Sample records for yac transgenic mice

  1. Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

    PubMed

    Fedosyuk, Halyna; Peterson, Kenneth R

    2007-01-01

    A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

  2. Cellular, Molecular and Functional Characterisation of YAC Transgenic Mouse Models of Friedreich Ataxia

    PubMed Central

    Anjomani Virmouni, Sara; Sandi, Chiranjeevi; Al-Mahdawi, Sahar; Pook, Mark A.

    2014-01-01

    Background Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC) transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats), YG8R (90 and 190 GAA repeats) and YG22R (190 GAA repeats). Methodology/Principal Findings We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH) analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R. Conclusions/Significance Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy. PMID:25198290

  3. YAC128 Huntington's disease transgenic mice show enhanced short-term hippocampal synaptic plasticity early in the course of the disease.

    PubMed

    Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana

    2014-09-18

    Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

    PubMed Central

    Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

  5. Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

    PubMed

    Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

  6. Amyloid Precursor Protein Haploinsufficiency Preferentially Mediates Brain Iron Accumulation in Mice Transgenic for The Huntington's Disease Mutation.

    PubMed

    Berggren, Kiersten; Agrawal, Sonal; Fox, Julia A; Hildenbrand, Justin; Nelson, Ryan; Bush, Ashley I; Fox, Jonathan H

    2017-01-01

    Huntington's disease (HD) is an autosomal dominant disorder caused by a CAG expansion in the huntingtin gene that results in expression of mutant huntingtin protein. Iron accumulates in HD brain neurons. Amyloid precursor protein (APP) promotes neuronal iron export. However, the role of APP in brain iron accumulation in HD is unclear. To determine the effects of APP insufficiency on HD in YAC128 mice. We crossed APP hemizygous mice (APP+/-) with YAC128 mice that are transgenic (Tg) for human mutant huntingtin (hmHTT) to generate APP+/+ hmHTT-/-, APP+/- hmHTT-/-, APP+/+ hmHTT+/- and APP+/- hmHTT+/- progeny. Mice were evaluated for behavioral, biochemical and neuropathology HD outcomes at 2-12 months of age. APP heterozygosity decreased cortical APP 25% and 60% in non-Tg and Tg mice, respectively. Cerebral and striatal iron levels were increased by APP knockdown in Tg mice only. Nest-building behavior was decreased in Tg mice; APP knockdown decreased nest building in non-Tg but not Tg mice. Rota-rod endurance was decreased in Tg mice. APP+/- hHTT+/- mice demonstrated additional decreases in rota-rod endurance from 4-10 months of age. Tg mice had smaller striatal volumes and fewer striatal neurons but were not affected by APP knockdown. APP heterozygosity results in greater decreases of cortical APP in Tg versus non-Tg mice. Mutant huntingtin transgenic mice develop brain iron accumulation as a result of greater suppression of APP levels. Elevated brain iron in Tg mice was associated with a decline in motor endurance consistent with a disease promoting effect of iron in the YAC128 model of human HD.

  7. Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington's Disease Mice.

    PubMed

    Berggren, Kiersten L; Lu, Zhen; Fox, Julia A; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H

    2016-01-01

    Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington's disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363-74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Female neonatal mice were supplemented daily from days 10-17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later.

  8. Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington’s Disease Mice

    PubMed Central

    Berggren, Kiersten L.; Lu, Zhen; Fox, Julia A.; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H.

    2016-01-01

    Background: Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington’s disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363–74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. Objective: To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Methods: Female neonatal mice were supplemented daily from days 10–17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Results: Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Conclusions: Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later. PMID:27079948

  9. Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

    PubMed Central

    Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

    2000-01-01

    We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

  10. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice

    PubMed Central

    Vidal, Ruben; Sammeta, Neeraja; Garringer, Holly J.; Sambamurti, Kumar; Miravalle, Leticia; Lamb, Bruce T.; Ghetti, Bernardino

    2012-01-01

    Genetically engineered mice have been generated to model cerebral β-amyloidosis, one of the hallmarks of Alzheimer disease (AD) pathology, based on the overexpression of a mutated cDNA of the amyloid-β precursor protein (AβPP) or by knock-in of the murine Aβpp gene alone or with presenilin1 mutations. Here we describe the generation and initial characterization of a new mouse line based on the presence of 2 copies of the human genomic region encoding the wild-type AβPP and the L166P presenilin 1 mutation. At ∼6 mo of age, double-mutant mice develop amyloid pathology, with signs of neuritic dystrophy, intracellular Aβ accumulation, and glial inflammation, an increase in AβPP C-terminal fragments, and an 8 times increase in Aβ42 levels with a 40% decrease in Aβ40 levels, leading to a significant increase (14 times) of Aβ42/Aβ40 ratios, with minimal effects on presenilin or the Notch1 pathway in the brain. We conclude that in mice, neither mutations in AβPP nor overexpression of an AβPP isoform are a prerequisite for Aβ pathology. This model will allow the study of AD pathogenesis and testing of therapeutic strategies in a more relevant environment without experimental artifacts due to the overexpression of a single-mutant AβPP isoform using exogenous promoters.—Vidal, R., Sammeta, N., Garringer, H. J., Sambamurti, K., Miravalle, L., Lamb B. T., Ghetti, B. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice. PMID:22459153

  11. DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

    PubMed

    Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2010-05-07

    Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

  12. IGF-1 intranasal administration rescues Huntington's disease phenotypes in YAC128 mice.

    PubMed

    Lopes, Carla; Ribeiro, Márcio; Duarte, Ana I; Humbert, Sandrine; Saudou, Frederic; Pereira de Almeida, Luís; Hayden, Michael; Rego, A Cristina

    2014-06-01

    Huntington's disease (HD) is an autosomal dominant disease caused by an expansion of CAG repeats in the gene encoding for huntingtin. Brain metabolic dysfunction and altered Akt signaling pathways have been associated with disease progression. Nevertheless, conflicting results persist regarding the role of insulin-like growth factor-1 (IGF-1)/Akt pathway in HD. While high plasma levels of IGF-1 correlated with cognitive decline in HD patients, other data showed protective effects of IGF-1 in HD striatal neurons and R6/2 mice. Thus, in the present study, we investigated motor phenotype, peripheral and central metabolic profile, and striatal and cortical signaling pathways in YAC128 mice subjected to intranasal administration of recombinant human IGF-1 (rhIGF-1) for 2 weeks, in order to promote IGF-1 delivery to the brain. We show that IGF-1 supplementation enhances IGF-1 cortical levels and improves motor activity and both peripheral and central metabolic abnormalities in YAC128 mice. Moreover, decreased Akt activation in HD mice brain was ameliorated following IGF-1 administration. Upregulation of Akt following rhIGF-1 treatment occurred concomitantly with increased phosphorylation of mutant huntingtin on Ser421. These data suggest that intranasal administration of rhIGF-1 ameliorates HD-associated glucose metabolic brain abnormalities and mice phenotype.

  13. Changes in the striatal proteome of YAC128Q mice exhibit gene-environment interactions between mutant huntingtin and manganese.

    PubMed

    Wegrzynowicz, Michal; Holt, Hunter K; Friedman, David B; Bowman, Aaron B

    2012-02-03

    Huntington's disease (HD) is a neurodegenerative disorder caused by expansion of a CAG repeat within the Huntingtin (HTT) gene, though the clinical presentation of disease and age-of-onset are strongly influenced by ill-defined environmental factors. We recently reported a gene-environment interaction wherein expression of mutant HTT is associated with neuroprotection against manganese (Mn) toxicity. Here, we are testing the hypothesis that this interaction may be manifested by altered protein expression patterns in striatum, a primary target of both neurodegeneration in HD and neurotoxicity of Mn. To this end, we compared striatal proteomes of wild-type and HD (YAC128Q) mice exposed to vehicle or Mn. Principal component analysis of proteomic data revealed that Mn exposure disrupted a segregation of WT versus mutant proteomes by the major principal component observed in vehicle-exposed mice. Identification of altered proteins revealed novel markers of Mn toxicity, particularly proteins involved in glycolysis, excitotoxicity, and cytoskeletal dynamics. In addition, YAC128Q-dependent changes suggest that axonal pathology may be an early feature in HD pathogenesis. Finally, for several proteins, genotype-specific responses to Mn were observed. These differences include increased sensitivity to exposure in YAC128Q mice (UBQLN1) and amelioration of some mutant HTT-induced alterations (SAE1, ENO1). We conclude that the interaction of Mn and mutant HTT may suppress proteomic phenotypes of YAC128Q mice, which could reveal potential targets in novel treatment strategies for HD.

  14. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

    PubMed

    Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

    2011-11-25

    Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as

  15. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

    PubMed Central

    2011-01-01

    Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2

  16. In Vivo MRI Evidence that Neuropathology is Attenuated by Cognitive Enrichment in the Yac128 Huntington's Disease Mouse Model.

    PubMed

    Steventon, Jessica J; Harrison, David J; Trueman, Rebecca C; Rosser, Anne E; Jones, Derek K; Brooks, Simon P

    2015-01-01

    Environmental enrichment has been shown to improve symptoms and reduce neuropathology in mouse models of Huntington's disease (HD); however results are limited to ex vivo techniques with associated shortcomings. In-vivo magnetic resonance imaging (MRI) can overcome some of the shortcomings and is applied for the first time here to assess the effect of a cognitive intervention in a mouse model of HD. We aimed to investigate whether in-vivo high-field MRI can detect a disease-modifying effect in tissue macrostructure following a cognitive enrichment regime. YAC128 transgenic and wild type mice were exposed to cognitive enrichment throughout their lifetime. At 20-months old, mice were scanned with a T2-weighted MRI sequence and a region-of-interest (ROI) approach was used to examine structural changes. Locomotor activity and performance on the rotarod and serial discrimination watermaze task were assessed to measure motor and cognitive function respectively. Mice exposed to cognitive enrichment were more active and able to stay on a rotating rod longer compared to control mice, with comparable rotarod performance between HD enriched mice and wild-type mice. YAC128 mice demonstrated cognitive impairments which were not improved by cognitive enrichment. In-vivo MRI revealed a reduction in the degree of caudate-putamen atrophy in the enriched HD mice. We provide in vivo evidence of a beneficial effect of environmental enrichment on neuropathology and motor function in a HD mouse model. This demonstrates the efficacy of MRI in a model of HD and provides the basis for an in-vivo non-destructive outcome measure necessary for longitudinal study designs to understand the effect of enrichment with disease progression.

  17. Transgenic mice in developmental toxicology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woychik, R.P.

    1992-12-31

    Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areasmore » of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.« less

  18. Transgenic mice in developmental toxicology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woychik, R.P.

    1992-01-01

    Advances in molecular biology and embryology are being utilized for the generation of transgenic mice, animals that contain specific additions, deletions, or modifications of genes or sequences in their DNA. Mouse embryonic stem cells and homologous recombination procedures have made it possible to target specific DNA structural alterations to highly localized region in the host chromosomes. The majority of the DNA structural rearrangements in transgenic mice can be passed through the germ line and used to establish new genetic traits in the carrier animals. Since the use of transgenic mice is having such an enormous impact on so many areasmore » of mammalian biological research, including developmental toxicology, the objective of this review is to briefly describe the fundamental methodologies for generating transgenic mice and to describe one particular application that has direct relevance to the field of genetic toxicology.« less

  19. [Breeding of transgenic mice expressing human tau isoform with P301L mutation and identification of homozygous transgenic mice].

    PubMed

    Wang, Yan-yan; Chen, Ru-zhui; Zhu, Xiao-nani; Liu, Jing; Li, Zhi-hui; Liu, Xiu-juan; Li, Zhi-hui; Na, Xin; Liang, Shan-shan; Qiu, Guo-guang; Zhang, Wei; Wang, Hai; Wang, Xue-lan

    2012-05-01

    To establish homozygous transgenic mouse strain expressing human tau isoform with P301L mutation. Five transgenic mice expressing human tau isoform with P301L mutation were obtained by microinjection into male nuclei. Homozygote and hemizygote were identified by PCR and real-time fluorescent quantitative PCR. Ninety five homozygous transgenic mice were selected, and the results indicated that homozygous transgenic mice were superior to hemizygote in simulating the changes of biological characteristics. Exogenous gene tau is able to stably transmit to next generation and the combination of SYBR Green real-time fluorescent quantitative PCR with the traditional mating is a fast, reliable and economical way to screen homozygous and hemizygous transgenic mice.

  20. AAV-dominant negative tumor necrosis factor (DN-TNF) gene transfer to the striatum does not rescue medium spiny neurons in the YAC128 mouse model of Huntington's disease.

    PubMed

    Alto, Laura Taylor; Chen, Xi; Ruhn, Kelly A; Treviño, Isaac; Tansey, Malú G

    2014-01-01

    CNS inflammation is a hallmark of neurodegenerative disease, and recent studies suggest that the inflammatory response may contribute to neuronal demise. In particular, increased tumor necrosis factor (TNF) signaling is implicated in the pathology of both Parkinson's disease (PD) and Alzheimer's disease (AD). We have previously shown that localized gene delivery of dominant negative TNF to the degenerating brain region can limit pathology in animal models of PD and AD. TNF is upregulated in Huntington's disease (HD), like in PD and AD, but it is unknown whether TNF signaling contributes to neuronal degeneration in HD. We used in vivo gene delivery to test whether selective reduction of soluble TNF signaling could attenuate medium spiny neuron (MSN) degeneration in the YAC128 transgenic (TG) mouse model of Huntington's disease (HD). AAV vectors encoding cDNA for dominant-negative tumor necrosis factor (DN-TNF) or GFP (control) were injected into the striatum of young adult wild type WT and YAC128 TG mice and achieved 30-50% target coverage. Expression of dominant negative TNF protein was confirmed immunohistologically and biochemically and was maintained as mice aged to one year, but declined significantly over time. However, the extent of striatal DN-TNF gene transfer achieved in our studies was not sufficient to achieve robust effects on neuroinflammation, rescue degenerating MSNs or improve motor function in treated mice. Our findings suggest that alternative drug delivery strategies should be explored to determine whether greater target coverage by DN-TNF protein might afford some level of neuroprotection against HD-like pathology and/or that soluble TNF signaling may not be the primary driver of striatal neuroinflammation and MSN loss in YAC128 TG mice.

  1. Acute acetaminophen toxicity in transgenic mice with elevated hepatic glutathione.

    PubMed

    Rzucidlo, S J; Bounous, D I; Jones, D P; Brackett, B G

    2000-06-01

    Previous studies demonstrated that elevation of hepatic glutathione (GSH) concentrations protect against acetaminophen (APAP) hepatotoxicity in mice. Employing transgenic mice overexpressing glutathione synthetase, this study was conducted to determine if sustained elevation of hepatic GSH concentrations could ameliorate or prevent APAP toxicity. International Cancer Research transgenic mouse males and matched (ie same strain, sex, and age) control nontransgenic mice were pretreated ip with GSH synthetase substrate gamma-glutamylcysteinyl ethyl ester (gamma-GCE) or with saline. After a 16-h fast, mice received a single dose of 500 mg APAP/kg bw in saline ip and were sacrificed 4 h later. Other mice similarly pretreated were killed without APAP challenge. The elevated GSH concentrations in transgenic mice livers did not lessen APAP hepatotoxicity. Instead higher degrees of hepatotoxicity and nephrotoxicity were observed in transgenic mice than in controls as indicated by higher serum alanine aminotransferase activity and more severe histopathological lesions in transgenic mice livers and kidneys. Pretreatment with gamma-GCE did not affect either initial or post-APAP treatment tissue GSH concentrations or observed degrees of toxicity. Detection of a higher level of serum APAP in transgenic mice and the histopathological lesions found in transgenic mice kidneys together with no observable nephrotoxicity in control mice indicated early kidney damage in transgenic mice. Our findings suggest that high levels of GSH-APAP conjugates resulting from increased GSH concentrations in the livers of transgenic mice caused rapid kidney damage. Compromised excretory ability may have caused retention of APAP, which, in effect, elicited higher hepatotoxicity than that observed in nontransgenic mice.

  2. Overexpression of the human VPAC2 receptor in the suprachiasmatic nucleus alters the circadian phenotype of mice

    PubMed Central

    Shen, Sanbing; Spratt, Christopher; Sheward, W. John; Kallo, Imre; West, Katrine; Morrison, Christine F.; Coen, Clive W.; Marston, Hugh M.; Harmar, Anthony J.

    2000-01-01

    The neuropeptides vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) belong to a superfamily of structurally related peptide hormones that includes glucagon, glucagon-like peptides, secretin, and growth hormone-releasing hormone. Microinjection of VIP or PACAP into the rodent suprachiasmatic nucleus (SCN) phase shifts the circadian pacemaker and VIP antagonists, and antisense oligodeoxynucleotides have been shown to disrupt circadian function. VIP and PACAP have equal potency as agonists of the VPAC2 receptor (VPAC2R), which is expressed abundantly in the SCN, in a circadian manner. To determine whether manipulating the level of expression of the VPAC2R can influence the control of the circadian clock, we have created transgenic mice overexpressing the human VPAC2R gene from a yeast artificial chromosome (YAC) construct. The YAC was modified by a strategy using homologous recombination to introduce (i) the HA epitope tag sequence (from influenza virus hemagglutinin) at the carboxyl terminus of the VPAC2R protein, (ii) the lacZ reporter gene, and (iii) a conditional centromere, enabling YAC DNA to be amplified in culture in the presence of galactose. High levels of lacZ expression were detected in the SCN, habenula, pancreas, and testis of the transgenic mice, with lower levels in the olfactory bulb and various hypothalamic areas. Transgenic mice resynchronized more quickly than wild-type controls to an advance of 8 h in the light-dark (LD) cycle and exhibited a significantly shorter circadian period in constant darkness (DD). These data suggest that the VPAC2R can influence the rhythmicity and photic entrainment of the circadian clock. PMID:11027354

  3. A comprehensive glycome profiling of Huntington's disease transgenic mice.

    PubMed

    Gizaw, Solomon T; Koda, Toshiaki; Amano, Maho; Kamimura, Keiko; Ohashi, Tetsu; Hinou, Hiroshi; Nishimura, Shin-Ichiro

    2015-09-01

    Huntington's disease (HD) is an autosomal, dominantly inherited and progressive neurodegenerative disease, nosologically classified as the presence of intranuclear inclusion bodies and the loss of GABA-containing neurons in the neostriatum and subsequently in the cerebellar cortex. Abnormal processing of neuronal proteins can result in the misfolding of proteins and altered post-translational modification of newly synthesized proteins. Total glycomics, namely, N-glycomics, O-glycomics, and glycosphingolipidomics (GSL-omics) of HD transgenic mice would be a hallmark for central nervous system disorders in order to discover disease specific biomarkers. Glycoblotting method, a high throughput glycomic protocol, and matrix-assisted laser desorption ionization-time of flight/mass spectrometry (MALDI-TOF/MS) were used to study the total glycome expression levels in the brain tissue (3 mice of each sex) and sera (5 mice of each sex) of HD transgenic and control mice. All experiments were performed twice and differences in the expression levels of major glycoforms were compared between HD transgenic and control mice. We estimated the structure and expression levels of 87 and 58N-glycans in brain tissue and sera, respectively, of HD transgenic and control mice. The present results clearly indicated that the brain glycome and their expression levels are significantly gender specific when compared with those of other tissues and serum. Core-fucosylated and bisecting-GlcNAc types of N-glycans were found in increased levels in the brain tissue HD transgenic mice. Accordingly, core-fucosylated and sialic acid (particularly N-glycolylneuraminic acid, NeuGc) for biantennary type glycans were found in increased amounts in the sera of HD transgenic mice compared to that of control mice. Core 3 type O-glycans were found in increased levels in male and in decreased levels in both the striatum and cortexes of female HD transgenic mice. Furthermore, serum levels of core 1 type O

  4. Comparative studies using the Morris water maze to assess spatial memory deficits in two transgenic mouse models of Alzheimer's disease.

    PubMed

    Edwards, Stephen R; Hamlin, Adam S; Marks, Nicola; Coulson, Elizabeth J; Smith, Maree T

    2014-10-01

    Evaluation of the efficacy of novel therapeutics for potential treatment of Alzheimer's disease (AD) requires an animal model that develops age-related cognitive deficits reproducibly between independent groups of investigators. Herein we assessed comparative temporal changes in spatial memory function in two commercially available transgenic mouse models of AD using the Morris water maze (MWM), incorporating both visible and hidden platform training. Individual cohorts of cDNA-based 'line 85'-derived double-transgenic mice coexpressing the 'Swedish' mutation of amyloid precursor protein (APPSwe) and the presenillin 1 (PS1) 'dE9' mutation were assessed in the MWM at mean ages of 3.6, 9.3 and 14.8 months. We found significant deficits in spatial memory retention in APPSwe/PS1dE9 mice aged 3.6 months and robust deficits in spatial memory acquisition and retention in APPSwe/PS1dE9 mice aged 9.3 months, with a further significant decline by age 14.8 months. β-Amyloid deposits were present in brain sections by 7.25 months of age. In contrast, MWM studies with individual cohorts (aged 4-21 months) of single-transgenic genomic-based APPSwe mice expressing APPSwe on a yeast artificial chromosomal (YAC) construct showed no significant deficits in spatial memory acquisition until 21 months of age. There were no significant deficits in spatial memory retention up to 21 months of age and β-amyloid deposits were not present in brain sections up to 24 months of age. These data, generated using comprehensive study designs, show that APPSwe/PS1dE9 but not APPSwe YAC mice appear to provide a suitably robust model of AD for efficacy assessment of novel AD treatments in development. © 2014 Wiley Publishing Asia Pty Ltd.

  5. Multiple ovarian transplants to rescue a transgenic line of mice.

    PubMed

    Dawes, Joyce; Liu, Bowen; Mars, Wendy; Michalopoulos, George; Khillan, Jaspal S

    2010-06-01

    Transgenic mice are useful tools for studying gene function and regulation but can be difficult to successfully breed. To 'rescue' transgenic lines that are difficult to propagate, researchers use a variety of techniques. One method is ovarian transplant, in which researchers remove ovaries from a donor transgenic mouse, cryopreserve the ovarian tissue, transplant this tissue into histocompatible female mice and breed these recipient females. Though it is a useful technique, cryopreservation can potentially damage ovarian tissue, which could reduce fertility. In this article, the authors describe how they carried out ovarian transplants without cryopreservation to rescue a line of transgenic C57BL/6 mice. Other researchers who have experience with mouse reproductive surgery should be able to use this technique to rescue infertile transgenic lines of mice.

  6. [Transgenerational transmission of bovine satellite DNA in transgenic mice].

    PubMed

    Slominskaia, N A; Suchkova, I O; Klinskaia, T A; Zabezhinskaia, M A; Patkin, E L

    2006-01-01

    Genetical, cytogenetical and molecular analysis was made for 5 generations of mice transgenic for bovine satellite DNA (Sat). In all cases transgenic mice were generated by crosses of transgenic males and females with normal (CBA x C57B1) mice. No abnormalities in the founder development were noticed. A normal (near 50 %) ratio of transgenic and nontransgenic offsprings was observed in blastocysts. However, profound differences occurred in the rate of transgene bearing offsprings, depending on the sex of grandparents rather than of parents. The grandfather Sat transmission resulted in the appearance of 0-52.4 % transgenic grandchildren, whereas the grandmother transmission ended in the theoretically expected rate. This means that stabilization of transsatellite took place upon the female germ line transmission (a positive grandmother effect). It is essential that in hemizygous transsatellite mice Sat integration led to the occurrence of mammary tumors, inflammation of uterine horns, and infringement of mother care of transgenic females. Simultaneous FISH and G-banding showed Sat to be localized in the internal region of chromosome 12 near Pax 9 and Brms 11 genes. Commonly, these genes are implicated in tumorigenesis as their expression decreases. Thus, a kind of silencing effect of these genes' expression may be supposed.

  7. [Reproduction,genotype identification and evaluation of APP/PS1 transgenic mice].

    PubMed

    Tan, Long; Li, Hai-Qiang; Li, Yi-Bo; Liu, Wei; Pang, Wei; Jiang, Yu-Gang

    2018-02-08

    To identify the genotype of (APP/PS1) transgenic mice and evaluate the changing of cognitive and behavioral fu nctions, provide an effective animal model for the Alzheimer's disease (AD) research. Male APP/PS1 transgenic mice mated with female APP/PS1 transgenic mice, and the genotype of their filial mice was identified by PCR. The APP +/PS1 + mice were assigned into AD model group (AD group, n =8), and the APP/PS1 mice were assigned into control group (CT group, n =8). The Morris water maze test was carried out to detect the capacity of learning and memory of mice. After that, the mice were sacrificed and the brain tissues were sampled and stained by HE and congo red for the pathological examination. ①A APP/PS1 genome DNA about 360 bp size was detected. The methods of feeding and breeding were successful to attain APP/PS1 transgenic mice.②Statistical significance was found in the differences of the capacity of learning and memory between 7-month-old APP/PS1 positive mice and negative mice ( P <0.05).③The results of HE stain showed that the structure and cellular morphology of hippocampus of AD mice were obviously abnormal. The results of congo red stain showed that positive amyloid plaque was observed in brains of AD mice. APP/PS1 transgenic mice present typical symptoms and behaviors of Alzheimer's disease. The transgenic mouse is an effective tool for the research and prevention of AD.

  8. Extra-prostatic Transgene-associated Neoplastic Lesions in Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) Mice

    PubMed Central

    Berman-Booty, Lisa D.; Thomas-Ahner, Jennifer M.; Bolon, Brad; Oglesbee, Michael J.; Clinton, Steven K.; Kulp, Samuel K.; Chen, Ching-Shih; La Perle, Krista

    2014-01-01

    Male transgenic adenocarcinoma of the mouse prostate (TRAMP) mice are frequently used in prostate cancer research because their prostates consistently develop a series of pre-neoplastic and neoplastic lesions. Disease progression in TRAMP mouse prostates culminates in metastatic, poorly differentiated carcinomas with neuroendocrine features. The androgen dependence of the rat probasin promoter largely limits transgene expression to the prostatic epithelium. However, extra-prostatic transgene-positive lesions have been described in TRAMP mice, including renal tubulo-acinar carcinomas, neuroendocrine carcinomas of the urethra, and phyllodes-like tumors of the seminal vesicle. Here we describe the histologic and immunohistochemical features of two novel extra-prostatic lesions in TRAMP mice: primary anaplastic tumors of uncertain cell origin in the midbrain, and poorly differentiated adenocarcinomas of the submandibular salivary gland. These newly characterized tumors apparently result from transgene expression in extra-prostatic locations rather than representing metastatic prostate neoplasms because lesions were identified in both male and female mice as well as in male TRAMP mice without histologically apparent prostate tumors. In this paper we also calculate the incidences of the urethral carcinomas and renal tubulo-acinar carcinomas, further elucidate the biological behavior of the urethral carcinomas, and demonstrate the critical importance of complete necropsies even when evaluating presumably well characterized phenotypes in genetically engineered mice. PMID:24742627

  9. Extra-prostatic transgene-associated neoplastic lesions in transgenic adenocarcinoma of the mouse prostate (TRAMP) mice.

    PubMed

    Berman-Booty, Lisa D; Thomas-Ahner, Jennifer M; Bolon, Brad; Oglesbee, Michael J; Clinton, Steven K; Kulp, Samuel K; Chen, Ching-Shih; La Perle, Krista M D

    2015-02-01

    Male transgenic adenocarcinoma of the mouse prostate (TRAMP) mice are frequently used in prostate cancer research because their prostates consistently develop a series of preneoplastic and neoplastic lesions. Disease progression in TRAMP mouse prostates culminates in metastatic, poorly differentiated carcinomas with neuroendocrine features. The androgen dependence of the rat probasin promoter largely limits transgene expression to the prostatic epithelium. However, extra-prostatic transgene-positive lesions have been described in TRAMP mice, including renal tubuloacinar carcinomas, neuroendocrine carcinomas of the urethra, and phyllodes-like tumors of the seminal vesicle. Here, we describe the histologic and immunohistochemical features of 2 novel extra-prostatic lesions in TRAMP mice: primary anaplastic tumors of uncertain cell origin in the midbrain and poorly differentiated adenocarcinomas of the submandibular salivary gland. These newly characterized tumors apparently result from transgene expression in extra-prostatic locations rather than representing metastatic prostate neoplasms because lesions were identified in both male and female mice and in male TRAMP mice without histologically apparent prostate tumors. In this article, we also calculate the incidences of the urethral carcinomas and renal tubuloacinar carcinomas, further elucidate the biological behavior of the urethral carcinomas, and demonstrate the critical importance of complete necropsies even when evaluating presumably well characterized phenotypes in genetically engineered mice. © 2014 by The Author(s).

  10. [Development of a hepatitis B virus carrier transgenic mice model].

    PubMed

    Caner, Müge; Arat, Sezen; Bircan, Rifat

    2008-01-01

    The studies for the development of transgenic mice models which provide important profits for the studies concerning immunopathogenesis of hepatitis B virus (HBV) infections are in progress since 20 years. For this purpose different lineages bearing whole HBV genome or selected viral genes have been developed and their usage in clarifying the HBV replication and pathogenesis mechanisms have been emphasized. The aim of this study was to develop and breed a HBV carrier mice model. In the study the full HBV genome has been transferred to mouse embryos by microinjection procedure. Following transgenic manipulation, the HBV carriers among the daughter mice have been detected by molecular methods in which HBV-DNA replication and expression have been shown. The manipulations for transgene transfers have been performed in TUBITAK Marmara Research Center Transgene Laboratory, Gebze, Istanbul. The HBV-DNA carrier mice have been demonstrated by polymerase chain reaction (PCR) using the DNA samples obtained from tail tissues and also by dot-blot hybridization of the mice sera. Integrated HBV-DNA has been detected by applying in-situ hybridization to the liver tissue sections. HBV-DNA expression has been shown by reverse transcriptase PCR method with total RNA molecules that have been isolated from the liver tissues of the HBV-DNA carrier mice. HBsAg has been detected in the liver by immunohistochemical method, and HBsAg and HBeAg have additionally been demonstrated by ELISA. HBV genome, expression of the genome and the expression products have been determined in approximately 10% of the mice of which HBV-DNA have been transferred. By inbreeding heterozygote carrier mice, homozygote HBV transgenic mice line have been obtained. These HBV transgenic mice are the first lineages developed in our country. It is hopefully thought that this HBV carrier transgenic mouse model may contribute to the studies on the pathogenesis of HBV infections which are important health problems in the

  11. Overexpression of the A-FABP gene facilitates intermuscular fat deposition in transgenic mice.

    PubMed

    Liu, Z W; Fan, H L; Liu, X F; Ding, X B; Wang, T; Sui, G N; Li, G P; Guo, H

    2015-03-31

    Adipocyte fatty acid-binding protein (A-FABP), the most abundant FABP in adipocytes, controls fatty acid uptake, transport, and metabolism in fat cells. We constructed a transgenic mice model that overexpressed the cattle A-FABP gene to investigate the relationship between A-FABP expression and intermuscular fat deposition. There was no significant difference in body weight and serum biochemical indexes between transgenic and wild-type mice. Further, there were no significant differences in intermuscular triglyceride content and A-FABP expression levels over three generations of transgenic mice. However, abdominal adipose rate, A-FABP protein content, and intermuscular triglyceride levels of transgenic mice were significantly higher than those of wild-type mice. In addition, triglycerides were remarkably higher in the skeletal muscle but lower in the myocardium of transgenic mice. Thus, overexpression of cattle A-FABP gene promoted fat deposition in the skeletal muscle of transgenic mice.

  12. Simple and rapid determination of homozygous transgenic mice via in vivo fluorescence imaging.

    PubMed

    Lin, Xiaolin; Jia, Junshuang; Qin, Yujuan; Lin, Xia; Li, Wei; Xiao, Gaofang; Li, Yanqing; Xie, Raoying; Huang, Hailu; Zhong, Lin; Wu, Qinghong; Wang, Wanshan; Huang, Wenhua; Yao, Kaitai; Xiao, Dong; Sun, Yan

    2015-11-17

    Setting up breeding programs for transgenic mouse strains require to distinguish homozygous from the heterozygous transgenic animals. The combinational use of the fluorescence reporter transgene and small animal in-vivo imaging system might allow us to rapidly and visually determine the transgenic mice homozygous for transgene(s) by the in vivo fluorescence imaging. RLG, RCLG or Rm17LG transgenic mice ubiquitously express red fluorescent protein (RFP). To identify homozygous RLG transgenic mice, whole-body fluorescence imaging for all of newborn F2-generation littermates produced by mating of RFP-positive heterozygous transgenic mice (F1-generation) derived from the same transgenic founder was performed. Subsequently, the immediate data analysis of the in vivo fluorescence imaging was carried out, which greatly facilitated us to rapidly and readily distinguish RLG transgenic individual(s) with strong fluorescence from the rest of F2-generation littermates, followed by further determining this/these RLG individual(s) showing strong fluorescence to be homozygous, as strongly confirmed by mouse mating. Additionally, homozygous RCLG or Rm17LG transgenic mice were also rapidly and precisely distinguished by the above-mentioned optical approach. This approach allowed us within the shortest time period to obtain 10, 8 and 2 transgenic mice homozygous for RLG, RCLG and Rm17LG transgene, respectively, as verified by mouse mating, indicating the practicality and reliability of this optical method. Taken together, our findings fully demonstrate that the in vivo fluorescence imaging offers a visual, rapid and reliable alternative method to the traditional approaches (i.e., mouse mating and real-time quantitative PCR) in identifying homozygous transgenic mice harboring fluorescence reporter transgene under the control of a ubiquitous promoter in the situation mentioned in this study.

  13. Simple and rapid determination of homozygous transgenic mice via in vivo fluorescence imaging

    PubMed Central

    Li, Wei; Xiao, Gaofang; Li, Yanqing; Xie, Raoying; Huang, Hailu; Zhong, Lin; Wu, Qinghong; Wang, Wanshan; Huang, Wenhua; Yao, Kaitai; Xiao, Dong; Sun, Yan

    2015-01-01

    Setting up breeding programs for transgenic mouse strains require to distinguish homozygous from the heterozygous transgenic animals. The combinational use of the fluorescence reporter transgene and small animal in-vivo imaging system might allow us to rapidly and visually determine the transgenic mice homozygous for transgene(s) by the in vivo fluorescence imaging. RLG, RCLG or Rm17LG transgenic mice ubiquitously express red fluorescent protein (RFP). To identify homozygous RLG transgenic mice, whole-body fluorescence imaging for all of newborn F2-generation littermates produced by mating of RFP-positive heterozygous transgenic mice (F1-generation) derived from the same transgenic founder was performed. Subsequently, the immediate data analysis of the in vivo fluorescence imaging was carried out, which greatly facilitated us to rapidly and readily distinguish RLG transgenic individual(s) with strong fluorescence from the rest of F2-generation littermates, followed by further determining this/these RLG individual(s) showing strong fluorescence to be homozygous, as strongly confirmed by mouse mating. Additionally, homozygous RCLG or Rm17LG transgenic mice were also rapidly and precisely distinguished by the above-mentioned optical approach. This approach allowed us within the shortest time period to obtain 10, 8 and 2 transgenic mice homozygous for RLG, RCLG and Rm17LG transgene, respectively, as verified by mouse mating, indicating the practicality and reliability of this optical method. Taken together, our findings fully demonstrate that the in vivo fluorescence imaging offers a visual, rapid and reliable alternative method to the traditional approaches (i.e., mouse mating and real-time quantitative PCR) in identifying homozygous transgenic mice harboring fluorescence reporter transgene under the control of a ubiquitous promoter in the situation mentioned in this study. PMID:26472024

  14. Biglycan Overexpression on Tooth Enamel Formation in Transgenic Mice

    PubMed Central

    Wen, Xin; Zou, YanMing; Luo, Wen; Goldberg, Michel; Moats, Rex; Conti, Peter S.; Snead, Malcolm L.; Paine, Michael L.

    2008-01-01

    Previously it was shown that the volume of forming enamel of molar teeth in biglycan-null mice was greater than in genetically matched wild-type mice. This phenotypic change appeared to result from an increase in amelogenin expression, implying that biglycan directly influences amelogenin synthesis. To determine whether biglycan over-expression resulted in decreased amelogenin expression, we engineered transgenic mice to over-express biglycan in the enamel organ epithelium. Biglycan over-expression did not significantly affect the amelogenin expression in incisor and molar teeth in 3-day transgenic mice. In the transgenic animals we observed that the immature and mature enamel appeared normal. These results suggested that increasing the biglycan expression, in the cells that synthesize the precursor protein matrix for enamel, has a negligible influence on amelogenesis. PMID:18727043

  15. Endogenous galectin-3 expression levels modulate immune responses in galectin-3 transgenic mice.

    PubMed

    Chaudhari, Aparna D; Gude, Rajiv P; Kalraiya, Rajiv D; Chiplunkar, Shubhada V

    2015-12-01

    Galectin-3 (Gal-3), a β-galactoside-binding mammalian lectin, is involved in cancer progression and metastasis. However, there is an unmet need to identify the underlying mechanisms of cancer metastasis mediated by endogenous host galectin-3. Galectin-3 is also known to be an important regulator of immune responses. The present study was aimed at analysing how expression of endogenous galectin-3 regulates host immunity and lung metastasis in B16F10 murine melanoma model. Transgenic Gal-3(+/-) (hemizygous) and Gal-3(-/-) (null) mice exhibited decreased levels of Natural Killer (NK) cells and lower NK mediated cytotoxicity against YAC-1 tumor targets, compared to Gal-3(+/+) (wild-type) mice. On stimulation, Gal-3(+/-) and Gal-3(-/-) mice splenocytes showed increased T cell proliferation than Gal-3(+/+) mice. Intracellular calcium flux was found to be lower in activated T cells of Gal-3(-/-) mice as compared to T cells from Gal-3(+/+) and Gal-3(+/-) mice. In Gal-3(-/-) mice, serum Th1, Th2 and Th17 cytokine levels were found to be lowest, exhibiting dysregulation of pro-inflammatory and anti-inflammatory cytokines balance. Marked decrease in serum IFN-γ levels and splenic IFN-γR1 (IFN-γ Receptor 1) expressing T and NK cell percentages were observed in Gal-3(-/-) mice. On recombinant IFN-γ treatment of splenocytes in vitro, Suppressor of Cytokine Signaling (SOCS) 1 and SOCS3 protein expression was higher in Gal-3(-/-) mice compared to that in Gal-3(+/+) and Gal-3(+/-) mice; suggesting possible attenuation of Signal Transducer and Activator of Transcription (STAT) 1 mediated IFN-γ signaling in Gal-3(-/-) mice. The ability of B16F10 melanoma cells to form metastatic colonies in the lungs of Gal-3(+/+) and Gal-3(-/-) mice remained comparable, whereas it was found to be reduced in Gal-3(+/-) mice. Our data indicates that complete absence of endogenous host galectin-3 facilitates lung metastasis of B16F10 cells in mice, which may be contributed by dysregulated immune

  16. Assembly of YAC contigs on the long arm of human chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, J.; Fujiwara, T.M.; Wang, J.X.

    1994-09-01

    We have previously identified approximately 2,000 chromosome 2-specific YACs by screening the CEPH Mark I YAC library (`Midi- YACs`). Using STS content mapping, we have been able to order groups of these YACs along chromosome 2q. The four biggest YAC groups were associated with VIL (2q35), FN (2q34), PAX3 (2q36), ALPI (2q37) and contained 113, 107, 79, and 63 YACs, respectively. We have identified the minimal tiling paths for most YAC groups and determined the insert sizes of over 300 YACs. Furthermore, on human chromosome 2q31-q37, 15 microsatellite markers were linked to various expressed genes through overlapping YACs and themore » physical distance of microsatellites to expressed genes was determined. The precise mapping of a set of highly informative microsatellite markers with respect to known genes provides a useful tool for linkage studies and the identification of disease genes from the long arm of human chromosome 2.« less

  17. Bacterial magnetic particles improve testes-mediated transgene efficiency in mice.

    PubMed

    Wang, Chao; Sun, Guanghong; Wang, Ye; Kong, Nana; Chi, Yafei; Yang, Leilei; Xin, Qiliang; Teng, Zhen; Wang, Xu; Wen, Yujun; Li, Ying; Xia, Guoliang

    2017-11-01

    Nano-scaled materials have been proved to be ideal DNA carriers for transgene. Bacterial magnetic particles (BMPs) help to reduce the toxicity of polyethylenimine (PEI), an efficient gene-transferring agent, and assist tissue transgene ex vivo. Here, the effectiveness of the BMP-PEI complex-conjugated foreign DNAs (BPDs) in promoting testes-mediated gene transfer (TMGT) in mouse was compared with that of liposome-conjugated foreign DNAs. The results proved that through testes injection, the clusters of BPDs successfully reached the cytoplasm and the nuclear of spermatogenesis cell, and expressed in testes of transgene founder mice. Additionally, the ratio of founder mice obtained from BPDs (88%) is about 3 times higher than the control (25%) (p < 0.05). Interestingly, the motility of sperms recovered from epididymis of the founder mice from BPD group were significantly improved, as compared with the control (p < 0.01). Based on classic breeding, the ratio of transgene mice within the first filial was significantly higher in BPDs compared with the control (73.8% versus 11.6%, p < 0.05). TMGT in this study did not produce visible histological changes in the testis. In conclusion, nano-scaled BPDs could be an alternative strategy for efficiently producing transgene mice in vivo.

  18. Memory impairment in transgenic Alzheimer mice requires cellular prion protein.

    PubMed

    Gimbel, David A; Nygaard, Haakon B; Coffey, Erin E; Gunther, Erik C; Laurén, Juha; Gimbel, Zachary A; Strittmatter, Stephen M

    2010-05-05

    Soluble oligomers of the amyloid-beta (Abeta) peptide are thought to play a key role in the pathophysiology of Alzheimer's disease (AD). Recently, we reported that synthetic Abeta oligomers bind to cellular prion protein (PrP(C)) and that this interaction is required for suppression of synaptic plasticity in hippocampal slices by oligomeric Abeta peptide. We hypothesized that PrP(C) is essential for the ability of brain-derived Abeta to suppress cognitive function. Here, we crossed familial AD transgenes encoding APPswe and PSen1DeltaE9 into Prnp-/- mice to examine the necessity of PrP(C) for AD-related phenotypes. Neither APP expression nor Abeta level is altered by PrP(C) absence in this transgenic AD model, and astrogliosis is unchanged. However, deletion of PrP(C) expression rescues 5-HT axonal degeneration, loss of synaptic markers, and early death in APPswe/PSen1DeltaE9 transgenic mice. The AD transgenic mice with intact PrP(C) expression exhibit deficits in spatial learning and memory. Mice lacking PrP(C), but containing Abeta plaque derived from APPswe/PSen1DeltaE9 transgenes, show no detectable impairment of spatial learning and memory. Thus, deletion of PrP(C) expression dissociates Abeta accumulation from behavioral impairment in these AD mice, with the cognitive deficits selectively requiring PrP(C).

  19. Memory Impairment in Transgenic Alzheimer Mice Requires Cellular Prion Protein

    PubMed Central

    Gimbel, David A.; Nygaard, Haakon B.; Coffey, Erin E.; Gunther, Erik C.; Laurén, Juha; Gimbel, Zachary A.; Strittmatter, Stephen M.

    2012-01-01

    Soluble oligomers of the amyloid-β (Aβ) peptide are thought to play a key role in the pathophysiology of Alzheimer’s disease (AD). Recently, we reported that synthetic Aβ oligomers bind to cellular prion protein (PrPC) and that this interaction is required for suppression of synaptic plasticity in hippocampal slices by oligomeric Aβ peptide. We hypothesized that PrPC is essential for the ability of brain-derived Aβ to suppress cognitive function. Here, we crossed familial AD transgenes encoding APPswe and PSen1ΔE9 into Prnp−/− mice to examine the necessity of PrPC for AD-related phenotypes. Neither APP expression nor Aβ level is altered by PrPC absence in this transgenic AD model, and astrogliosis is unchanged. However, deletion of PrPC expression rescues 5-HT axonal degeneration, loss of synaptic markers, and early death in APPswe/PSen1ΔE9 transgenic mice. The AD transgenic mice with intact PrPC expression exhibit deficits in spatial learning and memory. Mice lacking PrPC, but containing Aβ plaque derived from APPswe/PSen1ΔE9 transgenes, show no detectable impairment of spatial learning and memory. Thus, deletion of PrPC expression dissociates Aβ accumulation from behavioral impairment in these AD mice, with the cognitive deficits selectively requiring PrPC. PMID:20445063

  20. Dietary salt loading increases nitric oxide synthesis in transgenic mice overexpressing sodium-proton exchanger.

    PubMed

    Kiraku, J; Nakamura, T; Sugiyama, T; Takahashi, N; Kuro-o, M; Fujii, J; Nagai, R

    1999-06-01

    We studied the role of nitric oxide (NO) synthesis in amelioration of blood pressure elevation during dietary salt loading in transgenic mice overexpressing sodium proton exchanger. Systolic blood pressure rose after starting salt loading only in the high-salt group of transgenic mice. However, this elevation of blood pressure was not continued. Urinary excretion of inorganic nitrite and nitrate in the high-salt group of transgenic mice was significantly higher than in the high-salt group of control mice. These results suggest that increased NO synthesis in response to salt loading is one of the anti-hypertensive mechanisms in transgenic mice overexpressing sodium proton exchanger.

  1. Anxiety-like behavior in transgenic mice with brain expression of neuropeptide Y.

    PubMed

    Inui, A; Okita, M; Nakajima, M; Momose, K; Ueno, N; Teranishi, A; Miura, M; Hirosue, Y; Sano, K; Sato, M; Watanabe, M; Sakai, T; Watanabe, T; Ishida, K; Silver, J; Baba, S; Kasuga, M

    1998-01-01

    Neuropeptide Y (NPY), one of the most abundant peptide transmitters in the mammalian brain, is assumed to play an important role in behavior and its disorders. To understand the long-term modulation of neuronal functions by NPY, we raised transgenic mice created with a novel central nervous system (CNS) neuron-specific expression vector of human Thy- gene fragment linked to mouse NPY cDNA. In situ hybridization analysis demonstrated transgene-derived NPY expression in neurons (e.g., in the hippocampus, cerebral cortex, and the arcuate nucleus of the hypothalamus) in the transgenic mice. The modest increase of NPY protein in the brain was demonstrated by semiquantitative immunohistochemical analysis and by radioreceptor assay (115% in transgenic mice compared to control littermates). Double-staining experiments indicated colocalization of the transgene-derived NPY message and NPY protein in the same neurons, such as in the arcuate nucleus. The transgenic mice displayed behavioral signs of anxiety and hypertrophy of adrenal zona fasciculata cells, but no change in food intake was observed. The anxiety-like behavior of transgenic mice was reversed, at least in part, by administration of corticotropin-releasing factor (CRF) antagonists, alpha-helical CRF9-41, into the third cerebral ventricle. These results suggest that NPY has a role in anxiety and behavioral responses to stress partly via the CRF neuronal system. This genetic model may provide a unique opportunity to study human anxiety and emotional disorders.

  2. Fertility comparison between wild type and transgenic mice by in vitro fertilization.

    PubMed

    Vasudevan, Kuzhalini; Raber, James; Sztein, Jorge

    2010-08-01

    Transgenic mice are increasingly used as animal models for studies of gene function and regulation of mammalian genes. Although there has been continuous and remarkable progress in the development of transgenic technology over several decades, many aspects of the resulting transgenic model's phenotype cannot be completely predicted. For example, it is well known that as a consequence of the random insertion of the injected DNA construct, several founder mice of the new line need to be analyzed for possible differences in phenotype secondary to different insertion sites. The Knock out technique for transgenic production disrupts a specific gene by insertion or homologous recombination creating a null expression or replacement of the gene with a marker to localize it expression. This modification could result in pleiotropic phenotype if the gene is also expressed in tissues other than the target organs. Although the future breeding performance of the newly created model is critical to many studies, it is rarely anticipated that the new integrations could modify the reproductive profile of the new transgenic line. To date, few studies have demonstrated the difference between the parent strain's reproductive performance and the newly developed transgenic model. This study was designed to determine whether a genetic modification, knock out (KO) or transgenics, not anticipated to affect reproductive performance could affect the resulting reproductive profile of the newly developed transgenic mouse. More specifically, this study is designed to study the impact of the genetic modification on the ability of gametes to be fertilized in vitro. We analyzed the reproductive performance of mice with different background strains: FVB/N, C57BL/6 (129Sv/J x C57Bl/6)F1 and outbred CD1((R)) and compared them to mice of the same strain carrying a transgene or KO which was not anticipated to affect fertility. In vitro Fertilization was used to analyze the fertility of the mice. Oocytes

  3. Polycythemia in transgenic mice expressing the human erythropoietin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.

