http://www-ab.informatik.unituebingen.de/software/oslay.

Deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene presents an asymptomatic phenotype, indicating a target region for multiexon skipping therapy.

PubMed

Nakamura, Akinori; Fueki, Noboru; Shiba, Naoko; Motoki, Hirohiko; Miyazaki, Daigo; Nishizawa, Hitomi; Echigoya, Yusuke; Yokota, Toshifumi; Aoki, Yoshitsugu; Takeda, Shin'ichi

2016-07-01

Few cases of dystrophinopathy show an asymptomatic phenotype with mutations in the 5' (exons 3-7) hot spot in the Duchenne muscular dystrophy (DMD) gene. Our patient showed increased serum creatine kinase levels at 12 years of age. A muscle biopsy at 15 years of age led to a diagnosis of Becker muscular dystrophy. The patient showed a slight decrease in cardiac function at the age of 21 years and was administered a β-blocker, but there was no muscle involvement even at the age of 27 years. A deletion of exons 3-9 encompassing a mutational hot spot in the DMD gene was detected, and dystrophin protein expression was ∼15% that of control level. We propose that in-frame deletion of exons 3-9 may produce a functional protein, and that multiexon skipping therapy targeting these exons may be feasible for severe dystrophic patients with a mutation in the 5' hot spot of the DMD gene.

Identification of expressed sequences in the coffee genome potentially associated with somatic embryogenesis.

PubMed

Silva, A T; Paiva, L V; Andrade, A C; Barduche, D

2013-05-21

Brazil possesses the most modern and productive coffee growing farms in the world, but technological development is desired to cope with the increasing world demand. One way to increase Brazilian coffee growing productivity is wide scale production of clones with superior genotypes, which can be obtained with in vitro propagation technique, or from tissue culture. These procedures can generate thousands of clones. However, the methodologies for in vitro cultivation are genotype-dependent, which leads to an almost empirical development of specific protocols for each species. Therefore, molecular markers linked to the biochemical events of somatic embryogenesis would greatly facilitate the development of such protocols. In this context, sequences potentially involved in embryogenesis processes in the coffee plant were identified in silico from libraries generated by the Brazilian Coffee Genome Project. Through these in silico analyses, we identified 15 EST-contigs related to the embryogenesis process. Among these, 5 EST-contigs (3605, 9850, 13686, 17240, and 17265) could readily be associated with plant embryogenesis. Sequence analysis of EST-contig 3605, 9850, and 17265 revealed similarity to a polygalacturonase, to a cysteine-proteinase, and to an allergenine, respectively. Results also show that EST-contig 17265 sequences presented similarity to an expansin. Finally, analysis of EST-contig 17240 revealed similarity to a protein of unknown function, but it grouped in the similarity dendrogram with the WUSCHEL transcription factor. The data suggest that these EST-contigs are related to the embryogenic process and have potential as molecular markers to increase methodological efficiency in obtaining coffee plant embryogenic materials.

Rare RNF213 variants in the C-terminal region encompassing the RING-finger domain are associated with moyamoya angiopathy in Caucasians.

PubMed

Guey, Stéphanie; Kraemer, Markus; Hervé, Dominique; Ludwig, Thomas; Kossorotoff, Manoëlle; Bergametti, Françoise; Schwitalla, Jan Claudius; Choi, Simone; Broseus, Lucile; Callebaut, Isabelle; Genin, Emmanuelle; Tournier-Lasserve, Elisabeth

2017-08-01

Moyamoya angiopathy (MMA) is a cerebral angiopathy affecting the terminal part of internal carotid arteries. Its prevalence is 10 times higher in Japan and Korea than in Europe. In East Asian countries, moyamoya is strongly associated to the R4810K variant in the RNF213 gene that encodes for a protein containing a RING-finger and two AAA+ domains. This variant has never been detected in Caucasian MMA patients, but several rare RNF213 variants have been reported in Caucasian cases. Using a collapsing test based on exome data from 68 European MMA probands and 573 ethnically matched controls, we showed a significant association between rare missense RNF213 variants and MMA in European patients (odds ratio (OR)=2.24, 95% confidence interval (CI)=(1.19-4.11), P=0.01). Variants specific to cases had higher pathogenicity predictive scores (median of 24.2 in cases versus 9.4 in controls, P=0.029) and preferentially clustered in a C-terminal hotspot encompassing the RING-finger domain of RNF213 (P<10 -3 ). This association was even stronger when restricting the analysis to childhood-onset and familial cases (OR=4.54, 95% CI=(1.80-11.34), P=1.1 × 10 -3 ). All clinically affected relatives who were genotyped were carriers. However, the need for additional factors to develop MMA is strongly suggested by the fact that only 25% of mutation carrier relatives were clinically affected.

Transcriptome Analysis of Thapsia laciniata Rouy Provides Insights into Terpenoid Biosynthesis and Diversity in Apiaceae

PubMed Central

Drew, Damian Paul; Dueholm, Bjørn; Weitzel, Corinna; Zhang, Ye; Sensen, Christoph W.; Simonsen, Henrik Toft

2013-01-01

Thapsia laciniata Rouy (Apiaceae) produces irregular and regular sesquiterpenoids with thapsane and guaiene carbon skeletons, as found in other Apiaceae species. A transcriptomic analysis utilizing Illumina next-generation sequencing enabled the identification of novel genes involved in the biosynthesis of terpenoids in Thapsia. From 66.78 million HQ paired-end reads obtained from T. laciniata roots, 64.58 million were assembled into 76,565 contigs (N50: 1261 bp). Seventeen contigs were annotated as terpene synthases and five of these were predicted to be sesquiterpene synthases. Of the 67 contigs annotated as cytochromes P450, 18 of these are part of the CYP71 clade that primarily performs hydroxylations of specialized metabolites. Three contigs annotated as aldehyde dehydrogenases grouped phylogenetically with the characterized ALDH1 from Artemisia annua and three contigs annotated as alcohol dehydrogenases grouped with the recently described ADH1 from A. annua. ALDH1 and ADH1 were characterized as part of the artemisinin biosynthesis. We have produced a comprehensive EST dataset for T. laciniata roots, which contains a large sample of the T. laciniata transcriptome. These transcriptome data provide the foundation for future research into the molecular basis for terpenoid biosynthesis in Thapsia and on the evolution of terpenoids in Apiaceae. PMID:23698765

De novo characterisation of the greenlip abalone transcriptome (Haliotis laevigata) with a focus on the heat shock protein 70 (HSP70) family.

PubMed

Shiel, Brett P; Hall, Nathan E; Cooke, Ira R; Robinson, Nicholas A; Strugnell, Jan M

2015-02-01

Abalone (Haliotis) are economically important molluscs for fisheries and aquaculture industries worldwide. Despite this, genomic resources for abalone and molluscs are still limited. Here we present a description and functional annotation of the greenlip abalone (Haliotis laevigata) transcriptome. We present a focused analysis on the heat shock protein 70 (HSP70) family of genes with putative functions affecting temperature stress and immunity. A total of ~38 million paired end Illumina reads were obtained, resulting in a Trinity assembly of 222,172 contigs with minimum length of 200 base pairs and maximum length of 33 kilobases. The 20,702 contigs were annotated with gene descriptions by BLAST. We created a program to maximise the number of functionally annotated genes, and over 10,000 contigs were assigned Gene ontologies (GO terms). By using CateGOrizer, immunity related GO terms for stressors such as heat, hypoxia, oxidative stress and wounding received the highest counts. Twenty-six contigs with homology to the HSP70 family of genes were identified. Ninety-one putative single-nucleotide polymorphisms were observed in the abalone HSP70 contigs. Eleven of these were considered non-synonymous. The annotated transcriptome described in this study will be a useful basis for future work investigating the genetic response of abalone to stress.

Comparative Transcriptome Analysis Identifies Candidate Genes Related to Skin Color Differentiation in Red Tilapia.

PubMed

Zhu, Wenbin; Wang, Lanmei; Dong, Zaijie; Chen, Xingting; Song, Feibiao; Liu, Nian; Yang, Hui; Fu, Jianjun

2016-08-11

Red tilapia is becoming more popular for aquaculture production in China in recent years. However, the pigmentation differentiation in genetic breeding is the main problem limiting its development of commercial red tilapia culture and the genetic basis of skin color variation is still unknown. In this study, we conducted Illumina sequencing of transcriptome on three color variety red tilapia. A total of 224,895,758 reads were generated, resulting in 160,762 assembled contigs that were used as reference contigs. The contigs of red tilapia transcriptome had hits in the range of 53.4% to 86.7% of the unique proteins of zebrafish, fugu, medaka, three-spined stickleback and tilapia. And 44,723 contigs containing 77,423 simple sequence repeats (SSRs) were identified, with 16,646 contigs containing more than one SSR. Three skin transcriptomes were compared pairwise and the results revealed that there were 148 common significantly differentially expressed unigenes and several key genes related to pigment synthesis, i.e. tyr, tyrp1, silv, sox10, slc24a5, cbs and slc7a11, were included. The results will facilitate understanding the molecular mechanisms of skin pigmentation differentiation in red tilapia and accelerate the molecular selection of the specific strain with consistent skin colors.

Integration of transcriptomic and proteomic data from a single wheat cultivar provides new tools for understanding the roles of individual alpha gliadin proteins in flour quality and celiac disease

USDA-ARS?s Scientific Manuscript database

One-hundred-thirty-six expressed sequence tags (ESTs) encoding alpha gliadins from Triticum aestivum cv Butte 86 were identified in public databases and assembled into 19 contigs. Consensus sequences for 12 of the contigs encoded complete alpha gliadin proteins, but only two were identical to protei...

Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour

USDA-ARS?s Scientific Manuscript database

The complement of gamma gliadin genes expressed in the wheat cultivar Butte 86 was evaluated by analyzing publicly available expressed sequence tag (EST) data. Eleven contigs were assembled from 153 Butte 86 ESTs. Nine of the contigs encoded full-length proteins and four of the proteins contained an...

A brain-specific gene cluster isolated from the region of the mouse obesity locus is expressed in the adult hypothalamus and during mouse development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laig-Webster, M.; Lim, M.E.; Chehab, F.F.

1994-09-01

The molecular defect underlying an autosomal recessive form of genetic obesity in a classical mouse model C57 BL/6J-ob/ob has not yet been elucidated. Whereas metabolic and physiological disturbances such as diabetes and hypertension are associated with obesity, the site of expression and the nature of the primary lesion responsible for this cascade of events remains elusive. Our efforts aimed at the positional cloning of the ob gene by YAC contig mapping and gene identification have resulted in the cloning of a brain-specific gene cluster from the ob critical region. The expression of this gene cluster is remarkably complex owing tomore » the multitude of brain-specific mRNA transcripts detected on Northern blots. cDNA cloning of these transcripts suggests that they are expressed from different genes as well as by alternate splicing mechanisms. Furthermore, the genomic organization of the cluster appears to consist of at least two identical promoters displaying CpG islands characteristic of housekeeping genes, yet clearly involving tissue-specific expression. Sense and anti-sense synthetic RNA probes were derived from a common DNA sequence on 3 cDNA clones and hybridized to 8-16 days mouse embryonic stages and mouse adult brain sections. Expression in development was noticeable as of the 11th day of gestation and confined to the central nervous system mainly in the telencephalon and spinal cord. Coronal and sagittal sections of the adult mouse brain showed expression only in 3 different regions of the brain stem. In situ hybridization to mouse hypothalamus sections revealed the presence of a localized and specialized group of cells expressing high levels of mRNA, suggesting that this gene cluster may also be involved in the regulation of hypothalamic activities. The hypothalamus has long been hypothesized as a primary candidate tissue for the expression of the obesity gene mainly because of its well-established role in the regulation of energy metabolism and

Deep Sequencing Analysis of Apple Infecting Viruses in Korea

PubMed Central

Cho, In-Sook; Igori, Davaajargal; Lim, Seungmo; Choi, Gug-Seoun; Hammond, John; Lim, Hyoun-Sub; Moon, Jae Sun

2016-01-01

Deep sequencing has generated 52 contigs derived from five viruses; Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), Apple green crinkle associated virus (AGCaV), and Apricot latent virus (ApLV) were identified from eight apple samples showing small leaves and/or growth retardation. Nucleotide (nt) sequence identity of the assembled contigs was from 68% to 99% compared to the reference sequences of the five respective viral genomes. Sequences of ASPV and ASGV were the most abundantly represented by the 52 contigs assembled. The presence of the five viruses in the samples was confirmed by RT-PCR using specific primers based on the sequences of each assembled contig. All five viruses were detected in three of the samples, whereas all samples had mixed infections with at least two viruses. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV which were withal found in mixed infections in the tested samples. AGCaV was identified in assembled contigs ID 1012480 and 93549, which showed 82% and 78% nt sequence identity with ORF1 of AGCaV isolate Aurora-1. ApLV was identified in three assembled contigs, ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV isolate LA2. Deep sequencing assay was shown to be a valuable and powerful tool for detection and identification of known and unknown virome in infected apple trees, here identifying ApLV and AGCaV in commercial orchards in Korea for the first time. PMID:27721694

An ovary transcriptome for all maturational stages of the striped bass (Morone saxatilis), a highly advanced perciform fish.

PubMed

Reading, Benjamin J; Chapman, Robert W; Schaff, Jennifer E; Scholl, Elizabeth H; Opperman, Charles H; Sullivan, Craig V

2012-02-21

The striped bass and its relatives (genus Morone) are important fisheries and aquaculture species native to estuaries and rivers of the Atlantic coast and Gulf of Mexico in North America. To open avenues of gene expression research on reproduction and breeding of striped bass, we generated a collection of expressed sequence tags (ESTs) from a complementary DNA (cDNA) library representative of their ovarian transcriptome. Sequences of a total of 230,151 ESTs (51,259,448 bp) were acquired by Roche 454 pyrosequencing of cDNA pooled from ovarian tissues obtained at all stages of oocyte growth, at ovulation (eggs), and during preovulatory atresia. Quality filtering of ESTs allowed assembly of 11,208 high-quality contigs ≥ 100 bp, including 2,984 contigs 500 bp or longer (average length 895 bp). Blastx comparisons revealed 5,482 gene orthologues (E-value < 10-3), of which 4,120 (36.7% of total contigs) were annotated with Gene Ontology terms (E-value < 10-6). There were 5,726 remaining unknown unique sequences (51.1% of total contigs). All of the high-quality EST sequences are available in the National Center for Biotechnology Information (NCBI) Short Read Archive (GenBank: SRX007394). Informative contigs were considered to be abundant if they were assembled from groups of ESTs comprising ≥ 0.15% of the total short read sequences (≥ 345 reads/contig). Approximately 52.5% of these abundant contigs were predicted to have predominant ovary expression through digital differential display in silico comparisons to zebrafish (Danio rerio) UniGene orthologues. Over 1,300 Gene Ontology terms from Biological Process classes of Reproduction, Reproductive process, and Developmental process were assigned to this collection of annotated contigs. This first large reference sequence database available for the ecologically and economically important temperate basses (genus Morone) provides a foundation for gene expression studies in these species. The predicted predominance of

Lawyers' delights and geneticists' nightmares: at forty, the double helix shows some wrinkles.

PubMed

Sgaramella, V

1993-12-15

The National Institutes of Health (NIH) request to patent the base sequences of incomplete and uncharacterized fragments of DNA copied on messenger RNAs (cDNAs) extracted from human tissues, the refusal by the patent office, and the appeal placed by NIH, have incited a violent controversy, fueled by rational, as well as emotional elements. In a compromising mode between liberalism and protectionism, I propose that legal protection be considered only for those RNA/DNA sequences, either natural or artificial, which can generate practical applications per se, and not through their expression products. Another controversy is developing around a popular tool for genomic research: the fidelity of yeast artificial chromosome (YAC) libraries being distributed worldwide for physical mapping is being questioned. Some of these libraries have been shown to be affected by surprisingly high levels of co-cloning, in addition to more common gene reshuffling instances. Also in this case, scientific as well as non-scientific components have to be considered. Possible remedies for the underlying problems may be found in the proper use of kinetic, enzymatic and microbiological variables in the production of YACs. Here too, a sharper distinction between the secular and scientific gratifications of research could help.

Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

PubMed Central

Guirao-Rico, Sara; Aguadé, Montserrat

2013-01-01

In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

4-substituted cyclohexyl sulfones as potent, orally active gamma-secretase inhibitors.

PubMed

Churcher, Ian; Beher, Dirk; Best, Jonathan D; Castro, José L; Clarke, Earl E; Gentry, Amy; Harrison, Timothy; Hitzel, Laure; Kay, Euan; Kerrad, Sonia; Lewis, Huw D; Morentin-Gutierrez, Pablo; Mortishire-Smith, Russell; Oakley, Paul J; Reilly, Michael; Shaw, Duncan E; Shearman, Mark S; Teall, Martin R; Williams, Susie; Wrigley, Jonathan D J

2006-01-15

The protease gamma-secretase plays a pivotal role in the synthesis of pathogenic amyloid-beta in Alzheimer's disease (AD). Here, we report a further extension to a series of cyclohexyl sulfone-based gamma-secretase inhibitors which has allowed the preparation of highly potent compounds which also demonstrate robust Abeta(40) lowering in vivo (e.g., compound 32, MED 1mg/kg p.o. in APP-YAC mice).

Microdeletion del(22)(q12.2) encompassing the facial development-associated gene, MN1 (meningioma 1) in a child with Pierre-Robin sequence (including cleft palate) and neurofibromatosis 2 (NF2): a case report and review of the literature.

PubMed

Davidson, Tom B; Sanchez-Lara, Pedro A; Randolph, Linda M; Krieger, Mark D; Wu, Shi-Qi; Panigrahy, Ashok; Shimada, Hiroyuki; Erdreich-Epstein, Anat

2012-03-22

Pierre-Robin sequence (PRS) is defined by micro- and/or retrognathia, glossoptosis and cleft soft palate, either caused by deformational defect or part of a malformation syndrome. Neurofibromatosis type 2 (NF2) is an autosomal dominant syndrome caused by mutations in the NF2 gene on chromosome 22q12.2. NF2 is characterized by bilateral vestibular schwannomas, spinal cord schwannomas, meningiomas and ependymomas, and juvenile cataracts. To date, NF2 and PRS have not been described together in the same patient. We report a female with PRS (micrognathia, cleft palate), microcephaly, ocular hypertelorism, mental retardation and bilateral hearing loss, who at age 15 was also diagnosed with severe NF2 (bilateral cerebellopontine schwannomas and multiple extramedullary/intradural spine tumors). This is the first published report of an individual with both diagnosed PRS and NF2. High resolution karyotype revealed 46, XX, del(22)(q12.1q12.3), FISH confirmed a deletion encompassing NF2, and chromosomal microarray identified a 3,693 kb deletion encompassing multiple genes including NF2 and MN1 (meningioma 1).Five additional patients with craniofacial dysmorphism and deletion in chromosome 22-adjacent-to or containing NF2 were identified in PubMed and the DECIPHER clinical chromosomal database. Their shared chromosomal deletion encompassed MN1, PITPNB and TTC28. MN1, initially cloned from a patient with meningioma, is an oncogene in murine hematopoiesis and participates as a fusion gene (TEL/MN1) in human myeloid leukemias. Interestingly, Mn1-haploinsufficient mice have abnormal skull development and secondary cleft palate. Additionally, Mn1 regulates maturation and function of calvarial osteoblasts and is an upstream regulator of Tbx22, a gene associated with murine and human cleft palate. This suggests that deletion of MN1 in the six patients we describe may be causally linked to their cleft palates and/or craniofacial abnormalities. Thus, our report describes a NF2-adjacent

A hybrid BAC physical map of potato: a framework for sequencing a heterozygous genome

PubMed Central

2011-01-01

Background Potato is the world's third most important food crop, yet cultivar improvement and genomic research in general remain difficult because of the heterozygous and tetraploid nature of its genome. The development of physical map resources that can facilitate genomic analyses in potato has so far been very limited. Here we present the methods of construction and the general statistics of the first two genome-wide BAC physical maps of potato, which were made from the heterozygous diploid clone RH89-039-16 (RH). Results First, a gel electrophoresis-based physical map was made by AFLP fingerprinting of 64478 BAC clones, which were aligned into 4150 contigs with an estimated total length of 1361 Mb. Screening of BAC pools, followed by the KeyMaps in silico anchoring procedure, identified 1725 AFLP markers in the physical map, and 1252 BAC contigs were anchored the ultradense potato genetic map. A second, sequence-tag-based physical map was constructed from 65919 whole genome profiling (WGP) BAC fingerprints and these were aligned into 3601 BAC contigs spanning 1396 Mb. The 39733 BAC clones that overlap between both physical maps provided anchors to 1127 contigs in the WGP physical map, and reduced the number of contigs to around 2800 in each map separately. Both physical maps were 1.64 times longer than the 850 Mb potato genome. Genome heterozygosity and incomplete merging of BAC contigs are two factors that can explain this map inflation. The contig information of both physical maps was united in a single table that describes hybrid potato physical map. Conclusions The AFLP physical map has already been used by the Potato Genome Sequencing Consortium for sequencing 10% of the heterozygous genome of clone RH on a BAC-by-BAC basis. By layering a new WGP physical map on top of the AFLP physical map, a genetically anchored genome-wide framework of 322434 sequence tags has been created. This reference framework can be used for anchoring and ordering of genomic

Features of the organization of bread wheat chromosome 5BS based on physical mapping.

PubMed

Salina, Elena A; Nesterov, Mikhail A; Frenkel, Zeev; Kiseleva, Antonina A; Timonova, Ekaterina M; Magni, Federica; Vrána, Jan; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Korol, Abraham; Sergeeva, Ekaterina M

2018-02-09

The IWGSC strategy for construction of the reference sequence of the bread wheat genome is based on first obtaining physical maps of the individual chromosomes. Our aim is to develop and use the physical map for analysis of the organization of the short arm of wheat chromosome 5B (5BS) which bears a number of agronomically important genes, including genes conferring resistance to fungal diseases. A physical map of the 5BS arm (290 Mbp) was constructed using restriction fingerprinting and LTC software for contig assembly of 43,776 BAC clones. The resulting physical map covered ~ 99% of the 5BS chromosome arm (111 scaffolds, N50 = 3.078 Mb). SSR, ISBP and zipper markers were employed for anchoring the BAC clones, and from these 722 novel markers were developed based on previously obtained data from partial sequencing of 5BS. The markers were mapped using a set of Chinese Spring (CS) deletion lines, and F2 and RICL populations from a cross of CS and CS-5B dicoccoides. Three approaches have been used for anchoring BAC contigs on the 5BS chromosome, including clone-by-clone screening of BACs, GenomeZipper analysis, and comparison of BAC-fingerprints with in silico fingerprinting of 5B pseudomolecules of T. dicoccoides. These approaches allowed us to reach a high level of BAC contig anchoring: 96% of 5BS BAC contigs were located on 5BS. An interesting pattern was revealed in the distribution of contigs along the chromosome. Short contigs (200-999 kb) containing markers for the regions interrupted by tandem repeats, were mainly localized to the 5BS subtelomeric block; whereas the distribution of larger 1000-3500 kb contigs along the chromosome better correlated with the distribution of the regions syntenic to rice, Brachypodium, and sorghum, as detected by the Zipper approach. The high fingerprinting quality, LTC software and large number of BAC clones selected by the informative markers in screening of the 43,776 clones allowed us to significantly increase the

Small 6q16.1 Deletions Encompassing POU3F2 Cause Susceptibility to Obesity and Variable Developmental Delay with Intellectual Disability.

PubMed

Kasher, Paul R; Schertz, Katherine E; Thomas, Megan; Jackson, Adam; Annunziata, Silvia; Ballesta-Martinez, María J; Campeau, Philippe M; Clayton, Peter E; Eaton, Jennifer L; Granata, Tiziana; Guillén-Navarro, Encarna; Hernando, Cristina; Laverriere, Caroline E; Liedén, Agne; Villa-Marcos, Olaya; McEntagart, Meriel; Nordgren, Ann; Pantaleoni, Chiara; Pebrel-Richard, Céline; Sarret, Catherine; Sciacca, Francesca L; Wright, Ronnie; Kerr, Bronwyn; Glasgow, Eric; Banka, Siddharth

2016-02-04

Genetic studies of intellectual disability and identification of monogenic causes of obesity in humans have made immense contribution toward the understanding of the brain and control of body mass. The leptin > melanocortin > SIM1 pathway is dysregulated in multiple monogenic human obesity syndromes but its downstream targets are still unknown. In ten individuals from six families, with overlapping 6q16.1 deletions, we describe a disorder of variable developmental delay, intellectual disability, and susceptibility to obesity and hyperphagia. The 6q16.1 deletions segregated with the phenotype in multiplex families and were shown to be de novo in four families, and there was dramatic phenotypic overlap among affected individuals who were independently ascertained without bias from clinical features. Analysis of the deletions revealed a ∼350 kb critical region on chromosome 6q16.1 that encompasses a gene for proneuronal transcription factor POU3F2, which is important for hypothalamic development and function. Using morpholino and mutant zebrafish models, we show that POU3F2 lies downstream of SIM1 and controls oxytocin expression in the hypothalamic neuroendocrine preoptic area. We show that this finding is consistent with the expression patterns of POU3F2 and related genes in the human brain. Our work helps to further delineate the neuro-endocrine control of energy balance/body mass and demonstrates that this molecular pathway is conserved across multiple species. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

De novo interstitial deletion of 3q22.3-q25.2 encompassing FOXL2, ATR, ZIC1, and ZIC4 in a patient with blepharophimosis/ptosis/epicanthus inversus syndrome, Dandy-Walker malformation, and global developmental delay.

PubMed

Lim, Byung Chan; Park, Woong Yang; Seo, Eul-Ju; Kim, Ki Joong; Hwang, Yong Seung; Chae, Jong Hee

2011-05-01

We report a case carrying a de novo interstitial deletion of chromosome 3q22-q25. The clinical phenotype of this case included blepharophimosis/ptosis/epicanthus inversus syndrome, Dandy-Walker malformation, and global developmental delay. Contiguous heterozygous deletion of FOXL2, ATR, ZIC1, and ZIC4 was postulated as the causative mechanism of the clinical phenotype. The association of blepharophimosis, ptosis, and epicanthus inversus syndrome with developmental delay or mental retardation may be an indication for the use of brain imaging and chromosomal analysis capable of detecting chromosomal rearrangements encompassing several candidate genes.

Clinical Investigation Program.

DTIC Science & Technology

1985-10-01

Patients with Nasopharyngeal Carcinoma (NPC) and Determination of the Effect of IFN on Epstein - Barr Virus (EBV)-related Immunological Markers (0) (P...with Nasopharyngeal Carcinoma (NPC) and Determination of the Effect of IFN on Epstein - Barr virus (EBV)-related Immunological Markers Principal...Ribosomal Vaccine (0) (PR) (P) 12A/84 Lieberman, M. M. Relationship of the Immune 26 Response to the Heat Sensitivity of the Moloney Virus -Induced YAC

Adapting Teaching Strategies To Encompass New Technologies.

ERIC Educational Resources Information Center

Oravec, Jo Ann

2001-01-01

The explosion of special-purpose computing devices--Internet appliances, handheld computers, wireless Internet, networked household appliances--challenges business educators attempting to provide computer literacy education. At a minimum, they should address connectivity, expanded applications, and social and public policy implications of these…

Identification of evolutionary hotspots based on genetic data from multiple terrestrial and aquatic taxa and gap analysis of hotspots in protected lands encompassed by the South Atlantic Landscape Conservation Cooperative.

USGS Publications Warehouse

Robinson, J.; Snider, M.; Duke, J.; Moyer, G.R.

2014-01-01

 The southeastern United States is a recognized hotspot of biodiversity for a variety of aquatic taxa, including fish, amphibians, and mollusks. Unfortunately, the great diversity of the area is accompanied by a large proportion of species at risk of extinction . Gap analysis was employed to assess the representation of evolutionary hotspots in protected lands w h ere an evolutionary hotspot was defined as an area with high evolutionary potential and measured by atypical patterns of genetic divergence, genetic diversity, and to a lesser extent genetic similarity across multiple terrestrial or aquatic taxa. A survey of the primary literature produced 16 terrestrial and 14 aquatic genetic datasets for estimation of genetic divergence and diversity. Relative genetic diversity and divergence values for each terrestrial and aquatic dataset were used for interpolation of multispecies genetic surfaces and subsequent visualization using ArcGIS. The multispecies surfaces interpolated from relative divergences and diversity data identified numerous evolutionary hotspots for both terrestrial and aquatic taxa , many of which were afforded some current protection. For instance, 14% of the cells identified as hotspots of aquatic diversity were encompassed by currently protected areas. Additionally, 25% of the highest 1% of terrestrial diversity cells were afforded some level of protection. In contrast, areas of high and low divergence among species, and areas of high variance in diversity were poorly represented in the protected lands. Of particular interest were two areas that were consistently identified by several different measures as important from a conservation perspective. These included an area encompassing the panhandle of Florida and southern Georgia near the Apalachicola National Forest (displaying varying levels of genetic divergence and greater than average levels of genetic diversity) and a large portion of the coastal regions of North and South Carolina

Transcriptomic analysis of the mussel Elliptio complanata identifies candidate stress-response genes and an abundance of novel or noncoding transcripts

USGS Publications Warehouse

Cornman, Robert S.; Robertson, Laura S.; Galbraith, Heather S.; Blakeslee, Carrie J.

2014-01-01

Mussels are useful indicator species of environmental stress and degradation, and the global decline in freshwater mussel diversity and abundance is of conservation concern. Elliptio complanata is a common freshwater mussel of eastern North America that can serve both as an indicator and as an experimental model for understanding mussel physiology and genetics. To support genetic components of these research goals, we assembled transcriptome contigs from Illumina paired-end reads. Despite efforts to collapse similar contigs, the final assembly was in excess of 136,000 contigs with an N50 of 982 bp. Even so, comparisons to the CEGMA database of conserved eukaryotic genes indicated that ∼20% of genes remain unrepresented. However, numerous candidate stress-response genes were present, and we identified lineage-specific patterns of diversification among molluscs for cytochrome P450 detoxification genes and two saccharide-modifying enzymes: 1,3 beta-galactosyltransferase and fucosyltransferase. Less than a quarter of contigs had protein-level similarity based on modest BLAST and Hmmer3 statistical thresholds. These results add comparative genomic resources for molluscs and suggest a wealth of novel proteins and noncoding transcripts.

Improved gap size estimation for scaffolding algorithms.

PubMed

Sahlin, Kristoffer; Street, Nathaniel; Lundeberg, Joakim; Arvestad, Lars

2012-09-01

One of the important steps of genome assembly is scaffolding, in which contigs are linked using information from read-pairs. Scaffolding provides estimates about the order, relative orientation and distance between contigs. We have found that contig distance estimates are generally strongly biased and based on false assumptions. Since erroneous distance estimates can mislead in subsequent analysis, it is important to provide unbiased estimation of contig distance. In this article, we show that state-of-the-art programs for scaffolding are using an incorrect model of gap size estimation. We discuss why current maximum likelihood estimators are biased and describe what different cases of bias we are facing. Furthermore, we provide a model for the distribution of reads that span a gap and derive the maximum likelihood equation for the gap length. We motivate why this estimate is sound and show empirically that it outperforms gap estimators in popular scaffolding programs. Our results have consequences both for scaffolding software, structural variation detection and for library insert-size estimation as is commonly performed by read aligners. A reference implementation is provided at https://github.com/SciLifeLab/gapest. Supplementary data are availible at Bioinformatics online.

Fine mapping suggests that the goat Polled Intersex Syndrome and the human Blepharophimosis Ptosis Epicanthus Syndrome map to a 100-kb homologous region.

PubMed

Schibler, L; Cribiu, E P; Oustry-Vaiman, A; Furet, J P; Vaiman, D

2000-03-01

To clone the goat Polled Intersex Syndrome (PIS) gene(s), a chromosome walk was performed from six entry points at 1q43. This enabled 91 BACs to be recovered from a recently constructed goat BAC library. Six BAC contigs of goat chromosome 1q43 (ICC1-ICC6) were thus constructed covering altogether 4.5 Mb. A total of 37 microsatellite sequences were isolated from this 4.5-Mb region (16 in this study), of which 33 were genotyped and mapped. ICC3 (1500 kb) was shown by genetic analysis to encompass the PIS locus in a approximately 400-kb interval without recombinants detected in the resource families (293 informative meioses). A strong linkage disequilibrium was detected among unrelated animals with the two central markers of the region, suggesting a probable location for PIS in approximately 100 kb. High-resolution comparative mapping with human data shows that this DNA segment is the homolog of the human region associated with Blepharophimosis Ptosis Epicanthus inversus Syndrome (BPES) gene located in 3q23. This finding suggests that homologous gene(s) could be responsible for the pathologies observed in humans and goats.

De novo transcriptome assembly for a non-model species, the blood-sucking bug Triatoma brasiliensis, a vector of Chagas disease.

PubMed

Marchant, A; Mougel, F; Almeida, C; Jacquin-Joly, E; Costa, J; Harry, M

2015-04-01

High throughput sequencing (HTS) provides new research opportunities for work on non-model organisms, such as differential expression studies between populations exposed to different environmental conditions. However, such transcriptomic studies first require the production of a reference assembly. The choice of sampling procedure, sequencing strategy and assembly workflow is crucial. To develop a reliable reference transcriptome for Triatoma brasiliensis, the major Chagas disease vector in Northeastern Brazil, different de novo assembly protocols were generated using various datasets and software. Both 454 and Illumina sequencing technologies were applied on RNA extracted from antennae and mouthparts from single or pooled individuals. The 454 library yielded 278 Mb. Fifteen Illumina libraries were constructed and yielded nearly 360 million RNA-seq single reads and 46 million RNA-seq paired-end reads for nearly 45 Gb. For the 454 reads, we used three assemblers, Newbler, CAP3 and/or MIRA and for the Illumina reads, the Trinity assembler. Ten assembly workflows were compared using these programs separately or in combination. To compare the assemblies obtained, quantitative and qualitative criteria were used, including contig length, N50, contig number and the percentage of chimeric contigs. Completeness of the assemblies was estimated using the CEGMA pipeline. The best assembly (57,657 contigs, completeness of 80 %, <1 % chimeric contigs) was a hybrid assembly leading to recommend the use of (1) a single individual with large representation of biological tissues, (2) merging both long reads and short paired-end Illumina reads, (3) several assemblers in order to combine the specific advantages of each.

Exploiting a wheat EST database to assess genetic diversity

PubMed Central

2010-01-01

Expressed sequence tag (EST) markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum). In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F2 individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29%) contigs and 96 (10%) singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs) and metabolism and energy (singletons). EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725) being between Harmankaya99 and Sönmez2001, and the lowest (0.622) between Aytin98 and Izgi01. PMID:21637582

Exploiting a wheat EST database to assess genetic diversity.

PubMed

Karakas, Ozge; Gurel, Filiz; Uncuoglu, Ahu Altinkut

2010-10-01

Expressed sequence tag (EST) markers have been used to assess variety and genetic diversity in wheat (Triticum aestivum). In this study, 1549 ESTs from wheat infested with yellow rust were used to examine the genetic diversity of six susceptible and resistant wheat cultivars. The aim of using these cultivars was to improve the competitiveness of public wheat breeding programs through the intensive use of modern, particularly marker-assisted, selection technologies. The F(2) individuals derived from cultivar crosses were screened for resistance to yellow rust at the seedling stage in greenhouses and adult stage in the field to identify DNA markers genetically linked to resistance. Five hundred and sixty ESTs were assembled into 136 contigs and 989 singletons. BlastX search results showed that 39 (29%) contigs and 96 (10%) singletons were homologous to wheat genes. The database-matched contigs and singletons were assigned to eight functional groups related to protein synthesis, photosynthesis, metabolism and energy, stress proteins, transporter proteins, protein breakdown and recycling, cell growth and division and reactive oxygen scavengers. PCR analyses with primers based on the contigs and singletons showed that the most polymorphic functional categories were photosynthesis (contigs) and metabolism and energy (singletons). EST analysis revealed considerable genetic variability among the Turkish wheat cultivars resistant and susceptible to yellow rust disease and allowed calculation of the mean genetic distance between cultivars, with the greatest similarity (0.725) being between Harmankaya99 and Sönmez2001, and the lowest (0.622) between Aytin98 and Izgi01.

A 3.7 Mb Deletion Encompassing ZEB2 Causes a Novel Polled and Multisystemic Syndrome in the Progeny of a Somatic Mosaic Bull

PubMed Central

Capitan, Aurélien; Allais-Bonnet, Aurélie; Pinton, Alain; Marquant-Le Guienne, Brigitte; Le Bourhis, Daniel; Grohs, Cécile; Bouet, Stéphan; Clément, Laëtitia; Salas-Cortes, Laura; Venot, Eric; Chaffaux, Stéphane; Weiss, Bernard; Delpeuch, Arnaud; Noé, Guy; Rossignol, Marie-Noëlle; Barbey, Sarah; Dozias, Dominique; Cobo, Emilie; Barasc, Harmonie; Auguste, Aurélie; Pannetier, Maëlle; Deloche, Marie-Christine; Lhuilier, Emeline; Bouchez, Olivier; Esquerré, Diane; Salin, Gérald; Klopp, Christophe; Donnadieu, Cécile; Chantry-Darmon, Céline; Hayes, Hélène; Gallard, Yves; Ponsart, Claire; Boichard, Didier; Pailhoux, Eric

2012-01-01

Polled and Multisystemic Syndrome (PMS) is a novel developmental disorder occurring in the progeny of a single bull. Its clinical spectrum includes polledness (complete agenesis of horns), facial dysmorphism, growth delay, chronic diarrhea, premature ovarian failure, and variable neurological and cardiac anomalies. PMS is also characterized by a deviation of the sex-ratio, suggesting male lethality during pregnancy. Using Mendelian error mapping and whole-genome sequencing, we identified a 3.7 Mb deletion on the paternal bovine chromosome 2 encompassing ARHGAP15, GTDC1 and ZEB2 genes. We then produced control and affected 90-day old fetuses to characterize this syndrome by histological and expression analyses. Compared to wild type individuals, affected animals showed a decreased expression of the three deleted genes. Based on a comparison with human Mowat-Wilson syndrome, we suggest that deletion of ZEB2, is responsible for most of the effects of the mutation. Finally sperm-FISH, embryo genotyping and analysis of reproduction records confirmed somatic mosaicism in the founder bull and male-specific lethality during the first third of gestation. In conclusion, we identified a novel locus involved in bovid horn ontogenesis and suggest that epithelial-to-mesenchymal transition plays a critical role in horn bud differentiation. We also provide new insights into the pathogenicity of ZEB2 loss of heterozygosity in bovine and humans and describe the first case of male-specific lethality associated with an autosomal locus in a non-murine mammalian species. This result sets PMS as a unique model to study sex-specific gene expression/regulation. PMID:23152852

Transcriptomic Analysis and the Expression of Disease-Resistant Genes in Oryza meyeriana under Native Condition

PubMed Central

He, Bin; Tao, Xiang; Gu, Yinghong; Wei, Changhe; Cheng, Xiaojie; Xiao, Suqin; Cheng, Zaiquan; Zhang, Yizheng

2015-01-01

Oryza meyeriana (O. meyeriana), with a GG genome type (2n = 24), accumulated plentiful excellent characteristics with respect to resistance to many diseases such as rice shade and blast, even immunity to bacterial blight. It is very important to know if the diseases-resistant genes exist and express in this wild rice under native conditions. However, limited genomic or transcriptomic data of O. meyeriana are currently available. In this study, we present the first comprehensive characterization of the O. meyeriana transcriptome using RNA-seq and obtained 185,323 contigs with an average length of 1,692 bp and an N50 of 2,391 bp. Through differential expression analysis, it was found that there were most tissue-specifically expressed genes in roots, and next to stems and leaves. By similarity search against protein databases, 146,450 had at least a significant alignment to existed gene models. Comparison with the Oryza sativa (japonica-type Nipponbare and indica-type 93–11) genomes revealed that 13% of the O. meyeriana contigs had not been detected in O. sativa. Many diseases-resistant genes, such as bacterial blight resistant, blast resistant, rust resistant, fusarium resistant, cyst nematode resistant and downy mildew gene, were mined from the transcriptomic database. There are two kinds of rice bacterial blight-resistant genes (Xa1 and Xa26) differentially or specifically expressed in O. meyeriana. The 4 Xa1 contigs were all only expressed in root, while three of Xa26 contigs have the highest expression level in leaves, two of Xa26 contigs have the highest expression profile in stems and one of Xa26 contigs was expressed dominantly in roots. The transcriptomic database of O. meyeriana has been constructed and many diseases-resistant genes were found to express under native condition, which provides a foundation for future discovery of a number of novel genes and provides a basis for studying the molecular mechanisms associated with disease resistance in O

A first generation BAC-based physical map of the rainbow trout genome

PubMed Central

Palti, Yniv; Luo, Ming-Cheng; Hu, Yuqin; Genet, Carine; You, Frank M; Vallejo, Roger L; Thorgaard, Gary H; Wheeler, Paul A; Rexroad, Caird E

2009-01-01

Background Rainbow trout (Oncorhynchus mykiss) are the most-widely cultivated cold freshwater fish in the world and an important model species for many research areas. Coupling great interest in this species as a research model with the need for genetic improvement of aquaculture production efficiency traits justifies the continued development of genomics research resources. Many quantitative trait loci (QTL) have been identified for production and life-history traits in rainbow trout. A bacterial artificial chromosome (BAC) physical map is needed to facilitate fine mapping of QTL and the selection of positional candidate genes for incorporation in marker-assisted selection (MAS) for improving rainbow trout aquaculture production. This resource will also facilitate efforts to obtain and assemble a whole-genome reference sequence for this species. Results The physical map was constructed from DNA fingerprinting of 192,096 BAC clones using the 4-color high-information content fingerprinting (HICF) method. The clones were assembled into physical map contigs using the finger-printing contig (FPC) program. The map is composed of 4,173 contigs and 9,379 singletons. The total number of unique fingerprinting fragments (consensus bands) in contigs is 1,185,157, which corresponds to an estimated physical length of 2.0 Gb. The map assembly was validated by 1) comparison with probe hybridization results and agarose gel fingerprinting contigs; and 2) anchoring large contigs to the microsatellite-based genetic linkage map. Conclusion The production and validation of the first BAC physical map of the rainbow trout genome is described in this paper. We are currently integrating this map with the NCCCWA genetic map using more than 200 microsatellites isolated from BAC end sequences and by identifying BACs that harbor more than 300 previously mapped markers. The availability of an integrated physical and genetic map will enable detailed comparative genome analyses, fine mapping of

Effects of Simultaneous Radiofrequency Radiation and Chemical Exposure of Mammalian Cells. Volume 2

DTIC Science & Technology

1988-07-01

chromosome - - - - - - -I aberrations and sister chromatid exchanges (SCE). Yao (1982) exposed rat kangaroo RH5 and RH1l6 cells to 2.45 GHz radiation, and...control was reported in chromosome aberrations. Yac (1982) investigated the cytogenetic consequences of chronic microwave exposure on rat kangaroo RH5...was said to be 280C. The cells were exposed both as conidia, which are "rather inactive metabolically ," and also after DNA replication had been

Production of tag-free recombinant fusion protein encompassing promiscuous T cell epitope of tetanus toxoid and dog zona pellucida glycoprotein-3 for contraceptive vaccine development.