    1989-04-01

    Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver,more » adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.« less

  4. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice

    PubMed Central

    Khare, Sanjay D.; Sarosi, Ildiko; Xia, Xing-Zhong; McCabe, Susan; Miner, Kent; Solovyev, Irina; Hawkins, Nessa; Kelley, Michael; Chang, David; Van, Gwyneth; Ross, Larry; Delaney, John; Wang, Ling; Lacey, David; Boyle, William J.; Hsu, Hailing

    2000-01-01

    TALL-1/Blys/BAFF is a member of the tumor necrosis factor (TNF) ligand superfamily that is functionally involved in B cell proliferation. Here, we describe B cell hyperplasia and autoimmune lupus-like changes in transgenic mice expressing TALL-1 under the control of a β-actin promoter. The TALL-1 transgenic mice showed severe enlargement of spleen, lymph nodes, and Peyer's patches because of an increased number of B220+ cells. The transgenic mice also had hypergammaglobulinemia contributed by elevations of serum IgM, IgG, IgA, and IgE. In addition, a phenotype similar to autoimmune lupus-like disease was also seen in TALL-1 transgenic mice, characterized by the presence of autoantibodies to nuclear antigens and immune complex deposits in the kidney. Prolonged survival and hyperactivity of transgenic B cells may contribute to the autoimmune lupus-like phenotype in these animals. Our studies further confirm TALL-1 as a stimulator of B cells that affect Ig production. Thus, TALL-1 may be a primary mediator in B cell-associated autoimmune diseases. PMID:10716715

  5. Characterization of diabetic nephropathy in CaM kinase IIalpha (Thr286Asp) transgenic mice.

    PubMed

    Suzuki, Hikari; Kato, Ichiro; Usui, Isao; Takasaki, Ichiro; Tabuchi, Yoshiaki; Oya, Takeshi; Tsuneyama, Koichi; Kawaguchi, Hiroshi; Hiraga, Koichi; Takasawa, Shin; Okamoto, Hiroshi; Tobe, Kazuyuki; Sasahara, Masakiyo

    2009-01-30

    Detailed studies were performed on diabetic kidneys derived from transgenic mice overexpressing the mutant form (Thr286Asp) of Ca(2+)/calmodulin-dependent protein kinase IIalpha (CaM kinase IIalpha) in pancreatic beta-cells. Kidney weight/body weight ratio, urinary albumin/creatinine ratio, serum BUN level, and mesangial/glomerular area ratio were all significantly higher in transgenic mice than in wild-type mice. cDNA microarray analysis revealed 17 up-regulated genes and 12 down-regulated genes in transgenic kidney. Among up-regulated genes, cyclin D2 (6.70-fold) and osteopontin (2.35-fold) were thought to play important roles in the progression of diabetic nephropathy. Transgenic glomeruli and tubular epithelial cells were strongly stained for osteopontin, a molecule which induces immune response. In quantitative real-time RT-PCR analyses, expressions of not only M1 macrophage marker genes but also M2 macrophage marker genes were elevated in renal cortex of transgenic mice. Overall results indicate that CaM kinase IIalpha (Thr286Asp) transgenic mice serve as an excellent model for diabetic nephropathy.

  6. Both core and F proteins of hepatitis C virus could enhance cell proliferation in transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Wen-Ta; Li, Hui-Chun; Lee, Shen-Kao

    Highlights: •HCV core and F proteins could induce hepatocyte proliferation in the transgenic mice. •β-Catenin signaling pathway was activated by core protein in the transgenic mice. •β-Catenin signaling pathway was activated by myc-F protein in the transgenic mice. •Expression of SMA protein was enhanced by core but not myc-F protein. -- Abstract: The role of the protein encoded by the alternative open reading frame (ARF/F/core+1) of the Hepatitis C virus (HCV) genome in viral pathogenesis remains unknown. The different forms of ARF/F/core+1 protein were labile in cultured cells, a myc-tag fused at the N-terminus of the F protein made itmore » more stable. To determine the role of core and F proteins in HCV pathogenesis, transgenic mice with either protein expression under the control of Albumin promoter were generated. Expression of core protein and F protein with myc tag (myc-F) could be detected by Western blotting analysis in the livers of these mice. The ratio of liver to body weight is increased for both core and myc-F transgenic mice compared to that of wild type mice. Indeed, the proliferating cell nuclear antigen protein, a proliferation marker, was up-regulated in the transgenic mice with core or myc-F protein. Further analyses by microarray and Western blotting suggested that β-catenin signaling pathway was activated by either core or myc-F protein in the transgenic mice. These transgenic mice were further treated with either Diethynitrosamine (a tumor initiator) or Phenobarbital (a tumor promoter). Phenobarbital but not Diethynitrosamine treatment could increase the liver/body weight ratio of these mice. However, no tumor formation was observed in these mice. In conclusion, HCV core and myc-F proteins could induce hepatocyte proliferation in the transgenic mice possibly through β-catenin signaling pathway.« less

  7. Chronic Activation of FXR in Transgenic Mice Caused Perinatal Toxicity and Sensitized Mice to Cholesterol Toxicity

    PubMed Central

    Cheng, Qiuqiong; Inaba, Yuka; Lu, Peipei; Xu, Meishu; He, Jinhan; Zhao, Yueshui; Guo, Grace L.; Kuruba, Ramalinga; de la Vega, Rona; Evans, Rhobert W.; Li, Song

    2015-01-01

    The nuclear receptor farnesoid X receptor (FXR) (nuclear receptor subfamily 1, group H, member 4, or NR1H4) is highly expressed in the liver and intestine. Previous reports have suggested beneficial functions of FXR in the homeostasis of bile acids, lipids, and glucose, as well as in promoting liver regeneration and inhibiting carcinogenesis. To investigate the effect of chronic FXR activation in vivo, we generated transgenic mice that conditionally and tissue specifically express the activated form of FXR in the liver and intestine. Unexpectedly, the transgenic mice showed several intriguing phenotypes, including partial neonatal lethality, growth retardation, and spontaneous liver toxicity. The transgenic mice also displayed heightened sensitivity to a high-cholesterol diet-induced hepatotoxicity but resistance to the gallstone formation. The phenotypes were transgene specific, because they were abolished upon treatment with doxycycline to silence the transgene expression. The perinatal toxicity, which can be rescued by a maternal vitamin supplement, may have resulted from vitamin deficiency due to low biliary bile acid output as a consequence of inhibition of bile acid formation. Our results also suggested that the fibroblast growth factor-inducible immediate-early response protein 14 (Fn14), a member of the proinflammatory TNF family, is a FXR-responsive gene. However, the contribution of Fn14 induction in the perinatal toxic phenotype of the transgenic mice remains to be defined. Because FXR is being explored as a therapeutic target, our results suggested that a chronic activation of this nuclear receptor may have an unintended side effect especially during the perinatal stage. PMID:25719402

  8. Transgenic and gene knockout mice in gastric cancer research

    PubMed Central

    Jiang, Yannan; Yu, Yingyan

    2017-01-01

    Mouse models are useful tool for carcinogenic study. They will greatly enrich the understanding of pathogenesis and molecular mechanisms for gastric cancer. However, only few of mice could develop gastric cancer spontaneously. With the development and improvement of gene transfer technology, investigators created a variety of transgenic and knockout/knockin mouse models of gastric cancer, such as INS-GAS mice and gastrin knockout mice. Combined with helicobacter infection and carcinogens treatment, these transgenic/knockout/knockin mice developed precancerous or cancerous lesions, which are proper for gene function study or experimental therapy. Here we review the progression of genetically engineered mouse models on gastric cancer research, and emphasize the effects of chemical carcinogens or infectious factors on carcinogenesis of genetically modified mouse. We also emphasize the histological examination on mouse stomach. We expect to provide researchers with some inspirations on this field. PMID:27713138

  9. Immune selection of tumor cells in TCR β-chain transgenic mice.

    PubMed

    Silaeva, Yulia Yu; Grinenko, Tatyana S; Vagida, Murad S; Kalinina, Anastasia A; Khromykh, Ludmila M; Kazansky, Dmitry B

    2014-10-01

    The concept of immunological surveillance implies that immunogenic variants of tumor cells arising in the organism can be recognized by the immune system. Tumor progression is provided by somatic evolution of tumor cells under the pressure of the immune system. The loss of MHC Class I molecules on the surface of tumor cells is one of the most known outcomes of immune selection. This study developed a model of immune selection based on the immune response of TCR 1d1 single β-chain transgenic B10.D2(R101) (K(d)I(d)D(b)) mice to allogeneic EL4 (H-2(b)) thymoma cells. In wild-type B10.D2(R101) mice, immunization with EL4 cells induced a vigorous CTL response targeted to the H-2K(b) molecule and results in full rejection of the tumor cells. In contrast, transgenic mice developed a compromised proliferative response in mixed-lymphocyte response assays and were unable to reject transplanted allogeneic EL4 cells. During the immune response to EL4 cells, CD8(+) T-lymphocytes with endogenous β-chains accumulated predominantly in the spleen of transgenic mice and only a small part of the T-lymphocytes expressing transgenic β-chains became CD8(+)CD44(+)CD62L(-) effectors. Then, instead of a full elimination of tumor cells as in wild-type mice, a reproducible prolonged equilibrium phase and subsequent escape was observed in transgenic mice that resulted in death of 90% of the mice in 40-60 days after grafting. Prolonged exposure of tumor cells to the pressure of the immune system in transgenic mice in vivo resulted in a stable loss of H-2K(b) molecules on the EL4 cell surface. Genetic manipulation of the T-lymphocyte repertoire was sufficient to reproduce the classic pattern of interactions between tumor cells and the immune system, usually observed in reliable syngeneic models of anti-tumor immunity. This newly-developed model could be used in further studies of immunoregulatory circuits common for transplantational and anti-tumor immune responses.

  10. Assembly of ordered contigs of cosmids selected with YACs of human chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, S.G.; Cayanis, E.; Boukhgalter, B.

    1994-06-01

    The authors have developed an efficient method for assembling ordered cosmid contigs aligned to mega-YACs and midi-YACs (average insert sizes of 1.0 and 0.35 Mb, respectively) and used this general method to initiate high-resolution physical mapping of human chromosome 13 (Chr 13). Chr 13-enriched midi-YAC (mYAC) and mega-YAC (MYAC) sublibraries were obtained from corresponding CEPH total human YAC libraries by selecting colonies with inter-Alu PCR probes derived from Chr 13 monochromosomal cell hybrid DNA. These sublibraries were arrayed on filters at high density. In this approach, the MYAC 13 sublibrary is screened by hybridization with cytogenetically assigned Chr 13 DNAmore » probes to select one or a small subset of MYACs. Inter-Alu PCR products from each mYAC are then hybridized to the MYAC and mYAC sublibraries to identify overlapping YACs and to an arrayed Chr 13-specific cosmid library to select corresponding cosmids. The set of selected cosmids, gridded on filters at high density, is hybridized with inter-Alu PCR products from each of the overlapping YACs to identify subsets of cosmids and also with riboprobes from each cosmid of the arrayed set ({open_quotes}cosmid matrix cross-hybridization{close_quotes}). From these data, cosmid contigs are assembled by a specifically designed computer program. Application of this method generates cosmid contigs spanning the length of a MYAC with few gaps. To provide a high-resolution map, ends of cosmids are sequenced at preselected sites to position densely spaced sequence-tagged sites. 33 refs., 7 figs., 1 tab.« less

  11. Neurobehavioral characterization of APP23 transgenic mice with the SHIRPA primary screen.

    PubMed

    Lalonde, R; Dumont, M; Staufenbiel, M; Strazielle, C

    2005-02-10

    The SHIRPA primary screen comprises 40 measures covering various reflexes and basic sensorimotor functions. This multi-test battery was used to compare non-transgenic controls with APP23 transgenic mice, expressing the 751 isoform of human beta-amyloid precursor protein and characterized by amyloid deposits in parenchyma and vessel walls. The APP23 mice were distinguishable from controls by pathological limb reflexes, myoclonic jumping, seizure activity, and tail malformation. In addition, this mouse model of Alzheimer's disease was also marked by a crooked swimming trajectory. APP23 mice were also of lighter weight and were less inclined to stay immobile during a transfer arousal test. Despite the neurologic signs, APP23 transgenic mice were not deficient in stationary beam, coat-hanger, and rotorod tests, indicating intact motor coordination abilities.

  12. Evaluation of an FRDA-EGFP genomic reporter assay in transgenic mice.

    PubMed

    Sarsero, Joseph P; Holloway, Timothy P; Li, Lingli; McLenachan, Samuel; Fowler, Kerry J; Bertoncello, Ivan; Voullaire, Lucille; Gazeas, Sophie; Ioannou, Panos A

    2005-04-01

    Friedreich ataxia is an autosomal recessive neurodegenerative disorder caused by a GAA trinucleotide expansion in the first intron of the Friedreich ataxia gene (FRDA) that causes reduced synthesis of frataxin, a mitochondrial protein likely to be involved in biosynthesis of iron-sulfur clusters. This leads to increased oxidative stress, progressive loss of large sensory neurons, and hypertrophic cardiomyopathy. To elucidate the mechanisms regulating FRDA expression and to develop an in vivo assay for agents that might upregulate FRDA expression in a therapeutically relevant manner, we have generated transgenic mice with a BAC genomic reporter construct consisting of an in-frame fusion between FRDA and the gene coding for enhanced green fluorescent protein (EGFP). Production of full-length frataxin-EGFP fusion protein was demonstrated by immunoblotting. EGFP expression was observed as early as day E3.5 of development. Most tissues of adult transgenic mice were fluorescent. The level of FRDA-EGFP expression in peripheral blood, bone marrow, and cells obtained from enzymatically disaggregated tissues was quantitated by flow cytometry. There was a twofold increase in EGFP expression in mice homozygous for the transgene when compared to hemizygous mice. These transgenic mice are a valuable tool for the examination of spatial and temporal aspects of FRDA gene expression and for the preclinical evaluation of pharmacological inducers of FRDA expression in a whole-animal model. In addition, tissues from these mice should also be valuable for stem cell transplantation studies.

  13. Amyloidosis in transgenic mice expressing murine amyloidogenic apolipoprotein A-II (Apoa2c).

    PubMed

    Ge, Fengxia; Yao, Junjie; Fu, Xiaoying; Guo, Zhanjun; Yan, Jingmin; Zhang, Beiru; Zhang, Huanyu; Tomozawa, Hiroshi; Miyazaki, Junichi; Sawashita, Jinko; Mori, Masayuki; Higuchi, Keiichi

    2007-07-01

    In mice, apolipoprotein A-II (apoA-II) self-associates to form amyloid fibrils (AApoAII) in an age-associated manner. We postulated that the two most important factors in apoA-II amyloidosis are the Apoa2(c) allele, which codes for the amyloidogenic protein APOA2C (Gln5, Ala38) and transmission of amyloid fibrils. To characterize further the contribution of the Apoa2(c) allele to amyloidogenesis and improve detection of amyloidogenic materials, we established transgenic mice that overexpress APOA2C protein under the cytomegalovirus (CMV) immediate early gene (CMV-IE) enhancer/chicken beta promoter. Compared to transgene negative (Tg(-/-)) mice that express apoA-II protein mainly in the liver, mice homozygous (Tg(+/+)) and heterozygous (Tg(+/-)) for the transgene express a high level of apoA-II protein in many tissues. They also have higher plasma concentrations of apoA-II, higher ratios of ApoA-II/apolipoprotein A-I (ApoA-I) and higher concentrations of high-density lipoprotein (HDL) cholesterol. Following injection of AApoAII fibrils into Tg(+/+) mice, amyloid deposition was observed in the testis, liver, kidney, heart, lungs, spleen, tongue, stomach and intestine but not in the brain. In Tg(+/+) mice, but not in Tg(-/-) mice, amyloid deposition was induced by injection of less than 10(-8) mug AApoAII fibrils. Furthermore, deposition in Tg(+/+) mice occurred more rapidly and to a greater extent than in Tg(-/-) mice. These studies indicate that increased levels of APOA2C protein lead to earlier and greater amyloid deposition and enhanced sensitivity to the transmission of amyloid fibrils in transgenic mice. This transgenic mouse model should prove valuable for studies of amyloidosis.

  14. Overexpression of alpha(1)-acid glycoprotein in transgenic mice leads to sensitisation to acute colitis.

    PubMed

    Hochepied, T; Wullaert, A; Berger, F G; Baumann, H; Brouckaert, P; Steidler, L; Libert, C

    2002-09-01

    alpha(1)-Acid glycoprotein (alpha(1)-AGP) is an acute phase protein in most mammalian species whose concentration rises 2-5-fold during an acute phase reaction. Its serum concentration has often been used as a marker of disease, including inflammatory bowel disease (IBD). High alpha(1)-AGP levels were found to have a prognostic value for an increased risk of relapse in IBD. To investigate a possible role for increased serum levels of alpha(1)-AGP in the development of IBD. Dextran sodium sulphate (DSS) 2% was added to the drinking water of transgenic mice, overexpressing the rat alpha(1)-AGP gene, to induce acute colitis, thus mimicking the conditions of relapse. Clinical parameters, inflammatory parameters, and histological analyses on colon sections were performed. Homozygous alpha(1)-AGP-transgenic mice started losing weight and showed rectal bleeding significantly earlier than heterozygous transgenic or wild-type mice. Survival time of homozygous transgenic mice was significantly shorter compared with heterozygous and wild-type mice. The higher susceptibility of homozygous alpha(1)-AGP-transgenic mice to DSS induced acute colitis was also reflected in higher local myeloperoxidase levels, higher inflammation scores of the colon, and higher systemic levels of interleukin 6 and serum amyloid P component. Local inflammatory parameters were also significantly different in heterozygous transgenic mice compared with wild-type mice, indicating a local dosage effect. In homozygous transgenic mice, significantly higher amounts of bacteria were found in organs but IgA levels were only slightly lower than those of control mice. Sufficiently high serum levels of alpha(1)-AGP result in a more aggressive development of acute colitis.

  15. A novel humanized mouse model of Huntington disease for preclinical development of therapeutics targeting mutant huntingtin alleles.

    PubMed

    Southwell, Amber L; Skotte, Niels H; Villanueva, Erika B; Østergaard, Michael E; Gu, Xiaofeng; Kordasiewicz, Holly B; Kay, Chris; Cheung, Daphne; Xie, Yuanyun; Waltl, Sabine; Dal Cengio, Louisa; Findlay-Black, Hailey; Doty, Crystal N; Petoukhov, Eugenia; Iworima, Diepiriye; Slama, Ramy; Ooi, Jolene; Pouladi, Mahmoud A; Yang, X William; Swayze, Eric E; Seth, Punit P; Hayden, Michael R

    2017-03-15

    Huntington disease (HD) is a neurodegenerative disease caused by a mutation in the huntingtin (HTT) gene. HTT is a large protein, interacts with many partners and is involved in many cellular pathways, which are perturbed in HD. Therapies targeting HTT directly are likely to provide the most global benefit. Thus there is a need for preclinical models of HD recapitulating human HTT genetics. We previously generated a humanized mouse model of HD, Hu97/18, by intercrossing BACHD and YAC18 mice with knockout of the endogenous mouse HD homolog (Hdh). Hu97/18 mice recapitulate the genetics of HD, having two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of Caucasian descent. We have now generated a companion model, Hu128/21, by intercrossing YAC128 and BAC21 mice on the Hdh-/- background. Hu128/21 mice have two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of East Asian descent and in a minority of patients from other ethnic groups. Hu128/21 mice display a wide variety of HD-like phenotypes that are similar to YAC128 mice. Additionally, both transgenes in Hu128/21 mice match the human HTT exon 1 reference sequence. Conversely, the BACHD transgene carries a floxed, synthetic exon 1 sequence. Hu128/21 mice will be useful for investigations of human HTT that cannot be addressed in Hu97/18 mice, for developing therapies targeted to exon 1, and for preclinical screening of personalized HTT lowering therapies in HD patients of East Asian descent. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Transgenic mice overexpressing insulin-like growth factor-II in β cells develop type 2 diabetes

    PubMed Central

    Devedjian, Jean-Christophe; George, Monica; Casellas, Alba; Pujol, Anna; Visa, Joana; Pelegrín, Mireia; Gros, Laurent; Bosch, Fatima

    2000-01-01

    During embryonic development, insulin-like growth factor-II (IGF-II) participates in the regulation of islet growth and differentiation. We generated transgenic mice (C57BL6/SJL) expressing IGF-II in β cells under control of the rat Insulin I promoter in order to study the role of islet hyperplasia and hyperinsulinemia in the development of type 2 diabetes. In contrast to islets from control mice, islets from transgenic mice displayed high levels of IGF-II mRNA and protein. Pancreases from transgenic mice showed an increase in β-cell mass (about 3-fold) and in insulin mRNA levels. However, the organization of cells within transgenic islets was disrupted, with glucagon-producing cells randomly distributed throughout the core. We also observed enhanced glucose-stimulated insulin secretion and glucose utilization in islets from transgenic mice. These mice displayed hyperinsulinemia, mild hyperglycemia, and altered glucose and insulin tolerance tests, and about 30% of these animals developed overt diabetes when fed a high-fat diet. Furthermore, transgenic mice obtained from the N1 backcross to C57KsJ mice showed high islet hyperplasia and insulin resistance, but they also developed fatty liver and obesity. These results indicate that local overexpression of IGF-II in islets might lead to type 2 diabetes and that islet hyperplasia and hypersecretion of insulin might occur early in the pathogenesis of this disease. PMID:10727441

  17. Aggregated Recombinant Human Interferon Beta Induces Antibodies but No Memory in Immune-Tolerant Transgenic Mice

    PubMed Central

    Sauerborn, Melody; Gilli, Francesca; Brinks, Vera; Schellekens, Huub; Jiskoot, Wim

    2010-01-01

    ABSTRACT Purpose To study the influence of protein aggregation on the immunogenicity of recombinant human interferon beta (rhIFNβ) in wild-type mice and transgenic, immune-tolerant mice, and to evaluate the induction of immunological memory. Methods RhIFNβ-1b and three rhIFNβ-1a preparations with different aggregate levels were injected intraperitoneally in mice 15× during 3 weeks, and the mice were rechallenged with rhIFNβ-1a. The formation of binding (BABs) and neutralizing antibodies (NABs) was monitored. Results Bulk rhIFNβ-1a contained large, mainly non-covalent aggregates and stressed rhIFNβ-1a mainly covalent, homogeneous (ca. 100 nm) aggregates. Reformulated rhIFNβ-1a was essentially aggregate-free. All products induced BABs and NABs in wild-type mice. Immunogenicity in the transgenic mice was product dependent. RhIFNβ-1b showed the highest and reformulated rhIFNβ-1a the lowest immunogenicity. In contrast with wild-type mice, transgenic mice did not show NABs, nor did they respond to the rechallenge. Conclusions The immunogenicity of the products in transgenic mice, unlike in wild-type mice, varied. In the transgenic mice, neither NABs nor immunological memory developed. The immunogenicity of rhIFNβ in a model reflecting the human immune system depends on the presence and the characteristics of aggregates. PMID:20499141

  18. Overexpression of Thioredoxin in Transgenic Mice Attenuates Focal Ischemic Brain Damage

    NASA Astrophysics Data System (ADS)

    Takagi, Yasushi; Mitsui, Akira; Nishiyama, Akira; Nozaki, Kazuhiko; Sono, Hiroshi; Gon, Yasuhiro; Hashimoto, Nobuo; Yodoi, Junji

    1999-03-01

    Thioredoxin (TRX) plays important biological roles both in intra- and extracellular compartments, including in regulation of various intracellular molecules via thiol redox control. We produced TRX overexpressing mice and confirmed that there were no anatomical and physiological differences between wild-type (WT) mice and TRX transgenic (Tg) mice. In the present study we subjected mice to focal brain ischemia to shed light on the role of TRX in brain ischemic injury. At 24 hr after middle cerebral artery occlusion, infarct areas and volume were significantly smaller in Tg mice than in WT mice. Moreover neurological deficit was ameliorated in Tg mice compared with WT mice. Protein carbonyl content, a marker of cellular protein oxidation, in Tg mice showed less increase than did that of WT mice after the ischemic insult. Furthermore, c-fos expression in Tg mice was stronger than in WT mice 1 hr after ischemia. Our results suggest that transgene expression of TRX decreased ischemic neuronal injury and that TRX and the redox state modified by TRX play a crucial role in brain damage during stroke.

  19. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Young; Department of Internal Medicine, University of Texas, Southwestern Medical Center, Dallas, TX 75390-8854; Naseem, R. Haris

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activatedmore » receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.« less

  20. Tissue-specific expression of human CD4 in transgenic mice.

    PubMed Central

    Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C

    1993-01-01

    The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. Images PMID:8474453

  1. Hyperactive hypothalamus, motivated and non-distractible chronic overeating in ADAR2 transgenic mice

    PubMed Central

    Akubuiro, Ashley; Zimmerman, M. Bridget; Boles Ponto, Laura L.; Walsh, Susan A.; Sunderland, John; McCormick, Laurie; Singh, Minati

    2013-01-01

    ADAR2 transgenic mice misexpressing the RNA editing enzyme ADAR2 (Adenosine Deaminase that act on RNA) show characteristics of overeating and experience adult onset obesity. Behavioral patterns and brain changes related to a possible addictive overeating in these transgenic mice were explored as transgenic mice display chronic hyperphagia. ADAR2 transgenic mice were assessed in their food preference and motivation to overeat in a competing reward environment with ad lib access to a running wheel and food. Metabolic activity of brain and peripheral tissue were assessed with [18F] fluorodeoxyglucose positron emission tomography (FDG-PET) and RNA expression of feeding related genes, ADAR2, dopamine and opiate receptors from the hypothalamus and striatum were examined. The results indicate that ADAR2 transgenic mice exhibit, (1) a food preference for diets with higher fat content, (2) significantly increased food intake that is non-distractible in a competing reward environment, (3) significantly increased mRNA expressions of ADAR2, serotonin 2C receptor (5HT2CR), D1, D2, and mu opioid receptors and no change in CRH mRNAs and significantly reduced ADAR2 protein expression in the hypothalamus, (4) significantly increased D1 receptor and altered bioamines with no change in ADAR2, mu opioid and D2 receptor mRNA expression in the striatum, and (5) significantly greater glucose metabolism in the hypothalamus, brain stem, right hippocampus, left and right mid brain regions and suprascapular peripheral tissue than controls. These results suggest that highly motivated and goal-oriented overeating behaviors of ADAR2 transgenic mice are associated with altered feeding, reward-related mRNAs, and hyperactive brain mesolimbic region. PMID:23323881

  2. Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauss, W.M.; Dausman, J.; Beard, C.

    Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protectionmore » analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.« less

  3. Fluorescent transgenic mice suitable for multi-color aggregation chimera studies.

    PubMed

    Ohtsuka, Masato; Miura, Hiromi; Gurumurthy, Channabasavaiah B; Kimura, Minoru; Inoko, Hidetoshi; Yoshimura, Shinichi; Sato, Masahiro

    2012-11-01

    We recently reported a novel method of mouse transgenesis called Pronuclear Injection-based Targeted Transgenisis (PITT) using which a series of fluorescent transgenic (Tg) mice lines were generated. These lines, unlike those generated using conventional random integration methods, express the transgenes faithfully and reproducibly generation after generation. Because of this superior nature, these lines are ideal for the generation of multi-colored aggregation chimeras that can be used to study cell-cell interactions and lineage analyses in living embryos/organs, where the transgenes can be detected and the clonal origin of a given cell population easily traced by its distinct fluorescence. In this study, to verify if Tg fluorescent mice generated through PITT were suitable for such applications, we sought to generate chimeric blastocysts and chimeric-Tg mice by aggregating two- or three-colored 8-cell embryos. Our analyses using these models led to the following observations. First, we noticed that cell mixing was infrequent during the stages of morula to early blastocyst. Second, chimeric fetuses obtained after aggregation of the two-colored 8-cell embryos exhibited uniform cell mixing. And third, in the organs of adult chimeric mice, the mode of cell distribution could be either clonal or polyclonal, as previously pointed out by others. Implications of our novel and improved Tg-chimeric mice approach for clonal cell lineage and developmental studies are discussed.

  4. Muscle-specific transgenic expression of porcine myostatin propeptide enhances muscle growth in mice.

    PubMed

    Wang, Kaiyun; Li, Zicong; Li, Yang; Zeng, Jinyong; He, Chang; Yang, Jinzeng; Liu, Dewu; Wu, Zhenfang

    2013-10-01

    Myostatin is a well-known negative regulator of skeletal muscle growth. Inhibition of myostatin activity results in increased muscle mass. Myostatin propeptide, as a myostatin antagonist, could be applied to promote meat production in livestock such as pigs. In this study, we generated a transgenic mouse model expressing porcine myostatin propeptide under the control of muscle-specific regulatory elements. The mean body weight of transgenic mice from a line expressing the highest level of porcine myostatin propeptide was increased by 5.4 % (P = 0.023) and 3.2 % (P = 0.031) in males and females, respectively, at 8 weeks of age. Weight of carcass, fore limb and hind limb was respectively increased by 6.0 % (P = 0.038), 9.0 % (P = 0.014), 8.7 % (P = 0.036) in transgenic male mice, compared to wild-type male controls at the age of 9 weeks. Similarly, carcass, fore limb and hind limb of transgenic female mice was 11.4 % (P = 0.002), 14.5 % (P = 0.006) and 14.5 % (P = 0.03) respectively heavier than that of wild-type female mice. The mean cross-section area of muscle fiber was increased by 17 % (P = 0.002) in transgenic mice, in comparison with wild-type controls. These results demonstrated that porcine myostatin propeptide is effective in enhancement of muscle growth. The present study provided useful information for future study on generation of transgenic pigs overexpressing porcine myostatin propeptide for improvement of muscle mass.

  5. Reduced aortic lesions and elevated high density lipoprotein levels in transgenic mice overexpressing mouse apolipoprotein A-IV.

    PubMed Central

    Cohen, R D; Castellani, L W; Qiao, J H; Van Lenten, B J; Lusis, A J; Reue, K

    1997-01-01

    Transgenic mouse lines carrying several copies of the mouse apo A-IV gene were produced. Lipoprotein composition and function, and aortic lesion development were examined. Apo A-IV levels in the plasma of transgenic mice were elevated threefold compared with nontransgenic littermates on a chow diet, and sixfold in mice fed an atherogenic diet. Plasma concentrations of total cholesterol, HDL cholesterol, triglycerides, and free fatty acids were similar in transgenic and control mice fed a chow diet. However, with the atherogenic diet, male transgenic mice exhibited significantly higher levels of plasma triglycerides (P < 0.05), total cholesterol (P < 0.01), HDL cholesterol (P < 0.0001), and free fatty acids (P < 0.05), and lower levels of unesterified cholesterol (P < 0.05), than nontransgenic littermates. Expression of the apo A-IV transgene had a protective effect against the formation of diet-induced aortic lesions, with transgenics exhibiting lesion scores of approximately 30% those seen in control mice. HDL-sized lipoproteins isolated from transgenic mice fed the atherogenic diet promoted cholesterol efflux from cholesterol-loaded human monocytes more efficiently than comparable lipoproteins from nontransgenic counterparts. Plasma from transgenics also exhibited higher endogenous cholesterol esterification rates. Taken together, these results suggest that apo A-IV levels influence the metabolism and antiatherogenic properties of HDL. PMID:9109435

  6. Neural differentiation of adipose-derived stem cells isolated from GFP transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fujimura, Juri; Department of Pediatrics, Nippon Medical School, Tokyo; E-mail: juri-f@nms.ac.jp

    2005-07-22

    Taking advantage of homogeneously marked cells from green fluorescent protein (GFP) transgenic mice, we have recently reported that adipose-derived stromal cells (ASCs) could differentiate into mesenchymal lineages in vitro. In this study, we performed neural induction using ASCs from GFP transgenic mice and were able to induce these ASCs into neuronal and glial cell lineages. Most of the neurally induced cells showed bipolar or multipolar appearance morphologically and expressed neuronal markers. Electron microscopy revealed their neuronal morphology. Some cells also showed glial phenotypes, as shown immunocytochemically. The present study clearly shows that ASCs derived from GFP transgenic mice differentiate intomore » neural lineages in vitro, suggesting that these cells might provide an ideal source for further neural stem cell research with possible therapeutic application for neurological disorders.« less

  7. Hyperactive hypothalamus, motivated and non-distractible chronic overeating in ADAR2 transgenic mice.

    PubMed

    Akubuiro, A; Bridget Zimmerman, M; Boles Ponto, L L; Walsh, S A; Sunderland, J; McCormick, L; Singh, M

    2013-04-01

    ADAR2 transgenic mice misexpressing the RNA editing enzyme ADAR2 (Adenosine Deaminase that act on RNA) show characteristics of overeating and experience adult onset obesity. Behavioral patterns and brain changes related to a possible addictive overeating in these transgenic mice were explored as transgenic mice display chronic hyperphagia. ADAR2 transgenic mice were assessed in their food preference and motivation to overeat in a competing reward environment with ad lib access to a running wheel and food. Metabolic activity of brain and peripheral tissue were assessed with [(18) F] fluorodeoxyglucose positron emission tomography (FDG-PET) and RNA expression of feeding related genes, ADAR2, dopamine and opiate receptors from the hypothalamus and striatum were examined. The results indicate that ADAR2 transgenic mice exhibit, (1) a food preference for diets with higher fat content, (2) significantly increased food intake that is non-distractible in a competing reward environment, (3) significantly increased messenger RNA (mRNA) expressions of ADAR2, serotonin 2C receptor (5HT2C R), D1, D2 and mu opioid receptors and no change in corticotropin-releasing hormone mRNAs and significantly reduced ADAR2 protein expression in the hypothalamus, (4) significantly increased D1 receptor and altered bioamines with no change in ADAR2, mu opioid and D2 receptor mRNA expression in the striatum and (5) significantly greater glucose metabolism in the hypothalamus, brain stem, right hippocampus, left and right mid brain regions and suprascapular peripheral tissue than controls. These results suggest that highly motivated and goal-oriented overeating behaviors of ADAR2 transgenic mice are associated with altered feeding, reward-related mRNAs and hyperactive brain mesolimbic region. Genes, Brain and Behavior © 2013 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

  8. Caspase 6 has a protective role in SOD1(G93A) transgenic mice.

    PubMed

    Hogg, Marion C; Mitchem, Mollie R; König, Hans-Georg; Prehn, Jochen H M

    2016-06-01

    In amyotrophic lateral sclerosis (ALS), it has been suggested that the process of neurodegeneration starts at the neuromuscular junction and is propagated back along axons towards motor neurons. Caspase-dependent pathways are well established as a cause of motor neuron death, and recent work in other disease models indicated a role for caspase 6 in axonal degeneration. Therefore we hypothesised that caspase 6 may be involved in motor neuron death in ALS. To investigate the role of caspase 6 in ALS we profiled protein levels of caspase-6 throughout disease progression in the ALS mouse model SOD1(G93A); this did not reveal differences in caspase 6 levels during disease. To investigate the role of caspase 6 further we generated a colony with SOD1(G93A) transgenic mice lacking caspase 6. Analysis of the transgenic SOD1(G93A); Casp6(-/-) revealed an exacerbated phenotype with motor dysfunction occurring earlier and a significantly shortened lifespan when compared to transgenic SOD1(G93A); Casp6(+/+) mice. Immunofluorescence analysis of the neuromuscular junction revealed no obvious difference between caspase 6(+/+) and caspase 6(-/-) in non-transgenic mice, while the SOD1(G93A) transgenic mice showed severe degeneration compared to non-transgenic mice in both genotypes. Our data indicate that caspase-6 does not exacerbate ALS pathogenesis, but may have a protective role. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. APP transgenic mice for modelling behavioral and psychological symptoms of dementia (BPSD)

    PubMed Central

    Lalonde, R.; Fukuchi, K.; Strazielle, C.

    2012-01-01

    The discovery of gene mutations responsible for autosomal dominant Alzheimer's disease has enabled researchers to reproduce in transgenic mice several hallmarks of this disorder, notably Aβ accumulation, though in most cases without neurofibrillary tangles. Mice expressing mutated and wild-type APP as well as C-terminal fragments of APP exhibit variations in exploratory activity reminiscent of behavioral and psychological symptoms of Alzeimer dementia (BPSD). In particular, open-field, spontaneous alternation, and elevated plus-maze tasks as well as aggression are modified in several APP transgenic mice relative to non-transgenic controls. However, depending on the precise murine models, changes in open-field and elevated plus-maze exploration occur in either direction, either increased or decreased relative to controls. It remains to be determined which neurotransmitter changes are responsible for this variability, in particular with respect to GABA, 5HT, and dopamine. PMID:22373961

  10. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    PubMed Central

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  11. Anti-tau antibody administration increases plasma tau in transgenic mice and patients with tauopathy

    PubMed Central

    Yanamandra, Kiran; Patel, Tirth K.; Jiang, Hong; Schindler, Suzanne; Ulrich, Jason D.; Boxer, Adam L.; Miller, Bruce L.; Kerwin, Diana R.; Gallardo, Gilbert; Stewart, Floy; Finn, Mary Beth; Cairns, Nigel J.; Verghese, Philip B.; Fogelman, Ilana; West, Tim; Braunstein, Joel; Robinson, Grace; Keyser, Jennifer; Roh, Joseph; Knapik, Stephanie S.; Hu, Yan; Holtzman, David M.

    2017-01-01

    Tauopathies are a group of disorders in which the cytosolic protein tau aggregates and accumulates in cells within the brain, resulting in neurodegeneration. A promising treatment being explored for tauopathies is passive immunization with anti-tau antibodies. We previously found that administration of an anti-tau antibody to human tau transgenic mice increased the concentration of plasma tau. We further explored the effects of administering an anti-tau antibody on plasma tau. After peripheral administration of an anti-tau antibody to human patients with tauopathy and to mice expressing human tau in the central nervous system, there was a dose-dependent increase in plasma tau. In mouse plasma, we found that tau had a short half-life of 8 min that increased to more than 3 hours after administration of anti-tau antibody. As tau transgenic mice accumulated insoluble tau in the brain, brain soluble and interstitial fluid tau decreased. Administration of anti-tau antibody to tau transgenic mice that had decreased brain soluble tau and interstitial fluid tau resulted in an increase in plasma tau, but this increase was less than that observed in tau transgenic mice without these brain changes. Tau transgenic mice subjected to acute neuronal injury using 3-nitropropionic acid showed increased interstitial fluid tau and plasma tau. These data suggest that peripheral administration of an anti-tau antibody results in increased plasma tau, which correlates with the concentration of extracellular and soluble tau in the brain. PMID:28424326

  12. Magnetic biomineralisation in Huntington's disease transgenic mice

    NASA Astrophysics Data System (ADS)

    Beyhum, W.; Hautot, D.; Dobson, J.; Pankhurst, Q. A.

    2005-01-01

    The concentration levels of biogenic magnetite nanoparticles in transgenic R6/2 Huntington's disease (HD) mice have been investigated, using seven control and seven HD mice each from an 8 week-old litter and from a 12 week-old litter. Hysteresis and isothermal remnant magnetisation data were collected on a SQUID magnetometer, and analysed using a model comprising dia/paramagnetic, ferrimagnetic and superparamagnetic contributions, to extract the magnetite and ferritin concentrations present. It was found that magnetite was present in both superparamagnetic and blocked states. A larger spread and higher concentration of magnetite levels was found in the diseased mice for both the 8 week-old and 12 week-old batches, compared to the controls.

  13. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Protein Precursor Transgenic Mice.

    PubMed

    Liu, Peng; Reichl, John H; Rao, Eshaan R; McNellis, Brittany M; Huang, Eric S; Hemmy, Laura S; Forster, Colleen L; Kuskowski, Michael A; Borchelt, David R; Vassar, Robert; Ashe, Karen H; Zahs, Kathleen R

    2017-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β protein precursor (AβPP) with Alzheimer's disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ∼4.5 times that of 21-month-old Tg2576 mice and ∼15 times that of 21-24-month-old rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort.

  14. Quantitative Comparison of Dense-Core Amyloid Plaque Accumulation in Amyloid-β Precursor Protein Transgenic Mice

    PubMed Central

    Liu, Peng; Reichl, John H.; Rao, Eshaan R.; McNellis, Brittany M.; Huang, Eric S.; Hemmy, Laura S.; Forster, Colleen L.; Kuskowski, Michael A.; Borchelt, David R.; Vassar, Robert; Ashe, Karen H.; Zahs, Kathleen R.

    2016-01-01

    There exist several dozen lines of transgenic mice that express human amyloid-β precursor protein (AβPP) with Alzheimer’s disease (AD)-linked mutations. AβPP transgenic mouse lines differ in the types and amounts of Aβ that they generate and in their spatiotemporal patterns of expression of Aβ assemblies, providing a toolkit to study Aβ amyloidosis and the influence of Aβ aggregation on brain function. More complete quantitative descriptions of the types of Aβ assemblies present in transgenic mice and in humans during disease progression should add to our understanding of how Aβ toxicity in mice relates to the pathogenesis of AD. Here, we provide a direct quantitative comparison of amyloid plaque burdens and plaque sizes in four lines of AβPP transgenic mice. We measured the fraction of cortex and hippocampus occupied by dense-core plaques, visualized by staining with Thioflavin S, in mice from young adulthood through advanced age. We found that the plaque burdens among the transgenic lines varied by an order of magnitude: at 15 months of age, the oldest age studied, the median cortical plaque burden in 5XFAD mice was already ~4.5 times that of 21-month Tg2576 mice and ~15 times that of 21–24-month rTg9191 mice. Plaque-size distributions changed across the lifespan in a line- and region-dependent manner. We also compared the dense-core plaque burdens in the mice to those measured in a set of pathologically-confirmed AD cases from the Nun Study. Cortical plaque burdens in Tg2576, APPSwePS1ΔE9, and 5XFAD mice eventually far exceeded those measured in the human cohort. PMID:28059792

  15. Expression of the G72/G30 gene in transgenic mice induces behavioral changes

    PubMed Central

    Cheng, Lijun; Hattori, Eiji; Nakajima, Akira; Woehrle, Nancy S.; Opal, Mark D.; Zhang, Chunling; Grennan, Kay; Dulawa, Stephanie C.; Tang, Ya-Ping; Gershon, Elliot S.; Liu, Chunyu

    2012-01-01

    The G72/G30 gene complex is a candidate gene for schizophrenia and bipolar disorder. However, G72 and G30 mRNAs are expressed at very low levels in human brain, with only rare splicing forms observed. We report here G72/G30 expression profiles and behavioral changes in a G72/G30 transgenic mouse model. A human BAC clone containing the G72/G30 genomic region was used to establish the transgenic mouse model, on which gene expression studies, Western blot and behavioral tests were performed. Relative to their minimal expression in humans, G72 and G30 mRNAs were highly expressed in the transgenic mice, and had a more complex splicing pattern. The highest G72 transcript levels were found in testis, followed by cerebral cortex, with very low or undetectable levels in other tissues. No LG72 (the long putative isoform of G72) protein was detected in the transgenic mice. Whole-genome expression profiling identified 361 genes differentially-expressed in transgenic mice compared to wild-type, including genes previously implicated in neurological and psychological disorders. Relative to wild-type mice, the transgenic mice exhibited fewer stereotypic movements in the open field test, higher baseline startle responses in the course of the prepulse inhibition test, and lower hedonic responses in the sucrose preference test. The transcriptome profile changes and multiple mouse behavioral effects suggest that the G72 gene may play a role in modulating behaviors relevant to psychiatric disorders. PMID:23337943

  16. Enhanced O6-methylguanine-DNA methyltransferase activity in transgenic mice containing an integrated E. coli ada repair gene.

    PubMed

    Matsukuma, S; Nakatsuru, Y; Nakagawa, K; Utakoji, T; Sugano, H; Kataoka, H; Sekiguchi, M; Ishikawa, T

    1989-11-01

    The E. coli ada gene encodes O6-methylguanine DNA methyltransferase (O6MTase) which repairs the methylation of guanine at the O6 position in DNA. After recombination with a Chinese hamster metallothionein I gene promoter, the ada gene was microinjected into C3H/HeN mouse zygotes. Eventually, transgenic mice containing the ada fusion DNA were generated. The integrated ada DNA complex was transmitted to the progeny in a mode conforming to tandem integration at a single chromosome site, and homozygotes were also obtained from an inter-transgenic mouse cross. RNA transcripts of the chimeric ada gene were identified in the livers of these transgenic mice using dot and Northern blot analyses. O6MTase activity was increased in the liver of transgenic mice of line No. 708, and was more than 3 times the activity found in non-transgenic mice, especially in the transgenic homozygotes. The ada gene product was detected in the liver of a transgenic homozygote by immunoblot analysis. These transgenic mice have great potential for analysis of the role played by O6MTase in chemical carcinogenesis.

  17. RNAi-Mediated Knockdown of IKK1 in Transgenic Mice Using a Transgenic Construct Containing the Human H1 Promoter

    PubMed Central

    Moreno-Maldonado, Rodolfo; Murillas, Rodolfo; Page, Angustias; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Bravo, Ana; Casanova, M. Llanos

    2014-01-01

    Inhibition of gene expression through siRNAs is a tool increasingly used for the study of gene function in model systems, including transgenic mice. To achieve perdurable effects, the stable expression of siRNAs by an integrated transgenic construct is necessary. For transgenic siRNA expression, promoters transcribed by either RNApol II or III (such as U6 or H1 promoters) can be used. Relatively large amounts of small RNAs synthesis are achieved when using RNApol III promoters, which can be advantageous in knockdown experiments. To study the feasibility of H1 promoter-driven RNAi-expressing constructs for protein knockdown in transgenic mice, we chose IKK1 as the target gene. Our results indicate that constructs containing the H1 promoter are sensitive to the presence of prokaryotic sequences and to transgene position effects, similar to RNApol II promoters-driven constructs. We observed variable expression levels of transgenic siRNA among different tissues and animals and a reduction of up to 80% in IKK1 expression. Furthermore, IKK1 knockdown led to hair follicle alterations. In summary, we show that constructs directed by the H1 promoter can be used for knockdown of genes of interest in different organs and for the generation of animal models complementary to knockout and overexpression models. PMID:24523631

  18. [Chromosomal localization of foreign genes in transgenic mice using dual-color fluorescence in situ hybridization].

    PubMed

    Lin, Dan; Gong, Xiu-li; Li, Wei; Guo, Xin-bing; Zhu, Yi-wen; Huang, Ying

    2008-02-01

    To establish a highly sensitive and specific dual-color fluorescence in situ hybridization (D-FISH) method used for chromosomal localization of foreign genes in double transgenic mice. Two strains of double transgenic mice were used in this experiment, one was integrated with the herpes simplex virus thymidine kinase (HSV-tk) and the enhanced green fluorescence protein (eGFP), the other was with the short hairpin RNA interference(RNAi) and beta(654). Splenic cells cultured in vitro were arrested in metaphase by colchicine and hybridized with digoxigenin-labeled and biotinylated DNA probes, then detected by rhodamine-conjugated avidin and FITC-conjugated anti-digoxigenin. Dual-color fluorescence signals were detected on the same metaphase in both transgenic mice strains. In HSV-tk/eGFP double transgenic mice, strong green fluorescence for HSV-tk and red for eGFP were observed and localized at 2E5-G3 and 8A2-A4 respectively. In beta(654)/RNAi mice, beta(654) was detected as red fluorescence on chromosome 7D3-E2, and RNAi showed random integration on chromosomes. It was detected as green fluorescence on chromosome 12B1 in one mouse, while on 1E2.3-1F and 3A3 in the other. Highly sensitive and specific D-FISH method was established using the self-prepared DNA probes, and chromosomal localization of the foreign genes was also performed in combination with G-banding in double transgenic mice. This technology will facilitate the researches in transgenic animals and gene therapy models.

  19. Combined Treatment with the Mood Stabilizers Lithium and Valproate Produces Multiple Beneficial Effects in Transgenic Mouse Models of Huntington's Disease

    PubMed Central

    Chiu, Chi-Tso; Liu, Guangping; Leeds, Peter; Chuang, De-Maw

    2011-01-01

    Emerging evidence suggests that the mood stabilizers lithium and valproate (VPA) have broad neuroprotective and neurotrophic properties, and that these occur via inhibition of glycogen synthase kinase 3 (GSK-3) and histone deacetylases (HDACs), respectively. Huntington's disease (HD) is an inherited neurodegenerative disorder characterized by impaired movement, cognitive and psychiatric disturbances, and premature death. We treated N171-82Q and YAC128 mice, two mouse models of HD varying in genetic backgrounds and pathological progressions, with a diet containing therapeutic doses of lithium, VPA, or both. Untreated, these transgenic mice displayed a decrease in levels of GSK-3β serine 9 phosphorylation and histone H3 acetylation in the striatum and cerebral cortex around the onset of behavioral deficits, indicating a hyperactivity of GSK-3β and HDACs. Using multiple well-validated behavioral tests, we found that co-treatment with lithium and VPA more effectively alleviated spontaneous locomotor deficits and depressive-like behaviors in both models of HD mice. Furthermore, compared with monotherapy with either drug alone, co-treatment more successfully improved motor skill learning and coordination in N171-82Q mice, and suppressed anxiety-like behaviors in YAC128 mice. This combined treatment consistently inhibited GSK-3β and HDACs, and caused a sustained elevation in striatal as well as cortical brain-derived neurotrophic factor and heat shock protein 70. Importantly, co-treatment markedly prolonged median survival of N171-82Q mice from 31.6 to 41.6 weeks. Given that there is presently no proven treatment for HD, our results suggest that combined treatment with lithium and VPA, two mood stabilizers with a long history of safe use in humans, may have important therapeutic potential for HD patients. PMID:21796107

  20. Markedly Increased Susceptibility to Natural Sheep Scrapie of Transgenic Mice Expressing Ovine PrP

    PubMed Central

    Vilotte, Jean-Luc; Soulier, Solange; Essalmani, Rachid; Stinnakre, Marie-George; Vaiman, Daniel; Lepourry, Laurence; Da Silva, Jose Costa; Besnard, Nathalie; Dawson, Mike; Buschmann, Anne; Groschup, Martin; Petit, Stephanie; Madelaine, Marie-Francoise; Rakatobe, Sabine; Le Dur, Annick; Vilette, Didier; Laude, Hubert

    2001-01-01

    The susceptibility of sheep to scrapie is known to involve, as a major determinant, the nature of the prion protein (PrP) allele, with the VRQ allele conferring the highest susceptibility to the disease. Transgenic mice expressing in their brains three different ovine PrPVRQ-encoding transgenes under an endogenous PrP-deficient genetic background were established. Nine transgenic (tgOv) lines were selected and challenged with two scrapie field isolates derived from VRQ-homozygous affected sheep. All inoculated mice developed neurological signs associated with a transmissible spongiform encephalopathy (TSE) disease and accumulated a protease-resistant form of PrP (PrPres) in their brains. The incubation duration appeared to be inversely related to the PrP steady-state level in the brain, irrespective of the transgene construct. The survival time for animals from the line expressing the highest level of PrP was reduced by at least 1 year compared to those of two groups of conventional mice. With one isolate, the duration of incubation was as short as 2 months, which is comparable to that observed for the rodent TSE models with the briefest survival times. No survival time reduction was observed upon subpassaging of either isolate, suggesting no need for adaptation of the agent to its new host. Overexpression of the transgene was found not to be required for transmission to be accelerated compared to that observed with wild-type mice. Conversely, transgenic mice overexpressing murine PrP were found to be less susceptible than tgOv lines expressing ovine PrP at physiological levels. These data argue that ovine PrPVRQ provided a better substrate for sheep prion replication than did mouse PrP. Altogether, these tgOv mice could be an improved model for experimental studies on natural sheep scrapie. PMID:11390599

  1. Effects of exercise on capillaries in the white matter of transgenic AD mice.

    PubMed

    Zhang, Yi; Chao, Feng-Lei; Zhou, Chun-Ni; Jiang, Lin; Zhang, Lei; Chen, Lin-Mu; Luo, Yan-Min; Xiao, Qian; Tang, Yong

    2017-09-12

    Previous studies have shown that exercise can prevent white matter atrophy in APP/PS1 transgenic Alzheimer's disease (AD) mice. However, the mechanism of this protective effect remains unknown. To further understand this issue, we investigated the effects of exercise on the blood supply of white matter in transgenic AD mice. Six-month-old male APP/PS1 mice were randomly divided into a control group and a running group, and age-matched non-transgenic littermates were used as a wild-type control group. Mice in the running group ran on a treadmill at low intensity for four months. Then, spatial learning and memory abilities, white matter and white matter capillaries were examined in all mice. The 10-month-old AD mice exhibited deficits in cognitive function, and 4 months of exercise improved these deficits. The white matter volume and the total length, total volume and total surface area of the white matter capillaries were decreased in the 10-month-old AD mice, and 4 months of exercise dramatically delayed the changes in these parameters in the AD mice. Our results demonstrate that even low-intensity running exercise can improve spatial learning and memory abilities, delay white matter atrophy and protect white matter capillaries in early-stage AD mice. Protecting capillaries might be an important structural basis for the exercise-induced protection of the structural integrity of white matter in AD.

  2. Transcriptional insulation of the human keratin 18 gene in transgenic mice.

    PubMed Central

    Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G

    1993-01-01

    Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and

  3. Infertility in transgenic mice overexpressing the bovine growth hormone gene: luteal failure secondary to prolactin deficiency.

    PubMed

    Cecim, M; Kerr, J; Bartke, A

    1995-05-01

    Overexpression of growth hormone (GH) in transgenic mice is associated with various degrees of impairment of female reproductive functions. Transgenic PEPCK.bGH mice express high GH levels, and only around 20% of the females will carry gestation to Day 7. The objective of the present study was to investigate luteal function in PEPCK.bGH mice during early pregnancy, when CL are fully dependent on the pituitary. Plasma progesterone levels measured on Days 2 or 7 postcoitum (p.c.) were lower in transgenic than in normal females. In transgenic females with a previous history of infertility, daily injections of 1 mg progesterone starting on Day 2 p.c. significantly increased the proportion of animals pregnant on Day 7. When ovaries from transgenic mice were transplanted into ovariectomized normal littermates, the recipients exhibited normal vaginal cycles and responded to mating by vaginal cytology changes consistent with pseudopregnancy. In contrast, ovariectomized transgenic females bearing transplants of ovaries from normal mice had slightly prolonged estrous cycles and failed to become pseudopregnant after mating. Plasma progesterone levels on Days 2 and 7 p.c. in normal females with transgenic ovaries were not different from plasma progesterone levels measured in normal females into which normal ovaries had been transplanted. Twice-daily injections of 100 micrograms of prolactin (PRL) in saline or in polyvinylpyrrolidone starting on the evening of Day 2 p.c. were able to rescue luteal function. The proportion of PRL-injected transgenic animals that were pregnant on Day 7 was significantly higher than that of saline-injected transgenic controls and resembled the pregnancy rate of normal animals.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Some characteristics of neoplastic cell transformation in transgenic mice.

    PubMed

    Shvemberger, I N; Ermilov, A N

    1996-01-01

    The role of the expression of different cellular genes and viral oncogenes in malignant cell transformation is discussed. We pay special attention to the role of the genes for growth factors and their receptors and homeobox genes in oncogenesis. Based on both the literature and our own data, specific features of tumors developed in transgenic mice are discussed. All of these data are used to analyze current theories of multistep oncogenesis and the stochastic component in this process. We suggest that all known evidence about the mechanisms of oncogenesis be used in studying the problem at various structural and functional levels in an organism. The chapter shows that transgenic mice are a most suitable model for studying various aspects of malignant transformation from the molecular to the organismal and populational levels.

  5. Immune Responses of HIV-1 Tat Transgenic Mice to Mycobacterium Tuberculosis W-Beijing SA161

    PubMed Central

    Honda, Jennifer R; Shang, Shaobin; Shanley, Crystal A; Caraway, Megan L; Henao-Tamayo, Marcela; Chan, Edward D; Basaraba, Randall J; Orme, Ian M; Ordway, Diane J; Flores, Sonia C

    2011-01-01

    Background: Mycobacterium tuberculosis remains among the leading causes of death from an infectious agent in the world and exacerbates disease caused by the human immunodeficiency virus (HIV). HIV infected individuals are prone to lung infections by a variety of microbial pathogens, including M. tuberculosis. While the destruction of the adaptive immune response by HIV is well understood, the actual pathogenesis of tuberculosis in co-infected individuals remains unclear. Tat is an HIV protein essential for efficient viral gene transcription, is secreted from infected cells, and is known to influence a variety of host inflammatory responses. We hypothesize Tat contributes to pathophysiological changes in the lung microenvironment, resulting in impaired host immune responses to infection by M. tuberculosis. Results: Herein, we show transgenic mice that express Tat by lung alveolar cells are more susceptible than non-transgenic control littermates to a low-dose aerosol infection of M. tuberculosis W-Beijing SA161. Survival assays demonstrate accelerated mortality rates of the Tat transgenic mice compared to non-transgenics. Tat transgenic mice also showed poorly organized lung granulomata-like lesions. Analysis of the host immune response using quantitative RT-PCR, flow cytometry for surface markers, and intracellular cytokine staining showed increased expression of pro-inflammatory cytokines in the lungs, increased numbers of cells expressing ICAM1, increased numbers of CD4+CD25+Foxp3+ T regulatory cells, and IL-4 producing CD4+ T cells in the Tat transgenics compared to infected non-tg mice. Conclusions: Our data show quantitative differences in the inflammatory response to the SA161 clinical isolate of M. tuberculosis W-Beijing between Tat transgenic and non-transgenic mice, suggesting Tat contributes to the pathogenesis of tuberculosis. PMID:22046211

  6. Transient development of ovotestes in XX Sox9 transgenic mice.

    PubMed

    Gregoire, Elodie P; Lavery, Rowena; Chassot, Anne-Amandine; Akiyama, Haruhiko; Treier, Mathias; Behringer, Richard R; Chaboissier, Marie-Christine

    2011-01-01

    The sex of an individual results from the paternal transmission of the SRY gene located on the Y chromosome. In turn, SRY initiates Sox9 expression, a transcription factor required for testicular differentiation. Ectopic activation of SOX9 in XX Wt1:Sox9 transgenic mice induces female-to-male sex reversal in adult mice. Here we show that complete sex reversal is preceded by a transient phase of ovotestis differentiation with XX Wt1:Sox9 transgenic gonads containing a testicular central region and one or both ovarian poles indicating that Wt1:Sox9 is not as efficient as Sry to induce male development. In XX Wt1:Sox9(Tg/+) gonads, transgenic Sox9 is expressed earlier than Sox9 in XY gonads and is able to induce the expression of EGFP, knocked into the 3' UTR of Sox9 indicating that SOX9 is involved in the initiation and maintenance of its own expression. However, the delayed onset of expression of endogenous Sox9-EGFP suggests that this activation requires other factors, whose expression depends on SOX9. In the testicular regions of the XX Wt1:Sox9 ovotestes, proliferation of the XX fetal germ cells is hampered and they differentiate as pro-spermatogonia. This indicates that XX germ cells are not competent to respond to proliferative signals released from a testicular environment. In the ovarian regions, despite the continuous mRNA expression of the WT1:Sox9 transgene, the SOX9 protein does not accumulate suggesting that regulation of this gene in ovarian cells involves post-transcriptional mechanisms. Finally, ovarian cells of the XX Wt1:Sox9 ovotestis undergo apoptosis during late embryogenesis leading to complete female-to-male sex reversal of the transgenic mice at birth. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Transient development of ovotestes in XX Sox9 transgenic mice

    PubMed Central

    Gregoire, Elodie P.; Lavery, Rowena; Chassot, Anne-Amandine; Akiyama, Haruhiko; Treier, Mathias; Behringer, Richard R.; Chaboissier, Marie-Christine

    2010-01-01

    The sex of an individual results from the paternal transmission of the SRY gene located on the Y chromosome. In turn, SRY initiates Sox9 expression, a transcription factor required for testicular differentiation. Ectopic activation of SOX9 in XX Wt1:Sox9 transgenic mice, induces female-to-male sex reversal in adult mice. Here we show that complete sex reversal is preceded by a transient phase of ovotestis differentiation with XX Wt1:Sox9 transgenic gonads containing a testicular central region and one or both ovarian poles indicating that Wt1:Sox9 is not as efficient as Sry to induce male development. In XX Wt1:Sox9Tg/+ gonads, transgenic Sox9 is expressed earlier than Sox9 in XY gonads, and is able to induce the expression of EGFP, knocked into the 3′ UTR of Sox9 indicating that SOX9 is involved in the initiation and maintenance of its own expression. However, the delayed onset of expression of endogenous Sox9-EGFP suggests that this activation requires other factors, whose expression depends on SOX9. In the testicular regions of the XX Wt1:Sox9 ovotestes, proliferation of the XX foetal germ cells is hampered and they differentiate as pro-spermatogonia. This indicates that XX germ cells are not competent to respond to proliferative signals released from a testicular environment. In the ovarian regions, despite the continuous mRNA expression of the WT1:Sox9 transgene, the SOX9 protein does not accumulate suggesting that regulation of this gene in ovarian cells involves post-transcriptional mechanisms. Finally, ovarian cells of the XX Wt1:Sox9 ovotestis undergo apoptosis during late embryogenesis leading to complete female-to-male sex reversal of the transgenic mice at birth. PMID:20965161

  8. Ablation of the Locus Coeruleus Increases Oxidative Stress in Tg-2576 Transgenic but Not Wild-Type Mice

    PubMed Central

    Hurko, Orest; Boudonck, Kurt; Gonzales, Cathleen; Hughes, Zoe A.; Jacobsen, J. Steve; Reinhart, Peter H.; Crowther, Daniel

    2010-01-01

    Mice transgenic for production of excessive or mutant forms of beta-amyloid differ from patients with Alzheimer's disease in the degree of inflammation, oxidative damage, and alteration of intermediary metabolism, as well as the paucity or absence of neuronal atrophy and cognitive impairment. Previous observers have suggested that differences in inflammatory response reflect a discrepancy in the state of the locus coeruleus (LC), loss of which is an early change in Alzheimer's disease but which is preserved in the transgenic mice. In this paper, we extend these observations by examining the effects of the LC on markers of oxidative stress and intermediary metabolism. We compare four groups: wild-type or Tg2576 Aβ transgenic mice injected with DSP4 or vehicle. Of greatest interest were metabolites different between ablated and intact transgenics, but not between ablated and intact wild-type animals. The Tg2576_DSP4 mice were distinguished from the other three groups by oxidative stress and altered energy metabolism. These observations provide further support for the hypothesis that Tg2576 Aβ transgenic mice with this ablation may be a more congruent model of Alzheimer's disease than are transgenics with an intact LC. PMID:20981353

  9. [Premature immunosenescence in triple-transgenic mice for Alzheimer's disease].

    PubMed

    Mate, Ianire; Cruces, Julia; Vida, Carmen; Sanfeliu, Coral; Manassra, Rashed; Giménez-Llort, Lydia; De la Fuente, Mónica

    2014-01-01

    A deterioration of the neuroimmunoendocrine network has been observed in Alzheimer's disease (AD). However, the peripheral immune response has hardly been investigated in this pathology. Since some immune function parameters have been established as good markers of the rate of ageing, and can predict longevity, the aim of the present work was to study some of these functions in splenic leucocytes in transgenic mice for AD of different ages. Young female (4 ± 1 months), adult (9 ± 1 months), and mature (12 ± 1 months) triple-transgenic mice for AD (3 xTgAD) and non-transgenic (NTg) control mice of the same ages were used. The chemotaxis, the anti-tumour activity of « natural killer » (NK) cells and the lymphoproliferative response in the presence of the mitogens concanavalin A and lipopolysaccharide, functions that decrease with age, were determined in splenic leucocytes. In addition, the differences in lifespan between 3 xTgAD and NTg were studied in parallel using other animals, until their death through natural causes. In 3 xTgAD, with respect to NTg, chemotaxis decreased at all ages studied, whereas in lymphoproliferative response this reduction was shown at 4 months and 9 months. NK activity was diminished only in young 3 xTgAD with respect to NTg. The 3 xTgAD showed a shorter lifespan than the NTg control group. The 3 xTgAD mice show a premature immunosenescence, which could explain their early mortality. The determination of these immune functions at peripheral level could serve as a marker of the progression of the Alzheimer's disease. Copyright © 2013 SEGG. Published by Elsevier Espana. All rights reserved.

  10. Chimeric elk/mouse prion proteins in transgenic mice.

    PubMed

    Tamgüney, Gültekin; Giles, Kurt; Oehler, Abby; Johnson, Natrina L; DeArmond, Stephen J; Prusiner, Stanley B

    2013-02-01

    Chronic wasting disease (CWD) of deer and elk is a highly communicable neurodegenerative disorder caused by prions. Investigations of CWD are hampered by slow bioassays in transgenic (Tg) mice. Towards the development of Tg mice that will be more susceptible to CWD prions, we created a series of chimeric elk/mouse transgenes that encode the N terminus of elk PrP (ElkPrP) up to residue Y168 and the C terminus of mouse PrP (MoPrP) beyond residue 169 (mouse numbering), designated Elk3M(SNIVVK). Between codons 169 and 219, six residues distinguish ElkPrP from MoPrP: N169S, T173N, V183I, I202V, I214V and R219K. Using chimeric elk/mouse PrP constructs, we generated 12 Tg mouse lines and determined incubation times after intracerebral inoculation with the mouse-passaged RML scrapie or Elk1P CWD prions. Unexpectedly, one Tg mouse line expressing Elk3M(SNIVVK) exhibited incubation times of <70 days when inoculated with RML prions; a second line had incubation times of <90 days. In contrast, mice expressing full-length ElkPrP had incubation periods of >250 days for RML prions. Tg(Elk3M,SNIVVK) mice were less susceptible to CWD prions than Tg(ElkPrP) mice. Changing three C-terminal mouse residues (202, 214 and 219) to those of elk doubled the incubation time for mouse RML prions and rendered the mice resistant to Elk1P CWD prions. Mutating an additional two residues from mouse to elk at codons 169 and 173 increased the incubation times for mouse prions to >300 days, but made the mice susceptible to CWD prions. Our findings highlight the role of C-terminal residues in PrP that control the susceptibility and replication of prions.

  11. Transgenic nude mice ubiquitously expressing fluorescent proteins for color-coded imaging of the tumor microenvironment.

    PubMed

    Hoffman, Robert M

    2014-01-01

    We have developed a transgenic green fluorescent protein (GFP) nude mouse with ubiquitous GFP expression. The GFP nude mouse was obtained by crossing nontransgenic nude mice with the transgenic C57/B6 mouse in which the β-actin promoter drives GFP expression in essentially all tissues. In the adult mice, many organs brightly expressed GFP, including the spleen, heart, lungs, spleen, pancreas, esophagus, stomach, and duodenum as well as the circulatory system. The liver expressed GFP at a lesser level. The red fluorescent protein (RFP) transgenic nude mouse was obtained by crossing non-transgenic nude mice with the transgenic C57/B6 mouse in which the beta-actin promoter drives RFP (DsRed2) expression in essentially all tissues. In the RFP nude mouse, the organs all brightly expressed RFP, including the heart, lungs, spleen, pancreas, esophagus, stomach, liver, duodenum, the male and female reproductive systems; brain and spinal cord; and the circulatory system, including the heart, and major arteries and veins. The skinned skeleton highly expressed RFP. The bone marrow and spleen cells were also RFP positive. The cyan fluorescent protein (CFP) nude mouse was developed by crossing nontransgenic nude mice with the transgenic CK/ECFP mouse in which the β-actin promoter drives expression of CFP in almost all tissues. In the CFP nude mice, the pancreas and reproductive organs displayed the strongest fluorescence signals of all internal organs, which vary in intensity. The GFP, RFP, and CFP nude mice when transplanted with cancer cells of another color are powerful models for color-coded imaging of the tumor microenvironment (TME) at the cellular level.

  12. Anesthetic Sevoflurane Causes Neurotoxicity Differently in Neonatal Naïve and Alzheimer's Disease Transgenic Mice

    PubMed Central

    Lu, Yan; Wu, Xu; Dong, Yuanlin; Xu, Zhipeng; Zhang, Yiying; Xie, Zhongcong

    2010-01-01

    Background Recent studies have suggested that children having surgery under anesthesia could be at an increased risk for the development of learning disabilities, but whether anesthetics contribute to this learning disability is unclear. We therefore set out to assess effects of sevoflurane, the most commonly used inhalation anesthetic, on caspase activation, apoptosis, β-amyloid protein levels, and neuroinflammation in brain tissues of neonatal naïve and Alzheimer's disease (AD) transgenic mice. Methods Six-day-old naïve and AD transgenic [B6.Cg-Tg(amyloid precursor protein swe, PSEN1dE9)85Dbo/J] mice were treated with sevoflurane. The mice were euthanized at the end of the anesthesia and brain tissues were harvested, and were then subjected to Western blot, immunocytochemistry, ELISA and real-time polymerase chain reaction. Results Here we show for the first time that sevoflurane anesthesia induced caspase activation and apoptosis, altered amyloid precursor protein processing, and increased β-amyloid protein levels in the brain tissues of the neonatal mice. Furthermore, the sevoflurane anesthesia led to a greater degree of neurotoxicity in the brain tissues of the AD transgenic mice as compared to the naïve mice, and increased tumor necrosis factor-α levels only in the brain tissues of the AD transgenic mice. Finally, inositol 1,4,5-trisphosphate receptor antagonist 2-APB attenuated the sevoflurane-induced caspase-3 activation and β-amyloid protein accumulation in vivo. Conclusion These results suggest that sevoflurane may induce the neurotoxicity in neonatal mice. AD transgenic mice could be more venerable to such neurotoxicity. These findings should promote more studies to determine the potential neurotoxicity of anesthesia in animals and humans, especially in children. PMID:20460993

  13. Multiple effects of genetic background on variegated transgene expression in mice.

    PubMed Central

    Opsahl, Margaret L; McClenaghan, Margaret; Springbett, Anthea; Reid, Sarah; Lathe, Richard; Colman, Alan; Whitelaw, C Bruce A

    2002-01-01

    BLG/7 transgenic mice express an ovine beta-lactoglobulin transgene during lactation. Unusually, transgene expression levels in milk differ between siblings. This variable expression is due to variegated transgene expression in the mammary gland and is reminiscent of position-effect variegation. The BLG/7 line was created and maintained on a mixed CBA x C57BL/6 background. We have investigated the effect on transgene expression of backcrossing for 13 generations into these backgrounds. Variable transgene expression was observed in all populations examined, confirming that it is an inherent property of the transgene array at its site of integration. There were also strain-specific effects on transgene expression that appear to be independent of the inherent variegation. The transgene, compared to endogenous milk protein genes, is specifically susceptible to inbreeding depression. Outcrossing restored transgene expression levels to that of the parental population; thus suppression was not inherited. Finally, no generation-dependent decrease in mean expression levels was observed in the parental population. Thus, although the BLG/7 transgene is expressed in a variegated manner, there was no generation-associated accumulated silencing of transgene expression. PMID:11901126

  14. Multiple effects of genetic background on variegated transgene expression in mice.

    PubMed

    Opsahl, Margaret L; McClenaghan, Margaret; Springbett, Anthea; Reid, Sarah; Lathe, Richard; Colman, Alan; Whitelaw, C Bruce A

    2002-03-01

    BLG/7 transgenic mice express an ovine beta-lactoglobulin transgene during lactation. Unusually, transgene expression levels in milk differ between siblings. This variable expression is due to variegated transgene expression in the mammary gland and is reminiscent of position-effect variegation. The BLG/7 line was created and maintained on a mixed CBA x C57BL/6 background. We have investigated the effect on transgene expression of backcrossing for 13 generations into these backgrounds. Variable transgene expression was observed in all populations examined, confirming that it is an inherent property of the transgene array at its site of integration. There were also strain-specific effects on transgene expression that appear to be independent of the inherent variegation. The transgene, compared to endogenous milk protein genes, is specifically susceptible to inbreeding depression. Outcrossing restored transgene expression levels to that of the parental population; thus suppression was not inherited. Finally, no generation-dependent decrease in mean expression levels was observed in the parental population. Thus, although the BLG/7 transgene is expressed in a variegated manner, there was no generation-associated accumulated silencing of transgene expression.

  15. Misregulated progesterone secretion and impaired pregnancy in Cyp11a1 transgenic mice.

    PubMed

    Chien, Yu; Cheng, Wei-Cheng; Wu, Menq-Rong; Jiang, Si-Tse; Shen, Che-Kun James; Chung, Bon-chu

    2013-10-01

    Normal pregnancy is supported by increased levels of progesterone (P4), which is secreted from ovarian luteal cells via enzymatic steps catalyzed by P450scc (CYP11A1) and HSD3B. The development and maintenance of corpora lutea during pregnancy, however, are less well understood. Here we used Cyp11a1 transgenic mice to delineate the steps of luteal cell differentiation during pregnancy. Cyp11a1 in a bacterial artificial chromosome was injected into mouse embryos to generate transgenic mice with transgene expression that recapitulated endogenous Cyp11a1 expression. Cyp11a1 transgenic females displayed reduced pregnancy rate, impaired implantation and placentation, and decreased litter size in utero, although they produced comparable numbers of blastocysts. The differentiation of transgenic luteal cells was delayed during early pregnancy as shown by the delayed activation of genes involved in steroidogenesis and cholesterol availability. Luteal cell mitochondria were elongated, and their numbers were reduced, with morphology and numbers similar to those observed in granulosa cells. Transgenic luteal cells accumulated lipid droplets and secreted less progesterone during early pregnancy. The progesterone level returned to normal on gestation day 9 but was not properly withdrawn at term, leading to delayed stillbirth. P4 supplementation rescued the implantation rates but not the ovarian defects. Thus, overexpression of Cyp11a1 disrupts normal development of the corpus luteum, leading to progesterone insufficiency during early pregnancy. Misregulation of the progesterone production in Cyp11a1 transgenic mice during pregnancy resulted in aberrant implantation, anomalous placentation, and delayed parturition.

  16. Enhanced motivation to alcohol in transgenic mice expressing human α-synuclein.

    PubMed

    Rotermund, Carola; Reolon, Gustavo K; Leixner, Sarah; Boden, Cindy; Bilbao, Ainhoa; Kahle, Philipp J

    2017-11-01

    α-Synuclein (αSYN) is the neuropathological hallmark protein of Parkinson's disease (PD) and related neurodegenerative disorders. Moreover, the gene encoding αSYN (SNCA) is a major genetic contributor to PD. Interestingly, independent genome-wide association studies also identified SNCA as the most important candidate gene for alcoholism. Furthermore, single-nucleotide-polymorphisms have been associated with alcohol-craving behavior and alcohol-craving patients showed augmented αSYN expression in blood. To investigate the effect of αSYN on the addictive properties of chronic alcohol use, we examined consumption, motivation, and seeking responses induced by environmental stimuli and relapse behavior in transgenic mice expressing the human mutant [A30P]αSYN throughout the brain. The primary reinforcing effects of alcohol under operant self-administration conditions were increased, while consumption and the alcohol deprivation effect were not altered in the transgenic mice. The same mice were subjected to immunohistochemical measurements of immediate-early gene inductions in brain regions involved in addiction-related behaviors. Acute ethanol injection enhanced immunostaining for the phosphorylated form of cAMP response element binding protein in both amygdala and nucleus accumbens of αSYN transgenic mice, while in wild-type mice no effect was visible. However, at the same time, levels of cFos remain unchanged in both genotypes. These results provide experimental confirmation of SNCA as a candidate gene for alcoholism in addition to its known link to PD. © 2017 International Society for Neurochemistry.

  17. Effects of exercise on capillaries in the white matter of transgenic AD mice

    PubMed Central

    Zhang, Yi; Chao, Feng-Lei; Zhou, Chun-Ni; Jiang, Lin; Zhang, Lei; Chen, Lin-Mu; Luo, Yan-Min; Xiao, Qian; Tang, Yong

    2017-01-01

    Previous studies have shown that exercise can prevent white matter atrophy in APP/PS1 transgenic Alzheimer’s disease (AD) mice. However, the mechanism of this protective effect remains unknown. To further understand this issue, we investigated the effects of exercise on the blood supply of white matter in transgenic AD mice. Six-month-old male APP/PS1 mice were randomly divided into a control group and a running group, and age-matched non-transgenic littermates were used as a wild-type control group. Mice in the running group ran on a treadmill at low intensity for four months. Then, spatial learning and memory abilities, white matter and white matter capillaries were examined in all mice. The 10-month-old AD mice exhibited deficits in cognitive function, and 4 months of exercise improved these deficits. The white matter volume and the total length, total volume and total surface area of the white matter capillaries were decreased in the 10-month-old AD mice, and 4 months of exercise dramatically delayed the changes in these parameters in the AD mice. Our results demonstrate that even low-intensity running exercise can improve spatial learning and memory abilities, delay white matter atrophy and protect white matter capillaries in early-stage AD mice. Protecting capillaries might be an important structural basis for the exercise-induced protection of the structural integrity of white matter in AD. PMID:29029478

  18. Caudal dysgenesis in islet-1 transgenic mice

    PubMed Central

    Muller, Yunhua Li; Yueh, Yir Gloria; Yaworsky, Paul J.; Salbaum, J. Michael; Kappen, Claudia

    2014-01-01

    Maternal diabetes during pregnancy is responsible for the occurrence of diabetic embryopathy, a spectrum of birth defects that includes heart abnormalities, neural tube defects, and caudal dysgenesis syndromes. Here, we report that mice transgenic for the homeodomain transcription factor Isl-1 develop profound caudal growth defects that resemble human sacral/caudal agenesis. Isl-1 is normally expressed in the pancreas and is required for pancreas development and endocrine cell differentiation. Aberrant regulation of this pancreatic transcription factor causes increased mesodermal cell death, and the severity of defects is dependent on transgene dosage. Together with the finding that mutation of the pancreatic transcription factor HLXB9 causes sacral agenesis, our results implicate pancreatic transcription factors in the pathogenesis of birth defects associated with diabetes. PMID:12738808

  19. Thrombospondin-2 overexpression in the skin of transgenic mice reduces the susceptibility to chemically induced multistep skin carcinogenesis.

    PubMed

    Kunstfeld, Rainer; Hawighorst, Thomas; Streit, Michael; Hong, Young-Kwon; Nguyen, Lynh; Brown, Lawrence F; Detmar, Michael

    2014-05-01

    We have previously reported stromal upregulation of the endogenous angiogenesis inhibitor thrombospondin-2 (TSP-2) during multistep carcinogenesis, and we found accelerated and enhanced skin angiogenesis and carcinogenesis in TSP-2 deficient mice. To investigate whether enhanced levels of TSP-2 might protect from skin cancer development. We established transgenic mice with targeted overexpression of TSP-2 in the skin and subjected hemizygous TSP-2 transgenic mice and their wild-type littermates to a chemical skin carcinogenesis regimen. TSP-2 transgenic mice showed a significantly delayed onset of tumor formation compared to wild-type mice, whereas the ratio of malignant conversion to squamous cell carcinomas was comparable in both genotypes. Computer-assisted morphometric analysis of blood vessels revealed pronounced tumor angiogenesis already in the early stages of carcinogenesis in wild type mice. TSP-2 overexpression significantly reduced tumor blood vessel density in transgenic mice but had no overt effect on LYVE-1 positive lymphatic vessels. The percentage of desmin surrounded, mature tumor-associated blood vessels and the degree of epithelial differentiation remained unaffected. The antiangiogenic effect of transgenic TSP-2 was accompanied by a significantly increased number of apoptotic tumor cells in transgenic mice. Our results demonstrate that enhanced levels of TSP-2 in the skin result in reduced susceptibility to chemically-induced skin carcinogenesis and identify TSP-2 as a new target for the prevention of skin cancer. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  20. Trichostatin A suppresses lung adenocarcinoma development in Grg1 overexpressing transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ju, E-mail: ju.liu@sdu.edu.cn; Molecular and Cellular Biology Division, Sunnybrook Health Science Centre, University of Toronto, 2075 Bayview Avenue, Toronto, Ontario M4N 3M5; Li, Yan

    Trichostatin A (TSA) is a histone deacetylase inhibitor and a potential therapeutic for various malignancies. The in vivo effect of TSA, however, has not been investigated in a transgenic lung cancer model. Previously, we generated transgenic mice with overexpression of Groucho-related-gene 1 (Grg1) and these mice all developed mucinous lung adenocarcinoma. Grg1 is a transcriptional co-repressor protein, the function of which is thought to depend on HDAC activity. However, functions outside the nucleus have also been proposed. We tested the supposition that Grg1-induced tumorigenesis is HDAC-dependent by assaying the therapeutic effect of TSA in the Grg1 transgenic mouse model. We foundmore » that TSA significantly inhibited lung tumorigenesis in Grg1 transgenic mice (p < 0.01). TSA did not affect overall Grg1 protein levels, but instead reduced ErbB1 and ErbB2 expression, which are upregulated by Grg1 in the absence of TSA. We confirmed this effect in A549 cells. Furthermore, lapatinib, an inhibitor of both ErbB1 and ErbB2, effectively masked the effect of TSA on the inhibition of A549 cell proliferation and migration, suggesting TSA does work, at least in part, by downregulating ErbB receptors. We additionally found that TSA reduced the expression of VEGF and VEGFR2, but not basic FGF and FGFR1. Our findings indicate that TSA effectively inhibits Grg1-induced lung tumorigenesis through the down-regulation of ErbB1 and ErbB2, as well as reduced VEGF signaling. This suggests TSA and other HDAC inhibitors could have therapeutic value in the treatment of lung cancers with Grg1 overexpression. - Highlights: • TSA suppresses lung tumorigenesis in Grg1 overexpressing transgenic mice. • TSA does not affect overall Grg1 protein levels in the mice and in A549 cells. • TSA reduces ErbB1 and ErbB2 expression in the mice and in A549 cells. • Lapatinib masks TSA-induced inhibition of A549 cell proliferation and migration. • TSA inhibits VEGF signaling, but not

  1. Expression and biological effects of high levels of serum IgE in epsilon heavy chain transgenic mice.

    PubMed

    Adamczewski, M; Köhler, G; Lamers, M C

    1991-03-01

    We have generated and examined transgenic mice carrying a rearranged immunoglobulin transgene coding for the heavy chain of an IgE antibody. These mice produce the secreted form of the recombinant epsilon heavy chain. Serum IgE levels were increased at least 100-fold over control values. Transgenic epsilon mRNA was detected in spleen and thymus, not in liver and heart. Transgenic epsilon production in vitro was slightly up-regulated by T cells, but not affected by interleukin 4 in vitro or Nippostrongylus infestation in vivo. The B cell and T cell compartments and antigen-specific IgE, IgG1 and IgM responses as well as the increase in endogenous IgE after Nippostrongylus infestation in transgenic mice were normal. These data indicate that the presence of high levels of transgenic IgE did not induce class-specific suppressive mechanisms. Transgenic IgE bound to Fc epsilon receptor type I and Fc epsilon receptor type II and mediated histamine release from mast cells in vitro and an allergic skin reaction in vivo. It inhibited an ovalbumin-specific skin reaction in ovalbumin-immunized transgenic mice only during the initial phases of the immune response. This result has a bearing on the feasibility of immune therapy of allergic diseases with substances that block binding of IgE to its receptors.

  2. Overexpression of IGF-I in skeletal muscle of transgenic mice does not prevent unloading-induced atrophy

    NASA Technical Reports Server (NTRS)

    Criswell, D. S.; Booth, F. W.; DeMayo, F.; Schwartz, R. J.; Gordon, S. E.; Fiorotto, M. L.

    1998-01-01

    This study examined the association between local insulin-like growth factor I (IGF-I) overexpression and atrophy in skeletal muscle. We hypothesized that endogenous skeletal muscle IGF-I mRNA expression would decrease with hindlimb unloading (HU) in mice, and that transgenic mice overexpressing human IGF-I (hIGF-I) specifically in skeletal muscle would exhibit less atrophy after HU. Male transgenic mice and nontransgenic mice from the parent strain (FVB) were divided into four groups (n = 10/group): 1) transgenic, weight-bearing (IGF-I/WB); 2) transgenic, hindlimb unloaded (IGF-I/HU); 3) nontransgenic, weight-bearing (FVB/WB); and 4) nontransgenic, hindlimb unloaded (FVB/HU). HU groups were hindlimb unloaded for 14 days. Body mass was reduced (P < 0.05) after HU in both IGF-I (-9%) and FVB mice (-13%). Contrary to our hypothesis, we found that the relative abundance of mRNA for the endogenous rodent IGF-I (rIGF-I) was unaltered by HU in the gastrocnemius (GAST) muscle of wild-type FVB mice. High-level expression of hIGF-I peptide and mRNA was confirmed in the GAST and tibialis anterior (TA) muscles of the transgenic mice. Nevertheless, masses of the GAST and TA muscles were reduced (P < 0.05) in both FVB/HU and IGF-I/HU groups compared with FVB/WB and IGF-I/WB groups, respectively, and the percent atrophy in mass of these muscles did not differ between FVB and IGF-I mice. Therefore, skeletal muscle atrophy may not be associated with a reduction of endogenous rIGF-I mRNA level in 14-day HU mice. We conclude that high local expression of hIGF-I mRNA and peptide in skeletal muscle alone cannot attenuate unloading-induced atrophy of fast-twitch muscle in mice.

  3. Hyperactivity and Learning Deficits in Transgenic Mice Bearing a Human Mutant Thyroid Hormone β1 Receptor Gene

    PubMed Central

    McDonald, Michael P.; Wong, Rosemary; Goldstein, Gregory; Weintraub, Bruce; Cheng, Sheue-yann; Crawley, Jacqueline N.

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor β (TRβ) gene on chromosome 3, representing a mutation of the ligandbinding domain of the TRβ gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRβ gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRβ gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD. PMID:10454355

  4. Hyperactivity and learning deficits in transgenic mice bearing a human mutant thyroid hormone beta1 receptor gene.

    PubMed

    McDonald, M P; Wong, R; Goldstein, G; Weintraub, B; Cheng, S Y; Crawley, J N

    1998-01-01

    Resistance to thyroid hormone (RTH) is a human syndrome mapped to the thyroid receptor beta (TRbeta) gene on chromosome 3, representing a mutation of the ligand-binding domain of the TRbeta gene. The syndrome is characterized by reduced tissue responsiveness to thyroid hormone and elevated serum levels of thyroid hormones. A common behavioral phenotype associated with RTH is attention deficit hyperactivity disorder (ADHD). To test the hypothesis that RTH produces attention deficits and/or hyperactivity, transgenic mice expressing a mutant TRbeta gene were generated. The present experiment tested RTH transgenic mice from the PV kindred on behavioral tasks relevant to the primary features of ADHD: hyperactivity, sustained attention (vigilance), learning, and impulsivity. Male transgenic mice showed elevated locomotor activity in an open field compared to male wild-type littermate controls. Both male and female transgenic mice exhibited impaired learning of an autoshaping task, compared to wild-type controls. On a vigilance task in an operant chamber, there were no differences between transgenics and controls on the proportion of hits, response latency, or duration of stimulus tolerated. On an operant go/no-go task measuring sustained attention and impulsivity, there were no differences between controls and transgenics. These results indicate that transgenic mice bearing a mutant human TRbeta gene demonstrate several behavioral characteristics of ADHD and may serve a valuable heuristic role in elucidating possible candidate genes in converging pathways for other causes of ADHD.

  5. Expression of Folate Pathway Genes in the Cartilage of Hoxd4 and Hoxc8 Transgenic Mice

    PubMed Central

    Kruger, Claudia; Talmadge, Catherine; Kappen, Claudia

    2014-01-01

    BACKGROUND Hox transcription factors are well known for their role in skeletal patterning in vertebrates. They regulate gene expression during the development of cartilage, the precursor to mature bone. We previously reported that overexpression of the homeobox genes Hoxc8 and Hoxd4 results in severe cartilage defects, reduced proteoglycan content, accumulation of immature chondrocytes, and decreased maturation to hypertrophy. We have also shown that Hoxd4 transgenic mice whose diets were supplemented with folate had their skeletal development restored. Since folate is required for growth and differentiation of chondrocytes, we hypothesized that the beneficial effect of folate in Hoxd4 transgenic mice might indicate a local deficiency in folate utilization, possibly caused by deregulation of genes encoding folate transport proteins or folate metabolic enzymes. METHODS We assayed the prevalence of transcripts for 22 folate transport proteins and metabolizing enzymes, here collectively referred to as folate pathway genes. Quantitative real-time PCR was performed on cDNA samples derived from RNA isolated from primary chondrocytes of individual rib cartilages from Hoxd4 and Hoxc8 transgenic mice, respectively. RESULTS This study shows that the Hox transgenes produce overexpression of Hoxd4 and Hoxc8 in primary chondrocytes from perinatal transgenic mice. However, no differences were found in expression levels of the folate pathway genes in transgenic cells compared to littermate controls. CONCLUSIONS Our results provide evidence that folate pathway genes are only indirect targets of Hox transgene overexpression in our transgenic animals. These expression studies provide a baseline for future studies into the role of folate metabolism in chondrocyte differentiation. PMID:16586448

  6. DNA damage preceding dopamine neuron degeneration in A53T human α-synuclein transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Degui; Yu, Tianyu; Liu, Yongqiang

    Defective DNA repair has been linked with age-associated neurodegenerative disorders. Parkinson's disease (PD) is a progressive neurodegenerative disorder caused by genetic and environmental factors. Whether damages to nuclear DNA contribute to neurodegeneration of PD still remain obscure. in this study we aim to explore whether nuclear DNA damage induce dopamine neuron degeneration in A53T human α-Synuclein over expressed mouse model. We investigated the effects of X-ray irradiation on A53T-α-Syn MEFs and A53T-α-Syn transgene mice. Our results indicate that A53T-α-Syn MEFs show a prolonged DNA damage repair process and senescense phenotype. DNA damage preceded onset of motor phenotype in A53T-α-Syn transgenicmore » mice and decrease the number of nigrostriatal dopaminergic neurons. Neurons of A53T-α-Syn transgenic mice are more fragile to DNA damages. - Highlights: • This study explore contribution of DNA damage to neurodegeneration in Parkinson's disease mice. • A53T-α-Syn MEF cells show a prolonged DNA damage repair process and senescense phenotype. • DNA damage preceded onset of motor phenotype in A53T-α-Syn transgenic mice. • DNA damage decrease the number of nigrostriatal dopaminergic neurons. • Neurons of A53T-α-Syn transgenic mice are more fragile to DNA damages.« less

  7. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    NASA Technical Reports Server (NTRS)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  8. Ocular myasthenia gravis induced by human acetylcholine receptor ϵ subunit immunization in HLA DR3 transgenic mice.

    PubMed

    Wu, Xiaorong; Tuzun, Erdem; Saini, Shamsher S; Wang, Jun; Li, Jing; Aguilera-Aguirre, Leopoldo; Huda, Ruksana; Christadoss, Premkumar

    2015-12-01

    Extraocular muscles (EOM) are preferentially involved in myasthenia gravis (MG) and acetylcholine receptor (AChR) antibody positive MG patients may occasionally present with isolated ocular symptoms. Although experimental autoimmune myasthenia gravis (EAMG) induced by whole AChR immunization closely mimics clinical and immunopathological aspects of MG, EOM are usually not affected. We have previously developed an EAMG model, which imitates EOM symptoms of MG by immunization of human leukocyte antigen (HLA) transgenic mice with α or γ-subunits of human AChR (H-AChR). To investigate the significance of the ϵ-subunit in ocular MG, we immunized HLA-DR3 and HLA-DQ8 transgenic mice with recombinant H-AChR ϵ-subunit expressed in Escherichia coli. HLA-DR3 transgenic mice showed significantly higher clinical ocular and generalized MG severity scores and lower grip strength values than HLA-DQ8 mice. H-AChR ϵ-subunit-immunized HLA-DR3 transgenic mice had higher serum anti-AChR antibody (IgG, IgG1, IgG2b, IgG2c and IgM) levels, neuromuscular junction IgG and complement deposit percentages than ϵ-subunit-immunized HLA-DQ8 transgenic mice. Control mice immunized with E. coli extract or complete Freund adjuvant (CFA) did not show clinical and immunopathological features of ocular and generalized EAMG. Lymph node cells of ϵ-subunit-immunized HLA-DR3 mice showed significantly higher proliferative responses than those of ϵ-subunit-immunized HLA-DQ8 mice, crude E. coli extract-immunized and CFA-immunized transgenic mice. Our results indicate that the human AChR ϵ-subunit is capable of inducing myasthenic muscle weakness. Diversity of the autoimmune responses displayed by mice expressing different HLA class II molecules suggests that the interplay between HLA class II alleles and AChR subunits might have a profound impact on the clinical course of MG. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  9. Antiviral effects of Stichopus japonicus acid mucopolysaccharide on hepatitis B virus transgenic mice

    NASA Astrophysics Data System (ADS)

    Xin, Yongning; Li, Wei; Lu, Linlin; Zhou, Li; Victor, David W.; Xuan, Shiying

    2016-08-01

    Hepatitis B virus (HBV) is a significant global pathogen and efficient cure for HBV patients is still a challenging goal. We previously reported that acidic mucopolysaccharide from stichopus japonicus selenka (SJAMP) could inhibit HBsAg and HBeAg expression in vitro. However, the potential anti-HBV effects of SJAMP in vivo have not yet been explored. In this study, we show that SJAMP exhibits potent anti-HBV activity in HBV transgenic mice in a dose-dependent manner. Specifically, sixty HBV transgenic male BALB/c mice were randomly selected to receive the treatment of PBS, low dose SJAMP (30 mg kg-1), middle dose SJAMP (40 mg kg-1), high dose SJAMP (50 mg kg-1) and IFN (45 IU kg-1) for 30 d. SJAMP treatment suppressed serum HBV-DNA, and liver HBsAg and HBcAg levels in HBV-transgenic mice. The present study highlights the potential application of SJAMP in HBV therapy.

  10. YAC cloning Mus musculus telomeric DNA: physical, genetic, in situ and STS markers for the distal telomere of chromosome 10.

    PubMed

    Kipling, D; Wilson, H E; Thomson, E J; Cooke, H J

    1995-06-01

    Three Mus musculus DBA/2 YAC libraries were constructed using a half-YAC telomere cloning vector. This functional complementation approach yields libraries which include terminal restriction fragments of the mouse genome. Screening all three libraries led to the isolation of 32 independent clones which carry linear YACs containing the mouse terminal repeat sequence, (TTAGGG)n. These YACs provide a resource to isolate regions of the mouse genome close to chromosome termini and excluded from existing conventional YAC libraries. To demonstrate their utility, a hybridization probe was isolated from Mtel-1, the first (TTAGGG)n-containing YAC isolated. This probe detects a approximately 70 kb Kpnl fragment in the mouse genome which is sensitive to pretreatment with BAL31 exonuclease. A PCR-based genetic marker generated from the sequence of this probe maps 4.4 cM from the most distal anchor locus on chromosome 10 in the EUCIB interspecific backcross. STS primers for this locus, D10Hgu1, were used to isolate YAC 110F4 from a commercially available mouse YAC library. Fluorescence in situ hybridization demonstrates that YAC 110F4 hybridizes to the distal telomere of chromosome 10. Clones in this collection of telomere YACs therefore partially overlap clones in conventional YAC libraries, and thus the previously unavailable terminal regions of the mouse genome can now be linked with the developing mouse STS YAC contig. Genetic markers such as D10Hgu1 allow the ends of the mouse genetic map to be defined, thus closing the map.