PubMed

Gupta, Neha; Shrestha, Abhinav; Panda, Amulya Kumar; Gupta, Satish Kumar

2013-07-01

Affinity tags can interfere in various physicochemical properties and immunogenicity of the recombinant proteins. In the present study, tag-free recombinant fusion protein encompassing promiscuous T cell epitope of tetanus toxoid [TT; amino acid (aa) residues 830-844] followed by dilysine linker and dog zona pellucida glycoprotein-3 (ZP3; aa residues 23-348) (TT-KK-ZP3) was expressed in Escherichia coli. The recombinant protein, expressed as inclusion bodies (IBs), was purified by isolation of IBs, processed to remove host cell proteins, followed by solubilization and refolding. A specific 39 kDa protein including ZP3 was identified by SDS-PAGE. CD spectra showed the presence of α-helices and β-sheets, and fluorescent spectroscopy revealed emission maxima of 265 A.U. at 339 nm for refolded protein and showed red shift in the presence of 6 M guanidine hydrochloride. Immunization of inbred FvB/J female mice with purified recombinant TT-KK-ZP3 (25 μg/animal) led to generation of high antibody titers against the recombinant protein. The antibodies reacted specifically with ZP matrix surrounding mouse oocytes. Immunized mice showed significant reduction in fertility as compared to the control group. The studies described herein provide a simple method to produce and purify tag-free recombinant protein for the development of a contraceptive vaccine.

Xp11.22 deletions encompassing CENPVL1, CENPVL2, MAGED1 and GSPT2 as a cause of syndromic X-linked intellectual disability.

PubMed

Grau, Christina; Starkovich, Molly; Azamian, Mahshid S; Xia, Fan; Cheung, Sau Wai; Evans, Patricia; Henderson, Alex; Lalani, Seema R; Scott, Daryl A

2017-01-01

By searching a clinical database of over 60,000 individuals referred for array-based CNV analyses and online resources, we identified four males from three families with intellectual disability, developmental delay, hypotonia, joint hypermobility and relative macrocephaly who carried small, overlapping deletions of Xp11.22. The maximum region of overlap between their deletions spanned ~430 kb and included two pseudogenes, CENPVL1 and CENPVL2, whose functions are not known, and two protein coding genes-the G1 to S phase transition 2 gene (GSPT2) and the MAGE family member D1 gene (MAGED1). Deletions of this ~430 kb region have not been previously implicated in human disease. Duplications of GSPT2 have been documented in individuals with intellectual disability, but the phenotypic consequences of a loss of GSPT2 function have not been elucidated in humans or mouse models. Changes in MAGED1 have not been associated with intellectual disability in humans, but loss of MAGED1 function is associated with neurocognitive and neurobehavioral phenotypes in mice. In all cases, the Xp11.22 deletion was inherited from an unaffected mother. Studies performed on DNA from one of these mothers did not show evidence of skewed X-inactivation. These results suggest that deletions of an ~430 kb region on chromosome Xp11.22 that encompass CENPVL1, CENPVL2, GSPT2 and MAGED1 cause a distinct X-linked syndrome characterized by intellectual disability, developmental delay, hypotonia, joint hypermobility and relative macrocephaly. Loss of GSPT2 and/or MAGED1 function may contribute to the intellectual disability and developmental delay seen in males with these deletions.

GFinisher: a new strategy to refine and finish bacterial genome assemblies

NASA Astrophysics Data System (ADS)

Guizelini, Dieval; Raittz, Roberto T.; Cruz, Leonardo M.; Souza, Emanuel M.; Steffens, Maria B. R.; Pedrosa, Fabio O.

2016-10-01

Despite the development in DNA sequencing technology, improving the number and the length of reads, the process of reconstruction of complete genome sequences, the so called genome assembly, is still complex. Only 13% of the prokaryotic genome sequencing projects have been completed. Draft genome sequences deposited in public databases are fragmented in contigs and may lack the full gene complement. The aim of the present work is to identify assembly errors and improve the assembly process of bacterial genomes. The biological patterns observed in genomic sequences and the application of a priori information can allow the identification of misassembled regions, and the reorganization and improvement of the overall de novo genome assembly. GFinisher starts generating a Fuzzy GC skew graphs for each contig in an assembly and follows breaking down the contigs in critical points in order to reassemble and close them using jFGap. This has been successfully applied to dataset from 96 genome assemblies, decreasing the number of contigs by up to 86%. GFinisher can easily optimize assemblies of prokaryotic draft genomes and can be used to improve the assembly programs based on nucleotide sequence patterns in the genome. The software and source code are available at http://gfinisher.sourceforge.net/.

Resequencing of the common marmoset genome improves genome assemblies and gene-coding sequence analysis.

PubMed

Sato, Kengo; Kuroki, Yoko; Kumita, Wakako; Fujiyama, Asao; Toyoda, Atsushi; Kawai, Jun; Iriki, Atsushi; Sasaki, Erika; Okano, Hideyuki; Sakakibara, Yasubumi

2015-11-20

The first draft of the common marmoset (Callithrix jacchus) genome was published by the Marmoset Genome Sequencing and Analysis Consortium. The draft was based on whole-genome shotgun sequencing, and the current assembly version is Callithrix_jacches-3.2.1, but there still exist 187,214 undetermined gap regions and supercontigs and relatively short contigs that are unmapped to chromosomes in the draft genome. We performed resequencing and assembly of the genome of common marmoset by deep sequencing with high-throughput sequencing technology. Several different sequence runs using Illumina sequencing platforms were executed, and 181 Gbp of high-quality bases including mate-pairs with long insert lengths of 3, 8, 20, and 40 Kbp were obtained, that is, approximately 60× coverage. The resequencing significantly improved the MGSAC draft genome sequence. The N50 of the contigs, which is a statistical measure used to evaluate assembly quality, doubled. As a result, 51% of the contigs (total length: 299 Mbp) that were unmapped to chromosomes in the MGSAC draft were merged with chromosomal contigs, and the improved genome sequence helped to detect 5,288 new genes that are homologous to human cDNAs and the gaps in 5,187 transcripts of the Ensembl gene annotations were completely filled.

De novo sequencing and comparative analysis of leaf transcriptomes of diverse condensed tannin-containing lines of underutilized Psophocarpus tetragonolobus (L.) DC

PubMed Central

Singh, Vinayak; Goel, Ridhi; Pande, Veena; Asif, Mehar Hasan; Mohanty, Chandra Sekhar

2017-01-01

Condensed tannin (CT) or proanthocyanidin (PA) is a unique group of phenolic metabolite with high molecular weight with specific structure. It is reported that, the presence of high-CT in the legumes adversely affect the nutrients in the plant and impairs the digestibility upon consumption by animals. Winged bean (Psophocarpus tetragonolobus (L.) DC.) is one of the promising underutilized legume with high protein and oil-content. One of the reasons for its underutilization is due to the presence of CT. Transcriptome sequencing of leaves of two diverse CT-containing lines of P. tetragonolobus was carried out on Illumina Nextseq 500 sequencer to identify the underlying genes and contigs responsible for CT-biosynthesis. RNA-Seq data generated 102586 and 88433 contigs for high (HCTW) and low CT (LCTW) lines of P. tetragonolobus, respectively. Based on the similarity searches against gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) database revealed 5210 contigs involved in 229 different pathways. A total of 1235 contigs were detected to differentially express between HCTW and LCTW lines. This study along with its findings will be helpful in providing information for functional and comparative genomic analysis of condensed tannin biosynthesis in this plant in specific and legumes in general. PMID:28322296

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

GFinisher: a new strategy to refine and finish bacterial genome assemblies.

PubMed

Guizelini, Dieval; Raittz, Roberto T; Cruz, Leonardo M; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O

2016-10-10

Despite the development in DNA sequencing technology, improving the number and the length of reads, the process of reconstruction of complete genome sequences, the so called genome assembly, is still complex. Only 13% of the prokaryotic genome sequencing projects have been completed. Draft genome sequences deposited in public databases are fragmented in contigs and may lack the full gene complement. The aim of the present work is to identify assembly errors and improve the assembly process of bacterial genomes. The biological patterns observed in genomic sequences and the application of a priori information can allow the identification of misassembled regions, and the reorganization and improvement of the overall de novo genome assembly. GFinisher starts generating a Fuzzy GC skew graphs for each contig in an assembly and follows breaking down the contigs in critical points in order to reassemble and close them using jFGap. This has been successfully applied to dataset from 96 genome assemblies, decreasing the number of contigs by up to 86%. GFinisher can easily optimize assemblies of prokaryotic draft genomes and can be used to improve the assembly programs based on nucleotide sequence patterns in the genome. The software and source code are available at http://gfinisher.sourceforge.net/.

Comparison of carotenoid accumulation and biosynthetic gene expression between Valencia and Rohde Red Valencia sweet oranges.

PubMed

Wei, Xu; Chen, Chunxian; Yu, Qibin; Gady, Antoine; Yu, Yuan; Liang, Guolu; Gmitter, Frederick G

2014-10-01

Carotenoid accumulation and biosynthetic gene expression levels during fruit maturation were compared between ordinary Valencia (VAL) and its more deeply colored mutant Rohde Red Valencia orange (RRV). The two cultivars exhibited different carotenoid profiles and regulatory mechanisms in flavedo and juice sacs, respectively. In flavedo, there was uncoordinated carotenoid accumulation and gene expression in RRV during green stages, which might be related to the expression of certain gene(s) in the MEP (methylerythritol phosphate) pathway. The carotenoid biosynthesis pathway shifting from α,β-xanthophylls to β,β-xanthophylls synthesis occurred in RRV earlier than VAL during orange stages. In juice sacs, the low carotenoid content in both cultivars coincided with low expression of LCYE-Contig03 and LCYE-Contig24 during green stages, suggesting LCYE might be a limiting step for carotenoid accumulation. VAL mainly accumulated violaxanthin, but RRV accumulated β-cryptoxanthin and violaxanthin during orange stages, which corresponded to differences in juice color. Several upstream genes (PDS-Contig17, LCYB-Contig19, and ZDS members) and a downstream gene (ZEP) were expressed at higher levels in RRV than VAL, which might be responsible for greater accumulation of β-cryptoxanthin and violaxanthin in RRV, respectively. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Linkage analysis and physical mapping near the gene for x-linked agammaglobulinemia at Xq22

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parolini, O.; Lassiter, G.L.; Henry, M.J.

The gene for x-linked agammaglobulinemia (XLA) has been mapped to Xq22. No recombinations have been reported between the gene and the prob p212 at DXS178; however, this probe is informative in only 30-40% of women and the reported flanking markers, DXS3 and DXS94, and 10-15 cM apart. To identify additional probes that might be useful in genetic counseling, we examined 11 polymorphisms that have been mapped to the Xq21.3-q22 region in 13 families with XLA. In addition, pulsed-field gel electrophoresis and yeast artificial chromosomes (YACs) were used to further characterize the segman of DNA within which the gene for SLAmore » must lie. The results demonstrated that DXS366 and DXS442, which share a 430-kb pulsed-field fragment, could replace DXS3 as proximal flanking markers. Probes at DXS178 and DXS265 identified the same 145-kb pulsed-field fragment, and both loci were contained within a 200-kb YAC identified with the probe p212. A highly polymorphic CA repeat (DCS178CA) was isolated from one end of this YAC and used in linkage analysis. Probes at DXS101 and DXS328 shared several pulsed-field fragments, the smallest of which was 250 kb. No recombinations were seen between XLA and the DXS178-DXS265-DXS178CA complex, DXS101, DXS328, DXS87, or the gene for proteolipid protein (PLP). Key crossovers, when combined with the linkage data from families with Alport syndrome, suggested the following order of loci: cen-DXS3-DXS366-DXS442-(PLP, DXS101, DXS328, DXS178-DXS265-DXS178CA complex, XL)-(DXS87, DXS94)-DXS327-(DXS350, DXS362)-tel. Our studies also limit the segment of DNA within which the XLA gene must lie to the 3- to 4-cM distance between DCS442 and DXS94 and they identify and orient polymorphisms that can be used in genetic counseling not only for XLA but also for Pelizaeus-Merzbacher disease (PLP deficiency), Alport syndrome (COL4A5 deficiency), and Fabry disease ([alpha]-galactosidase A difficiency). 31 refs., 5 figs., 2 tabs.« less

Draft genome sequence of Lactobacillus mali KCTC 3596.

PubMed

Kim, Dong-Wook; Choi, Sang-Haeng; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dae-Soo; Kim, Ryong Nam; Kim, Aeri; Park, Hong-Seog

2011-09-01

We announce the draft genome sequence of the type strain Lactobacillus mali KCTC 3596 (2,652,969 bp, with a G+C content of 36.0%), which is one of the most prevalent lactic acid bacteria present during the manufacturing process of apple juice. The genome consists of 122 large contigs (>100 bp). All of the contigs were assembled by Newbler Assembler 2.3 (454 Life Science). Copyright © 2011, American Society for Microbiology. All Rights Reserved.

A strategy for rapid production and screening of yeast artificial chromosome libraries.

PubMed

Strauss, W M; Jaenisch, E; Jaenisch, R

1992-01-01

We describe methods for rapid production and screening of yeast artificial chromosome (YAC) libraries. Utilizing complete restriction digests of mouse genomic DNA for ligations in agarose, a 32,000-clone library was produced and screened in seven weeks. Screening was accomplished by subdividing primary transformation plates into pools of approximately 100 clones which were transferred into a master glycerol stock. These master stocks were used to inoculate liquid cultures to produce culture "pools," and ten pools of 100 clones were then combined to yield superpools of 1,000 clones. Both pool and superpool DNA was screened by polymerase chain reaction (PCR) and positive pools representing 100 clones were then plated on selective medium and screened by in situ hybridization. Screening by the two tiered PCR assay and by in situ hybridization was completed in 4-5 days. Utilizing this methodology we have isolated a 150 kb clone spanning the alpha 1(I) collagen (Col1a1) gene as well as 40 kb clones from the Hox-2 locus. To characterize the representation of the YAC library, the size distribution of genomic Sal I fragments was compared to that of clones picked at random from the library. The results demonstrate significant biasing of the cloned fragment distribution, resulting in a loss of representation for larger fragments.

Transcriptome analysis of Nautilus and pygmy squid developing eye provides insights in lens and eye evolution.

PubMed

Sousounis, Konstantinos; Ogura, Atsushi; Tsonis, Panagiotis A

2013-01-01

Coleoid cephalopods like squids have a camera-type eye similar to vertebrates. On the other hand, Nautilus (Nautiloids) has a pinhole eye that lacks lens and cornea. Since pygmy squid and Nautilus are closely related species they are excellent model organisms to study eye evolution. Having being able to collect Nautilus embryos, we employed next-generation RNA sequencing using Nautilus and pygmy squid developing eyes. Their transcriptomes were compared and analyzed. Enrichment analysis of Gene Ontology revealed that contigs related to nucleic acid binding were largely up-regulated in squid, while the ones related to metabolic processes and extracellular matrix-related genes were up-regulated in Nautilus. These differences are most likely correlated with the complexity of tissue organization in these species. Moreover, when the analysis focused on the eye-related contigs several interesting patterns emerged. First, contigs from both species related to eye tissue differentiation and morphogenesis as well as to cilia showed best hits with their Human counterparts, while contigs related to rabdomeric photoreceptors showed the best hit with their Drosophila counterparts. This bolsters the idea that eye morphogenesis genes have been generally conserved in evolution, and compliments other studies showing that genes involved in photoreceptor differentiation clearly follow the diversification of invertebrate (rabdomeric) and vertebrate (ciliated) photoreceptors. Interestingly some contigs showed as good a hit with Drosophila and Human homologues in Nautilus and squid samples. One of them, capt/CAP1, is known to be preferentially expressed in Drosophila developing eye and in vertebrate lens. Importantly our analysis also provided evidence of gene duplication and diversification of their function in both species. One of these genes is the Neurofibromatosis 1 (NF1/Nf1), which in mice has been implicated in lens formation, suggesting a hitherto unsuspected role in the evolution

Insight into Dominant Cellulolytic Bacteria from Two Biogas Digesters and Their Glycoside Hydrolase Genes

PubMed Central

Zhang, Jun; Zhang, Lei; Geng, Alei; Liu, Fanghua; Zhao, Guoping; Wang, Shengyue; Zhou, Zhihua; Yan, Xing

2015-01-01

Diverse cellulolytic bacteria are essential for maintaining high lignocellulose degradation ability in biogas digesters. However, little was known about functional genes and gene clusters of dominant cellulolytic bacteria in biogas digesters. This is the foundation to understand lignocellulose degradation mechanisms of biogas digesters and apply these gene resource for optimizing biofuel production. A combination of metagenomic and 16S rRNA gene clone library methods was used to investigate the dominant cellulolytic bacteria and their glycoside hydrolase (GH) genes in two biogas digesters. The 16S rRNA gene analysis revealed that the dominant cellulolytic bacteria were strains closely related to Clostridium straminisolvens and an uncultured cellulolytic bacterium designated BG-1. To recover GH genes from cellulolytic bacteria in general, and BG-1 in particular, a refined assembly approach developed in this study was used to assemble GH genes from metagenomic reads; 163 GH-containing contigs ≥ 1 kb in length were obtained. Six recovered GH5 genes that were expressed in E. coli demonstrated multiple lignocellulase activities and one had high mannanase activity (1255 U/mg). Eleven fosmid clones harboring the recovered GH-containing contigs were sequenced and assembled into 10 fosmid contigs. The composition of GH genes in the 163 assembled metagenomic contigs and 10 fosmid contigs indicated that diverse GHs and lignocellulose degradation mechanisms were present in the biogas digesters. In particular, a small portion of BG-1 genome information was recovered by PhyloPythiaS analysis. The lignocellulase gene clusters in BG-1 suggested that it might use a possible novel lignocellulose degradation mechanism to efficiently degrade lignocellulose. Dominant cellulolytic bacteria of biogas digester possess diverse GH genes, not only in sequences but also in their functions, which may be applied for production of biofuel in the future. PMID:26070087

Transcriptome analysis in cotton boll weevil (Anthonomus grandis) and RNA interference in insect pests.

PubMed

Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

2013-01-01

Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

Transcriptome Analysis in Cotton Boll Weevil (Anthonomus grandis) and RNA Interference in Insect Pests

PubMed Central

Coelho, Roberta Ramos; Antonino de Souza Jr, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas-Jr, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

2013-01-01

Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families’ data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects. PMID:24386449

Transcriptome Analysis of Nautilus and Pygmy Squid Developing Eye Provides Insights in Lens and Eye Evolution

PubMed Central

Sousounis, Konstantinos; Ogura, Atsushi; Tsonis, Panagiotis A.

2013-01-01

Coleoid cephalopods like squids have a camera-type eye similar to vertebrates. On the other hand, Nautilus (Nautiloids) has a pinhole eye that lacks lens and cornea. Since pygmy squid and Nautilus are closely related species they are excellent model organisms to study eye evolution. Having being able to collect Nautilus embryos, we employed next-generation RNA sequencing using Nautilus and pygmy squid developing eyes. Their transcriptomes were compared and analyzed. Enrichment analysis of Gene Ontology revealed that contigs related to nucleic acid binding were largely up-regulated in squid, while the ones related to metabolic processes and extracellular matrix-related genes were up-regulated in Nautilus. These differences are most likely correlated with the complexity of tissue organization in these species. Moreover, when the analysis focused on the eye-related contigs several interesting patterns emerged. First, contigs from both species related to eye tissue differentiation and morphogenesis as well as to cilia showed best hits with their Human counterparts, while contigs related to rabdomeric photoreceptors showed the best hit with their Drosophila counterparts. This bolsters the idea that eye morphogenesis genes have been generally conserved in evolution, and compliments other studies showing that genes involved in photoreceptor differentiation clearly follow the diversification of invertebrate (rabdomeric) and vertebrate (ciliated) photoreceptors. Interestingly some contigs showed as good a hit with Drosophila and Human homologues in Nautilus and squid samples. One of them, capt/CAP1, is known to be preferentially expressed in Drosophila developing eye and in vertebrate lens. Importantly our analysis also provided evidence of gene duplication and diversification of their function in both species. One of these genes is the Neurofibromatosis 1 (NF1/Nf1), which in mice has been implicated in lens formation, suggesting a hitherto unsuspected role in the evolution

Analysis of the Salivary Gland Transcriptome of Frankliniella occidentalis

PubMed Central

Stafford-Banks, Candice A.; Rotenberg, Dorith; Johnson, Brian R.; Whitfield, Anna E.; Ullman, Diane E.

2014-01-01

Saliva is known to play a crucial role in insect feeding behavior and virus transmission. Currently, little is known about the salivary glands and saliva of thrips, despite the fact that Frankliniella occidentalis (Pergande) (the western flower thrips) is a serious pest due to its destructive feeding, wide host range, and transmission of tospoviruses. As a first step towards characterizing thrips salivary gland functions, we sequenced the transcriptome of the primary salivary glands of F. occidentalis using short read sequencing (Illumina) technology. A de novo-assembled transcriptome revealed 31,392 high quality contigs with an average size of 605 bp. A total of 12,166 contigs had significant BLASTx or tBLASTx hits (E≤1.0E−6) to known proteins, whereas a high percentage (61.24%) of contigs had no apparent protein or nucleotide hits. Comparison of the F. occidentalis salivary gland transcriptome (sialotranscriptome) against a published F. occidentalis full body transcriptome assembled from Roche-454 reads revealed several contigs with putative annotations associated with salivary gland functions. KEGG pathway analysis of the sialotranscriptome revealed that the majority (18 out of the top 20 predicted KEGG pathways) of the salivary gland contig sequences match proteins involved in metabolism. We identified several genes likely to be involved in detoxification and inhibition of plant defense responses including aldehyde dehydrogenase, metalloprotease, glucose oxidase, glucose dehydrogenase, and regucalcin. We also identified several genes that may play a role in the extra-oral digestion of plant structural tissues including β-glucosidase and pectin lyase; and the extra-oral digestion of sugars, including α-amylase, maltase, sucrase, and α-glucosidase. This is the first analysis of a sialotranscriptome for any Thysanopteran species and it provides a foundational tool to further our understanding of how thrips interact with their plant hosts and the viruses

Analysis of the salivary gland transcriptome of Frankliniella occidentalis.

PubMed

Stafford-Banks, Candice A; Rotenberg, Dorith; Johnson, Brian R; Whitfield, Anna E; Ullman, Diane E

2014-01-01

Saliva is known to play a crucial role in insect feeding behavior and virus transmission. Currently, little is known about the salivary glands and saliva of thrips, despite the fact that Frankliniella occidentalis (Pergande) (the western flower thrips) is a serious pest due to its destructive feeding, wide host range, and transmission of tospoviruses. As a first step towards characterizing thrips salivary gland functions, we sequenced the transcriptome of the primary salivary glands of F. occidentalis using short read sequencing (Illumina) technology. A de novo-assembled transcriptome revealed 31,392 high quality contigs with an average size of 605 bp. A total of 12,166 contigs had significant BLASTx or tBLASTx hits (E≤1.0E-6) to known proteins, whereas a high percentage (61.24%) of contigs had no apparent protein or nucleotide hits. Comparison of the F. occidentalis salivary gland transcriptome (sialotranscriptome) against a published F. occidentalis full body transcriptome assembled from Roche-454 reads revealed several contigs with putative annotations associated with salivary gland functions. KEGG pathway analysis of the sialotranscriptome revealed that the majority (18 out of the top 20 predicted KEGG pathways) of the salivary gland contig sequences match proteins involved in metabolism. We identified several genes likely to be involved in detoxification and inhibition of plant defense responses including aldehyde dehydrogenase, metalloprotease, glucose oxidase, glucose dehydrogenase, and regucalcin. We also identified several genes that may play a role in the extra-oral digestion of plant structural tissues including β-glucosidase and pectin lyase; and the extra-oral digestion of sugars, including α-amylase, maltase, sucrase, and α-glucosidase. This is the first analysis of a sialotranscriptome for any Thysanopteran species and it provides a foundational tool to further our understanding of how thrips interact with their plant hosts and the viruses they

A comparative physical map reveals the pattern of chromosomal evolution between the turkey (Meleagris gallopavo) and chicken (Gallus gallus) genomes

PubMed Central

2011-01-01

Background A robust bacterial artificial chromosome (BAC)-based physical map is essential for many aspects of genomics research, including an understanding of chromosome evolution, high-resolution genome mapping, marker-assisted breeding, positional cloning of genes, and quantitative trait analysis. To facilitate turkey genetics research and better understand avian genome evolution, a BAC-based integrated physical, genetic, and comparative map was developed for this important agricultural species. Results The turkey genome physical map was constructed based on 74,013 BAC fingerprints (11.9 × coverage) from two independent libraries, and it was integrated with the turkey genetic map and chicken genome sequence using over 41,400 BAC assignments identified by 3,499 overgo hybridization probes along with > 43,000 BAC end sequences. The physical-comparative map consists of 74 BAC contigs, with an average contig size of 13.6 Mb. All but four of the turkey chromosomes were spanned on this map by three or fewer contigs, with 14 chromosomes spanned by a single contig and nine chromosomes spanned by two contigs. This map predicts 20 to 27 major rearrangements distinguishing turkey and chicken chromosomes, despite up to 40 million years of separate evolution between the two species. These data elucidate the chromosomal evolutionary pattern within the Phasianidae that led to the modern turkey and chicken karyotypes. The predominant rearrangement mode involves intra-chromosomal inversions, and there is a clear bias for these to result in centromere locations at or near telomeres in turkey chromosomes, in comparison to interstitial centromeres in the orthologous chicken chromosomes. Conclusion The BAC-based turkey-chicken comparative map provides novel insights into the evolution of avian genomes, a framework for assembly of turkey whole genome shotgun sequencing data, and tools for enhanced genetic improvement of these important agricultural and model species. PMID:21906286

Role of Modular Polyketide Synthases in the Production of Polyether Ladder Compounds in Ciguatoxin-Producing Gambierdiscus polynesiensis and G. excentricus (Dinophyceae).

PubMed

Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A

2017-09-01

Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.

Deep, Staged Transcriptomic Resources for the Novel Coleopteran Models Atrachya menetriesi and Callosobruchus maculatus

PubMed Central

Conrads, Kai H.; Roth, Siegfried; Lynch, Jeremy A.

2016-01-01

Despite recent efforts to sample broadly across metazoan and insect diversity, current sequence resources in the Coleoptera do not adequately describe the diversity of the clade. Here we present deep, staged transcriptomic data for two coleopteran species, Atrachya menetriesi (Faldermann 1835) and Callosobruchus maculatus (Fabricius 1775). Our sampling covered key stages in ovary and early embryonic development in each species. We utilized this data to build combined assemblies for each species which were then analysed in detail. The combined A. menetriesi assembly consists of 228,096 contigs with an N50 of 1,598 bp, while the combined C. maculatus assembly consists of 128,837 contigs with an N50 of 2,263 bp. For these assemblies, 34.6% and 32.4% of contigs were identified using Blast2GO, and 97% and 98.3% of the BUSCO set of metazoan orthologs were present, respectively. We also carried out manual annotation of developmental signalling pathways and found that nearly all expected genes were present in each transcriptome. Our analyses show that both transcriptomes are of high quality. Lastly, we performed read mapping utilising our timed, stage specific RNA samples to identify differentially expressed contigs. The resources presented here will provide a firm basis for a variety of experimentation, both in developmental biology and in comparative genomic studies. PMID:27907180

Deep, Staged Transcriptomic Resources for the Novel Coleopteran Models Atrachya menetriesi and Callosobruchus maculatus.

PubMed

Benton, Matthew A; Kenny, Nathan J; Conrads, Kai H; Roth, Siegfried; Lynch, Jeremy A

2016-01-01

Despite recent efforts to sample broadly across metazoan and insect diversity, current sequence resources in the Coleoptera do not adequately describe the diversity of the clade. Here we present deep, staged transcriptomic data for two coleopteran species, Atrachya menetriesi (Faldermann 1835) and Callosobruchus maculatus (Fabricius 1775). Our sampling covered key stages in ovary and early embryonic development in each species. We utilized this data to build combined assemblies for each species which were then analysed in detail. The combined A. menetriesi assembly consists of 228,096 contigs with an N50 of 1,598 bp, while the combined C. maculatus assembly consists of 128,837 contigs with an N50 of 2,263 bp. For these assemblies, 34.6% and 32.4% of contigs were identified using Blast2GO, and 97% and 98.3% of the BUSCO set of metazoan orthologs were present, respectively. We also carried out manual annotation of developmental signalling pathways and found that nearly all expected genes were present in each transcriptome. Our analyses show that both transcriptomes are of high quality. Lastly, we performed read mapping utilising our timed, stage specific RNA samples to identify differentially expressed contigs. The resources presented here will provide a firm basis for a variety of experimentation, both in developmental biology and in comparative genomic studies.

Transcriptional dynamics of the developing sweet cherry (Prunus avium L.) fruit: sequencing, annotation and expression profiling of exocarp-associated genes

PubMed Central

Alkio, Merianne; Jonas, Uwe; Declercq, Myriam; Van Nocker, Steven; Knoche, Moritz

2014-01-01

The exocarp, or skin, of fleshy fruit is a specialized tissue that protects the fruit, attracts seed dispersing fruit eaters, and has large economical relevance for fruit quality. Development of the exocarp involves regulated activities of many genes. This research analyzed global gene expression in the exocarp of developing sweet cherry (Prunus avium L., ‘Regina’), a fruit crop species with little public genomic resources. A catalog of transcript models (contigs) representing expressed genes was constructed from de novo assembled short complementary DNA (cDNA) sequences generated from developing fruit between flowering and maturity at 14 time points. Expression levels in each sample were estimated for 34 695 contigs from numbers of reads mapping to each contig. Contigs were annotated functionally based on BLAST, gene ontology and InterProScan analyses. Coregulated genes were detected using partitional clustering of expression patterns. The results are discussed with emphasis on genes putatively involved in cuticle deposition, cell wall metabolism and sugar transport. The high temporal resolution of the expression patterns presented here reveals finely tuned developmental specialization of individual members of gene families. Moreover, the de novo assembled sweet cherry fruit transcriptome with 7760 full-length protein coding sequences and over 20 000 other, annotated cDNA sequences together with their developmental expression patterns is expected to accelerate molecular research on this important tree fruit crop. PMID:26504533

Development of genetic markers in abalone through construction of a SNP database.

PubMed

Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

2011-06-01

In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

ABACAS: algorithm-based automatic contiguation of assembled sequences

PubMed Central

Assefa, Samuel; Keane, Thomas M.; Otto, Thomas D.; Newbold, Chris; Berriman, Matthew

2009-01-01

Summary: Due to the availability of new sequencing technologies, we are now increasingly interested in sequencing closely related strains of existing finished genomes. Recently a number of de novo and mapping-based assemblers have been developed to produce high quality draft genomes from new sequencing technology reads. New tools are necessary to take contigs from a draft assembly through to a fully contiguated genome sequence. ABACAS is intended as a tool to rapidly contiguate (align, order, orientate), visualize and design primers to close gaps on shotgun assembled contigs based on a reference sequence. The input to ABACAS is a set of contigs which will be aligned to the reference genome, ordered and orientated, visualized in the ACT comparative browser, and optimal primer sequences are automatically generated. Availability and Implementation: ABACAS is implemented in Perl and is freely available for download from http://abacas.sourceforge.net Contact: sa4@sanger.ac.uk PMID:19497936

A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s

PubMed Central

Dalman, Kerstin; Himmelstrand, Kajsa; Olson, Åke; Lind, Mårten; Brandström-Durling, Mikael; Stenlid, Jan

2013-01-01

The dense single nucleotide polymorphisms (SNP) panels needed for genome wide association (GWA) studies have hitherto been expensive to establish and use on non-model organisms. To overcome this, we used a next generation sequencing approach to both establish SNPs and to determine genotypes. We conducted a GWA study on a fungal species, analysing the virulence of Heterobasidion annosum s.s., a necrotrophic pathogen, on its hosts Picea abies and Pinus sylvestris. From a set of 33,018 single nucleotide polymorphisms (SNP) in 23 haploid isolates, twelve SNP markers distributed on seven contigs were associated with virulence (P<0.0001). Four of the contigs harbour known virulence genes from other fungal pathogens and the remaining three harbour novel candidate genes. Two contigs link closely to virulence regions recognized previously by QTL mapping in the congeneric hybrid H. irregulare × H. occidentale. Our study demonstrates the efficiency of GWA studies for dissecting important complex traits of small populations of non-model haploid organisms with small genomes. PMID:23341945

Toxoplasma gondii infection shifts dendritic cells into an amoeboid rapid migration mode encompassing podosome dissolution, secretion of TIMP-1, and reduced proteolysis of extracellular matrix.

PubMed

Ólafsson, Einar B; Varas-Godoy, Manuel; Barragan, Antonio

2018-03-01

Dendritic cells (DCs) infected by Toxoplasma gondii rapidly acquire a hypermigratory phenotype that promotes systemic parasite dissemination by a "Trojan horse" mechanism in mice. Recent paradigms of leukocyte migration have identified the amoeboid migration mode of DCs as particularly suited for rapid locomotion in extracellular matrix and tissues. Here, we have developed a microscopy-based high-throughput approach to assess motility and matrix degradation by Toxoplasma-challenged murine and human DCs. DCs challenged with T. gondii exhibited dependency on metalloproteinase activity for hypermotility and transmigration but, strikingly, also dramatically reduced pericellular proteolysis. Toxoplasma-challenged DCs up-regulated expression and secretion of tissue inhibitor of metalloproteinases-1 (TIMP-1) and their supernatants impaired matrix degradation by naïve DCs and by-stander DCs dose dependently. Gene silencing of TIMP-1 by short hairpin RNA restored matrix degradation activity in Toxoplasma-infected DCs. Additionally, dissolution of podosome structures in parasitised DCs coincided with abrogated matrix degradation. Toxoplasma lysates inhibited pericellular proteolysis in a MyD88-dependent fashion whereas abrogated proteolysis persevered in Toxoplasma-infected MyD88-deficient DCs. This indicated that both TLR/MyD88-dependent and TLR/MyD88-independent signalling pathways mediated podosome dissolution and the abrogated matrix degradation. We report that increased TIMP-1 secretion and cytoskeletal rearrangements encompassing podosome dissolution are features of Toxoplasma-induced hypermigration of DCs with an impact on matrix degradation. Jointly, the data highlight how an obligate intracellular parasite orchestrates key regulatory cellular processes consistent with non-proteolytic amoeboid migration of the vehicle cells that facilitate its dissemination. © 2017 John Wiley & Sons Ltd.

Finishing bacterial genome assemblies with Mix.

PubMed

Soueidan, Hayssam; Maurier, Florence; Groppi, Alexis; Sirand-Pugnet, Pascal; Tardy, Florence; Citti, Christine; Dupuy, Virginie; Nikolski, Macha

2013-01-01

Among challenges that hamper reaping the benefits of genome assembly are both unfinished assemblies and the ensuing experimental costs. First, numerous software solutions for genome de novo assembly are available, each having its advantages and drawbacks, without clear guidelines as to how to choose among them. Second, these solutions produce draft assemblies that often require a resource intensive finishing phase. In this paper we address these two aspects by developing Mix , a tool that mixes two or more draft assemblies, without relying on a reference genome and having the goal to reduce contig fragmentation and thus speed-up genome finishing. The proposed algorithm builds an extension graph where vertices represent extremities of contigs and edges represent existing alignments between these extremities. These alignment edges are used for contig extension. The resulting output assembly corresponds to a set of paths in the extension graph that maximizes the cumulative contig length. We evaluate the performance of Mix on bacterial NGS data from the GAGE-B study and apply it to newly sequenced Mycoplasma genomes. Resulting final assemblies demonstrate a significant improvement in the overall assembly quality. In particular, Mix is consistent by providing better overall quality results even when the choice is guided solely by standard assembly statistics, as is the case for de novo projects. Mix is implemented in Python and is available at https://github.com/cbib/MIX, novel data for our Mycoplasma study is available at http://services.cbib.u-bordeaux2.fr/mix/.

Metavir 2: new tools for viral metagenome comparison and assembled virome analysis

PubMed Central

2014-01-01

Background Metagenomics, based on culture-independent sequencing, is a well-fitted approach to provide insights into the composition, structure and dynamics of environmental viral communities. Following recent advances in sequencing technologies, new challenges arise for existing bioinformatic tools dedicated to viral metagenome (i.e. virome) analysis as (i) the number of viromes is rapidly growing and (ii) large genomic fragments can now be obtained by assembling the huge amount of sequence data generated for each metagenome. Results To face these challenges, a new version of Metavir was developed. First, all Metavir tools have been adapted to support comparative analysis of viromes in order to improve the analysis of multiple datasets. In addition to the sequence comparison previously provided, viromes can now be compared through their k-mer frequencies, their taxonomic compositions, recruitment plots and phylogenetic trees containing sequences from different datasets. Second, a new section has been specifically designed to handle assembled viromes made of thousands of large genomic fragments (i.e. contigs). This section includes an annotation pipeline for uploaded viral contigs (gene prediction, similarity search against reference viral genomes and protein domains) and an extensive comparison between contigs and reference genomes. Contigs and their annotations can be explored on the website through specifically developed dynamic genomic maps and interactive networks. Conclusions The new features of Metavir 2 allow users to explore and analyze viromes composed of raw reads or assembled fragments through a set of adapted tools and a user-friendly interface. PMID:24646187

Dramatic improvement in genome assembly achieved using doubled-haploid genomes.

PubMed

Zhang, Hong; Tan, Engkong; Suzuki, Yutaka; Hirose, Yusuke; Kinoshita, Shigeharu; Okano, Hideyuki; Kudoh, Jun; Shimizu, Atsushi; Saito, Kazuyoshi; Watabe, Shugo; Asakawa, Shuichi

2014-10-27

Improvement in de novo assembly of large genomes is still to be desired. Here, we improved draft genome sequence quality by employing doubled-haploid individuals. We sequenced wildtype and doubled-haploid Takifugu rubripes genomes, under the same conditions, using the Illumina platform and assembled contigs with SOAPdenovo2. We observed 5.4-fold and 2.6-fold improvement in the sizes of the N50 contig and scaffold of doubled-haploid individuals, respectively, compared to the wildtype, indicating that the use of a doubled-haploid genome aids in accurate genome analysis.

Striatal Direct and Indirect Pathway Output Structures are Differentially Altered in Mouse Models of Huntington's Disease.

PubMed

Barry, Joshua; Akopian, Garnik; Cepeda, Carlos; Levine, Michael S

2018-04-24

The present study examined synaptic communication between direct and indirect output pathway striatal medium-sized spiny neurons (MSNs) and their target structures, the substantia nigra pars reticulata (SNr) and the external globus pallidus (GPe) in two mouse models of Huntington's disease (HD). Cre-recombination, optogenetics, and whole-cell patch clamp recordings were used to determine alterations in intrinsic and synaptic properties of SNr and GPe neurons from both male and female symptomatic R6/2 (>60 days) and pre- (2 months) or symptomatic (10-12 months) YAC128 mice. Cell membrane capacitance was decreased whereas input resistance was increased in SNr neurons from R6/2, but not YAC128 mice. The amplitude of GABAergic responses evoked by optogenetic stimulation of direct pathway terminals was reduced in SNr neurons of symptomatic mice of both models. A decrease in spontaneous GABA synaptic activity, in particular large-amplitude events, in SNr neurons also was observed. Passive membrane properties of GPe neurons were not different between R6/2 or YAC128 mice and their control littermates. Similarly, the amplitude of GABA responses evoked by activation of indirect pathway MSN terminals and the frequency of spontaneous GABA synaptic activity were similar in HD and control animals. In contrast, the decay time of the evoked GABA response was significantly longer in cells from HD mice. Interestingly, activation of indirect pathway MSNs within the striatum evoked larger-amplitude responses in direct pathway MSNs. Together, these results demonstrate differential alterations in responses evoked by direct and indirect pathway terminals in SNr and GPe leading to striatal output imbalance and motor dysfunction. SIGNIFICANCE STATEMENT Previous work on Huntington's disease (HD) focused on striatal medium-sized spiny neurons (MSNs) almost exclusively. Little is known about the effects that alterations in the striatum have on output structures of the direct and indirect

Dysregulation of mitochondrial calcium signaling and superoxide flashes cause mitochondrial genomic DNA damage in Huntington disease.

PubMed

Wang, Jiu-Qiang; Chen, Qian; Wang, Xianhua; Wang, Qiao-Chu; Wang, Yun; Cheng, He-Ping; Guo, Caixia; Sun, Qinmiao; Chen, Quan; Tang, Tie-Shan

2013-02-01

Huntington disease (HD) is an inherited, fatal neurodegenerative disorder characterized by the progressive loss of striatal medium spiny neurons. Indications of oxidative stress are apparent in brain tissues from both HD patients and HD mouse models; however, the origin of this oxidant stress remains a mystery. Here, we used a yeast artificial chromosome transgenic mouse model of HD (YAC128) to investigate the potential connections between dysregulation of cytosolic Ca(2+) signaling and mitochondrial oxidative damage in HD cells. We found that YAC128 mouse embryonic fibroblasts exhibit a strikingly higher level of mitochondrial matrix Ca(2+) loading and elevated superoxide generation compared with WT cells, indicating that both mitochondrial Ca(2+) signaling and superoxide generation are dysregulated in HD cells. The excessive mitochondrial oxidant stress is critically dependent on mitochondrial Ca(2+) loading in HD cells, because blocking mitochondrial Ca(2+) uptake abolished elevated superoxide generation. Similar results were obtained using neurons from HD model mice and fibroblast cells from HD patients. More importantly, mitochondrial Ca(2+) loading in HD cells caused a 2-fold higher level of mitochondrial genomic DNA (mtDNA) damage due to the excessive oxidant generation. This study provides strong evidence to support a new causal link between dysregulated mitochondrial Ca(2+) signaling, elevated mitochondrial oxidant stress, and mtDNA damage in HD. Our results also indicate that reducing mitochondrial Ca(2+) uptake could be a therapeutic strategy for HD.

Structural analysis of the HLA-A/HLA-F subregion: Precise localization of two new multigene families closely associated with the HLA class I sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pichon, L.; Carn, G.; Bouric, P.