  11. Effect of Hypertriglyceridemia on Beta Cell Mass and Function in ApoC3 Transgenic Mice*

    PubMed Central

    Liu, Yun-Zi; Cheng, Xiaoyun; Zhang, Ting; Lee, Sojin; Yamauchi, Jun; Xiao, Xiangwei; Gittes, George; Qu, Shen; Jiang, Chun-Lei; Dong, H. Henry

    2016-01-01

    Hypertriglyceridemia results from increased production and decreased clearance of triglyceride-rich very low-density lipoproteins, a pathological condition that accounts for heightened risk of ischemic vascular diseases in obesity and type 2 diabetes. Despite its intimate association with insulin resistance, whether hypertriglyceridemia constitutes an independent risk for beta cell dysfunction in diabetes is unknown. Answering this fundamental question is stymied by the fact that hypertriglyceridemia is intertwined with hyperglycemia and insulin resistance in obese and diabetic subjects. To circumvent this limitation, we took advantage of apolipoprotein C3 (ApoC3)-transgenic mice, a model with genetic predisposition to hypertriglyceridemia. We showed that ApoC3-transgenic mice, as opposed to age/sex-matched wild-type littermates, develop hypertriglyceridemia with concomitant elevations in plasma cholesterol and non-esterified fatty acid levels. Anti-insulin and anti-glucagon dual immunohistochemistry in combination with morphometric analysis revealed that ApoC3-transgenic and wild-type littermates had similar beta cell and alpha cell masses as well as islet size and architecture. These effects correlated with similar amplitudes of glucose-stimulated insulin secretion and similar degrees of postprandial glucose excursion in ApoC3-transgenic versus wild-type littermates. Oil Red O histology did not visualize lipid infiltration into islets, correlating with the lack of ectopic triglyceride and cholesterol depositions in the pancreata of ApoC3-transgenic versus wild-type littermates. ApoC3-transgenic mice, despite persistent hypertriglyceridemia, maintained euglycemia under both fed and fasting conditions without manifestation of insulin resistance and fasting hyperinsulinemia. Thus, hypertriglyceridemia per se is not an independent risk factor for beta cell dysfunction in ApoC3 transgenic mice. PMID:27226540

  12. Protection against vascular leak in neprilysin transgenic mice with complex overexpression pattern.

    PubMed

    Wick, Marilee J; Loomis, Zoe L; Harral, Julie W; Le, Mysan; Wehling, Carol A; Miller, York E; Dempsey, Edward C

    2016-12-01

    Neprilysin (NEP) is a cell surface metallopeptidase found in many tissues. Based mostly on pharmacological manipulations, NEP has been thought to protect blood vessels from plasma extravasation. We have suggested that NEP may protect against pulmonary vascular injury. However, these prior studies did not utilize mice which overexpress NEP. The aims of the present investigation were to develop and characterize doubly transgenic (DT) mice that overexpress NEP universally and conditionally, and to investigate the protective effect that overexpressed NEP may have against plasma extravasation in the vasculature. The duodenum, which is often used to assess vascular permeability, and in which the NEP protein was overexpressed in our DT mice two-fold, was selected as our experimental preparation. We found that substance P-induced plasma extravasation was decreased substantially (3.5-fold) in the duodenums of our doxycycline-treated DT mice, giving independent evidence of NEP's protective effects against plasma extravasation. Transgenic lung NEP protein was not stably expressed in the DT mice, so we were not able to test the effect of NEP overexpression in the lung. Although initially overexpressed nearly nine-fold at that site, pulmonary NEP protein overexpression eventually dissipated. Surprisingly, at a time when there was no lung transgenic NEP protein overexpression, lung NEP mRNA expression was still increased 23-fold, indicating that the expression defect probably is not transcriptional. These studies help to characterize our complex transgenic model of NEP overexpression and further demonstrate NEP's protective effects against plasma extravasation.

  13. Epidermal Expression of Intercellular Adhesion Molecule 1 is Not a Primary Inducer of Cutaneous Inflammation in Transgenic Mice

    NASA Astrophysics Data System (ADS)

    Williams, Ifor R.; Kupper, Thomas S.

    1994-10-01

    Keratinocytes at sites of cutaneous inflammation have increased expression of intercellular adhesion molecule 1 (ICAM-1), a cytokine-inducible adhesion molecule which binds the leukocyte integrins LFA-1 and Mac-1. Transgenic mice were prepared in which the expression of mouse ICAM-1 was targeted to basal keratinocytes by using the human K14 keratin promoter. The level of constitutive expression attained in the transgenic mice exceeded the peak level of ICAM-1 expression induced on nontransgenic mouse keratinocytes in vitro by optimal combinations of interferon γ and tumor necrosis factor α or in vivo by proinflammatory stimuli such as phorbol 12-myristate 13-acetate. In vitro adhesion assays demonstrated that cultured transgenic keratinocytes were superior to normal keratinocytes as a substrate for the LFA-1-dependent binding of mouse T cells, confirming that the transgene-encoded ICAM-1 was expressed in a functional form. However, the high level of constitutive ICAM-1 expression achieved on keratinocytes in vivo in these transgenic mice did not result in additional recruitment of CD45^+ leukocytes into transgenic epidermis, nor did it elicit dermal inflammation. Keratinocyte ICAM-1 expression also did not potentiate contact-hypersensitivity reactions to epicutaneous application of haptens. The absence of a spontaneous phenotype in these transgenic mice was not the result of increased levels of soluble ICAM-1, since serum levels of soluble ICAM-1 were equal in transgenic mice and controls. We conclude that elevated ICAM-1 expression on keratinocytes cannot act independently to influence leukocyte trafficking and elicit cutaneous inflammation.

  14. Selenoprotein-deficient transgenic mice exhibit enhanced exercise-induced muscle growth.

    PubMed

    Hornberger, Troy A; McLoughlin, Thomas J; Leszczynski, Jori K; Armstrong, Dustin D; Jameson, Ruth R; Bowen, Phyllis E; Hwang, Eun-Sun; Hou, Honglin; Moustafa, Mohamed E; Carlson, Bradley A; Hatfield, Dolph L; Diamond, Alan M; Esser, Karyn A

    2003-10-01

    Dietary intake of selenium has been implicated in a wide range of health issues, including aging, heart disease and cancer. Selenium deficiency, which can reduce selenoprotein levels, has been associated with several striated muscle pathologies. To investigate the role of selenoproteins in skeletal muscle biology, we used a transgenic mouse (referred to as i6A-) that has reduced levels of selenoproteins due to the introduction and expression of a dominantly acting mutant form of selenocysteine transfer RNA (tRNA[Ser]Sec). As a consequence, each organ contains reduced levels of most selenoproteins, yet these mice are normal with regard to fertility, overall health, behavior and blood chemistries. In the present study, although skeletal muscles from i6A- mice were phenotypically indistinguishable from those of wild-type mice, plantaris muscles were approximately 50% heavier after synergist ablation, a model of exercise overload. Like muscle in wild-type mice, the enhanced growth in the i6A- mice was completely blocked by inhibition of the mammalian target of rapamycin (mTOR) pathway. Muscles of transgenic mice exhibited increased site-specific phosphorylation on both Akt and p70 ribosomal S6 kinase (p70S6k) (P < 0.05) before ablation, perhaps accounting for the enhanced response to synergist ablation. Thus, a single genetic alteration resulted in enhanced skeletal muscle adaptation after exercise, and this is likely through subtle changes in the resting phosphorylation state of growth-related kinases.

  15. Cosmetics-triggered percutaneous remote control of transgene expression in mice

    PubMed Central

    Wang, Hui; Ye, Haifeng; Xie, Mingqi; Daoud El-Baba, Marie; Fussenegger, Martin

    2015-01-01

    Synthetic biology has significantly advanced the rational design of trigger-inducible gene switches that program cellular behavior in a reliable and predictable manner. Capitalizing on genetic componentry, including the repressor PmeR and its cognate operator OPmeR, that has evolved in Pseudomonas syringae pathovar tomato DC3000 to sense and resist plant-defence metabolites of the paraben class, we have designed a set of inducible and repressible mammalian transcription-control devices that could dose-dependently fine-tune transgene expression in mammalian cells and mice in response to paraben derivatives. With an over 60-years track record as licensed preservatives in the cosmetics industry, paraben derivatives have become a commonplace ingredient of most skin-care products including shower gels, cleansing toners and hand creams. As parabens can rapidly reach the bloodstream of mice following topical application, we used this feature to percutaneously program transgene expression of subcutaneous designer cell implants using off-the-shelf commercial paraben-containing skin-care cosmetics. The combination of non-invasive, transdermal and orthogonal trigger-inducible remote control of transgene expression may provide novel opportunities for dynamic interventions in future gene and cell-based therapies. PMID:25943548

  16. Podocyte changes upon induction of albuminuria in Thy-1.1 transgenic mice.

    PubMed

    Smeets, Bart; Dijkman, Henry B P M; te Loeke, Nathalie A J M; van Son, Jacco P H F; Steenbergen, Eric J; Assmann, Karel J M; Wetzels, Jack F M; Groenen, Patricia J T A

    2003-12-01

    Thy-1.1 transgenic mice, characterized by ectopic expression of the Thy-1.1 protein on podocytes, spontaneously develop proteinuria and focal glomerulosclerosis (FGS). Injection of a monoclonal antibody (mAb) directed against the Thy-1.1 protein in young transgenic mice induces a massive albuminuria that is followed by an accelerated FGS within 3 weeks. This albuminuria is complement and leukocyte independent. The time course of proteinuria, the pathogenesis of the acute proteinuria and the dose dependency of FGS are unknown. Albuminuria was measured in Thy-1.1 transgenic mice after injection of different doses of anti-Thy-1.1 mAb and at different time points within the first 24 h after injection. Podocytic foot processes and slit pore diameter were quantitated by electron microscopy. Changes in expression of slit pore constituents (podocin, CD2AP, nephrin and ZO-1), cytoskeleton-associated proteins (actin, alpha-actinin, ezrin and synaptopodin), the GDH-podocyte adhesion molecules alpha(3)-integrin, and heparan sulfate were studied by immunofluorescence. FGS was scored by light microscopy at 3 weeks after induction of albuminuria. Albuminuria in Thy-1.1 transgenic mice was observed within 10 min after anti-Thy-1.1 mAb injection. This rapid development of albuminuria was accompanied by a reduction in number of podocytic foot processes from 20.0 +/- 0.7/10 microm glomerular basement membrane (GBM) in saline-treated transgenic mice to 8.0 +/- 0.5 and 2.2 +/- 0.2 in anti-Thy-1.1-treated mice, at 10 min and 8 h after treatment, respectively. In addition, we observed a significant decrease in width of remaining slit pores, from 32.7 +/- 1.1 to 26.8 +/- 1.4 nm at 10 min after mAb injection. By immunofluorescence, we did not observe major changes in the expression pattern of any of the proteins studied. There was no correlation between the injected dose of the anti-Thy-1.1 mAb and the acute albuminuria. In contrast, the percentage of FGS at 3 weeks correlated with the

  17. Chromogranin A deficiency in transgenic mice leads to aberrant chromaffin granule biogenesis.

    PubMed

    Kim, Taeyoon; Zhang, Chun-fa; Sun, Ziqing; Wu, Heling; Loh, Y Peng

    2005-07-27

    The biogenesis of dense-core secretory granules (DCGs), organelles responsible for the storage and secretion of neurotransmitters and neuropeptides in chromaffin cells, is poorly understood. Chromogranin A (CgA), which binds catecholamines for storage in the lumen of chromaffin granules, has been shown to be involved in DCG biogenesis in neuroendocrine PC12 cells. Here, we report that downregulation of CgA expression in vivo by expressing antisense RNA against CgA in transgenic mice led to a significant reduction in DCG formation in adrenal chromaffin cells. The number of DCGs formed in CgA antisense transgenic mice was directly correlated with the amount of CgA present in adrenal medulla. In addition, DCGs showed an increase in size, with enlargement in the volume around the dense core, a phenomenon that occurs to maintain constant "free" catecholamine concentration in the lumen of these granules. The extent of DCG swelling was inversely correlated with the number of DCGs formed, as well as the amount of CgA present in the adrenal glands of CgA antisense transgenic mice. These data indicate an essential role of CgA in regulating chromaffin DCG biogenesis and catecholamine storage in vivo.

  18. Transgenes expressing the Wnt-1 and int-2 proto-oncogenes cooperate during mammary carcinogenesis in doubly transgenic mice.

    PubMed Central

    Kwan, H; Pecenka, V; Tsukamoto, A; Parslow, T G; Guzman, R; Lin, T P; Muller, W J; Lee, F S; Leder, P; Varmus, H E

    1992-01-01

    The Wnt-1 and int-2 proto-oncogenes are transcriptionally activated by mouse mammary tumor virus insertion mutations in virus-induced tumors and encode secretory glycoproteins. To determine whether these two genes can cooperate during carcinogenesis, we have crossed two previously characterized lines of transgenic mice to obtain bitransgenic animals carrying both Wnt-1 and int-2 transgenes under the control of the mouse mammary tumor virus long terminal repeat. Mammary carcinomas appear earlier and with higher frequency in the bitransgenic animals, especially the males, than in either parental line. Nearly all bitransgenic males develop mammary neoplasms within 8 months of birth, whereas only 15% of Wnt-1 transgenic males and none of the int-2 transgenic males have tumors. In virgin bitransgenic females, tumors occur approximately 2 months earlier than in their Wnt-1 transgenic siblings; int-2 transgenic females rarely exhibit tumors. Preneoplastic glands from the bitransgenic animals of either sex demonstrate pronounced epithelial hyperplasia similar to that seen in Wnt-1 transgenic virgin females and males, and both transgenes are expressed in the hyperplastic glands and mammary tumors. RNA from the int-2 transgene is more abundant in mammary glands from bitransgenic animals than from int-2 transgenic animals; the increase is associated with high levels of RNA specific for keratin genes 14 and 18, suggesting that Wnt-1-induced epithelial hyperplasia is responsible for the observed increase in expression of the int-2 transgene. Images PMID:1530875

  19. Effect of Hypertriglyceridemia on Beta Cell Mass and Function in ApoC3 Transgenic Mice.

    PubMed

    Liu, Yun-Zi; Cheng, Xiaoyun; Zhang, Ting; Lee, Sojin; Yamauchi, Jun; Xiao, Xiangwei; Gittes, George; Qu, Shen; Jiang, Chun-Lei; Dong, H Henry

    2016-07-08

    Hypertriglyceridemia results from increased production and decreased clearance of triglyceride-rich very low-density lipoproteins, a pathological condition that accounts for heightened risk of ischemic vascular diseases in obesity and type 2 diabetes. Despite its intimate association with insulin resistance, whether hypertriglyceridemia constitutes an independent risk for beta cell dysfunction in diabetes is unknown. Answering this fundamental question is stymied by the fact that hypertriglyceridemia is intertwined with hyperglycemia and insulin resistance in obese and diabetic subjects. To circumvent this limitation, we took advantage of apolipoprotein C3 (ApoC3)-transgenic mice, a model with genetic predisposition to hypertriglyceridemia. We showed that ApoC3-transgenic mice, as opposed to age/sex-matched wild-type littermates, develop hypertriglyceridemia with concomitant elevations in plasma cholesterol and non-esterified fatty acid levels. Anti-insulin and anti-glucagon dual immunohistochemistry in combination with morphometric analysis revealed that ApoC3-transgenic and wild-type littermates had similar beta cell and alpha cell masses as well as islet size and architecture. These effects correlated with similar amplitudes of glucose-stimulated insulin secretion and similar degrees of postprandial glucose excursion in ApoC3-transgenic versus wild-type littermates. Oil Red O histology did not visualize lipid infiltration into islets, correlating with the lack of ectopic triglyceride and cholesterol depositions in the pancreata of ApoC3-transgenic versus wild-type littermates. ApoC3-transgenic mice, despite persistent hypertriglyceridemia, maintained euglycemia under both fed and fasting conditions without manifestation of insulin resistance and fasting hyperinsulinemia. Thus, hypertriglyceridemia per se is not an independent risk factor for beta cell dysfunction in ApoC3 transgenic mice. © 2016 by The American Society for Biochemistry and Molecular Biology

  20. Transgenic mice expressing human fibroblast growth factor-19 display increased metabolic rate and decreased adiposity.

    PubMed

    Tomlinson, Elizabeth; Fu, Ling; John, Linu; Hultgren, Bruce; Huang, Xiaojian; Renz, Mark; Stephan, Jean Philippe; Tsai, Saio Ping; Powell-Braxton, Lyn; French, Dorothy; Stewart, Timothy A

    2002-05-01

    The fibroblast growth factors (FGFs), and the corresponding receptors, are implicated in more than just the regulation of epithelial cell proliferation and differentiation. Specifically, FGF23 is a regulator of serum inorganic phosphate levels, and mice deficient in FGF receptor-4 have altered cholesterol metabolism. The recently described FGF19 is unusual in that it is nonmitogenic and appears to interact only with FGF receptor-4. Here, we report that FGF19 transgenic mice had a significant and specific reduction in fat mass that resulted from an increase in energy expenditure. Further, the FGF19 transgenic mice did not become obese or diabetic on a high fat diet. The FGF19 transgenic mice had increased brown adipose tissue mass and decreased liver expression of acetyl coenzyme A carboxylase 2, providing two mechanisms by which FGF19 may increase energy expenditure. Consistent with the reduction in expression of acetyl CoA carboxylase 2, liver triglyceride levels were reduced.

  1. Opposing behavioural alterations in male and female transgenic TGF alpha mice: association with tumour susceptibility.

    PubMed Central

    Hilakivi-Clarke, L. A.; Arora, P. K.; Clarke, R.; Wright, A.; Lippman, M. E.; Dickson, R. B.

    1993-01-01

    Psychosocial factors are thought to influence risk and survival from cancer. We have previously studied specific behaviours in transgenic male CD-1 MT42 mice, which overexpress the gene encoding human transforming growth factor alpha (TGF alpha) in multiple tissues, and which develop a high incidence of spontaneous hepatocellular carcinoma. The male TGF alpha mice spent a lengthened time immobile in the swim test, were highly aggressive, had increased plasma levels of 17 beta-estradiol (E2), and reduced natural killer (NK) cell activity. The female transgenic MT42 TGF alpha mice do not develop an increased rate of tumours at any site. We hypothesised that if the alterations in male TGF alpha mice are associated with their development of hepatocellular carcinomas, female TGF alpha should not show these alterations. The data in the present study indicate that female TGF alpha mice display shortened immobility in the swim test, suggesting an improved ability to cope with stress, and appear less aggressive in the resident-intruder test than non-transgenic female CD-1 mice. The female TGF alpha mice also exhibit a 3-fold increase in the plasma levels of E2, and a 3-fold increase in NK cell activity. These findings suggest that the elevated expression of TGF alpha in the transgenic mice is associated with gender-specific behavioural alterations, and the development of spontaneous hepatocellular tumours in the males. Furthermore, TGF alpha alters hormonal and immune parameters similarly in both sexes. It remains to be determined whether the development of hepatocarcinoma in the male TGF alpha animals is associated with an impaired ability to cope with stress and elevated aggressive tendencies and/or whether manipulations leading to an impaired ability to cope with stress will promote tumourigenesis in female TGF alpha mice. PMID:8494695

  2. The a“MAZE”ing World of Lung-Specific Transgenic Mice

    PubMed Central

    Rawlins, Emma L.

    2012-01-01

    The purpose of this review is to give a comprehensive overview of transgenic mouse lines suitable for studying gene function and cellular lineage relationships in lung development, homeostasis, injury, and repair. Many of the mouse strains reviewed in this Perspective have been widely shared within the lung research community, and new strains are continuously being developed. There are many transgenic lines that target subsets of lung cells, but it remains a challenge for investigators to select the correct transgenic modules for their experiment. This review covers the tetracycline- and tamoxifen-inducible systems and focuses on conditional lines that target the epithelial cells. We point out the limitations of each strain so investigators can choose the system that will work best for their scientific question. Current mesenchymal and endothelial lines are limited by the fact that they are not lung specific. These lines are summarized in a brief overview. In addition, useful transgenic reporter mice for studying lineage relationships, promoter activity, and signaling pathways will complete our lung-specific conditional transgenic mouse shopping list. PMID:22180870

  3. Reduced beta 2-microglobulin mRNA levels in transgenic mice expressing a designed hammerhead ribozyme.

    PubMed Central

    Larsson, S; Hotchkiss, G; Andäng, M; Nyholm, T; Inzunza, J; Jansson, I; Ahrlund-Richter, L

    1994-01-01

    We have generated three artificial hammerhead ribozymes, denoted 'Rz-b', 'Rz-c' and 'Rz-d', with different specificities for exon II of the mouse beta-2-microglobulin (beta 2M) mRNA. In this study we tested for ribozyme mediated reduction of beta 2M mRNA in a cell line and in transgenic mice. Transfections of either of the Rz-b, Rz-c or Rz-d plasmids into a mouse cell-line (NIH/3T3) revealed reductions of beta 2M mRNA substrate in each case. Ribozyme expression in individual transfected clones was accompanied with an up to 80% reduction of beta 2M mRNA levels. Rz-c was selected for a transgenic study. Seven Rz-c transgenic founder animals were identified from which three ribozyme expressing families were established and analysed. Expression of the ribozyme transgene was tested for and detected in lung, kidney and spleen. Expression was accompanied with reduction of the beta 2M mRNA levels of heterozygous (Rz+/-) animals compared to non-transgenic litter mates. The effect was most pronounced in lung with more than 90% beta 2M mRNA reduction in individual mice. In summary, expression of our ribozymes in a cell free system, in a cell-line and in transgenic mice were all accompanied with reductions of beta 2M mRNA levels. Images PMID:8036151

  4. APP mRNA splicing is upregulated in the brain of biglycan transgenic mice.

    PubMed

    Bjelik, Annamária; Pákáski, Magdolna; Bereczki, Erika; Gonda, Szilvia; Juhász, Anna; Rimanóczy, Agnes; Zana, Marianna; Janka, Zoltán; Sántha, Miklós; Kálmán, János

    2007-01-01

    Many of the risk factors for cerebrovascular disease and atherosclerosis also increase the risk of Alzheimer's disease, characterized by the cerebral deposition of beta-amyloid plaques resulting from the abnormal processing of the transmembrane amyloid precursor protein (APP). The initiating event of cholesterol-induced atherosclerosis is the retention and accumulation of atherogenic apolipoprotein B (apoB) together with low-density lipoproteins in the vascular intima. Biglycan, a member of the small leucine-rich protein family, was suspected of contributing to this process. The individual and combined overexpressions of biglycan and apoB-100 were therefore examined on the cortical APP mRNA levels of transgenic mice by means of semiquantitative PCR. As compared with the control littermates, transgenic biglycan mice had significantly increased cortical APP695 (122%) and APP770 (157%) mRNA levels, while the double transgenic (apoB(+/-)xbiglycan(+/-)) mice did not exhibit any changes. These results provide the first experimental evidence that the atherogenic risk factor biglycan alters APP splicing and may participate in the pathogenesis of both Alzheimer and vascular dementias.

  5. Use Of Transgenic Mice In UDP-Glucuronosyltransferase (UGT) Studies

    PubMed Central

    Ou, Zhimin; Huang, Min; Zhao, Lizi; Xie, Wen

    2009-01-01

    Transgenic mouse models are useful to understand the function and regulation of drug metabolizing enzymes in vivo. This article is intended to describe the general strategies and to discuss specific examples on how to use transgenic, gene knockout, and humanized mice to study the function as well as genetic and pharmacological regulation of UDP-glucuronosyltransferases (UGTs). The physiological and pharmacological implications of transcription factor-mediated UGT regulation will also be discussed. The UGT-regulating transcription factors to be discussed in this article include nuclear hormone receptors (NRs), aryl hydrocarbon receptor (AhR), and nuclear factor erythroid 2-related factor 2 (Nrf2). PMID:20070245

  6. FGF-23 transgenic mice demonstrate hypophosphatemic rickets with reduced expression of sodium phosphate cotransporter type IIa.

    PubMed

    Shimada, Takashi; Urakawa, Itaru; Yamazaki, Yuji; Hasegawa, Hisashi; Hino, Rieko; Yoneya, Takashi; Takeuchi, Yasuhiro; Fujita, Toshiro; Fukumoto, Seiji; Yamashita, Takeyoshi

    2004-02-06

    Fibroblast growth factor (FGF)-23 was identified as a causative factor of tumor-induced osteomalacia and also as a responsible gene for autosomal dominant hypophosphatemic rickets. To clarify the pathophysiological roles of FGF-23 in these diseases, we generated its transgenic mice. The transgenic mice expressing human FGF-23 reproduced the common clinical features of these diseases such as hypophosphatemia probably due to increased renal phosphate wasting, inappropriately low serum 1,25-dihydroxyvitamin D level, and rachitic bone. The renal phosphate wasting in the transgenic mice was accompanied by the reduced expression of sodium phosphate cotransporter type IIa in renal proximal tubules. These results reinforce the notion that the excessive action of FGF-23 plays a causative role in the development of several hypophosphatemic rickets/osteomalacia.

  7. The influence of chronic stress on anxiety-like behavior and cognitive function in different human GFAP-ApoE transgenic adult male mice.

    PubMed

    Meng, Fan-Tao; Zhao, Jun; Fang, Hui; Liu, Ya-Jing

    2015-01-01

    The apolipoprotein E (ApoE) ɛ4 allele (ApoE4) is an important genetic risk factor for the pathogenesis of Alzheimer's disease (AD). In addition to genetic factors, environmental factors such as stress may play a critical role in AD pathogenesis. This study was designed to investigate the anxiety-like behavioral and cognitive changes in different human glial fibrillary acidic protein (GFAP)-ApoE transgenic adult male mice under chronic stress conditions. On the open field test, anxiety-like behavior was increased in the non-stressed GFAP-ApoE4 transgenic mice relative to the corresponding GFAP-ApoE3 (ApoE ɛ3 allele) mice. Anxiety-like behavior was increased in the stressed GFAP-ApoE3 mice relative to non-stressed GFAP-ApoE3 mice, but was unexpectedly decreased in the stressed GFAP-ApoE4 mice relative to non-stressed GFAP-ApoE4 mice. On the novel object recognition task, both GFAP-ApoE4 and GFAP-ApoE3 mice exhibited long-term non-spatial memory impairment after chronic stress. Interestingly, short-term non-spatial memory impairment (based on the novel object recognition task) was observed only in the stressed GFAP-ApoE4 male mice relative to non-stressed GFAP-ApoE4 transgenic mice. In addition, short-term spatial memory impairment was observed in the stressed GFAP-ApoE3 transgenic male mice relative to non-stressed GFAP-ApoE3 transgenic male mice; however, short-term spatial memory performance of GFAP-ApoE4 transgenic male mice was not reduced compared to non-stressed control mice based on the Y-maze task. In conclusion, our findings suggested that chronic stress affects anxiety-like behavior and spatial and non-spatial memory in GFAP-ApoE transgenic mice in an ApoE isoform-dependent manner.

  8. Physiology of transgenic mice with brown fat ablation: obesity is due to lowered body temperature.

    PubMed

    Klaus, S; Münzberg, H; Trüloff, C; Heldmaier, G

    1998-02-01

    We investigated the physiological basis for development of obesity in uncoupling protein-diphtheria toxin A chain (UCP-DTA) transgenic mice. In these mice the promoter of the brown adipose tissue (BAT)-specific UCP was used to drive expression of DTA, resulting in decreased BAT function and development of obesity and insulin resistance (Lowell, B. B., S. V. Susulic, A. Hamann, J. A. Lawitts, J. Himms-Hagen, B. B. Boyer, L. Kozak, and J. S. Flier. Nature 366: 740-742, 1994). In adult UCP-DTA mice, we measured food intake and food assimilation, locomotor activity, metabolic rate, and body temperature in comparison to control animals. No differences could be observed in food intake or assimilation and locomotor activity. Weight-specific metabolic rates at temperatures between 20 and 37 degrees C, however, were consistently lower in transgenic mice. Continuous telemetric recording of core body temperature showed that transgenic mice displayed a downshift in body temperature levels of approximately 0.9 degree C. In summary, we provide evidence that attenuated body temperature levels alone can be responsible for development of obesity and that BAT thermogenesis is a major determinant of body temperature levels in rodents.

  9. Cosmetics-triggered percutaneous remote control of transgene expression in mice.

    PubMed

    Wang, Hui; Ye, Haifeng; Xie, Mingqi; Daoud El-Baba, Marie; Fussenegger, Martin

    2015-08-18

    Synthetic biology has significantly advanced the rational design of trigger-inducible gene switches that program cellular behavior in a reliable and predictable manner. Capitalizing on genetic componentry, including the repressor PmeR and its cognate operator OPmeR, that has evolved in Pseudomonas syringae pathovar tomato DC3000 to sense and resist plant-defence metabolites of the paraben class, we have designed a set of inducible and repressible mammalian transcription-control devices that could dose-dependently fine-tune transgene expression in mammalian cells and mice in response to paraben derivatives. With an over 60-years track record as licensed preservatives in the cosmetics industry, paraben derivatives have become a commonplace ingredient of most skin-care products including shower gels, cleansing toners and hand creams. As parabens can rapidly reach the bloodstream of mice following topical application, we used this feature to percutaneously program transgene expression of subcutaneous designer cell implants using off-the-shelf commercial paraben-containing skin-care cosmetics. The combination of non-invasive, transdermal and orthogonal trigger-inducible remote control of transgene expression may provide novel opportunities for dynamic interventions in future gene and cell-based therapies. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Cholera toxin B protein in transgenic tomato fruit induces systemic immune response in mice.

    PubMed

    Jiang, Xiao-Ling; He, Zhu-Mei; Peng, Zhi-Qiang; Qi, Yu; Chen, Qing; Yu, Shou-Yi

    2007-04-01

    Cholera toxin B (CTB) subunit is a well-characterized antigen against cholera. Transgenic plants can offer an inexpensive and safe source of edible CTB vaccine and may be one of the best candidates for the production of plant vaccines. The present study aimed to develop transgenic tomato expressing CTB protein, especially in the ripening tomato fruit under the control of the tomato fruit-specific E8 promoter by using Agrobacterium-mediated transformation. Transgenic plants were selected using PCR and Southern blot analysis. Exogenous protein extracted from leaf, stem, and fruit tissues of transgenic plants was detected by ELISA and Western blot analysis, showing specific expression in the ripening fruit, with the highest amount of CTB protein being 0.081% of total soluble protein. Gavage of mice with ripe transgenic tomato fruits induced both serum and mucosal CTB specific antibodies. These results demonstrate the immunogenicity of the CTB protein in transgenic tomato and provide a considerable basis for exploring the utilization of CTB in the development of tomato-based edible vaccine against cholera. The rCTB antigen resulted in much lower antibody titers than an equal amount of exogenous CTB in transgenic fruits, suggesting the protective effect of the fibrous tissue of the fruit to the exogenous CTB protein against the degradation of protease in the digestive tracts of mice.

  11. Non-pathogenic protein aggregates in skeletal muscle in MLF1 transgenic mice.

    PubMed

    Li, Zhi-Fang; Wu, Xiaohua; Jiang, Yun; Liu, Jianxiang; Wu, Chun; Inagaki, Masaki; Izawa, Ichiro; Mizisin, Andrew P; Engvall, Eva; Shelton, G Diane

    2008-01-15

    Protein aggregate formation in muscle is thought to be pathogenic and associated with clinical weakness. Over-expression of either wild type or a mutant form of myeloid leukemia factor 1 (MLF1) in transgenic mouse skeletal muscle and in cultured cells resulted in aggregate formation. Aggregates were detected in MLF1 transgenic mice at 6 weeks of age, and increased in size with age. However, histological examination of skeletal muscles of MLF1 transgenic mice revealed no pathological changes other than the aggregates, and RotaRod testing did not detect functional deficits. MLF1 has recently been identified as a protein that could neutralize the toxicity of intracellular protein aggregates in a Drosophila model of Huntington's disease (HD). We also demonstrate that MLF1 interacts with MRJ, a heat shock protein, which can independently neutralize the toxicity of intracellular protein aggregates in the Drosophila HD model. Our data suggest that over-expression of MLF1 has no significant impact on skeletal muscle function in mice; that progressive formation of protein aggregates in muscle are not necessarily pathogenic; and that MLF1 and MRJ may function together to ameliorate the toxic effects of polyglutamine or mutant proteins in myodegenerative diseases such as inclusion body myositis and oculopharyngeal muscular dystrophy, as well as neurodegenerative disease.

  12. Betacellulin transgenic mice develop urothelial hyperplasia and show sex-dependent reduction in urinary major urinary protein content.

    PubMed

    Schulz, Helene; Dahlhoff, Maik; Glogowska, Aleksandra; Zhang, Lin; Arnold, Georg J; Fröhlich, Thomas; Schneider, Marlon R; Klonisch, Thomas

    2015-08-01

    The epidermal growth factor (EGF)-like ligands and their cognate ERBB1-4 receptors represent important signaling pathways that regulate tissue and cell proliferation, differentiation and regeneration in a wide variety of tissues, including the urogenital tract. Betacellulin (BTC) can activate all four ERBB tyrosine kinase receptors and is a multifunctional EGF-like ligand with diverse roles in β cell differentiation, bone maturation, formation of functional epithelial linings and vascular permeability in different organs. Using transgenic BTC mice, we have studied the effect of constitutive systemic BTC over-expression on the urinary bladder. BTC was detected in microvascular structures of the stromal bladder compartment and in umbrella cells representing the protective apical lining of the uroepithelium. ERBB1 and ERBB4 receptors were co-localized in the urothelium. Mice transgenic for BTC and double transgenic for both BTC and the dominant kinase-dead mutant of EGFR (Waved 5) developed hyperplasia of the uroepithelium at 5months of age, suggesting that urothelial hyperplasia was not exclusively dependent on ERBB1/EGFR. Mass spectrometric analysis of urine revealed a significant down-regulation of major urinary proteins in female BTC transgenic mice, suggesting a novel role for systemic BTC in odor-based signaling in female transgenic BTC mice. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. The effects of enhanced zinc on spatial memory and plaque formation in transgenic mice

    USGS Publications Warehouse

    Linkous, D.H.; Adlard, P.A.; Wanschura, P.B.; Conko, K.M.; Flinn, J.M.

    2009-01-01

    There is considerable evidence suggesting that metals play a central role in the pathogenesis of Alzheimer's disease. Reports suggest that elevated dietary metals may both precipitate and potentiate an Alzheimer's disease phenotype. Despite this, there remain few studies that have examined the behavioral consequences of elevated dietary metals in wild type and Alzheimer's disease animals. To further investigate this in the current study, two separate transgenic models of AD (Tg2576 and TgCRND8), together with wild type littermates were administered 10 ppm (0.153 mM) Zn. Tg2576 animals were maintained on a zinc-enriched diet both pre- and postnatally until 11 months of age, while TgCRND8 animals were treated for five months following weaning. Behavioral testing, consisting of "Atlantis" and "moving" platform versions of the Morris water maze, were conducted at the end of the study, and tissues were collected for immunohistochemical analysis of amyloid-β burden. Our data demonstrate that the provision of a zinc-enriched diet potentiated Alzheimer-like spatial memory impairments in the transgenic animals and was associated with reduced hippocampal amyloid-β plaque deposits. Zinc-related behavioral deficits were also demonstrated in wild type mice, which were sometimes as great as those present in the transgenic animals. However, zinc-related cognitive impairments in transgenic mice were greater than the summation of zinc effects in the wild type mice and the transgene effects.

  14. Serial transmission in rodents of neurodegeneration from transgenic mice expressing mutant prion protein.

    PubMed Central

    Hsiao, K K; Groth, D; Scott, M; Yang, S L; Serban, H; Rapp, D; Foster, D; Torchia, M; Dearmond, S J; Prusiner, S B

    1994-01-01

    Two lines of transgenic (Tg) mice expressing high (H) levels of the mutant P101L prion protein (PrP) developed a neurologic illness and central nervous system pathology indistinguishable from experimental murine scrapie; these mice were designated Tg(MoPrP-P101L)H. Brain homogenates from Tg(MoPrP-P101L)H mice were inoculated intracerebrally into CD-1 Swiss mice, Syrian hamsters, and Tg196 mice, Tg mice expressing the MoPrP-P101L transgene at low levels. None of the CD-1 mice developed central nervous system dysfunction, whereas approximately 10% of hamsters and approximately 40% of the Tg196 mice manifested neurologic signs between 117 and 639 days after inoculation. Serial transmission of neurodegeneration in Tg196 mice and Syrian hamsters was initiated with brain extracts, producing incubation times of approximately 400 and approximately 75 days, respectively. Although the Tg(MoPrP-P101L)H mice appear to accumulate only low levels of infections prions in their brains, the serial transmission of disease to inoculated recipients argues that prion formation occurs de novo in the brains of these uninoculated animals. These Tg mouse studies, taken together with similar findings in humans dying of inherited prion diseases, provide additional evidence that prions lack a foreign nucleic acid. Images PMID:7916462

  15. Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

    PubMed Central

    Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

    2014-01-01

    In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

  16. Age-dependent changes in nitric oxide synthase activity and protein expression in striata of mice transgenic for the Huntington's disease mutation.

    PubMed

    Pérez-Severiano, Francisca; Escalante, Bruno; Vergara, Paula; Ríos, Camilo; Segovia, José

    2002-09-27

    Huntington's disease (HD) is an autosomal hereditary neurodegenerative disorder caused by an abnormal expansion of the CAG repeats that code for a polyglutamine tract in a novel protein called huntingtin (htt). Both patients and experimental animals exhibit oxidative damage in specific areas of the brain, particularly the striatum. Nitric oxide (NO) is involved in many different physiological processes, and under pathological conditions it may promote oxidative damage through the formation of the highly reactive metabolite peroxynitrite; however, it may also play a role protecting cells from oxidative damage. We previously showed a correlation between the progression of the neurological phenotype and striatal oxidative damage in a line of transgenic mice, R6/1, which expresses a human mutated htt exon 1 with 116 CAG repeats. The purpose of the present work was to explore the participation of NO in the progressive oxidative damage that occurs in the striata of R6/1 mice. We analyzed the role of NO by measuring the activity of nitric oxide synthase (NOS) in the striata of transgenic and control mice at different ages. There was no difference in NOS activity between transgenic and wild-type mice at 11 weeks of age. In contrast, 19-week-old transgenic mice showed a significant increase in NOS activity, compared with same age controls. By 35 weeks of age, there was a decrease in NOS activity in transgenic mice when compared with wild-type controls. NOS protein expression was also determined in 11-, 19- and 35-week-old transgenic mice and wild-type littermates. Our results show increased neuronal NOS expression in 19-week-old transgenic mice, followed by a decreased level in 35-week-old mice, compared with controls, a phenomenon that parallels the changes in NOS enzyme activity. The present results suggest that NO is involved in the process leading to striatal oxidative damage and that it is associated with the onset of the progressive neurological phenotype in mice

  17. Imaging Neural Activity Using Thy1-GCaMP Transgenic mice

    PubMed Central

    Chen, Qian; Cichon, Joseph; Wang, Wenting; Qiu, Li; Lee, Seok-Jin R.; Campbell, Nolan R.; DeStefino, Nicholas; Goard, Michael J.; Fu, Zhanyan; Yasuda, Ryohei; Looger, Loren L.; Arenkiel, Benjamin R.; Gan, Wen-Biao; Feng, Guoping

    2014-01-01

    Summary The ability to chronically monitor neuronal activity in the living brain is essential for understanding the organization and function of the nervous system. The genetically encoded green fluorescent protein based calcium sensor GCaMP provides a powerful tool for detecting calcium transients in neuronal somata, processes, and synapses that are triggered by neuronal activities. Here we report the generation and characterization of transgenic mice that express improved GCaMPs in various neuronal subpopulations under the control of the Thy1 promoter. In vitro and in vivo studies show that calcium transients induced by spontaneous and stimulus-evoked neuronal activities can be readily detected at the level of individual cells and synapses in acute brain slices, as well as chronically in awake behaving animals. These GCaMP transgenic mice allow investigation of activity patterns in defined neuronal populations in the living brain, and will greatly facilitate dissecting complex structural and functional relationships of neural networks. PMID:23083733

  18. Mutant prenyltransferase-like mitochondrial protein (PLMP) and mitochondrial abnormalities in kd/kd mice

    PubMed Central

    Peng, Min; Jarett, Leonard; Meade, Ray; Madaio, Michael P.; Hancock, Wayne W.; George, Alfred L.; Neilson, Eric G.; Gasser, David L.

    2008-01-01

    Background Mice that are homozygous for the kidney disease (kd) mutation are apparently healthy for the first 8 weeks of life, but spontaneously develop a severe form of interstitial nephritis that progresses to end-stage renal disease (ESRD) by 4 to 8 months of age. By testing for linkage to microsatellite markers, we previously localized the kd gene to a YAC/BAC contig. Methods The sequence of the entire critical region was examined, and candidate genes were identified. These candidate genes were sequenced in both mutant (kd/kd) mice and normal controls. The phenotype was further characterized by immunohistochemistry and electron microscopy. Transgenic mice were constructed that carried the wild-type allele of the prime candidate gene, and this transgene was transferred to a kd/kd background by breeding. Results We have obtained evidence that kd is a mutant allele of a novel gene for a prenyltransferase-like mitochondrial protein (PLMP). This gene is alternatively spliced, with the larger gene product having one domain that resembles transprenyltransferase and another that is similar to geranylgeranyl pyrophosphate synthase. The smaller gene product includes only the first domain. An antiserum to PLMP localizes to mitochondria, and ultrastructural defects are present in the mitochondria of renal tubular epithelial cells, and to a lesser extent, hepatocytes and heart cells from kd/kd mice. In a line of kd/kd mice that carried the wild-type PLMP allele as a transgene, only 1 out of 13 animals expressed the disease by 120 days of age. Conclusion The kd allele codes for a novel protein that localizes to the mitochondria, and the kd/kd mouse has dysmorphic mitochondria in the renal tubular epithelial cells. This mouse is therefore a unique animal model for studying mechanisms that lead to tubulointerstitial nephritis. PMID:15200409

  19. Morphological, Histochemical, Immunohistochemical, and Ultrastructural Characterization of Tumors and Dysplastic and Non-Neoplastic Lesions Arising in BK Virus/tat Transgenic Mice

    PubMed Central

    Altavilla, Giuseppe; Trabanelli, Cecilia; Merlin, Michela; Caputo, Antonella; Lanfredi, Massimo; Barbanti-Brodano, Giuseppe; Corallini, Alfredo

    1999-01-01

    To study the role in AIDS pathogenesis of the human immunodeficiency virus type 1 (HIV-1) Tat protein, a transactivator of viral and cellular genes, we generated transgenic mice with a recombinant DNA containing BK virus (BKV) early region and the HIV-1 tat gene, directed by its own promoter-enhancer. DNA hybridization revealed that the transgene is stably maintained in all organs of transgenic mice as a tandem insertion in a number of copies ranging from 5 to 20 per cell. In addition, tat and BKV RNA were expressed in all tissues. Transgenic mice developed three types of lesions: 1) tumors, 2) hyperplastic and dysplastic lesions, and 3) non-neoplastic lesions. Tumors of different histotypes, such as lymphomas, adenocarcinomas of skin glands, leiomyosarcomas, skin squamous cell carcinomas, hepatomas, hepatocarcinomas, and cavernous liver hemangiomas, developed in 29% of transgenic animals. The majority of tumors were malignant, invasive, and producing metastases. Conversely, tumors of only two histotypes (lymphomas and adenocarcinomas of skin glands) appeared in control mice. Hyperplastic and dysplastic lesions were more frequent in transgenic than in control mice and involved the skin or its adnexes, the liver and the rectum, indicating multiple targets for the activity of the transgene. Pyelonephritis, frequently complicated with hydronephrosis, inflammatory eye lesions, and amyloid depositions represented the most frequent non-neoplastic lesions detected in transgenic mice. Many of the pathological findings observed in this animal model are comparable to similar lesions appearing in AIDS patients, suggesting a relevant role for Tat in the pathogenesis of such lesions during the course of AIDS. PMID:10233861

  20. DNA damage preceding dopamine neuron degeneration in A53T human α-synuclein transgenic mice.

    PubMed

    Wang, Degui; Yu, Tianyu; Liu, Yongqiang; Yan, Jun; Guo, Yingli; Jing, Yuhong; Yang, Xuguang; Song, Yanfeng; Tian, Yingxia

    2016-12-02

    Defective DNA repair has been linked with age-associated neurodegenerative disorders. Parkinson's disease (PD) is a progressive neurodegenerative disorder caused by genetic and environmental factors. Whether damages to nuclear DNA contribute to neurodegeneration of PD still remain obscure. in this study we aim to explore whether nuclear DNA damage induce dopamine neuron degeneration in A53T human α-Synuclein over expressed mouse model. We investigated the effects of X-ray irradiation on A53T-α-Syn MEFs and A53T-α-Syn transgene mice. Our results indicate that A53T-α-Syn MEFs show a prolonged DNA damage repair process and senescense phenotype. DNA damage preceded onset of motor phenotype in A53T-α-Syn transgenic mice and decrease the number of nigrostriatal dopaminergic neurons. Neurons of A53T-α-Syn transgenic mice are more fragile to DNA damages. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Degeneration of oxidative muscle fibers in HTLV-1 tax transgenic mice.

    PubMed

    Nerenberg, M I; Wiley, C A

    1989-12-01

    The HTLV-1 tax gene under control of the HTLV-1 long terminal repeat (LTR) was introduced into transgenic mice. Previously tax protein expression in the muscle and peripheral nerves of three independent mouse lines was reported. Here the localization of this transgenic protein at a cellular and subcellular level is described. Tax protein was expressed in oxidative muscle fibers that developed severe progressive atrophy. It localized to the cytoplasma where it was associated with structures resembling degenerating Z bands. This pattern of muscle fiber involvement is similar to that observed in human retroviral associated myopathy. This transgenic mouse model suggests that preferential expression of the HTLV-1 viral promoter in oxidative muscle fibers may explain the productive infection of these fibers in HTLV-1 myopathy.

  2. Genetic Biomarkers for ALS Disease in Transgenic SOD1G93A Mice

    PubMed Central

    Calvo, Ana C.; Manzano, Raquel; Atencia-Cibreiro, Gabriela; Oliván, Sara; Muñoz, María J.; Zaragoza, Pilar; Cordero-Vázquez, Pilar; Esteban-Pérez, Jesús; García-Redondo, Alberto; Osta, Rosario

    2012-01-01

    The pathophysiological mechanisms of both familial and sporadic Amyotrophic Lateral Sclerosis (ALS) are unknown, although growing evidence suggests that skeletal muscle tissue is a primary target of ALS toxicity. Skeletal muscle biopsies were performed on transgenic SOD1G93A mice, a mouse model of ALS, to determine genetic biomarkers of disease longevity. Mice were anesthetized with isoflurane, and three biopsy samples were obtained per animal at the three main stages of the disease. Transcriptional expression levels of seventeen genes, Ankrd1, Calm1, Col19a1, Fbxo32, Gsr, Impa1, Mef2c, Mt2, Myf5, Myod1, Myog, Nnt, Nogo A, Pax7, Rrad, Sln and Snx10, were tested in each muscle biopsy sample. Total RNA was extracted using TRIzol Reagent according to the manufacturer's protocol, and variations in gene expression were assayed by real-time PCR for all of the samples. The Pearson correlation coefficient was used to determine the linear correlation between transcriptional expression levels throughout disease progression and longevity. Consistent with the results obtained from total skeletal muscle of transgenic SOD1G93A mice and 74-day-old denervated mice, five genes (Mef2c, Gsr, Col19a1, Calm1 and Snx10) could be considered potential genetic biomarkers of longevity in transgenic SOD1G93A mice. These results are important because they may lead to the exploration of previously unexamined tissues in the search for new disease biomarkers and even to the application of these findings in human studies. PMID:22412900

  3. Decreased severity of collagen antibody and lipopolysaccharide-induced arthritis in human IL-32β overexpressed transgenic mice.

    PubMed

    Park, Mi Hee; Yoon, Do-Young; Ban, Jung Ok; Kim, Dae Hwan; Lee, Dong Hun; Song, Sukgil; Kim, Youngsoo; Han, Sang-Bae; Lee, Hee Pom; Hong, Jin Tae

    2015-11-17

    Interleukin (IL)-32, mainly produced by T-lymphocytes, natural killer cells, epithelial cells, and blood monocytes, is dominantly known as a pro-inflammatory cytokine. However, the role of IL-32 on inflammatory disease has been doubtful according to diverse conflicting results. This study was designed to examine the role of IL-32β on the development of collagen antibody (CAIA) and lipopolysaccharide (LPS)-induced inflammatory arthritis. Our data showed that the paw swelling volume and clinical score were significantly reduced in the CAIA and LPS-treated IL-32β transgenic mice compared with non-transgenic mice. The populations of cytotoxic T, NK and dendritic cells was inhibited and NF-κB and STAT3 activities were significantly lowered in the CAIA and LPS-treated IL-32β transgenic mice. The expression of pro-inflammatory proteins was prevented in the paw tissues of CAIA and LPS-treated IL-32β transgenic mice. In addition, IL-32β altered several cytokine levels in the blood, spleen and paw joint. Our data indicates that IL-32β comprehensively inhibits the inflammation responses in the CAIA and LPS-induced inflammatory arthritis model.

  4. Persistent hyperplastic primary vitreous in transgenic mice expressing IE180 of the pseudorabies virus.

    PubMed

    Taharaguchi, Satoshi; Yoshida, Kazuhiko; Tomioka, Yukiko; Yoshino, Saori; Uede, Toshimitsu; Ono, Etsuro

    2005-05-01

    Pseudorabies virus (PRV), a representative member of the alpha-herpesvirus family, causes nervous symptoms and ocular lesions, such as keratoconjunctivitis and retinal degeneration in piglets. The immediate-early protein IE180 of the PRV is known to be essential, not only in viral gene expression, but also in the cellular gene expression in host cells. The purpose of this study was to examine the effect of IE180 on the development of the mouse eye, by using transgenic technology. Transgenic mice expressing IE180 were generated and their eyes analyzed by histology, immunocytochemistry, and the bromodeoxyuridine cell proliferation assay. A fibrovascular retrolental tissue analogous to persistent hyperplastic primary vitreous (PHPV) in humans was observed in a transgenic mouse line expressing IE180. The gross anatomy of the eye showed white pupils. Analysis of hematoxylin and eosin-stained sections revealed that the retrolental tissue adhered to the neuroretina, the inner nuclear and ganglion cell layers were disorganized, and rosettelike arrangements of dysplastic photoreceptor cells were present. Bromodeoxyuridine-positive cells were detected in the retrolental tissues of postnatal day (P)1, P7, and P14 mice. The retrolental mass in the P7 transgenic mouse was composed of melanocytes and endothelial cells, which were detected by a cocktail of antibodies against endoglin, CD31, and VEGF receptor-2. The observation that the eye disease in transgenic mice is similar to that in PHPV in humans raises the possibility that expression of the immediate-early gene of alpha-herpesviruses may contribute to PHPV.