1996-03-01

Positional cloning strategies for the hemochromatosis gene have previously concentrated on a target area restricted to a maximum genomic expanse of 400 kb around the HLA-A and HLA-F loci. Recently, the candidate region has been extended to 2-3 Mb on the distal side of the MHC. In this study, 10 coding sequences [hemochromatosis candidate genes (HCG) I to X] were isolated by cDNA selection using YACs covering the HLA-A/HLA-F subregion. Two of these (HCG II and HCG IV) belong to multigene families, as well as other sequences already described in this region, i.e., P5, pMC 6.7, and HLA class I.more » Fingerprinting of the four YACSs overlapping the region was performed and allowed partial localization of the different multigene family sequences on each YAC without defining their exact positions. Fingerprinting on cosmids isolated from the ICRF chromosome 6-specific cosmid library allowed more precise localization of the redundant sequences in all of the multigene families and revealed their apparent organization in clusters. Further examination of these intertwined sequences demonstrated that this structural organization resulted from a succession of complex phenomena, including duplications and contractions. This study presents a precise description of the structural organization of the HLA-A/HLA-F region and a determination of the sequences involved in the megabase size polymorphism observed among the A3, A24, and A31 haplotypes. 29 refs., 2 figs., 2 tabs.« less

Keyhole limpet hemocyanin augmented the killing activity, cytokine production and proliferation of NK cells, and inhibited the proliferation of Meth A sarcoma cells in vitro.

PubMed

Sarker, Md Moklesur Rahman; Zhong, Ming

2014-01-01

Keyhole limpet hemocyanin (KLH) is a popular tumor vaccine carrier protein and an immunostimulant. The present study aimed to investigate the immunoregulatory activity of KLH on cytotoxicity, cytokines production, and proliferation of natural killer (NK) cells. Moreover, antiproliferative activity of KLH on Meth A sarcoma cells was studied. Cytotoxicity was determined with killing ability of NK cells against yeast artificial chromosome (YAC)-1 cells. Interferon-gamma (IFN-γ) and tumor necrosis factor-alpha (TNF-α) productions by NK cells were measured by enzyme-linked immunosorbent assay (ELISA). Proliferations of NK and Meth A cells were determined by [(3)H]thymidine incorporated proliferation and 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) methods, respectively. KLH at 6.25, 12.5, and 25 μg/well augmented cytotoxicity of NK cells against YAC-1 cells by 2.5, three, and five-times, respectively. KLH at 25 μg/well enhanced IFN-γ and TNF-α productions by 17- and 23-folds, respectively. The proliferation of NK cells was three times stimulated by KLH. The proliferation of Meth A cells was markedly inhibited by all the doses; the highest (4-folds higher) inhibition was observed at a dose of KLH (25 μg/well). The study demonstrated the anticancer activity of KLH acting through the induction of NK cells and inhibition of cancer cells. KLH, therefore, may be a good candidate for an anticancer agent alone or in combination with other chemotherapeutic agents.

Acute mental stress but not enforced muscle activity transiently increases natural cytotoxicity in spontaneously hypertensive rats.

PubMed

Jonsdottir, I H; Johansson, C; Asea, A; Hellstrand, K; Hoffmann, P

1996-08-01

The influence of acute mental stress and the effect of electrically induced skeletal muscle contractions on natural cytotoxicity in vivo was investigated in spontaneously hypertensive rats Natural cytotoxicity in vivo was measured as the clearance of injected 51Cr-labelled YAC-1 lymphoma cells from the lungs, which are specifically lysed by natural killer cells. The mental stress consisted of an air jet directed towards the animals in their cage for 25 min. During the mental stress there was a significant increase in natural cytotoxicity. Thus, retained radioactivity in the lungs was decreased to 74 +/- 6% of the control levels which was set to 100% (P < 0.01). This augmentation of YAC-1-cell clearance could be blocked with the beta-adrenergic receptor antagonist Timolol. Two hours after termination of the air stress, in vivo cytotoxicity had returned to control levels. In contrast, acute physical stress, consisting of electrically induced muscle contractions for 60 min, had no significant effects on in vivo cytotoxicity, either during the stimulation or 1, 2 or 24 h after the stimulation. Further, significantly increased plasma levels of adrenaline were seen after the air jet stress, but not after muscle stimulation. There were no significant changes in plasma noradrenaline levels either after air stress or muscle stimulation. These results indicate that changes in in vivo cytotoxicity after mild mental stress are dependent on increased plasma catecholamine levels while acute physical stress without changes in catecholamine levels, does not influence in vivo cytotoxicity.

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

PubMed

Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

2008-05-01

Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

Comparing de novo assemblers for 454 transcriptome data

PubMed Central

2010-01-01

Background Roche 454 pyrosequencing has become a method of choice for generating transcriptome data from non-model organisms. Once the tens to hundreds of thousands of short (250-450 base) reads have been produced, it is important to correctly assemble these to estimate the sequence of all the transcripts. Most transcriptome assembly projects use only one program for assembling 454 pyrosequencing reads, but there is no evidence that the programs used to date are optimal. We have carried out a systematic comparison of five assemblers (CAP3, MIRA, Newbler, SeqMan and CLC) to establish best practices for transcriptome assemblies, using a new dataset from the parasitic nematode Litomosoides sigmodontis. Results Although no single assembler performed best on all our criteria, Newbler 2.5 gave longer contigs, better alignments to some reference sequences, and was fast and easy to use. SeqMan assemblies performed best on the criterion of recapitulating known transcripts, and had more novel sequence than the other assemblers, but generated an excess of small, redundant contigs. The remaining assemblers all performed almost as well, with the exception of Newbler 2.3 (the version currently used by most assembly projects), which generated assemblies that had significantly lower total length. As different assemblers use different underlying algorithms to generate contigs, we also explored merging of assemblies and found that the merged datasets not only aligned better to reference sequences than individual assemblies, but were also more consistent in the number and size of contigs. Conclusions Transcriptome assemblies are smaller than genome assemblies and thus should be more computationally tractable, but are often harder because individual contigs can have highly variable read coverage. Comparing single assemblers, Newbler 2.5 performed best on our trial data set, but other assemblers were closely comparable. Combining differently optimal assemblies from different programs

Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures.

PubMed

Pride, David T; Schoenfeld, Thomas

2008-09-17

Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs

Embryonic Mutant Huntingtin Aggregate Formation in Mouse Models of Huntington's Disease.

PubMed

Osmand, Alexander P; Bichell, Terry Jo; Bowman, Aaron B; Bates, Gillian P

2016-12-15

The role of aggregate formation in the pathophysiology of Huntington's disease (HD) remains uncertain. However, the temporal appearance of aggregates tends to correlate with the onset of symptoms and the numbers of neuropil aggregates correlate with the progression of clinical disease. Using highly sensitive immunohistochemical methods we have detected the appearance of diffuse aggregates during embryonic development in the R6/2 and YAC128 mouse models of HD. These are initially seen in developing axonal tracts and appear to spread throughout the cerebrum in the early neonate.

Elicitation of anti-viral cytotoxic T lymphocytes with purified viral and H-2 antigens.

PubMed

Hale, A H; Ruebush, M J; Harris, D T

1980-07-01

The minimal molecular requirements for elicitation of secondary anti-Sendai virus CTL were investigated. The hemagglutinin-neuraminidase (HN) glycoprotein of Sendai virus and the H-2Kk glycoprotein of YAC tumor cells were purified and incorporated into phospholipid vesicles. These unilamellar liposomes were then tested for the ability to elicit H-2 restricted secondary anti-Sendai virus CTL. The results indicate that these well-defined vesicles were capable of eliciting secondary anti-Sendai virus CTL which lysed only target cells possessing the H-2Kk haplotype and modified with inactivated Sendai virus.

Meraculous: De Novo Genome Assembly with Short Paired-End Reads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chapman, Jarrod A.; Ho, Isaac; Sunkara, Sirisha

2011-08-18

We describe a new algorithm, meraculous, for whole genome assembly of deep paired-end short reads, and apply it to the assembly of a dataset of paired 75-bp Illumina reads derived from the 15.4 megabase genome of the haploid yeast Pichia stipitis. More than 95% of the genome is recovered, with no errors; half the assembled sequence is in contigs longer than 101 kilobases and in scaffolds longer than 269 kilobases. Incorporating fosmid ends recovers entire chromosomes. Meraculous relies on an efficient and conservative traversal of the subgraph of the k-mer (deBruijn) graph of oligonucleotides with unique high quality extensions inmore » the dataset, avoiding an explicit error correction step as used in other short-read assemblers. A novel memory-efficient hashing scheme is introduced. The resulting contigs are ordered and oriented using paired reads separated by ~280 bp or ~3.2 kbp, and many gaps between contigs can be closed using paired-end placements. Practical issues with the dataset are described, and prospects for assembling larger genomes are discussed.« less

The reconstruction of 2,631 draft metagenome-assembled genomes from the global oceans.

PubMed

Tully, Benjamin J; Graham, Elaina D; Heidelberg, John F

2018-01-16

Microorganisms play a crucial role in mediating global biogeochemical cycles in the marine environment. By reconstructing the genomes of environmental organisms through metagenomics, researchers are able to study the metabolic potential of Bacteria and Archaea that are resistant to isolation in the laboratory. Utilizing the large metagenomic dataset generated from 234 samples collected during the Tara Oceans circumnavigation expedition, we were able to assemble 102 billion paired-end reads into 562 million contigs, which in turn were co-assembled and consolidated in to 7.2 million contigs ≥2 kb in length. Approximately 1 million of these contigs were binned to reconstruct draft genomes. In total, 2,631 draft genomes with an estimated completion of ≥50% were generated (1,491 draft genomes >70% complete; 603 genomes >90% complete). A majority of the draft genomes were manually assigned phylogeny based on sets of concatenated phylogenetic marker genes and/or 16S rRNA gene sequences. The draft genomes are now publically available for the research community at-large.

The reconstruction of 2,631 draft metagenome-assembled genomes from the global oceans

PubMed Central

Tully, Benjamin J.; Graham, Elaina D.; Heidelberg, John F.

2018-01-01

Microorganisms play a crucial role in mediating global biogeochemical cycles in the marine environment. By reconstructing the genomes of environmental organisms through metagenomics, researchers are able to study the metabolic potential of Bacteria and Archaea that are resistant to isolation in the laboratory. Utilizing the large metagenomic dataset generated from 234 samples collected during the Tara Oceans circumnavigation expedition, we were able to assemble 102 billion paired-end reads into 562 million contigs, which in turn were co-assembled and consolidated in to 7.2 million contigs ≥2 kb in length. Approximately 1 million of these contigs were binned to reconstruct draft genomes. In total, 2,631 draft genomes with an estimated completion of ≥50% were generated (1,491 draft genomes >70% complete; 603 genomes >90% complete). A majority of the draft genomes were manually assigned phylogeny based on sets of concatenated phylogenetic marker genes and/or 16S rRNA gene sequences. The draft genomes are now publically available for the research community at-large. PMID:29337314

Pyrosequencing the Midgut Transcriptome of the Banana Weevil Cosmopolites sordidus (Germar) (Coleoptera: Curculionidae) Reveals Multiple Protease-Like Transcripts.

PubMed

Valencia, Arnubio; Wang, Haichuan; Soto, Alberto; Aristizabal, Manuel; Arboleda, Jorge W; Eyun, Seong-Il; Noriega, Daniel D; Siegfried, Blair

2016-01-01

The banana weevil Cosmopolites sordidus is an important and serious insect pest in most banana and plantain-growing areas of the world. In spite of the economic importance of this insect pest very little genomic and transcriptomic information exists for this species. In the present study, we characterized the midgut transcriptome of C. sordidus using massive 454-pyrosequencing. We generated over 590,000 sequencing reads that assembled into 30,840 contigs with more than 400 bp, representing a significant expansion of existing sequences available for this insect pest. Among them, 16,427 contigs contained one or more GO terms. In addition, 15,263 contigs were assigned an EC number. In-depth transcriptome analysis identified genes potentially involved in insecticide resistance, peritrophic membrane biosynthesis, immunity-related function and defense against pathogens, and Bacillus thuringiensis toxins binding proteins as well as multiple enzymes involved with protein digestion. This transcriptome will provide a valuable resource for understanding larval physiology and for identifying novel target sites and management approaches for this important insect pest.

Pyrosequencing the Midgut Transcriptome of the Banana Weevil Cosmopolites sordidus (Germar) (Coleoptera: Curculionidae) Reveals Multiple Protease-Like Transcripts

PubMed Central

Valencia, Arnubio; Wang, Haichuan; Soto, Alberto; Aristizabal, Manuel; Arboleda, Jorge W.; Eyun, Seong-il; Noriega, Daniel D.; Siegfried, Blair

2016-01-01

The banana weevil Cosmopolites sordidus is an important and serious insect pest in most banana and plantain-growing areas of the world. In spite of the economic importance of this insect pest very little genomic and transcriptomic information exists for this species. In the present study, we characterized the midgut transcriptome of C. sordidus using massive 454-pyrosequencing. We generated over 590,000 sequencing reads that assembled into 30,840 contigs with more than 400 bp, representing a significant expansion of existing sequences available for this insect pest. Among them, 16,427 contigs contained one or more GO terms. In addition, 15,263 contigs were assigned an EC number. In-depth transcriptome analysis identified genes potentially involved in insecticide resistance, peritrophic membrane biosynthesis, immunity-related function and defense against pathogens, and Bacillus thuringiensis toxins binding proteins as well as multiple enzymes involved with protein digestion. This transcriptome will provide a valuable resource for understanding larval physiology and for identifying novel target sites and management approaches for this important insect pest. PMID:26949943

KENNEDY SPACE CENTER, FLA. - Two manatees surface for air in water on KSC. Manatees live in Florida's warm water rivers and inland springs. KSC shares a boundary with the Merritt Island National Wildlife Refuge, which encompasses 92,000 acres that are a habitat for more than 331 species of birds, 31 mammals, 117 fishes, and 65 amphibians and reptiles.

NASA Image and Video Library

2003-08-15

KENNEDY SPACE CENTER, FLA. - Two manatees surface for air in water on KSC. Manatees live in Florida's warm water rivers and inland springs. KSC shares a boundary with the Merritt Island National Wildlife Refuge, which encompasses 92,000 acres that are a habitat for more than 331 species of birds, 31 mammals, 117 fishes, and 65 amphibians and reptiles.

Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

PubMed

Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

2016-03-01

Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Generation of expressed sequence tags for discovery of genes responsible for floral traits of Chrysanthemum morifolium by next-generation sequencing technology.

PubMed

Sasaki, Katsutomo; Mitsuda, Nobutaka; Nashima, Kenji; Kishimoto, Kyutaro; Katayose, Yuichi; Kanamori, Hiroyuki; Ohmiya, Akemi

2017-09-04

Chrysanthemum morifolium is one of the most economically valuable ornamental plants worldwide. Chrysanthemum is an allohexaploid plant with a large genome that is commercially propagated by vegetative reproduction. New cultivars with different floral traits, such as color, morphology, and scent, have been generated mainly by classical cross-breeding and mutation breeding. However, only limited genetic resources and their genome information are available for the generation of new floral traits. To obtain useful information about molecular bases for floral traits of chrysanthemums, we read expressed sequence tags (ESTs) of chrysanthemums by high-throughput sequencing using the 454 pyrosequencing technology. We constructed normalized cDNA libraries, consisting of full-length, 3'-UTR, and 5'-UTR cDNAs derived from various tissues of chrysanthemums. These libraries produced a total number of 3,772,677 high-quality reads, which were assembled into 213,204 contigs. By comparing the data obtained with those of full genome-sequenced species, we confirmed that our chrysanthemum contig set contained the majority of all expressed genes, which was sufficient for further molecular analysis in chrysanthemums. We confirmed that our chrysanthemum EST set (contigs) contained a number of contigs that encoded transcription factors and enzymes involved in pigment and aroma compound metabolism that was comparable to that of other species. This information can serve as an informative resource for identifying genes involved in various biological processes in chrysanthemums. Moreover, the findings of our study will contribute to a better understanding of the floral characteristics of chrysanthemums including the myriad cultivars at the molecular level.

Enhancing genome assemblies by integrating non-sequence based data

PubMed Central

2011-01-01

Introduction Many genome projects were underway before the advent of high-throughput sequencing and have thus been supported by a wealth of genome information from other technologies. Such information frequently takes the form of linkage and physical maps, both of which can provide a substantial amount of data useful in de novo sequencing projects. Furthermore, the recent abundance of genome resources enables the use of conserved synteny maps identified in related species to further enhance genome assemblies. Methods The tammar wallaby (Macropus eugenii) is a model marsupial mammal with a low coverage genome. However, we have access to extensive comparative maps containing over 14,000 markers constructed through the physical mapping of conserved loci, chromosome painting and comprehensive linkage maps. Using a custom Bioperl pipeline, information from the maps was aligned to assembled tammar wallaby contigs using BLAT. This data was used to construct pseudo paired-end libraries with intervals ranging from 5-10 MB. We then used Bambus (a program designed to scaffold eukaryotic genomes by ordering and orienting contigs through the use of paired-end data) to scaffold our libraries. To determine how map data compares to sequence based approaches to enhance assemblies, we repeated the experiment using a 0.5× coverage of unique reads from 4 KB and 8 KB Illumina paired-end libraries. Finally, we combined both the sequence and non-sequence-based data to determine how a combined approach could further enhance the quality of the low coverage de novo reconstruction of the tammar wallaby genome. Results Using the map data alone, we were able order 2.2% of the initial contigs into scaffolds, and increase the N50 scaffold size to 39 KB (36 KB in the original assembly). Using only the 0.5× paired-end sequence based data, 53% of the initial contigs were assigned to scaffolds. Combining both data sets resulted in a further 2% increase in the number of initial contigs integrated

Enhancing genome assemblies by integrating non-sequence based data.

PubMed

Heider, Thomas N; Lindsay, James; Wang, Chenwei; O'Neill, Rachel J; Pask, Andrew J

2011-05-28

Many genome projects were underway before the advent of high-throughput sequencing and have thus been supported by a wealth of genome information from other technologies. Such information frequently takes the form of linkage and physical maps, both of which can provide a substantial amount of data useful in de novo sequencing projects. Furthermore, the recent abundance of genome resources enables the use of conserved synteny maps identified in related species to further enhance genome assemblies. The tammar wallaby (Macropus eugenii) is a model marsupial mammal with a low coverage genome. However, we have access to extensive comparative maps containing over 14,000 markers constructed through the physical mapping of conserved loci, chromosome painting and comprehensive linkage maps. Using a custom Bioperl pipeline, information from the maps was aligned to assembled tammar wallaby contigs using BLAT. This data was used to construct pseudo paired-end libraries with intervals ranging from 5-10 MB. We then used Bambus (a program designed to scaffold eukaryotic genomes by ordering and orienting contigs through the use of paired-end data) to scaffold our libraries. To determine how map data compares to sequence based approaches to enhance assemblies, we repeated the experiment using a 0.5× coverage of unique reads from 4 KB and 8 KB Illumina paired-end libraries. Finally, we combined both the sequence and non-sequence-based data to determine how a combined approach could further enhance the quality of the low coverage de novo reconstruction of the tammar wallaby genome. Using the map data alone, we were able order 2.2% of the initial contigs into scaffolds, and increase the N50 scaffold size to 39 KB (36 KB in the original assembly). Using only the 0.5× paired-end sequence based data, 53% of the initial contigs were assigned to scaffolds. Combining both data sets resulted in a further 2% increase in the number of initial contigs integrated into a scaffold (55% total

Modeling dynamics for oncogenesis encompassing mutations and genetic instability.

PubMed

Fassoni, Artur C; Yang, Hyun M

2018-06-27

Tumorigenesis has been described as a multistep process, where each step is associated with a genetic alteration, in the direction to progressively transform a normal cell and its descendants into a malignant tumour. Into this work, we propose a mathematical model for cancer onset and development, considering three populations: normal, premalignant and cancer cells. The model takes into account three hallmarks of cancer: self-sufficiency on growth signals, insensibility to anti-growth signals and evading apoptosis. By using a nonlinear expression to describe the mutation from premalignant to cancer cells, the model includes genetic instability as an enabling characteristic of tumour progression. Mathematical analysis was performed in detail. Results indicate that apoptosis and tissue repair system are the first barriers against tumour progression. One of these mechanisms must be corrupted for cancer to develop from a single mutant cell. The results also show that the presence of aggressive cancer cells opens way to survival of less adapted premalignant cells. Numerical simulations were performed with parameter values based on experimental data of breast cancer, and the necessary time taken for cancer to reach a detectable size from a single mutant cell was estimated with respect to some parameters. We find that the rates of apoptosis and mutations have a large influence on the pace of tumour progression and on the time it takes to become clinically detectable.

Encompassing multiple moral paradigms: a challenge for nursing educators.

PubMed

Caldwell, Elizabeth Shirin; Lu, Hongyan; Harding, Thomas

2010-03-01

Providing ethically competent care requires nurses to reflect not only on nursing ethics, but also on their own ethical traditions. New challenges for nurse educators over the last decade have been the increasing globalization of the nursing workforce and the internationalization of nursing education. In New Zealand, there has been a large increase in numbers of Chinese students, both international and immigrant, already acculturated with ethical and cultural values derived from Chinese Confucian moral traditions. Recently, several incidents involving Chinese nursing students in morally conflicting situations have led to one nursing faculty reflecting upon how moral philosophy is taught to non-European students and the support given to Chinese students in integrating the taught curriculum into real-life clinical practice settings. This article uses a case study involving a Chinese student to reflect on the challenges for both faculty members and students when encountering situations that present ethical dilemmas.

Argentina to Ecuador: Highlights encompassing exploration, development, and infrastructure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aufranc, J.L.

1997-04-01

In recent years mining has expanded significantly in Argentina due to many developments, which include elimination, or reduction to reasonable levels, of a very high level of economic instability. It was a situation that lasted for many decades and that made it very difficult to plan or calculate taxes during the term of a project. Nevertheless, a very important legal security for property rights-which included mining-existed, together with the absence of expropriations. The world and regional conditions with respect to the globalization of activities changed in many ways: the international trade accords such as Mercosur, communications, transportation, the easy accessmore » to information through data processing, satellites, etc. Nationalism and the monopolistic statism-with an emotional rejection to foreign capital-have almost disappeared, especially in Argentina. It should be mentioned that the main state companies, i.e. oil, gas, airlines, coal, maritime companies, water, electricity, steel, etc., had the national colors in their logos. In this circumstance, the European concept was followed, without its efficiency and administrative culture. Now, irreversibly, the state manager disappears, and the economy opens-together with the free flow of capital to enter and leave. Convertibility and the set of rules related to mining created a framework necessary for the mining sector`s awakening and the beginning of development of important projects such as Bajo de la Alumbrera and Salar del Hombre Muerto.« less

Physical Mapping in a Triplicated Genome: Mapping the Downy Mildew Resistance Locus Pp523 in Brassica oleracea L.

PubMed Central

Carlier, Jorge D.; Alabaça, Claudia S.; Sousa, Nelson H.; Coelho, Paula S.; Monteiro, António A.; Paterson, Andrew H.; Leitão, José M.

2011-01-01

We describe the construction of a BAC contig and identification of a minimal tiling path that encompass the dominant and monogenically inherited downy mildew resistance locus Pp523 of Brassica oleracea L. The selection of BAC clones for construction of the physical map was carried out by screening gridded BAC libraries with DNA overgo probes derived from both genetically mapped DNA markers flanking the locus of interest and BAC-end sequences that align to Arabidopsis thaliana sequences within the previously identified syntenic region. The selected BAC clones consistently mapped to three different genomic regions of B. oleracea. Although 83 BAC clones were accurately mapped within a ∼4.6 cM region surrounding the downy mildew resistance locus Pp523, a subset of 33 BAC clones mapped to another region on chromosome C8 that was ∼60 cM away from the resistance gene, and a subset of 63 BAC clones mapped to chromosome C5. These results reflect the triplication of the Brassica genomes since their divergence from a common ancestor shared with A. thaliana, and they are consonant with recent analyses of the C genome of Brassica napus. The assembly of a minimal tiling path constituted by 13 (BoT01) BAC clones that span the Pp523 locus sets the stage for map-based cloning of this resistance gene. PMID:22384370

RNAi-Based GluN3A Silencing Prevents and Reverses Disease Phenotypes Induced by Mutant huntingtin.

PubMed

Marco, Sonia; Murillo, Alvaro; Pérez-Otaño, Isabel

2018-06-15

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by expansion of a polyglutamine tract in the huntingtin protein. HD symptoms include severe motor, cognitive, and psychiatric impairments that result from dysfunction and later degeneration of medium-sized spiny neurons (MSNs) in the striatum. A key early pathogenic mechanism is dysregulated synaptic transmission due to enhanced surface expression of juvenile NMDA-type glutamate receptors containing GluN3A subunits, which trigger the aberrant pruning of synapses formed by cortical afferents onto MSNs. Here, we tested the therapeutic potential of silencing GluN3A expression in YAC128 mice, a well-established HD model. Recombinant adeno-associated viruses encoding a short-hairpin RNA against GluN3A (rAAV-shGluN3A) were generated, and the ability of different serotypes to transduce MSNs was compared. A single injection of rAAV9-shGluN3A into the striatum of 1-month-old mice drove potent (>90%) and long-lasting reductions of GluN3A expression in MSNs, prevented dendritic spine loss and improved motor performance in YAC128 mice. Later delivery, when spine pathology is already apparent, was also effective. Our data provide proof-of-concept for GluN3A silencing as a beneficial strategy to prevent or reverse corticostriatal disconnectivity and motor impairment in HD and support the use of RNAi-based or small-molecule approaches for harnessing this therapeutic potential. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Comparison of mHTT Antibodies in Huntington’s Disease Mouse Models Reveal Specific Binding Profiles and Steady-State Ubiquitin Levels with Disease Development

PubMed Central

Bayram-Weston, Zubeyde; Jones, Lesley; Dunnett, Stephen B.; Brooks, Simon P.

2016-01-01

Huntington’s disease (HD) cellular pathology is characterised by the aggregation of mutant huntingtin (mHTT) protein into inclusion bodies. The present paper compared the sensitivity of five widely used mHTT antibodies (S830; MW8; EM48; 1C2; ubiquitin) against mice from five commonly used HD mouse models (R6/1; YAC128; HdhQ92; B6 HdhQ150; B6 x129/Ola HdhQ150) at two ages to determine: the most sensitive antibodies for each model; whether mHTT antibody binding differed depending on aggregation stage (diffuse versus frank inclusion); the role of ubiquitin during aggregation as the ubiquitin proteosome system has been implicated in disease development. The models demonstrated unique profiles of antibody binding even when the models varied only by background strain (HdhQ150). MW8 was highly sensitive for detecting frank inclusions in all lines whereas EM48, ubiquitin and 1C2 demonstrated consistent staining in all models irrespective of age or form of mHTT. MW8 and S830 were the most sensitive antibodies with 1C2 the least. Ubiquitin levels were stable for each model regardless of age. Ubiquitin was particularly sensitive in young YAC128 mice that demonstrate an absence of inclusions until ~12 months of age suggesting high affinity to mHTT in its diffuse form. The data indicate that generalisations across models regarding the quantification of aggregations may not be valid and that mHTT antibody binding is unique to the mouse model and sensitive to changes in inclusion development. PMID:27196694

Huntington disease iPSCs show early molecular changes in intracellular signaling, the expression of oxidative stress proteins and the p53 pathway

PubMed Central

Szlachcic, Wojciech J.; Switonski, Pawel M.; Krzyzosiak, Wlodzimierz J.; Figlerowicz, Marek; Figiel, Maciej

2015-01-01

ABSTRACT Huntington disease (HD) is a brain disorder characterized by the late onset of motor and cognitive symptoms, even though the neurons in the brain begin to suffer dysfunction and degeneration long before symptoms appear. There is currently no cure. Several molecular and developmental effects of HD have been identified using neural stem cells (NSCs) and differentiated cells, such as neurons and astrocytes. Still, little is known regarding the molecular pathogenesis of HD in pluripotent cells, such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Therefore, we examined putative signaling pathways and processes involved in HD pathogenesis in pluripotent cells. We tested naïve mouse HD YAC128 iPSCs and two types of human HD iPSC that were generated from HD and juvenile-HD patients. Surprisingly, we found that a number of changes affecting cellular processes in HD were also present in undifferentiated pluripotent HD iPSCs, including the dysregulation of the MAPK and Wnt signaling pathways and the dysregulation of the expression of genes related to oxidative stress, such as Sod1. Interestingly, a common protein interactor of the huntingtin protein and the proteins in the above pathways is p53, and the expression of p53 was dysregulated in HD YAC128 iPSCs and human HD iPSCs. In summary, our findings demonstrate that multiple molecular pathways that are characteristically dysregulated in HD are already altered in undifferentiated pluripotent cells and that the pathogenesis of HD might begin during the early stages of life. PMID:26092128

SOPRA: Scaffolding algorithm for paired reads via statistical optimization.

PubMed

Dayarian, Adel; Michael, Todd P; Sengupta, Anirvan M

2010-06-24

High throughput sequencing (HTS) platforms produce gigabases of short read (<100 bp) data per run. While these short reads are adequate for resequencing applications, de novo assembly of moderate size genomes from such reads remains a significant challenge. These limitations could be partially overcome by utilizing mate pair technology, which provides pairs of short reads separated by a known distance along the genome. We have developed SOPRA, a tool designed to exploit the mate pair/paired-end information for assembly of short reads. The main focus of the algorithm is selecting a sufficiently large subset of simultaneously satisfiable mate pair constraints to achieve a balance between the size and the quality of the output scaffolds. Scaffold assembly is presented as an optimization problem for variables associated with vertices and with edges of the contig connectivity graph. Vertices of this graph are individual contigs with edges drawn between contigs connected by mate pairs. Similar graph problems have been invoked in the context of shotgun sequencing and scaffold building for previous generation of sequencing projects. However, given the error-prone nature of HTS data and the fundamental limitations from the shortness of the reads, the ad hoc greedy algorithms used in the earlier studies are likely to lead to poor quality results in the current context. SOPRA circumvents this problem by treating all the constraints on equal footing for solving the optimization problem, the solution itself indicating the problematic constraints (chimeric/repetitive contigs, etc.) to be removed. The process of solving and removing of constraints is iterated till one reaches a core set of consistent constraints. For SOLiD sequencer data, SOPRA uses a dynamic programming approach to robustly translate the color-space assembly to base-space. For assessing the quality of an assembly, we report the no-match/mismatch error rate as well as the rates of various rearrangement errors

Novel genomic resources for a climate change sensitive mammal: characterization of the American pika transcriptome.

PubMed

Lemay, Matthew A; Henry, Philippe; Lamb, Clayton T; Robson, Kelsey M; Russello, Michael A

2013-05-10

When faced with climate change, species must either shift their home range or adapt in situ in order to maintain optimal physiological balance with their environment. The American pika (Ochotona princeps) is a small alpine mammal with limited dispersal capacity and low tolerance for thermal stress. As a result, pikas have become an important system for examining biotic responses to changing climatic conditions. Previous research using amplified fragment length polymorphisms (AFLPs) has revealed evidence for environmental-mediated selection in O. princeps populations distributed along elevation gradients, yet the anonymity of AFLP loci and lack of available genomic resources precluded the identification of associated gene regions. Here, we harnessed next-generation sequencing technology in order to characterize the American pika transcriptome and identify a large suite of single nucleotide polymorphisms (SNPs), which can be used to elucidate elevation- and site-specific patterns of sequence variation. We constructed pooled cDNA libraries of O. princeps from high (1400 m) and low (300 m) elevation sites along a previously established transect in British Columbia. Transcriptome sequencing using the Roche 454 GS FLX titanium platform generated 780 million base pairs of data, which were assembled into 7,325 high coverage contigs. These contigs were used to identify 24,261 novel SNP loci. Using high resolution melt analysis, we developed 17 of these SNPs into genotyping assays, which were validated with independent DNA samples from British Columbia Canada and Oregon State USA. In addition, we detected haplotypes in the NADH dehydrogenase subunit 5 of the mitochondrial genome that were fixed and different among elevations, suggesting that this may be an informative target gene for studying the role of cellular respiration in local adaptation. We also identified contigs that were unique to each elevation, including a high elevation-specific contig that was a positive match

Viral Predation and Host Immunity Structure Microbial Communities in a Terrestrial Deep Subsurface, Hydraulically Fractured Shale System

NASA Astrophysics Data System (ADS)

Daly, R. A.; Mouser, P. J.; Trexler, R.; Wrighton, K. C.

2014-12-01

Despite a growing appreciation for the ecological role of viruses in marine and gut systems, little is known about their role in the terrestrial deep (> 2000 m) subsurface. We used assembly-based metagenomics to examine the viral component in fluids from hydraulically fractured Marcellus shale gas wells. Here we reconstructed microbial and viral genomes from samples collected 7, 82, and 328 days post fracturing. Viruses accounted for 4.14%, 0.92% and 0.59% of the sample reads that mapped to the assembly. We identified 6 complete, circularized viral genomes and an additional 92 viral contigs > 5 kb with a maximum contig size of 73.6 kb. A BLAST comparison to NCBI viral genomes revealed that 85% of viral contigs had significant hits to the viral order Caudovirales, with 43% of sequences belonging to the family Siphoviridae, 38% to Myoviridae, and 12% to Podoviridae. Enrichment of Caudovirales viruses was supported by a large number of predicted proteins characteristic of tailed viruses including terminases (TerL), tape measure, tail formation, and baseplate related proteins. The viral contigs included evidence of lytic and temperate lifestyles, with the 7 day sample having the greatest number of detected lytic viruses. Notably in this sample, the most abundant virus was lytic and its inferred host, a member of the Vibrionaceae, was not detected at later time points. Analyses of CRISPR sequences (a viral and foreign DNA immune system in bacteria and archaea), linked 18 viral contigs to hosts. CRISPR linkages increased through time and all bacterial and archaeal genomes recovered in the final time point had genes for CRISPR-mediated viral defense. The majority of CRISPR sequences linked phage genomes to several Halanaerobium strains, which are the dominant and persisting members of the community inferred to be responsible for carbon and sulfur cycling in these shales. Network analysis revealed that several viruses were present in the 82 and 328 day samples; this viral

Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures

PubMed Central

Pride, David T; Schoenfeld, Thomas

2008-01-01

Background Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. Results From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw

A Single Molecule Scaffold for the Maize Genome

PubMed Central

Zhou, Shiguo; Wei, Fusheng; Nguyen, John; Bechner, Mike; Potamousis, Konstantinos; Goldstein, Steve; Pape, Louise; Mehan, Michael R.; Churas, Chris; Pasternak, Shiran; Forrest, Dan K.; Wise, Roger; Ware, Doreen; Wing, Rod A.; Waterman, Michael S.; Livny, Miron; Schwartz, David C.

2009-01-01

About 85% of the maize genome consists of highly repetitive sequences that are interspersed by low-copy, gene-coding sequences. The maize community has dealt with this genomic complexity by the construction of an integrated genetic and physical map (iMap), but this resource alone was not sufficient for ensuring the quality of the current sequence build. For this purpose, we constructed a genome-wide, high-resolution optical map of the maize inbred line B73 genome containing >91,000 restriction sites (averaging 1 site/∼23 kb) accrued from mapping genomic DNA molecules. Our optical map comprises 66 contigs, averaging 31.88 Mb in size and spanning 91.5% (2,103.93 Mb/∼2,300 Mb) of the maize genome. A new algorithm was created that considered both optical map and unfinished BAC sequence data for placing 60/66 (2,032.42 Mb) optical map contigs onto the maize iMap. The alignment of optical maps against numerous data sources yielded comprehensive results that proved revealing and productive. For example, gaps were uncovered and characterized within the iMap, the FPC (fingerprinted contigs) map, and the chromosome-wide pseudomolecules. Such alignments also suggested amended placements of FPC contigs on the maize genetic map and proactively guided the assembly of chromosome-wide pseudomolecules, especially within complex genomic regions. Lastly, we think that the full integration of B73 optical maps with the maize iMap would greatly facilitate maize sequence finishing efforts that would make it a valuable reference for comparative studies among cereals, or other maize inbred lines and cultivars. PMID:19936062

Improvement of the Threespine Stickleback Genome Using a Hi-C-Based Proximity-Guided Assembly.

PubMed

Peichel, Catherine L; Sullivan, Shawn T; Liachko, Ivan; White, Michael A

2017-09-01

Scaffolding genomes into complete chromosome assemblies remains challenging even with the rapidly increasing sequence coverage generated by current next-generation sequence technologies. Even with scaffolding information, many genome assemblies remain incomplete. The genome of the threespine stickleback (Gasterosteus aculeatus), a fish model system in evolutionary genetics and genomics, is not completely assembled despite scaffolding with high-density linkage maps. Here, we first test the ability of a Hi-C based proximity-guided assembly (PGA) to perform a de novo genome assembly from relatively short contigs. Using Hi-C based PGA, we generated complete chromosome assemblies from a distribution of short contigs (20-100 kb). We found that 96.40% of contigs were correctly assigned to linkage groups (LGs), with ordering nearly identical to the previous genome assembly. Using available bacterial artificial chromosome (BAC) end sequences, we provide evidence that some of the few discrepancies between the Hi-C assembly and the existing assembly are due to structural variation between the populations used for the 2 assemblies or errors in the existing assembly. This Hi-C assembly also allowed us to improve the existing assembly, assigning over 60% (13.35 Mb) of the previously unassigned (~21.7 Mb) contigs to LGs. Together, our results highlight the potential of the Hi-C based PGA method to be used in combination with short read data to perform relatively inexpensive de novo genome assemblies. This approach will be particularly useful in organisms in which it is difficult to perform linkage mapping or to obtain high molecular weight DNA required for other scaffolding methods. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparative Genome Sequence Analysis of the Bpa/Str Region in Mouse and Man

PubMed Central

Mallon, A.-M.; Platzer, M.; Bate, R.; Gloeckner, G.; Botcherby, M.R.M.; Nordsiek, G.; Strivens, M.A.; Kioschis, P.; Dangel, A.; Cunningham, D.; Straw, R.N.A.; Weston, P.; Gilbert, M.; Fernando, S.; Goodall, K.; Hunter, G.; Greystrong, J.S.; Clarke, D.; Kimberley, C.; Goerdes, M.; Blechschmidt, K.; Rump, A.; Hinzmann, B.; Mundy, C.R.; Miller, W.; Poustka, A.; Herman, G.E.; Rhodes, M.; Denny, P.; Rosenthal, A.; Brown, S.D.M.

2000-01-01

The progress of human and mouse genome sequencing programs presages the possibility of systematic cross-species comparison of the two genomes as a powerful tool for gene and regulatory element identification. As the opportunities to perform comparative sequence analysis emerge, it is important to develop parameters for such analyses and to examine the outcomes of cross-species comparison. Our analysis used gene prediction and a database search of 430 kb of genomic sequence covering the Bpa/Str region of the mouse X chromosome, and 745 kb of genomic sequence from the homologous human X chromosome region. We identified 11 genes in mouse and 13 genes and two pseudogenes in human. In addition, we compared the mouse and human sequences using pairwise alignment and searches for evolutionary conserved regions (ECRs) exceeding a defined threshold of sequence identity. This approach aided the identification of at least four further putative conserved genes in the region. Comparative sequencing revealed that this region is a mosaic in evolutionary terms, with considerably more rearrangement between the two species than realized previously from comparative mapping studies. Surprisingly, this region showed an extremely high LINE and low SINE content, low G+C content, and yet a relatively high gene density, in contrast to the low gene density usually associated with such regions. [The sequence data described in this paper have been submitted to EMBL under the following accession nos.: Mouse Genomic Sequence: Mouse contig A (AL021127), Mouse contig B (AL049866), BAC41M10 (AL136328), PAC303O11(AL136329). Human Genomic Sequence: Human contig 1 (U82671, U82670), Human contig 2 (U82695).] PMID:10854409

Developing the anemone Aiptasia as a tractable model for cnidarian-dinoflagellate symbiosis: the transcriptome of aposymbiotic A. pallida.

PubMed

Lehnert, Erik M; Burriesci, Matthew S; Pringle, John R

2012-06-22

Coral reefs are hotspots of oceanic biodiversity, forming the foundation of ecosystems that are important both ecologically and for their direct practical impacts on humans. Corals are declining globally due to a number of stressors, including rising sea-surface temperatures and pollution; such stresses can lead to a breakdown of the essential symbiotic relationship between the coral host and its endosymbiotic dinoflagellates, a process known as coral bleaching. Although the environmental stresses causing this breakdown are largely known, the cellular mechanisms of symbiosis establishment, maintenance, and breakdown are still largely obscure. Investigating the symbiosis using an experimentally tractable model organism, such as the small sea anemone Aiptasia, should improve our understanding of exactly how the environmental stressors affect coral survival and growth. We assembled the transcriptome of a clonal population of adult, aposymbiotic (dinoflagellate-free) Aiptasia pallida from ~208 million reads, yielding 58,018 contigs. We demonstrated that many of these contigs represent full-length or near-full-length transcripts that encode proteins similar to those from a diverse array of pathways in other organisms, including various metabolic enzymes, cytoskeletal proteins, and neuropeptide precursors. The contigs were annotated by sequence similarity, assigned GO terms, and scanned for conserved protein domains. We analyzed the frequency and types of single-nucleotide variants and estimated the size of the Aiptasia genome to be ~421 Mb. The contigs and annotations are available through NCBI (Transcription Shotgun Assembly database, accession numbers JV077153-JV134524) and at http://pringlelab.stanford.edu/projects.html. The availability of an extensive transcriptome assembly for A. pallida will facilitate analyses of gene-expression changes, identification of proteins of interest, and other studies in this important emerging model system.

Integrated physical map of bread wheat chromosome arm 7DS to facilitate gene cloning and comparative studies.

PubMed

Tulpová, Zuzana; Luo, Ming-Cheng; Toegelová, Helena; Visendi, Paul; Hayashi, Satomi; Vojta, Petr; Paux, Etienne; Kilian, Andrzej; Abrouk, Michaël; Bartoš, Jan; Hajdúch, Marián; Batley, Jacqueline; Edwards, David; Doležel, Jaroslav; Šimková, Hana

2018-03-08

Bread wheat (Triticum aestivum L.) is a staple food for a significant part of the world's population. The growing demand on its production can be satisfied by improving yield and resistance to biotic and abiotic stress. Knowledge of the genome sequence would aid in discovering genes and QTLs underlying these traits and provide a basis for genomics-assisted breeding. Physical maps and BAC clones associated with them have been valuable resources from which to generate a reference genome of bread wheat and to assist map-based gene cloning. As a part of a joint effort coordinated by the International Wheat Genome Sequencing Consortium, we have constructed a BAC-based physical map of bread wheat chromosome arm 7DS consisting of 895 contigs and covering 94% of its estimated length. By anchoring BAC contigs to one radiation hybrid map and three high resolution genetic maps, we assigned 73% of the assembly to a distinct genomic position. This map integration, interconnecting a total of 1713 markers with ordered and sequenced BAC clones from a minimal tiling path, provides a tool to speed up gene cloning in wheat. The process of physical map assembly included the integration of the 7DS physical map with a whole-genome physical map of Aegilops tauschii and a 7DS Bionano genome map, which together enabled efficient scaffolding of physical-map contigs, even in the non-recombining region of the genetic centromere. Moreover, this approach facilitated a comparison of bread wheat and its ancestor at BAC-contig level and revealed a reconstructed region in the 7DS pericentromere. Copyright © 2018. Published by Elsevier B.V.

Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio)

PubMed Central

2012-01-01

Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

MagnaportheDB: a federated solution for integrating physical and genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea.

PubMed

Martin, Stanton L; Blackmon, Barbara P; Rajagopalan, Ravi; Houfek, Thomas D; Sceeles, Robert G; Denn, Sheila O; Mitchell, Thomas K; Brown, Douglas E; Wing, Rod A; Dean, Ralph A

2002-01-01

We have created a federated database for genome studies of Magnaporthe grisea, the causal agent of rice blast disease, by integrating end sequence data from BAC clones, genetic marker data and BAC contig assembly data. A library of 9216 BAC clones providing >25-fold coverage of the entire genome was end sequenced and fingerprinted by HindIII digestion. The Image/FPC software package was then used to generate an assembly of 188 contigs covering >95% of the genome. The database contains the results of this assembly integrated with hybridization data of genetic markers to the BAC library. AceDB was used for the core database engine and a MySQL relational database, populated with numerical representations of BAC clones within FPC contigs, was used to create appropriately scaled images. The database is being used to facilitate sequencing efforts. The database also allows researchers mapping known genes or other sequences of interest, rapid and easy access to the fundamental organization of the M.grisea genome. This database, MagnaportheDB, can be accessed on the web at http://www.cals.ncsu.edu/fungal_genomics/mgdatabase/int.htm.

Hierarchical Scaffolding With Bambus

PubMed Central

Pop, Mihai; Kosack, Daniel S.; Salzberg, Steven L.

2004-01-01

The output of a genome assembler generally comprises a collection of contiguous DNA sequences (contigs) whose relative placement along the genome is not defined. A procedure called scaffolding is commonly used to order and orient these contigs using paired read information. This ordering of contigs is an essential step when finishing and analyzing the data from a whole-genome shotgun project. Most recent assemblers include a scaffolding module; however, users have little control over the scaffolding algorithm or the information produced. We thus developed a general-purpose scaffolder, called Bambus, which affords users significant flexibility in controlling the scaffolding parameters. Bambus was used recently to scaffold the low-coverage draft dog genome data. Most significantly, Bambus enables the use of linking data other than that inferred from mate-pair information. For example, the sequence of a completed genome can be used to guide the scaffolding of a related organism. We present several applications of Bambus: support for finishing, comparative genomics, analysis of the haplotype structure of genomes, and scaffolding of a mammalian genome at low coverage. Bambus is available as an open-source package from our Web site. PMID:14707177

Hierarchical scaffolding with Bambus.

PubMed

Pop, Mihai; Kosack, Daniel S; Salzberg, Steven L

2004-01-01

The output of a genome assembler generally comprises a collection of contiguous DNA sequences (contigs) whose relative placement along the genome is not defined. A procedure called scaffolding is commonly used to order and orient these contigs using paired read information. This ordering of contigs is an essential step when finishing and analyzing the data from a whole-genome shotgun project. Most recent assemblers include a scaffolding module; however, users have little control over the scaffolding algorithm or the information produced. We thus developed a general-purpose scaffolder, called Bambus, which affords users significant flexibility in controlling the scaffolding parameters. Bambus was used recently to scaffold the low-coverage draft dog genome data. Most significantly, Bambus enables the use of linking data other than that inferred from mate-pair information. For example, the sequence of a completed genome can be used to guide the scaffolding of a related organism. We present several applications of Bambus: support for finishing, comparative genomics, analysis of the haplotype structure of genomes, and scaffolding of a mammalian genome at low coverage. Bambus is available as an open-source package from our Web site.

A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B-cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5.

PubMed

Kapanadze, B; Kashuba, V; Baranova, A; Rasool, O; van Everdink, W; Liu, Y; Syomov, A; Corcoran, M; Poltaraus, A; Brodyansky, V; Syomova, N; Kazakov, A; Ibbotson, R; van den Berg, A; Gizatullin, R; Fedorova, L; Sulimova, G; Zelenin, A; Deaven, L; Lehrach, H; Grander, D; Buys, C; Oscier, D; Zabarovsky, E R; Einhorn, S; Yankovsky, N

1998-04-17

B-cell chronic lymphocytic leukemia (B-CLL) is a human hematological neoplastic disease often associated with the loss of a chromosome 13 region between RB1 gene and locus D13S25. A new tumor suppressor gene (TSG) may be located in the region. A cosmid contig has been constructed between the loci D13S1168 (WI9598) and D13S25 (H2-42), which corresponds to the minimal region shared by B-CLL associated deletions. The contig includes more than 200 LANL and ICRF cosmid clones covering 620 kb. Three cDNAs likely corresponding to three different genes have been found in the minimally deleted region, sequenced and mapped against the contigged cosmids. cDNA clone 10k4 as well as a chimeric clone 13g3, codes for a zinc-finger domain of the RING type and shares homology to some known genes involved in tumorigenesis (RET finger protein, BRCA1) and embryogenesis (MID1). We have termed the gene corresponding to 10k4/13g3 clones LEU5. This is the first gene with homology to known TSGs which has been found in the region of B-CLL rearrangements.

extendFromReads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Kelly P.

2013-10-03

This package assists in genome assembly. extendFromReads takes as input a set of Illumina (eg, MiSeq) DNA sequencing reads, a query seed sequence and a direction to extend the seed. The algorithm collects all seed-- ]matching reads (flipping reverse-- ]orientation hits), trims off the seed and additional sequence in the other direction, sorts the remaining sequences alphabetically, and prints them aligned without gaps from the point of seed trimming. This produces a visual display distinguishing the flanks of multi- ]copy seeds. A companion script hitMates.pl collects the mates of seed-- ]hi]ng reads, whose alignment reveals longer extensions from the seed.more » The collect/trim/sort strategy was made iterative and scaled up in the script denovo.pl, for de novo contig assembly. An index is pre-- ]built using indexReads.pl that for each unique 21-- ]mer found in all the reads, records its gfate h of extension (whether extendable, blocked by low coverage, or blocked by branching after a duplicated sequence) and other characteristics. Importantly, denovo.pl records all branchings that follow a branching contig endpoint, providing contig- ]extension information« less

Final Report for Contract N00014-86-C-0598 (Thermo Electron Technologies Corporation)

DTIC Science & Technology

1989-12-28

At least 20 A/cm2 were observed at 193 nm. 248 nm (KrF) and 308 (XeCl). Beam brightness appears to be a minimum of 4 x 105 A/cm 2 -rad 2 at 248 nm...governed by the envelope equation3, d2r K b 0 dz (4) For a weakly relativistic beam. e J o r0 2 2 Co 0Mo (yac) 3 (5) where Jo is the beam current...correspond to laser wavotengths of the present study, preliminary measurement for ArF given by x .1 pattern ot spots on the phosphor screen for 248 nm

A physical map of Brassica oleracea shows complexity of chromosomal changes following recursive paleopolyploidizations

PubMed Central

2011-01-01

Background Evolution of the Brassica species has been recursively affected by polyploidy events, and comparison to their relative, Arabidopsis thaliana, provides means to explore their genomic complexity. Results A genome-wide physical map of a rapid-cycling strain of B. oleracea was constructed by integrating high-information-content fingerprinting (HICF) of Bacterial Artificial Chromosome (BAC) clones with hybridization to sequence-tagged probes. Using 2907 contigs of two or more BACs, we performed several lines of comparative genomic analysis. Interspecific DNA synteny is much better preserved in euchromatin than heterochromatin, showing the qualitative difference in evolution of these respective genomic domains. About 67% of contigs can be aligned to the Arabidopsis genome, with 96.5% corresponding to euchromatic regions, and 3.5% (shown to contain repetitive sequences) to pericentromeric regions. Overgo probe hybridization data showed that contigs aligned to Arabidopsis euchromatin contain ~80% of low-copy-number genes, while genes with high copy number are much more frequently associated with pericentromeric regions. We identified 39 interchromosomal breakpoints during the diversification of B. oleracea and Arabidopsis thaliana, a relatively high level of genomic change since their divergence. Comparison of the B. oleracea physical map with Arabidopsis and other available eudicot genomes showed appreciable 'shadowing' produced by more ancient polyploidies, resulting in a web of relatedness among contigs which increased genomic complexity. Conclusions A high-resolution genetically-anchored physical map sheds light on Brassica genome organization and advances positional cloning of specific genes, and may help to validate genome sequence assembly and alignment to chromosomes. All the physical mapping data is freely shared at a WebFPC site (http://lulu.pgml.uga.edu/fpc/WebAGCoL/brassica/WebFPC/; Temporarily password-protected: account: pgml; password: 123qwe123

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

PubMed Central

Eastman, Alexander W.; Yuan, Ze-Chun

2015-01-01

Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

Revealing the missing expressed genes beyond the human reference genome by RNA-Seq.

PubMed

Chen, Geng; Li, Ruiyuan; Shi, Leming; Qi, Junyi; Hu, Pengzhan; Luo, Jian; Liu, Mingyao; Shi, Tieliu

2011-12-02

The complete and accurate human reference genome is important for functional genomics researches. Therefore, the incomplete reference genome and individual specific sequences have significant effects on various studies. we used two RNA-Seq datasets from human brain tissues and 10 mixed cell lines to investigate the completeness of human reference genome. First, we demonstrated that in previously identified ~5 Mb Asian and ~5 Mb African novel sequences that are absent from the human reference genome of NCBI build 36, ~211 kb and ~201 kb of them could be transcribed, respectively. Our results suggest that many of those transcribed regions are not specific to Asian and African, but also present in Caucasian. Then, we found that the expressions of 104 RefSeq genes that are unalignable to NCBI build 37 in brain and cell lines are higher than 0.1 RPKM. 55 of them are conserved across human, chimpanzee and macaque, suggesting that there are still a significant number of functional human genes absent from the human reference genome. Moreover, we identified hundreds of novel transcript contigs that cannot be aligned to NCBI build 37, RefSeq genes and EST sequences. Some of those novel transcript contigs are also conserved among human, chimpanzee and macaque. By positioning those contigs onto the human genome, we identified several large deletions in the reference genome. Several conserved novel transcript contigs were further validated by RT-PCR. Our findings demonstrate that a significant number of genes are still absent from the incomplete human reference genome, highlighting the importance of further refining the human reference genome and curating those missing genes. Our study also shows the importance of de novo transcriptome assembly. The comparative approach between reference genome and other related human genomes based on the transcriptome provides an alternative way to refine the human reference genome.

Transcriptome wide identification and validation of calcium sensor gene family in the developing spikes of finger millet genotypes for elucidating its role in grain calcium accumulation.

PubMed

Singh, Uma M; Chandra, Muktesh; Shankhdhar, Shailesh C; Kumar, Anil

2014-01-01

In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of gene family in non-model species.

Sequencing of transcriptomes from two Miscanthus species reveals functional specificity in rhizomes, and clarifies evolutionary relationships.

PubMed

Kim, Changsoo; Lee, Tae-Ho; Guo, Hui; Chung, Sung Jin; Paterson, Andrew H; Kim, Do-Soon; Lee, Geung-Joo

2014-05-18

Miscanthus is a promising biomass crop for temperate regions. Despite the increasing interest in this plant, limited sequence information has constrained research into its biology, physiology, and breeding. The whole genome transcriptomes of M. sinensis and M. sacchariflorus presented in this study may provide good resources to understand functional compositions of two important Miscanthus genomes and their evolutionary relationships. For M. sinensis, a total of 457,891 and 512,950 expressed sequence tags (ESTs) were produced from leaf and rhizome tissues, respectively, which were assembled into 12,166 contigs and 89,648 singletons for leaf, and 13,170 contigs and 112,138 singletons for rhizome. For M. sacchariflorus, a total of 288,806 and 267,952 ESTs from leaf and rhizome tissues, respectively, were assembled into 8,732 contigs and 66,881 singletons for leaf, and 8,104 contigs and 63,212 singletons for rhizome. Based on the distributions of synonymous nucleotide substitution (Ks), sorghum and Miscanthus diverged about 6.2 million years ago (MYA), Saccharum and Miscanthus diverged 4.6 MYA, and M. sinensis and M. sacchariflorus diverged 1.5 MYA. The pairwise alignment of predicted protein sequences from sorghum-Miscanthus and two Miscanthus species found a total of 43,770 and 35,818 nsSNPs, respectively. The impacts of striking mutations found by nsSNPs were much lower between sorghum and Miscanthus than those between the two Miscanthus species, perhaps as a consequence of the much higher level of gene duplication in Miscanthus and resulting ability to buffer essential functions against disturbance. The ESTs generated in the present study represent a significant addition to Miscanthus functional genomics resources, permitting us to discover some candidate genes associated with enhanced biomass production. Ks distributions based on orthologous ESTs may serve as a guideline for future research into the evolution of Miscanthus species as well as its close relatives

Optimizing de novo transcriptome assembly and extending genomic resources for striped catfish (Pangasianodon hypophthalmus).

PubMed

Thanh, Nguyen Minh; Jung, Hyungtaek; Lyons, Russell E; Njaci, Isaac; Yoon, Byoung-Ha; Chand, Vincent; Tuan, Nguyen Viet; Thu, Vo Thi Minh; Mather, Peter

2015-10-01

Striped catfish (Pangasianodon hypophthalmus) is a commercially important freshwater fish used in inland aquaculture in the Mekong Delta, Vietnam. The culture industry is facing a significant challenge however from saltwater intrusion into many low topographical coastal provinces across the Mekong Delta as a result of predicted climate change impacts. Developing genomic resources for this species can facilitate the production of improved culture lines that can withstand raised salinity conditions, and so we have applied high-throughput Ion Torrent sequencing of transcriptome libraries from six target osmoregulatory organs from striped catfish as a genomic resource for use in future selection strategies. We obtained 12,177,770 reads after trimming and processing with an average length of 97bp. De novo assemblies were generated using CLC Genomic Workbench, Trinity and Velvet/Oases with the best overall contig performance resulting from the CLC assembly. De novo assembly using CLC yielded 66,451 contigs with an average length of 478bp and N50 length of 506bp. A total of 37,969 contigs (57%) possessed significant similarity with proteins in the non-redundant database. Comparative analyses revealed that a significant number of contigs matched sequences reported in other teleost fishes, ranging in similarity from 45.2% with Atlantic cod to 52% with zebrafish. In addition, 28,879 simple sequence repeats (SSRs) and 55,721 single nucleotide polymorphisms (SNPs) were detected in the striped catfish transcriptome. The sequence collection generated in the current study represents the most comprehensive genomic resource for P. hypophthalmus available to date. Our results illustrate the utility of next-generation sequencing as an efficient tool for constructing a large genomic database for marker development in non-model species. Copyright © 2015 Elsevier B.V. All rights reserved.

An integrated metagenome and -proteome analysis of the microbial community residing in a biogas production plant.

PubMed

Ortseifen, Vera; Stolze, Yvonne; Maus, Irena; Sczyrba, Alexander; Bremges, Andreas; Albaum, Stefan P; Jaenicke, Sebastian; Fracowiak, Jochen; Pühler, Alfred; Schlüter, Andreas

2016-08-10

To study the metaproteome of a biogas-producing microbial community, fermentation samples were taken from an agricultural biogas plant for microbial cell and protein extraction and corresponding metagenome analyses. Based on metagenome sequence data, taxonomic community profiling was performed to elucidate the composition of bacterial and archaeal sub-communities. The community's cytosolic metaproteome was represented in a 2D-PAGE approach. Metaproteome databases for protein identification were compiled based on the assembled metagenome sequence dataset for the biogas plant analyzed and non-corresponding biogas metagenomes. Protein identification results revealed that the corresponding biogas protein database facilitated the highest identification rate followed by other biogas-specific databases, whereas common public databases yielded insufficient identification rates. Proteins of the biogas microbiome identified as highly abundant were assigned to the pathways involved in methanogenesis, transport and carbon metabolism. Moreover, the integrated metagenome/-proteome approach enabled the examination of genetic-context information for genes encoding identified proteins by studying neighboring genes on the corresponding contig. Exemplarily, this approach led to the identification of a Methanoculleus sp. contig encoding 16 methanogenesis-related gene products, three of which were also detected as abundant proteins within the community's metaproteome. Thus, metagenome contigs provide additional information on the genetic environment of identified abundant proteins. Copyright © 2016 Elsevier B.V. All rights reserved.

Intestinal virome changes precede autoimmunity in type I diabetes-susceptible children

PubMed Central

Vatanen, Tommi; Droit, Lindsay; Kostic, Aleksandar D.; Poon, Tiffany W.; Vlamakis, Hera; Siljander, Heli; Härkönen, Taina; Hämäläinen, Anu-Maaria; Peet, Aleksandr; Tillmann, Vallo; Ilonen, Jorma; Wang, David; Knip, Mikael; Xavier, Ramnik J.

2017-01-01

Viruses have long been considered potential triggers of autoimmune diseases. Here we defined the intestinal virome from birth to the development of autoimmunity in children at risk for type 1 diabetes (T1D). A total of 220 virus-enriched preparations from serially collected fecal samples from 11 children (cases) who developed serum autoantibodies associated with T1D (of whom five developed clinical T1D) were compared with samples from controls. Intestinal viromes of case subjects were less diverse than those of controls. Among eukaryotic viruses, we identified significant enrichment of Circoviridae-related sequences in samples from controls in comparison with cases. Enterovirus, kobuvirus, parechovirus, parvovirus, and rotavirus sequences were frequently detected but were not associated with autoimmunity. For bacteriophages, we found higher Shannon diversity and richness in controls compared with cases and observed that changes in the intestinal virome over time differed between cases and controls. Using Random Forests analysis, we identified disease-associated viral bacteriophage contigs after subtraction of age-associated contigs. These disease-associated contigs were statistically linked to specific components of the bacterial microbiome. Thus, changes in the intestinal virome preceded autoimmunity in this cohort. Specific components of the virome were both directly and inversely associated with the development of human autoimmune disease. PMID:28696303

Investigating the viral ecology of global bee communities with high-throughput metagenomics.

PubMed

Galbraith, David A; Fuller, Zachary L; Ray, Allyson M; Brockmann, Axel; Frazier, Maryann; Gikungu, Mary W; Martinez, J Francisco Iturralde; Kapheim, Karen M; Kerby, Jeffrey T; Kocher, Sarah D; Losyev, Oleksiy; Muli, Elliud; Patch, Harland M; Rosa, Cristina; Sakamoto, Joyce M; Stanley, Scott; Vaudo, Anthony D; Grozinger, Christina M

2018-06-11

Bee viral ecology is a fascinating emerging area of research: viruses exert a range of effects on their hosts, exacerbate impacts of other environmental stressors, and, importantly, are readily shared across multiple bee species in a community. However, our understanding of bee viral communities is limited, as it is primarily derived from studies of North American and European Apis mellifera populations. Here, we examined viruses in populations of A. mellifera and 11 other bee species from 9 countries, across 4 continents and Oceania. We developed a novel pipeline to rapidly and inexpensively screen for bee viruses. This pipeline includes purification of encapsulated RNA/DNA viruses, sequence-independent amplification, high throughput sequencing, integrated assembly of contigs, and filtering to identify contigs specifically corresponding to viral sequences. We identified sequences for (+)ssRNA, (-)ssRNA, dsRNA, and ssDNA viruses. Overall, we found 127 contigs corresponding to novel viruses (i.e. previously not observed in bees), with 27 represented by >0.1% of the reads in a given sample, and 7 contained an RdRp or replicase sequence which could be used for robust phylogenetic analysis. This study provides a sequence-independent pipeline for viral metagenomics analysis, and greatly expands our understanding of the diversity of viruses found in bee communities.

Assembly: a resource for assembled genomes at NCBI

PubMed Central

Kitts, Paul A.; Church, Deanna M.; Thibaud-Nissen, Françoise; Choi, Jinna; Hem, Vichet; Sapojnikov, Victor; Smith, Robert G.; Tatusova, Tatiana; Xiang, Charlie; Zherikov, Andrey; DiCuccio, Michael; Murphy, Terence D.; Pruitt, Kim D.; Kimchi, Avi

2016-01-01

The NCBI Assembly database (www.ncbi.nlm.nih.gov/assembly/) provides stable accessioning and data tracking for genome assembly data. The model underlying the database can accommodate a range of assembly structures, including sets of unordered contig or scaffold sequences, bacterial genomes consisting of a single complete chromosome, or complex structures such as a human genome with modeled allelic variation. The database provides an assembly accession and version to unambiguously identify the set of sequences that make up a particular version of an assembly, and tracks changes to updated genome assemblies. The Assembly database reports metadata such as assembly names, simple statistical reports of the assembly (number of contigs and scaffolds, contiguity metrics such as contig N50, total sequence length and total gap length) as well as the assembly update history. The Assembly database also tracks the relationship between an assembly submitted to the International Nucleotide Sequence Database Consortium (INSDC) and the assembly represented in the NCBI RefSeq project. Users can find assemblies of interest by querying the Assembly Resource directly or by browsing available assemblies for a particular organism. Links in the Assembly Resource allow users to easily download sequence and annotations for current versions of genome assemblies from the NCBI genomes FTP site. PMID:26578580

Next Generation Sequencing Identifies Five Major Classes of Potentially Therapeutic Enzymes Secreted by Lucilia sericata Medical Maggots.

PubMed

Franta, Zdeněk; Vogel, Heiko; Lehmann, Rüdiger; Rupp, Oliver; Goesmann, Alexander; Vilcinskas, Andreas

2016-01-01

Lucilia sericata larvae are used as an alternative treatment for recalcitrant and chronic wounds. Their excretions/secretions contain molecules that facilitate tissue debridement, disinfect, or accelerate wound healing and have therefore been recognized as a potential source of novel therapeutic compounds. Among the substances present in excretions/secretions various peptidase activities promoting the wound healing processes have been detected but the peptidases responsible for these activities remain mostly unidentified. To explore these enzymes we applied next generation sequencing to analyze the transcriptomes of different maggot tissues (salivary glands, gut, and crop) associated with the production of excretions/secretions and/or with digestion as well as the rest of the larval body. As a result we obtained more than 123.8 million paired-end reads, which were assembled de novo using Trinity and Oases assemblers, yielding 41,421 contigs with an N50 contig length of 2.22 kb and a total length of 67.79 Mb. BLASTp analysis against the MEROPS database identified 1729 contigs in 577 clusters encoding five peptidase classes (serine, cysteine, aspartic, threonine, and metallopeptidases), which were assigned to 26 clans, 48 families, and 185 peptidase species. The individual enzymes were differentially expressed among maggot tissues and included peptidase activities related to the therapeutic effects of maggot excretions/secretions.

[Complete genome sequencing and sequence analysis of BCG Tice].

PubMed

Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

2012-10-04

The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

The genome of the Antarctic-endemic copepod, Tigriopus kingsejongensis.

PubMed

Kang, Seunghyun; Ahn, Do-Hwan; Lee, Jun Hyuck; Lee, Sung Gu; Shin, Seung Chul; Lee, Jungeun; Min, Gi-Sik; Lee, Hyoungseok; Kim, Hyun-Woo; Kim, Sanghee; Park, Hyun

2017-01-01

The Antarctic intertidal zone is continuously subjected to extremely fluctuating biotic and abiotic stressors. The West Antarctic Peninsula is the most rapidly warming region on Earth. Organisms living in Antarctic intertidal pools are therefore interesting for research into evolutionary adaptation to extreme environments and the effects of climate change. We report the whole genome sequence of the Antarctic-endemic harpacticoid copepod Tigriopus kingsejongensi . The 37 Gb raw DNA sequence was generated using the Illumina Miseq platform. Libraries were prepared with 65-fold coverage and a total length of 295 Mb. The final assembly consists of 48 368 contigs with an N50 contig length of 17.5 kb, and 27 823 scaffolds with an N50 contig length of 159.2 kb. A total of 12 772 coding genes were inferred using the MAKER annotation pipeline. Comparative genome analysis revealed that T. kingsejongensis -specific genes are enriched in transport and metabolism processes. Furthermore, rapidly evolving genes related to energy metabolism showed positive selection signatures. The T. kingsejongensis genome provides an interesting example of an evolutionary strategy for Antarctic cold adaptation, and offers new genetic insights into Antarctic intertidal biota. © The Author 2017. Published by Oxford University Press.

The genome of the Antarctic-endemic copepod, Tigriopus kingsejongensis

PubMed Central

Kang, Seunghyun; Ahn, Do-Hwan; Lee, Jun Hyuck; Lee, Sung Gu; Shin, Seung Chul; Lee, Jungeun; Min, Gi-Sik; Lee, Hyoungseok

2017-01-01

Abstract Background: The Antarctic intertidal zone is continuously subjected to extremely fluctuating biotic and abiotic stressors. The West Antarctic Peninsula is the most rapidly warming region on Earth. Organisms living in Antarctic intertidal pools are therefore interesting for research into evolutionary adaptation to extreme environments and the effects of climate change. Findings: We report the whole genome sequence of the Antarctic-endemic harpacticoid copepod Tigriopus kingsejongensi. The 37 Gb raw DNA sequence was generated using the Illumina Miseq platform. Libraries were prepared with 65-fold coverage and a total length of 295 Mb. The final assembly consists of 48 368 contigs with an N50 contig length of 17.5 kb, and 27 823 scaffolds with an N50 contig length of 159.2 kb. A total of 12 772 coding genes were inferred using the MAKER annotation pipeline. Comparative genome analysis revealed that T. kingsejongensis-specific genes are enriched in transport and metabolism processes. Furthermore, rapidly evolving genes related to energy metabolism showed positive selection signatures. Conclusions: The T. kingsejongensis genome provides an interesting example of an evolutionary strategy for Antarctic cold adaptation, and offers new genetic insights into Antarctic intertidal biota. PMID:28369352

De novo assembly of the transcriptome of Aegiceras corniculatum, a mangrove species in the Indo-West Pacific region.

PubMed

Fang, Lu; Yang, Yuchen; Guo, Wuxia; Li, Jianfang; Zhong, Cairong; Huang, Yelin; Zhou, Renchao; Shi, Suhua

2016-08-01

Aegiceras corniculatum (L.) Blanco is one of the most salt tolerant mangrove species and can thrive in 3% salinity at the seaward edge of mangrove forests. Here we sequenced the transcriptome of A. corniculatum used Illumina GA platform to develop its genomic resources for ecological and evolutionary studies. We obtained about 50 million high-quality paired-end reads with 75bp in length. Using the short read assembler Velvet, we yielded 49,437 contigs with the average length of 625bp. A total of 32,744 (66.23%) contigs showed significant similarity to the GenBank non-redundant (NR) protein database. 30,911 and 18,004 of these sequences were assigned to Gene Ontology and eukaryotic orthologous groups of proteins (KOG). A total of 4942 transcripts from our assemblies had significant similarity with KEGG Orthologs and were involved in 144 KEGG pathways, while 9899 unigenes had enzyme commission (EC) numbers. In addition, 9792 transcriptome-derived SSRs were identified from 7342 sequences. With our strict criteria, 4165 candidate SNPs were also identified from 2058 contigs. Some of these SNPs were further validated by Sanger sequencing. Genomic resources generated in this study should be valuable in ecological, evolutionary, and functional genomics studies for this mangrove species. Copyright © 2016 Elsevier B.V. All rights reserved.

PGE2 suppresses NK activity in vivo directly and through adrenal hormones: Effects that cannot be reflected by ex-vivo assessment of NK cytotoxicity

PubMed Central

Meron, G.; Tishler, Y.; Shaashua, L.; Rosenne, E.; Levi, B.; Melamed, R.; Gotlieb, N.; Matzner, P.; Sorski, L.; Ben-Eliyahu, S.

2013-01-01

Surgery can suppress in vivo levels of NK cell cytotoxicity (NKCC) through various mechanisms, including catecholamine-, glucocorticoid (CORT)-, and prostaglandin (PG)-mediated responses. However, PGs are synthesized locally following tissue damage, driving proinflammatory and CORT responses, while their systemic levels are often unaffected. Thus, we herein studied the role of adrenal factors in mediating in vivo effects of PGs on NKCC, using adrenalectomized and sham-operated F344 rats subjected to surgery or PGE2 administration. In vivo and ex-vivo approaches were employed, based on intravenous administration of the NK-sensitive MADB106 tumor line, and based on ex-vivo assessment of YAC-1 and MADB106 target-line lysis. Additionally, in vitro studies assessed the kinetics of the impact of epinephrine, CORT, and PGE2 on NKCC. The results indicated that suppression of NKCC by epinephrine and PGE2 are short lasting, and cannot be evident when these compounds are removed from the in vitro assay milieu, or in the context of ex-vivo assessment of NKCC. In contrast, the effects of CORT are long-lasting and are reflected in both conditions even after its removal. Marginating-pulmonary NKCC was less susceptible to suppression than circulating NKCC, when tested against the xenogeneic YAC-1 target line, but not against the syngeneic MADB106 line, which seems to involve different cytotoxicity mechanisms. Overall, these findings indicate that elevated systemic PG levels can directly suppress NKCC in vivo, but following laparotomy adrenal hormones mediate most of the effects of endogenously-released PGs. Additionally, the ex-vivo approach seems limited in reflecting the short-lasting NK-suppressive effects of catecholamines and PGs. PMID:23153554

PGE2 suppresses NK activity in vivo directly and through adrenal hormones: effects that cannot be reflected by ex vivo assessment of NK cytotoxicity.

PubMed

Meron, G; Tishler, Y; Shaashua, L; Rosenne, E; Levi, B; Melamed, R; Gotlieb, N; Matzner, P; Sorski, L; Ben-Eliyahu, S

2013-02-01

Surgery can suppress in vivo levels of NK cell cytotoxicity (NKCC) through various mechanisms, including catecholamine-, glucocorticoid (CORT)-, and prostaglandin (PG)-mediated responses. However, PGs are synthesized locally following tissue damage, driving proinflammatory and CORT responses, while their systemic levels are often unaffected. Thus, we herein studied the role of adrenal factors in mediating in vivo effects of PGs on NKCC, using adrenalectomized and sham-operated F344 rats subjected to surgery or PGE(2) administration. In vivo and ex vivo approaches were employed, based on intravenous administration of the NK-sensitive MADB106 tumor line, and based on ex vivo assessment of YAC-1 and MADB106 target-line lysis. Additionally, in vitro studies assessed the kinetics of the impact of epinephrine, CORT, and PGE(2) on NKCC. The results indicated that suppression of NKCC by epinephrine and PGE(2) are short lasting, and cannot be evident when these compounds are removed from the in vitro assay milieu, or in the context of ex vivo assessment of NKCC. In contrast, the effects of CORT are long-lasting and are reflected in both conditions even after its removal. Marginating-pulmonary NKCC was less susceptible to suppression than circulating NKCC, when tested against the xenogeneic YAC-1 target line, but not against the syngeneic MADB106 line, which seems to involve different cytotoxicity mechanisms. Overall, these findings indicate that elevated systemic PG levels can directly suppress NKCC in vivo, but following laparotomy adrenal hormones mediate most of the effects of endogenously-released PGs. Additionally, the ex vivo approach seems limited in reflecting the short-lasting NK-suppressive effects of catecholamines and PGs. Copyright © 2012 Elsevier Inc. All rights reserved.

Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

PubMed Central

Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

1995-01-01

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

Impaired development of cortico-striatal synaptic connectivity in a cell culture model of Huntington's disease.

PubMed

Buren, Caodu; Parsons, Matthew P; Smith-Dijak, Amy; Raymond, Lynn A

2016-03-01

Huntington's disease (HD) is a genetically inherited neurodegenerative disease caused by a mutation in the gene encoding the huntingtin protein. This mutation results in progressive cell death that is particularly striking in the striatum. Recent evidence indicates that early HD is initially a disease of the synapse, in which subtle alterations in synaptic neurotransmission, particularly at the cortico-striatal (C-S) synapse, can be detected well in advance of cell death. Here, we used a cell culture model in which striatal neurons are co-cultured with cortical neurons, and monitored the development of C-S connectivity up to 21days in vitro (DIV) in cells cultured from either the YAC128 mouse model of HD or the background strain, FVB/N (wild-type; WT) mice. Our data demonstrate that while C-S connectivity in WT co-cultures develops rapidly and continuously from DIV 7 to 21, YAC128 C-S connectivity shows no significant growth from DIV 14 onward. Morphological and electrophysiological data suggest that a combination of pre- and postsynaptic mechanisms contribute to this effect, including a reduction in both the postsynaptic dendritic arborization and the size and replenishment rate of the presynaptic readily releasable pool of excitatory vesicles. Moreover, a chimeric culture strategy confirmed that the most robust impairment in C-S connectivity was only observed when mutant huntingtin was expressed both pre- and postsynaptically. In all, our data demonstrate a progressive HD synaptic phenotype in this co-culture system that may be exploited as a platform for identifying promising therapeutic strategies to prevent early HD-associated synaptopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morrow, B.; Carlson, C.; Gupta, R.D.

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

Distal 22q11.2 microduplication encompassing the BCR gene.

PubMed

Descartes, Maria; Franklin, Judy; Diaz de Ståhl, Teresita; Piotrowski, Arkadiusz; Bruder, Carl E G; Dumanski, Jan P; Carroll, Andrew J; Mikhail, Fady M

2008-12-01

Chromosome 22 band q11.2 has been recognized to be highly susceptible to subtle microdeletions and microduplications, which have been attributed to the presence of several large segmental duplications; also known as low copy repeats (LCRs). These LCRs function as mediators of non-allelic homologous recombination (NAHR), which results in these chromosomal rearrangements as a result of unequal crossover. The four centromeric LCRs at proximal 22q11.2 have been previously implicated in recurrent chromosomal rearrangements including the DiGeorge/Velocardiofacial syndrome (DG/VCFs) microdeletion and its reciprocal microduplication. Recently, we and others have demonstrated that the four telomeric LCRs at distal 22q11.2 are causally implicated in a newly recognized recurrent distal 22q11.2 microdeletion syndrome in the region immediately telomeric to the DG/VCFs typically deleted region. Here we report on the clinical, cytogenetic, and array CGH studies of a 4.5-year-old girl with history of failure to thrive, developmental delay (DD), and relative macrocephaly. She carries a paternally inherited approximately 2.1 Mb microduplication at distal 22q11.2, which spans approximately 34 annotated genes, and is flanked by two of the four telomeric 22q11.2 LCRs. We conclude that the four telomeric LCRs at distal 22q11.2 can mediate both deletions and duplications in this genomic region. Both deletions and duplication of this region present with subtle clinical features including mild to moderate mental retardation, DD, and mild dysmorphic features. Copyright (c) 2008 Wiley-Liss, Inc.

Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.

PubMed

Hu, Pingzhao; Janga, Sarath Chandra; Babu, Mohan; Díaz-Mejía, J Javier; Butland, Gareth; Yang, Wenhong; Pogoutse, Oxana; Guo, Xinghua; Phanse, Sadhna; Wong, Peter; Chandran, Shamanta; Christopoulos, Constantine; Nazarians-Armavil, Anaies; Nasseri, Negin Karimi; Musso, Gabriel; Ali, Mehrab; Nazemof, Nazila; Eroukova, Veronika; Golshani, Ashkan; Paccanaro, Alberto; Greenblatt, Jack F; Moreno-Hagelsieb, Gabriel; Emili, Andrew

2009-04-28

One-third of the 4,225 protein-coding genes of Escherichia coli K-12 remain functionally unannotated (orphans). Many map to distant clades such as Archaea, suggesting involvement in basic prokaryotic traits, whereas others appear restricted to E. coli, including pathogenic strains. To elucidate the orphans' biological roles, we performed an extensive proteomic survey using affinity-tagged E. coli strains and generated comprehensive genomic context inferences to derive a high-confidence compendium for virtually the entire proteome consisting of 5,993 putative physical interactions and 74,776 putative functional associations, most of which are novel. Clustering of the respective probabilistic networks revealed putative orphan membership in discrete multiprotein complexes and functional modules together with annotated gene products, whereas a machine-learning strategy based on network integration implicated the orphans in specific biological processes. We provide additional experimental evidence supporting orphan participation in protein synthesis, amino acid metabolism, biofilm formation, motility, and assembly of the bacterial cell envelope. This resource provides a "systems-wide" functional blueprint of a model microbe, with insights into the biological and evolutionary significance of previously uncharacterized proteins.

Transcription map of Xq27: candidates for several X-linked diseases.

PubMed

Zucchi, I; Jones, J; Affer, M; Montagna, C; Redolfi, E; Susani, L; Vezzoni, P; Parvari, R; Schlessinger, D; Whyte, M P; Mumm, S

1999-04-15

Human Xq27 contains candidate regions for several disorders, yet is predicted to be a gene-poor cytogenetic band. We have developed a transcription map for the entire cytogenetic band to facilitate the identification of the relatively small number of expected candidate genes. Two approaches were taken to identify genes: (1) a group of 64 unique STSs that were generated during the physical mapping of the region were used in RT-PCR with RNA from human adult and fetal brain and (2) ESTs that have been broadly mapped to this region of the chromosome were finely mapped using a high-resolution yeast artificial chromosome contig. This combined approach identified four distinct regions of transcriptional activity within the Xq27 band. Among them is a region at the centromeric boundary that contains candidate regions for several rare developmental disorders (X-linked recessive hypoparathyroidism, thoracoabdominal syndrome, albinism-deafness syndrome, and Borjeson-Forssman-Lehman syndrome). Two transcriptionally active regions were identified in the center of Xq27 and include candidate regions for X-linked mental retardation syndrome 6, X-linked progressive cone dystrophy, X-linked retinitis pigmentosa 24, and a prostate cancer susceptibility locus. The fourth region of transcriptional activity encompasses the FMR1 (FRAXA) and FMR2 (FRAXE) genes. The analysis thus suggests clustered transcription in Xq27 and provides candidates for several heritable disorders for which the causative genes have not yet been found. Copyright 1999 Academic Press.

Metagenomic Analysis of Virioplankton of the Subtropical Jiulong River Estuary, China

PubMed Central

Cai, Lanlan; Zhang, Rui; He, Ying; Feng, Xiaoyuan; Jiao, Nianzhi

2016-01-01

Viruses are the most abundant biological entities in the oceans, and encompass a significant reservoir of genetic diversity. However, little is known about their biodiversity in estuary environments, which represent a highly dynamic and potentially more diverse habitat. Here, we report a metagenomic analysis of the dsDNA viral community from the Jiulong River Estuary (JRE), China, and provide a comparative analysis with other closely related environments. The results showed that the majority of JRE virome did not show any significant similarity to the database. For the major viral group (Caudovirales) detected in the sample, Podoviridae (44.88%) were the most abundant family, followed by Siphoviridae (32.98%) and Myoviridae (17.32%). The two most abundant viruses identified in the virome were phages HTVC010P and HMO-2011, which infect bacteria belonging to marine SAR11 and SAR116 clades, respectively. Two contigs larger than 20 kb, which show similar overall genome architectures to Celeribacter phage P12053L and Thalosomonas phage BA3, respectively, were generated during assembly. Comparative analysis showed that the JRE virome was more similar to marine viromes than to freshwater viromes, and shared a relative coarse-grain genetic overlap (averaging 14.14% ± 1.68%) with other coastal viromes. Our study indicated that the diversity and community structure of the virioplankton found in JRE were mainly affected by marine waters, with less influence from freshwater discharge. PMID:26848678

Katome: de novo DNA assembler implemented in rust

NASA Astrophysics Data System (ADS)

Neumann, Łukasz; Nowak, Robert M.; Kuśmirek, Wiktor

2017-08-01

Katome is a new de novo sequence assembler written in the Rust programming language, designed with respect to future parallelization of the algorithms, run time and memory usage optimization. The application uses new algorithms for the correct assembly of repetitive sequences. Performance and quality tests were performed on various data, comparing the new application to `dnaasm', `ABySS' and `Velvet' genome assemblers. Quality tests indicate that the new assembler creates more contigs than well-established solutions, but the contigs have better quality with regard to mismatches per 100kbp and indels per 100kbp. Additionally, benchmarks indicate that the Rust-based implementation outperforms `dnaasm', `ABySS' and `Velvet' assemblers, written in C++, in terms of assembly time. Lower memory usage in comparison to `dnaasm' is observed.

Evolutionary origin of the segmental duplication encompassing the wheat GLU-B1 locus encoding the overexpressed Bx7 (Bx7OE) high molecular weight glutenin subunit.

PubMed

Ragupathy, Raja; Naeem, Hamid A; Reimer, Elsa; Lukow, Odean M; Sapirstein, Harry D; Cloutier, Sylvie

2008-01-01

Sequencing of a BAC clone encompassing the Glu-B1 locus in Glenlea, revealed a 10.3 Kb segmental duplication including the Bx7 gene and flanking an LTR retroelement. To better understand the evolution of this locus, two collections of wheat were surveyed. The first consisted of 96 diploid and tetraploid species accessions while the second consisted of 316 Triticum aestivum cultivars and landraces from 41 countries. The genotypes were first characterized by SDS-PAGE and a total of 40 of the 316 T. aestivum accessions were found to display the overexpressed Bx7 phenotype (Bx7OE). Three lines from the 96 diploid/tetraploid collection also displayed the stronger intensity staining characteristic of the Bx7(OE) subunit. The relative amounts of the Bx7 subunit to total HMW-GS were quantified by RP-HPLC for all Bx7OE accessions and a number of checks. The entire collection was assessed for the presence of four DNA markers namely an 18 bp indel of the coding region of Bx7 variant alleles, a 43 bp indel of the 5'-region and the left and right junctions of the LTR retrotransposon borders and the duplicated segment. All 43 accessions found to have the Bx7OE subunit by SDS-PAGE and RP-HPLC produced the four diagnostic PCR amplicons. None of the lines without the Bx7OE had the LTR retroelement/duplication genomic structure. However, the 18 and 43 bp indel were found in accessions other than Bx7OE. These results indicate that the overexpression of the Bx7 HMW-GS is likely the result of a single event, i.e., a gene duplication at the Glu-B1 locus mediated by the insertion of a retroelement. Also, the 18 and 43 bp indels pre-date the duplication event. Allelic variants Bx7*, Bx7 with and without 43 bp insert and Bx7OE were found in both tetraploid and hexaploid collections and shared the same genomic organization. Though the possibility of introgression from T. aestivum to T. turgidum cannot be ruled out, the three structural genomic changes of the B-genome taken together support

Transcriptome resources for the frogs Lithobates clamitans and Pseudacris regilla, emphasizing antimicrobial peptides and conserved loci for phylogenetics

USGS Publications Warehouse

Robertson, Laura S.; Cornman, Robert S.