  5. Differences in glutathione S-transferase pi expression in transgenic mice with symptoms of neurodegeneration.

    PubMed

    Kaźmierczak, Beata; Kuźma-Kozakiewicz, Magdalena; Usarek, Ewa; Barańczyk-Kuźma, Anna

    2011-01-01

    Glutathione S-transferase pi (GST pi) is an enzyme involved in cell protection against toxic electrophiles and products of oxidative stress. GST pi expression was studied in transgenic mice hybrids (B6-C3H) with symptoms of neurodegeneration harboring SOD1G93A (SOD1/+), Dync1h1 (Cra1/+) and double (Cra1/SOD1) mutations, at presymptomatic and symptomatic stages (age 70, 140, 365 days) using RT-PCR and Western blotting. The main changes in GST pi expression were observed in mice with the SODG93A mutation. In SOD1/+ and Cra1/SOD1 transgenics, with the exception of cerebellum, the changes in GST pi-mRNA accompanied those in GST pi protein. In brain cortex of both groups the expression was unchanged at the presymptomatic (age 70 days) but was lower at the symptomatic stage (age 140 days) and at both stages in hippocampus and spinal cord of SOD1/+ but not of Cra1/SOD1 mice compared to age-matched wild-type controls. In cerebellum of the presymptomatic and the symptomatic SOD1/+ mice and presymptomatic Cra1/SOD1 mice, the GST pi-mRNA was drastically elevated but the protein level remained unchanged. In Cra1/+ transgenics there were no changes in GST pi expression in any CNS region both on the mRNA and on the protein level. It can be concluded that the SOD1G93A but not the Dync1h1 mutation significantly decreases detoxification efficiency of GST pi in CNS, however the Dync1h1 mutation reduces the effects caused by the SOD1G93A mutation. Despite similarities in neurological symptoms, the differences in GST pi expression between SOD1/+ and Cra1/+ transgenics indicate a distinct pathogenic entity of these two conditions.

  6. Over-Expression of Porcine Myostatin Missense Mutant Leads to A Gender Difference in Skeletal Muscle Growth between Transgenic Male and Female Mice.

    PubMed

    Ma, Dezun; Gao, Pengfei; Qian, Lili; Wang, Qingqing; Cai, Chunbo; Jiang, Shengwang; Xiao, Gaojun; Cui, Wentao

    2015-08-24

    Myostatin, a transforming growth factor-β family member, is a negative regulator of skeletal muscle development and growth. Piedmontese cattle breeds have a missense mutation, which results in a cysteine to tyrosine substitution in the mature myostatin protein (C313Y). This loss-of-function mutation in myostatin results in a double-muscled phenotype in cattle. Myostatin propeptide is an inhibitor of myostatin activity and is considered a potential agent to stimulate muscle growth in livestock. In this study, we generated transgenic mice overexpressing porcine myostatin missense mutant (pmMS), C313Y, and wild-type porcine myostatin propeptide (ppMS), respectively, to examine their effects on muscle growth in mice. Enhanced muscle growth was observed in both pmMS and ppMS transgenic female mice and also in ppMS transgenic male mice. However, there was no enhanced muscle growth observed in pmMS transgenic male mice. To explore why there is such a big difference in muscle growth between pmMS and ppMS transgenic male mice, the expression level of androgen receptor (AR) mutant AR45 was measured by Western blot. Results indicated that AR45 expression significantly increased in pmMS transgenic male mice while it decreased dramatically in ppMS transgenic male mice. Our data demonstrate that both pmMS and ppMS act as myostatin inhibitors in the regulation of muscle growth, but the effect of pmMS in male mice is reversed by an increased AR45 expression. These results provide useful insight and basic theory to future studies on improving pork quality by genetically manipulating myostatin expression or by regulating myostatin activity.

  7. Deletion of the Fcγ Receptor IIb in Thymic Stromal Lymphopoietin Transgenic Mice Aggravates Membranoproliferative Glomerulonephritis

    PubMed Central

    Mühlfeld, Anja S.; Segerer, Stephan; Hudkins, Kelly; Carling, Matthew D.; Wen, Min; Farr, Andrew G.; Ravetch, Jeffrey V.; Alpers, Charles E.

    2003-01-01

    Engagement of immunoglobulin-binding receptors (FcγR) on leukocytes and other cell types is one means by which immunoglobulins and immune complexes activate effector cells. One of these FcγRs, FcγRIIb, is thought to contribute to protection from autoimmune disease by down-regulation of B-cell responsiveness and myeloid cell activation. We assessed the role of FcγRIIb in a mouse model of cryoglobulin-associated membranoproliferative glomerulonephritis induced by overexpression of thymic stromal lymphopoietin (TSLP). TSLP transgenic mice were crossbred with animals deficient for FcγRIIb on the same genetic background (C57BL/6). Renal pathology was assessed in female and male animals (wild-type, FcγRIIb−/−, TSLP transgenic, and combined TSLP transgenic/FcγRIIb−/− mice) after 50 and 120 days, respectively. FcγRIIb−/− mice had no significant renal pathology, whereas overexpression of TSLP induced a membranoproliferative glomerulonephritis, as previously established. TSLP transgenic FcγRIIb−/− mice appeared sick with increased mortality. Kidney function was significantly impaired in male mice corresponding to aggravated glomerular pathology with increases in glomerular matrix and cellularity. This resulted from both a large influx of infiltrating macrophages and increased cellular proliferation. These results emphasize the important role of FcγRIIb in regulating immune responses and suggest that modulation of Fcγ receptor activation or expression may be a useful therapeutic approach for treating glomerular diseases. PMID:12937154

  8. Skeletal Phenotype of Transgenic Mice Expressing the Beta1 Integrin Cytoplasmic Tail In Osteoblasts

    NASA Technical Reports Server (NTRS)

    Globus, R. K.; vanderMeulen, M. C. H.; Damsky, D.; Kim, J.-B.; Amblard, D.; Amblard, D.; Nishimura, Y.; Almeida, E.; Iwaniec, U. T.; Wronski, T. J.; hide

    2002-01-01

    To define the physiologic role of beta1 integrin in bone formation and mechanical loading, transgenic mice were generated by expressing the cytoplasmic tall and transmembrane domain of Beta1 integrin under the control of the osteocalcin promoter. In cultured cells, this truncated fragment of Beta1 can act as a dominant negative. Previously, the matrix of calvariae was shown to be abnormal in transgenic (TG) compared to wildtype (WT) mice. In this study, we analyzed appendicular bone in TG and WT, male and female mice at 14, 35, 63, 90 and 365 days old (n=8-12/gp). To assess beta1 integrin function in mechanical loading, a pilot study using hindlimb unloading by tail suspension was performed. 35d old TG and WT females were hindlimb unloaded for 4 wks (n=3-5). Body mass, bone mineral content, histomorphometric (distal femur) and biomechanical parameters were analyzed. Statistical significance (P less than.05) was defined by ANOVA using the Tukey-Kramer post-hoc test. We confirmed transgene expression by immunoprecipitating then immunoblotting bone lysates using an antibody against the beta1 tail. Body masses of TG mice at 63, 90 and 365d old were greater (16-25%) than WT. Some TG female mice at 365d appeared obese; mean abdominal fat mass was 415% greater in TG than WT mice. Tibiae were longer (5-7%) in TG than WT mice at 63 and 90d. Tibial mineral mass of 35d males was 7% lower in TG than WT mice, but at 63d was 21% higher. The % osteoblast surface in 35d TG mice was 20% higher than WT, and at 63d was 17% lower, while % osteoclast surface did not differ. In 365d mice, cancellous bone volume (125%) and endocortical mineral apposition rate (40%) were greater in TG than WT males but not females. In WT mice, hindlimb unloading caused a reduction in mineral mass of tibiae (-20%) and lumbar vertebrae (-22%) relative to normally loaded controls. Surprisingly, hindlimb unloading also caused a relative reduction (-13%) in humerus mass. The effects of hindlimb unloading on

  9. Transgenic mice: an irreplaceable tool for the study of mammalian development and biology.

    PubMed

    Babinet, C

    2000-11-01

    Stable integration into the mouse genome of exogenous genetic information, i.e., the creation of transgenic mice, has become a privileged way of analyzing gene function in normal development and pathology. Both gene addition and gene replacement may be performed. This has allowed, in particular, the creation of mice in which precise mutations are introduced into a given gene. Furthermore, in recent years, strategies that induce the expression of a mutation in a given type of cell and/or at a given time in development have been developed. Thus, the transgenic methodology affords a unique and irreplaceable tool for the study of mammalian development and biology and for the creation of animal models for human genetic diseases.

  10. HO-1 induction in motor cortex and intestinal dysfunction in TDP-43 A315T transgenic mice.

    PubMed

    Guo, Yansu; Wang, Qian; Zhang, Kunxi; An, Ting; Shi, Pengxiao; Li, Zhongyao; Duan, Weisong; Li, Chunyan

    2012-06-15

    TAR DNA-binding protein 43 (TDP-43) has been found to be related to the pathogenesis of amyotrophic lateral sclerosis (ALS). TDP-43 A315T transgenic mice develop degeneration of specific motor neurons, and accumulation of ubiquitinated proteins has been observed in the pyramidal cells of motor cortex of these mice. In this study, we found stress-responsive HO-1 induction and no autophagic alteration in motor cortex of TDP-43 A315T transgenic mice. Glial activation, especially astrocytic proliferation, occurred in cortical layer 5 and sub-meningeal region. Interestingly, we noticed that progressively thinned colon, swollen small intestine and reduced food intake, rather than severe muscle weakness, contributed to the death of TDP-43 A315T transgenic mice. Increased TDP-43 accumulation in the myenteric nerve plexus and increased thickness of muscular layer of colon were related to the intestinal dysfunction. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. A Dietary Mixture Containing Fish Oil, Resveratrol, Lycopene, Catechins, and Vitamins E and C Reduces Atherosclerosis in Transgenic Mice123

    PubMed Central

    Verschuren, Lars; Wielinga, Peter Y.; van Duyvenvoorde, Wim; Tijani, Samira; Toet, Karin; van Ommen, Ben; Kooistra, Teake; Kleemann, Robert

    2011-01-01

    Chronic inflammation and proatherogenic lipids are important risk factors of cardiovascular disease (CVD). Specific dietary constituents such as polyphenols and fish oils may improve cardiovascular risk factors and may have a beneficial effect on disease outcomes. We hypothesized that the intake of an antiinflammatory dietary mixture (AIDM) containing resveratrol, lycopene, catechin, vitamins E and C, and fish oil would reduce inflammatory risk factors, proatherogenic lipids, and endpoint atherosclerosis. AIDM was evaluated in an inflammation model, male human C-reactive protein (CRP) transgenic mice, and an atherosclerosis model, female ApoE*3Leiden transgenic mice. Two groups of male human-CRP transgenic mice were fed AIDM [0.567% (wt:wt) powder and 0.933% (wt:wt oil)] or placebo for 6 wk. The effects of AIDM on basal and IL-1β–stimulated CRP expression were investigated. AIDM reduced cytokine-induced human CRP and fibrinogen expression in human-CRP transgenic mice. In the atherosclerosis study, 2 groups of female ApoE*3Leiden transgenic mice were fed an atherogenic diet supplemented with AIDM [0.567% (wt:wt) powder and 0.933% (wt:wt oil)] or placebo for 16 wk. AIDM strongly reduced plasma cholesterol, TG, and serum amyloid A concentrations compared with placebo. Importantly, long-term treatment of ApoE*3Leiden mice with AIDM markedly reduced the development of atherosclerosis by 96% compared with placebo. The effect on atherosclerosis was paralleled by a reduced expression of the vascular inflammation markers and adhesion molecules inter-cellular adhesion molecule-1 and E-selectin. Dietary supplementation of AIDM improves lipid and inflammatory risk factors of CVD and strongly reduces atherosclerotic lesion development in female transgenic mice. PMID:21411607

  12. Transgenic Expression of Dspp Partially Rescued the Long Bone Defects of Dmp1-null Mice

    PubMed Central

    Jani, Priyam H.; Gibson, Monica P.; Liu, Chao; Zhang, Hua; Wang, Xiaofang; Lu, Yongbo; Qin, Chunlin

    2016-01-01

    Dentin matrix protein 1 (DMP1) and dentin sialophosphoprotein (DSPP) belong to the Small Integrin-Binding Ligand N-linked Glycoprotein (SIBLING) family. In addition to the features common to all SIBLING members, DMP1 and DSPP share several unique similarities in chemical structure, proteolytic activation and tissue localization. Mutations in, or deletion of DMP1, cause autosomal recessive hypophosphatemic rickets along with dental defects; DSPP mutations or its ablation are associated with dentinogenesis imperfecta. While the roles and functional mechanisms of DMP1 in osteogenesis have been extensively studied, those of DSPP in long bones have been studied only to a limited extent. Previous studies by our group revealed that transgenic expression of Dspp completely rescued the dentin defects of Dmp1-null (Dmp1−/−) mice. In this investigation, we assessed the effects of transgenic Dspp on osteogenesis by analyzing the formation and mineralization of the long bones in Dmp1−/− mice that expresses a transgene encoding full-length DSPP driven by a 3.6-kb rat Col1a1 promoter (referred as “Dmp1−/−;Dspp-Tg mice”). We characterized the long bones of the Dmp1−/−;Dspp-Tg mice at different ages and compared them with those from Dmp1−/− and Dmp1+/− (normal control) mice. Our analyses showed that the long bones of Dmp1−/−;Dspp-Tg mice had a significant increase in cortical bone thickness, bone volume and mineral density along with a remarkable restoration of trabecular thickness compared to those of the Dmp1−/− mice. The long bones of Dmp1−/−;Dspp-Tg mice underwent a dramatic reduction in the amount of osteoid, significant improvement of the collagen fibrillar network, and better organization of the lacunocanalicular system, compared to the Dmp1−/− mice. The elevated levels of biglycan, bone sialoprotein and osteopontin in Dmp1−/− mice were also noticeably corrected by the transgenic expression of Dspp. These findings suggest that

  13. Pkd1 transgenic mice: adult model of polycystic kidney disease with extrarenal and renal phenotypes

    PubMed Central

    Kurbegovic, Almira; Côté, Olivier; Couillard, Martin; Ward, Christopher J.; Harris, Peter C.; Trudel, Marie

    2010-01-01

    While high levels of Pkd1 expression are detected in tissues of patients with autosomal dominant polycystic kidney disease (ADPKD), it is unclear whether enhanced expression could be a pathogenetic mechanism for this systemic disorder. Three transgenic mouse lines were generated from a Pkd1-BAC modified by introducing a silent tag via homologous recombination to target a sustained wild-type genomic Pkd1 expression within the native tissue and temporal regulation. These mice specifically overexpressed the Pkd1 transgene in extrarenal and renal tissues from ∼2- to 15-fold over Pkd1 endogenous levels in a copy-dependent manner. All transgenic mice reproducibly developed tubular and glomerular cysts leading to renal insufficiency. Interestingly, Pkd1TAG mice also exhibited renal fibrosis and calcium deposits in papilla reminiscent of nephrolithiasis as frequently observed in ADPKD. Similar to human ADPKD, these mice consistently displayed hepatic fibrosis and ∼15% intrahepatic cysts of the bile ducts affecting females preferentially. Moreover, a significant proportion of mice developed cardiac anomalies with severe left-ventricular hypertrophy, marked aortic arch distention and/or valvular stenosis and calcification that had profound functional impact. Of significance, Pkd1TAG mice displayed occasional cerebral lesions with evidence of ruptured and unruptured cerebral aneurysms. This Pkd1TAG mouse model demonstrates that overexpression of wild-type Pkd1 can trigger the typical adult renal and extrarenal phenotypes resembling human ADPKD. PMID:20053665

  14. Diabetic kidney lesions of GIPRdn transgenic mice: podocyte hypertrophy and thickening of the GBM precede glomerular hypertrophy and glomerulosclerosis.

    PubMed

    Herbach, Nadja; Schairer, Irene; Blutke, Andreas; Kautz, Sabine; Siebert, Angela; Göke, Burkhard; Wolf, Eckhard; Wanke, Ruediger

    2009-04-01

    Diabetic nephropathy is the leading cause of end-stage renal disease and the largest contributor to the total cost of diabetes care. Rodent models are excellent tools to gain more insight into the pathogenesis of diabetic nephropathy. In the present study, we characterize the age-related sequence of diabetes-associated kidney lesions in GIPR(dn) transgenic mice, a novel mouse model of early-onset diabetes mellitus. Clinical-chemical analyses as well as qualitative and quantitative morphological analyses of the kidneys of GIPR(dn) transgenic animals and nontransgenic littermate controls were performed at 3, 8, 20, and 28 wk of age. Early renal changes of transgenic mice consisted of podocyte hypertrophy, reduced numerical volume density of podocytes in glomeruli, and homogenous thickening of the glomerular basement membrane, followed by renal and glomerular hypertrophy as well as mesangial expansion and matrix accumulation. At 28 wk of age, glomerular damage was most prominent, including advanced glomerulosclerosis, tubulointerstitial lesions, and proteinuria. Real-time PCR demonstrated increased glomerular expression of Col4a1, Fn1, and Tgfb1. Immunohistochemistry revealed increased mesangial deposition of collagen type IV, fibronectin, and laminin. The present study shows that GIPR(dn) transgenic mice exhibit renal changes that closely resemble diabetes-associated kidney alterations in humans. Data particularly from male transgenic mice indicate that podocyte hypertrophy is directly linked to hyperglycemia, without the influence of mechanical stress. GIPR(dn) transgenic mice are considered an excellent new tool to study the mechanisms involved in onset and progression of diabetic nephropathy.

  15. Oral immunization of mice using transgenic tomato fruit expressing VP1 protein from enterovirus 71.

    PubMed

    Chen, Hsuan-Fu; Chang, Meng-Huei; Chiang, Bor-Luen; Jeng, Shih-Tong

    2006-04-05

    Enterovirus 71 (EV71) causes seasonal epidemics of hand-foot-and-mouth disease associated with fatal neurological complications in young children, and several major outbreaks have occurred recently. This study developed an effective antiviral agent by transforming the gene for VP1 protein, a previously defined epitope and also a coat protein of EV71, into tomato plant. VP1 protein was first fused with sorting signals to enable it to be retained in the endoplasmic reticulum of tomato plant, and its expression level increased to 27 microg/g of fresh tomato fruit. Transgenic tomato fruit expressing VP1 protein was then used as an oral vaccine, and the development of VP1-specific fecal IgA and serum IgG were observed in BALB/c mice. Additionally, serum from mice fed transgenic tomato could neutralize the infection of EV71 to rhabdomyosarcoma cells, indicating that tomato fruit expressing VP1 was successful in orally immunizing mice. Moreover, the proliferation of spleen cells from orally immunized mice was stimulated by VP1 protein, and provided further evidence of both humoral and cellular immunity. Results of this study not only demonstrate the feasibility of using transgenic tomato as an oral vaccine to generate protective immunity in mice against EV71, but also suggest the probability of enterovirus vaccine development.

  16. A soluble form of Siglec-9 provides an antitumor benefit against mammary tumor cells expressing MUC1 in transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomioka, Yukiko, E-mail: ytomi@muses.tottori-u.ac.jp; Avian Zoonosis Research Center, Faculty of Agriculture, Tottori University, Tottori 680-8553; Morimatsu, Masami, E-mail: mmorimat@vetmed.hokudai.ac.jp

    Highlights: • Tumor-associated antigen MUC1 binds to Siglec-9. • Soluble Siglec-9 reduced proliferation of MUC1-positive tumor in transgenic mice. • Soluble Siglec-9 and MUC1 on tumor cells were colocalized in transgenic mice. • MUC1 expression on tumor cells were reduced in soluble Siglec-9 transgenic mice. - Abstract: Tumor-associated MUC1 binds to Siglec-9, which is expected to mediate tumor cell growth and negative immunomodulation. We hypothesized that a soluble form of Siglec-9 (sSiglec-9) competitively inhibits a binding of MUC1 to its receptor molecules like human Siglec-9, leading to provide antitumor benefit against MUC1-expressing tumor, and generated transgenic mouse lines expressing sSiglec-9more » (sSiglec-9 Tg). When mammary tumor cells expressing MUC1 were intraperitoneally transplanted into sSiglec-9 Tg, tumor proliferation was slower with the lower histological malignancy as compared with non-transgenic mice. The sSiglec-9 was detected in the ascites caused by the tumor in the sSiglec-9 Tg, and sSiglec-9 and MUC1 were often colocalized on surfaces of the tumor cells. PCNA immunohistochemistry also revealed the reduced proliferation of the tumor cells in sSiglec-9 Tg. In sSiglec-9 Tg with remarkable suppression of tumor proliferation, MUC1 expressions were tend to be reduced. In the ascites of sSiglec-9 Tg bearing the tumor, T cells were uniformly infiltrated, whereas aggregations of degenerative T cells were often observed in the non-transgenic mice. These results suggest that sSiglec-9 has an antitumor benefit against MUC1-expressing tumor in the transgenic mice, which may avoid the negative immunomodulation and/or suppress tumor-associated MUC1 downstream signal transduction, and subsequent tumor proliferation.« less

  17. Long-term cannabidiol treatment prevents the development of social recognition memory deficits in Alzheimer's disease transgenic mice.

    PubMed

    Cheng, David; Spiro, Adena S; Jenner, Andrew M; Garner, Brett; Karl, Tim

    2014-01-01

    Impairments in cognitive ability and widespread pathophysiological changes caused by neurotoxicity, neuroinflammation, oxidative damage, and altered cholesterol homeostasis are associated with Alzheimer's disease (AD). Cannabidiol (CBD) has been shown to reverse cognitive deficits of AD transgenic mice and to exert neuroprotective, anti-oxidative, and anti-inflammatory properties in vitro and in vivo. Here we evaluate the preventative properties of long-term CBD treatment in male AβPPSwe/PS1ΔE9 (AβPP × PS1) mice, a transgenic model of AD. Control and AD transgenic mice were treated orally from 2.5 months of age with CBD (20 mg/kg) daily for 8 months. Mice were then assessed in the social preference test, elevated plus maze, and fear conditioning paradigms, before cortical and hippocampal tissues were analyzed for amyloid load, oxidative damage, cholesterol, phytosterols, and inflammation. We found that AβPP × PS1 mice developed a social recognition deficit, which was prevented by CBD treatment. CBD had no impact on anxiety or associative learning. The prevention of the social recognition deficit was not associated with any changes in amyloid load or oxidative damage. However, the study revealed a subtle impact of CBD on neuroinflammation, cholesterol, and dietary phytosterol retention, which deserves further investigation. This study is the first to demonstrate CBD's ability to prevent the development of a social recognition deficit in AD transgenic mice. Our findings provide the first evidence that CBD may have potential as a preventative treatment for AD with a particular relevance for symptoms of social withdrawal and facial recognition.

  18. Real-time PCR to determine transgene copy number and to quantitate the biolocalization of adoptively transferred cells from EGFP-transgenic mice.

    PubMed

    Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn

    2008-09-01

    Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.

  19. Transgenic neuronal expression of proopiomelanocortin attenuates hyperphagic response to fasting and reverses metabolic impairments in leptin-deficient obese mice.

    PubMed

    Mizuno, Tooru M; Kelley, Kevin A; Pasinetti, Giulio M; Roberts, James L; Mobbs, Charles V

    2003-11-01

    Hypothalamic proopiomelanocortin (POMC) gene expression is reduced in many forms of obesity and diabetes, particularly in those attributable to deficiencies in leptin or its receptor. To assess the functional significance of POMC in mediating metabolic phenotypes associated with leptin deficiency, leptin-deficient mice bearing a transgene expressing the POMC gene under control of the neuron-specific enolase promoter were produced. The POMC transgene attenuated fasting-induced hyperphagia in wild-type mice. Furthermore, the POMC transgene partially reversed obesity, hyperphagia, and hypothermia and effectively normalized hyperglycemia, glucosuria, glucose intolerance, and insulin resistance in leptin-deficient mice. Effects of the POMC transgene on glucose homeostasis were independent of the partial correction of hyperphagia and obesity. Furthermore, the POMC transgene normalized the profile of hepatic and adipose gene expression associated with gluconeogenesis, glucose output, and insulin sensitivity. These results indicate that central POMC is a key modulator of glucose homeostasis and that agonists of POMC products may provide effective therapy in treating impairments in glucose homeostasis when hypothalamic POMC expression is reduced, as occurs with leptin deficiency, hypothalamic damage, and aging.

  20. Vitamin C deficiency increases basal exploratory activity but decreases scopolamine-induced activity in APP/PSEN1 transgenic mice

    PubMed Central

    Harrison, F. E.; May, J. M.; McDonald, M. P.

    2010-01-01

    Vitamin C is a powerful antioxidant and its levels are decreased in Alzheimer's patients. Even sub-clinical vitamin C deficiency could impact disease development. To investigate this principle we crossed APP/PSEN1 transgenic mice with Gulo knockout mice unable to synthesize their own vitamin C. Experimental mice were maintained from 6 weeks of age on standard (0.33 g/L) or reduced (0.099 g/L) levels of vitamin C and then assessed for changes in behavior and neuropathology. APP/PSEN1 mice showed impaired spatial learning in the Barnes maze and water maze that was not further impacted by vitamin C level. However, long-term decreased vitamin C levels led to hyperactivity in transgenic mice, with altered locomotor habituation and increased omission errors in the Barnes maze. Decreased vitamin C also led to increased oxidative stress. Transgenic mice were more susceptible to the activity-enhancing effects of scopolamine and low vitamin C attenuated these effects in both genotypes. These data indicate an interaction between the cholinergic system and vitamin C that could be important given the cholinergic degeneration associated with Alzheimer's disease. PMID:19941887

  1. Targeted overexpression of calcitonin in gonadotrophs of transgenic mice leads to chronic hypoprolactinemia.

    PubMed

    Yuan, Ren; Kulkarni, Trupti; Wei, Fu; Shah, Girish V

    2005-01-14

    It was previously shown that calcitonin-like pituitary peptide (pit-CT) is synthesized and secreted by gonadotrophs, and pit-CT inhibits PRL gene transcription and lactotroph cell proliferation. Present studies examined long-term consequences of pit-CT overexpression on the functioning of mouse anterior pituitary (AP) gland. Targeted overexpression of pit-CT in gonadotrophs of mouse pituitaries was achieved by generating mice overexpressing bovine luteinizing hormone (LH)-alpha subunit promoter-pit-CT cDNA transgene. Transgenic (pit-CT+) mice displayed chronic but selective overexpression of pit-CT in gonadotrophs. The mice also displayed a dramatic decline in PRL gene expression as assessed by PRL mRNA abundance, PRL immunohistochemistry (IHC) and serum PRL levels. LH secretion in pit-CT+ mice was also reduced, without any change in FSH secretion. Reproductive abnormalities such as prolonged estrous cycles, reduced pregnancy rate, delivery of smaller litters, increased neonatal mortality and deficient lactation were also observed. Administration of PRL during early pregnancy significantly increased the pregnancy rate and neonatal survival of newborns. These results demonstrate that overexpression of pit-CT leads to chronic hypoprolactinemia and reproductive dysfunction in female mice, and reinforces the possibility that gonadotroph-derived pit-CT is an important paracrine regulator of lactotroph function.

  2. Transgenic expression of cyclooxygenase-2 (COX2) causes premature aging phenotypes in mice.

    PubMed

    Kim, Joohwee; Vaish, Vivek; Feng, Mingxiao; Field, Kevin; Chatzistamou, Ioulia; Shim, Minsub

    2016-10-07

    Cyclooxygenase (COX) is a key enzyme in the biosynthesis of prostanoids, lipid signaling molecules that regulate various physiological processes. COX2, one of the isoforms of COX, is highly inducible in response to a wide variety of cellular and environmental stresses. Increased COX2 expression is thought to play a role in the pathogenesis of many age-related diseases. COX2 expression is also reported to be increased in the tissues of aged humans and mice, which suggests the involvement of COX2 in the aging process. However, it is not clear whether the increased COX2 expression is causal to or a result of aging. We have now addressed this question by creating an inducible COX2 transgenic mouse model. Here we show that post-natal expression of COX2 led to a panel of aging-related phenotypes. The expression of p16, p53, and phospho-H2AX was increased in the tissues of COX2 transgenic mice. Additionally, adult mouse lung fibroblasts from COX2 transgenic mice exhibited increased expression of the senescence-associated β-galactosidase. Our study reveals that the increased COX2 expression has an impact on the aging process and suggests that modulation of COX2 and its downstream signaling may be an approach for intervention of age-related disorders.

  3. Overexpression of BID in thyroids of transgenic mice increases sensitivity to iodine-induced autoimmune thyroiditis

    PubMed Central

    2014-01-01

    Background BID functions as a bridge molecule between death-receptor and mitochondrial related apoptotic pathways to amplify apoptotic signaling. Our previous studies have demonstrated a substantial increase in BID expression in primary normal thyroid epithelia cells treated with inflammatory cytokines, including the combination of IFNγ and IL-1β or IFNγ and TNFα. The aim of this study was to determine whether an increase in BID expression in thyroid can induce autoimmune thyroiditis. Methods A transgenic mouse line that expresses human BID in thyroid cells was established by fusing a mouse thyroglobulin (Tg) promoter upstream of human BID (Tg-BID). We tested whether the increased expression of pro-apoptotic BID in thyroid would induce autoimmune thyroiditis, both in the presence and absence of 0.3% iodine water. Results Our data show that Tg-BID mice in a CBA/J (H-2 k) background do not spontaneously develop autoimmune thyroiditis for over a year. However, upon ingestion of iodine in the drinking water, autoimmune thyroiditis does develop in Tg-BID transgenic mice, as shown by a significant increase in anti-Tg antibody and mononuclear cell infiltration in the thyroid glands in 30% of mice tested. Serum T4 levels, however, were similar between iodine-treated Tg-BID transgenic mice and the wild type mice. Conclusions Our data demonstrate that increased thyroid expression of BID facilitates the development of autoimmune thyroiditis induced by iodine uptake. However, the overexpression of BID itself is not sufficient to initiate thyroiditis in CBA/J (H-2 k) mice. PMID:24957380

  4. Tissue-specific and hormonally regulated expression of a rat alpha 2u globulin gene in transgenic mice.

    PubMed Central

    Soares, V da C; Gubits, R M; Feigelson, P; Costantini, F

    1987-01-01

    To investigate the tissue-specific and hormonal regulation of the rat alpha 2u globulin gene family, we introduced one cloned member of the gene family into the mouse germ line and studied its expression in the resulting transgenic mice. Alpha 2u globulingene 207 was microinjected on a 7-kilobase DNA fragment, and four transgenic lines were analyzed. The transgene was expressed at very high levels, specifically in the liver and the preputial gland of adult male mice. The expression in male liver was first detected at puberty, and no expression was detected in female transgenic mice. This pattern of expression is similar to the expression of endogenous alpha 2u globulin genes in the rat but differs from the expression of the homologous mouse major urinary protein (MUP) gene family in that MUPs are synthesized in female liver and not in the male preputial gland. We conclude that these differences between rat alpha 2u globulin and mouse MUP gene expression are due to evolutionary differences in cis-acting regulatory elements. The expression of the alpha 2u globulin transgene in the liver was abolished by castration and fully restored after testosterone replacement. The expression could also be induced in the livers of female mice by treatment with either testosterone or dexamethasone, following ovariectomy and adrenalectomy. Therefore, the cis-acting elements responsible for regulation by these two hormones, as well as those responsible for tissue-specific expression, are closely linked to the alpha 2u globulin gene. Images PMID:2446121

  5. Genetic element from human surfactant protein SP-C gene confers bronchiolar-alveolar cell specificity in transgenic mice.

    PubMed

    Glasser, S W; Korfhagen, T R; Wert, S E; Bruno, M D; McWilliams, K M; Vorbroker, D K; Whitsett, J A

    1991-10-01

    Transgenic mice bearing chimeric genes consisting of 5'-sequences derived from the human surfactant protein C (SP-C) gene and the bacterial chloramphenicol acetyltransferase (CAT) gene were generated. Analysis of CAT activity was utilized to demonstrate tissue-specific and developmental expression of chimeric genes containing 3.7 kb of sequences from the human SP-C gene. Lung-specific expression of the 3.7 SP-C-CAT transgene was observed in eight distinct transgenic mouse lines. Expression of the 3.7 SP-C-CAT transgene was first detected in fetal lung on day 11 of gestation and increased dramatically with advancing gestational age, reaching adult levels of activity before birth. In situ hybridization demonstrated that expression of 3.7 SP-C-CAT mRNA was confined to the distal respiratory epithelium. Antisense CAT hybridization was detected in bronchiolar and type II epithelial cells in the adult lung of the 3.7 SP-C-CAT transgenic mice. In situ hybridization of four distinct 3.7 SP-C-CAT transgenic mouse lines demonstrated bronchiolar-alveolar expression of the chimeric CAT gene, although the relative intensity of expression at each site varied within the lines studied. Glucocorticoids increased murine SP-C mRNA in fetal lung organ culture. Likewise, expression of 3.7 SP-C-CAT transgene increased during fetal lung organ or explant culture and was further enhanced by glucocorticoid in vitro. The 5'-regions of human SP-C conferred developmental, lung epithelial, and glucocorticoid-enhanced expression of bacterial CAT in transgenic mice. The increased expression of SP-C accompanying prenatal lung development and exposure to glucocorticoid is mediated, at least in part, at the transcriptional level, being influenced by cis-active elements contained within the 5'-flanking region of the human SP-C gene.

  6. Utrophin Up-Regulation by an Artificial Transcription Factor in Transgenic Mice

    PubMed Central

    Mattei, Elisabetta; Corbi, Nicoletta; Di Certo, Maria Grazia; Strimpakos, Georgios; Severini, Cinzia; Onori, Annalisa; Desantis, Agata; Libri, Valentina; Buontempo, Serena; Floridi, Aristide; Fanciulli, Maurizio; Baban, Dilair; Davies, Kay E.; Passananti, Claudio

    2007-01-01

    Duchenne Muscular Dystrophy (DMD) is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter “A”. Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP) demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics. PMID:17712422

  7. Sex dimorphisms of crossbridge cycling kinetics in transgenic hypertrophic cardiomyopathy mice.

    PubMed

    Birch, Camille L; Behunin, Samantha M; Lopez-Pier, Marissa A; Danilo, Christiane; Lipovka, Yulia; Saripalli, Chandra; Granzier, Henk; Konhilas, John P

    2016-07-01

    Familial hypertrophic cardiomyopathy (HCM) is a disease of the sarcomere and may lead to hypertrophic, dilated, restrictive, and/or arrhythmogenic cardiomyopathy, congestive heart failure, or sudden cardiac death. We hypothesized that hearts from transgenic HCM mice harboring a mutant myosin heavy chain increase the energetic cost of contraction in a sex-specific manner. To do this, we assessed Ca(2+) sensitivity of tension and crossbridge kinetics in demembranated cardiac trabeculas from male and female wild-type (WT) and HCM hearts at an early time point (2 mo of age). We found a significant effect of sex on Ca(2+) sensitivity such that male, but not female, HCM mice displayed a decrease in Ca(2+) sensitivity compared with WT counterparts. The HCM transgene and sex significantly impacted the rate of force redevelopment by a rapid release-restretch protocol and tension cost by the ATPase-tension relationship. In each of these measures, HCM male trabeculas displayed a gain-of-function when compared with WT counterparts. In addition, cardiac remodeling measured by echocardiography, histology, morphometry, and posttranslational modifications demonstrated sex- and HCM-specific effects. In conclusion, female and male HCM mice display sex dimorphic crossbridge kinetics accompanied by sex- and HCM-dependent cardiac remodeling at the morphometric, histological, and cellular level. Copyright © 2016 the American Physiological Society.

  8. The influence of convection drying on the physicochemical properties of yacón (Smallanthus sonchifolius)

    NASA Astrophysics Data System (ADS)

    Salinas, Juan Gabriel; Alvarado, Juan Antonio; Bergenståhl, Björn; Tornberg, Eva

    2018-04-01

    Yacón root is a natural source of fructans, which has many potential benefits. Convective drying has been applied to increase the shelf life of yacón roots. However, this processing may lead to detrimental effects on the physicochemical functionality. The drying was investigated using different conditions (drying temperatures of 45 °C, 50 °C and 55 °C at a drying air velocity of 2 m/s and 60 °C at a drying air velocity of 2 m/s, 3 m/s and 4 m/s). The dried samples were compared to the original yacón with regard to their physicochemical properties. From all the properties that were studied, the color of the dried material and the elastic modulus of the reconstituted yacón were the most important properties being minimized respectively. The results of this investigation indicate that the best drying conditions, where the physicochemical properties of the samples are kept closest to the original material, are obtained either by using temperatures of 55 °C and 2 m/s or using higher temperatures but increasing the air velocity.

  9. [Effect of electroacupuncture on the behavior and hippocampal ultrastructure in APP 695 V 717 I transgenic mice].

    PubMed

    Xue, Wei-Guo; Ge, Gui-Ling; Zhang, Zhong; Xu, Hong; Bai, Li-Min

    2009-10-01

    To investigate the ultrastructural basis underlying electroacupuncture (EA) induced improvement of Alzheimer disease (AD) in transgenic mice. Twelve APP 695 V 717 I transgenic mice were randomly divided into model group and EA group; and other 6 negative transgenic mice (C 57 BL/6 J) were made up of normal control group. After 3 months treatment by EA (15 min per other day, 2 Hz/100 Hz, 3-4 mA) applied to "Baihui" (GV 20) and "Yongquan" (KI 1), the learning and memory ability of mice was measured by Lashley III water maze test, and the ultrastructural changes of hippocampal CA 1 region was observed by electronic microscopy. The swimming escape latency and the number of navigating errors (dead-end forward swimming) in model group were significantly longer and more than those in normal control group (P < 0.05); and those in EA group were considerably shorter and fewer than those in model group (P < 0.05), suggesting an improvement of learning-memory ability after EA. Comparison of the ultrastructure of the neurons in the hippocampal CA 1 region showed swelling of the mitochondria, broken or disappearance of the mitochondrial cristae, degeneration of the synapses, breakage and vague outline of the basement membrane of the blood capillaries in mice of model group; and basically distinct outline of the mitochondrial cristae and microvessels, and more synaptic vesicles in EA group. EA may effectively improve the learning-memory capacity of the APP transgenic AD mice and alleviate the pathological changes of neurons of the hippocampal CA 1 region, which may be one of the mechanisms underlying the improvement of AD by EA.

  10. The murine SP-C promoter directs type II cell-specific expression in transgenic mice.

    PubMed

    Glasser, Stephan W; Eszterhas, Susan K; Detmer, Emily A; Maxfield, Melissa D; Korfhagen, Thomas R

    2005-04-01

    Genomic DNA from the mouse pulmonary surfactant protein C (SP-C) gene was analyzed in transgenic mice to identify DNA essential for alveolar type II cell-specific expression. SP-C promoter constructs extending either 13 or 4.8 kb upstream of the transcription start site directed lung-specific expression of the bacterial chloramphenicol acetyl transferase (CAT) reporter gene. In situ hybridization analysis demonstrated alveolar cell-specific expression in the lungs of adult transgenic mice, and the pattern of 4.8 SP-C-CAT expression during development paralleled that of the endogenous SP-C gene. With the use of deletion constructs, lung-specific, low-level CAT activity was detected in tissue assays of SP-C-CAT transgenic mice retaining 318 bp of the promoter. In transient and stable cell transfection experiments, the 4.8-kb SP-C promoter was 90-fold more active as a stably integrated gene. These findings indicate that 1) the 4.8-kb SP-C promoter is sufficient to direct cell-specific and developmental expression, 2) an enhancer essential for lung-specific expression maps to the proximal 318-bp promoter, and 3) the activity of the 4.8-kb SP-C promoter construct is highly dependent on its chromatin environment.

  11. Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

    PubMed Central

    Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

    1986-01-01

    Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

  12. Osteoblasts are target cells for transformation in c-fos transgenic mice

    PubMed Central

    1993-01-01

    We have generated transgenic mice expressing the proto-oncogene c-fos from an H-2Kb class I MHC promoter as a tool to identify and isolate cell populations which are sensitive to altered levels of Fos protein. All homozygous H2-c-fosLTR mice develop osteosarcomas with a short latency period. This phenotype is specific for c-fos as transgenic mice expressing the fos- and jun-related genes, fosB and c-jun, from the same regulatory elements do not develop any pathology despite high expression in bone tissues. The c-fos transgene is not expressed during embryogenesis but is expressed after birth in bone tissues before the onset of tumor formation, specifically in putative preosteoblasts, bone- forming osteoblasts, osteocytes, as well as in osteoblastic cells present within the tumors. Primary and clonal cell lines established from c-fos-induced tumors expressed high levels of exogenous c-fos as well as the bone cell marker genes, type I collagen, alkaline phosphatase, and osteopontin/2ar. In contrast, osteocalcin/BGP expression was either low or absent. All cell lines were tumorigenic in vivo, some of which gave rise to osteosarcomas, expressing exogenous c- fos mRNA, and Fos protein in osteoblastic cells. Detailed analysis of one osteogenic cell line, P1, and several P1-derived clonal cell lines indicated that bone-forming osteoblastic cells were transformed by Fos. The regulation of osteocalcin/BGP and alkaline phosphatase gene expression by 1,25-dihydroxyvitamin D3 was abrogated in P1-derived clonal cells, whereas glucocorticoid responsiveness was unaltered. These results suggest that high levels of Fos perturb the normal growth control of osteoblastic cells and exert specific effects on the expression of the osteoblast phenotype. PMID:8335693

  13. Studies on induction of lamotrigine metabolism in transgenic UGT1 mice

    PubMed Central

    Argikar, U. A.; Senekeo-Effenberger, K.; Larson, E. E.; Tukey, R. H.; Remmel, R. P.

    2010-01-01

    A transgenic ‘knock-in’ mouse model expressing a human UGT1 locus (Tg-UGT1) was recently developed and validated. Although these animals express mouse UGT1A proteins, UGT1A4 is a pseudo-gene in mice. Therefore, Tg-UGT1 mice serve as a ‘humanized’ UGT1A4 animal model.Lamotrigine (LTG) is primarily metabolized to its N-glucuronide (LTGG) by hUGT1A4. This investigation aimed at examining the impact of pregnane X receptor (PXR), constitutive androstane receptor (CAR) and peroxisome proliferator-activated receptor (PPAR) activators on LTG glucuronidation in vivo and in vitro. Tg-UGT1 mice were administered the inducers phenobarbital (CAR), pregnenolone-16α-carbonitrile (PXR), WY-14643 (PPAR-α), ciglitazone (PPAR-γ), or L-165041 (PPAR-β), once daily for 3 or 4 days. Thereafter, LTG was administered orally and blood samples were collected over 24 h. LTG was measured in blood and formation of LTGG was measured in pooled microsomes made from the livers of treated animals.A three-fold increase in in vivo LTG clearance was seen after phenobarbital administration. In microsomes prepared from phenobarbital-treated Tg-UGT1 animals, 13-fold higher CLint (Vmax/Km) value was observed as compared with the untreated transgenic mice. A trend toward induction of catalytic activity in vitro and in vivo was also observed following pregnenolone-16α-carbonitrile and WY-14643 treatment. This study demonstrates the successful application of Tg-UGT1 mice as a novel tool to study the impact of induction and regulation on metabolism of UGT1A4 substrates. PMID:19845433

  14. Divergent prion strain evolution driven by PrPC expression level in transgenic mice

    PubMed Central

    Le Dur, Annick; Laï, Thanh Lan; Stinnakre, Marie-George; Laisné, Aude; Chenais, Nathalie; Rakotobe, Sabine; Passet, Bruno; Reine, Fabienne; Soulier, Solange; Herzog, Laetitia; Tilly, Gaëlle; Rézaei, Human; Béringue, Vincent; Vilotte, Jean-Luc; Laude, Hubert

    2017-01-01

    Prions induce a fatal neurodegenerative disease in infected host brain based on the refolding and aggregation of the host-encoded prion protein PrPC into PrPSc. Structurally distinct PrPSc conformers can give rise to multiple prion strains. Constrained interactions between PrPC and different PrPSc strains can in turn lead to certain PrPSc (sub)populations being selected for cross-species transmission, or even produce mutation-like events. By contrast, prion strains are generally conserved when transmitted within the same species, or to transgenic mice expressing homologous PrPC. Here, we compare the strain properties of a representative sheep scrapie isolate transmitted to a panel of transgenic mouse lines expressing varying levels of homologous PrPC. While breeding true in mice expressing PrPC at near physiological levels, scrapie prions evolve consistently towards different strain components in mice beyond a certain threshold of PrPC overexpression. Our results support the view that PrPC gene dosage can influence prion evolution on homotypic transmission. PMID:28112164

  15. In vivo regulation of the heme oxygenase-1 gene in humanized transgenic mice

    PubMed Central

    Kim, Junghyun; Zarjou, Abolfazl; Traylor, Amie M.; Bolisetty, Subhashini; Jaimes, Edgar A.; Hull, Travis D.; George, James F.; Mikhail, Fady M.; Agarwal, Anupam

    2012-01-01

    Heme oxygenase-1 (HO-1) catalyzes the rate-limiting step in heme degradation producing equimolar amounts of carbon monoxide, iron, and biliverdin. Induction of HO-1 is a beneficial response to tissue injury in diverse animal models of diseases including acute kidney injury. In vitro analysis has shown that the human HO-1 gene is transcriptionally regulated by changes in chromatin conformation but whether such control occurs in vivo is not known. To enable such analysis, we generated transgenic mice, harboring an 87-kb bacterial artificial chromosome expressing human HO-1 mRNA and protein and bred these mice with HO-1 knockout mice to generate humanized BAC transgenic mice. This successfully rescued the phenotype of the knockout mice including reduced birth rates, tissue iron overload, splenomegaly, anemia, leukocytosis, dendritic cell abnormalities and survival after acute kidney injury induced by rhabdomyolysis or cisplatin nephrotoxicity. Transcription factors such as USF1/2, JunB, Sp1, and CTCF were found to associate with regulatory regions of the human HO-1 gene in the kidney following rhabdomyolysis. Chromosome Conformation Capture and ChIP-loop assays confirmed this in the formation of chromatin looping in vivo. Thus, these bacterial artificial chromosome humanized HO-1 mice are a valuable model to study the human HO-1 gene providing insight to the in vivo architecture of the gene in acute kidney injury and other diseases. PMID:22495295

  16. Epidermal dysplasia and abnormal hair follicles in transgenic mice overexpressing homeobox gene MSX-2.

    PubMed

    Jiang, T X; Liu, Y H; Widelitz, R B; Kundu, R K; Maxson, R E; Chuong, C M

    1999-08-01

    The homeobox gene Msx-2 is expressed specifically in sites of skin appendage formation. To explore its part in skin morphogenesis, we produced transgenic mice expressing Msx-2 under the control of the cytomegalovirus promoter. The skin of these transgenic mice was flaky, exhibiting desquamation and shorter hairs. Histologic analysis showed thickened epidermis with hyperproliferation, which was restricted to the basal layer. Hyperkeratosis was also evident. A wide zone of suprabasal cells were misaligned and coexpressed keratins 14 and 10. There was reduced expression of integrin beta 1 and DCC in the basal layer. Hair follicles were misaligned with a shrunken matrix region. The dermis showed increased cellularity and empty vacuoles. We suggest that Msx-2 is involved in the growth control of skin and skin appendages.