2014-01-01

We developed genetic resources for two North American frogs, Lithobates clamitans and Pseudacris regilla, widespread native amphibians that are potential indicator species of environmental health. For both species, mRNA from multiple tissues was sequenced using 454 technology. De novo assemblies with Mira3 resulted in 50 238 contigs (N50 = 687 bp) and 48 213 contigs (N50 = 686 bp) for L. clamitans and P. regilla, respectively, after clustering with CD-Hit-EST and purging contigs below 200 bp. We performed BLASTX similarity searches against the Xenopus tropicalis proteome and, for predicted ORFs, HMMER similarity searches against the Pfam-A database. Because there is broad interest in amphibian immune factors, we manually annotated putative antimicrobial peptides. To identify conserved regions suitable for amplicon resequencing across a broad taxonomic range, we performed an additional assembly of public short-read transcriptome data derived from two species of the genus Rana and identified reciprocal best TBLASTX matches among all assemblies. Although P. regilla, a hylid frog, is substantially more diverged from the ranid species, we identified 56 genes that were sufficiently conserved to allow nondegenerate primer design with Primer3. In addition to providing a foundation for comparative genomics and quantitative gene expression analysis, our results enable quick development of nuclear sequence-based markers for phylogenetics or population genetics.

Next Generation Sequencing Identifies Five Major Classes of Potentially Therapeutic Enzymes Secreted by Lucilia sericata Medical Maggots

PubMed Central

Franta, Zdeněk; Vogel, Heiko; Lehmann, Rüdiger; Rupp, Oliver; Goesmann, Alexander; Vilcinskas, Andreas

2016-01-01

Lucilia sericata larvae are used as an alternative treatment for recalcitrant and chronic wounds. Their excretions/secretions contain molecules that facilitate tissue debridement, disinfect, or accelerate wound healing and have therefore been recognized as a potential source of novel therapeutic compounds. Among the substances present in excretions/secretions various peptidase activities promoting the wound healing processes have been detected but the peptidases responsible for these activities remain mostly unidentified. To explore these enzymes we applied next generation sequencing to analyze the transcriptomes of different maggot tissues (salivary glands, gut, and crop) associated with the production of excretions/secretions and/or with digestion as well as the rest of the larval body. As a result we obtained more than 123.8 million paired-end reads, which were assembled de novo using Trinity and Oases assemblers, yielding 41,421 contigs with an N50 contig length of 2.22 kb and a total length of 67.79 Mb. BLASTp analysis against the MEROPS database identified 1729 contigs in 577 clusters encoding five peptidase classes (serine, cysteine, aspartic, threonine, and metallopeptidases), which were assigned to 26 clans, 48 families, and 185 peptidase species. The individual enzymes were differentially expressed among maggot tissues and included peptidase activities related to the therapeutic effects of maggot excretions/secretions. PMID:27119084

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Analysis of differentially expressed genes in two immunologically distinct strains of Eimeria maxima using suppression subtractive hybridization and dot-blot hybridization

PubMed Central

2014-01-01

Background It is well known that different Eimeria maxima strains exhibit significant antigenic variation. However, the genetic basis of these phenotypes remains unclear. Methods Total RNA and mRNA were isolated from unsporulated oocysts of E. maxima strains SH and NT, which were found to have significant differences in immunogenicity in our previous research. Two subtractive cDNA libraries were constructed using suppression subtractive hybridization (SSH) and specific genes were further analyzed by dot-blot hybridization and qRT-PCR analysis. Results A total of 561 clones were selected from both cDNA libraries and the length of the inserted fragments was 0.25–1.0 kb. Dot-blot hybridization revealed a total of 86 differentially expressed clones (63 from strain SH and 23 from strain NT). Nucleotide sequencing analysis of these clones revealed ten specific contigs (six from strain SH and four from strain NT). Further analysis found that six contigs from strain SH and three from strain NT shared significant identities with previously reported proteins, and one contig was presumed to be novel. The specific differentially expressed genes were finally verified by RT-PCR and qRT-PCR analyses. Conclusions The data presented here suggest that specific genes identified between the two strains may be important molecules in the immunogenicity of E. maxima that may present potential new drug targets or vaccine candidates for coccidiosis. PMID:24894832

Characterization of Three Maize Bacterial Artificial Chromosome Libraries toward Anchoring of the Physical Map to the Genetic Map Using High-Density Bacterial Artificial Chromosome Filter Hybridization1

PubMed Central

Yim, Young-Sun; Davis, Georgia L.; Duru, Ngozi A.; Musket, Theresa A.; Linton, Eric W.; Messing, Joachim W.; McMullen, Michael D.; Soderlund, Carol A.; Polacco, Mary L.; Gardiner, Jack M.; Coe, Edward H.

2002-01-01

Three maize (Zea mays) bacterial artificial chromosome (BAC) libraries were constructed from inbred line B73. High-density filter sets from all three libraries, made using different restriction enzymes (HindIII, EcoRI, and MboI, respectively), were evaluated with a set of complex probes including the185-bp knob repeat, ribosomal DNA, two telomere-associated repeat sequences, four centromere repeats, the mitochondrial genome, a multifragment chloroplast DNA probe, and bacteriophage λ. The results indicate that the libraries are of high quality with low contamination by organellar and λ-sequences. The use of libraries from multiple enzymes increased the chance of recovering each region of the genome. Ninety maize restriction fragment-length polymorphism core markers were hybridized to filters of the HindIII library, representing 6× coverage of the genome, to initiate development of a framework for anchoring BAC contigs to the intermated B73 × Mo17 genetic map and to mark the bin boundaries on the physical map. All of the clones used as hybridization probes detected at least three BACs. Twenty-two single-copy number core markers identified an average of 7.4 ± 3.3 positive clones, consistent with the expectation of six clones. This information is integrated into fingerprinting data generated by the Arizona Genomics Institute to assemble the BAC contigs using fingerprint contig and contributed to the process of physical map construction. PMID:12481051

Mapping of Micro-Tom BAC-End Sequences to the Reference Tomato Genome Reveals Possible Genome Rearrangements and Polymorphisms

PubMed Central

Asamizu, Erika; Shirasawa, Kenta; Hirakawa, Hideki; Sato, Shusei; Tabata, Satoshi; Yano, Kentaro; Ariizumi, Tohru; Shibata, Daisuke; Ezura, Hiroshi

2012-01-01

A total of 93,682 BAC-end sequences (BESs) were generated from a dwarf model tomato, cv. Micro-Tom. After removing repetitive sequences, the BESs were similarity searched against the reference tomato genome of a standard cultivar, “Heinz 1706.” By referring to the “Heinz 1706” physical map and by eliminating redundant or nonsignificant hits, 28,804 “unique pair ends” and 8,263 “unique ends” were selected to construct hypothetical BAC contigs. The total physical length of the BAC contigs was 495, 833, 423 bp, covering 65.3% of the entire genome. The average coverage of euchromatin and heterochromatin was 58.9% and 67.3%, respectively. From this analysis, two possible genome rearrangements were identified: one in chromosome 2 (inversion) and the other in chromosome 3 (inversion and translocation). Polymorphisms (SNPs and Indels) between the two cultivars were identified from the BLAST alignments. As a result, 171,792 polymorphisms were mapped on 12 chromosomes. Among these, 30,930 polymorphisms were found in euchromatin (1 per 3,565 bp) and 140,862 were found in heterochromatin (1 per 2,737 bp). The average polymorphism density in the genome was 1 polymorphism per 2,886 bp. To facilitate the use of these data in Micro-Tom research, the BAC contig and polymorphism information are available in the TOMATOMICS database. PMID:23227037

PeanutDB: an integrated bioinformatics web portal for Arachis hypogaea transcriptomics

PubMed Central

2012-01-01

Background The peanut (Arachis hypogaea) is an important crop cultivated worldwide for oil production and food sources. Its complex genetic architecture (e.g., the large and tetraploid genome possibly due to unique cross of wild diploid relatives and subsequent chromosome duplication: 2n = 4x = 40, AABB, 2800 Mb) presents a major challenge for its genome sequencing and makes it a less-studied crop. Without a doubt, transcriptome sequencing is the most effective way to harness the genome structure and gene expression dynamics of this non-model species that has a limited genomic resource. Description With the development of next generation sequencing technologies such as 454 pyro-sequencing and Illumina sequencing by synthesis, the transcriptomics data of peanut is rapidly accumulated in both the public databases and private sectors. Integrating 187,636 Sanger reads (103,685,419 bases), 1,165,168 Roche 454 reads (333,862,593 bases) and 57,135,995 Illumina reads (4,073,740,115 bases), we generated the first release of our peanut transcriptome assembly that contains 32,619 contigs. We provided EC, KEGG and GO functional annotations to these contigs and detected SSRs, SNPs and other genetic polymorphisms for each contig. Based on both open-source and our in-house tools, PeanutDB presents many seamlessly integrated web interfaces that allow users to search, filter, navigate and visualize easily the whole transcript assembly, its annotations and detected polymorphisms and simple sequence repeats. For each contig, sequence alignment is presented in both bird’s-eye view and nucleotide level resolution, with colorfully highlighted regions of mismatches, indels and repeats that facilitate close examination of assembly quality, genetic polymorphisms, sequence repeats and/or sequencing errors. Conclusion As a public genomic database that integrates peanut transcriptome data from different sources, PeanutDB (http://bioinfolab.muohio.edu/txid3818v1) provides the

An expressed sequence tag (EST) library for Drosophila serrata, a model system for sexual selection and climatic adaptation studies.

PubMed

Frentiu, Francesca D; Adamski, Marcin; McGraw, Elizabeth A; Blows, Mark W; Chenoweth, Stephen F

2009-01-21

The native Australian fly Drosophila serrata belongs to the highly speciose montium subgroup of the melanogaster species group. It has recently emerged as an excellent model system with which to address a number of important questions, including the evolution of traits under sexual selection and traits involved in climatic adaptation along latitudinal gradients. Understanding the molecular genetic basis of such traits has been limited by a lack of genomic resources for this species. Here, we present the first expressed sequence tag (EST) collection for D. serrata that will enable the identification of genes underlying sexually-selected phenotypes and physiological responses to environmental change and may help resolve controversial phylogenetic relationships within the montium subgroup. A normalized cDNA library was constructed from whole fly bodies at several developmental stages, including larvae and adults. Assembly of 11,616 clones sequenced from the 3' end allowed us to identify 6,607 unique contigs, of which at least 90% encoded peptides. Partial transcripts were discovered from a variety of genes of evolutionary interest by BLASTing contigs against the 12 Drosophila genomes currently sequenced. By incorporating into the cDNA library multiple individuals from populations spanning a large portion of the geographical range of D. serrata, we were able to identify 11,057 putative single nucleotide polymorphisms (SNPs), with 278 different contigs having at least one "double hit" SNP that is highly likely to be a real polymorphism. At least 394 EST-associated microsatellite markers, representing 355 different contigs, were also found, providing an additional set of genetic markers. The assembled EST library is available online at http://www.chenowethlab.org/serrata/index.cgi. We have provided the first gene collection and largest set of polymorphic genetic markers, to date, for the fly D. serrata. The EST collection will provide much needed genomic resources for

Graph mining for next generation sequencing: leveraging the assembly graph for biological insights.

PubMed

Warnke-Sommer, Julia; Ali, Hesham

2016-05-06

The assembly of Next Generation Sequencing (NGS) reads remains a challenging task. This is especially true for the assembly of metagenomics data that originate from environmental samples potentially containing hundreds to thousands of unique species. The principle objective of current assembly tools is to assemble NGS reads into contiguous stretches of sequence called contigs while maximizing for both accuracy and contig length. The end goal of this process is to produce longer contigs with the major focus being on assembly only. Sequence read assembly is an aggregative process, during which read overlap relationship information is lost as reads are merged into longer sequences or contigs. The assembly graph is information rich and capable of capturing the genomic architecture of an input read data set. We have developed a novel hybrid graph in which nodes represent sequence regions at different levels of granularity. This model, utilized in the assembly and analysis pipeline Focus, presents a concise yet feature rich view of a given input data set, allowing for the extraction of biologically relevant graph structures for graph mining purposes. Focus was used to create hybrid graphs to model metagenomics data sets obtained from the gut microbiomes of five individuals with Crohn's disease and eight healthy individuals. Repetitive and mobile genetic elements are found to be associated with hybrid graph structure. Using graph mining techniques, a comparative study of the Crohn's disease and healthy data sets was conducted with focus on antibiotics resistance genes associated with transposase genes. Results demonstrated significant differences in the phylogenetic distribution of categories of antibiotics resistance genes in the healthy and diseased patients. Focus was also evaluated as a pure assembly tool and produced excellent results when compared against the Meta-velvet, Omega, and UD-IDBA assemblers. Mining the hybrid graph can reveal biological phenomena captured

Transcriptome Assembly, Gene Annotation and Tissue Gene Expression Atlas of the Rainbow Trout

PubMed Central

Salem, Mohamed; Paneru, Bam; Al-Tobasei, Rafet; Abdouni, Fatima; Thorgaard, Gary H.; Rexroad, Caird E.; Yao, Jianbo

2015-01-01

Efforts to obtain a comprehensive genome sequence for rainbow trout are ongoing and will be complemented by transcriptome information that will enhance genome assembly and annotation. Previously, transcriptome reference sequences were reported using data from different sources. Although the previous work added a great wealth of sequences, a complete and well-annotated transcriptome is still needed. In addition, gene expression in different tissues was not completely addressed in the previous studies. In this study, non-normalized cDNA libraries were sequenced from 13 different tissues of a single doubled haploid rainbow trout from the same source used for the rainbow trout genome sequence. A total of ~1.167 billion paired-end reads were de novo assembled using the Trinity RNA-Seq assembler yielding 474,524 contigs > 500 base-pairs. Of them, 287,593 had homologies to the NCBI non-redundant protein database. The longest contig of each cluster was selected as a reference, yielding 44,990 representative contigs. A total of 4,146 contigs (9.2%), including 710 full-length sequences, did not match any mRNA sequences in the current rainbow trout genome reference. Mapping reads to the reference genome identified an additional 11,843 transcripts not annotated in the genome. A digital gene expression atlas revealed 7,678 housekeeping and 4,021 tissue-specific genes. Expression of about 16,000–32,000 genes (35–71% of the identified genes) accounted for basic and specialized functions of each tissue. White muscle and stomach had the least complex transcriptomes, with high percentages of their total mRNA contributed by a small number of genes. Brain, testis and intestine, in contrast, had complex transcriptomes, with a large numbers of genes involved in their expression patterns. This study provides comprehensive de novo transcriptome information that is suitable for functional and comparative genomics studies in rainbow trout, including annotation of the genome. PMID

Transcriptome Wide Identification and Validation of Calcium Sensor Gene Family in the Developing Spikes of Finger Millet Genotypes for Elucidating Its Role in Grain Calcium Accumulation

PubMed Central

Singh, Uma M.; Chandra, Muktesh; Shankhdhar, Shailesh C.; Kumar, Anil

2014-01-01

Background In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. Principal Finding In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Conclusion Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of

Transcriptome Analysis in Venom Gland of the Predatory Giant Ant Dinoponera quadriceps: Insights into the Polypeptide Toxin Arsenal of Hymenopterans

PubMed Central

Chong, Cheong-Meng; Leung, Siu Wai; Prieto-da-Silva, Álvaro R. B.; Havt, Alexandre; Quinet, Yves P.; Martins, Alice M. C.; Lee, Simon M. Y.; Rádis-Baptista, Gandhi

2014-01-01

Background Dinoponera quadriceps is a predatory giant ant that inhabits the Neotropical region and subdues its prey (insects) with stings that deliver a toxic cocktail of molecules. Human accidents occasionally occur and cause local pain and systemic symptoms. A comprehensive study of the D. quadriceps venom gland transcriptome is required to advance our knowledge about the toxin repertoire of the giant ant venom and to understand the physiopathological basis of Hymenoptera envenomation. Results We conducted a transcriptome analysis of a cDNA library from the D. quadriceps venom gland with Sanger sequencing in combination with whole-transcriptome shotgun deep sequencing. From the cDNA library, a total of 420 independent clones were analyzed. Although the proportion of dinoponeratoxin isoform precursors was high, the first giant ant venom inhibitor cysteine-knot (ICK) toxin was found. The deep next generation sequencing yielded a total of 2,514,767 raw reads that were assembled into 18,546 contigs. A BLAST search of the assembled contigs against non-redundant and Swiss-Prot databases showed that 6,463 contigs corresponded to BLASTx hits and indicated an interesting diversity of transcripts related to venom gene expression. The majority of these venom-related sequences code for a major polypeptide core, which comprises venom allergens, lethal-like proteins and esterases, and a minor peptide framework composed of inter-specific structurally conserved cysteine-rich toxins. Both the cDNA library and deep sequencing yielded large proportions of contigs that showed no similarities with known sequences. Conclusions To our knowledge, this is the first report of the venom gland transcriptome of the New World giant ant D. quadriceps. The glandular venom system was dissected, and the toxin arsenal was revealed; this process brought to light novel sequences that included an ICK-folded toxins, allergen proteins, esterases (phospholipases and carboxylesterases), and lethal

Towards a transcription map spanning a 250 kb area within the DiGeorge syndrome chromosome region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, W.; Emanuel, B.S.; Siegert, J.

1994-09-01

DiGeorge syndrome (DGS) and velocardiofacial syndrome (VCFS) are congenital anomalies affecting predominantly the thymus, parathyroid glands, heart and craniofacial development. Detection of 22q11.2 deletions in the majority of DGS and VCFS patients implicate 22q11 haploinsufficiency in the etiology of these disorders. The VCFS/DGS critical region lies within the proximal portion of a commonly deleted 1.2 Mb region in 22q11. A 250 kb cosmid contig covering this critical region and containing D22S74 (N25) has been established. From this contig, eleven cosmids with minimal overlap were biotinylated by nick translation, and hybridized to PCR-amplified cDNAs prepared from different tissues. The use ofmore » cDNAs from a variety of tissues increases the likelihood of identifying low abundance transcripts and tissue-specific expressed sequences. A DGCR-specific cDNA sublibrary consisting of 670 cDNA clones has been constructed. To date, 49 cDNA clones from this sub-library have been identified with single copy probes and cosmids containing putative CpG islands. Based on sequence analysis, 25 of the clones contain regions of homology to several cDNAs which map within the proximal contig. LAN is a novel partial cDNA isolated from a fetal brain library probed with one of the cosmids in the proximal contig. Using LAN as a probe, we have found 19 positive clones in the DGCR-specific cDNA sub-library (4 clones from fetal brain, 14 from adult skeletal muscle and one from fetal liver). Some of the LAN-positive clones extend the partial cDNA in the 5{prime} direction and will be useful in assembling a full length transcript. This resource will be used to develop a complete transcriptional map of the critical region in order to identify candidate gene(s) involved in the etiology of DGS/VCFS and to determine the relationship between the transcriptional and physical maps of 22q11.« less

Physical Maps for Genome Analysis of Serotype A and D Strains of the Fungal Pathogen Cryptococcus neoformans

PubMed Central

Schein, Jacqueline E.; Tangen, Kristin L.; Chiu, Readman; Shin, Heesun; Lengeler, Klaus B.; MacDonald, William Kim; Bosdet, Ian; Heitman, Joseph; Jones, Steven J.M.; Marra, Marco A.; Kronstad, James W.

2002-01-01

The basidiomycete fungus Cryptococcus neoformans is an important opportunistic pathogen of humans that poses a significant threat to immunocompromised individuals. Isolates of C. neoformans are classified into serotypes (A, B, C, D, and AD) based on antigenic differences in the polysaccharide capsule that surrounds the fungal cells. Genomic and EST sequencing projects are underway for the serotype D strain JEC21 and the serotype A strain H99. As part of a genomics program for C. neoformans, we have constructed fingerprinted bacterial artificial chromosome (BAC) clone physical maps for strains H99 and JEC21 to support the genomic sequencing efforts and to provide an initial comparison of the two genomes. The BAC clones represented an estimated 10-fold redundant coverage of the genomes of each serotype and allowed the assembly of 20 contigs each for H99 and JEC21. We found that the genomes of the two strains are sufficiently distinct to prevent coassembly of the two maps when combined fingerprint data are used to construct contigs. Hybridization experiments placed 82 markers on the JEC21 map and 102 markers on the H99 map, enabling contigs to be linked with specific chromosomes identified by electrophoretic karyotyping. These markers revealed both extensive similarity in gene order (conservation of synteny) between JEC21 and H99 as well as examples of chromosomal rearrangements including inversions and translocations. Sequencing reads were generated from the ends of the BAC clones to allow correlation of genomic shotgun sequence data with physical map contigs. The BAC maps therefore represent a valuable resource for the generation, assembly, and finishing of the genomic sequence of both JEC21 and H99. The physical maps also serve as a link between map-based and sequence-based data, providing a powerful resource for continued genomic studies. [This paper is dedicated to the memory of Michael Smith, Founding Director of the Biotechnology Laboratory and the BC Cancer

Easy and accurate reconstruction of whole HIV genomes from short-read sequence data with shiver

PubMed Central

Blanquart, François; Golubchik, Tanya; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Croucher, Nicholas J; Hall, Matthew; Hillebregt, Mariska; Ratmann, Oliver; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Cornelissen, Marion; Kellam, Paul; Reiss, Peter

2018-01-01

Abstract Studying the evolution of viruses and their molecular epidemiology relies on accurate viral sequence data, so that small differences between similar viruses can be meaningfully interpreted. Despite its higher throughput and more detailed minority variant data, next-generation sequencing has yet to be widely adopted for HIV. The difficulty of accurately reconstructing the consensus sequence of a quasispecies from reads (short fragments of DNA) in the presence of large between- and within-host diversity, including frequent indels, may have presented a barrier. In particular, mapping (aligning) reads to a reference sequence leads to biased loss of information; this bias can distort epidemiological and evolutionary conclusions. De novo assembly avoids this bias by aligning the reads to themselves, producing a set of sequences called contigs. However contigs provide only a partial summary of the reads, misassembly may result in their having an incorrect structure, and no information is available at parts of the genome where contigs could not be assembled. To address these problems we developed the tool shiver to pre-process reads for quality and contamination, then map them to a reference tailored to the sample using corrected contigs supplemented with the user’s choice of existing reference sequences. Run with two commands per sample, it can easily be used for large heterogeneous data sets. We used shiver to reconstruct the consensus sequence and minority variant information from paired-end short-read whole-genome data produced with the Illumina platform, for sixty-five existing publicly available samples and fifty new samples. We show the systematic superiority of mapping to shiver’s constructed reference compared with mapping the same reads to the closest of 3,249 real references: median values of 13 bases called differently and more accurately, 0 bases called differently and less accurately, and 205 bases of missing sequence recovered. We also

Easy and accurate reconstruction of whole HIV genomes from short-read sequence data with shiver.

PubMed

Wymant, Chris; Blanquart, François; Golubchik, Tanya; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Croucher, Nicholas J; Hall, Matthew; Hillebregt, Mariska; Ong, Swee Hoe; Ratmann, Oliver; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Berkhout, Ben; Cornelissen, Marion; Kellam, Paul; Reiss, Peter; Fraser, Christophe

2018-01-01

Studying the evolution of viruses and their molecular epidemiology relies on accurate viral sequence data, so that small differences between similar viruses can be meaningfully interpreted. Despite its higher throughput and more detailed minority variant data, next-generation sequencing has yet to be widely adopted for HIV. The difficulty of accurately reconstructing the consensus sequence of a quasispecies from reads (short fragments of DNA) in the presence of large between- and within-host diversity, including frequent indels, may have presented a barrier. In particular, mapping (aligning) reads to a reference sequence leads to biased loss of information; this bias can distort epidemiological and evolutionary conclusions. De novo assembly avoids this bias by aligning the reads to themselves, producing a set of sequences called contigs. However contigs provide only a partial summary of the reads, misassembly may result in their having an incorrect structure, and no information is available at parts of the genome where contigs could not be assembled. To address these problems we developed the tool shiver to pre-process reads for quality and contamination, then map them to a reference tailored to the sample using corrected contigs supplemented with the user's choice of existing reference sequences. Run with two commands per sample, it can easily be used for large heterogeneous data sets. We used shiver to reconstruct the consensus sequence and minority variant information from paired-end short-read whole-genome data produced with the Illumina platform, for sixty-five existing publicly available samples and fifty new samples. We show the systematic superiority of mapping to shiver's constructed reference compared with mapping the same reads to the closest of 3,249 real references: median values of 13 bases called differently and more accurately, 0 bases called differently and less accurately, and 205 bases of missing sequence recovered. We also successfully applied

Sequencing of transcriptomes from two Miscanthus species reveals functional specificity in rhizomes, and clarifies evolutionary relationships

PubMed Central

2014-01-01

Background Miscanthus is a promising biomass crop for temperate regions. Despite the increasing interest in this plant, limited sequence information has constrained research into its biology, physiology, and breeding. The whole genome transcriptomes of M. sinensis and M. sacchariflorus presented in this study may provide good resources to understand functional compositions of two important Miscanthus genomes and their evolutionary relationships. Results For M. sinensis, a total of 457,891 and 512,950 expressed sequence tags (ESTs) were produced from leaf and rhizome tissues, respectively, which were assembled into 12,166 contigs and 89,648 singletons for leaf, and 13,170 contigs and 112,138 singletons for rhizome. For M. sacchariflorus, a total of 288,806 and 267,952 ESTs from leaf and rhizome tissues, respectively, were assembled into 8,732 contigs and 66,881 singletons for leaf, and 8,104 contigs and 63,212 singletons for rhizome. Based on the distributions of synonymous nucleotide substitution (Ks), sorghum and Miscanthus diverged about 6.2 million years ago (MYA), Saccharum and Miscanthus diverged 4.6 MYA, and M. sinensis and M. sacchariflorus diverged 1.5 MYA. The pairwise alignment of predicted protein sequences from sorghum-Miscanthus and two Miscanthus species found a total of 43,770 and 35,818 nsSNPs, respectively. The impacts of striking mutations found by nsSNPs were much lower between sorghum and Miscanthus than those between the two Miscanthus species, perhaps as a consequence of the much higher level of gene duplication in Miscanthus and resulting ability to buffer essential functions against disturbance. Conclusions The ESTs generated in the present study represent a significant addition to Miscanthus functional genomics resources, permitting us to discover some candidate genes associated with enhanced biomass production. Ks distributions based on orthologous ESTs may serve as a guideline for future research into the evolution of Miscanthus species

Generation and characterization of the sea bass Dicentrarchus labrax brain and liver transcriptomes.

PubMed

Magnanou, Elodie; Klopp, Christophe; Noirot, Celine; Besseau, Laurence; Falcón, Jack

2014-07-01

The sea bass Dicentrarchus labrax is the center of interest of an increasing number of basic or applied research investigations, even though few genomic or transcriptomic data is available. Current public data only represent a very partial view of its transcriptome. To fill this need, we characterized brain and liver transcriptomes in a generalist manner that would benefit the entire scientific community. We also tackled some bioinformatics questions, related to the effect of RNA fragment size on the assembly quality. Using Illumina RNA-seq, we sequenced organ pools from both wild and farmed Atlantic and Mediterranean fishes. We built two distinct cDNA libraries per organ that only differed by the length of the selected mRNA fragments. Efficiency of assemblies performed on either or both fragments size differed depending on the organ, but remained very close reflecting the quality of the technical replication. We generated more than 19,538Mbp of data. Over 193million reads were assembled into 35,073 contigs (average length=2374bp; N50=3257). 59% contigs were annotated with SwissProt, which corresponded to 12,517 unique genes. We compared the Gene Ontology (GO) contig distribution between the sea bass and the tilapia. We also looked for brain and liver GO specific signatures as well as KEGG pathway coverage. 23,050 putative micro-satellites and 134,890 putative SNPs were identified. Our sampling strategy and assembly pipeline provided a reliable and broad reference transcriptome for the sea bass. It constitutes an indisputable quantitative and qualitative improvement of the public data, as it provides 5 times more base pairs with fewer and longer contigs. Both organs present unique signatures consistent with their specific physiological functions. The discrepancy in fragment size effect on assembly quality between organs lies in their difference in complexity and thus does not allow prescribing any general strategy. This information on two key organs will facilitate

RNA-Seq reveals genotype-specific molecular responses to water deficit in eucalyptus

PubMed Central

2011-01-01

Background In a context of climate change, phenotypic plasticity provides long-lived species, such as trees, with the means to adapt to environmental variations occurring within a single generation. In eucalyptus plantations, water availability is a key factor limiting productivity. However, the molecular mechanisms underlying the adaptation of eucalyptus to water shortage remain unclear. In this study, we compared the molecular responses of two commercial eucalyptus hybrids during the dry season. Both hybrids differ in productivity when grown under water deficit. Results Pyrosequencing of RNA extracted from shoot apices provided extensive transcriptome coverage - a catalog of 129,993 unigenes (49,748 contigs and 80,245 singletons) was generated from 398 million base pairs, or 1.14 million reads. The pyrosequencing data enriched considerably existing Eucalyptus EST collections, adding 36,985 unigenes not previously represented. Digital analysis of read abundance in 14,460 contigs identified 1,280 that were differentially expressed between the two genotypes, 155 contigs showing differential expression between treatments (irrigated vs. non irrigated conditions during the dry season), and 274 contigs with significant genotype-by-treatment interaction. The more productive genotype displayed a larger set of genes responding to water stress. Moreover, stress signal transduction seemed to involve different pathways in the two genotypes, suggesting that water shortage induces distinct cellular stress cascades. Similarly, the response of functional proteins also varied widely between genotypes: the most productive genotype decreased expression of genes related to photosystem, transport and secondary metabolism, whereas genes related to primary metabolism and cell organisation were over-expressed. Conclusions For the most productive genotype, the ability to express a broader set of genes in response to water availability appears to be a key characteristic in the maintenance

GAA repeat expansion mutation mouse models of Friedreich ataxia exhibit oxidative stress leading to progressive neuronal and cardiac pathology.

PubMed

Al-Mahdawi, Sahar; Pinto, Ricardo Mouro; Varshney, Dhaval; Lawrence, Lorraine; Lowrie, Margaret B; Hughes, Sian; Webster, Zoe; Blake, Julian; Cooper, J Mark; King, Rosalind; Pook, Mark A

2006-11-01

Friedreich ataxia (FRDA) is a neurodegenerative disorder caused by an unstable GAA repeat expansion mutation within intron 1 of the FXN gene. However, the origins of the GAA repeat expansion, its unstable dynamics within different cells and tissues, and its effects on frataxin expression are not yet completely understood. Therefore, we have chosen to generate representative FRDA mouse models by using the human FXN GAA repeat expansion itself as the genetically modified mutation. We have previously reported the establishment of two lines of human FXN YAC transgenic mice that contain unstable GAA repeat expansions within the appropriate genomic context. We now describe the generation of FRDA mouse models by crossbreeding of both lines of human FXN YAC transgenic mice with heterozygous Fxn knockout mice. The resultant FRDA mice that express only human-derived frataxin show comparatively reduced levels of frataxin mRNA and protein expression, decreased aconitase activity, and oxidative stress, leading to progressive neurodegenerative and cardiac pathological phenotypes. Coordination deficits are present, as measured by accelerating rotarod analysis, together with a progressive decrease in locomotor activity and increase in weight. Large vacuoles are detected within neurons of the dorsal root ganglia (DRG), predominantly within the lumbar regions in 6-month-old mice, but spreading to the cervical regions after 1 year of age. Secondary demyelination of large axons is also detected within the lumbar roots of older mice. Lipofuscin deposition is increased in both DRG neurons and cardiomyocytes, and iron deposition is detected in cardiomyocytes after 1 year of age. These mice represent the first GAA repeat expansion-based FRDA mouse models that exhibit progressive FRDA-like pathology and thus will be of use in testing potential therapeutic strategies, particularly GAA repeat-based strategies.

Combined Treatment with the Mood Stabilizers Lithium and Valproate Produces Multiple Beneficial Effects in Transgenic Mouse Models of Huntington's Disease

PubMed Central

Chiu, Chi-Tso; Liu, Guangping; Leeds, Peter; Chuang, De-Maw

2011-01-01

Emerging evidence suggests that the mood stabilizers lithium and valproate (VPA) have broad neuroprotective and neurotrophic properties, and that these occur via inhibition of glycogen synthase kinase 3 (GSK-3) and histone deacetylases (HDACs), respectively. Huntington's disease (HD) is an inherited neurodegenerative disorder characterized by impaired movement, cognitive and psychiatric disturbances, and premature death. We treated N171-82Q and YAC128 mice, two mouse models of HD varying in genetic backgrounds and pathological progressions, with a diet containing therapeutic doses of lithium, VPA, or both. Untreated, these transgenic mice displayed a decrease in levels of GSK-3β serine 9 phosphorylation and histone H3 acetylation in the striatum and cerebral cortex around the onset of behavioral deficits, indicating a hyperactivity of GSK-3β and HDACs. Using multiple well-validated behavioral tests, we found that co-treatment with lithium and VPA more effectively alleviated spontaneous locomotor deficits and depressive-like behaviors in both models of HD mice. Furthermore, compared with monotherapy with either drug alone, co-treatment more successfully improved motor skill learning and coordination in N171-82Q mice, and suppressed anxiety-like behaviors in YAC128 mice. This combined treatment consistently inhibited GSK-3β and HDACs, and caused a sustained elevation in striatal as well as cortical brain-derived neurotrophic factor and heat shock protein 70. Importantly, co-treatment markedly prolonged median survival of N171-82Q mice from 31.6 to 41.6 weeks. Given that there is presently no proven treatment for HD, our results suggest that combined treatment with lithium and VPA, two mood stabilizers with a long history of safe use in humans, may have important therapeutic potential for HD patients. PMID:21796107

Induction of NKCF-like activity in mixed lymphocyte-tumor cell culture: direct involvement of mycoplasma infection of tumor cells.

PubMed

Wayner, E A; Brooks, C G

1984-04-01

Co-culture of CBA/J spleen cells and certain lines of YAC-1 stimulators resulted in the appearance of NKCF-like activity in 24- to 48-hr supernatants. Numerous other in vitro cell lines were effective stimulators of this splenic cytotoxic factor (SCF). The cells participating in SCF production were absent from normal thymocytes and were present in BALB/c nu/nu spleen, were nonadherent, asialo GM1+, and bore low levels of Thy-1.2. SCF could mediate lysis of certain NK-sensitive tumor targets in an 18-hr 51Cr-release assay. However, the induction of SCF was not correlated with the ability of a particular cell line to be lysed by NK cells, but showed an absolute correlation with the presence of mycoplasma contamination in cultured tumor cell lines. Mycoplasma negative cell lines, including an uninfected but NK-sensitive subline of YAC-1, were unable to induce SCF. Decontamination of mycoplasma-infected lines with antibiotics or by passage through syngeneic mice abrogated the ability of infected tumor cells to stimulate SCF. The ability to induce SCF could be restored by reinfection with mycoplasma. Tumor cell-free supernatants from contaminated cultures were mitogenic for CBA spleen cells and could themselves induce SCF activity in spleen cell supernatants. SCF production and the agent responsible could be removed by passing such supernatants through 0.1-micron filters. The organism apparently responsible for SCF induction from CBA spleen cells was typed and found to be Mycoplasma orale, a nonfermentative, arginine-dependent, common tissue culture contaminant. About 50 to 60% of SCF activity could be removed by 0.1-micron filters, suggesting that SCF is composed of two components: mycoplasma organisms themselves and a soluble cytotoxic factor produced in response to mycoplasma.

Comparative studies using the Morris water maze to assess spatial memory deficits in two transgenic mouse models of Alzheimer's disease.

PubMed

Edwards, Stephen R; Hamlin, Adam S; Marks, Nicola; Coulson, Elizabeth J; Smith, Maree T

2014-10-01

Evaluation of the efficacy of novel therapeutics for potential treatment of Alzheimer's disease (AD) requires an animal model that develops age-related cognitive deficits reproducibly between independent groups of investigators. Herein we assessed comparative temporal changes in spatial memory function in two commercially available transgenic mouse models of AD using the Morris water maze (MWM), incorporating both visible and hidden platform training. Individual cohorts of cDNA-based 'line 85'-derived double-transgenic mice coexpressing the 'Swedish' mutation of amyloid precursor protein (APPSwe) and the presenillin 1 (PS1) 'dE9' mutation were assessed in the MWM at mean ages of 3.6, 9.3 and 14.8 months. We found significant deficits in spatial memory retention in APPSwe/PS1dE9 mice aged 3.6 months and robust deficits in spatial memory acquisition and retention in APPSwe/PS1dE9 mice aged 9.3 months, with a further significant decline by age 14.8 months. β-Amyloid deposits were present in brain sections by 7.25 months of age. In contrast, MWM studies with individual cohorts (aged 4-21 months) of single-transgenic genomic-based APPSwe mice expressing APPSwe on a yeast artificial chromosomal (YAC) construct showed no significant deficits in spatial memory acquisition until 21 months of age. There were no significant deficits in spatial memory retention up to 21 months of age and β-amyloid deposits were not present in brain sections up to 24 months of age. These data, generated using comprehensive study designs, show that APPSwe/PS1dE9 but not APPSwe YAC mice appear to provide a suitably robust model of AD for efficacy assessment of novel AD treatments in development. © 2014 Wiley Publishing Asia Pty Ltd.

De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes.

PubMed

Ashrafi, Hamid; Hill, Theresa; Stoffel, Kevin; Kozik, Alexander; Yao, Jiqiang; Chin-Wo, Sebastian Reyes; Van Deynze, Allen

2012-10-30

Molecular breeding of pepper (Capsicum spp.) can be accelerated by developing DNA markers associated with transcriptomes in breeding germplasm. Before the advent of next generation sequencing (NGS) technologies, the majority of sequencing data were generated by the Sanger sequencing method. By leveraging Sanger EST data, we have generated a wealth of genetic information for pepper including thousands of SNPs and Single Position Polymorphic (SPP) markers. To complement and enhance these resources, we applied NGS to three pepper genotypes: Maor, Early Jalapeño and Criollo de Morelos-334 (CM334) to identify SNPs and SSRs in the assembly of these three genotypes. Two pepper transcriptome assemblies were developed with different purposes. The first reference sequence, assembled by CAP3 software, comprises 31,196 contigs from >125,000 Sanger-EST sequences that were mainly derived from a Korean F1-hybrid line, Bukang. Overlapping probes were designed for 30,815 unigenes to construct a pepper Affymetrix GeneChip® microarray for whole genome analyses. In addition, custom Python scripts were used to identify 4,236 SNPs in contigs of the assembly. A total of 2,489 simple sequence repeats (SSRs) were identified from the assembly, and primers were designed for the SSRs. Annotation of contigs using Blast2GO software resulted in information for 60% of the unigenes in the assembly. The second transcriptome assembly was constructed from more than 200 million Illumina Genome Analyzer II reads (80-120 nt) using a combination of Velvet, CLC workbench and CAP3 software packages. BWA, SAMtools and in-house Perl scripts were used to identify SNPs among three pepper genotypes. The SNPs were filtered to be at least 50 bp from any intron-exon junctions as well as flanking SNPs. More than 22,000 high-quality putative SNPs were identified. Using the MISA software, 10,398 SSR markers were also identified within the Illumina transcriptome assembly and primers were designed for the identified

De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes

PubMed Central

2012-01-01

Background Molecular breeding of pepper (Capsicum spp.) can be accelerated by developing DNA markers associated with transcriptomes in breeding germplasm. Before the advent of next generation sequencing (NGS) technologies, the majority of sequencing data were generated by the Sanger sequencing method. By leveraging Sanger EST data, we have generated a wealth of genetic information for pepper including thousands of SNPs and Single Position Polymorphic (SPP) markers. To complement and enhance these resources, we applied NGS to three pepper genotypes: Maor, Early Jalapeño and Criollo de Morelos-334 (CM334) to identify SNPs and SSRs in the assembly of these three genotypes. Results Two pepper transcriptome assemblies were developed with different purposes. The first reference sequence, assembled by CAP3 software, comprises 31,196 contigs from >125,000 Sanger-EST sequences that were mainly derived from a Korean F1-hybrid line, Bukang. Overlapping probes were designed for 30,815 unigenes to construct a pepper Affymetrix GeneChip® microarray for whole genome analyses. In addition, custom Python scripts were used to identify 4,236 SNPs in contigs of the assembly. A total of 2,489 simple sequence repeats (SSRs) were identified from the assembly, and primers were designed for the SSRs. Annotation of contigs using Blast2GO software resulted in information for 60% of the unigenes in the assembly. The second transcriptome assembly was constructed from more than 200 million Illumina Genome Analyzer II reads (80–120 nt) using a combination of Velvet, CLC workbench and CAP3 software packages. BWA, SAMtools and in-house Perl scripts were used to identify SNPs among three pepper genotypes. The SNPs were filtered to be at least 50 bp from any intron-exon junctions as well as flanking SNPs. More than 22,000 high-quality putative SNPs were identified. Using the MISA software, 10,398 SSR markers were also identified within the Illumina transcriptome assembly and primers were

Molecular characterization and combined genotype association study of bovine cluster of differentiation 14 gene with clinical mastitis in crossbred dairy cattle.

PubMed

Selvan, A Sakthivel; Gupta, I D; Verma, A; Chaudhari, M V; Magotra, A

2016-07-01

The present study was undertaken with the objectives to characterize and to analyze combined genotypes of cluster of differentiation 14 (CD14) gene to explore its association with clinical mastitis in Karan Fries (KF) cows maintained in the National Dairy Research Institute herd, Karnal. Genomic DNA was extracted using blood of randomly selected 94 KF lactating cattle by phenol-chloroform method. After checking its quality and quantity, polymerase chain reaction (PCR) was carried out using six sets of reported gene-specific primers to amplify complete KF CD14 gene. The forward and reverse sequences for each PCR fragments were assembled to form complete sequence for the respective region of KF CD14 gene. The multiple sequence alignments of the edited sequence with the corresponding reference with reported Bos taurus sequence (EU148610.1) were performed with ClustalW software to identify single nucleotide polymorphisms (SNPs). Basic Local Alignment Search Tool analysis was performed to compare the sequence identity of KF CD14 gene with other species. The restriction fragment length polymorphism (RFLP) analysis was carried out in all KF cows using Helicobacter pylori 188I (Hpy188I) (contig 2) and Haemophilus influenzae I (HinfI) (contig 4) restriction enzyme (RE). Cows were assigned genotypes obtained by PCR-RFLP analysis, and association study was done using Chi-square (χ (2)) test. The genotypes of both contigs (loci) number 2 and 4 were combined with respect to each animal to construct combined genotype patterns. Two types of sequences of KF were obtained: One with 2630 bp having one insertion at 616 nucleotide (nt) position and one deletion at 1117 nt position, and the another sequence was of 2629 bp having only one deletion at 615 nt position. ClustalW, multiple alignments of KF CD14 gene sequence with B. taurus cattle sequence (EU148610.1), revealed 24 nt changes (SNPs). Cows were also screened using PCR-RFLP with Hpy188I (contig 2) and HinfI (contig 4) RE

Optimizing and evaluating the reconstruction of Metagenome-assembled microbial genomes.

PubMed

Papudeshi, Bhavya; Haggerty, J Matthew; Doane, Michael; Morris, Megan M; Walsh, Kevin; Beattie, Douglas T; Pande, Dnyanada; Zaeri, Parisa; Silva, Genivaldo G Z; Thompson, Fabiano; Edwards, Robert A; Dinsdale, Elizabeth A

2017-11-28

Microbiome/host interactions describe characteristics that affect the host's health. Shotgun metagenomics includes sequencing a random subset of the microbiome to analyze its taxonomic and metabolic potential. Reconstruction of DNA fragments into genomes from metagenomes (called metagenome-assembled genomes) assigns unknown fragments to taxa/function and facilitates discovery of novel organisms. Genome reconstruction incorporates sequence assembly and sorting of assembled sequences into bins, characteristic of a genome. However, the microbial community composition, including taxonomic and phylogenetic diversity may influence genome reconstruction. We determine the optimal reconstruction method for four microbiome projects that had variable sequencing platforms (IonTorrent and Illumina), diversity (high or low), and environment (coral reefs and kelp forests), using a set of parameters to select for optimal assembly and binning tools. We tested the effects of the assembly and binning processes on population genome reconstruction using 105 marine metagenomes from 4 projects. Reconstructed genomes were obtained from each project using 3 assemblers (IDBA, MetaVelvet, and SPAdes) and 2 binning tools (GroopM and MetaBat). We assessed the efficiency of assemblers using statistics that including contig continuity and contig chimerism and the effectiveness of binning tools using genome completeness and taxonomic identification. We concluded that SPAdes, assembled more contigs (143,718 ± 124 contigs) of longer length (N50 = 1632 ± 108 bp), and incorporated the most sequences (sequences-assembled = 19.65%). The microbial richness and evenness were maintained across the assembly, suggesting low contig chimeras. SPAdes assembly was responsive to the biological and technological variations within the project, compared with other assemblers. Among binning tools, we conclude that MetaBat produced bins with less variation in GC content (average standard deviation: 1

Final Report for LDRD Project 02-ERD-069: Discovering the Unknown Mechanism(s) of Virulence in a BW, Class A Select Agent

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, P; Garcia, E

2003-02-06

The goal of this proposed effort was to assess the difficulty in identifying and characterizing virulence candidate genes in an organism for which very limited data exists. This was accomplished by first addressing the finishing phase of draft-sequenced F. tularensis genomes and conducting comparative analyses to determine the coding potential of each genome; to discover the differences in genome structure and content, and to identify potential genes whose products may be involved in the F. tularensis virulence process. The project was divided into three parts: (1) Genome finishing: This part involves determining the order and orientation of the consensus sequencesmore » of contigs obtained from Phrap assemblies of random draft genomic sequences. This tedious process consists of linking contig ends using information embedded in each sequence file that relates the sequence to the original cloned insert. Since inserts are sequenced from both ends, we can establish a link between these paired-ends in different contigs and thus order and orient contigs. Since these genomes carry numerous copies of insertion sequences, these repeated elements ''confuse'' the Phrap assembly program. It is thus necessary to break these contigs apart at the repeated sequences and individually join the proper flanking regions using paired-end information, or using results of comparisons against a similar genome. Larger repeated elements such as the small subunit ribosomal RNA operon require verification with PCR. Tandem repeats require manual intervention and typically rely on single nucleotide polymorphisms to be resolved. Remaining gaps require PCR reactions and sequencing. Once the genomes have been ''closed'', low quality regions are addressed by resequencing reactions. (2) Genome analysis: The final consensus sequences are processed by combining the results of three gene modelers: Glimmer, Critica and Generation. The final gene models are submitted to a battery of homology searches

Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

PubMed

Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

2017-05-01

Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

An evaluation of genotyping by sequencing (GBS) to map the Breviaristatum-e (ari-e) locus in cultivated barley.

PubMed

Liu, Hui; Bayer, Micha; Druka, Arnis; Russell, Joanne R; Hackett, Christine A; Poland, Jesse; Ramsay, Luke; Hedley, Pete E; Waugh, Robbie

2014-02-06

We explored the use of genotyping by sequencing (GBS) on a recombinant inbred line population (GPMx) derived from a cross between the two-rowed barley cultivar 'Golden Promise' (ari-e.GP/Vrs1) and the six-rowed cultivar 'Morex' (Ari-e/vrs1) to map plant height. We identified three Quantitative Trait Loci (QTL), the first in a region encompassing the spike architecture gene Vrs1 on chromosome 2H, the second in an uncharacterised centromeric region on chromosome 3H, and the third in a region of chromosome 5H coinciding with the previously described dwarfing gene Breviaristatum-e (Ari-e). Barley cultivars in North-western Europe largely contain either of two dwarfing genes; Denso on chromosome 3H, a presumed ortholog of the rice green revolution gene OsSd1, or Breviaristatum-e (ari-e) on chromosome 5H. A recessive mutant allele of the latter gene, ari-e.GP, was introduced into cultivation via the cv. 'Golden Promise' that was a favourite of the Scottish malt whisky industry for many years and is still used in agriculture today. Using GBS mapping data and phenotypic measurements we show that ari-e.GP maps to a small genetic interval on chromosome 5H and that alternative alleles at a region encompassing Vrs1 on 2H along with a region on chromosome 3H also influence plant height. The location of Ari-e is supported by analysis of near-isogenic lines containing different ari-e alleles. We explored use of the GBS to populate the region with sequence contigs from the recently released physically and genetically integrated barley genome sequence assembly as a step towards Ari-e gene identification. GBS was an effective and relatively low-cost approach to rapidly construct a genetic map of the GPMx population that was suitable for genetic analysis of row type and height traits, allowing us to precisely position ari-e.GP on chromosome 5H. Mapping resolution was lower than we anticipated. We found the GBS data more complex to analyse than other data types but it did directly

The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.).

PubMed

Raju, Nikku L; Gnanesh, Belaghihalli N; Lekha, Pazhamala; Jayashree, Balaji; Pande, Suresh; Hiremath, Pavana J; Byregowda, Munishamappa; Singh, Nagendra K; Varshney, Rajeev K

2010-03-11

Pigeonpea (Cajanus cajan (L.) Millsp) is one of the major grain legume crops of the tropics and subtropics, but biotic stresses [Fusarium wilt (FW), sterility mosaic disease (SMD), etc.] are serious challenges for sustainable crop production. Modern genomic tools such as molecular markers and candidate genes associated with resistance to these stresses offer the possibility of facilitating pigeonpea breeding for improving biotic stress resistance. Availability of limited genomic resources, however, is a serious bottleneck to undertake molecular breeding in pigeonpea to develop superior genotypes with enhanced resistance to above mentioned biotic stresses. With an objective of enhancing genomic resources in pigeonpea, this study reports generation and analysis of comprehensive resource of FW- and SMD- responsive expressed sequence tags (ESTs). A total of 16 cDNA libraries were constructed from four pigeonpea genotypes that are resistant and susceptible to FW ('ICPL 20102' and 'ICP 2376') and SMD ('ICP 7035' and 'TTB 7') and a total of 9,888 (9,468 high quality) ESTs were generated and deposited in dbEST of GenBank under accession numbers GR463974 to GR473857 and GR958228 to GR958231. Clustering and assembly analyses of these ESTs resulted into 4,557 unique sequences (unigenes) including 697 contigs and 3,860 singletons. BLASTN analysis of 4,557 unigenes showed a significant identity with ESTs of different legumes (23.2-60.3%), rice (28.3%), Arabidopsis (33.7%) and poplar (35.4%). As expected, pigeonpea ESTs are more closely related to soybean (60.3%) and cowpea ESTs (43.6%) than other plant ESTs. Similarly, BLASTX similarity results showed that only 1,603 (35.1%) out of 4,557 total unigenes correspond to known proteins in the UniProt database (

The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.)

PubMed Central

2010-01-01

Background Pigeonpea (Cajanus cajan (L.) Millsp) is one of the major grain legume crops of the tropics and subtropics, but biotic stresses [Fusarium wilt (FW), sterility mosaic disease (SMD), etc.] are serious challenges for sustainable crop production. Modern genomic tools such as molecular markers and candidate genes associated with resistance to these stresses offer the possibility of facilitating pigeonpea breeding for improving biotic stress resistance. Availability of limited genomic resources, however, is a serious bottleneck to undertake molecular breeding in pigeonpea to develop superior genotypes with enhanced resistance to above mentioned biotic stresses. With an objective of enhancing genomic resources in pigeonpea, this study reports generation and analysis of comprehensive resource of FW- and SMD- responsive expressed sequence tags (ESTs). Results A total of 16 cDNA libraries were constructed from four pigeonpea genotypes that are resistant and susceptible to FW ('ICPL 20102' and 'ICP 2376') and SMD ('ICP 7035' and 'TTB 7') and a total of 9,888 (9,468 high quality) ESTs were generated and deposited in dbEST of GenBank under accession numbers GR463974 to GR473857 and GR958228 to GR958231. Clustering and assembly analyses of these ESTs resulted into 4,557 unique sequences (unigenes) including 697 contigs and 3,860 singletons. BLASTN analysis of 4,557 unigenes showed a significant identity with ESTs of different legumes (23.2-60.3%), rice (28.3%), Arabidopsis (33.7%) and poplar (35.4%). As expected, pigeonpea ESTs are more closely related to soybean (60.3%) and cowpea ESTs (43.6%) than other plant ESTs. Similarly, BLASTX similarity results showed that only 1,603 (35.1%) out of 4,557 total unigenes correspond to known proteins in the UniProt database (≤ 1E-08). Functional categorization of the annotated unigenes sequences showed that 153 (3.3%) genes were assigned to cellular component category, 132 (2.8%) to biological process, and 132 (2.8%) in

Draft Genome Sequence of Gordonia sp. Strain UCD-TK1 (Phylum Actinobacteria)

PubMed Central

Koenigsaecker, Tynisha M.; Coil, David A.

2016-01-01

Here, we present the draft genome of Gordonia sp. strain UCD-TK1. The assembly contains 5,470,576 bp in 98 contigs. This strain was isolated from a disinfected ambulatory surgery center. PMID:27738036

De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

PubMed Central

O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.

2012-01-01

Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: a genomics approach to personalized medicine.

PubMed

O'Leary, Ryan E; Shih, Jean C; Hyland, Keith; Kramer, Nancy; Asher, Y Jane Tavyev; Graham, John M

2012-05-01

Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4-6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood. These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient's cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

[Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

PubMed

Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

2013-01-01

Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

Evidence for retrovirus and paramyxovirus infection of multiple bat species in china.

PubMed

Yuan, Lihong; Li, Min; Li, Linmiao; Monagin, Corina; Chmura, Aleksei A; Schneider, Bradley S; Epstein, Jonathan H; Mei, Xiaolin; Shi, Zhengli; Daszak, Peter; Chen, Jinping

2014-05-16

Bats are recognized reservoirs for many emerging zoonotic viruses of public health importance. Identifying and cataloguing the viruses of bats is a logical approach to evaluate the range of potential zoonoses of bat origin. We characterized the fecal pathogen microbiome of both insectivorous and frugivorous bats, incorporating 281 individual bats comprising 20 common species, which were sampled in three locations of Yunnan province, by combining reverse transcription polymerase chain reaction (RT-PCR) assays and next-generation sequencing. Seven individual bats were paramyxovirus-positive by RT-PCR using degenerate primers, and these paramyxoviruses were mainly classified into three genera (Rubulavirus, Henipavirus and Jeilongvirus). Various additional novel pathogens were detected in the paramyxovirus-positive bats using Illumina sequencing. A total of 7066 assembled contigs (≥200 bp) were constructed, and 105 contigs matched eukaryotic viruses (of them 103 belong to 2 vertebrate virus families, 1 insect virus, and 1 mycovirus), 17 were parasites, and 4913 were homologous to prokaryotic microorganisms. Among the 103 vertebrate viral contigs, 79 displayed low identity (<70%) to known viruses including human viruses at the amino acid level, suggesting that these belong to novel and genetically divergent viruses. Overall, the most frequently identified viruses, particularly in bats from the family Hipposideridae, were retroviruses. The present study expands our understanding of the bat virome in species commonly found in Yunnan, China, and provides insight into the overall diversity of viruses that may be capable of directly or indirectly crossing over into humans.

Evidence for Retrovirus and Paramyxovirus Infection of Multiple Bat Species in China

PubMed Central

Yuan, Lihong; Li, Min; Li, Linmiao; Monagin, Corina; Chmura, Aleksei A.; Schneider, Bradley S.; Epstein, Jonathan H.; Mei, Xiaolin; Shi, Zhengli; Daszak, Peter; Chen, Jinping

2014-01-01

Bats are recognized reservoirs for many emerging zoonotic viruses of public health importance. Identifying and cataloguing the viruses of bats is a logical approach to evaluate the range of potential zoonoses of bat origin. We characterized the fecal pathogen microbiome of both insectivorous and frugivorous bats, incorporating 281 individual bats comprising 20 common species, which were sampled in three locations of Yunnan province, by combining reverse transcription polymerase chain reaction (RT-PCR) assays and next-generation sequencing. Seven individual bats were paramyxovirus-positive by RT-PCR using degenerate primers, and these paramyxoviruses were mainly classified into three genera (Rubulavirus, Henipavirus and Jeilongvirus). Various additional novel pathogens were detected in the paramyxovirus-positive bats using Illumina sequencing. A total of 7066 assembled contigs (≥200 bp) were constructed, and 105 contigs matched eukaryotic viruses (of them 103 belong to 2 vertebrate virus families, 1 insect virus, and 1 mycovirus), 17 were parasites, and 4913 were homologous to prokaryotic microorganisms. Among the 103 vertebrate viral contigs, 79 displayed low identity (<70%) to known viruses including human viruses at the amino acid level, suggesting that these belong to novel and genetically divergent viruses. Overall, the most frequently identified viruses, particularly in bats from the family Hipposideridae, were retroviruses. The present study expands our understanding of the bat virome in species commonly found in Yunnan, China, and provides insight into the overall diversity of viruses that may be capable of directly or indirectly crossing over into humans. PMID:24841387

Transcriptome Analysis of Nine Tissues to Discover Genes Involved in the Biosynthesis of Active Ingredients in Sophora flavescens.

PubMed

Han, Rongchun; Takahashi, Hiroki; Nakamura, Michimi; Bunsupa, Somnuk; Yoshimoto, Naoko; Yamamoto, Hirobumi; Suzuki, Hideyuki; Shibata, Daisuke; Yamazaki, Mami; Saito, Kazuki

2015-01-01

Sophora flavescens AITON (kurara) has long been used to treat various diseases. Although several research findings revealed the biosynthetic pathways of its characteristic chemical components as represented by matrine, insufficient analysis of transcriptome data hampered in-depth analysis of the underlying putative genes responsible for the biosynthesis of pharmaceutical chemical components. In this study, more than 200 million fastq format reads were generated by Illumina's next-generation sequencing approach using nine types of tissue from S. flavescens, followed by CLC de novo assembly, ultimately yielding 83,325 contigs in total. By mapping the reads back to the contigs, reads per kilobase of the transcript per million mapped reads values were calculated to demonstrate gene expression levels, and overrepresented gene ontology terms were evaluated using Fisher's exact test. In search of the putative genes relevant to essential metabolic pathways, all 1350 unique enzyme commission numbers were used to map pathways against the Kyoto Encyclopedia of Genes and Genomes. By analyzing expression patterns, we proposed some candidate genes involved in the biosynthesis of isoflavonoids and quinolizidine alkaloids. Adopting RNA-Seq analysis, we obtained substantially credible contigs for downstream work. The preferential expression of the gene for putative lysine/ornithine decarboxylase committed in the initial step of matrine biosynthesis in leaves and stems was confirmed in semi-quantitative polymerase chain reaction (PCR) analysis. The findings in this report may serve as a stepping-stone for further research into this promising medicinal plant.

BusyBee Web: metagenomic data analysis by bootstrapped supervised binning and annotation

PubMed Central

Kiefer, Christina; Fehlmann, Tobias; Backes, Christina

2017-01-01

Abstract Metagenomics-based studies of mixed microbial communities are impacting biotechnology, life sciences and medicine. Computational binning of metagenomic data is a powerful approach for the culture-independent recovery of population-resolved genomic sequences, i.e. from individual or closely related, constituent microorganisms. Existing binning solutions often require a priori characterized reference genomes and/or dedicated compute resources. Extending currently available reference-independent binning tools, we developed the BusyBee Web server for the automated deconvolution of metagenomic data into population-level genomic bins using assembled contigs (Illumina) or long reads (Pacific Biosciences, Oxford Nanopore Technologies). A reversible compression step as well as bootstrapped supervised binning enable quick turnaround times. The binning results are represented in interactive 2D scatterplots. Moreover, bin quality estimates, taxonomic annotations and annotations of antibiotic resistance genes are computed and visualized. Ground truth-based benchmarks of BusyBee Web demonstrate comparably high performance to state-of-the-art binning solutions for assembled contigs and markedly improved performance for long reads (median F1 scores: 70.02–95.21%). Furthermore, the applicability to real-world metagenomic datasets is shown. In conclusion, our reference-independent approach automatically bins assembled contigs or long reads, exhibits high sensitivity and precision, enables intuitive inspection of the results, and only requires FASTA-formatted input. The web-based application is freely accessible at: https://ccb-microbe.cs.uni-saarland.de/busybee. PMID:28472498

Transcript expression plasticity as a response to alternative larval host plants in the speciation process of corn and rice strains of Spodoptera frugiperda.

PubMed

Silva-Brandão, Karina Lucas; Horikoshi, Renato Jun; Bernardi, Daniel; Omoto, Celso; Figueira, Antonio; Brandão, Marcelo Mendes

2017-10-16

Our main purpose was to evaluate the expression of plastic and evolved genes involved in ecological speciation in the noctuid moth Spodoptera frugiperda, the fall armyworm (FAW); and to demonstrate how host plants might influence lineage differentiation in this polyphagous insect. FAW is an important pest of several crops worldwide, and it is differentiated into host plant-related strains, corn (CS) and rice strains (RS). RNA-Seq and transcriptome characterization were applied to evaluate unbiased genetic expression differences in larvae from the two strains, fed on primary (corn) and alternative (rice) host plants. We consider that genes that are differently regulated by the same FAW strain, as a response to different hosts, are "plastic". Otherwise, differences in gene expression between the two strains fed on the same host are considered constitutive differences. Individual performance parameters (larval and pupal weight) varied among conditions (strains vs. hosts). A total of 3657 contigs was related to plastic response, and 2395 contigs were differentially regulated in the two strains feeding on preferential and alternative hosts (constitutive contigs). Three molecular functions were present in all comparisons, both down- and up-regulated: oxidoreductase activity, metal-ion binding, and hydrolase activity. Metabolization of foreign chemicals is among the key functions involved in the phenotypic variation of FAW strains. From an agricultural perspective, high plasticity in families of detoxifying genes indicates the capacity for a rapid response to control compounds such as insecticides.

Identification of genes associated with low furanocoumarin content in grapefruit.

PubMed

Chen, Chunxian; Yu, Qibin; Wei, Xu; Cancalon, Paul F; Gmitter, Fred G

2014-10-01

Some furanocoumarins in grapefruit (Citrus paradisi) are associated with the so-called grapefruit juice effect. Previous phytochemical quantification and genetic analysis suggested that the synthesis of these furanocoumarins may be controlled by a single gene in the pathway. In this study, cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis of fruit tissues was performed to identify the candidate gene(s) likely associated with low furanocoumarin content in grapefruit. Fifteen tentative differentially expressed fragments were cloned through the cDNA-AFLP analysis of the grapefruit variety Foster and its spontaneous low-furanocoumarin mutant Low Acid Foster. Sequence analysis revealed a cDNA-AFLP fragment, Contig 6, was homologous to a substrate-proved psoralen synthase gene, CYP71A22, and was part of citrus unigenes Cit.3003 and Csi.1332, and predicted genes Ciclev10004717m in mandarin and orange1.1g041507m in sweet orange. The two predicted genes contained the highly conserved motifs at one of the substrate recognition sites of CYP71A22. Digital gene expression profile showed the unigenes were expressed only in fruit and seed. Quantitative real-time PCR also proved Contig 6 was down-regulated in Low Acid Foster. These results showed the differentially expressed Contig 6 was related to the reduced furanocoumarin levels in the mutant. The identified fragment, homologs, unigenes, and genes may facilitate further furanocoumarin genetic study and grapefruit variety improvement.

Xerochrysium gen. nov. and Bettsia, genera encompassing xerophilic species of Chrysosporium.

PubMed

Pitt, John I; Lantz, Henrik; Pettersson, Olga Vinnere; Leong, Su-Lin L

2013-12-01

On the basis of a study of ITS sequences, Vidal et al. (Rev. Iber. Micol. 17: 22, 2000) recommended that the genus Chrysosporium be restricted to species belonging to Onygenales. Using nrLSU genes, we studied the majority of clades examined by Vidal et al. and showed that currently accepted species in Chrysosporium phylogenetically belong in six clades in three orders. Surprisingly, the xerophilic species of Chrysosporium, long thought to be a single grouping away from the majority of Chrysosporium species, occupy two clades, one in Leotiales, the other in Eurotiales. Species accepted in Leotiales are related to the sexual genus Bettsia. One is the type species B. alvei, and related asexual strains classified as C. farinicola, the second is C. fastidium transferred to Bettsia as B. fastidia. Species in the Eurotiales are transferred to Xerochrysium gen. nov., where the accepted species are X. xerophilum and X. dermatitidis, the correct name for C. inops on transfer to Xerochrysium. All accepted species are extreme xerophiles, found in dried and concentrated foods.

New parasite inhibitors encompassing novel conformationally-locked 5'-acyl sulfamoyl adenosines.

PubMed

Dixit, Shailesh S; Upadhayaya, Ram Shankar; Chattopadhyaya, Jyoti

2012-08-14

We describe the design, synthesis and biological evaluation of conformationally-locked 5'-acyl sulfamoyl adenosine derivatives as new parasitic inhibitors against Trypanosoma and Leishmania. The conformationally-locked (3'-endo, North-type) nucleosides have been synthesized by covalently attaching a 4'-CH(2)-O-2' bridge () across C2'-C4' of adenosine in order to reduce the conformational flexibility of the pentose ring. This is designed to decrease the entropic penalty for complex formation with the target protein, which may improve free-energy of stabilization of the complex leading to improved potency. Conformationally-locked 5'-acyl sulfamoyl adenosine derivatives (16-22) were tested against parasitic protozoans for the first time in this work, and showed potent inhibition of Trypanosoma cruzi, Trypanosoma brucei, Trypanosoma rhodesiense and Leishmania infantum with IC(50) = 0.25-0.51 μM. In particular, the potent 5'-pentanyl acyl sulfamoyl adenosine derivative 17 (IC(50) = 0.25 μM) against intracellular L. infantum amastigotes and Trypanosoma subspecies is interesting in view of its almost insignificant cytotoxicity in murine macrophage host cells (CC(50) >4 μM) and in diploid human fibroblasts MRC-5 cell lines (CC(50) 4 μM). This work also suggests that variable alkyl chain length of the acyl group on the acylsulfamoyl side chain at 5' can modulate the toxicity of 5'-O-sulfamoylnucleoside analogues. This conformationally-locked sulfamoyl adenosine scaffold presents some interesting possibilities for further drug design and lead optimization.

How encompassing is the effect of negativity bias on political conservatism?

PubMed

Malka, Ariel; Soto, Christopher J

2014-06-01

We argue that the political effects of negativity bias are narrower than Hibbing et al. suggest. Negativity bias reliably predicts social, but not economic, conservatism, and its political effects often vary across levels of political engagement. Thus the role of negativity bias in broad ideological conflict depends on the strategic packaging of economic and social attitudes by political elites.

De-Novo Assembly and Analysis of the Heterozygous Triploid Genome of the Wine Spoilage Yeast Dekkera bruxellensis AWRI1499

PubMed Central

Chambers, Paul J.; Pretorius, Isak S.

2012-01-01

Despite its industrial importance, the yeast species Dekkera (Brettanomyces) bruxellensis has remained poorly understood at the genetic level. In this study we describe whole genome sequencing and analysis for a prevalent wine spoilage strain, AWRI1499. The 12.7 Mb assembly, consisting of 324 contigs in 99 scaffolds (super-contigs) at 26-fold coverage, exhibits a relatively high density of single nucleotide polymorphisms (SNPs). Haplotype sampling for 1.2% of open reading frames suggested that the D. bruxellensis AWRI1499 genome is comprised of a moderately heterozygous diploid genome, in combination with a divergent haploid genome. Gene content analysis revealed enrichment in membrane proteins, particularly transporters, along with oxidoreductase enzymes. Availability of this assembly and annotation provides a resource for further investigation of genomic organization in this species, and functional characterization of genes that may confer important phenotypic traits. PMID:22470482

De novo assembly and annotation of the Antarctic copepod (Tigriopus kingsejongensis) transcriptome.

PubMed

Kim, Hui-Su; Lee, Bo-Young; Han, Jeonghoon; Lee, Young Hwan; Min, Gi-Sik; Kim, Sanghee; Lee, Jae-Seong

2016-08-01

The whole transcriptome of the Antarctic copepod (Tigriopus kingsejongensis) was sequenced using Illumina RNA-seq. De novo assembly was performed with 64,785,098 raw reads using Trinity, which assembled into 81,653 contigs. TransDecoder found 38,250 candidate coding contigs which showed homology to other species by BLAST analysis. Functional gene annotation was performed by Gene Ontology (GO), InterProScan, and KEGG pathway analyses. Finally, we identified a number of expressed gene catalog for T. kingsejongensis that is a useful model animal for gene information-based polar research to uncover molecular mechanisms of environmental adaptation on harsh environments. In particular, we observed highly developing lipid metabolism in T. kingsejongensis directly compared to those of the Far East Pacific coast copepod Tigriopus japonicus at the transcriptome level. Copyright © 2016 Elsevier B.V. All rights reserved.

Genome Sequence of the Historical Clinical Isolate Burkholderia pseudomallei PHLS 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’haeseleer, Patrik; Johnson, Shannon L.; Davenport, Karen W.

We present the draft genome sequence ofBurkholderia pseudomalleiPHLS 6, a virulent clinical strain isolated from a melioidosis patient in Bangladesh in 1960. This draft genome consists of 39 contigs and is 7,322,181 bp long.

Genome Sequence of the Historical Clinical Isolate Burkholderia pseudomallei PHLS 6

DOE PAGES

D’haeseleer, Patrik; Johnson, Shannon L.; Davenport, Karen W.; ...

2016-06-30

We present the draft genome sequence ofBurkholderia pseudomalleiPHLS 6, a virulent clinical strain isolated from a melioidosis patient in Bangladesh in 1960. This draft genome consists of 39 contigs and is 7,322,181 bp long.

Fine Mapping Suggests that the Goat Polled Intersex Syndrome and the Human Blepharophimosis Ptosis Epicanthus Syndrome Map to a 100-kb Homologous Region

PubMed Central

Schibler, Laurent; Cribiu, Edmond P.; Oustry-Vaiman, Anne; Furet, Jean-Pierre; Vaiman, Daniel

2000-01-01

To clone the goat Polled Intersex Syndrome (PIS) gene(s), a chromosome walk was performed from six entry points at 1q43. This enabled 91 BACs to be recovered from a recently constructed goat BAC library. Six BAC contigs of goat chromosome 1q43 (ICC1–ICC6) were thus constructed covering altogether 4.5 Mb. A total of 37 microsatellite sequences were isolated from this 4.5-Mb region (16 in this study), of which 33 were genotyped and mapped. ICC3 (1500 kb) was shown by genetic analysis to encompass the PIS locus in a ∼400-kb interval without recombinants detected in the resource families (293 informative meioses). A strong linkage disequilibrium was detected among unrelated animals with the two central markers of the region, suggesting a probable location for PIS in ∼100 kb. High-resolution comparative mapping with human data shows that this DNA segment is the homolog of the human region associated with Blepharophimosis Ptosis Epicanthus inversus Syndrome (BPES) gene located in 3q23. This finding suggests that homologous gene(s) could be responsible for the pathologies observed in humans and goats. [The sequence data, PCR primers and PCR conditions for STS and microsatellites described in this paper have been submitted to the GenBank data library under accession nos. AQ666547–AQ666579, AQ686084–AQ686129, AQ793920–793931, AQ810429–AQ810527, G41201–G41228, and G54270–G54286.] PMID:10720572

Molecular characterization of a novel Nucleorhabdovirus from black currant identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...

Identification and initial characterization of a novel turkey-origin picobirnavirus using a metagenomic approach

USDA-ARS?s Scientific Manuscript database

Using the Genome Sequencer FLX Titanium technology (Roche, 454 Life Sciences), a ribonucleic acid (RNA) virus-specific metagenome was prepared using the pooled intestinal contents collected from North Carolina turkey flocks experiencing enteric disease signs. This analysis produced 6526 contigs rang...

Molecular characterization and combined genotype association study of bovine cluster of differentiation 14 gene with clinical mastitis in crossbred dairy cattle

PubMed Central

Selvan, A. Sakthivel; Gupta, I. D.; Verma, A.; Chaudhari, M. V.; Magotra, A.

2016-01-01

Aim: The present study was undertaken with the objectives to characterize and to analyze combined genotypes of cluster of differentiation 14 (CD14) gene to explore its association with clinical mastitis in Karan Fries (KF) cows maintained in the National Dairy Research Institute herd, Karnal. Materials and Methods: Genomic DNA was extracted using blood of randomly selected 94 KF lactating cattle by phenol-chloroform method. After checking its quality and quantity, polymerase chain reaction (PCR) was carried out using six sets of reported gene-specific primers to amplify complete KF CD14 gene. The forward and reverse sequences for each PCR fragments were assembled to form complete sequence for the respective region of KF CD14 gene. The multiple sequence alignments of the edited sequence with the corresponding reference with reported Bos taurus sequence (EU148610.1) were performed with ClustalW software to identify single nucleotide polymorphisms (SNPs). Basic Local Alignment Search Tool analysis was performed to compare the sequence identity of KF CD14 gene with other species. The restriction fragment length polymorphism (RFLP) analysis was carried out in all KF cows using Helicobacter pylori 188I (Hpy188I) (contig 2) and Haemophilus influenzae I (HinfI) (contig 4) restriction enzyme (RE). Cows were assigned genotypes obtained by PCR-RFLP analysis, and association study was done using Chi-square (χ2) test. The genotypes of both contigs (loci) number 2 and 4 were combined with respect to each animal to construct combined genotype patterns. Results: Two types of sequences of KF were obtained: One with 2630 bp having one insertion at 616 nucleotide (nt) position and one deletion at 1117 nt position, and the another sequence was of 2629 bp having only one deletion at 615 nt position. ClustalW, multiple alignments of KF CD14 gene sequence with B. taurus cattle sequence (EU148610.1), revealed 24 nt changes (SNPs). Cows were also screened using PCR-RFLP with Hpy188I

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa

PubMed Central

2012-01-01

Background Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions Two transcriptome sets

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

PubMed

Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

2012-11-20

Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable

KONAGAbase: a genomic and transcriptomic database for the diamondback moth, Plutella xylostella.

PubMed

Jouraku, Akiya; Yamamoto, Kimiko; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Narukawa, Junko; Miyamoto, Kazuhisa; Kurita, Kanako; Kanamori, Hiroyuki; Katayose, Yuichi; Matsumoto, Takashi; Noda, Hiroaki

2013-07-09

The diamondback moth (DBM), Plutella xylostella, is one of the most harmful insect pests for crucifer crops worldwide. DBM has rapidly evolved high resistance to most conventional insecticides such as pyrethroids, organophosphates, fipronil, spinosad, Bacillus thuringiensis, and diamides. Therefore, it is important to develop genomic and transcriptomic DBM resources for analysis of genes related to insecticide resistance, both to clarify the mechanism of resistance of DBM and to facilitate the development of insecticides with a novel mode of action for more effective and environmentally less harmful insecticide rotation. To contribute to this goal, we developed KONAGAbase, a genomic and transcriptomic database for DBM (KONAGA is the Japanese word for DBM). KONAGAbase provides (1) transcriptomic sequences of 37,340 ESTs/mRNAs and 147,370 RNA-seq contigs which were clustered and assembled into 84,570 unigenes (30,695 contigs, 50,548 pseudo singletons, and 3,327 singletons); and (2) genomic sequences of 88,530 WGS contigs with 246,244 degenerate contigs and 106,455 singletons from which 6,310 de novo identified repeat sequences and 34,890 predicted gene-coding sequences were extracted. The unigenes and predicted gene-coding sequences were clustered and 32,800 representative sequences were extracted as a comprehensive putative gene set. These sequences were annotated with BLAST descriptions, Gene Ontology (GO) terms, and Pfam descriptions, respectively. KONAGAbase contains rich graphical user interface (GUI)-based web interfaces for easy and efficient searching, browsing, and downloading sequences and annotation data. Five useful search interfaces consisting of BLAST search, keyword search, BLAST result-based search, GO tree-based search, and genome browser are provided. KONAGAbase is publicly available from our website (http://dbm.dna.affrc.go.jp/px/) through standard web browsers. KONAGAbase provides DBM comprehensive transcriptomic and draft genomic sequences with

Transcriptomic analysis of grain amaranth (Amaranthus hypochondriacus) using 454 pyrosequencing: comparison with A. tuberculatus, expression profiling in stems and in response to biotic and abiotic stress

PubMed Central

2011-01-01

Background Amaranthus hypochondriacus, a grain amaranth, is a C4 plant noted by its ability to tolerate stressful conditions and produce highly nutritious seeds. These possess an optimal amino acid balance and constitute a rich source of health-promoting peptides. Although several recent studies, mostly involving subtractive hybridization strategies, have contributed to increase the relatively low number of grain amaranth expressed sequence tags (ESTs), transcriptomic information of this species remains limited, particularly regarding tissue-specific and biotic stress-related genes. Thus, a large scale transcriptome analysis was performed to generate stem- and (a)biotic stress-responsive gene expression profiles in grain amaranth. Results A total of 2,700,168 raw reads were obtained from six 454 pyrosequencing runs, which were assembled into 21,207 high quality sequences (20,408 isotigs + 799 contigs). The average sequence length was 1,064 bp and 930 bp for isotigs and contigs, respectively. Only 5,113 singletons were recovered after quality control. Contigs/isotigs were further incorporated into 15,667 isogroups. All unique sequences were queried against the nr, TAIR, UniRef100, UniRef50 and Amaranthaceae EST databases for annotation. Functional GO annotation was performed with all contigs/isotigs that produced significant hits with the TAIR database. Only 8,260 sequences were found to be homologous when the transcriptomes of A. tuberculatus and A. hypochondriacus were compared, most of which were associated with basic house-keeping processes. Digital expression analysis identified 1,971 differentially expressed genes in response to at least one of four stress treatments tested. These included several multiple-stress-inducible genes that could represent potential candidates for use in the engineering of stress-resistant plants. The transcriptomic data generated from pigmented stems shared similarity with findings reported in developing stems of Arabidopsis and

Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species

PubMed Central

2012-01-01

Background Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Results Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape) x Vita 7 (hastate leaf shape). A QTL for leaf shape, Hls (hastate leaf shape), was identified on the Sanzi x Vita 7 genetic map spanning from 56.54 cM to 67.54 cM distance on linkage group 15. SNP marker 1_0910 was the most significant over the two experiments, accounting for 74.7% phenotypic variance (LOD 33.82) in a greenhouse experiment and 71.5% phenotypic variance (LOD 30.89) in a field experiment. The corresponding Hls locus was positioned on the cowpea consensus genetic map on linkage group 4, spanning from 25.57 to 35.96 cM. A marker-trait association of the Hls region identified SNP marker 1_0349 alleles co-segregating with either the hastate or sub-globose leaf phenotype. High co-linearity was observed for the syntenic Hls region in Medicago truncatula and Glycine max. One syntenic locus for Hls was identified on Medicago chromosome 7 while syntenic regions for Hls were identified on two soybean chromosomes, 3 and 19. In all three syntenic loci, an ortholog for the EZA1/SWINGER (AT4G02020.1) gene was observed and is the candidate gene for the Hls locus. The Hls locus was identified on the cowpea physical map via SNP markers 1_0910, 1_1013 and 1_0992 which were identified in three BAC contigs; contig926, contig821 and contig25. Conclusions This study has demonstrated how integrated genomic resources can be utilized for a candidate gene approach. Identification of genes which control leaf morphology may be utilized to improve the quality of cowpea leaves for vegetable and or forage markets as well as contribute to more fundamental research understanding the control of leaf shape in legumes. PMID:22691139

Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species.

PubMed

Pottorff, Marti; Ehlers, Jeffrey D; Fatokun, Christian; Roberts, Philip A; Close, Timothy J

2012-06-12

Cowpea [Vigna unguiculata (L.) Walp] exhibits a considerable variation in leaf shape. Although cowpea is mostly utilized as a dry grain and animal fodder crop, cowpea leaves are also used as a high-protein pot herb in many countries of Africa. Leaf morphology was studied in the cowpea RIL population, Sanzi (sub-globose leaf shape) x Vita 7 (hastate leaf shape). A QTL for leaf shape, Hls (hastate leaf shape), was identified on the Sanzi x Vita 7 genetic map spanning from 56.54 cM to 67.54 cM distance on linkage group 15. SNP marker 1_0910 was the most significant over the two experiments, accounting for 74.7% phenotypic variance (LOD 33.82) in a greenhouse experiment and 71.5% phenotypic variance (LOD 30.89) in a field experiment. The corresponding Hls locus was positioned on the cowpea consensus genetic map on linkage group 4, spanning from 25.57 to 35.96 cM. A marker-trait association of the Hls region identified SNP marker 1_0349 alleles co-segregating with either the hastate or sub-globose leaf phenotype. High co-linearity was observed for the syntenic Hls region in Medicago truncatula and Glycine max. One syntenic locus for Hls was identified on Medicago chromosome 7 while syntenic regions for Hls were identified on two soybean chromosomes, 3 and 19. In all three syntenic loci, an ortholog for the EZA1/SWINGER (AT4G02020.1) gene was observed and is the candidate gene for the Hls locus. The Hls locus was identified on the cowpea physical map via SNP markers 1_0910, 1_1013 and 1_0992 which were identified in three BAC contigs; contig926, contig821 and contig25. This study has demonstrated how integrated genomic resources can be utilized for a candidate gene approach. Identification of genes which control leaf morphology may be utilized to improve the quality of cowpea leaves for vegetable and or forage markets as well as contribute to more fundamental research understanding the control of leaf shape in legumes.

De novo transcriptomic analysis of hydrogen production in the green alga Chlamydomonas moewusii through RNA-Seq

PubMed Central

2013-01-01

Background Microalgae can make a significant contribution towards meeting global renewable energy needs in both carbon-based and hydrogen (H2) biofuel. The development of energy-related products from algae could be accelerated with improvements in systems biology tools, and recent advances in sequencing technology provide a platform for enhanced transcriptomic analyses. However, these techniques are still heavily reliant upon available genomic sequence data. Chlamydomonas moewusii is a unicellular green alga capable of evolving molecular H2 under both dark and light anaerobic conditions, and has high hydrogenase activity that can be rapidly induced. However, to date, there is no systematic investigation of transcriptomic profiling during induction of H2 photoproduction in this organism. Results In this work, RNA-Seq was applied to investigate transcriptomic profiles during the dark anaerobic induction of H2 photoproduction. 156 million reads generated from 7 samples were then used for de novo assembly after data trimming. BlastX results against NCBI database and Blast2GO results were used to interpret the functions of the assembled 34,136 contigs, which were then used as the reference contigs for RNA-Seq analysis. Our results indicated that more contigs were differentially expressed during the period of early and higher H2 photoproduction, and fewer contigs were differentially expressed when H2-photoproduction rates decreased. In addition, C. moewusii and C. reinhardtii share core functional pathways, and transcripts for H2 photoproduction and anaerobic metabolite production were identified in both organisms. C. moewusii also possesses similar metabolic flexibility as C. reinhardtii, and the difference between C. moewusii and C. reinhardtii on hydrogenase expression and anaerobic fermentative pathways involved in redox balancing may explain their different profiles of hydrogenase activity and secreted anaerobic metabolites. Conclusions Herein, we have described a

Production of a reference transcriptome and transcriptomic database (EdwardsiellaBase) for the lined sea anemone, Edwardsiella lineata, a parasitic cnidarian

PubMed Central

2014-01-01

Background The lined sea anemone Edwardsiella lineata is an informative model system for evolutionary-developmental studies of parasitism. In this species, it is possible to compare alternate developmental pathways leading from a larva to either a free-living polyp or a vermiform parasite that inhabits the mesoglea of a ctenophore host. Additionally, E. lineata is confamilial with the model cnidarian Nematostella vectensis, providing an opportunity for comparative genomic, molecular and organismal studies. Description We generated a reference transcriptome for E. lineata via high-throughput sequencing of RNA isolated from five developmental stages (parasite; parasite-to-larva transition; larva; larva-to-adult transition; adult). The transcriptome comprises 90,440 contigs assembled from >15 billion nucleotides of DNA sequence. Using a molecular clock approach, we estimated the divergence between E. lineata and N. vectensis at 215–364 million years ago. Based on gene ontology and metabolic pathway analyses and gene family surveys (bHLH-PAS, deiodinases, Fox genes, LIM homeodomains, minicollagens, nuclear receptors, Sox genes, and Wnts), the transcriptome of E. lineata is comparable in depth and completeness to N. vectensis. Analyses of protein motifs and revealed extensive conservation between the proteins of these two edwardsiid anemones, although we show the NF-κB protein of E. lineata reflects the ancestral structure, while the NF-κB protein of N. vectensis has undergone a split that separates the DNA-binding domain from the inhibitory domain. All contigs have been deposited in a public database (EdwardsiellaBase), where they may be searched according to contig ID, gene ontology, protein family motif (Pfam), enzyme commission number, and BLAST. The alignment of the raw reads to the contigs can also be visualized via JBrowse. Conclusions The transcriptomic data and database described here provide a platform for studying the evolutionary developmental genomics

Production of a reference transcriptome and transcriptomic database (EdwardsiellaBase) for the lined sea anemone, Edwardsiella lineata, a parasitic cnidarian.