  17. Spontaneous Generation of Infectious Prion Disease in Transgenic Mice

    PubMed Central

    Castilla, Joaquín; Pintado, Belén; Gutiérrez-Adan, Alfonso; Andréoletti, Olivier; Aguilar-Calvo, Patricia; Arroba, Ana-Isabel; Parra-Arrondo, Beatriz; Ferrer, Isidro; Manzanares, Jorge; Espinosa, Juan-Carlos

    2013-01-01

    We generated transgenic mice expressing bovine cellular prion protein (PrPC) with a leucine substitution at codon 113 (113L). This protein is homologous to human protein with mutation 102L, and its genetic link with Gerstmann–Sträussler–Scheinker syndrome has been established. This mutation in bovine PrPC causes a fully penetrant, lethal, spongiform encephalopathy. This genetic disease was transmitted by intracerebral inoculation of brain homogenate from ill mice expressing mutant bovine PrP to mice expressing wild-type bovine PrP, which indicated de novo generation of infectious prions. Our findings demonstrate that a single amino acid change in the PrPC sequence can induce spontaneous generation of an infectious prion disease that differs from all others identified in hosts expressing the same PrPC sequence. These observations support the view that a variety of infectious prion strains might spontaneously emerge in hosts displaying random genetic PrPC mutations. PMID:24274622

  18. Transgenic overexpression of p23 induces spontaneous hydronephrosis in mice

    PubMed Central

    Lee, Jaehoon; Kim, Hye Jin; Moon, Jung Ah; Sung, Young Hoon; Baek, In-Jeoung; Roh, Jae-il; Ha, Na Young; Kim, Seung-Yeon; Bahk, Young Yil; Lee, Jong Eun; Yoo, Tae Hyun; Lee, Han-Woong

    2011-01-01

    p23 is a cochaperone of heat shock protein 90 and also interacts functionally with numerous steroid receptors and kinases. However, the in vivo roles of p23 remain unclear. To explore its in vivo function, we generated the transgenic (TG) mice ubiquitously overexpressing p23. The p23 TG mice spontaneously developed kidney abnormalities closely resembling human hydronephrosis. Consistently, kidney functions deteriorate significantly in the p23 TG mice compared to their wild-type (WT) littermates. Furthermore, the expression of target genes for aryl hydrocarbon receptor (AhR), such as cytochrome P450, family 1, subfamily A, polypeptide 1 (Cyp1A1) and cytochrome P450, family 1, subfamily B, polypeptide 1 (Cyp1B1), were induced in the kidneys of the p23 TG mice. These results indicate that the overexpression of p23 contributes to the development of hydronephrosis through the upregulation of the AhR pathway in vivo. PMID:21323770

  19. Supplementation with macular carotenoids improves visual performance of transgenic mice.

    PubMed

    Li, Binxing; Rognon, Gregory T; Mattinson, Ty; Vachali, Preejith P; Gorusupudi, Aruna; Chang, Fu-Yen; Ranganathan, Arunkumar; Nelson, Kelly; George, Evan W; Frederick, Jeanne M; Bernstein, Paul S

    2018-07-01

    Carotenoid supplementation can improve human visual performance, but there is still no validated rodent model to test their effects on visual function in laboratory animals. We recently showed that mice deficient in β-carotene oxygenase 2 (BCO2) and/or β-carotene oxygenase 1 (BCO1) enzymes can accumulate carotenoids in their retinas, allowing us to investigate the effects of carotenoids on the visual performance of mice. Using OptoMotry, a device to measure visual function in rodents, we examined the effect of zeaxanthin, lutein, and β-carotene on visual performance of various BCO knockout mice. We then transgenically expressed the human zeaxanthin-binding protein GSTP1 (hGSTP1) in the rods of bco2 -/- mice to examine if delivering more zeaxanthin to retina will improve their visual function further. The visual performance of bco2 -/- mice fed with zeaxanthin or lutein was significantly improved relative to control mice fed with placebo beadlets. β-Carotene had no significant effect in bco2 -/- mice but modestly improved cone visual function of bco1 -/- mice. Expression of hGSTP1 in the rods of bco2 -/- mice resulted in a 40% increase of retinal zeaxanthin and further improvement of visual performance. This work demonstrates that these "macular pigment mice" may serve as animal models to study carotenoid function in the retina. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. The nature of youth care tasks in families experiencing chronic illness/disability: development of the Youth Activities of Caregiving Scale (YACS).

    PubMed

    Ireland, Michael James; Pakenham, Kenneth Ian

    2010-07-01

    The purpose of this study was to develop an empirically derived multi-item scale of care tasks performed by young people in the context of family illness/disability: the Youth Activities of Caregiving Scale (YACS). A total of 135 youngsters aged 10-24 years with an ill/disabled family member completed questionnaires. Factor analyses performed on the YACS yielded four factors, instrumental care, social/emotional care, personal/intimate care and domestic/household care, accounting for 57.78% of the variance. The internal reliabilities of all factors ranged from 0.74 to 0.92. Higher scores on the YACS related to higher youth age and several caregiving context variables (i.e. household type [single or dual-parent household], relationship with care-recipient and perceived choice in caregiving). Higher scores on the YACS also related to care-recipient illness/disability variables (onset, functional impairment, prognosis, predictability and illness/disability type). Strong positive correlations between the YACS and a conceptually related measure of young caregiving experiences provided good convergent validity data. Criterion validity was established with evidence that the YACS predicted youth adjustment in the domains of health and prosocial behaviour.

  1. Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

    PubMed

    Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

    2013-01-01

    Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy

  2. Search Strategies Used by "APP" Transgenic Mice during Navigation in the Morris Water Maze

    ERIC Educational Resources Information Center

    Janus, Christopher

    2004-01-01

    TgCRND8 mice represent a transgenic mouse model of Alzheimer's disease, with onset of cognitive impairment and increasing amyloid-[beta] plaques in their brains at 12 weeks of age. In this study, the spatial memory in 25- to 30-week-old TgCRND8 mice was analyzed in two reference and one working memory Morris water maze (MWM) tests. In reference…

  3. Expression of endogenous mouse APP modulates β-amyloid deposition in hAPP-transgenic mice.

    PubMed

    Steffen, Johannes; Krohn, Markus; Schwitlick, Christina; Brüning, Thomas; Paarmann, Kristin; Pietrzik, Claus U; Biverstål, Henrik; Jansone, Baiba; Langer, Oliver; Pahnke, Jens

    2017-06-20

    Amyloid-β (Aβ) deposition is one of the hallmarks of the amyloid hypothesis in Alzheimer's disease (AD). Mouse models using APP-transgene overexpression to generate amyloid plaques have shown to model only certain parts of the disease. The extent to which the data from mice can be transferred to man remains controversial. Several studies have shown convincing treatment results in reducing Aβ and enhancing cognition in mice but failed totally in human. One model-dependent factor has so far been almost completely neglected: the endogenous expression of mouse APP and its effects on the transgenic models and the readout for therapeutic approaches.Here, we report that hAPP-transgenic models of amyloidosis devoid of endogenous mouse APP expression (mAPP-knockout / mAPPko) show increased amounts and higher speed of Aβ deposition than controls with mAPP. The number of senile plaques and the level of aggregated hAβ were elevated in mAPPko mice, while the deposition in cortical blood vessels was delayed, indicating an alteration in the general aggregation propensity of hAβ together with endogenous mAβ. Furthermore, the cellular response to Aβ deposition was modulated: mAPPko mice developed a pronounced and age-dependent astrogliosis, while microglial association to amyloid plaques was diminished. The expression of human and murine aggregation-prone proteins with differing amino acid sequences within the same mouse model might not only alter the extent of deposition but also modulate the route of pathogenesis, and thus, decisively influence the study outcome, especially in translational research.

  4. Transcervical Inoculation with Chlamydia trachomatis Induces Infertility in HLA-DR4 Transgenic and Wild-Type Mice.

    PubMed

    Pal, Sukumar; Tifrea, Delia F; Zhong, Guangming; de la Maza, Luis M

    2018-01-01

    Chlamydia trachomatis is the leading cause of infection-induced infertility in women. Attempts to control this epidemic with screening programs and antibiotic therapy have failed. Currently, a vaccine to prevent C. trachomatis infections is not available. In order to develop an animal model for evaluating vaccine antigens that can be applied to humans, we used C. trachomatis serovar D (strain UW-3/Cx) to induce infertility in mice whose major histocompatibility complex class II antigen was replaced with the human leukocyte antigen DR4 (HLA-DR4). Transcervical inoculation of medroxyprogesterone-treated HLA-DR4 transgenic mice with 5 × 10 5 C. trachomatis D inclusion forming units (IFU) induced a significant reduction in fertility, with a mean number of embryos/mouse of 4.4 ± 1.3 compared to 7.8 ± 0.5 for the uninfected control mice ( P < 0.05). A similar fertility reduction was elicited in the wild-type (WT) C57BL/6 mice (4.3 ± 1.4 embryos/mouse) compared to the levels of the WT controls (9.1 ± 0.4 embryos/mouse) ( P < 0.05). Following infection, WT mice mounted more robust humoral and cellular immune responses than HLA-DR4 mice. As determined by vaginal shedding, HLA-DR4 mice were more susceptible to a transcervical C. trachomatis D infection than WT mice. To assess if HLA-DR4 transgenic and WT mice could be protected by vaccination, 10 4 IFU of C. trachomatis D was delivered intranasally, and mice were challenged transcervically 6 weeks later with 5 × 10 5 IFU of C. trachomatis D. As determined by severity and length of vaginal shedding, WT C57BL/6 and HLA-DR4 mice were significantly protected by vaccination. The advantages and limitations of the HLA-DR4 transgenic mouse model for evaluating human C. trachomatis vaccine antigens are discussed. Copyright © 2017 American Society for Microbiology.

  5. Compensation of the AKT signaling by ERK signaling in transgenic mice hearts overexpressing TRIM72

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ham, Young-Mi, E-mail: youngmi_ham@hms.harvard.edu; Department of Cell Biology, Harvard Medical School, Boston, MA 02115; Mahoney, Sarah Jane

    The AKT and ERK signaling pathways are known to be involved in cell hypertrophy, proliferation, survival and differentiation. Although there is evidence for crosstalk between these two signaling pathways in cellulo, there is less evidence for cross talk in vivo. Here, we show that crosstalk between AKT and ERK signaling in the hearts of TRIM72-overexpressing transgenic mice (TRIM72-Tg) with alpha-MHC promoter regulates and maintains their heart size. TRIM72, a heart- and skeletal muscle-specific protein, downregulates AKT-mTOR signaling via IRS-1 degradation and reduces the size of rat cardiomyocytes and the size of postnatal TRIM72-Tg hearts. TRIM72 expression was upregulated by hypertrophicmore » inducers in cardiomyocytes, while IRS-1 was downregulated by IGF-1. TRIM72 specifically regulated IGF-1-dependent AKT-mTOR signaling, resulting in a reduction of the size of cardiomyocytes. Postnatal TRIM72-Tg hearts were smaller than control-treated hearts with inhibition of AKT-mTOR signaling. However, adult TRIM72-Tg hearts were larger than of control despite the suppression of AKT-mTOR signaling. Activation of ERK, PKC-α, and JNK were observed to be elevated in adult TRIM72-Tg, and these signals were mediated by ET-1 via the ET receptors A and B. Altogether, these results suggest that AKT signaling regulates cardiac hypertrophy in physiological conditions, and ERK signaling compensates for the absence of AKT signaling during TRIM72 overexpression, leading to pathological hypertrophy. -- Highlights: • TRIM72 inhibits AKT signaling through ubiquitination of IRS-1 in cardiac cells. • TRIM72 regulates the size of cardiac cells. • TRIM72 regulates size of postnatal TRIM72-overexpressing transgenic mice hearts. • Adult TRIM72-overexpressing transgenic mice hearts showed cardiac dysfunction. • Adult TRIM72 transgenic mice hearts showed higher expression of endothelin receptors.« less

  6. Transgenic expression of human neutrophil peptide-1 enhances hepatic fibrosis in mice fed a choline-deficient, L-amino acid-defined diet.

    PubMed

    Ibusuki, Rie; Uto, Hirofumi; Arima, Shiho; Mawatari, Seiichi; Setoguchi, Yoshiko; Iwashita, Yuji; Hashimoto, Shinichi; Maeda, Takuro; Tanoue, Shiro; Kanmura, Shuji; Oketani, Makoto; Ido, Akio; Tsubouchi, Hirohito

    2013-11-01

    Neutrophils infiltrate the livers of patients with nonalcoholic steatohepatitis (NASH). Human neutrophil peptides (HNPs) induce cytokine and chemokine production under inflammatory conditions, which may contribute to the progression of NASH. In this study, we focused on the effects of HNP-1 on hepatic steatosis and fibrosis in a mouse model of NASH induced by a choline-deficient, L-amino acid-defined (CDAA) diet. We generated transgenic mice expressing HNP-1 under the control of a β-actin-based promoter. HNP-1 transgenic and wild-type C57BL/6N mice were fed a CDAA diet for 16 weeks to induce hepatic steatosis and fibrosis. Serological and histological features were examined, and the effects of HNP-1 on hepatic stellate cell lines were assessed. HNP-1 transgenic and wild-type mice fed the CDAA diet showed no significant differences in serum alanine aminotransferase levels or the degree of hepatic steatosis based on Oil red O staining and hepatic triglyceride content. In contrast, Sirius Red and Azan staining showed significantly more severe hepatic fibrosis in HNP-1 transgenic mice compared with wild-type mice. In addition, significantly more α-smooth muscle actin-positive hepatic stellate cells were observed in the transgenic mice than in the wild-type mice. Finally, the proliferation of the LI90 hepatic stellate cell line increased in response to HNP-1. Our data indicate that HNP-1 enhances hepatic fibrosis in fatty liver by inducing hepatic stellate cell proliferation. Thus, neutrophil-derived HNP-1 may contribute to the progression of NASH. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Epithalon decelerates aging and suppresses development of breast adenocarcinomas in transgenic her-2/neu mice.

    PubMed

    Anisimov, V N; Khavinson, V Kh; Alimova, I N; Semchenko, A V; Yashin, A I

    2002-08-01

    Female transgenic FVB/N mice carrying the breast cancer gene HER-2/neu received epithalon (Ala-Glu-Asp-Gly) in a dose of 1 mg subcutaneously 5 times a week to from the 2nd month of life to death. Epithalon prolonged the average and maximum lifetimes of mice by 13.5 (p<0.05) and 13.9%, respectively. The peptide prolonged the average lifetime of animals without neoplasms (by 34.2%, p<0.05). Epithalon decelerated the development of age-related disturbances in reproductive activity and suppressed the formation of neoplasms. The peptide decreased the incidence of breast adenocarcinomas, lungs metastases (by 1.6 times, p<0.05), and multiple tumors (by 2 times). Epithalon 3.7-fold increased the number of mice without breast tumors (p<0.05), while the number of animals with 6 or more breast tumors decreased by 3 times (p<0.05). Epithalon prolonged the lifetime of mice with breast tumors by 1.4 times (p<0.05). These results indicate that Epithalon possesses geroprotective activity and inhibits breast carcinogenesis in transgenic mice, which is probably related to suppression of HER-2/neu expression.

  8. Bone turnover in wild type and pleiotrophin-transgenic mice housed for three months in the International Space Station (ISS).

    PubMed

    Tavella, Sara; Ruggiu, Alessandra; Giuliani, Alessandra; Brun, Francesco; Canciani, Barbara; Manescu, Adrian; Marozzi, Katia; Cilli, Michele; Costa, Delfina; Liu, Yi; Piccardi, Federica; Tasso, Roberta; Tromba, Giuliana; Rustichelli, Franco; Cancedda, Ranieri

    2012-01-01

    Bone is a complex dynamic tissue undergoing a continuous remodeling process. Gravity is a physical force playing a role in the remodeling and contributing to the maintenance of bone integrity. This article reports an investigation on the alterations of the bone microarchitecture that occurred in wild type (Wt) and pleiotrophin-transgenic (PTN-Tg) mice exposed to a near-zero gravity on the International Space Station (ISS) during the Mice Drawer System (MDS) mission, to date, the longest mice permanence (91 days) in space. The transgenic mouse strain over-expressing pleiotrophin (PTN) in bone was selected because of the PTN positive effects on bone turnover. Wt and PTN-Tg control animals were maintained on Earth either in a MDS payload or in a standard vivarium cage. This study revealed a bone loss during spaceflight in the weight-bearing bones of both strains. For both Tg and Wt a decrease of the trabecular number as well as an increase of the mean trabecular separation was observed after flight, whereas trabecular thickness did not show any significant change. Non weight-bearing bones were not affected. The PTN-Tg mice exposed to normal gravity presented a poorer trabecular organization than Wt mice, but interestingly, the expression of the PTN transgene during the flight resulted in some protection against microgravity's negative effects. Moreover, osteocytes of the Wt mice, but not of Tg mice, acquired a round shape, thus showing for the first time osteocyte space-related morphological alterations in vivo. The analysis of specific bone formation and resorption marker expression suggested that the microgravity-induced bone loss was due to both an increased bone resorption and a decreased bone deposition. Apparently, the PTN transgene protection was the result of a higher osteoblast activity in the flight mice.

  9. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1.

    PubMed

    Thurston, G; Suri, C; Smith, K; McClain, J; Sato, T N; Yancopoulos, G D; McDonald, D M

    1999-12-24

    Angiopoietin-1 (Ang1) and vascular endothelial growth factor (VEGF) are endothelial cell-specific growth factors. Direct comparison of transgenic mice overexpressing these factors in the skin revealed that the VEGF-induced blood vessels were leaky, whereas those induced by Ang1 were nonleaky. Moreover, vessels in Ang1-overexpressing mice were resistant to leaks caused by inflammatory agents. Coexpression of Ang1 and VEGF had an additive effect on angiogenesis but resulted in leakage-resistant vessels typical of Ang1. Ang1 therefore may be useful for reducing microvascular leakage in diseases in which the leakage results from chronic inflammation or elevated VEGF and, in combination with VEGF, for promoting growth of nonleaky vessels.

  10. Regulated expression of the Ren-2 gene in transgenic mice derived from parental strains carrying only the Ren-1 gene.

    PubMed Central

    Tronik, D; Dreyfus, M; Babinet, C; Rougeon, F

    1987-01-01

    The Ren-2 gene encoding the mouse submaxillary gland (SMG) renin was microinjected into the pronuclei of fertilized eggs from mice carrying only the Ren-1 gene. In addition to the whole transcription unit, the injected DNA contained 2.5 and 3 kb of upstream and downstream flanking sequences, respectively. Three independent transgenic mice lines were obtained; two of them had integrated one copy of the Ren-2 gene, the last one had integrated five and eleven copies at two independent sites. Independently of the number of Ren-2 copies integrated, the pattern of Ren-2 gene expression in all the transgenic mice was identical to that observed in wild-type animals in which Ren-1 and Ren-2 are closely linked on chromosome 1. In particular, the exogenous Ren-2 gene was only transcribed in the kidney and in the SMG. In the kidney, Ren-1 and Ren-2 mRNAs were present at a comparable level, whereas in the SMG Ren-2 mRNA was at least 100-fold more abundant than Ren-1 mRNA. Moreover, Ren-2 expression in the SMG was positively regulated by androgens. Only one difference between transgenic mice and wild-type mice carrying the Ren-2 gene has been observed: the basal level of Ren-2 transcription in the SMG of transgenic females was lower than in two-gene strain females. Androgen treatment of transgenic females induced SMG renin mRNA to a level identical to that of transgenic males. This suggests that the basal level of SMG renin mRNA is dependent upon cis-acting elements which are not present in the microinjected fragment. Images Fig. 1. Fig. 2. Fig. 3. PMID:3297677

  11. UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

    UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

  12. Acetaminophen-induced acute liver injury in HCV transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Uehara, Takeki; Kosyk, Oksana; Jeannot, Emmanuelle

    2013-01-15

    The exact etiology of clinical cases of acute liver failure is difficult to ascertain and it is likely that various co-morbidity factors play a role. For example, epidemiological evidence suggests that coexistent hepatitis C virus (HCV) infection increased the risk of acetaminophen-induced acute liver injury, and was associated with an increased risk of progression to acute liver failure. However, little is known about possible mechanisms of enhanced acetaminophen hepatotoxicity in HCV-infected subjects. In this study, we tested a hypothesis that HCV-Tg mice may be more susceptible to acetaminophen hepatotoxicity, and also evaluated the mechanisms of acetaminophen-induced liver damage in wildmore » type and HCV-Tg mice expressing core, E1 and E2 proteins. Male mice were treated with a single dose of acetaminophen (300 or 500 mg/kg in fed animals; or 200 mg/kg in fasted animals; i.g.) and liver and serum endpoints were evaluated at 4 and 24 h after dosing. Our results suggest that in fed mice, liver toxicity in HCV-Tg mice is not markedly exaggerated as compared to the wild-type mice. In fasted mice, greater liver injury was observed in HCV-Tg mice. In fed mice dosed with 300 mg/kg acetaminophen, we observed that liver mitochondria in HCV-Tg mice exhibited signs of dysfunction showing the potential mechanism for increased susceptibility. -- Highlights: ► Acetaminophen-induced liver injury is a significant clinical challenge. ► HCV-infected subjects may be at higher risk for acetaminophen-induced liver injury. ► We used HCV transgenics to test if liver injury due to acetaminophen is exacerbated.« less

  13. GENETIC CATHEPSIN B DEFICIENCY REDUCES β-AMYLOID IN TRANSGENIC MICE EXPRESSING HUMAN WILD-TYPE AMYLOID PRECURSOR PROTEIN

    PubMed Central

    Hook, Vivian Y. H.; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory

    2009-01-01

    Neurotoxic β-amyloid (Aβ) peptides participate in Alzheimer’s disease (AD); therefore, reduction of Aβ generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Aβ may identify targets for reducing Aβ. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decrease of Aβ40 and Aβ42 by 67% in brain, and decreases levels of the C-terminal β-secretase fragment (CTFβ) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Aβ. The difference in reduction of Aβ in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Aβ in AD. PMID:19501042

  14. Genetic cathepsin B deficiency reduces beta-amyloid in transgenic mice expressing human wild-type amyloid precursor protein.

    PubMed

    Hook, Vivian Y H; Kindy, Mark; Reinheckel, Thomas; Peters, Christoph; Hook, Gregory

    2009-08-21

    Neurotoxic beta-amyloid (Abeta) peptides participate in Alzheimer's disease (AD); therefore, reduction of Abeta generated from APP may provide a therapeutic approach for AD. Gene knockout studies in transgenic mice producing human Abeta may identify targets for reducing Abeta. This study shows that knockout of the cathepsin B gene in mice expressing human wild-type APP (hAPPwt) results in substantial decreases in brain Abeta40 and Abeta42 by 67% and decreases in levels of the C-terminal beta-secretase fragment (CTFbeta) derived from APP. In contrast, knockout of cathepsin B in mice expressing hAPP with the rare Swedish (Swe) and Indiana (Ind) mutations had no effect on Abeta. The difference in reduction of Abeta in hAPPwt mice, but not in hAPPSwe/Ind mice, shows that the transgenic model can affect cathepsin B gene knockout results. Since most AD patients express hAPPwt, these data validate cathepsin B as a target for development of inhibitors to lower Abeta in AD.

  15. Mouse Mammary Tumor Virus c-rel Transgenic Mice Develop Mammary Tumors

    PubMed Central

    Romieu-Mourez, Raphaëlle; Kim, Dong W.; Min Shin, Sang; Demicco, Elizabeth G.; Landesman-Bollag, Esther; Seldin, David C.; Cardiff, Robert D.; Sonenshein, Gail E.

    2003-01-01

    Amplification, overexpression, or rearrangement of the c-rel gene, encoding the c-Rel NF-κB subunit, has been reported in solid and hematopoietic malignancies. For example, many primary human breast cancer tissue samples express high levels of nuclear c-Rel. While the Rev-T oncogene v-rel causes tumors in birds, the ability of c-Rel to transform in vivo has not been demonstrated. To directly test the role of c-Rel in breast tumorigenesis, mice were generated in which overexpression of mouse c-rel cDNA was driven by the hormone-responsive mouse mammary tumor virus long terminal repeat (MMTV-LTR) promoter, and four founder lines identified. In the first cycle of pregnancy, the expression of transgenic c-rel mRNA was observed, and levels of c-Rel protein were increased in the mammary gland. Importantly, 31.6% of mice developed one or more mammary tumors at an average age of 19.9 months. Mammary tumors were of diverse histology and expressed increased levels of nuclear NF-κB. Analysis of the composition of NF-κB complexes in the tumors revealed aberrant nuclear expression of multiple subunits, including c-Rel, p50, p52, RelA, RelB, and the Bcl-3 protein, as observed previously in human primary breast cancers. Expression of the cancer-related NF-κB target genes cyclin D1, c-myc, and bcl-xl was significantly increased in grossly normal transgenic mammary glands starting the first cycle of pregnancy and increased further in mammary carcinomas compared to mammary glands from wild-type mice or virgin transgenic mice. In transient transfection analysis in untransformed breast epithelial cells, c-Rel-p52 or -p50 heterodimers either potently or modestly induced cyclin D1 promoter activity, respectively. Lastly, stable overexpression of c-Rel resulted in increased cyclin D1 and NF-κB p52 and p50 subunit protein levels. These results indicate for the first time that dysregulated expression of c-Rel, as observed in breast cancers, is capable of contributing to mammary

  16. The food additive vanillic acid controls transgene expression in mammalian cells and mice.

    PubMed

    Gitzinger, Marc; Kemmer, Christian; Fluri, David A; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

    2012-03-01

    Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

  17. Overproduction of cardiac S-adenosylmethionine decarboxylase in transgenic mice

    PubMed Central

    Nisenberg, Oleg; Pegg, Anthony E.; Welsh, Patricia A.; Keefer, Kerry; Shantz, Lisa M.

    2005-01-01

    The present study was designed to provide a better understanding of the role played by AdoMetDC (S-adenosylmethionine decarboxylase), the key rate-controlling enzyme in the synthesis of spermidine and spermine, in controlling polyamine levels and the importance of polyamines in cardiac physiology. The αMHC (α-myosin heavy chain) promoter was used to generate transgenic mice with cardiac-specific expression of AdoMetDC. A founder line (αMHC/AdoMetDC) was established with a >100-fold increase in AdoMetDC activity in the heart. Transgene expression was maximal by 1 week of age and remained constant into adulthood. However, the changes in polyamine levels were most pronounced during the first week of age, with a 2-fold decrease in putrescine and spermidine and a 2-fold increase in spermine. At later times, spermine returned to near control levels, whereas putrescine and spermidine levels remained lower, suggesting that compensatory mechanisms exist to limit spermine accumulation. The αMHC/AdoMetDC mice did not display an overt cardiac phenotype, but there was an increased cardiac hypertrophy after β-adrenergic stimulation with isoprenaline (‘isoproterenol’), as well as a small increase in spermine content. Crosses of the αMHC/AdoMetDC with αMHC/ornithine decarboxylase mice that have a >1000-fold increase in cardiac ornithine decarboxylase were lethal in utero, presumably due to increase in spermine to toxic levels. These findings suggest that cardiac spermine levels are highly regulated to avoid polyamine-induced toxicity and that homoeostatic mechanisms can maintain non-toxic levels even when one enzyme of the biosynthetic pathway is greatly elevated but are unable to do so when two biosynthetic enzymes are increased. PMID:16153183

  18. Biaryl Amides and Hydrazones as Therapeutics for Prion Disease in Transgenic Mice

    PubMed Central

    Lu, Duo; Giles, Kurt; Li, Zhe; Rao, Satish; Dolghih, Elena; Gever, Joel R.; Geva, Michal; Elepano, Manuel L.; Oehler, Abby; Bryant, Clifford; Renslo, Adam R.; Jacobson, Matthew P.; DeArmond, Stephen J.; Silber, B. Michael

    2013-01-01

    The only small-molecule compound demonstrated to substantially extend survival in prion-infected mice is a biaryl hydrazone termed “Compd B” (4-pyridinecarboxaldehyde,2-[4-(5-oxazolyl)phenyl]hydrazone). However, the hydrazone moiety of Compd B results in toxic metabolites, making it a poor candidate for further drug development. We developed a pharmacophore model based on diverse antiprion compounds identified by high-throughput screening; based on this model, we generated biaryl amide analogs of Compd B. Medicinal chemistry optimization led to multiple compounds with increased potency, increased brain concentrations, and greater metabolic stability, indicating that they could be promising candidates for antiprion therapy. Replacing the pyridyl ring of Compd B with a phenyl group containing an electron-donating substituent increased potency, while adding an aryl group to the oxazole moiety increased metabolic stability. To test the efficacy of Compd B, we applied bioluminescence imaging (BLI), which was previously shown to detect prion disease onset in live mice earlier than clinical signs. In our studies, Compd B showed good efficacy in two lines of transgenic mice infected with the mouse-adapted Rocky Mountain Laboratory (RML) strain of prions, but not in transgenic mice infected with human prions. The BLI system successfully predicted the efficacies in all cases long before extension in survival could be observed. Our studies suggest that this BLI system has good potential to be applied in future antiprion drug efficacy studies. PMID:23965382

  19. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel Therapeutic Formulation

    PubMed Central

    Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira

    2016-01-01

    ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel

  20. Transgenic Over Expression of Nicotinic Receptor Alpha 5, Alpha 3, and Beta 4 Subunit Genes Reduces Ethanol Intake in Mice

    PubMed Central

    Gallego, Xavier; Ruiz, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C.; Dierssen, Mara

    2012-01-01

    Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol’s as well as nicotine’s effects. PMID:22459873

  1. Transgenic over expression of nicotinic receptor alpha 5, alpha 3, and beta 4 subunit genes reduces ethanol intake in mice.

    PubMed

    Gallego, Xavier; Ruiz-Medina, Jessica; Valverde, Olga; Molas, Susanna; Robles, Noemí; Sabrià, Josefa; Crabbe, John C; Dierssen, Mara

    2012-05-01

    Abuse of alcohol and smoking are extensively co-morbid. Some studies suggest partial commonality of action of alcohol and nicotine mediated through nicotinic acetylcholine receptors (nAChRs). We tested mice with transgenic over expression of the alpha 5, alpha 3, beta 4 receptor subunit genes, which lie in a cluster on human chromosome 15, that were previously shown to have increased nicotine self-administration, for several responses to ethanol. Transgenic and wild-type mice did not differ in sensitivity to several acute behavioral responses to ethanol. However, transgenic mice drank less ethanol than wild-type in a two-bottle (ethanol vs. water) preference test. These results suggest a complex role for this receptor subunit gene cluster in the modulation of ethanol's as well as nicotine's effects. Copyright © 2012. Published by Elsevier Inc.

  2. Early Cognitive/Social Deficits and Late Motor Phenotype in Conditional Wild-Type TDP-43 Transgenic Mice.

    PubMed

    Alfieri, Julio A; Silva, Pablo R; Igaz, Lionel M

    2016-01-01

    Frontotemporal Dementia (FTD) and amyotrophic lateral sclerosis (ALS) are two neurodegenerative diseases associated to mislocalization and aggregation of TAR DNA-binding protein 43 (TDP-43). To investigate in depth the behavioral phenotype associated with this proteinopathy, we used as a model transgenic (Tg) mice conditionally overexpressing human wild-type TDP 43 protein (hTDP-43-WT) in forebrain neurons. We previously characterized these mice at the neuropathological level and found progressive neurodegeneration and other features that evoke human TDP-43 proteinopathies of the FTD/ALS spectrum. In the present study we analyzed the behavior of mice at multiple domains, including motor, social and cognitive performance. Our results indicate that young hTDP-43-WT Tg mice (1 month after post-weaning transgene induction) present a normal motor phenotype compared to control littermates, as assessed by accelerated rotarod performance, spontaneous locomotor activity in the open field test and a mild degree of spasticity shown by a clasping phenotype. Analysis of social and cognitive behavior showed a rapid installment of deficits in social interaction, working memory (Y-maze test) and recognition memory (novel object recognition test) in the absence of overt motor abnormalities. To investigate if the motor phenotype worsen with age, we analyzed the behavior of mice after long-term (up to 12 months) transgene induction. Our results reveal a decreased performance on the rotarod test and in the hanging wire test, indicating a motor phenotype that was absent in younger mice. In addition, long-term hTDP-43-WT expression led to hyperlocomotion in the open field test. In sum, these results demonstrate a time-dependent emergence of a motor phenotype in older hTDP-43-WT Tg mice, recapitulating aspects of clinical FTD presentations with motor involvement in human patients, and providing a complementary animal model for studying TDP-43 proteinopathies.

  3. Expression Analysis of CB2-GFP BAC Transgenic Mice.

    PubMed

    Schmöle, Anne-Caroline; Lundt, Ramona; Gennequin, Benjamin; Schrage, Hanna; Beins, Eva; Krämer, Alexandra; Zimmer, Till; Limmer, Andreas; Zimmer, Andreas; Otte, David-Marian

    2015-01-01

    The endocannabinoid system (ECS) is a retrograde messenger system, consisting of lipid signaling molecules that bind to at least two G-protein-coupled receptors, Cannabinoid receptor 1 and 2 (CB1 and 2). As CB2 is primarily expressed on immune cells such as B cells, T cells, macrophages, dendritic cells, and microglia, it is of great interest how CB2 contributes to immune cell development and function in health and disease. Here, understanding the mechanisms of CB2 involvement in immune-cell function as well as the trafficking and regulation of CB2 expressing cells are crucial issues. Up to now, CB2 antibodies produce unclear results, especially those targeting the murine protein. Therefore, we have generated BAC transgenic GFP reporter mice (CB2-GFPTg) to trace CB2 expression in vitro and in situ. Those mice express GFP under the CB2 promoter and display GFP expression paralleling CB2 expression on the transcript level in spleen, thymus and brain tissue. Furthermore, by using fluorescence techniques we show that the major sources for GFP-CB2 expression are B cells in spleen and blood and microglia in the brain. This novel CB2-GFP transgenic reporter mouse line represents a powerful resource to study CB2 expression in different cell types. Furthermore, it could be used for analyzing CB2-mediated mobilization and trafficking of immune cells as well as studying the fate of recruited immune cells in models of acute and chronic inflammation.

  4. [Screening of full human anthrax lethal factor neutralizing antibody in transgenic mice].

    PubMed

    Wang, Xiaolin; Chi, Xiangyang; Liu, Ju; Liu, Weicen; Liu, Shuling; Qiu, Shunfang; Wen, Zhonghua; Fan, Pengfei; Liu, Kun; Song, Xiaohong; Fu, Ling; Zhang, Jun; Yu, Changming

    2016-11-25

    Anthrax is a highly lethal infectious disease caused by the spore-forming bacterium Bacillus anthracis. The major virulence factor of B. anthracis consists of protective antigen (PA), lethal factor (LF) and edema factor (EF). PA binds with LF to form lethal toxin (LT), and PA binds with EF to form edema toxin (ET). Antibiotics is hard to work in advanced anthrax infections, because injuries and deaths of the infected are mainly caused by lethal toxin (LT). Thus, the therapeutic neutralizing antibody is the most effective treatment of anthrax. Currently most of the anthrax toxin antibodies are monoclonal antibodies (MAbs) for PA and US FDA has approved ABTHRAX humanized PA monoclonal antibody for the treatment of inhalational anthrax. Once B. anthracis was artificially reconstructed or PA had mutations within recognized neutralization epitopes, anti-PA MAbs would no longer be effective. Therefore, anti-LF MAbs is an important supplement for anthrax treatment. Most of the anti-LF antibodies are murine or chimeric antibodies. By contrast, fully human MAbs can avoid the high immunogenicity of murine antibodies. First, we used LF to immunize the transgenic mice and used fluorescent cell sorting to get antigen-specific memory B cells from transgenic mice spleen lymphocytes. By single cell PCR method, we quickly found two strains of anti-LF MAbs with binding activity, 1D7 and 2B9. Transiently transfected Expi 293F cells to obtain MAbs protein after purification. Both 1D7 and 2B9 efficiently neutralized LT in vitro, and had good synergistic effect when mixed with anti-PA MAbs. In summary, combining the advantages of transgenic mice, fluorescent cell sorting and single-cell PCR methods, this study shows new ideas and methods for the rapid screening of fully human monoclonal antibodies.

  5. Exploration, anxiety, and spatial memory in transgenic anophthalmic mice.

    PubMed

    Buhot, M C; Dubayle, D; Malleret, G; Javerzat, S; Segu, L

    2001-04-01

    Contradictory results are found in the literature concerning the role of vision in the perception of space or in spatial navigation, in part because of the lack of murine models of total blindness used so far. The authors evaluated the spatial abilities of anophthalmic transgenic mice. These mice did not differ qualitatively from their wild-type littermates in general locomotor activity, spontaneous alternation, object exploration, or anxiety, but their level of exploratory activity was generally lower. In the spatial version of the water maze, they displayed persistent thigmotaxic behavior and showed severe spatial learning impairments. However, their performances improved with training, suggesting that they may have acquired a rough representation of the platform position. These results suggest that modalities other than vision enable some degree of spatial processing in proximal and structured spaces but that vision is critical for accurate spatial navigation.

  6. Development and Evaluation of Transgenic Nude Mice Expressing Ubiquitous Green Fluorescent Protein.

    PubMed

    Iyer, Srikanth; Arindkar, Shailendra; Mishra, Alaknanda; Manglani, Kapil; Kumar, Jerald Mahesh; Majumdar, Subeer S; Upadhyay, Pramod; Nagarajan, Perumal

    2015-08-01

    Researchers had developed and characterized transgenic green/red fluorescent protein (GFP/RFP) nude mouse with ubiquitous RFP or GFP expression, but none has evaluated the level of immune cells and expression levels of GFP in this model. The nude GFP mice were evaluated by imaging, hematological indices, and flow cytometry to compare the proportion of immune T cells. Quantitative real-time PCR (qRT-PCR) was done for evaluating the relative expression of GFP transcripts in few organs of the nude GFP mice. The hematological and immune cells of nude GFP were within the range of nude mice. However, the gene expression levels were relatively less in various tissues compared with B6 GFP mice. These findings suggest that nude GFP is an ideal model resembling normal nude mice; however, GFP expression in various tissues by fluorescence should be considered, as the expression of GFP differs in various organs.

  7. Mice orally immunized with a transgenic plant expressing the glycoprotein of Crimean-Congo hemorrhagic fever virus.

    PubMed

    Ghiasi, S M; Salmanian, A H; Chinikar, S; Zakeri, S

    2011-12-01

    While Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed the transgenic plant material and injected subcutaneously with the plant-made CCHFV glycoprotein (fed/boosted), vaccinated with an attenuated CCHF vaccine (positive control), or received no treatment (negative control). All immunized groups had a consistent rise in anti-glycoprotein IgG and IgA antibodies in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition, while the study of CCHF is challenging, our protocol should be further used to study CCHFV infection in the knockout mouse model and virus neutralization assays in biosafety level 4 laboratories.

  8. Positive and Negative Selection in Transgenic Mice Expressing a T-Cell Receptor Specific for Influenza Nucleoprotein and Endogenous Superantigen

    PubMed Central

    Mamalaki, Clio; Elliott, James; Norton, Trisha; Yannoutsos, Nicholas; Townsend, Alain R.; Chandler, Phillip; Simpson, Elizabeth

    1993-01-01

    A transgenic mouse was generated expressing on most (>80%) of thymocytes and peripheral T cells a T-cell receptor isolated from a cytotoxic T-cell clone (F5). This clone is CD8+ and recognizes αα366-374 of the nucleoprotein (NP 366-374) of influenza virus (A/NT/60/68), in the context of Class ,MHC Db (Townsend et al., 1986). The receptor utilizes the Vβ11 and Vα4 gene segments for the β chain and α chain, respectively (Palmer et al., 1989). The usage of Vβ11 makes this TcR reactive to Class II IE molecules and an endogenous ligand recently identified as a product of the endogenous mammary tumour viruses (Mtv) 8, 9, and 11 (Dyson et al., 1991). Here we report the development of F5 transgenic T cells and their function in mice of the appropriate MHC (C57BL/10 H-2b, IE-) or in mice expressing Class II MHC IE (e.g., CBA/Ca H-2k and BALB/c H-2d) and the endogenous Mtv ligands. Positive selection of CD8+ T cells expressing the Vβ11 is seen in C57BL/10 transgenic mice (H-2b). Peripheral T cells from these mice are capable of killing target cells in an antigen-dependent manner after a period of in vitro culture with IL-2. In the presence of Class II MHC IE molecules and the endogenous Mtv ligand, most of the single-positive cells carrying the transgenic T-cell receptor are absent in the thymus. Unexpectedly, CD8+ peripheral T-cells in these (H-2k or H-2d) F5 mice are predominantly Vβ11 positive and also have the capacity to kill targets in an antigen-dependent manner. This is true even following backcrossing of the F5 TcR transgene to H-2d scid/scid mice, in which functional rearrangement of endogenous TcR alpha- and beta-chain genes is impaired. PMID:8281031

  9. Gene expression profiling of R6/2 transgenic mice with different CAG repeat lengths reveals genes associated with disease onset and progression in Huntington's disease.

    PubMed

    Tang, Bin; Seredenina, Tamara; Coppola, Giovanni; Kuhn, Alexandre; Geschwind, Daniel H; Luthi-Carter, Ruth; Thomas, Elizabeth A

    2011-06-01

    R6/2 transgenic mice with expanded CAG repeats (>300) have a surprisingly prolonged disease progression and longer lifespan than prototypical parent R6/2 mice (carrying 150 CAGs); however, the mechanism of this phenotype amelioration is unknown. We compared gene expression profiles in the striatum of R6/2 transgenic mice carrying ~300 CAG repeats (R6/2(Q300) transgenic mice) to those carrying ~150 CAG repeats (R6/2(Q150) transgenic mice) and littermate wildtype controls in order to identify genes that may play determinant roles in the time course of phenotypic expression in these mice. Of the top genes showing concordant expression changes in the striatum of both R6/2 lines, 85% were decreased in expression, while discordant expression changes were observed mostly for genes upregulated in R6/2(Q300) transgenic mice. Upregulated genes in the R6/2(Q300) mice were associated with the ubiquitin ligase complex, cell adhesion, protein folding, and establishment of protein localization. We qPCR-validated increases in expression of genes related to the latter category, including Lrsam1, Erp29, Nasp, Tap1, Rab9b, and Pfdn5 in R6/2(Q300) mice, changes that were not observed in R6/2 mice with shorter CAG repeats, even in late stages (i.e., 12 weeks of age). We further tested Lrsam1 and Erp29, the two genes showing the greatest upregulation in R6/2(Q300) transgenic mice, for potential neuroprotective effects in primary striatal cultures overexpressing a mutated human huntingtin (htt) fragment. Overexpression of Lrsam1 prevented the loss of NeuN-positive cell bodies in htt171-82Q cultures, concomitant with a reduction of nuclear htt aggregates. Erp29 showed no significant effects in this model. This is consistent with the distinct pattern of htt inclusion localization observed in R6/2(Q300) transgenic mice, in which smaller cytoplasmic inclusions represent the major form of insoluble htt in the cell, as opposed to large nuclear inclusions observed in R6/2(Q150) transgenic mice

  10. Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia

    PubMed Central

    Landry, Nichole K.; El-Achkar, Tarek M.; Lieske, John C.

    2017-01-01

    Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys’ thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies. PMID:29145399

  11. Point mutation in D8C domain of Tamm-Horsfall protein/uromodulin in transgenic mice causes progressive renal damage and hyperuricemia.

    PubMed

    Ma, Lijie; Liu, Yan; Landry, Nichole K; El-Achkar, Tarek M; Lieske, John C; Wu, Xue-Ru

    2017-01-01

    Hereditary mutations in Tamm-Horsfall protein (THP/uromodulin) gene cause autosomal dominant kidney diseases characterized by juvenile-onset hyperuricemia, gout and progressive kidney failure, although the disease pathogenesis remains unclear. Here we show that targeted expression in transgenic mice of a mutation within the domain of 8 cysteines of THP in kidneys' thick ascending limb (TAL) caused unfolded protein response in younger (1-month old) mice and apoptosis in older (12-month old) mice. While the young mice had urine concentration defects and polyuria, such defects progressively reversed in the older mice to marked oliguria, highly concentrated urine, fibrotic kidneys and reduced creatinine clearance. Both the young and the old transgenic mice had significantly higher serum uric acid and its catabolic product, allantoin, than age-matched wild-type mice. This THP mutation apparently caused primary defects in TAL by compromising the luminal translocation and reabsorptive functions of NKCC2 and ROMK and secondary responses in proximal tubules by upregulating NHE3 and URAT1. Our results strongly suggest that the progressive worsening of kidney functions reflects the accumulation of the deleterious effects of the misfolded mutant THP and the compensatory responses. Transgenic mice recapitulating human THP/uromodulin-associated kidney diseases could be used to elucidate their pathogenesis and test novel therapeutic strategies.

  12. Analysis of the effects of overexpression of metallothionein-I in transgenic mice on the reproductive toxicology of cadmium.

    PubMed Central

    Dalton, T; Fu, K; Enders, G C; Palmiter, R D; Andrews, G K

    1996-01-01

    Exposure to low levels of cadmium reduces fertility. In male mice spermatogenesis is highly sensitive to cadmium, whereas in females the peri-implantation period of pregnancy is sensitive. To examine the potential roles of the cadmium-binding protein, metallothionein (MT), in the reproductive toxicology of cadmium, we examined a transgenic mouse strain that overexpresses metallothionein-I (MT-I). These mice had dramatically increased steady-state levels of MT-I mRNA and MT in the testes and in the female reproductive tract during the peri-implantation period of pregnancy, and this overexpression occurred in a cell-specific and temporally regulated manner similar to that of the endogenous MT-I gene. Transgenic and control males were injected with cadmium, and the histology of the testes was examined. An injection of 7.5 mumol Cd/kg had no effect on histology of the testes in either transgenic or control mice. In contrast, an injection of 10 mumol Cd/kg caused rapid changes in the histology of the testes and resulted in pronounced testicular necrosis in both control and transgenic mice. Female transgenic and control mice were mated and then injected with cadmium (30-45 mumol Cd/kg) on the day of blastocyst implantation (day 4). In both of these groups, injection of cadmium reduced pregnancy rate, and no dramatic protection was afforded by maternal and/or embryonic overexpression of MT. Thus, overexpression of MT-I does not significantly protect against either of these cadmium-induced effects on fertility. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 2. C Figure 3. Figure 4. A Figure 4. A Figure 4. B Figure 4. B Figure 4. B Figure 4. B Figure 4. D4 Figure 4. D4 Figure 4. D6 Figure 4. D6 Figure 4. D8 Figure 5. A Figure 5. B Figure 5. C Figure 5. D Figure 5. E Figure 6. A Figure 6. B Figure 6. C Figure 6. D Figure 6. E Figure 6. F PMID:8834864

  13. Characterization of pancreatic lesions from MT-tgf alpha, Ela-myc and MT-tgf alpha/Ela-myc single and double transgenic mice.

    PubMed

    Liao, Dezhong Joshua; Wang, Yong; Wu, Jiusheng; Adsay, Nazmi Volkan; Grignon, David; Khanani, Fayyaz; Sarkar, Fazlul H

    2006-07-05

    In order to identify good animal models for investigating therapeutic and preventive strategies for pancreatic cancer, we analyzed pancreatic lesions from several transgenic models and made a series of novel findings. Female MT-tgf alpha mice of the MT100 line developed pancreatic proliferation, acinar-ductal metaplasia, multilocular cystic neoplasms, ductal adenocarcinomas and prominent fibrosis, while the lesions in males were less severe. MT-tgf alpha-ES transgenic lines of both sexes developed slowly progressing lesions that were similar to what was seen in MT100 males. In both MT100 and MT-tgf alpha-ES lines, TGF alpha transgene was expressed mainly in proliferating ductal cells. Ela-myc transgenic mice with a mixed C57BL/6, SJL and FVB genetic background developed pancreatic tumors at 2-7 months of age, and half of the tumors were ductal adenocarcinomas, similar to what was reported originally by Sandgren et al 1. However, in 20% of the mice, the tumors metastasized to the liver. MT100/Ela-myc and MT-tgf alpha-ES/Ela-myc double transgenic mice developed not only acinar carcinomas and mixed carcinomas as previously reported but also various ductal-originated lesions, including multilocular cystic neoplasms and ductal adenocarcinomas. The double transgenic tumors were more malignant and metastasized to the liver at a higher frequency (33%) compared with the Ela-myc tumors. Sequencing of the coding region of p16ink4, k-ras and Rb cDNA in small numbers of pancreatic tumors did not identify mutations. The short latency for tumor development, the variety of tumor morphology and the liver metastases seen in Ela-myc and MT-tgf alpha/Ela-myc mice make these animals good models for investigating new therapeutic and preventive strategies for pancreatic cancer.

  14. β-Secretase inhibitor GRL-8234 rescues age-related cognitive decline in APP transgenic mice

    PubMed Central

    Chang, Wan-Pin; Huang, Xiangping; Downs, Deborah; Cirrito, John R.; Koelsch, Gerald; Holtzman, David M.; Ghosh, Arun K.; Tang, Jordan

    2011-01-01

    Alzheimer disease is intimately linked to an excess amount of amyloid-β (Aβ) in the brain. Thus, therapeutic inhibition of Aβ production is an attractive clinical approach to treat this disease. Here we provide the first direct experimental evidence that the treatment of Tg2576 transgenic mice with an inhibitor of β-secretase, GRL-8234, rescues the age-related cognitive decline. We demonstrated that the injected GRL-8234 effectively enters the brain and rapidly decreases soluble Aβ in the brain of Tg2576 mice. The rescue of cognition, which was observed only after long-term inhibitor treatment ranging from 5 to 7.5 mo, was associated with a decrease of brain amyloid-β plaque load. We also found no accumulation of amyloid-β precursor protein after several months of inhibitor treatment. These observations substantiate the idea that Aβ accumulation plays a major role in the cognitive decline of Tg2576 mice and support the concept of Aβ reduction therapy as a treatment of AD.—Chang, W.-P., Huang, X., Downs, D., Cirrito, J. R., Koelsch, G., Holtzman, D. M. Ghosh, A. K., Tang, J. β-Secretase inhibitor GRL-8234 rescues age-related cognitive decline in APP transgenic mice. PMID:21059748

  15. Tubular overexpression of Gremlin in transgenic mice aggravates renal damage in diabetic nephropathy.

    PubMed

    Marchant, Vanessa; Droguett, Alejandra; Valderrama, Graciela; Burgos, M Eugenia; Carpio, Daniel; Kerr, Bredford; Ruiz-Ortega, Marta; Egido, Jesús; Mezzano, Sergio

    2015-09-15

    Diabetic nephropathy (DN) is currently a leading cause of end-stage renal failure worldwide. Gremlin was identified as a gene differentially expressed in mesangial cells exposed to high glucose and in experimental diabetic kidneys. We have described that Gremlin is highly expressed in biopsies from patients with diabetic nephropathy, predominantly in areas of tubulointerstitial fibrosis. In streptozotocin (STZ)-induced experimental diabetes, Gremlin deletion using Grem1 heterozygous knockout mice or by gene silencing, ameliorates renal damage. To study the in vivo role of Gremlin in renal damage, we developed a diabetic model induced by STZ in transgenic (TG) mice expressing human Gremlin in proximal tubular epithelial cells. The albuminuria/creatinuria ratio, determined at week 20 after treatment, was significantly increased in diabetic mice but with no significant differences between transgenic (TG/STZ) and wild-type mice (WT/STZ). To assess the level of renal damage, kidney tissue was analyzed by light microscopy (periodic acid-Schiff and Masson staining), electron microscopy, and quantitative PCR. TG/STZ mice had significantly greater thickening of the glomerular basement membrane, increased mesangial matrix, and podocytopenia vs. WT/STZ. At the tubulointerstitial level, TG/STZ showed increased cell infiltration and mild interstitial fibrosis. In addition, we observed a decreased expression of podocin and overexpression of monocyte chemoattractant protein-1 and fibrotic-related markers, including transforming growth factor-β1, Col1a1, and α-smooth muscle actin. Together, these results show that TG mice overexpressing Gremlin in renal tubules develop greater glomerular and tubulointerstitial injury in response to diabetic-mediated damage and support the involvement of Gremlin in diabetic nephropathy. Copyright © 2015 the American Physiological Society.

  16. Development of mammary hyperplasia, dysplasia, and invasive ductal carcinoma in transgenic mice expressing the 8p11 amplicon oncogene NSD3

    PubMed Central

    Turner-Ivey, Brittany; Smith, Ericka L.; Rutkovsky, Alex C.; Spruill, Laura S.; Mills, Jamie N.

    2018-01-01

    Purpose NSD3 has been implicated as a candidate driver oncogene from the 8p11-p12 locus, and we have previously published evidence for its amplification and overexpression in human breast cancer. This aim of this study was to further characterize the transforming function of NSD3 in vivo. Methods We generated a transgenic mouse model in which NSD3 gene expression was driven by the MMTV promoter and expressed in mammary epithelium of FVB mice. Mammary glands were fixed and whole mounts were stained with carmine to visualize gland structure. Mammary tumors were formalin-fixed, and paraffin embedded (FFPE) tumors were stained with hematoxylin and eosin. Results Pups born to transgenic females were significantly underdeveloped compared to pups born to WT females due to a lactation defect in transgenic female mice. Whole mount analysis of the mammary glands of transgenic female mice revealed a profound defect in functional differentiation of mammary gland alveoli that resulted in the lactation defect. We followed parous and virgin NSD3 transgenic and control mice to 50 weeks of age and observed that several NSD3 parous females developed mammary tumors. Whole mount analysis of the mammary glands of tumor-bearing mice revealed numerous areas of mammary hyperplasia and ductal dysplasia. Histological analysis showed that mammary tumors were high-grade ductal carcinomas, and lesions present in other mammary glands exhibited features of alveolar hyperplasia, ductal dysplasia, and carcinoma in situ. Conclusions Our results are consistent with our previous studies and demonstrate that NSD3 is a transforming breast cancer oncogene. PMID:28484924

  17. Pituitary hyperplasia and gigantism in mice caused by a cholera toxin transgene.

    PubMed

    Burton, F H; Hasel, K W; Bloom, F E; Sutcliffe, J G

    1991-03-07

    Cyclic AMP is thought to act as an intracellular second messenger, mediating the physiological response of many cell types to extracellular signals. In the pituitary, growth hormone (GH)-producing cells (somatotrophs) proliferate and produce GH in response to hypothalamic GH-releasing factor, which binds a receptor that stimulates Gs protein activation of adenylyl cyclase. We have now determined whether somatotroph proliferation and GH production are stimulated by cAMP alone, or require concurrent, non-Gs-mediated induction of other regulatory molecules by designing a transgene to induce chronic supraphysiological concentrations of cAMP in somatotrophs. The rat GH promoter was used to express an intracellular form of cholera toxin, a non-cytotoxic and irreversible activator of Gs. Introduction of this transgene into mice caused gigantism, elevated serum GH levels, somatotroph proliferation and pituitary hyperplasia. These results support the direct triggering of these events by cAMP, and illustrate the utility of cholera toxin transgenes as a tool for physiological engineering.

  18. Adjuvanted multi-epitope vaccines protect HLA-A*1101 transgenic mice against Toxoplasma gondii

    USDA-ARS?s Scientific Manuscript database

    We created and tested multi-epitope DNA or protein vaccines with TLR4 ligand emulsion adjuvant (gluco glucopyranosyl lipid adjuvant in a stable emulsion (GLA-SE)) for their ability to protect against Toxoplasma gondii in HLA transgenic mice. Our constructs each included five of our best down selecte...

  19. Transgenic mice overexpressing the extracellular domain of NCAM are impaired in working memory and cortical plasticity

    PubMed Central

    Brennaman, Leann H.; Kochlamazashvili, Gaga; Stoenica, Luminita; Nonneman, Randall J.; Moy, Sheryl S.; Schachner, Melitta; Dityatev, Alexander; Maness, Patricia F.

    2011-01-01

    The neural cell adhesion molecule, NCAM, is a pivotal regulator of neural development, with key roles in axonal and dendritic growth and synaptic plasticity. Alterations in NCAM expression or proteolytic cleavage have been linked to human neuropsychiatric disorders such as schizophrenia, bipolar disorder and Alzheimer’s disease, and may contribute to cognitive dysfunction. We have generated mice overexpressing the NCAM extracellular (EC) proteolytic cleavage fragment which has been reported to be increased in schizophrenic versus normal brains. These mice show impaired GABAergic innervation and reduced number of apical dendritic spines on pyramidal neurons in the prefrontal cortex (PFC). Here, these NCAM-EC transgenic mice were subjected to behavioral tasks and electrophysiological measurements to determine the impact of structural abnormalities in the PFC on synaptic and cognitive functions. NCAM-EC mice exhibited impaired working memory in a delayed non-match-to-sample task, which requires PFC function, but showed no differences in anxiety, olfactory abilities, or sociability. Transgenic mice displayed impaired long- and short-term potentiation in the PFC but normal synaptic plasticity in the hippocampus, suggesting that the abnormal synaptic innervation in NCAM-EC mice impairs PFC plasticity and alters working memory. These findings may have implications for cognitive dysfunctions observed in neuropsychiatric disorders. PMID:21515372

  20. Lymphoid hyperplasia in transgenic mice over-expressing a secreted form of the human interleukin-1β gene product

    PubMed Central

    Björkdahl, O; Åkerblad, P; Gjörloff-wingren, A; Leanderson, T; Dohlsten, M

    1999-01-01

    To evaluate the biological effects of over-expression of interleukin-1β (IL-1β) on the immune system we have generated transgenic mice, expressing the IL-1β gene fused to a heterologous signal sequence under the control of the mouse immunoglobulin enhancer (Eμ). A prominent hyperplasia and a disturbed microarchitecture of lymphoid tissues were observed in the transgenic mice. The CD4+ T cells in the hyperplastic lymphoid organs seemed to invade the majority of the lymphoid organs including B-cell restricted areas. Analysis of lymph node cells revealed an increased frequency of CD4+ CD44high CD62L− T cells and local secretion of IL-2 and IL-4, compatible with an elevated number of activated T cells. Furthermore, significant levels of human IL-1β in sera and high concentrations of serum immunoglobulin G (IgG) were observed in the transgenic mice. The data suggest a role for IL-1β in controlling lymphoid microarchitecture and, when over-expressed, breaking the threshold in T-helper–B-cell interaction. PMID:10233687

  1. Habituation, discrimination and anxiety in transgenic mice overexpressing acetylcholinesterase splice variants.

    PubMed

    Kofman, Ora; Shavit, Yehoshua; Ashkenazi, Sarit; Gabay, Shai

    2007-12-14

    TgS and TgR transgenic mice overexpress different splice variants of acetylcholinesterase and serve as models for genetic disruption of the cholinergic system. Whereas the TgS mouse overexpresses synaptic AChE, the TgR mouse overexpresses the rare readthrough variant whose C-terminal lacks the cysteine residue which permits adherence to the membrane. The two genotypes were compared to the parent strain, FVB/N mice on locomotion, discrimination learning and anxiety behavior following two exposures to the elevated plus maze. Male TgS mice were slower to acquire a simple odor discrimination, failed to habituate to a novel environment but were not impaired on reversal or set shifting compared to the FVB/N or TgR mice. In addition, TgS mice showed less avoidance behavior on the first exposure and but less exploration on the second exposure to the EPM. TgR mice were not impaired on discrimination learning; however, the females showed excessive running in circles in the activity meter. The findings suggest that the effects of overexpression of AChE are unique to different splice variants and may be sex-dependent.

  2. In Vivo Visualization of Alzheimer’s Amyloid Plaques by MRI in Transgenic Mice Without a Contrast Agent

    PubMed Central

    Jack, Clifford R.; Garwood, Michael; Wengenack, Thomas M.; Borowski, Bret; Curran, Geoffrey L.; Lin, Joseph; Adriany, Gregor; Grohn, Olli H.J.; Grimm, Roger; Poduslo, Joseph F.

    2009-01-01

    One of the cardinal pathologic features of Alzheimer’s disease (AD) is formation of senile, or amyloid, plaques. Transgenic mice have been developed that express one or more of the genes responsible for familial AD in humans. Doubly transgenic mice develop “human-like” plaques, providing a mechanism to study amyloid plaque biology in a controlled manner. Imaging of labeled plaques has been accomplished with other modalities, but only MRI has sufficient spatial and contrast resolution to visualize individual plaques non-invasively. Methods to optimize visualization of plaques in vivo in transgenic mice at 9.4 T using a spin echo sequence based on adiabatic pulses are described. Preliminary results indicate that a spin echo acquisition more accurately reflects plaque size, while a T2* weighted gradient echo sequence reflects plaque iron content not plaque size. In vivo MRI – ex vivo MRI – in vitro histological correlations are provided. Histologically verified plaques as small as 50 μm in diameter were visualized in the living animal. To our knowledge this work represents the first demonstration of non-invasive in vivo visualization of individual AD plaques without the use of a contrast agent. PMID:15562496

  3. Transgenic mice overexpressing tyrosine-to-cysteine mutant human alpha-synuclein: a progressive neurodegenerative model of diffuse Lewy body disease.

    PubMed

    Zhou, Wenbo; Milder, Julie B; Freed, Curt R

    2008-04-11

    Abnormal aggregation of human alpha-synuclein in Lewy bodies and Lewy neurites is a pathological hallmark of Parkinson disease and dementia with Lewy bodies. Studies have shown that oxidation and nitration of alpha-synuclein lead to the formation of stable dimers and oligomers through dityrosine cross-linking. Previously we have reported that tyrosine-to-cysteine mutations, particularly at the tyrosine 39 residue (Y39C), significantly enhanced alpha-synuclein fibril formation and neurotoxicity. In the current study, we have generated transgenic mice expressing the Y39C mutant human alpha-synuclein gene controlled by the mouse Thy1 promoter. Mutant human alpha-synuclein was widely expressed in transgenic mouse brain, resulting in 150% overexpression relative to endogenous mouse alpha-synuclein. At age 9-12 months, transgenic mice began to display motor dysfunction in rotarod testing. Older animals aged 15-18 months showed progressive accumulation of human alpha-synuclein oligomers, associated with worse motor function and cognitive impairment in the Morris water maze. By age 21-24 months, alpha-synuclein aggregates were further increased, accompanied by severe behavioral deficits. At this age, transgenic mice developed neuropathology, such as Lewy body-like alpha-synuclein and ubiquitin-positive inclusions, phosphorylation at Ser(129) of human alpha-synuclein, and increased apoptotic cell death. In summary, Y39C human alpha-synuclein transgenic mice show age-dependent, progressive neuronal degeneration with motor and cognitive deficits similar to diffuse Lewy body disease. The time course of alpha-synuclein oligomer accumulation coincided with behavioral and pathological changes, indicating that these oligomers may initiate protein aggregation, disrupt cellular function, and eventually lead to neuronal death.

  4. Progressive paralysis associated with diffuse astrocyte anaplasia in delta 202 mice homozygous for a transgene encoding the SV40 T antigen.

    PubMed

    López-Revilla, Rubén; Soto-Zárate, Carlos; Ridaura, Cecilia; Chávez-Dueñas, Lucía; Paul, Dieter

    2004-03-01

    A convenient transgenic astrocytoma model in delta202 mice, homozygous for a construct encoding the early region of the SV40 virus genome, is described. In the offspring of crosses between delta202 mice heterozygous for the transgene nearly 60% were transgenic; one third of these developed progressive paralysis starting in the hindlimbs at approximately 35 days of age and died at 90 +/- 30 days of age. In affected mice proliferating-non-neuronal cells immunostained with antibodies to the GFAP, an astrocyte marker, whose number increased with age were found in the white matter of the brain, cerebellum and spinal cord, and progressive degeneration and necrosis of spinal motoneurons was observed that-may explain the paralysis. The early onset and reproducible time course of the neurological disease suggest that homozygous delta202 mice, whose proliferating astrocytes appear to damage spinal motoneurons, are a useful model to study astrocyte differentiation, function and tumorigenesis.

  5. AβPP/PS1 Transgenic Mice Show Sex Differences in the Cerebellum Associated with Aging.

    PubMed

    Ordoñez-Gutierrez, Lara; Fernandez-Perez, Ivan; Herrera, Jose Luis; Anton, Marta; Benito-Cuesta, Irene; Wandosell, Francisco

    2016-09-06

    Cerebellar pathology has been related to presenilin 1 mutations in certain pedigrees of familial Alzheimer's disease. However, cerebellum tissue has not been intensively analyzed in transgenic models of mutant presenilins. Furthermore, the effect of the sex of the mice was not systematically analyzed, despite the fact that important gender differences in the evolution of the disease in the human population have been described. We analyzed whether the progression of amyloidosis in a double transgenic mouse, AβPP/PS1, is susceptible to aging and differentially affects males and females. The accumulation of amyloid in the cerebellum differentially affects males and females of the AβPP/PS1 transgenic line, which was found to be ten-fold higher in 15-month-old females. Amyloid-β accumulation was more evident in the molecular layer of the cerebellum, but glia reaction was only observed in the granular layer of the older mice. The sex divergence was also observed in other neuronal, survival, and autophagic markers. The cerebellum plays an important role in the evolution of the pathology in this transgenic mouse model. Sex differences could be crucial for a complete understanding of this disease. We propose that the human population could be studied in this way. Sex-specific treatment strategies in human populations could show a differential response to the therapeutic approach.

  6. Estrogen and progesterone receptors have distinct roles in the establishment of the hyperplastic phenotype in PR-A transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Simian, Marina; Bissell, Mina J.; Barcellos-Hoff, Mary Helen

    2009-05-11

    Expression of the A and B forms of progesterone receptor (PR) in an appropriate ratio is critical for mammary development. Mammary glands of PR-A transgenic mice, carrying an additional A form of PR as a transgene, exhibit morphological features associated with the development of mammary tumors. Our objective was to determine the roles of estrogen (E) and progesterone (P) in the genesis of mammary hyperplasias/preneoplasias in PR-A transgenics. We subjected PR-A mice to hormonal treatments and analyzed mammary glands for the presence of hyperplasias and used BrdU incorporation to measure proliferation. Quantitative image analysis was carried out to compare levelsmore » of latency-associated peptide and transforming growth factor beta 1 (TGF{beta}1) between PR-A and PR-B transgenics. Basement membrane disruption was examined by immunofluorescence and proteolytic activity by zymography. The hyperplastic phenotype of PR-A transgenics is inhibited by ovariectomy, and is reversed by treatment with E + P. Studies using the antiestrogen ICI 182,780 or antiprogestins RU486 or ZK 98,299 show that the increase in proliferation requires signaling through E/estrogen receptor alpha but is not sufficient to give rise to hyperplasias, whereas signaling through P/PR has little impact on proliferation but is essential for the manifestation of hyperplasias. Increased proliferation is correlated with decreased TGF{beta}1 activation in the PR-A transgenics. Analysis of basement membrane integrity showed loss of laminin-5, collagen III and collagen IV in mammary glands of PR-A mice, which is restored by ovariectomy. Examination of matrix metalloproteases (MMPs) showed that total levels of MMP-2 correlate with the steady-state levels of PR, and that areas of laminin-5 loss coincide with those of activation of MMP-2 in PR-A transgenics. Activation of MMP-2 is dependent on treatment with E and P in ovariectomized wild-type mice, but is achieved only by treatment with P in PR-A mice

  7. Infection by ME7 prion is not modified in transgenic mice expressing the yeast chaperone Hsp104 in neurons.

    PubMed

    Dandoy-Dron, Françoise; Bogdanova, Anna; Beringue, Vincent; Bailly, Yannick; Tovey, Michael G; Laude, Hubert; Dron, Michel

    2006-09-25

    The Hsp104 chaperone induces thermo-tolerance in yeast and rescues proteins trapped in aggregates. In this study, we showed that xenogenic expression of Hsp104 dramatically increased the viability of the neuronal mouse CAD cell line after exposure to heat shock. These results indicate that the Hsp104 protein confers thermo-resistance to mammalian neuronal cells, the canonical property of Hsp104 in yeast. Hsp104 also determines the prion state of prion-like proteins in yeast and to investigate whether Hsp104 expression may modify mammalian prion infection in vivo, transgenic mice with specific expression of Hsp104 in neurons were generated. Mice develop and reproduce normally, they show no detectable physical defect and may constitute valuable model for the study of aggregation-prone neuropathological disorders. Hsp104 transgenic and control littermates were infected intracerebrally with the ME7 strain of scrapie. No differences in the incubation time of the disease or in PrP(Sc) accumulation were observed between transgenic and control mice. These results suggest that the heat-shock protein Hsp104 is not efficient to modulate the multiplication of mammalian prions and/or to counteract neurodegeneration in the brain of scrapie-infected mice.

  8. Adverse effect on syngeneic islet transplantation by transgenic coexpression of decoy receptor 3 and heme oxygenase-1 in the islet of NOD mice.

    PubMed

    Huang, S-H; Lin, G-J; Chien, M-W; Chu, C-H; Yu, J-C; Chen, T-W; Hueng, D-Y; Liu, Y-L; Sytwu, H-K

    2013-03-01

    Decoy receptor 3 (DcR3) blocks both Fas ligand- and LIGHT-induced pancreatic β-cell damage in autoimmune diabetes. Heme oxygenase 1 (HO-1) possesses antiapoptotic, anti-inflammatory, and antioxidative effects that protect cells against various forms of attack by the immune system. Previously, we have demonstrated that transgenic islets overexpressing DcR3 or murine HO-1 (mHO-1) exhibit longer survival times than nontransgenic islets in syngeneic islet transplantation. In this study, we evaluated whether DcR3 and mHO-1 double-transgenic islets of NOD mice could provide better protective effects and achieve longer islet graft survival than DcR3 or mHO-1 single-transgenic islets after islet transplantation. We generated DcR3 and mHO-1 double-transgenic NOD mice that specifically overexpress DcR3 and HO-1 in islets. Seven hundred islets isolated from double-transgenic, single-transgenic, or nontransgenic NOD mice were syngeneically transplanted into the kidney capsules of newly diabetic female recipients. Unexpectedly, there was no significant difference in the survival time between double-transgenic or nontransgenic NOD islet grafts, and the survival times of double-transgenic NOD islet grafts were even shorter than those of DcR3 or mHO-1 single-transgenic islets. Our data indicate that transplantation of double-transgenic islets that coexpress HO-1 and DcR3 did not result in a better outcome. On the contrary, this strategy even caused an adverse effect in syngeneic islet transplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Huperzine A alleviates synaptic deficits and modulates amyloidogenic and nonamyloidogenic pathways in APPswe/PS1dE9 transgenic mice.

    PubMed

    Wang, Ying; Tang, Xi Can; Zhang, Hai Yan

    2012-02-01

    Huperzine A (HupA) is a potent acetylcholinesterase inhibitor (AChEI) used in the treatment of Alzheimer's disease (AD). Recently, HupA was shown to be active in modulating the nonamyloidogenic metabolism of β-amyloid precursor protein (APP) in APP-transfected human embryonic kidney cell line (HEK293swe). However, in vivo research concerning the mechanism of HupA in APP transgenic mice has not yet been fully elucidated. The present study indicates that the loss of dendritic spine density and synaptotagmin levels in the brain of APPswe/presenilin-1 (PS1) transgenic mice was significantly ameliorated by chronic HupA treatment and provides evidence that this neuroprotection was associated with reduced amyloid plaque burden and oligomeric β-amyloid (Aβ) levels in the cortex and hippocampus of APPswe/PS1dE9 transgenic mice. Our findings further demonstrate that the amelioration effect of HupA on Aβ deposits may be mediated, at least in part, by regulation of the compromised expression of a disintegrin and metalloprotease 10 (ADAM10) and excessive membrane trafficking of β-site APP cleavage enzyme 1 (BACE1) in these transgenic mice. In addition, extracellular signal-regulated kinases 1/2 (Erk1/2) phosphorylation may also be partially involved in the effect of HupA on APP processing. In conclusion, our work for the first time demonstrates the neuroprotective effect of HupA on synaptic deficits in APPswe/PS1dE9 transgenic mice and further clarifies the potential pharmacological targets for this protective effect, in which modulation of nonamyloidogenic and amyloidogenic APP processing pathways may be both involved. These findings may provide adequate evidence for the clinical and experimental benefits gained from HupA treatment. Copyright © 2011 Wiley Periodicals, Inc.

  10. Quantitative analysis of lentiviral transgene expression in mice over seven generations.

    PubMed

    Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

    2010-10-01

    Lentiviral transgenesis is now recognized as an extremely efficient and cost-effective method to produce transgenic animals. Transgenes delivered by lentiviral vectors exhibited inheritable expression in many species including those which are refractory to genetic modification such as non-human primates. However, epigenetic modification was frequently observed in lentiviral integrants, and transgene expression found to be inversely correlated with methylation density. Recent data showed that about one-third lentiviral integrants exhibited hypermethylation and low expression, but did not demonstrate whether those integrants with high expression could remain constant expression and hypomethylated during long term germline transmission. In this study, using lentiviral eGFP transgenic mice as the experimental animals, lentiviral eGFP expression levels and its integrant numbers in genome were quantitatively analyzed by fluorescent quantitative polymerase-chain reaction (FQ-PCR), using the house-keeping gene ribosomal protein S18 (Rps18) and the single copy gene fatty acid binding protein of the intestine (Fabpi) as the internal controls respectively. The methylation densities of the integrants were quantitatively analyzed by bisulfite sequencing. We found that the lentiviral integrants with high expression exhibited a relative constant expression level per integrant over at least seven generations. Besides, the individuals containing these integrants exhibited eGFP expression levels which were positively and almost linearly correlated with the integrant numbers in their genomes, suggesting that no remarkable position effect on transgene expression of the integrants analyzed was observed. In addition, over seven generations the methylation density of these integrants did not increase, but rather decreased remarkably, indicating that these high expressing integrants were not subjected to de novo methylation during at least seven generations of germline transmission. Taken

  11. Anxiolytic effect of music exposure on BDNFMet/Met transgenic mice.

    PubMed

    Li, Wen-Jing; Yu, Hui; Yang, Jian-Min; Gao, Jing; Jiang, Hong; Feng, Min; Zhao, Yu-Xia; Chen, Zhe-Yu

    2010-08-06

    Brain-derived neurotrophic factor (BDNF) has been reported to play important roles in the modulation of anxiety, mood stabilizers, and pathophysiology of affective disorders. Recently, a single nucleotide polymorphism (SNP) in the BDNF gene (Val66Met) has been found to be associated with depression and anxiety disorders. The humanized BDNF(Met/Met) knock-in transgenic mice exhibited increased anxiety-related behaviors that were unresponsive to serotonin reuptake inhibitors, fluoxetine. Music is known to be able to elicit emotional changes, including anxiolytic effects. In this study, we found that music treatment could significantly decrease anxiety state in BDNF(Met/Met) mice, but not in BDNF(+/)(-), mice compared with white noise exposure in open field and elevated plus maze test. Moreover, in contrast to white noise exposure, BDNF expression levels in the prefrontal cortex (PFC), amygdala and hippocampus were significantly increased in music-exposed adult BDNF(Met/Met) mice. However, music treatment could not upregulate BDNF levels in the PFC, amygdala, and hippocampus in BDNF(+/)(-) mice, which suggests the essential role of BDNF in the anxiolytic effect of music. Together, our results imply that music may provide an effective therapeutic intervention for anxiety disorders in humans with this genetic BDNF(Met) variant. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Increased Tau Phosphorylation and Tau Truncation, and Decreased Synaptophysin Levels in Mutant BRI2/Tau Transgenic Mice

    PubMed Central

    Garringer, Holly J.; Murrell, Jill; Sammeta, Neeraja; Gnezda, Anita; Ghetti, Bernardino; Vidal, Ruben

    2013-01-01

    Familial Danish dementia (FDD) is an autosomal dominant neurodegenerative disease caused by a 10-nucleotide duplication-insertion in the BRI2 gene. FDD is clinically characterized by loss of vision, hearing impairment, cerebellar ataxia and dementia. The main neuropathologic findings in FDD are the deposition of Danish amyloid (ADan) and the presence of neurofibrillary tangles (NFTs). Here we investigated tau accumulation and truncation in double transgenic (Tg-FDD-Tau) mice generated by crossing transgenic mice expressing human Danish mutant BRI2 (Tg-FDD) with mice expressing human 4-repeat mutant Tau-P301S (Tg-Tau). Compared to Tg-Tau mice, we observed a significant enhancement of tau deposition in Tg-FDD-Tau mice. In addition, a significant increase in tau cleaved at aspartic acid (Asp) 421 was observed in Tg-FDD-Tau mice. Tg-FDD-Tau mice also showed a significant decrease in synaptophysin levels, occurring before widespread deposition of fibrillar ADan and tau can be observed. Thus, the presence of soluble ADan/mutant BRI2 can lead to significant changes in tau metabolism and synaptic dysfunction. Our data provide new in vivo insights into the pathogenesis of FDD and the pathogenic pathway(s) by which amyloidogenic peptides, regardless of their primary amino acid sequence, can cause neurodegeneration. PMID:23418567

  13. Increased tau phosphorylation and tau truncation, and decreased synaptophysin levels in mutant BRI2/tau transgenic mice.

    PubMed

    Garringer, Holly J; Murrell, Jill; Sammeta, Neeraja; Gnezda, Anita; Ghetti, Bernardino; Vidal, Ruben

    2013-01-01

    Familial Danish dementia (FDD) is an autosomal dominant neurodegenerative disease caused by a 10-nucleotide duplication-insertion in the BRI(2) gene. FDD is clinically characterized by loss of vision, hearing impairment, cerebellar ataxia and dementia. The main neuropathologic findings in FDD are the deposition of Danish amyloid (ADan) and the presence of neurofibrillary tangles (NFTs). Here we investigated tau accumulation and truncation in double transgenic (Tg-FDD-Tau) mice generated by crossing transgenic mice expressing human Danish mutant BRI(2) (Tg-FDD) with mice expressing human 4-repeat mutant Tau-P301S (Tg-Tau). Compared to Tg-Tau mice, we observed a significant enhancement of tau deposition in Tg-FDD-Tau mice. In addition, a significant increase in tau cleaved at aspartic acid (Asp) 421 was observed in Tg-FDD-Tau mice. Tg-FDD-Tau mice also showed a significant decrease in synaptophysin levels, occurring before widespread deposition of fibrillar ADan and tau can be observed. Thus, the presence of soluble ADan/mutant BRI(2) can lead to significant changes in tau metabolism and synaptic dysfunction. Our data provide new in vivo insights into the pathogenesis of FDD and the pathogenic pathway(s) by which amyloidogenic peptides, regardless of their primary amino acid sequence, can cause neurodegeneration.

  14. p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

    2001-01-01

    Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

  15. Dissecting the roles of aquaporins in renal pathophysiology using transgenic mice

    PubMed Central

    Verkman, A. S.

    2008-01-01

    Transgenic mice lacking renal aquaporins (AQPs), or containing mutated AQPs, have been useful in confirming anticipated AQP functions in renal physiology and in discovering new functions. Mice lacking AQPs 1–4 manifest defects in urinary concentrating ability to different extents. Mechanistic studies have confirmed the involvement of AQP1 in near-isosmolar fluid absorption in proximal tubule, and in countercurrent multiplication and exchange mechanisms that produce medullary hypertonicity in the antidiuretic kidney. Deletion of AQPs 2–4 impairs urinary concentrating ability by reduction of transcellular water permeability in collecting duct. Recently created transgenic mouse models of nephrogenic diabetes insipidus produced by AQP2 gene mutation offer exciting possibilities to test new drug therapies. Several unanticipated AQP functions in kidney have been discovered recently that are unrelated to their role in transcellular water transport. There is evidence for involvement of AQP1 in kidney cell migration following renal injury, of AQP7 in renal glycerol clearance, of AQP11 in prevention of renal cystic disease, and possibly of AQP3 in regulation of collecting duct cell proliferation. Future work in renal AQPs will focus on mechanisms responsible for these non-fluid-transporting functions, and on the development of small-molecule AQP inhibitors for use as aquaretic-type diuretics. PMID:18519083

  16. The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Brody, L.C.; Martin, L.S.

    1993-05-01

    Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

  17. Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle.

    PubMed

    Lyons, John D; Klingensmith, Nathan J; Otani, Shunsuke; Mittal, Rohit; Liang, Zhe; Ford, Mandy L; Coopersmith, Craig M

    2017-12-01

    Cell production and death are tightly regulated in the rapidly renewing gut epithelium, with proliferation confined to crypts and apoptosis occurring in villi and crypts. This study sought to determine how stress alters these compartmentalized processes. Wild-type mice made septic via cecal ligation and puncture had decreased crypt proliferation and increased crypt and villus apoptosis. Fabpi -TAg mice expressing large T-antigen solely in villi had ectopic enterocyte proliferation with increased villus apoptosis in unmanipulated animals. Septic fabpi -TAg mice had an unexpected increase in villus proliferation compared with unmanipulated littermates, whereas crypt proliferation was decreased. Cell cycle regulators cyclin D1 and cyclin D2 were decreased in jejunal tissue in septic transgenic mice. In contrast, villus and crypt apoptosis were increased in septic fabpi -TAg mice. To examine the relationship between apoptosis and proliferation in a compartment-specific manner, fabpi -TAg mice were crossed with fabpl -Bcl-2 mice, resulting in expression of both genes in the villus but Bcl-2 alone in the crypt. Septic bi-transgenic animals had decreased crypt apoptosis but had a paradoxical increase in villus apoptosis compared with septic fabpi -TAg mice, associated with decreased proliferation in both compartments. Thus, sepsis unmasks compartment-specific proliferative and apoptotic regulation that is not present under homeostatic conditions.-Lyons, J. D., Klingensmith, N. J., Otani, S., Mittal, R., Liang, Z., Ford, M. L., Coopersmith, C. M. Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle. © FASEB.

  18. Mice Orally Immunized with a Transgenic Plant Expressing the Glycoprotein of Crimean-Congo Hemorrhagic Fever Virus ▿

    PubMed Central

    Ghiasi, S. M.; Salmanian, A. H.; Chinikar, S.; Zakeri, S.

    2011-01-01

    While Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed the transgenic plant material and injected subcutaneously with the plant-made CCHFV glycoprotein (fed/boosted), vaccinated with an attenuated CCHF vaccine (positive control), or received no treatment (negative control). All immunized groups had a consistent rise in anti-glycoprotein IgG and IgA antibodies in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition, while the study of CCHF is challenging, our protocol should be further used to study CCHFV infection in the knockout mouse model and virus neutralization assays in biosafety level 4 laboratories. PMID:22012978

  19. Reduced wheel running and blunted effects of voluntary exercise in LPA1-null mice: The importance of assessing the amount of running in transgenic mice studies

    PubMed Central

    Castilla-Ortega, Estela; Rosell-Valle, Cristina; Blanco, Eduardo; Pedraza, Carmen; Chun, Jerold; de Fonseca, Fernando Rodríguez; Estivill-Torrús, Guillermo; Santín, Luis J.

    2014-01-01

    This work was aimed to assess whether voluntary exercise rescued behavioral and hippocampal alterations in mice lacking the lysophosphatidic acid LPA1 receptor (LPA1-null mice), studying the potential relationship between the amount of exercise performed and its effects. Normal and LPA1-null mice underwent 23 days of free wheel running and were tested for open-field behavior and adult hippocampal neurogenesis (cell proliferation, immature neurons, cell survival). Running decreased anxiety-like behavior in both genotypes but increased exploration only in the normal mice. While running affected all neurogenesis-related measures in normal mice (especially in the suprapyramidal blade of the dentate gyrus), only a moderate increase in cell survival was found in the mutants. Importantly, the LPA1-nulls showed notably reduced running. Analysis suggested that defective running in the LPA1-null mice could contribute to explain the scarce benefit of the voluntary exercise treatment. On the other hand, a literature review revealed that voluntary exercise is frequently used to modulate behavior and the hippocampus in transgenic mice, but half of the studies did not assess the quantity of running, overlooking any potential running impairments. This study adds evidence to the relevance of the quantity of exercise performed, emphasizing the importance of its assessment in transgenic mice research. PMID:24055600

  20. Epithalon inhibits tumor growth and expression of HER-2/neu oncogene in breast tumors in transgenic mice characterized by accelerated aging.

    PubMed

    Anisimov, V N; Khavinsov, V Kh; Alimova, I N; Provintsiali, M; Manchini, R; Francheski, K

    2002-02-01

    Female transgenic FVB mice carrying breast cancer gene HER-2/neu were monthly injected with Vilon or Epithalon (1 microgram subcutaneously for 5 consecutive days) starting from the 2nd month of life. Epithalon markedly inhibited neoplasm development: the maximum size of breast adenocarcinomas was 33% lower than in the control (p < 0.05). The intensity of HER-2/neu mRNA expression in breast tumors of Epithalon-treated mice was 3.7 times lower than in control animals. These results indicate that Epithalon inhibits breast tumor development in transgenic mice, which is probably related to suppression of HER-2/neu expression.

  1. Effects of (−)Epicatechin on the Pathology of APP/PS1 Transgenic Mice

    PubMed Central

    Zeng, Yue-Qin; Wang, Yan-Jiang; Zhou, Xin-Fu

    2014-01-01

    Background: Alzheimer’s disease (AD) is a multifactorial disorder characterized by the progressive deterioration of neuronal networks. The clearance of Aβ from the brain and anti-inflammation are potential important strategies to prevent and treat disease. In a previous study, we demonstrated the grape seed extract (GSE) could reduce brain Aβ burden and microglia activation, but which polyphenol plays a major role in these events is not known. Here, we tested pharmacological effects of (−)epicatechin, one principle polyphenol compound in GSE, on transgenic AD mice. Methods: APP/PS1 transgenic mice were fed with (−)epicatechin diet (40 mg/kg/day) and curcumin diet (47 mg/kg/day) at 3 months of age for 9 months, the function of liver, Aβ levels in the brain and serum, AD-type neuropathology, plasma levels of inflammatory cytokines were measured. Results: Toward the end of the experiment, we found long-term feeding of (−)epicatechin diet was well tolerated without fatality, changes in food consumption, body weight, or liver function. (−)Epicatechin significantly reduced total Aβ in brain and serum by 39 and 40%, respectively, compared with control diet. Microgliosis and astrocytosis in the brain of Alzheimer’s mice were also reduced by 38 and 35%, respectively. The (−)epicatechin diet did not alter learning and memory behaviors in AD mice. Conclusion: This study has provided evidence on the beneficial role of (−)epicatechin in ameliorating amyloid-induced AD-like pathology in AD mice, but the impact of (−)epicatechin on tau pathology is not clear, also the mechanism needs further research. PMID:24847308

  2. Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

    PubMed Central

    Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

    2014-01-01

    Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

  3. Somatotroph hypoplasia and dwarfism in transgenic mice expressing a non-phosphorylatable CREB mutant.

    PubMed

    Struthers, R S; Vale, W W; Arias, C; Sawchenko, P E; Montminy, M R

    1991-04-18

    Most of the transcriptional effects of cyclic AMP are mediated by the cAMP response element binding protein (CREB). After activation of cAMP-dependent protein kinase A, the catalytic subunits of this enzyme apparently mediate the phosphorylation and activation of CREB. As cAMP serves as a mitogenic signal for anterior pituitary somatotrophic cells, we investigated whether CREB similarly regulates proliferation of these cells. We prepared transgenic mice expressing a transcriptionally inactive mutant of CREB (CREBM1), which cannot be phosphorylated, in cells of the anterior pituitary. If CREB activity is required for proliferation, the overexpressed mutant protein would effectively compete with wild-type CREB activity and thereby block the response to cAMP. As predicted, the CREBM1 transgenic mice exhibited a dwarf phenotype with atrophied pituitary glands markedly deficient in somatotroph but not other cell types. We conclude that transcriptional activation of CREB is necessary for the normal development of a highly restricted cell type, and that environmental cues, possibly provided by the hypothalamic growth hormone-releasing factor, are necessary for population of the pituitary by somatotrophic cells.

  4. Overexpression of TGF-alpha increases lung tissue hysteresivity in transgenic mice.

    PubMed

    Pillow, J J; Korfhagen, T R; Ikegami, M; Sly, P D

    2001-12-01

    Increased transforming growth factor (TGF)-alpha has been observed in neonatal chronic lung disease. Lungs of transgenic mice that overexpress TGF-alpha develop enlarged air spaces and pulmonary fibrosis compared with wild-type mice. We hypothesized that these pathological changes may alter the mechanical coupling of viscous and elastic forces within lung parenchyma. Respiratory impedance was measured in open-chested, tracheostomized adult wild-type and TGF-alpha mice by using the forced oscillation technique (0.25-19.63 Hz) delivered by flexiVent (Scireq, Montreal, PQ). Estimates of airway resistance (Raw), inertance (I), and the coefficients of tissue damping (G(L)) and tissue elastance (H(L)) were obtained by fitting a model to each impedance spectrum. Hysteresivity (eta) was calculated as G(L)/H(L). There was a significant increase in eta (P < 0.01) and a trend to a decrease in H(L) (P = 0.07) of TGF-alpha mice compared with the wild-type group. There was no significant change in Raw, I, or G(L). Structural abnormality present in the lungs of adult TGF-alpha mice alters viscoelastic coupling of the tissues, as evidenced by a change in eta.

  5. Chimeric analysis of EGFP and DsRed2 transgenic mice demonstrates polyclonal maintenance of pancreatic acini.

    PubMed

    Ryu, Je-Young; Siswanto, Antoni; Harimoto, Kenichi; Tagawa, Yoh-ichi

    2013-06-01

    The pancreatic islet is an assembly of specific endocrine cells. There are many conflicting reports regarding whether the acinus develops from single or multiple progenitor cells. This study investigated the development and maintenance clonality of the pancreatic acinus and duct using a chimeric analysis with EGFP and DsRed2 transgenic mice. Chimeric mice (G-R mice) were obtained by the aggregation method, using 8-cell stage embryos from EGFP and DsRed2 transgenic mice. The islets from the G-R mice were chimeric and mosaic, consisting of either EGFP- or DsRed2-positive populations, as in previous reports. On the other hand, most acini developed from either EGFP or DsRed2 origin, but some were chimeric. Interestingly, these chimeric acini were clearly separated into two-color regions and were not mosaic. Some large intralobular pancreatic ducts consisting of more than 10 cells were found to be chimeric, but no small ducts made up of less than 9 cells were chimeric. Our histological observations suggest that the pancreatic acinus polyclonally and directionally is maintained by multiple progenitor cells. Pancreatic large ducts also seem to develop polyclonally and might result from the assembly of small ducts that develop from a single origin. These findings provide useful information for further understanding pancreatic maintenance.

  6. Altered temporal patterns of anxiety in aged and amyloid precursor protein (APP) transgenic mice.

    PubMed

    Bedrosian, Tracy A; Herring, Kamillya L; Weil, Zachary M; Nelson, Randy J

    2011-07-12

    Both normal aging and dementia are associated with dysregulation of the biological clock, which contributes to disrupted circadian organization of physiology and behavior. Diminished circadian organization in conjunction with the loss of cholinergic input to the cortex likely contributes to impaired cognition and behavior. One especially notable and relatively common circadian disturbance among the aged is "sundowning syndrome," which is characterized by exacerbated anxiety, agitation, locomotor activity, and delirium during the hours before bedtime. Sundowning has been reported in both dementia patients and cognitively intact elderly individuals living in institutions; however, little is known about temporal patterns in anxiety and agitation, and the neurobiological basis of these rhythms remains unspecified. In the present study, we explored the diurnal pattern of anxiety-like behavior in aged and amyloid precursor protein (APP) transgenic mice. We then attempted to treat the observed behavioral disturbances in the aged mice using chronic nightly melatonin treatment. Finally, we tested the hypothesis that time-of-day differences in acetylcholinesterase and choline acetyltransferase expression and general neuronal activation (i.e., c-Fos expression) coincide with the behavioral symptoms. Our results show a temporal pattern of anxiety-like behavior that emerges in elderly mice. This behavioral pattern coincides with elevated locomotor activity relative to adult mice near the end of the dark phase, and with time-dependent changes in basal forebrain acetylcholinesterase expression. Transgenic APP mice show a similar behavioral phenomenon that is not observed among age-matched wild-type mice. These results may have useful applications to the study and treatment of age- and dementia-related circadian behavioral disturbances, namely, sundowning syndrome.

  7. Analysis of Stroma Labeling During Multiple Passage of a Sarcoma Imageable Patient-Derived Orthotopic Xenograft (iPDOX) in Red Fluorescent Protein Transgenic Nude Mice.

    PubMed

    Kiyuna, Tasuku; Murakami, Takashi; Tome, Yasunori; Kawaguchi, Kei; Igarashi, Kentaro; Miyake, Kentaro; Kanaya, Fuminori; Singh, Arun; Eilber, Fritz C; Hoffman, Robert M

    2017-10-01

    A patient-derived orthotopic xenograft (PDOX) model of undifferentiated pleomorphic sarcoma (UPS) was previously established that acquired red fluorescent protein (RFP)-expressing stroma by growth in an RFP transgenic nude mouse. In the present study, an imageable PDOX model (iPDOX) of UPS was established by orthotopic implantation in the biceps femoris of transgenic RFP nude mice. After the tumors grew to a diameter of 10 mm, they were harvested and the brightest portion of the tumors were subsequently orthotopically transplanted to both RFP and non-colored nude mice. The UPS PDOX tumor was again transplanted to RFP transgenic and non-colored nude mice, and finally a 3rd passage was made in the same manner. Five UPS tumors from each passage in both RFP and non-colored mouse models were harvested. The FV1,000 confocal microscope was used to visualize and quantitate the RFP area of the resected tumors. The average percent fluorescent area in the first passage of RFP mice was 34 ± 22%; in the second passage, 34 ± 20%; and 36 ± 11% in the third passage of RFP transgenic nude mice. The average tumor RFP area in the first passage from RFP mice to non-colored mice was 20 ± 7%; in the second passage, 28 ± 11%; in the third passage was 27 ± 13%. The present results demonstrate the extensive and stable acquisition of stroma by the UPS-tumor growing orthotopically in transgenic RFP nude mice (iPDOX). This model can be used for screening for effective drugs for individual patients and drug discovery. J. Cell. Biochem. 118: 3367-3371, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boycott, K.M.; Gratton, K.J.; Moore, B.J.

    1994-09-01

    X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailedmore » map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.« less

  9. Tg-SwDI Transgenic Mice Exhibit Novel Alterations in AβPP Processing, Aβ Degradation, and Resilient Amyloid Angiopathy

    PubMed Central

    Van Vickle, Gregory D.; Esh, Chera L.; Daugs, Ian D.; Kokjohn, Tyler A.; Kalback, Walter M.; Patton, R. Lyle; Luehrs, Dean C.; Walker, Douglas G.; Lue, Lih-Fen; Beach, Thomas G.; Davis, Judianne; Van Nostrand, William E.; Castaño, Eduardo M.; Roher, Alex E.

    2008-01-01

    Alzheimer’s disease (AD) is characterized by the accumulation of extracellular insoluble amyloid, primarily derived from polymerized amyloid-β (Aβ) peptides. We characterized the chemical composition of the Aβ peptides deposited in the brain parenchyma and cerebrovascular walls of triple transgenic Tg-SwDI mice that produce a rapid and profuse Aβ accumulation. The processing of the N- and C-terminal regions of mutant AβPP differs substantially from humans because the brain parenchyma accumulates numerous, diffuse, nonfibrillar plaques, whereas the thalamic microvessels harbor overwhelming amounts of compact, fibrillar, thioflavine-S- and apolipoprotein E-positive amyloid deposits. The abundant accretion of vascular amyloid, despite low AβPP transgene expression levels, suggests that inefficient Aβ proteolysis because of conformational changes and dimerization may be key pathogenic factors in this animal model. The disruption of amyloid plaque cores by immunotherapy is accompanied by increased perivascular deposition in both humans and transgenic mice. This analogous susceptibility and response to the disruption of amyloid deposits suggests that Tg-SwDI mice provide an excellent model in which to study the functional aftermath of immunotherapeutic interventions. These mice might also reveal new avenues to promote amyloidogenic AβPP processing and fundamental insights into the faulty degradation and clearance of Aβ in AD, pivotal issues in understanding AD pathophysiology and the assessment of new therapeutic agents. PMID:18599612

  10. A YAC contig encompassing the chromosome 7p locus for autosomal dominant retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inglehearn, C.F.; Keen, T.J.; Ratel, R.

    1994-09-01

    Retinitis pigmentosa is an inherited retinal degeneration characterized by night blindness and loss of peripheral vision, often leading to complete blindness. The autosomal dominant form (adRP) maps to at least six different loci, including the rhodopsin and peripherin/Rds genes and four loci identified only by linkage analysis on chromosomes 7p, 7q, 8cen and 19q. The 7p locus was reported by this laboratory in a large English family, with a lod score of 16.5. Several new genetic markers have been tested in the family and this locus has now been refined to an interval of approximately 1 cM between markers D7S795more » and D7S484 in the 7p13-15 region. In order to clone the gene for adRP, we have used microsatellites and STSs from the region to identify over 80 YACs, from four different libraries, which map to this interval. End clones from key YACs were isolated for the generation of additional STSs. Eleven microsatellite markers between D7S435 (distal) and D7S484 (proximal) have been ordered by a combination of both physical and genetic mapping. In this way we have now obtained a YAC contig spanning approximately 3 megabases of chromosome 7p within which the adRP gene must lie. One gene (aquaporin) and one chromosome 7 brain EST have been placed on the contig but both map distal to the region of interest. Sixteen other ESTs and three further known 7p genes mapping in the region have been excluded. We are now attempting to build a cosmid contig in the defined interval and identify further expressed sequences from both YACs and cosmids to test as candidates for the adRP gene.« less

  11. Studies of UCP2 transgenic and knockout mice reveal that liver UCP2 is not essential for the antiobesity effects of fish oil.