PubMed

Stefanik, Derek J; Lubinski, Tristan J; Granger, Brian R; Byrd, Allyson L; Reitzel, Adam M; DeFilippo, Lukas; Lorenc, Allison; Finnerty, John R

2014-01-28

The lined sea anemone Edwardsiella lineata is an informative model system for evolutionary-developmental studies of parasitism. In this species, it is possible to compare alternate developmental pathways leading from a larva to either a free-living polyp or a vermiform parasite that inhabits the mesoglea of a ctenophore host. Additionally, E. lineata is confamilial with the model cnidarian Nematostella vectensis, providing an opportunity for comparative genomic, molecular and organismal studies. We generated a reference transcriptome for E. lineata via high-throughput sequencing of RNA isolated from five developmental stages (parasite; parasite-to-larva transition; larva; larva-to-adult transition; adult). The transcriptome comprises 90,440 contigs assembled from >15 billion nucleotides of DNA sequence. Using a molecular clock approach, we estimated the divergence between E. lineata and N. vectensis at 215-364 million years ago. Based on gene ontology and metabolic pathway analyses and gene family surveys (bHLH-PAS, deiodinases, Fox genes, LIM homeodomains, minicollagens, nuclear receptors, Sox genes, and Wnts), the transcriptome of E. lineata is comparable in depth and completeness to N. vectensis. Analyses of protein motifs and revealed extensive conservation between the proteins of these two edwardsiid anemones, although we show the NF-κB protein of E. lineata reflects the ancestral structure, while the NF-κB protein of N. vectensis has undergone a split that separates the DNA-binding domain from the inhibitory domain. All contigs have been deposited in a public database (EdwardsiellaBase), where they may be searched according to contig ID, gene ontology, protein family motif (Pfam), enzyme commission number, and BLAST. The alignment of the raw reads to the contigs can also be visualized via JBrowse. The transcriptomic data and database described here provide a platform for studying the evolutionary developmental genomics of a derived parasitic life cycle. In

Characterization of the transcriptome of an ecologically important avian species, the Vinous-throated Parrotbill Paradoxornis webbianus bulomachus (Paradoxornithidae; Aves)

PubMed Central

2012-01-01

Background Adaptive divergence driven by environmental heterogeneity has long been a fascinating topic in ecology and evolutionary biology. The study of the genetic basis of adaptive divergence has, however, been greatly hampered by a lack of genomic information. The recent development of transcriptome sequencing provides an unprecedented opportunity to generate large amounts of genomic data for detailed investigations of the genetics of adaptive divergence in non-model organisms. Herein, we used the Illumina sequencing platform to sequence the transcriptome of brain and liver tissues from a single individual of the Vinous-throated Parrotbill, Paradoxornis webbianus bulomachus, an ecologically important avian species in Taiwan with a wide elevational range of sea level to 3100 m. Results Our 10.1 Gbp of sequences were first assembled based on Zebra Finch (Taeniopygia guttata) and chicken (Gallus gallus) RNA references. The remaining reads were then de novo assembled. After filtering out contigs with low coverage (<10X), we retained 67,791 of 487,336 contigs, which covered approximately 5.3% of the P. w. bulomachus genome. Of 7,779 contigs retained for a top-hit species distribution analysis, the majority (about 86%) were matched to known Zebra Finch and chicken transcripts. We also annotated 6,365 contigs to gene ontology (GO) terms: in total, 122 GO-slim terms were assigned, including biological process (41%), molecular function (32%), and cellular component (27%). Many potential genetic markers for future adaptive genomic studies were also identified: 8,589 single nucleotide polymorphisms, 1,344 simple sequence repeats and 109 candidate genes that might be involved in elevational or climate adaptation. Conclusions Our study shows that transcriptome data can serve as a rich genetic resource, even for a single run of short-read sequencing from a single individual of a non-model species. This is the first study providing transcriptomic information for species in the

Physical mapping and BAC-end sequence analysis provide initial insights into the flax (Linum usitatissimum L.) genome

PubMed Central

2011-01-01

Background Flax (Linum usitatissimum L.) is an important source of oil rich in omega-3 fatty acids, which have proven health benefits and utility as an industrial raw material. Flax seeds also contain lignans which are associated with reducing the risk of certain types of cancer. Its bast fibres have broad industrial applications. However, genomic tools needed for molecular breeding were non existent. Hence a project, Total Utilization Flax GENomics (TUFGEN) was initiated. We report here the first genome-wide physical map of flax and the generation and analysis of BAC-end sequences (BES) from 43,776 clones, providing initial insights into the genome. Results The physical map consists of 416 contigs spanning ~368 Mb, assembled from 32,025 fingerprints, representing roughly 54.5% to 99.4% of the estimated haploid genome (370-675 Mb). The N50 size of the contigs was estimated to be ~1,494 kb. The longest contig was ~5,562 kb comprising 437 clones. There were 96 contigs containing more than 100 clones. Approximately 54.6 Mb representing 8-14.8% of the genome was obtained from 80,337 BES. Annotation revealed that a large part of the genome consists of ribosomal DNA (~13.8%), followed by known transposable elements at 6.1%. Furthermore, ~7.4% of sequence was identified to harbour novel repeat elements. Homology searches against flax-ESTs and NCBI-ESTs suggested that ~5.6% of the transcriptome is unique to flax. A total of 4064 putative genomic SSRs were identified and are being developed as novel markers for their use in molecular breeding. Conclusion The first genome-wide physical map of flax constructed with BAC clones provides a framework for accessing target loci with economic importance for marker development and positional cloning. Analysis of the BES has provided insights into the uniqueness of the flax genome. Compared to other plant genomes, the proportion of rDNA was found to be very high whereas the proportion of known transposable elements was low. The SSRs

Physical mapping and BAC-end sequence analysis provide initial insights into the flax (Linum usitatissimum L.) genome.

PubMed

Ragupathy, Raja; Rathinavelu, Rajkumar; Cloutier, Sylvie

2011-05-09

Flax (Linum usitatissimum L.) is an important source of oil rich in omega-3 fatty acids, which have proven health benefits and utility as an industrial raw material. Flax seeds also contain lignans which are associated with reducing the risk of certain types of cancer. Its bast fibres have broad industrial applications. However, genomic tools needed for molecular breeding were non existent. Hence a project, Total Utilization Flax GENomics (TUFGEN) was initiated. We report here the first genome-wide physical map of flax and the generation and analysis of BAC-end sequences (BES) from 43,776 clones, providing initial insights into the genome. The physical map consists of 416 contigs spanning ~368 Mb, assembled from 32,025 fingerprints, representing roughly 54.5% to 99.4% of the estimated haploid genome (370-675 Mb). The N50 size of the contigs was estimated to be ~1,494 kb. The longest contig was ~5,562 kb comprising 437 clones. There were 96 contigs containing more than 100 clones. Approximately 54.6 Mb representing 8-14.8% of the genome was obtained from 80,337 BES. Annotation revealed that a large part of the genome consists of ribosomal DNA (~13.8%), followed by known transposable elements at 6.1%. Furthermore, ~7.4% of sequence was identified to harbour novel repeat elements. Homology searches against flax-ESTs and NCBI-ESTs suggested that ~5.6% of the transcriptome is unique to flax. A total of 4064 putative genomic SSRs were identified and are being developed as novel markers for their use in molecular breeding. The first genome-wide physical map of flax constructed with BAC clones provides a framework for accessing target loci with economic importance for marker development and positional cloning. Analysis of the BES has provided insights into the uniqueness of the flax genome. Compared to other plant genomes, the proportion of rDNA was found to be very high whereas the proportion of known transposable elements was low. The SSRs identified from BES will be

A Commentary on Mill’s Logic. Book I. Of Names and Propositions.

DTIC Science & Technology

1983-10-01

truth . [’extension and intension’ in Flew (1979)]. The presumption is that manness necessarily implies rationality, but i- only contigently...guilty and inocent ; these are contraries rather than contradictories, since there are things, such as numbers, that are neither guilty nor innocent

A whole-genome, radiation hybrid map of wheat

USDA-ARS?s Scientific Manuscript database

Generating a reference sequence of bread wheat (Triticum aestivum L.) is a challenging task because of its large, highly repetitive and allopolyploid genome. Ordering of BAC- and NGS-based contigs in ongoing wheat genome-sequencing projects primarily uses recombination and comparative genomics-base...

A high resolution radiation hybrid map of wheat chromosome 4A

USDA-ARS?s Scientific Manuscript database

Bread wheat has a large and complex allohexaploid genome with low recombination level at chromosome centromeric and peri-centromeric regions. This significantly hampers ordering of markers, contigs of physical maps and sequence scaffolds and impedes obtaining of high-quality reference genome sequenc...

Draft genome sequence of a Kluyvera intermedia isolate from a patient with a pancreatic abscess.

PubMed

Thele, Roland; Gumpert, Heidi; Christensen, Louise B; Worning, Peder; Schønning, Kristian; Westh, Henrik; Hansen, Thomas A

2017-09-01

The genus Kluyvera comprises potential pathogens that can cause many infections. This study reports a Kluyvera intermedia strain (FOSA7093) from a pancreatic cyst specimen from a long-term hospitalised patient. Whole-genome sequencing (WGS) of the K. intermedia isolate was performed and the strain was reported as sensitive to Danish-registered antibiotics although it had a fosA-like gene in the genome. There were nine contigs that aligned to a plasmid, and these contigs contained several heavy metal resistance gene homologues. Furthermore, a prophage was discovered in the genome. WGS represents an efficient tool for monitoring Kluyvera spp. and its role as a reservoir of multidrug resistance. Therefore, this susceptible K. intermedia genome has many characteristics that allow comparison of resistant K. intermedia that might be discovered in the future. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Recovering complete and draft population genomes from metagenome datasets

DOE PAGES

Sangwan, Naseer; Xia, Fangfang; Gilbert, Jack A.

2016-03-08

Assembly of metagenomic sequence data into microbial genomes is of fundamental value to improving our understanding of microbial ecology and metabolism by elucidating the functional potential of hard-to-culture microorganisms. Here, we provide a synthesis of available methods to bin metagenomic contigs into species-level groups and highlight how genetic diversity, sequencing depth, and coverage influence binning success. Despite the computational cost on application to deeply sequenced complex metagenomes (e.g., soil), covarying patterns of contig coverage across multiple datasets significantly improves the binning process. We also discuss and compare current genome validation methods and reveal how these methods tackle the problem ofmore » chimeric genome bins i.e., sequences from multiple species. Finally, we explore how population genome assembly can be used to uncover biogeographic trends and to characterize the effect of in situ functional constraints on the genome-wide evolution.« less

Recovering complete and draft population genomes from metagenome datasets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sangwan, Naseer; Xia, Fangfang; Gilbert, Jack A.

Assembly of metagenomic sequence data into microbial genomes is of fundamental value to improving our understanding of microbial ecology and metabolism by elucidating the functional potential of hard-to-culture microorganisms. Here, we provide a synthesis of available methods to bin metagenomic contigs into species-level groups and highlight how genetic diversity, sequencing depth, and coverage influence binning success. Despite the computational cost on application to deeply sequenced complex metagenomes (e.g., soil), covarying patterns of contig coverage across multiple datasets significantly improves the binning process. We also discuss and compare current genome validation methods and reveal how these methods tackle the problem ofmore » chimeric genome bins i.e., sequences from multiple species. Finally, we explore how population genome assembly can be used to uncover biogeographic trends and to characterize the effect of in situ functional constraints on the genome-wide evolution.« less

A comprehensive evaluation of assembly scaffolding tools

PubMed Central

2014-01-01

Background Genome assembly is typically a two-stage process: contig assembly followed by the use of paired sequencing reads to join contigs into scaffolds. Scaffolds are usually the focus of reported assembly statistics; longer scaffolds greatly facilitate the use of genome sequences in downstream analyses, and it is appealing to present larger numbers as metrics of assembly performance. However, scaffolds are highly prone to errors, especially when generated using short reads, which can directly result in inflated assembly statistics. Results Here we provide the first independent evaluation of scaffolding tools for second-generation sequencing data. We find large variations in the quality of results depending on the tool and dataset used. Even extremely simple test cases of perfect input, constructed to elucidate the behaviour of each algorithm, produced some surprising results. We further dissect the performance of the scaffolders using real and simulated sequencing data derived from the genomes of Staphylococcus aureus, Rhodobacter sphaeroides, Plasmodium falciparum and Homo sapiens. The results from simulated data are of high quality, with several of the tools producing perfect output. However, at least 10% of joins remains unidentified when using real data. Conclusions The scaffolders vary in their usability, speed and number of correct and missed joins made between contigs. Results from real data highlight opportunities for further improvements of the tools. Overall, SGA, SOPRA and SSPACE generally outperform the other tools on our datasets. However, the quality of the results is highly dependent on the read mapper and genome complexity. PMID:24581555

Expressed sequence tag (EST) analysis of the pine wood nematode Bursaphelenchus xylophilus and B. mucronatus.

PubMed

Kikuchi, Taisei; Aikawa, Takuya; Kosaka, Hajime; Pritchard, Leighton; Ogura, Nobuo; Jones, John T

2007-09-01

Most Bursaphelenchus species feed on fungi that colonise dead or dying trees. However, Bursaphelenchus xylophilus is unique in that in addition to feeding on fungi it has the capacity to be a parasite of live pine trees. We present an analysis of over 13,000 expressed sequence tags (ESTs) from B. xylophilus and, by way of contrast, over 3000 ESTs from a closely related species that does not parasitise plants as readily; B. mucronatus. Four libraries from B. xylophilus, from a variety of life stages including fungal feeding nematodes, nematodes extracted from plants and dauer-like stage nematodes, and one library from B. mucronatus were constructed and used to generate ESTs. Contig analysis showed that the 13,327 B. xylophilus ESTs could be grouped into 2110 contigs and 4377 singletons giving a total of 6487 identified genes. Similarly the 3193 B. mucronatus ESTs yielded a total of 2219 identified genes from 425 contigs and 1794 singletons. A variety of proteins potentially important in the parasitic process of B. xylophilus and B. mucronatus, including plant and fungal cell wall degrading enzymes and a novel gene potentially encoding a expansin-like protein that may disrupt non-covalent bonds in the plant cell wall were identified in the libraries. Additionally several gene candidates potentially involved in dauer entry or maintenance were also identified in the EST dataset. The EST sequences from this study will provide a solid base for future research on the biology, pathogenicity and evolutionary history of this nematode group.

Comparison of bacterial genome assembly software for MinION data and their applicability to medical microbiology.

PubMed

Judge, Kim; Hunt, Martin; Reuter, Sandra; Tracey, Alan; Quail, Michael A; Parkhill, Julian; Peacock, Sharon J

2016-09-01

Translating the Oxford Nanopore MinION sequencing technology into medical microbiology requires on-going analysis that keeps pace with technological improvements to the instrument and release of associated analysis software. Here, we use a multidrug-resistant Enterobacter kobei isolate as a model organism to compare open source software for the assembly of genome data, and relate this to the time taken to generate actionable information. Three software tools (PBcR, Canu and miniasm) were used to assemble MinION data and a fourth (SPAdes) was used to combine MinION and Illumina data to produce a hybrid assembly. All four had a similar number of contigs and were more contiguous than the assembly using Illumina data alone, with SPAdes producing a single chromosomal contig. Evaluation of the four assemblies to represent the genome structure revealed a single large inversion in the SPAdes assembly, which also incorrectly integrated a plasmid into the chromosomal contig. Almost 50 %, 80 % and 90 % of MinION pass reads were generated in the first 6, 9 and 12 h, respectively. Using data from the first 6 h alone led to a less accurate, fragmented assembly, but data from the first 9 or 12 h generated similar assemblies to that from 48 h sequencing. Assemblies were generated in 2 h using Canu, indicating that going from isolate to assembled data is possible in less than 48 h. MinION data identified that genes responsible for resistance were carried by two plasmids encoding resistance to carbapenem and to sulphonamides, rifampicin and aminoglycosides, respectively.

ILP-based maximum likelihood genome scaffolding

PubMed Central

2014-01-01

Background Interest in de novo genome assembly has been renewed in the past decade due to rapid advances in high-throughput sequencing (HTS) technologies which generate relatively short reads resulting in highly fragmented assemblies consisting of contigs. Additional long-range linkage information is typically used to orient, order, and link contigs into larger structures referred to as scaffolds. Due to library preparation artifacts and erroneous mapping of reads originating from repeats, scaffolding remains a challenging problem. In this paper, we provide a scalable scaffolding algorithm (SILP2) employing a maximum likelihood model capturing read mapping uncertainty and/or non-uniformity of contig coverage which is solved using integer linear programming. A Non-Serial Dynamic Programming (NSDP) paradigm is applied to render our algorithm useful in the processing of larger mammalian genomes. To compare scaffolding tools, we employ novel quantitative metrics in addition to the extant metrics in the field. We have also expanded the set of experiments to include scaffolding of low-complexity metagenomic samples. Results SILP2 achieves better scalability throughg a more efficient NSDP algorithm than previous release of SILP. The results show that SILP2 compares favorably to previous methods OPERA and MIP in both scalability and accuracy for scaffolding single genomes of up to human size, and significantly outperforms them on scaffolding low-complexity metagenomic samples. Conclusions Equipped with NSDP, SILP2 is able to scaffold large mammalian genomes, resulting in the longest and most accurate scaffolds. The ILP formulation for the maximum likelihood model is shown to be flexible enough to handle metagenomic samples. PMID:25253180

Direct comparisons of Illumina vs. Roche 454 sequencing technologies on the same microbial community DNA sample.

PubMed

Luo, Chengwei; Tsementzi, Despina; Kyrpides, Nikos; Read, Timothy; Konstantinidis, Konstantinos T

2012-01-01

Next-generation sequencing (NGS) is commonly used in metagenomic studies of complex microbial communities but whether or not different NGS platforms recover the same diversity from a sample and their assembled sequences are of comparable quality remain unclear. We compared the two most frequently used platforms, the Roche 454 FLX Titanium and the Illumina Genome Analyzer (GA) II, on the same DNA sample obtained from a complex freshwater planktonic community. Despite the substantial differences in read length and sequencing protocols, the platforms provided a comparable view of the community sampled. For instance, derived assemblies overlapped in ~90% of their total sequences and in situ abundances of genes and genotypes (estimated based on sequence coverage) correlated highly between the two platforms (R(2)>0.9). Evaluation of base-call error, frameshift frequency, and contig length suggested that Illumina offered equivalent, if not better, assemblies than Roche 454. The results from metagenomic samples were further validated against DNA samples of eighteen isolate genomes, which showed a range of genome sizes and G+C% content. We also provide quantitative estimates of the errors in gene and contig sequences assembled from datasets characterized by different levels of complexity and G+C% content. For instance, we noted that homopolymer-associated, single-base errors affected ~1% of the protein sequences recovered in Illumina contigs of 10× coverage and 50% G+C; this frequency increased to ~3% when non-homopolymer errors were also considered. Collectively, our results should serve as a useful practical guide for choosing proper sampling strategies and data possessing protocols for future metagenomic studies.

Assembly of 500,000 inter-specific catfish expressed sequence tags and large scale gene-associated marker development for whole genome association studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Catfish Genome Consortium; Wang, Shaolin; Peatman, Eric

2010-03-23

Background-Through the Community Sequencing Program, a catfish EST sequencing project was carried out through a collaboration between the catfish research community and the Department of Energy's Joint Genome Institute. Prior to this project, only a limited EST resource from catfish was available for the purpose of SNP identification. Results-A total of 438,321 quality ESTs were generated from 8 channel catfish (Ictalurus punctatus) and 4 blue catfish (Ictalurus furcatus) libraries, bringing the number of catfish ESTs to nearly 500,000. Assembly of all catfish ESTs resulted in 45,306 contigs and 66,272 singletons. Over 35percent of the unique sequences had significant similarities tomore » known genes, allowing the identification of 14,776 unique genes in catfish. Over 300,000 putative SNPs have been identified, of which approximately 48,000 are high-quality SNPs identified from contigs with at least four sequences and the minor allele presence of at least two sequences in the contig. The EST resource should be valuable for identification of microsatellites, genome annotation, large-scale expression analysis, and comparative genome analysis. Conclusions-This project generated a large EST resource for catfish that captured the majority of the catfish transcriptome. The parallel analysis of ESTs from two closely related Ictalurid catfishes should also provide powerful means for the evaluation of ancient and recent gene duplications, and for the development of high-density microarrays in catfish. The inter- and intra-specific SNPs identified from all catfish EST dataset assembly will greatly benefit the catfish introgression breeding program and whole genome association studies.« less

Molecular characterization of a novel Luteovirus from peach identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence homologies to Cherry-associated luteovirus were identified by high-throughput sequencing analysis of two peach accessions undergoing quarantine testing. The complete genomic sequences of the two isolates of this virus are 5,819 and 5,814 nucleotides. Their genome organization i...

USER'S GUIDE TO THE PERSONAL COMPUTER VERSION OF THE BIOGENIC EMISSIONS INVENTORY SYSTEM (PC-BEIS2)

EPA Science Inventory

The document is a user's guide for an updated Personal Computer version of the Biogenic Emissions Inventory System (PC-BEIS2), allowing users to estimate hourly emissions of biogenic volatile organic compounds (BVOCs) and soil nitrogen oxide emissions for any county in the contig...

Draft Genome Sequence of Sphingobium sp. Strain HDIPO4, an Avid Degrader of Hexachlorocyclohexane

PubMed Central

Mukherjee, Udita; Kumar, Roshan; Mahato, Nitish Kumar; Khurana, J. P.

2013-01-01

Sphingobium sp. strain HDIPO4 was isolated from a hexachlorocyclohexane (HCH) dumpsite and degraded HCH isomers rapidly. The draft genome sequence of HDIPO4 (~4.7 Mbp) contains 143 contigs and 4,646 coding sequences with a G+C content of 65%. PMID:24051321

Genome Sequence of Actinobacillus seminis Strain ATCC 15768, a Reference Strain of Ovine Pathogens That Causes Infections in Reproductive Organs

PubMed Central

Negrete-Abascal, Erasmo; Montes-Garcia, Fernando; Vaca-Pacheco, Sergio; Leyto-Gil, Abraham M.; Fragoso-Garcia, Edgar; Carvente-Garcia, Roberto; Perez-Agueros, Sandra; Castelan-Sanchez, Hugo G.; Garcia-Molina, Alejandra; Villamar, Tomas E.; Sánchez-Alonso, Patricia

2018-01-01

ABSTRACT The draft genome sequence of Actinobacillus seminis strain ATCC 15768 is reported here. The genome comprises 22 contigs corresponding to 2.36 Mb with 40.7% G+C content and contains several genes related to virulence, including a putative RTX protein. PMID:29326222

Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor)

PubMed Central

Ishizawa, Hidehiro; Kuroda, Masashi

2017-01-01

ABSTRACT Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. PMID:28818906

Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

USDA-ARS?s Scientific Manuscript database

Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

Radiation hybrid map of barley chromosome 3H

USDA-ARS?s Scientific Manuscript database

Assembly of the barley genome is complicated by its large size (5.1 Gb) and proportion of repetitive elements (84%). This process is facilitated by high resolution maps for aligning BAC contigs along chromosomes. Available genetic maps; however, do not provide accurate information on the physical po...

Draft genome sequence of Streptomyces vitaminophilus ATCC 31673, a producer of pyrrolomycin antibiotics, some of which contain a nitro group

DOE PAGES

Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich; ...

2016-01-21

Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.

Draft Genome Sequence of Streptomyces vitaminophilus ATCC 31673, a Producer of Pyrrolomycin Antibiotics, Some of Which Contain a Nitro Group

PubMed Central

Klingeman, Dawn M.; Hettich, Robert L.; Parry, Ronald J.

2016-01-01

Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. The 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content. PMID:26798098

Acetylcholinesterase 1 in populations of organophosphate resistant North American strains of the cattle tick, Rhipicephalus microplus (Acari: Ixodidae)

USDA-ARS?s Scientific Manuscript database

In a collaboration with Purdue University researchers, we sequenced a 143,606 base pair Rhipicephalus microplus BAC library clone that contained the coding region for acetylcholinesterase 1 (AChE1). Sequencing was by Sanger protocols and the final assembly resulted in 15 contigs of varying length, e...

Draft Genome Sequence of Escherichia coli Strain SN137, a Bacterium with Extracellular Proteolytic Activity on Immunoglobulins and Persistence in Human Tissue Blood

PubMed Central

Najera-Hernandez, Salustio; Sanchez-Alonso, Maria Patricia; Anastacio-Marcelino, Estela; Negrete-Abascal, Erasmo

2018-01-01

ABSTRACT The draft genome sequence of Escherichia coli strain SN137 is reported here. The genome comprises 172 contigs, corresponding to 4.9 Mb with 50% G+C content, and contains several genes related to pathogenicity that explain its survival in human hematic tissue. PMID:29348341

Scaffolding of long read assemblies using long range contact information

USDA-ARS?s Scientific Manuscript database

Long read technologies have made a revolution in de novo genome assembly by generating long contigs. Although the assembly contiguity has increased, it may not span a chromosome, resulting in an unfinished chromosome level assembly. To address this problem, we develop a scaffolding method that can b...

Radiation hybrid maps of D-genome of Aegilops tauschii and their application in sequence assembly of large and complex plant genomes

USDA-ARS?s Scientific Manuscript database

The large and complex genome of bread wheat (Triticum aestivum L., ~17 Gb) requires high-resolution genome maps saturated with ordered markers to assist in anchoring and orienting BAC contigs/ sequence scaffolds for whole genome sequence assembly. Radiation hybrid (RH) mapping has proven to be an e...

Draft genome sequence of Streptomyces vitaminophilus ATCC 31673, a producer of pyrrolomycin antibiotics, some of which contain a nitro group

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich

Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.

Gonadal Transcriptome Analysis of Male and Female Olive Flounder (Paralichthys olivaceus)

PubMed Central

Fan, Zhaofei; You, Feng; Wang, Lijuan; Weng, Shenda; Wu, Zhihao; Hu, Jinwei; Zou, Yuxia; Tan, Xungang; Zhang, Peijun

2014-01-01

Olive flounder (Paralichthys olivaceus) is an important commercially cultured marine flatfish in China, Korea, and Japan, of which female grows faster than male. In order to explore the molecular mechanism of flounder sex determination and development, we used RNA-seq technology to investigate transcriptomes of flounder gonads. This produced 22,253,217 and 19,777,841 qualified reads from ovary and testes, which were jointly assembled into 97,233 contigs. Among them, 23,223 contigs were mapped to known genes, of which 2,193 were predicted to be differentially expressed in ovary and 887 in testes. According to annotation information, several sex-related biological pathways including ovarian steroidogenesis and estrogen signaling pathways were firstly found in flounder. The dimorphic expression of overall sex-related genes provides further insights into sex determination and gonadal development. Our study also provides an archive for further studies of molecular mechanism of fish sex determination. PMID:25121093

Identification of 28 cytochrome P450 genes from the transcriptome of the marine rotifer Brachionus plicatilis and analysis of their expression.

PubMed

Kim, Hui-Su; Han, Jeonghoon; Kim, Hee-Jin; Hagiwara, Atsushi; Lee, Jae-Seong

2017-09-01

Whole transcriptomes of the rotifer Brachionus plicatilis were analyzed using an Illumina sequencer. De novo assembly was performed with 49,122,780 raw reads using Trinity software. Among the assembled 42,820 contigs, 27,437 putative open reading frame contigs were identified (average length 1235bp; N50=1707bp). Functional gene annotation with Gene Ontology and InterProScan, in addition to Kyoto Encyclopedia of Genes and Genomes pathway analysis, highlighted the metabolism of xenobiotics by cytochrome P450 (CYP). In addition, 28 CYP genes were identified, and their transcriptional responses to benzo[α]pyrene (B[α]P) were investigated. Most of the CYPs were significantly upregulated or downregulated (P<0.05) in response to B[α]P, suggesting that Bp-CYP genes play a crucial role in detoxification mechanisms in response to xenobiotics. This study sheds light on the molecular defense mechanisms of the rotifer B. plicatilis in response to exposure to various chemicals. Copyright © 2017 Elsevier Inc. All rights reserved.

Microsporidian polar tube proteins: highly divergent but closely linked genes encode PTP1 and PTP2 in members of the evolutionarily distant Antonospora and Encephalitozoon groups.

PubMed

Polonais, Valérie; Prensier, Gérard; Méténier, Guy; Vivarès, Christian P; Delbac, Frédéric

2005-09-01

The spore polar tube is a unique organelle required for cell invasion by fungi-related microsporidian parasites. Two major polar tube proteins (PTP1 and PTP2) are encoded by two tandemly arranged genes in Encephalitozoon species. A look at Antonospora (Nosema) locustae contigs (http://jbpc.mbl.edu/Nosema/Contigs/) revealed significant conservation in the order and orientation of various genes, despite high sequence divergence features, when comparing with Encephalitozoon cuniculi complete genome. This syntenic relationship between distantly related Encephalitozoon and Antonospora genera has been successfully exploited to identify ptp1 and ptp2 genes in two insect-infecting species assigned to the Antonospora clade (A. locustae and Paranosema grylli). Targeting of respective proteins to the polar tube was demonstrated through immunolocalization experiments with antibodies raised against recombinant proteins. Both PTPs were extracted from spores with 100mM dithiothreitol. Evidence for PTP1 mannosylation was obtained in studied species, supporting a key role of PTP1 in interactions with host cell surface.

Sequencing of Seven Haloarchaeal Genomes Reveals Patterns of Genomic Flux

PubMed Central

Lynch, Erin A.; Langille, Morgan G. I.; Darling, Aaron; Wilbanks, Elizabeth G.; Haltiner, Caitlin; Shao, Katie S. Y.; Starr, Michael O.; Teiling, Clotilde; Harkins, Timothy T.; Edwards, Robert A.; Eisen, Jonathan A.; Facciotti, Marc T.

2012-01-01

We report the sequencing of seven genomes from two haloarchaeal genera, Haloferax and Haloarcula. Ease of cultivation and the existence of well-developed genetic and biochemical tools for several diverse haloarchaeal species make haloarchaea a model group for the study of archaeal biology. The unique physiological properties of these organisms also make them good candidates for novel enzyme discovery for biotechnological applications. Seven genomes were sequenced to ∼20×coverage and assembled to an average of 50 contigs (range 5 scaffolds - 168 contigs). Comparisons of protein-coding gene compliments revealed large-scale differences in COG functional group enrichment between these genera. Analysis of genes encoding machinery for DNA metabolism reveals genera-specific expansions of the general transcription factor TATA binding protein as well as a history of extensive duplication and horizontal transfer of the proliferating cell nuclear antigen. Insights gained from this study emphasize the importance of haloarchaea for investigation of archaeal biology. PMID:22848480

BAC-end sequence-based SNPs and Bin mapping for rapid integration of physical and genetic maps in apple.

PubMed

Han, Yuepeng; Chagné, David; Gasic, Ksenija; Rikkerink, Erik H A; Beever, Jonathan E; Gardiner, Susan E; Korban, Schuyler S

2009-03-01

A genome-wide BAC physical map of the apple, Malus x domestica Borkh., has been recently developed. Here, we report on integrating the physical and genetic maps of the apple using a SNP-based approach in conjunction with bin mapping. Briefly, BAC clones located at ends of BAC contigs were selected, and sequenced at both ends. The BAC end sequences (BESs) were used to identify candidate SNPs. Subsequently, these candidate SNPs were genetically mapped using a bin mapping strategy for the purpose of mapping the physical onto the genetic map. Using this approach, 52 (23%) out of 228 BESs tested were successfully exploited to develop SNPs. These SNPs anchored 51 contigs, spanning approximately 37 Mb in cumulative physical length, onto 14 linkage groups. The reliability of the integration of the physical and genetic maps using this SNP-based strategy is described, and the results confirm the feasibility of this approach to construct an integrated physical and genetic maps for apple.

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.

PubMed Central

Philipp, W J; Poulet, S; Eiglmeier, K; Pascopella, L; Balasubramanian, V; Heym, B; Bergh, S; Bloom, B R; Jacobs, W R; Cole, S T

1996-01-01

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis, was constructed by using a twin-pronged approach. Pulsed-field gel electrophoretic analysis enabled cleavage sites for Asn I and Dra I to be positioned on the 4.4-Mb circular chromosome, while, in parallel, clones from two cosmid libraries were ordered into contigs by means of fingerprinting and hybridization mapping. The resultant contig map was readily correlated with the physical map of the genome via the landmarked restriction sites. Over 165 genes and markers were localized on the integrated map, thus enabling comparisons with the leprosy bacillus, Mycobacterium leprae, to be undertaken. Mycobacterial genomes appear to have evolved as mosaic structures since extended segments with conserved gene order and organization are interspersed with different flanking regions. Repetitive sequences and insertion elements are highly abundant in M. tuberculosis, but the distribution of IS6110 is apparently nonrandom. Images Fig. 1 Fig. 2 PMID:8610181

An improved assembly of the loblolly pine mega-genome using long-read single-molecule sequencing.

PubMed

Zimin, Aleksey V; Stevens, Kristian A; Crepeau, Marc W; Puiu, Daniela; Wegrzyn, Jill L; Yorke, James A; Langley, Charles H; Neale, David B; Salzberg, Steven L

2017-01-01

The 22-gigabase genome of loblolly pine (Pinus taeda) is one of the largest ever sequenced. The draft assembly published in 2014 was built entirely from short Illumina reads, with lengths ranging from 100 to 250 base pairs (bp). The assembly was quite fragmented, containing over 11 million contigs whose weighted average (N50) size was 8206 bp. To improve this result, we generated approximately 12-fold coverage in long reads using the Single Molecule Real Time sequencing technology developed at Pacific Biosciences. We assembled the long and short reads together using the MaSuRCA mega-reads assembly algorithm, which produced a substantially better assembly, P. taeda version 2.0. The new assembly has an N50 contig size of 25 361, more than three times as large as achieved in the original assembly, and an N50 scaffold size of 107 821, 61% larger than the previous assembly. © The Author 2017. Published by Oxford University Press.

Outbred genome sequencing and CRISPR/Cas9 gene editing in butterflies

PubMed Central

Li, Xueyan; Fan, Dingding; Zhang, Wei; Liu, Guichun; Zhang, Lu; Zhao, Li; Fang, Xiaodong; Chen, Lei; Dong, Yang; Chen, Yuan; Ding, Yun; Zhao, Ruoping; Feng, Mingji; Zhu, Yabing; Feng, Yue; Jiang, Xuanting; Zhu, Deying; Xiang, Hui; Feng, Xikan; Li, Shuaicheng; Wang, Jun; Zhang, Guojie; Kronforst, Marcus R.; Wang, Wen

2015-01-01

Butterflies are exceptionally diverse but their potential as an experimental system has been limited by the difficulty of deciphering heterozygous genomes and a lack of genetic manipulation technology. Here we use a hybrid assembly approach to construct high-quality reference genomes for Papilio xuthus (contig and scaffold N50: 492 kb, 3.4 Mb) and Papilio machaon (contig and scaffold N50: 81 kb, 1.15 Mb), highly heterozygous species that differ in host plant affiliations, and adult and larval colour patterns. Integrating comparative genomics and analyses of gene expression yields multiple insights into butterfly evolution, including potential roles of specific genes in recent diversification. To functionally test gene function, we develop an efficient (up to 92.5%) CRISPR/Cas9 gene editing method that yields obvious phenotypes with three genes, Abdominal-B, ebony and frizzled. Our results provide valuable genomic and technological resources for butterflies and unlock their potential as a genetic model system. PMID:26354079

PlantGI: a database for searching gene indices in agricultural plants developed at NIAB, Korea

PubMed Central

Kim, Chang Kug; Choi, Ji Weon; Park, DongSuk; Kang, Man Jung; Seol, Young-Joo; Hyun, Do Yoon; Hahn, Jang Ho

2008-01-01

The Plant Gene Index (PlantGI) database is developed as a web-based search system with search capabilities for keywords to provide information on gene indices specifically for agricultural plants. The database contains specific Gene Index information for ten agricultural species, namely, rice, Chinese cabbage, wheat, maize, soybean, barley, mushroom, Arabidopsis, hot pepper and tomato. PlantGI differs from other Gene Index databases in being specific to agricultural plant species and thus complements services from similar other developments. The database includes options for interactive mining of EST CONTIGS and assembled EST data for user specific keyword queries. The current version of PlantGI contains a total of 34,000 EST CONTIGS data for rice (8488 records), wheat (8560 records), maize (4570 records), soybean (3726 records), barley (3417 records), Chinese cabbage (3602 records), tomato (1236 records), hot pepper (998 records), mushroom (130 records) and Arabidopsis (8 records). Availability The database is available for free at http://www.niab.go.kr/nabic/. PMID:18685722

MetaQUAST: evaluation of metagenome assemblies.

PubMed

Mikheenko, Alla; Saveliev, Vladislav; Gurevich, Alexey

2016-04-01

During the past years we have witnessed the rapid development of new metagenome assembly methods. Although there are many benchmark utilities designed for single-genome assemblies, there is no well-recognized evaluation and comparison tool for metagenomic-specific analogues. In this article, we present MetaQUAST, a modification of QUAST, the state-of-the-art tool for genome assembly evaluation based on alignment of contigs to a reference. MetaQUAST addresses such metagenome datasets features as (i) unknown species content by detecting and downloading reference sequences, (ii) huge diversity by giving comprehensive reports for multiple genomes and (iii) presence of highly relative species by detecting chimeric contigs. We demonstrate MetaQUAST performance by comparing several leading assemblers on one simulated and two real datasets. http://bioinf.spbau.ru/metaquast aleksey.gurevich@spbu.ru Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Numerous uncharacterized and highly divergent microbes which colonize humans are revealed by circulating cell-free DNA

PubMed Central

Camunas-Soler, Joan; Kertesz, Michael; De Vlaminck, Iwijn; Koh, Winston; Pan, Wenying; Martin, Lance; Neff, Norma F.; Okamoto, Jennifer; Wong, Ronald J.; Kharbanda, Sandhya; El-Sayed, Yasser; Blumenfeld, Yair; Stevenson, David K.; Shaw, Gary M.; Wolfe, Nathan D.; Quake, Stephen R.

2017-01-01

Blood circulates throughout the human body and contains molecules drawn from virtually every tissue, including the microbes and viruses which colonize the body. Through massive shotgun sequencing of circulating cell-free DNA from the blood, we identified hundreds of new bacteria and viruses which represent previously unidentified members of the human microbiome. Analyzing cumulative sequence data from 1,351 blood samples collected from 188 patients enabled us to assemble 7,190 contiguous regions (contigs) larger than 1 kbp, of which 3,761 are novel with little or no sequence homology in any existing databases. The vast majority of these novel contigs possess coding sequences, and we have validated their existence both by finding their presence in independent experiments and by performing direct PCR amplification. When their nearest neighbors are located in the tree of life, many of the organisms represent entirely novel taxa, showing that microbial diversity within the human body is substantially broader than previously appreciated. PMID:28830999

ATLAS (Automatic Tool for Local Assembly Structures) - A Comprehensive Infrastructure for Assembly, Annotation, and Genomic Binning of Metagenomic and Metaranscripomic Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Richard A.; Brown, Joseph M.; Colby, Sean M.

ATLAS (Automatic Tool for Local Assembly Structures) is a comprehensive multiomics data analysis pipeline that is massively parallel and scalable. ATLAS contains a modular analysis pipeline for assembly, annotation, quantification and genome binning of metagenomics and metatranscriptomics data and a framework for reference metaproteomic database construction. ATLAS transforms raw sequence data into functional and taxonomic data at the microbial population level and provides genome-centric resolution through genome binning. ATLAS provides robust taxonomy based on majority voting of protein coding open reading frames rolled-up at the contig level using modified lowest common ancestor (LCA) analysis. ATLAS provides robust taxonomy based onmore » majority voting of protein coding open reading frames rolled-up at the contig level using modified lowest common ancestor (LCA) analysis. ATLAS is user-friendly, easy install through bioconda maintained as open-source on GitHub, and is implemented in Snakemake for modular customizable workflows.« less

Erratum to: An improved assembly of the loblolly pine mega-genome using long-read single-molecule sequencing.

PubMed

Zimin, Aleksey V; Stevens, Kristian A; Crepeau, Marc W; Puiu, Daniela; Wegrzyn, Jill L; Yorke, James A; Langley, Charles H; Neale, David B; Salzberg, Steven L

2017-10-01

The 22-gigabase genome of loblolly pine (Pinus taeda) is one of the largest ever sequenced. The draft assembly published in 2014 was built entirely from short Illumina reads, with lengths ranging from 100 to 250 base pairs (bp). The assembly was quite fragmented, containing over 11 million contigs whose weighted average (N50) size was 8206 bp. To improve this result, we generated approximately 12-fold coverage in long reads using the Single Molecule Real Time sequencing technology developed at Pacific Biosciences. We assembled the long and short reads together using the MaSuRCA mega-reads assembly algorithm, which produced a substantially better assembly, P. taeda version 2.0. The new assembly has an N50 contig size of 25 361, more than three times as large as achieved in the original assembly, and an N50 scaffold size of 107 821, 61% larger than the previous assembly. © The Authors 2017. Published by Oxford University Press.

Hybrid error correction and de novo assembly of single-molecule sequencing reads

PubMed Central

Koren, Sergey; Schatz, Michael C.; Walenz, Brian P.; Martin, Jeffrey; Howard, Jason; Ganapathy, Ganeshkumar; Wang, Zhong; Rasko, David A.; McCombie, W. Richard; Jarvis, Erich D.; Phillippy, Adam M.

2012-01-01

Emerging single-molecule sequencing instruments can generate multi-kilobase sequences with the potential to dramatically improve genome and transcriptome assembly. However, the high error rate of single-molecule reads is challenging, and has limited their use to resequencing bacteria. To address this limitation, we introduce a novel correction algorithm and assembly strategy that utilizes shorter, high-identity sequences to correct the error in single-molecule sequences. We demonstrate the utility of this approach on Pacbio RS reads of phage, prokaryotic, and eukaryotic whole genomes, including the novel genome of the parrot Melopsittacus undulatus, as well as for RNA-seq reads of the corn (Zea mays) transcriptome. Our approach achieves over 99.9% read correction accuracy and produces substantially better assemblies than current sequencing strategies: in the best example, quintupling the median contig size relative to high-coverage, second-generation assemblies. Greater gains are predicted if read lengths continue to increase, including the prospect of single-contig bacterial chromosome assembly. PMID:22750884

Use of Genome Sequence Information for Meat Quality Trait QTL Mining for Causal Genes and Mutations on Pig Chromosome 17

PubMed Central

Hu, Zhi-Liang; Ramos, Antonio M.; Humphray, Sean J.; Rogers, Jane; Reecy, James M.; Rothschild, Max F.

2011-01-01

The newly available pig genome sequence has provided new information to fine map quantitative trait loci (QTL) in order to eventually identify causal variants. With targeted genomic sequencing efforts, we were able to obtain high quality BAC sequences that cover a region on pig chromosome 17 where a number of meat quality QTL have been previously discovered. Sequences from 70 BAC clones were assembled to form an 8-Mbp contig. Subsequently, we successfully mapped five previously identified QTL, three for meat color and two for lactate related traits, to the contig. With an additional 25 genetic markers that were identified by sequence comparison, we were able to carry out further linkage disequilibrium analysis to narrow down the genomic locations of these QTL, which allowed identification of the chromosomal regions that likely contain the causative variants. This research has provided one practical approach to combine genetic and molecular information for QTL mining. PMID:22303339

DNaseI Hypersensitivity and Ultraconservation Reveal Novel, Interdependent Long-Range Enhancers at the Complex Pax6 Cis-Regulatory Region

PubMed Central

McBride, David J.; Buckle, Adam; van Heyningen, Veronica; Kleinjan, Dirk A.

2011-01-01

The PAX6 gene plays a crucial role in development of the eye, brain, olfactory system and endocrine pancreas. Consistent with its pleiotropic role the gene exhibits a complex developmental expression pattern which is subject to strict spatial, temporal and quantitative regulation. Control of expression depends on a large array of cis-elements residing in an extended genomic domain around the coding region of the gene. The minimal essential region required for proper regulation of this complex locus has been defined through analysis of human aniridia-associated breakpoints and YAC transgenic rescue studies of the mouse smalleye mutant. We have carried out a systematic DNase I hypersensitive site (HS) analysis across 200 kb of this critical region of mouse chromosome 2E3 to identify putative regulatory elements. Mapping the identified HSs onto a percent identity plot (PIP) shows many HSs correspond to recognisable genomic features such as evolutionarily conserved sequences, CpG islands and retrotransposon derived repeats. We then focussed on a region previously shown to contain essential long range cis-regulatory information, the Pax6 downstream regulatory region (DRR), allowing comparison of mouse HS data with previous human HS data for this region. Reporter transgenic mice for two of the HS sites, HS5 and HS6, show that they function as tissue specific regulatory elements. In addition we have characterised enhancer activity of an ultra-conserved cis-regulatory region located near Pax6, termed E60. All three cis-elements exhibit multiple spatio-temporal activities in the embryo that overlap between themselves and other elements in the locus. Using a deletion set of YAC reporter transgenic mice we demonstrate functional interdependence of the elements. Finally, we use the HS6 enhancer as a marker for the migration of precerebellar neuro-epithelium cells to the hindbrain precerebellar nuclei along the posterior and anterior extramural streams allowing visualisation of

Towards the isolation of the idiopathic hemochromatosis disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chorney, M.J.; Venditti, C.P.; Harris, J.M.

1994-09-01

Despite the existence of many useful reagents which exist to aid in the positional cloning of the idiopathic hermochromatosis disease gene (HFE), the nature and precise location of this common genetic disease has remained elusive. Our group has pursued an MHC-based positional cloning approach which has centered on the precise physical definition of HLA-A variant chromosomes. Using deletion breakpoint locations in combination with genetic data derived from the Brittany founder population, we have used cDNA selection techniques to isolate new members of distinct multigene families which reside in the HFE critical region (distal to the HLA-A9 breakpoint/proximal to HLA-F). Wemore » have also initiated an independent set of cytogenetic and physical mapping studies to position the marker D6S105 with respect to the telomeric end of the class I subregion. Toward this end, we have performed double labelling FISH experiments which have allowed the localization of D6S105-containing YACs with respect to the HLA-A subregion and to the major G-bands which contain these loci. We have also derived single-copy probes, cosmids and cDNA clones from the region which have been used to create a physical map around D6S105. The combination of the cytogenetic and physical mapping data indicate that D6S105 is at least 2 Mb from HLA-A and that the distal limit of the MHC class I region may extend much further into the the euchromatic region of 6p21.3 than previously expected. A mega-YAC walk is now in progress to link the two loci. Finally, we have identified and characterized a family which is segregating a balanced inversion in phase with HFE. The breakpoint locations of this mutant chromosome may be important in the precise positioning of the HFE gene and attempts to define coding sequences in the proximity of this rearrangement are underway.« less

Robust Segmentation of Embayments to Encompass Exposure and Changes in Constituent Load

EPA Science Inventory

Nutrient and contaminant loads from the watershed, atmosphere, and seaward boundary to an embayment continually change due to human activities and alterations in the trends of natural forcing. Nevertheless, residence time (a measure of exposure) is always viewed as an unchanging ...

Toward an Integrative Model for CBT: Encompassing Behavior, Cognition, Affect, and Process

ERIC Educational Resources Information Center

Mischel, Walter

2004-01-01

Dramatic changes in our science in recent years have profound implications for how psychologists conceptualize, assess, and treat people. I comment on these developments and the contributions to this special series, focusing on how they speak to new directions and challenges for the future of CBT. Discoveries about mind, brain, and behavior that…

Respiratory motion guided four dimensional cone beam computed tomography: encompassing irregular breathing

NASA Astrophysics Data System (ADS)

O'Brien, Ricky T.; Cooper, Benjamin J.; Kipritidis, John; Shieh, Chun-Chien; Keall, Paul J.

2014-02-01

Four dimensional cone beam computed tomography (4DCBCT) images suffer from angular under sampling and bunching of projections due to a lack of feedback between the respiratory signal and the acquisition system. To address this problem, respiratory motion guided 4DCBCT (RMG-4DCBCT) regulates the gantry velocity and projection time interval, in response to the patient’s respiratory signal, with the aim of acquiring evenly spaced projections in a number of phase or displacement bins during the respiratory cycle. Our previous study of RMG-4DCBCT was limited to sinusoidal breathing traces. Here we expand on that work to provide a practical algorithm for the case of real patient breathing data. We give a complete description of RMG-4DCBCT including full details on how to implement the algorithms to determine when to move the gantry and when to acquire projections in response to the patient’s respiratory signal. We simulate a realistic working RMG-4DCBCT system using 112 breathing traces from 24 lung cancer patients. Acquisition used phase-based binning and parameter settings typically used on commercial 4DCBCT systems (4 min acquisition time, 1200 projections across 10 respiratory bins), with the acceleration and velocity constraints of current generation linear accelerators. We quantified streaking artefacts and image noise for conventional and RMG-4DCBCT methods by reconstructing projection data selected from an oversampled set of Catphan phantom projections. RMG-4DCBCT allows us to optimally trade-off image quality, acquisition time and image dose. For example, for the same image quality and acquisition time as conventional 4DCBCT approximately half the imaging dose is needed. Alternatively, for the same imaging dose, the image quality as measured by the signal to noise ratio, is improved by 63% on average. C-arm cone beam computed tomography systems, with an acceleration up to 200°/s2, a velocity up to 100°/s and the acquisition of 80 projections per second, allow the image acquisition time to be reduced to below 60 s. We have made considerable progress towards realizing a system to reduce projection clustering in conventional 4DCBCT imaging and hence reduce the imaging dose to the patient.

Holistic science: An understanding of science education encompassing ethical and social issues

NASA Astrophysics Data System (ADS)

Malekpour, Susan

Science has often been viewed, by the majority of our educators and the general public, as being objective and emotionless. Based on this view, our educators teach science in the same manner, objectively and in an abstract form. This manner of teaching has hindered our learners' ability for active learning and distanced them from the subject matter. In this action research, I have examined holistic science pedagogy in conjunction with a constructivism theory. In holistic science pedagogy, scientific knowledge is combined with subjective personal experiences and social issues. There is an interaction between student and scientific data when the student's context, relationships, and lived experiences that play a role in the scientific recognition of the world were incorporated into the learning process. In this pedagogical model, the factual content was viewed from the context of social and ethical implications. By empowering learners with this ability, science knowledge will no longer be exclusive to a select group. This process empowers the general population with the ability to understand scientific knowledge and therefore the ability to make informed decisions based on this knowledge. The goal was to make curriculum developers more conscious of factors that can positively influence the learning process and increase student engagement and understanding within the science classroom. The holistic approach to science pedagogy has enlightened and empowered our adult learners more effectively. Learners became more actively engaged in their own process of learning. Teachers must be willing to listen and implement student suggestions on improving the teaching/learning process. Teachers should be willing to make the effort in connecting with their students by structuring courses so the topics would be relevant to the students in relation to real world and social/ethical and political issues. Holistic science pedagogy strives for social change through the empowerment of adult learners with scientific knowledge. This research has demonstrated that learners can better understand the decision-making process and more easily relate their experiences, and therefore their knowledge, to social/political and ethical issues.

Active PHO5 chromatin encompasses variable numbers of nucleosomes at individual promoters.

PubMed

Jessen, Walter J; Hoose, Scott A; Kilgore, Jessica A; Kladde, Michael P

2006-03-01

Transcriptional activation is often associated with chromatin remodeling. However, little is known about the dynamics of remodeling of nucleosome arrays in vivo. Upon induction of Saccharomyces cerevisiae PHO5, a novel kinetic assay of DNA methyltransferase accessibility showed that nucleosomes adjacent to the histone-free upstream activating sequence (UASp1) are disrupted earlier and at higher frequency in the cell population than are those more distal. Individually cloned molecules, each representing the chromatin state of a full promoter from a single cell, revealed multiple promoter classes with either no remodeling or variable numbers of disrupted nucleosomes. Individual promoters in the remodeled fraction were highly enriched for contiguous blocks of disrupted nucleosomes, the majority of which overlapped the UAS region. These results support a probabilistic model in which chromatin remodeling at PHO5 spreads from sites of transactivator association with DNA and attenuates with distance.

Draft Genome Sequence of Aquitalea magnusonii Strain H3, a Plant Growth-Promoting Bacterium of Duckweed (Lemna minor).

PubMed

Ishizawa, Hidehiro; Kuroda, Masashi; Ike, Michihiko

2017-08-17

Aquitalea magnusonii strain H3 is a promising plant growth-promoting bacterium for duckweed. Here, we report the draft genome sequence of strain H3 comprising 4,750,601 bp in 73 contigs. Several genes associated with plant root colonization were identified. Copyright © 2017 Ishizawa et al.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits

PubMed Central

Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo

2014-01-01

Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. PMID:25035321

77 FR 30265 - Notice of Submission for OMB Review; Federal Student Aid; Direct Loan Income Contingent Repayment...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-22

... Income Contingent Repayment Plan Alternative Documentation of Income SUMMARY: This form serves as the means by which a borrower who is repaying Direct Loan Program loans under the Income-Contigent Repayment (ICR) Plan or the Income-Based Repayment (IBR) Plan provides the U.S. Department of Education (the...

Draft Genome Sequence of a “Candidatus Liberibacter europaeus” Strain Assembled from Broom Psyllids (Arytainilla spartiophila) from New Zealand

PubMed Central

Thompson, Sarah M.; Kalamorz, Falk; David, Charles; Addison, Shea M.; Smith, Grant R.

2018-01-01

ABSTRACT Here, we report the draft genome sequence of “Candidatus Liberibacter europaeus” ASNZ1, assembled from broom psyllids (Arytainilla spartiophila) from New Zealand. The assembly comprises 15 contigs, with a total length of 1.33 Mb and a G+C content of 33.5%. PMID:29773636

Genome Sequence of Actinobacillus seminis Strain ATCC 15768, a Reference Strain of Ovine Pathogens That Causes Infections in Reproductive Organs.

PubMed

Negrete-Abascal, Erasmo; Montes-Garcia, Fernando; Vaca-Pacheco, Sergio; Leyto-Gil, Abraham M; Fragoso-Garcia, Edgar; Carvente-Garcia, Roberto; Perez-Agueros, Sandra; Castelan-Sanchez, Hugo G; Garcia-Molina, Alejandra; Villamar, Tomas E; Sánchez-Alonso, Patricia; Vazquez-Cruz, Candelario

2018-01-11

The draft genome sequence of Actinobacillus seminis strain ATCC 15768 is reported here. The genome comprises 22 contigs corresponding to 2.36 Mb with 40.7% G+C content and contains several genes related to virulence, including a putative RTX protein. Copyright © 2018 Negrete-Abascal et al.

Comparing de novo genome assembly: the long and short of it.

PubMed

Narzisi, Giuseppe; Mishra, Bud

2011-04-29

Recent advances in DNA sequencing technology and their focal role in Genome Wide Association Studies (GWAS) have rekindled a growing interest in the whole-genome sequence assembly (WGSA) problem, thereby, inundating the field with a plethora of new formalizations, algorithms, heuristics and implementations. And yet, scant attention has been paid to comparative assessments of these assemblers' quality and accuracy. No commonly accepted and standardized method for comparison exists yet. Even worse, widely used metrics to compare the assembled sequences emphasize only size, poorly capturing the contig quality and accuracy. This paper addresses these concerns: it highlights common anomalies in assembly accuracy through a rigorous study of several assemblers, compared under both standard metrics (N50, coverage, contig sizes, etc.) as well as a more comprehensive metric (Feature-Response Curves, FRC) that is introduced here; FRC transparently captures the trade-offs between contigs' quality against their sizes. For this purpose, most of the publicly available major sequence assemblers--both for low-coverage long (Sanger) and high-coverage short (Illumina) reads technologies--are compared. These assemblers are applied to microbial (Escherichia coli, Brucella, Wolbachia, Staphylococcus, Helicobacter) and partial human genome sequences (Chr. Y), using sequence reads of various read-lengths, coverages, accuracies, and with and without mate-pairs. It is hoped that, based on these evaluations, computational biologists will identify innovative sequence assembly paradigms, bioinformaticists will determine promising approaches for developing "next-generation" assemblers, and biotechnologists will formulate more meaningful design desiderata for sequencing technology platforms. A new software tool for computing the FRC metric has been developed and is available through the AMOS open-source consortium.

From biomedicine to natural history research: EST resources for ambystomatid salamanders

PubMed Central

Putta, Srikrishna; Smith, Jeramiah J; Walker, John A; Rondet, Mathieu; Weisrock, David W; Monaghan, James; Samuels, Amy K; Kump, Kevin; King, David C; Maness, Nicholas J; Habermann, Bianca; Tanaka, Elly; Bryant, Susan V; Gardiner, David M; Parichy, David M; Voss, S Randal

2004-01-01

Background Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories. Results Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for A. mexicanum were processed to yield 35,413 and 20,599 high quality ESTs for A. mexicanum and A. t. tigrinum, respectively. Because the A. t. tigrinum ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human – Ambystoma synteny group with marker loci, and extended PCR primer sets designed for A. mexicanum / A. t. tigrinum orthologues to a related tiger salamander species. Conclusions Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research. PMID:15310388

Toward an Integrated BAC Library Resource for Genome Sequencing and Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simon, M. I.; Kim, U.-J.

We developed a great deal of expertise in building large BAC libraries from a variety of DNA sources including humans, mice, corn, microorganisms, worms, and Arabidopsis. We greatly improved the technology for screening these libraries rapidly and for selecting appropriate BACs and mapping BACs to develop large overlapping contigs. We became involved in supplying BACs and BAC contigs to a variety of sequencing and mapping projects and we began to collaborate with Drs. Adams and Venter at TIGR and with Dr. Leroy Hood and his group at University of Washington to provide BACs for end sequencing and for mapping andmore » sequencing of large fragments of chromosome 16. Together with Dr. Ian Dunham and his co-workers at the Sanger Center we completed the mapping and they completed the sequencing of the first human chromosome, chromosome 22. This was published in Nature in 1999 and our BAC contigs made a major contribution to this sequencing effort. Drs. Shizuya and Ding invented an automated highly accurate BAC mapping technique. We also developed long-term collaborations with Dr. Uli Weier at UCSF in the design of BAC probes for characterization of human tumors and specific chromosome deletions and breakpoints. Finally the contribution of our work to the human genome project has been recognized in the publication both by the international consortium and the NIH of a draft sequence of the human genome in Nature last year. Dr. Shizuya was acknowledged in the authorship of that landmark paper. Dr. Simon was also an author on the Venter/Adams Celera project sequencing the human genome that was published in Science last year.« less

The European sea bass Dicentrarchus labrax genome puzzle: comparative BAC-mapping and low coverage shotgun sequencing

PubMed Central

2010-01-01

Background Food supply from the ocean is constrained by the shortage of domesticated and selected fish. Development of genomic models of economically important fishes should assist with the removal of this bottleneck. European sea bass Dicentrarchus labrax L. (Moronidae, Perciformes, Teleostei) is one of the most important fishes in European marine aquaculture; growing genomic resources put it on its way to serve as an economic model. Results End sequencing of a sea bass genomic BAC-library enabled the comparative mapping of the sea bass genome using the three-spined stickleback Gasterosteus aculeatus genome as a reference. BAC-end sequences (102,690) were aligned to the stickleback genome. The number of mappable BACs was improved using a two-fold coverage WGS dataset of sea bass resulting in a comparative BAC-map covering 87% of stickleback chromosomes with 588 BAC-contigs. The minimum size of 83 contigs covering 50% of the reference was 1.2 Mbp; the largest BAC-contig comprised 8.86 Mbp. More than 22,000 BAC-clones aligned with both ends to the reference genome. Intra-chromosomal rearrangements between sea bass and stickleback were identified. Size distributions of mapped BACs were used to calculate that the genome of sea bass may be only 1.3 fold larger than the 460 Mbp stickleback genome. Conclusions The BAC map is used for sequencing single BACs or BAC-pools covering defined genomic entities by second generation sequencing technologies. Together with the WGS dataset it initiates a sea bass genome sequencing project. This will allow the quantification of polymorphisms through resequencing, which is important for selecting highly performing domesticated fish. PMID:20105308

Metagenomics of rumen bacteriophage from thirteen lactating dairy cattle

PubMed Central

2013-01-01

Background The bovine rumen hosts a diverse and complex community of Eukarya, Bacteria, Archea and viruses (including bacteriophage). The rumen viral population (the rumen virome) has received little attention compared to the rumen microbial population (the rumen microbiome). We used massively parallel sequencing of virus like particles to investigate the diversity of the rumen virome in thirteen lactating Australian Holstein dairy cattle all housed in the same location, 12 of which were sampled on the same day. Results Fourteen putative viral sequence fragments over 30 Kbp in length were assembled and annotated. Many of the putative genes in the assembled contigs showed no homology to previously annotated genes, highlighting the large amount of work still required to fully annotate the functions encoded in viral genomes. The abundance of the contig sequences varied widely between animals, even though the cattle were of the same age, stage of lactation and fed the same diets. Additionally the twelve animals which were co-habited shared a number of their dominant viral contigs. We compared the functional characteristics of our bovine viromes with that of other viromes, as well as rumen microbiomes. At the functional level, we found strong similarities between all of the viral samples, which were highly distinct from the rumen microbiome samples. Conclusions Our findings suggest a large amount of between animal variation in the bovine rumen virome and that co-habiting animals may have more similar viromes than non co-habited animals. We report the deepest sequencing to date of the rumen virome. This work highlights the enormous amount of novelty and variation present in the rumen virome. PMID:24180266

Transcriptomics of In Vitro Immune-Stimulated Hemocytes from the Manila Clam Ruditapes philippinarum Using High-Throughput Sequencing

PubMed Central

Moreira, Rebeca; Balseiro, Pablo; Planas, Josep V.; Fuste, Berta; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio

2012-01-01

Background The Manila clam (Ruditapes philippinarum) is a worldwide cultured bivalve species with important commercial value. Diseases affecting this species can result in large economic losses. Because knowledge of the molecular mechanisms of the immune response in bivalves, especially clams, is scarce and fragmentary, we sequenced RNA from immune-stimulated R. philippinarum hemocytes by 454-pyrosequencing to identify genes involved in their immune defense against infectious diseases. Methodology and Principal Findings High-throughput deep sequencing of R. philippinarum using 454 pyrosequencing technology yielded 974,976 high-quality reads with an average read length of 250 bp. The reads were assembled into 51,265 contigs and the 44.7% of the translated nucleotide sequences into protein were annotated successfully. The 35 most frequently found contigs included a large number of immune-related genes, and a more detailed analysis showed the presence of putative members of several immune pathways and processes like the apoptosis, the toll like signaling pathway and the complement cascade. We have found sequences from molecules never described in bivalves before, especially in the complement pathway where almost all the components are present. Conclusions This study represents the first transcriptome analysis using 454-pyrosequencing conducted on R. philippinarum focused on its immune system. Our results will provide a rich source of data to discover and identify new genes, which will serve as a basis for microarray construction and the study of gene expression as well as for the identification of genetic markers. The discovery of new immune sequences was very productive and resulted in a large variety of contigs that may play a role in the defense mechanisms of Ruditapes philippinarum. PMID:22536348

A NGS approach to the encrusting Mediterranean sponge Crella elegans (Porifera, Demospongiae, Poecilosclerida): transcriptome sequencing, characterization and overview of the gene expression along three life cycle stages.

PubMed

Pérez-Porro, A R; Navarro-Gómez, D; Uriz, M J; Giribet, G

2013-05-01

Sponges can be dominant organisms in many marine and freshwater habitats where they play essential ecological roles. They also represent a key group to address important questions in early metazoan evolution. Recent approaches for improving knowledge on sponge biological and ecological functions as well as on animal evolution have focused on the genetic toolkits involved in ecological responses to environmental changes (biotic and abiotic), development and reproduction. These approaches are possible thanks to newly available, massive sequencing technologies-such as the Illumina platform, which facilitate genome and transcriptome sequencing in a cost-effective manner. Here we present the first NGS (next-generation sequencing) approach to understanding the life cycle of an encrusting marine sponge. For this we sequenced libraries of three different life cycle stages of the Mediterranean sponge Crella elegans and generated de novo transcriptome assemblies. Three assemblies were based on sponge tissue of a particular life cycle stage, including non-reproductive tissue, tissue with sperm cysts and tissue with larvae. The fourth assembly pooled the data from all three stages. By aggregating data from all the different life cycle stages we obtained a higher total number of contigs, contigs with blast hit and annotated contigs than from one stage-based assemblies. In that multi-stage assembly we obtained a larger number of the developmental regulatory genes known for metazoans than in any other assembly. We also advance the differential expression of selected genes in the three life cycle stages to explore the potential of RNA-seq for improving knowledge on functional processes along the sponge life cycle. © 2013 Blackwell Publishing Ltd.

Analysis of the Olive Fruit Fly Bactrocera oleae Transcriptome and Phylogenetic Classification of the Major Detoxification Gene Families

PubMed Central

Rombauts, Stephane; Chrisargiris, Antonis; Van Leeuwen, Thomas; Vontas, John

2013-01-01

The olive fruit fly Bactrocera oleae has a unique ability to cope with olive flesh, and is the most destructive pest of olives worldwide. Its control has been largely based on the use of chemical insecticides, however, the selection of insecticide resistance against several insecticides has evolved. The study of detoxification mechanisms, which allow the olive fruit fly to defend against insecticides, and/or phytotoxins possibly present in the mesocarp, has been hampered by the lack of genomic information in this species. In the NCBI database less than 1,000 nucleotide sequences have been deposited, with less than 10 detoxification gene homologues in total. We used 454 pyrosequencing to produce, for the first time, a large transcriptome dataset for B. oleae. A total of 482,790 reads were assembled into 14,204 contigs. More than 60% of those contigs (8,630) were larger than 500 base pairs, and almost half of them matched with genes of the order of the Diptera. Analysis of the Gene Ontology (GO) distribution of unique contigs, suggests that, compared to other insects, the assembly is broadly representative for the B. oleae transcriptome. Furthermore, the transcriptome was found to contain 55 P450, 43 GST-, 15 CCE- and 18 ABC transporter-genes. Several of those detoxification genes, may putatively be involved in the ability of the olive fruit fly to deal with xenobiotics, such as plant phytotoxins and insecticides. In summary, our study has generated new data and genomic resources, which will substantially facilitate molecular studies in B. oleae, including elucidation of detoxification mechanisms of xenobiotic, as well as other important aspects of olive fruit fly biology. PMID:23824998

Asian Citrus Psyllid Expression Profiles Suggest Candidatus Liberibacter Asiaticus-Mediated Alteration of Adult Nutrition and Metabolism, and of Nymphal Development and Immunity

PubMed Central

He, Ruifeng; Nelson, William; Yin, Guohua; Cicero, Joseph M.; Willer, Mark; Kim, Ryan; Kramer, Robin; May, Greg A.; Crow, John A.; Soderlund, Carol A.; Gang, David R.; Brown, Judith K.

2015-01-01

The Asian citrus psyllid (ACP) Diaphorina citri Kuwayama (Hemiptera: Psyllidae) is the insect vector of the fastidious bacterium Candidatus Liberibacter asiaticus (CLas), the causal agent of citrus greening disease, or Huanglongbing (HLB). The widespread invasiveness of the psyllid vector and HLB in citrus trees worldwide has underscored the need for non-traditional approaches to manage the disease. One tenable solution is through the deployment of RNA interference technology to silence protein-protein interactions essential for ACP-mediated CLas invasion and transmission. To identify psyllid interactor-bacterial effector combinations associated with psyllid-CLas interactions, cDNA libraries were constructed from CLas-infected and CLas-free ACP adults and nymphs, and analyzed for differential expression. Library assemblies comprised 24,039,255 reads and yielded 45,976 consensus contigs. They were annotated (UniProt), classified using Gene Ontology, and subjected to in silico expression analyses using the Transcriptome Computational Workbench (TCW) (http://www.sohomoptera.org/ACPPoP/). Functional-biological pathway interpretations were carried out using the Kyoto Encyclopedia of Genes and Genomes databases. Differentially expressed contigs in adults and/or nymphs represented genes and/or metabolic/pathogenesis pathways involved in adhesion, biofilm formation, development-related, immunity, nutrition, stress, and virulence. Notably, contigs involved in gene silencing and transposon-related responses were documented in a psyllid for the first time. This is the first comparative transcriptomic analysis of ACP adults and nymphs infected and uninfected with CLas. The results provide key initial insights into host-parasite interactions involving CLas effectors that contribute to invasion-virulence, and to host nutritional exploitation and immune-related responses that appear to be essential for successful ACP-mediated circulative, propagative CLas transmission. PMID

Diversity in a Polymicrobial Community Revealed by Analysis of Viromes, Endolysins and CRISPR Spacers.

PubMed

Davison, Michelle; Treangen, Todd J; Koren, Sergey; Pop, Mihai; Bhaya, Devaki

2016-01-01

The polymicrobial biofilm communities in Mushroom and Octopus Spring in Yellowstone National Park (YNP) are well characterized, yet little is known about the phage populations. Dominant species, Synechococcus sp. JA-2-3B'a(2-13), Synechococcus sp. JA-3-3Ab, Chloroflexus sp. Y-400-fl, and Roseiflexus sp. RS-1, contain multiple CRISPR-Cas arrays, suggesting complex interactions with phage predators. To analyze phage populations from Octopus Spring biofilms, we sequenced a viral enriched fraction. To assemble and analyze phage metagenomic data, we developed a custom module, VIRITAS, implemented within the MetAMOS framework. This module bins contigs into groups based on tetranucleotide frequencies and CRISPR spacer-protospacer matching and ORF calling. Using this pipeline we were able to assemble phage sequences into contigs and bin them into three clusters that corroborated with their potential host range. The virome contained 52,348 predicted ORFs; some were clearly phage-like; 9319 ORFs had a recognizable Pfam domain while the rest were hypothetical. Of the recognized domains with CRISPR spacer matches, was the phage endolysin used by lytic phage to disrupt cells. Analysis of the endolysins present in the thermophilic cyanophage contigs revealed a subset of characterized endolysins as well as a Glyco_hydro_108 (PF05838) domain not previously associated with sequenced cyanophages. A search for CRISPR spacer matches to all identified phage endolysins demonstrated that a majority of endolysin domains were targets. This strategy provides a general way to link host and phage as endolysins are known to be widely distributed in bacteriophage. Endolysins can also provide information about host cell wall composition and have the additional potential to be used as targets for novel therapeutics.

Genomic patterns of introgression in rainbow and westslope cutthroat trout illuminated by overlapping paired-end RAD sequencing

USGS Publications Warehouse

Hohenlohe, Paul A.; Day, Mitch D.; Amish, Stephen J.; Miller, Michael R.; Kamps-Hughes, Nick; Boyer, Matthew C.; Muhlfeld, Clint C.; Allendorf, Fred W.; Johnson, Eric A.; Luikart, Gordon

2013-01-01

Rapid and inexpensive methods for genomewide single nucleotide polymorphism (SNP) discovery and genotyping are urgently needed for population management and conservation. In hybridized populations, genomic techniques that can identify and genotype thousands of species-diagnostic markers would allow precise estimates of population- and individual-level admixture as well as identification of 'super invasive' alleles, which show elevated rates of introgression above the genomewide background (likely due to natural selection). Techniques like restriction-site-associated DNA (RAD) sequencing can discover and genotype large numbers of SNPs, but they have been limited by the length of continuous sequence data they produce with Illumina short-read sequencing. We present a novel approach, overlapping paired-end RAD sequencing, to generate RAD contigs of >300–400 bp. These contigs provide sufficient flanking sequence for design of high-throughput SNP genotyping arrays and strict filtering to identify duplicate paralogous loci. We applied this approach in five populations of native westslope cutthroat trout that previously showed varying (low) levels of admixture from introduced rainbow trout (RBT). We produced 77 141 RAD contigs and used these data to filter and genotype 3180 previously identified species-diagnostic SNP loci. Our population-level and individual-level estimates of admixture were generally consistent with previous microsatellite-based estimates from the same individuals. However, we observed slightly lower admixture estimates from genomewide markers, which might result from natural selection against certain genome regions, different genomic locations for microsatellites vs. RAD-derived SNPs and/or sampling error from the small number of microsatellite loci (n = 7). We also identified candidate adaptive super invasive alleles from RBT that had excessively high admixture proportions in hybridized cutthroat trout populations.

Characterization of Withania somnifera Leaf Transcriptome and Expression Analysis of Pathogenesis – Related Genes during Salicylic Acid Signaling

PubMed Central

Ghosh Dasgupta, Modhumita; George, Blessan Santhosh; Bhatia, Anil; Sidhu, Om Prakash

2014-01-01

Withania somnifera (L.) Dunal is a valued medicinal plant with pharmaceutical applications. The present study was undertaken to analyze the salicylic acid induced leaf transcriptome of W. somnifera. A total of 45.6 million reads were generated and the de novo assembly yielded 73,523 transcript contig with average transcript contig length of 1620 bp. A total of 71,062 transcripts were annotated and 53,424 of them were assigned GO terms. Mapping of transcript contigs to biological pathways revealed presence of 182 pathways. Seventeen genes representing 12 pathogenesis-related (PR) families were mined from the transcriptome data and their pattern of expression post 17 and 36 hours of salicylic acid treatment was documented. The analysis revealed significant up-regulation of all families of PR genes by 36 hours post treatment except WsPR10. The relative fold expression of transcripts ranged from 1 fold to 6,532 fold. The two families of peroxidases including the lignin-forming anionic peroxidase (WsL-PRX) and suberization-associated anionic peroxidase (WsS-PRX) recorded maximum expression of 377 fold and 6532 fold respectively, while the expression of WsPR10 was down-regulated by 14 fold. Additionally, the most stable reference gene for normalization of qRT-PCR data was also identified. The effect of SA on the accumulation of major secondary metabolites of W. somnifera including withanoside V, withaferin A and withanolide A was also analyzed and an increase in content of all the three metabolites were detected. This is the first report on expression patterns of PR genes during salicylic acid signaling in W. somnifera. PMID:24739900

Shotgun mitogenomics across body size classes in a local assemblage of tropical Diptera: Phylogeny, species diversity and mitochondrial abundance spectrum.

PubMed

Choo, Le Qin; Crampton-Platt, Alex; Vogler, Alfried P

2017-10-01

Mitochondrial genomes can be assembled readily from shotgun-sequenced DNA mixtures of mass-trapped arthropods ("mitochondrial metagenomics"), speeding up the taxonomic characterization. Bulk sequencing was conducted on some 800 individuals of Diptera obtained by canopy fogging of a single tree in Borneo dominated by small (<1.5 mm) individuals. Specimens were split into five body size classes for DNA extraction, to equalize read numbers across specimens and to study how body size, a key ecological trait, interacts with species and phylogenetic diversity. Genome assembly produced 304 orthologous mitochondrial contigs presumed to each represent a different species. The small-bodied fraction was the by far most species-rich (187 contigs). Identification of contigs was through phylogenetic analysis together with 56 reference mitogenomes, which placed most of the Bornean community into seven clades of small-bodied species, indicating phylogenetic conservation of body size. Mapping of shotgun reads against the mitogenomes showed wide ranges of read abundances within each size class. Ranked read abundance plots were largely log-linear, indicating a uniformly filled abundance spectrum, especially for small-bodied species. Small-bodied species differed greatly from other size classes in neutral metacommunity parameters, exhibiting greater levels of immigration, besides greater total community size. We suggest that the established uses of mitochondrial metagenomics for analysis of species and phylogenetic diversity can be extended to parameterize recent theories of community ecology and biodiversity, and by focusing on the number mitochondria, rather than individuals, a new theoretical framework for analysis of mitochondrial abundance spectra can be developed that incorporates metabolic activity approximated by the count of mitochondria. © 2017 John Wiley & Sons Ltd.

OryzaGenome: Genome Diversity Database of Wild Oryza Species.

PubMed

Ohyanagi, Hajime; Ebata, Toshinobu; Huang, Xuehui; Gong, Hao; Fujita, Masahiro; Mochizuki, Takako; Toyoda, Atsushi; Fujiyama, Asao; Kaminuma, Eli; Nakamura, Yasukazu; Feng, Qi; Wang, Zi-Xuan; Han, Bin; Kurata, Nori

2016-01-01

The species in the genus Oryza, encompassing nine genome types and 23 species, are a rich genetic resource and may have applications in deeper genomic analyses aiming to understand the evolution of plant genomes. With the advancement of next-generation sequencing (NGS) technology, a flood of Oryza species reference genomes and genomic variation information has become available in recent years. This genomic information, combined with the comprehensive phenotypic information that we are accumulating in our Oryzabase, can serve as an excellent genotype-phenotype association resource for analyzing rice functional and structural evolution, and the associated diversity of the Oryza genus. Here we integrate our previous and future phenotypic/habitat information and newly determined genotype information into a united repository, named OryzaGenome, providing the variant information with hyperlinks to Oryzabase. The current version of OryzaGenome includes genotype information of 446 O. rufipogon accessions derived by imputation and of 17 accessions derived by imputation-free deep sequencing. Two variant viewers are implemented: SNP Viewer as a conventional genome browser interface and Variant Table as a text-based browser for precise inspection of each variant one by one. Portable VCF (variant call format) file or tab-delimited file download is also available. Following these SNP (single nucleotide polymorphism) data, reference pseudomolecules/scaffolds/contigs and genome-wide variation information for almost all of the closely and distantly related wild Oryza species from the NIG Wild Rice Collection will be available in future releases. All of the resources can be accessed through http://viewer.shigen.info/oryzagenome/. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

A New Chicken Genome Assembly Provides Insight into Avian Genome Structure.

PubMed

Warren, Wesley C; Hillier, LaDeana W; Tomlinson, Chad; Minx, Patrick; Kremitzki, Milinn; Graves, Tina; Markovic, Chris; Bouk, Nathan; Pruitt, Kim D; Thibaud-Nissen, Francoise; Schneider, Valerie; Mansour, Tamer A; Brown, C Titus; Zimin, Aleksey; Hawken, Rachel; Abrahamsen, Mitch; Pyrkosz, Alexis B; Morisson, Mireille; Fillon, Valerie; Vignal, Alain; Chow, William; Howe, Kerstin; Fulton, Janet E; Miller, Marcia M; Lovell, Peter; Mello, Claudio V; Wirthlin, Morgan; Mason, Andrew S; Kuo, Richard; Burt, David W; Dodgson, Jerry B; Cheng, Hans H

2017-01-05

The importance of the Gallus gallus (chicken) as a model organism and agricultural animal merits a continuation of sequence assembly improvement efforts. We present a new version of the chicken genome assembly (Gallus_gallus-5.0; GCA_000002315.3), built from combined long single molecule sequencing technology, finished BACs, and improved physical maps. In overall assembled bases, we see a gain of 183 Mb, including 16.4 Mb in placed chromosomes with a corresponding gain in the percentage of intact repeat elements characterized. Of the 1.21 Gb genome, we include three previously missing autosomes, GGA30, 31, and 33, and improve sequence contig length 10-fold over the previous Gallus_gallus-4.0. Despite the significant base representation improvements made, 138 Mb of sequence is not yet located to chromosomes. When annotated for gene content, Gallus_gallus-5.0 shows an increase of 4679 annotated genes (2768 noncoding and 1911 protein-coding) over those in Gallus_gallus-4.0. We also revisited the question of what genes are missing in the avian lineage, as assessed by the highest quality avian genome assembly to date, and found that a large fraction of the original set of missing genes are still absent in sequenced bird species. Finally, our new data support a detailed map of MHC-B, encompassing two segments: one with a highly stable gene copy number and another in which the gene copy number is highly variable. The chicken model has been a critical resource for many other fields of study, and this new reference assembly will substantially further these efforts. Copyright © 2017 Warren et al.

A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.)

PubMed Central

2009-01-01

Background Chickpea (Cicer arietinum L.), an important grain legume crop of the world is seriously challenged by terminal drought and salinity stresses. However, very limited number of molecular markers and candidate genes are available for undertaking molecular breeding in chickpea to tackle these stresses. This study reports generation and analysis of comprehensive resource of drought- and salinity-responsive expressed sequence tags (ESTs) and gene-based markers. Results A total of 20,162 (18,435 high quality) drought- and salinity- responsive ESTs were generated from ten different root tissue cDNA libraries of chickpea. Sequence editing, clustering and assembly analysis resulted in 6,404 unigenes (1,590 contigs and 4,814 singletons). Functional annotation of unigenes based on BLASTX analysis showed that 46.3% (2,965) had significant similarity (≤1E-05) to sequences in the non-redundant UniProt database. BLASTN analysis of unique sequences with ESTs of four legume species (Medicago, Lotus, soybean and groundnut) and three model plant species (rice, Arabidopsis and poplar) provided insights on conserved genes across legumes as well as novel transcripts for chickpea. Of 2,965 (46.3%) significant unigenes, only 2,071 (32.3%) unigenes could be functionally categorised according to Gene Ontology (GO) descriptions. A total of 2,029 sequences containing 3,728 simple sequence repeats (SSRs) were identified and 177 new EST-SSR markers were developed. Experimental validation of a set of 77 SSR markers on 24 genotypes revealed 230 alleles with an average of 4.6 alleles per marker and average polymorphism information content (PIC) value of 0.43. Besides SSR markers, 21,405 high confidence single nucleotide polymorphisms (SNPs) in 742 contigs (with ≥ 5 ESTs) were also identified. Recognition sites for restriction enzymes were identified for 7,884 SNPs in 240 contigs. Hierarchical clustering of 105 selected contigs provided clues about stress- responsive candidate genes

Draft Genome Sequence of Streptomyces vitaminophilus ATCC 31673, a Producer of Pyrrolomycin Antibiotics, Some of Which Contain a Nitro Group.

PubMed

Mahan, Kristina M; Klingeman, Dawn M; Hettich, Robert L; Parry, Ronald J; Graham, David E

2016-01-21

Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. The 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content. Copyright © 2016 Mahan et al.

Beatrice Hill Virus Represents a Novel Species in the Genus Tibrovirus (Mononegavirales: Rhabdoviridae)

DTIC Science & Technology

2017-01-26

Huang et al. published a 5,734 nt-long contig of the Beatrice Hill virus genome, 48 which indicated that this virus most likely falls into the... Desktop sequencer. Illumina and SISPA-RACE adapter sequences were trimmed from 56 the sequencing reads using Cutadapt-1.2.1 (14), quality filtering

Arbovirus Detection in Insect Vectors by Rapid, High-Throughput Pyrosequencing

DTIC Science & Technology

2010-11-09

large contigs that by BLAST had their best hit to a rRNA of various fungal origins (including the genera Penicillium and Aspergillus ) and in all five...bioinformatic workflows need to be streamlined for non-expert users. For this approach to ever become part of the public health arsenal, our calculations

Draft Genome Sequence of Escherichia coli Strain SN137, a Bacterium with Extracellular Proteolytic Activity on Immunoglobulins and Persistence in Human Tissue Blood.

PubMed

Najera-Hernandez, Salustio; Sanchez-Alonso, Maria Patricia; Anastacio-Marcelino, Estela; Negrete-Abascal, Erasmo; Vazquez-Cruz, Candelario

2018-01-18

The draft genome sequence of Escherichia coli strain SN137 is reported here. The genome comprises 172 contigs, corresponding to 4.9 Mb with 50% G+C content, and contains several genes related to pathogenicity that explain its survival in human hematic tissue. Copyright © 2018 Najera-Hernandez et al.

Draft Genome Sequence of a Pseudomonas aeruginosa NA04 Bacterium Isolated from an Entomopathogenic Nematode.

PubMed

Salgado-Morales, Rosalba; Rivera-Gómez, Nancy; Lozano-Aguirre Beltrán, Luis Fernando; Hernández-Mendoza, Armando; Dantán-González, Edgar

2017-09-07

We report the draft genome sequence of Gram-negative bacterium Pseudomonas aeruginosa NA04, isolated from the entomopathogenic nematode Heterorhabditis indica MOR03. The draft genome consists of 54 contigs, a length of 6.37 Mb, and a G+C content 66.49%. Copyright © 2017 Salgado-Morales et al.

Draft Genome Sequence of the Extremely Halophilic Bacterium Halomonas salina Strain CIFRI1, Isolated from the East Coast of India

PubMed Central

Das, Priyanka; Maharana, Jitendra; Paria, Prasenjit; Mandal, Shambhu Nath; Meena, Dharmendra Kumar; Sharma, Anil Prakash; Jayarajan, Rijith; Dixit, Vishal; Verma, Ankit; Vellarikkal, Shamsudheen Karuthedath; Scaria, Vinod; Sivasubbu, Sridhar; Rao, Atmakuri Ramakrishna; Mohapatra, Trilochan

2015-01-01

Halomonas salina strain CIFRI1 is an extremely salt-stress-tolerant bacterium isolated from the salt crystals of the east coast of India. Here we report the annotated 3.45-Mb draft genome sequence of strain CIFRI1 having 86 contigs with 3,139 protein coding loci, including 62 RNA genes. PMID:25573926

Curtobacterium sp. Genome Sequencing Underlines Plant Growth Promotion-Related Traits.

PubMed

Bulgari, Daniela; Minio, Andrea; Casati, Paola; Quaglino, Fabio; Delledonne, Massimo; Bianco, Piero A

2014-07-17

Endophytic bacteria are microorganisms residing in plant tissues without causing disease symptoms. Here, we provide the high-quality genome sequence of Curtobacterium sp. strain S6, isolated from grapevine plant. The genome assembly contains 2,759,404 bp in 13 contigs and 2,456 predicted genes. Copyright © 2014 Bulgari et al.

Draft Genome Sequence of Methanohalophilus mahii Strain DAL1 Reconstructed from a Hydraulic Fracturing-Produced Water Metagenome

PubMed Central

Lipus, Daniel; Vikram, Amit

2016-01-01

We report here the 1,882,100-bp draft genome sequence of Methanohalophilus mahii strain DAL1, recovered from Marcellus Shale hydraulic fracturing-produced water using metagenomic contig binning. Genome annotation revealed several key methanogenesis genes and provides valuable information on archaeal activity associated with hydraulic fracturing-produced water environments. PMID:27587817

Draft genome sequence of the fish pathogen Flavobacterium columnare strain CSF-298-10

USDA-ARS?s Scientific Manuscript database

We announce the genome assembly of Flavobacterium columnare strain CSF-298-10, a strain isolated from an outbreak of Columnaris disease at a commercial trout farm in Snake River Valley Idaho, USA. The complete genome consists of 13 contigs totaling 3,284,579 bp, average G+C content of 31.5% and 2933...

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.