    PubMed

    Tsuboyama-Kasaoka, Nobuyo; Sano, Kayo; Shozawa, Chikako; Osaka, Toshimasa; Ezaki, Osamu

    2008-03-01

    Uncoupling protein 2 (UCP2) is a possible target molecule for energy dissipation. Many dietary fats, including safflower oil and lard, induce obesity in C57BL/6 mice, whereas fish oil does not. Fish oil increases UCP2 expression in hepatocytes and may enhance UCP2 activity by activating the UCP2 molecule or altering the lipid bilayer environment. To examine the role of liver UCP2 in obesity, we created transgenic mice that overexpressed human UCP2 in hepatocytes and examined whether UCP2 transgenic mice showed less obesity when fed a high-fat diet (safflower oil or lard). In addition, we examined whether fish oil had antiobesity effects in UCP2 knockout mice. UCP2 transgenic and wild-type mice fed a high-fat diet (safflower oil or lard) developed obesity to a similar degree. UCP2 knockout and wild-type mice fed fish oil had lower rates of obesity than mice fed safflower oil. Remarkably, safflower oil did not induce obesity in female UCP2 knockout mice, an unexpected phenotype for which we presently have no explanation. However, this unexpected effect was not observed in male UCP2 knockout mice or in UCP2 knockout mice fed a high-lard diet. These data indicate that liver UCP2 is not essential for fish oil-induced decreases in body fat.

  12. P-selectin expressed by a human SELP transgene is atherogenic in apolipoprotein E-deficient mice

    PubMed Central

    Zhang, Nan; Liu, Zhenghui; Yao, Longbiao; Mehta-D’souza, Padmaja; McEver, Rodger P.

    2016-01-01

    Objective During inflammation, P-selectin expressed on activated endothelial cells and platelets mediates rolling adhesion of leukocytes. Atherosclerosis-prone mice crossed with P-selectin-deficient (Selp−/−) mice develop smaller lesions. Cytokines such as tumor necrosis factor-α increase Selp transcripts and augment atherosclerosis in mice. However, they decrease SELP transcripts in humans, challenging assumptions that human P-selectin is atherogenic. We used mice expressing a human SELP transgene to examine the atherogenic role of P-selectin. Approach and results We crossed apolipoprotein E-deficient (Apoe−/−) mice with Selp−/− mice and/or transgenic mice expressing the entire human SELP gene (TgSELP+/−). Aortas developed larger, macrophage-rich atheromas in Apoe−/−Selp−/−TgSELP+/− mice than in Apoe−/−Selp−/− mice after 8 or 16 weeks on a Western diet. Confocal microscopy of Apoe−/−Selp−/−TgSELP+/− aortas revealed staining for human P-selectin in endothelial cells overlying atheromas, but not in lesional macrophages. We also observed staining for human P-selectin in aortic endothelial cells of 3–4-week-old Apoe−/−Selp−/−TgSELP+/− weanlings before atheromas developed. Furthermore, human SELP transcripts were ~3-fold higher in aortas of Apoe−/−Selp+/−TgSELP+/− weanlings than in Selp+/−TgSELP+/− weanlings, whereas murine Selp and Sele transcripts were equivalent in weanlings of both genotypes. Human SELP transcripts in aortas of Apoe−/−Selp+/−TgSELP+/− mice remained nearly constant during 16 weeks on a Western diet, whereas murine Selp and Sele transcripts progressively increased. Bone marrow transplantation in Apoe−/−Selp−/− and Apoe−/−Selp−/−TgSELP+/− mice demonstrated that both platelets and endothelial cells must express human P-selectin to promote atherogenesis. Conclusions P-selectin expressed by human SELP is atherogenic in Apoe−/− mice, suggesting that P

  13. Transgenic Overexpression of Abcb11 Enhances Biliary Bile Salt Outputs, But Does Not Affect Cholesterol Cholelithogenesis in Mice

    PubMed Central

    Wang, Helen H.; Lammert, Frank; Schmitz, Anne; Wang, David Q.-H.

    2010-01-01

    Background Cholesterol gallstone disease is a complex genetic trait and induced by multiple but as yet unknown genes. A major Lith gene, Lith1 was first identified on chromosome 2 in gallstone-susceptible C57L mice compared with resistant AKR mice. Abcb11, encoding the canalicular bile salt export pump in the hepatocyte, co-localizes with the Lith1 QTL region and its hepatic expression is significantly higher in C57L mice than in AKR mice. Material and methods To investigate whether Abcb11 influences cholesterol gallstone formation, we created an Abcb11 transgenic strain on the AKR genetic background and fed these mice with a lithogenic diet for 56 days. Result We excluded functionally relevant polymorphisms of the Abcb11 gene and its promoter region between C57L and AKR mice. Overexpression of Abcb11 significantly promoted biliary bile salt secretion and increased circulating bile salt pool size and bile salt-dependent bile flow rate. However, biliary cholesterol and phospholipid secretion, as well as gallbladder size and contractility were comparable in transgenic and wild-type mice. At 56 days on the lithogenic diet, cholesterol saturation indexes of gallbladder biles and gallstone prevalence rates were essentially similar in these two groups of mice. Conclusion Overexpression of Abcb11 augments biliary bile salt secretion, but does not affect cholelithogenesis in mice. PMID:20456485

  14. Brain-derived neurotrophic factor transgenic mice exhibit passive avoidance deficits, increased seizure severity and in vitro hyperexcitability in the hippocampus and entorhinal cortex.

    PubMed

    Croll, S D; Suri, C; Compton, D L; Simmons, M V; Yancopoulos, G D; Lindsay, R M; Wiegand, S J; Rudge, J S; Scharfman, H E

    1999-01-01

    Transgenic mice overexpressing brain-derived neurotrophic factor from the beta-actin promoter were tested for behavioral, gross anatomical and physiological abnormalities. Brain-derived neurotrophic factor messenger RNA overexpression was widespread throughout brain. Overexpression declined with age, such that levels of overexpression decreased sharply by nine months. Brain-derived neurotrophic factor transgenic mice had no gross deformities or behavioral abnormalities. However, they showed a significant passive avoidance deficit. This deficit was dependent on continued overexpression, and resolved with age as brain-derived neurotrophic factor transcripts decreased. In addition, the brain-derived neurotrophic factor transgenic mice showed increased seizure severity in response to kainic acid. Hippocampal slices from brain-derived neurotrophic factor transgenic mice showed hyperexcitability in area CA3 and entorhinal cortex, but not in dentate gyrus. Finally, area CA1 long-term potentiation was disrupted, indicating abnormal plasticity. Our data suggest that overexpression of brain-derived neurotrophic factor in the brain can interfere with normal brain function by causing learning impairments and increased excitability. The results also support the hypothesis that excess brain-derived neurotrophic factor could be pro-convulsant in the limbic system.

  15. Chemoprevention of urothelial cell carcinoma growth and invasion by the dual COX-LOX inhibitor licofelone in UPII-SV40T transgenic mice.

    PubMed

    Madka, Venkateshwar; Mohammed, Altaf; Li, Qian; Zhang, Yuting; Patlolla, Jagan M R; Biddick, Laura; Lightfoot, Stan; Wu, Xue-Ru; Steele, Vernon; Kopelovich, Levy; Rao, Chinthalapally V

    2014-07-01

    Epidemiologic and clinical data suggest that use of anti-inflammatory agents is associated with reduced risk for bladder cancer. We determined the chemopreventive efficacy of licofelone, a dual COX-lipoxygenase (LOX) inhibitor, in a transgenic UPII-SV40T mouse model of urothelial transitional cell carcinoma (TCC). After genotyping, six-week-old UPII-SV40T mice (n = 30/group) were fed control (AIN-76A) or experimental diets containing 150 or 300 ppm licofelone for 34 weeks. At 40 weeks of age, all mice were euthanized, and urinary bladders were collected to determine urothelial tumor weights and to evaluate histopathology. Results showed that bladders of the transgenic mice fed control diet weighed 3 to 5-fold more than did those of the wild-type mice due to urothelial tumor growth. However, treatment of transgenic mice with licofelone led to a significant, dose-dependent inhibition of the urothelial tumor growth (by 68.6%-80.2%, P < 0.0001 in males; by 36.9%-55.3%, P < 0.0001 in females) compared with the control group. The licofelone diet led to the development of significantly fewer invasive tumors in these transgenic mice. Urothelial tumor progression to invasive TCC was inhibited in both male (up to 50%; P < 0.01) and female mice (41%-44%; P < 0.003). Urothelial tumors of the licofelone-fed mice showed an increase in apoptosis (p53, p21, Bax, and caspase3) with a decrease in proliferation, inflammation, and angiogenesis markers (proliferating cell nuclear antigen, COX-2, 5-LOX, prostaglandin E synthase 1, FLAP, and VEGF). These results suggest that licofelone can serve as potential chemopreventive for bladder TCC. ©2014 American Association for Cancer Research.

  16. Efficient stabilization of recombinant human coagulation factor VIII in the milk of transgenic mice using hFVIII and vWF co-expression vector transduction.

    PubMed

    Ren, Xiaoye; Gong, Xiuli; Cai, Qin; Guo, Xinbing; Xu, Miao; Ren, Zhaorui; Zeng, Yitao

    2015-06-01

    To investigate the reasons for the instability of human coagulation factor FVIII (hFVIII) in milk which is an intractable obstacle during the hFVIII production by a transgenic mammary gland bioreactor. We constructed P1A3-hFVIIIBDD and P1A3-hFVIIIBDD-IRES-vWF co-expression cassettes for generating transgenic mice. P1A3-hFVIII/CMV-vWF double heterozygotes were also prepared by mating P1A3-hFVIIIBDD with CMV-vWF mice. hFVIII bioactivity in milk was determined under different storage conditions. The half-life (in vitro) of hFVIII bioactivity in P1A3-hFVIIIBDD-IRES-vWF mice was significantly longer than P1A3-hFVIIIBDD mice [77 ± 4.9 vs. 44 ± 2.6 h at 4 °C, 32.5 ± 5 vs. 19.7 ± 0.6 h at room temperature and 7.4 ± 1.4 vs. 3.4 ± 0.6 at 37 °C, respectively (P < 0.05)]. The half-life (in vitro) of hFVIII bioactivity in milk of double heterozygotes was similar to P1A3-hFVIIIBDD-IRES-vWF ones, demonstrating that the vWF transgene expression in hFVIII transgenic mice can efficiently improve the stabilization of hFVIII bioactivity in milk. We provide a new approach of P1A3-hFVIIIBDD-IRES-vWF co-expression to generate more stable hFVIII in transgenic milk with rapid and low cost as well as valuable information for producing pharmaceutical proteins by transgenic mammary gland bioreactor.

  17. Chronic wasting disease prions are not transmissible to transgenic mice overexpressing human prion protein.

    PubMed

    Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2010-10-01

    Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.

  18. Reduced wheel running and blunted effects of voluntary exercise in LPA1-null mice: the importance of assessing the amount of running in transgenic mice studies.

    PubMed

    Castilla-Ortega, Estela; Rosell-Valle, Cristina; Blanco, Eduardo; Pedraza, Carmen; Chun, Jerold; Rodríguez de Fonseca, Fernando; Estivill-Torrús, Guillermo; Santín, Luis J

    2013-11-01

    This work was aimed to assess whether voluntary exercise rescued behavioral and hippocampal alterations in mice lacking the lysophosphatidic acid LPA1 receptor (LPA1-null mice), studying the potential relationship between the amount of exercise performed and its effects. Normal and LPA1-null mice underwent 23 days of free wheel running and were tested for open-field behavior and adult hippocampal neurogenesis (cell proliferation, immature neurons, cell survival). Running decreased anxiety-like behavior in both genotypes but increased exploration only in the normal mice. While running affected all neurogenesis-related measures in normal mice (especially in the suprapyramidal blade of the dentate gyrus), only a moderate increase in cell survival was found in the mutants. Importantly, the LPA1-nulls showed notably reduced running. Analysis suggested that defective running in the LPA1-null mice could contribute to explain the scarce benefit of the voluntary exercise treatment. On the other hand, a literature review revealed that voluntary exercise is frequently used to modulate behavior and the hippocampus in transgenic mice, but half of the studies did not assess the quantity of running, overlooking any potential running impairments. This study adds evidence to the relevance of the quantity of exercise performed, emphasizing the importance of its assessment in transgenic mice research. Copyright © 2013 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  19. Studies of protein aggregation in A53T α-synuclein transgenic, Tg2576 transgenic, and P246L presenilin-1 knock-in cross bred mice.

    PubMed

    Emmer, Kristel L; Covy, Jason P; Giasson, Benoit I

    2012-01-24

    Synucleinopathies are a group of neurodegenerative disorders, including Parkinson disease, associated with neuronal amyloid inclusions comprised of the presynaptic protein α-synuclein (α-syn); however the biological events that initiate and lead to the formation of these inclusions are still poorly understood. There is mounting evidence that intracellular α-syn aggregation may proceed via a seeding mechanism and could spread between neurons through a prion-like mechanism that may involve other amyloidogenic proteins. Several lines of evidence suggest that Aβ peptides and/or extracellular Aβ deposits may directly or indirectly promote intracellular α-syn aggregation. To assess the effects of Aβ peptides and extracellular Aβ deposits on α-syn aggregate formation, transgenic mice (line M83) expressing A53T human α-syn that are sensitive to developing α-syn pathological inclusions were cross bred to Tg2576 transgenic mice that generated elevated levels of Aβ peptides and develop abundant Aβ plaques. In addition these mice were bred to mice with the P264L presenilin-1 knock-in mutation that further promotes Aβ plaque formation. These mice demonstrated the expected formation of Aβ plaques; however despite the accumulation of hyperphosphorylated α-syn dystrophic neurites within or surrounding Aβ plaques, no additional α-syn pathologies were observed. These studies show that Aβ amyloid deposits can cause the local aggregation of α-syn, but these did not lead to more extensive α-syn pathology. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  20. M2 Macrophages Play Critical Roles in Progression of Inflammatory Liver Disease in Hepatitis C Virus Transgenic Mice.

    PubMed

    Ohtsuki, Takahiro; Kimura, Kiminori; Tokunaga, Yuko; Tsukiyama-Kohara, Kyoko; Tateno, Chise; Hayashi, Yukiko; Hishima, Tsunekazu; Kohara, Michinori

    2016-01-01

    Macrophages in liver tissue are widely defined as important inflammatory cells in chronic viral hepatitis due to their proinflammatory activity. We reported previously that interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) play significant roles in causing chronic hepatitis in hepatitis C virus (HCV) transgenic mice (S. Sekiguchi et al., PLoS One 7:e51656, 2012, http://dx.doi.org/10.1371/journal.pone.0051656). In addition, we showed that recombinant vaccinia viruses expressing an HCV nonstructural protein (rVV-N25) could protect against the progression of chronic hepatitis by suppression of macrophage activation. Here, we focus on the role of macrophages in liver disease progression in HCV transgenic mice and examine characteristic features of macrophages following rVV-N25 treatment. The number of CD11b(+) F4/80(+) CD11c(-) CD206(+) (M2) macrophages in the liver of HCV transgenic mice was notably increased compared to that of age-matched control mice. These M2 macrophages in the liver produced elevated levels of IL-6 and TNF-α. rVV-N25 infection suppressed the number and activation of M2 macrophages in liver tissue. These results suggested that inflammatory cytokines produced by M2-like macrophages contribute to the induction of chronic liver inflammation in HCV transgenic mice. Moreover, the therapeutic effect of rVV-N25 might be induced by the suppression of the number and activation of hepatic macrophages. HCV causes persistent infections that can lead to chronic liver diseases, liver fibrosis, and hepatocellular carcinoma; the search for an HCV curative is the focus of ongoing research. Recently, effective anti-HCV drugs have been developed; however, vaccine development still is required for the prevention and therapy of infection by this virus. We demonstrate here that M2 macrophages are important for the pathogenesis of HCV-caused liver diseases and additionally show that M2 macrophages contribute to the therapeutic mechanism observed following r

  1. M2 Macrophages Play Critical Roles in Progression of Inflammatory Liver Disease in Hepatitis C Virus Transgenic Mice

    PubMed Central

    Ohtsuki, Takahiro; Kimura, Kiminori; Tokunaga, Yuko; Tsukiyama-Kohara, Kyoko; Tateno, Chise; Hayashi, Yukiko; Hishima, Tsunekazu

    2015-01-01

    ABSTRACT Macrophages in liver tissue are widely defined as important inflammatory cells in chronic viral hepatitis due to their proinflammatory activity. We reported previously that interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) play significant roles in causing chronic hepatitis in hepatitis C virus (HCV) transgenic mice (S. Sekiguchi et al., PLoS One 7:e51656, 2012, http://dx.doi.org/10.1371/journal.pone.0051656). In addition, we showed that recombinant vaccinia viruses expressing an HCV nonstructural protein (rVV-N25) could protect against the progression of chronic hepatitis by suppression of macrophage activation. Here, we focus on the role of macrophages in liver disease progression in HCV transgenic mice and examine characteristic features of macrophages following rVV-N25 treatment. The number of CD11b+ F4/80+ CD11c− CD206+ (M2) macrophages in the liver of HCV transgenic mice was notably increased compared to that of age-matched control mice. These M2 macrophages in the liver produced elevated levels of IL-6 and TNF-α. rVV-N25 infection suppressed the number and activation of M2 macrophages in liver tissue. These results suggested that inflammatory cytokines produced by M2-like macrophages contribute to the induction of chronic liver inflammation in HCV transgenic mice. Moreover, the therapeutic effect of rVV-N25 might be induced by the suppression of the number and activation of hepatic macrophages. IMPORTANCE HCV causes persistent infections that can lead to chronic liver diseases, liver fibrosis, and hepatocellular carcinoma; the search for an HCV curative is the focus of ongoing research. Recently, effective anti-HCV drugs have been developed; however, vaccine development still is required for the prevention and therapy of infection by this virus. We demonstrate here that M2 macrophages are important for the pathogenesis of HCV-caused liver diseases and additionally show that M2 macrophages contribute to the therapeutic mechanism

  2. Neuron and neuroblast numbers and cytogenesis in the dentate gyrus of aged APPswe/PS1dE9 transgenic mice: Effect of long-term treatment with paroxetine.

    PubMed

    Olesen, Louise Ørum; Sivasaravanaparan, Mithula; Severino, Maurizio; Babcock, Alicia A; Bouzinova, Elena V; West, Mark J; Wiborg, Ove; Finsen, Bente

    2017-08-01

    Altered neurogenesis may influence hippocampal functions such as learning and memory in Alzheimer's disease. Selective serotonin reuptake inhibitors enhance neurogenesis and have been reported to reduce cerebral amyloidosis in both humans and transgenic mice. We have used stereology to assess the longitudinal changes in the number of doublecortin-expressing neuroblasts and number of granular neurons in the dentate gyrus of APP swe /PS1 dE9 transgenic mice. Furthermore, we investigated the effect of long-term paroxetine treatment on the number of neuroblasts and granular neurons, hippocampal amyloidosis, and spontaneous alternation behaviour, a measure of spatial working memory, in transgenic mice. We observed no difference in granular neurons between transgenic and wild type mice up till 18months of age, and no differences with age in wild type mice. The number of neuroblasts and the performance in the spontaneous alternation task was reduced in aged transgenic mice. Paroxetine treatment from 9 to 18months of age reduced hippocampal amyloidosis without affecting the number of neuroblasts or granular neurons. These findings suggest that the amyloidosis affects the differentiation of neuroblasts and spatial working memory, independent of changes in total granular neurons. Furthermore, while long-term paroxetine treatment may be able to reduce hippocampal amyloidosis, it appears to have no effect on total number of granular neurons or spatial working memory. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Ingestion of transgenic carrots expressing the Escherichia coli heat-labile enterotoxin B subunit protects mice against cholera toxin challenge.

    PubMed

    Rosales-Mendoza, Sergio; Soria-Guerra, Ruth Elena; López-Revilla, Rubén; Moreno-Fierros, Leticia; Alpuche-Solís, Angel Gabriel

    2008-01-01

    Diarrheal diseases caused by Vibrio cholerae and enterotoxigenic Escherichia coli (ETEC) are worldwide health problems that might be prevented with vaccines based on edible plants expressing the B subunit from either the cholera toxin (CTB) or the E. coli heat labile toxin (LTB). In this work we analyzed the immunity induced in Balb/c mice by ingestion of three weekly doses of 10 mug of LTB derived from transgenic carrot material. Although the anti-LTB serum immunoglobulin G (IgG) and intestinal IgA antibody responses were higher with 10 mug-doses of pure bacterial recombinant LTB (rLTB), the transgenic carrot material also elicited significant serum and intestinal antibody responses. Serum anti-LTB IgG1 antibodies predominated over IgG2a antibodies, suggesting that mainly Th2 responses were induced. A decrease of intestinal fluid accumulation after cholera toxin challenge was observed in mice immunized with either rLTB or LTB-containing carrot material. These results demonstrate that ingestion of carrot-derived LTB induces antitoxin systemic and intestinal immunity in mice and suggest that transgenic carrots expressing LTB may be used as an effective edible vaccine against cholera and ETEC diarrhea in humans.

  4. Breaking tolerance in transgenic mice expressing the human TSH receptor A-subunit: thyroiditis, epitope spreading and adjuvant as a 'double edged sword'.

    PubMed

    McLachlan, Sandra M; Aliesky, Holly A; Chen, Chun-Rong; Chong, Gao; Rapoport, Basil

    2012-01-01

    Transgenic mice with the human thyrotropin-receptor (TSHR) A-subunit targeted to the thyroid are tolerant of the transgene. In transgenics that express low A-subunit levels (Lo-expressors), regulatory T cell (Treg) depletion using anti-CD25 before immunization with adenovirus encoding the A-subunit (A-sub-Ad) breaks tolerance, inducing extensive thyroid lymphocytic infiltration, thyroid damage and antibody spreading to other thyroid proteins. In contrast, no thyroiditis develops in Hi-expressor transgenics or wild-type mice. Our present goal was to determine if thyroiditis could be induced in Hi-expressor transgenics using a more potent immunization protocol: Treg depletion, priming with Complete Freund's Adjuvant (CFA) + A-subunit protein and further Treg depletions before two boosts with A-sub-Ad. As controls, anti-CD25 treated Hi- and Lo-expressors and wild-type mice were primed with CFA+ mouse thyroglobulin (Tg) or CFA alone before A-sub-Ad boosting. Thyroiditis developed after CFA+A-subunit protein or Tg and A-sub-Ad boosting in Lo-expressor transgenics but Hi- expressors (and wild-type mice) were resistant to thyroiditis induction. Importantly, in Lo-expressors, thyroiditis was associated with the development of antibodies to the mouse TSHR downstream of the A-subunit. Unexpectedly, we observed that the effect of bacterial products on the immune system is a "double-edged sword". On the one hand, priming with CFA (mycobacteria emulsified in oil) plus A-subunit protein broke tolerance to the A-subunit in Hi-expressor transgenics leading to high TSHR antibody levels. On the other hand, prior treatment with CFA in the absence of A-subunit protein inhibited responses to subsequent immunization with A-sub-Ad. Consequently, adjuvant activity arising in vivo after bacterial infections combined with a protein autoantigen can break self-tolerance but in the absence of the autoantigen, adjuvant activity can inhibit the induction of immunity to autoantigens (like the

  5. Hibernoma formation in transgenic mice and isolation of a brown adipocyte cell line expressing the uncoupling protein gene.

    PubMed Central

    Ross, S R; Choy, L; Graves, R A; Fox, N; Solevjeva, V; Klaus, S; Ricquier, D; Spiegelman, B M

    1992-01-01

    Transgenic mice were produced containing the adipocyte-specific regulatory region from the adipocyte P2 (aP2) gene linked to the simian virus 40 transforming genes. Most of the transgenic mice developed brown fat tumors (hibernomas) in their interscapular brown adipose tissue. Hibernoma formation was noticeable in some of the mice as early as 1 day after birth and most of the mice developed very large tumors by 1 month of age. All of the tumor tissue expressed the brown fat-specific uncoupling protein (UCP) gene as well as the aP2 gene. Several of the tumors have been used to establish cultured cell lines and at least one of these lines can be induced to differentiate into brown adipocytes. The cultured adipocytes express mRNA for UCP upon stimulation with N6,O2'-dibutyryladenosine 3',5'-cyclic monophosphate, norepinephrine, isoproterenol or D7114, a beta 3 adrenergic agonist. Thus, regulation of the key thermogenic gene UCP can now be studied in an established cell line. Images PMID:1323843

  6. Mono-allelic expression of variegating transgene locus in the mouse.

    PubMed

    Opsahl, Margaret L; Springbett, Anthea; Lathe, Richard; Colman, Alan; McClenaghan, Margaret; Whitelaw, C Bruce A

    2003-12-01

    We have generated transgenic mice which express an ovine beta-lactoglobulin transgene during lactation. In two transgenic lines, BLG/7 and BLG/45, beta-lactoglobulin protein levels vary between siblings, reflected at the cellular level by a mosaic transgene expression pattern in the mammary tissue that is reminiscent of position effect variegation. To investigate whether this variegating expression profile can be affected by the introduction of an identical variegating locus on the homologous chromosome, we compared the beta-lactoglobulin expression profiles in mice hemizygous or homozygous for the transgene locus. In BLG/45 mice, milk protein analysis revealed that transgene expression was effectively doubled in homozygous compared to hemizygous mice. In contrast, beta-lactoglobulin protein in hemizygous and homozygous BLG/7 mice displayed a similar range; although minimum expression levels were doubled in the homozygous population, the maximum level of expression was indistinguishable between the two populations. Fluorescent in situ hybridisation (FISH) for transgene mRNA indicated that for a given protein level, the extent of cellular expression is similar in both BLG/7 populations. In homozygous mice genomic DNA and nuclear RNA FISH demonstrated that only one of the two BLG/7 loci is active in expressing cells, while two transcription foci were present in BLG/45 homozygous mice. This mono-allelic transgene expression pattern is not inherited through the germline, as hemizygous mice bred from homozygous parents expressed at the expected hemizygous population level. We discuss these observations in the context of known epigenetic events such as imprinting and trans-inactivation.

  7. A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

    PubMed

    Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

    2015-03-01

    A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

  8. INCREASED RENAL OXIDATIVE STRESS IN SALT-SENSITIVE HUMAN GRK4γ486V TRANSGENIC MICE

    PubMed Central

    Diao, Zhenyu; Asico, Laureano D.; Villar, Van Anthony M.; Zheng, Xiaoxu; Cuevas, Santiago; Armando, Ines; Jose, Pedro A.; Wang, Xiaoyan

    2017-01-01

    We tested the hypothesis that salt-sensitive hypertension is caused by renal oxidative stress by measuring the blood pressure and reactive oxygen species-related proteins in the kidneys of human G protein-coupled receptor kinase 4γ (hGRK4γ) 486V transgenic mice and non-transgenic (Non-T) littermates on normal and high salt diets. High salt diet increased the blood pressure, associated with impaired sodium excretion, in hGRK4γ486V mice. Renal expressions of NOX isoforms were similar in both strains on normal salt diet but NOX2 was decreased by high salt diet to a greater extent in Non-T than hGRK4γ486V mice. Renal HO-2, but not HO-1, protein was greater in hGRK4γ486V than Non-T mice on normal salt diet and normalized by high salt diet. On normal salt diet, renal CuZnSOD and ECSOD proteins were similar but renal MnSOD was lower in hGRK4γ486V than Non-T mice and remained low on high salt diet. High salt diet decreased renal CuZnSOD in hGRK4γ486V but not Non-T mice and decreased renal ECSOD to a greater extent in hGRK4γ486V than Non-T mice. Renal SOD activity, superoxide production, and NOS3 protein were similar in two strains on normal salt diet. However, high salt diet decreased SOD activity and NOS3 protein and increased superoxide production in hGRK4γ486V mice but not in Non-T mice. High salt diet also increased urinary 8-isoprostane and 8-hydroxydeoxyguanosine to a greater extent in hGRK4γ486V than Non-T mice. hGRK4γwild-type mice were normotensive and hGRK4γ142V mice were hypertensive but both were salt-resistant and in normal redox balance. Chronic tempol treatment partially prevented the salt-sensitivity of hGRK4γ486V mice. Thus, hGRK4γ486V causes salt-sensitive hypertension due, in part, to defective renal antioxidant mechanisms. PMID:28189851

  9. Reduced striatal dopamine DA D2 receptor function in dominant-negative GSK-3 transgenic mice.

    PubMed

    Gomez-Sintes, Raquel; Bortolozzi, Analia; Artigas, Francesc; Lucas, José J

    2014-09-01

    Glycogen synthase kinase-3 (GSK-3) is a serine/threonine kinase with constitutive activity involved in cellular architecture, gene expression, cell proliferation, fate decision and apoptosis, among others. GSK-3 expression is particularly high in brain where it may be involved in neurological and psychiatric disorders such as Alzheimer׳s disease, bipolar disorder and major depression. A link with schizophrenia is suggested by the antipsychotic drug-induced GSK-3 regulation and by the involvement of the Akt/GSK-3 pathway in dopaminergic neurotransmission. Taking advantage of the previous development of dominant negative GSK-3 transgenic mice (Tg) showing a selective reduction of GSK-3 activity in forebrain neurons but not in dopaminergic neurons, we explored the relationship between GSK-3 and dopaminergic neurotransmission in vivo. In microdialysis experiments, local quinpirole (DA D2-R agonist) in dorsal striatum reduced dopamine (DA) release significantly less in Tg mice than in wild-type (WT) mice. However, local SKF-81297 (selective DA D1-R agonist) in dorsal striatum reduced DA release equally in both control and Tg mice indicating a comparable function of DA D1-R in the direct striato-nigral pathway. Likewise, systemic quinpirole administration - acting preferentially on presynaptic DA D2- autoreceptors to modulate DA release-reduced striatal DA release similarly in both control and Tg mice. Quinpirole reduced locomotor activity and induced c-fos expression in globus pallidus (both striatal DA D2-R-mediated effects) significantly more in WT than in Tg mice. Taking together, the present results show that dominant negative GSK-3 transgenic mice show reduced DA D2-R-mediated function in striatum and further support a link between dopaminergic neurotransmission and GSK-3 activity. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

  10. The high-level expression of human tissue plasminogen activator in the milk of transgenic mice with hybrid gene locus strategy.

    PubMed

    Zhou, Yanrong; Lin, Yanli; Wu, Xiaojie; Xiong, Fuyin; Lv, Yuemeng; Zheng, Tao; Huang, Peitang; Chen, Hongxing

    2012-02-01

    Transgene expression for the mammary gland bioreactor aimed at producing recombinant proteins requires optimized expression vector construction. Previously we presented a hybrid gene locus strategy, which was originally tested with human lactoferrin (hLF) as target transgene, and an extremely high-level expression of rhLF ever been achieved as to 29.8 g/l in mice milk. Here to demonstrate the broad application of this strategy, another 38.4 kb mWAP-htPA hybrid gene locus was constructed, in which the 3-kb genomic coding sequence in the 24-kb mouse whey acidic protein (mWAP) gene locus was substituted by the 17.4-kb genomic coding sequence of human tissue plasminogen activator (htPA), exactly from the start codon to the end codon. Corresponding five transgenic mice lines were generated and the highest expression level of rhtPA in the milk attained as to 3.3 g/l. Our strategy will provide a universal way for the large-scale production of pharmaceutical proteins in the mammary gland of transgenic animals.

  11. Effects of apoA-V on HDL and VLDL metabolism in APOC3 transgenic mice.

    PubMed

    Qu, Shen; Perdomo, German; Su, Dongming; D'Souza, Fiona M; Shachter, Neil S; Dong, H Henry

    2007-07-01

    Apolipoprotein A-V (apoA-V) and apoC-III are exchangeable constituents of VLDL and HDL. ApoA-V counteracts the effect of apoC-III on triglyceride (TG) metabolism with poorly defined mechanisms. To better understand the effects of apoA-V on TG and cholesterol metabolism, we delivered apoA-V cDNA into livers of hypertriglyceridemic APOC3 transgenic mice by adenovirus-mediated gene transfer. In response to hepatic apoA-V production, plasma TG levels were reduced significantly as a result of enhanced VLDL catabolism without alternations in VLDL production. This effect was associated with reduced apoC-III content in VLDL. Increased apoA-V production also resulted in decreased apoC-III and increased apoA-I content in HDL. Furthermore, apoA-V-enriched HDL was associated with enhanced LCAT activity and increased cholesterol efflux. This effect, along with apoE enrichment in HDL, contributed to HDL core expansion and alpha-HDL formation, accounting for significant increases in both the number and size of HDL particles. As a result, apoA-V-treated APOC3 transgenic mice exhibited decreased VLDL-cholesterol and increased HDL-cholesterol levels. ApoA-V-mediated reduction of apoC-III content in VLDL represents an important mechanism by which apoA-V acts to ameliorate hypertriglyceridemia in adult APOC3 transgenic mice. In addition, increased apoA-V levels accounted for cholesterol redistribution from VLDL to larger HDL particles. These data suggest that in addition to its TG-lowering effect, apoA-V plays a significant role in modulating HDL maturation and cholesterol metabolism.

  12. Construction of a YAC contig and STS map spanning 2.5 Mbp in Xq25, the critical region for the X-linked lymphoproliferative (XLP) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lanyi, A.; Li, B.F.; Li, S.

    1994-09-01

    X-linked lymphoproliferative disease (XLP) is characterized by a marked vulnerability in Epstein-Barr virus (EBV) infection. Infection of XLP patients with EBV invariably results in fatal mononucleosis, agammaglobulinemia or B-cell lymphoma. The XLP gene lies within a 10 cM region in Xq25 between DXS42 and DXS10. Initial chromosome studies revealed an interstitial, cytogenetically visible deletion in Xq25 in one XLP family (43-004). We estimated the size of the Xq25 deletion by dual laser flow karyotyping to involve 2% of the X chromosome, or approximately 3 Mbp of DNA sequences. To further delineate the deletion we performed a series of pulsed fieldmore » gel electrophoresis (PFGE) analyses which showed that DXS6 and DXS100, two Xq25-specific markers, are missing from 45-004 DNA. Five yeast artificial chromosomes (YACs) from a chromosome X specific YAC library containing sequences deleted in patient`s 43-004 DNA were isolated. These five YACs did not overlap, and their end fragments were used to screen the CEPH MegaYAC library. Seven YACs were isolated from the CEPH MegaYAC library. They could be arranged into a contig which spans between DXS6 and DXS100. The contig contains a minimum of 2.5 Mbp of human DNA. A total of 12 YAC end clone, lambda subclones and STS probes have been used to order clones within the contig. These reagents were also used in Southern blot and patients showed interstitial deletions in Xq25. The size of these deletions range between 0.5 and 2.5 Mbp. The shortest deletion probably represents the critical region for the XLP gene.« less

  13. Abnormal differentiation, hyperplasia and embryonic/perinatal lethality in BK5-T/t transgenic mice

    PubMed Central

    Chen, Xin; Schneider-Broussard, Robin; Hollowell, Debra; McArthur, Mark; Jeter, Collene R.; Benavides, Fernando; DiGiovanni, John; Tang, Dean G.

    2009-01-01

    The cell-of-origin has a great impact on the types of tumors that develop and the stem/progenitor cells have long been considered main targets of malignant transformation. The SV40 large T and small t antigens (T/t), have been targeted to multiple differentiated cellular compartments in transgenic mice. In most of these studies, transgenic animals develop tumors without apparent defects in animal development. In this study, we used the bovine keratin 5 (BK5) promoter to target the T/t antigens to stem/progenitor cell-containing cytokeratin 5 (CK5) cellular compartment. A transgene construct, BK5-T/t, was made and microinjected into the male pronucleus of FVB/N mouse oocytes. After implanting ∼1700 embryos, only 7 transgenics were obtained, including 4 embryos (E9.5, E13, E15, and E20) and 3 postnatal animals, which died at P1, P2, and P18, respectively. Immunohistological analysis revealed aberrant differentiation and prominent hyperplasia in several transgenic CK5 tissues, especially the upper digestive organs (tongue, oral mucosa, esophagus, and forestomach) and epidermis, the latter of which also showed focal dysplasia. Altogether, these results indicate that constitutive expression of the T/t antigens in CK5 cellular compartment results in abnormal epithelial differentiation and leads to embryonic/perinatal animal lethality. PMID:19272531

  14. Inhibition of elastase-pulmonary emphysema in dominant-negative MafB transgenic mice.

    PubMed

    Aida, Yasuko; Shibata, Yoko; Abe, Shuichi; Inoue, Sumito; Kimura, Tomomi; Igarashi, Akira; Yamauchi, Keiko; Nunomiya, Keiko; Kishi, Hiroyuki; Nemoto, Takako; Sato, Masamichi; Sato-Nishiwaki, Michiko; Nakano, Hiroshi; Sato, Kento; Kubota, Isao

    2014-01-01

    Alveolar macrophages (AMs) play important roles in the pathogenesis of chronic obstructive pulmonary disease (COPD). We previously demonstrated upregulation of the transcription factor MafB in AMs of mice exposed to cigarette smoke. The aim of this study was to elucidate the roles of MafB in the development of pulmonary emphysema. Porcine pancreatic elastase was administered to wild-type (WT) and dominant-negative (DN)-MafB transgenic (Tg) mice in which MafB activity was suppressed only in macrophages. We measured the mean linear intercept and conducted cell differential analysis of bronchoalveolar lavage (BAL) cells, surface marker analysis using flow cytometry, and immunohistochemical staining using antibodies to matrix metalloproteinase (MMP)-9 and MMP-12. Airspace enlargement of the lungs was suppressed significantly in elastase-treated DN-MafB Tg mice compared with treated WT mice. AMs with projected pseudopods were decreased in DN-MafB Tg mice. The number of cells intermediately positive for F4/80 and weakly or intermediately positive for CD11b, which are considered cell subsets of matured AMs, decreased in the BAL of DN-MafB Tg mice. Furthermore, MMP-9 and -12 were significantly downregulated in BAL cells of DN-MafB Tg mice. Because MMPs exacerbate emphysema, MafB may be involved in pulmonary emphysema development through altered maturation of macrophages and MMP expression.

  15. Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo

    PubMed Central

    Bidlack, Felicitas B.; Xia, Yan; Pugach, Megan K.

    2017-01-01

    Mice lacking amelogenin (KO) have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes (Tg) representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180Tg, CTRNCTg and LRAPTg mice to generate M180Tg and CTRNCTg double transgene and M180Tg, CTRNCTg, LRAPTg triple transgene mice with transgene hemizygosity (on one allelle) or homozygosity (on both alleles). Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene (p < 0.05). The presence of the LRAPTg did not improve the phenotype of M180Tg/CTRNCTg/KO enamel. In the absence of endogenous amelogenin, the addition of amelogenin transgenes representing the most abundant splice

  16. Transmission and adaptation of chronic wasting disease to hamsters and transgenic mice: evidence for strains.

    PubMed

    Raymond, Gregory J; Raymond, Lynne D; Meade-White, Kimberly D; Hughson, Andrew G; Favara, Cynthia; Gardner, Donald; Williams, Elizabeth S; Miller, Michael W; Race, Richard E; Caughey, Byron

    2007-04-01

    In vitro screening using the cell-free prion protein conversion system indicated that certain rodents may be susceptible to chronic wasting disease (CWD). Therefore, CWD isolates from mule deer, white-tailed deer, and elk were inoculated intracerebrally into various rodent species to assess the rodents' susceptibility and to develop new rodent models of CWD. The species inoculated were Syrian golden, Djungarian, Chinese, Siberian, and Armenian hamsters, transgenic mice expressing the Syrian golden hamster prion protein, and RML Swiss and C57BL10 wild-type mice. The transgenic mice and the Syrian golden, Chinese, Siberian, and Armenian hamsters had limited susceptibility to certain of the CWD inocula, as evidenced by incomplete attack rates and long incubation periods. For serial passages of CWD isolates in Syrian golden hamsters, incubation periods rapidly stabilized, with isolates having either short (85 to 89 days) or long (408 to 544 days) mean incubation periods and distinct neuropathological patterns. In contrast, wild-type mouse strains and Djungarian hamsters were not susceptible to CWD. These results show that CWD can be transmitted and adapted to some species of rodents and suggest that the cervid-derived CWD inocula may have contained or diverged into at least two distinct transmissible spongiform encephalopathy strains.

  17. Anesthesia/Surgery Induces Cognitive Impairment in Female Alzheimer's Disease Transgenic Mice.

    PubMed

    Zhang, Ce; Zhang, Yiying; Shen, Yuan; Zhao, Guoqing; Xie, Zhongcong; Dong, Yuanlin

    2017-01-01

    Anesthesia and/or surgery may promote Alzheimer's disease (AD) by accelerating its neuropathogenesis. Other studies showed different findings. However, the potential sex difference among these studies has not been well considered, and it is unknown whether male or female AD patients are more vulnerable to develop postoperative cognitive dysfunction. We therefore set out to perform a proof of concept study to determine whether anesthesia and surgery can have different effects in male and female AD transgenic (Tg) mice, and in female AD Tg plus Cyclophilin D knockout (CypD KO) mice. The mice received an abdominal surgery under sevoflurane anesthesia (anesthesia/surgery). Fear Conditioning System (FCS) was used to assess the cognitive function. Hippocampal levels of synaptic marker postsynaptic density 95 (PSD-95) and synaptophysin (SVP) were measured using western blot analysis. Here we showed that the anesthesia/surgery decreased the freezing time in context test of FCS at 7 days after the anesthesia/surgery in female, but not male, mice. The anesthesia/surgery reduced hippocampus levels of synaptic marker PSD-95 and SVP in female, but not male, mice. The anesthesia/surgery induced neither reduction in freezing time in FCS nor decreased hippocampus levels of PSD-95 and SVP in the AD Tg plus CypD KO mice. These data suggest that the anesthesia/surgery induced a sex-dependent cognitive impairment and reduction in hippocampus levels of synaptic markers in AD Tg mice, potentially via a mitochondria-associated mechanism. These findings could promote clinical investigations to determine whether female AD patients are more vulnerable to the development of postoperative cognitive dysfunction.

  18. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  19. Brain and Brown Adipose Tissue Metabolism in Transgenic Tg2576 Mice Models of Alzheimer Disease Assessed Using 18F-FDG PET Imaging

    PubMed Central

    Coleman, Robert A.; Liang, Christopher; Patel, Rima; Ali, Sarah

    2017-01-01

    Objective: Imaging animal models of Alzheimer disease (AD) is useful for the development of therapeutic drugs and understanding AD. Transgenic Swedish hAPPswe Tg2576 mice are a good model of β-amyloid plaques. We report 18F-fluoro-2-deoxyglucose (18F-FDG) positron emission tomography (PET) imaging of brain and intrascapular brown adipose tissue (IBAT) in transgenic mice 2576 (Tg2576) and wild-type (WT) mice. Methods: Transgenic Tg2576 mice and WT mice, >18 months were injected intraperitonally with ≈ 25 to 30 MBq 18F-FDG while awake. After 60 minutes, they were anesthetized with isoflurane (2.5%) and imaged with Inveon MicroPET. Select mice were killed, imaged ex vivo, and 20 µm sections cut for autoradiography. 18F-FDG uptake in brain and IBAT PET and brain autoradiographs were analyzed. Results: Fasting blood glucose levels averaged 120 mg/dL for WT and 100 mg/dL for Tg2576. Compared to WT, Tg2576 mice exhibited a decrease in SUVglc in the various brain regions. Average reductions in the cerebrum regions were as high as −20%, while changes in cerebellum were −3%. Uptake of 18F-FDG in IBAT decreased by −60% in Tg2576 mice and was found to be significant. Intrascapular brown adipose tissue findings in Tg2576 mice are new and not previously reported. Use of blood glucose for PET data analysis and corpus callosum as reference region for autoradiographic analysis were important to detect change in Tg2576 mice. Conclusion: Our results suggest that 18F-FDG uptake in the Tg2576 mice brain show 18F-FDG deficits only when blood glucose is taken into consideration. PMID:28654383

  20. Breaking Tolerance in Transgenic Mice Expressing the Human TSH Receptor A-Subunit: Thyroiditis, Epitope Spreading and Adjuvant as a ‘Double Edged Sword’

    PubMed Central

    McLachlan, Sandra M.; Aliesky, Holly A.; Chen, Chun-Rong; Chong, Gao; Rapoport, Basil

    2012-01-01

    Transgenic mice with the human thyrotropin-receptor (TSHR) A-subunit targeted to the thyroid are tolerant of the transgene. In transgenics that express low A-subunit levels (Lo-expressors), regulatory T cell (Treg) depletion using anti-CD25 before immunization with adenovirus encoding the A-subunit (A-sub-Ad) breaks tolerance, inducing extensive thyroid lymphocytic infiltration, thyroid damage and antibody spreading to other thyroid proteins. In contrast, no thyroiditis develops in Hi-expressor transgenics or wild-type mice. Our present goal was to determine if thyroiditis could be induced in Hi-expressor transgenics using a more potent immunization protocol: Treg depletion, priming with Complete Freund's Adjuvant (CFA) + A-subunit protein and further Treg depletions before two boosts with A-sub-Ad. As controls, anti-CD25 treated Hi- and Lo-expressors and wild-type mice were primed with CFA+ mouse thyroglobulin (Tg) or CFA alone before A-sub-Ad boosting. Thyroiditis developed after CFA+A-subunit protein or Tg and A-sub-Ad boosting in Lo-expressor transgenics but Hi- expressors (and wild-type mice) were resistant to thyroiditis induction. Importantly, in Lo-expressors, thyroiditis was associated with the development of antibodies to the mouse TSHR downstream of the A-subunit. Unexpectedly, we observed that the effect of bacterial products on the immune system is a “double-edged sword”. On the one hand, priming with CFA (mycobacteria emulsified in oil) plus A-subunit protein broke tolerance to the A-subunit in Hi-expressor transgenics leading to high TSHR antibody levels. On the other hand, prior treatment with CFA in the absence of A-subunit protein inhibited responses to subsequent immunization with A-sub-Ad. Consequently, adjuvant activity arising in vivo after bacterial infections combined with a protein autoantigen can break self-tolerance but in the absence of the autoantigen, adjuvant activity can inhibit the induction of immunity to autoantigens (like the

  1. HPV16 induces a wasting syndrome in transgenic mice: Amelioration by dietary polyphenols via NF-κB inhibition.

    PubMed

    Gil da Costa, Rui M; Aragão, Sofia; Moutinho, Magda; Alvarado, Antonieta; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Ribeiro, Joana; Sousa, Hugo; Ferreira, Rita; Nogueira-Ferreira, Rita; Pires, Maria João; Colaço, Bruno; Medeiros, Rui; Venâncio, Carlos; Oliveira, Maria Manuel; Bastos, Margarida M S M; Lopes, Carlos; Oliveira, Paula A

    2017-01-15

    Cancer patients often show a wasting syndrome for which there are little therapeutic options. Dietary polyphenols have been proposed for treating this syndrome, but their usefulness in cases associated with human papillomavirus (HPV)-induced cancers is unknown. We characterized HPV16-transgenic mice as a model of cancer cachexia and tested the efficacy of long-term oral supplementation with polyphenols curcumin and rutin. Both compounds were orally administered to six weeks-old HPV16-transgenic mice showing characteristic multi-step skin carcinogenesis, for 24weeks. Skin lesions and blood, liver and spleen inflammatory changes were characterized histologically and hematologically. Hepatic oxidative stress, skeletal muscle mass and the levels of muscle pro-inflammatory transcription factor NF-κB were also assessed. Skin carcinogenesis was associated with progressive, severe, systemic inflammation (leukocytosis, hepatitis, splenitis), significant mortality and cachexia. Curcumin and rutin totally suppressed mortality while reducing white blood cells and the incidence of splenitis and hepatitis. Rutin prevented muscle wasting more effectively than curcumin. Preservation of muscle mass and reduced hepatic inflammation were associated with down-regulation of the NF-κB canonical pathway and with reduced oxidative stress, respectively. These results point out HPV16-transgenic mice as a useful model for studying the wasting syndrome associated with HPV-induced cancers. Dietary NF-κB inhibitors may be useful resources for treating this syndrome. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Substitutions of PrP N-terminal histidine residues modulate scrapie disease pathogenesis and incubation time in transgenic mice

    PubMed Central

    Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg

    2017-01-01

    Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1–4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain. PMID:29220360

  3. Redox regulation of mast cell histamine release in thioredoxin-1 (TRX) transgenic mice.

    PubMed

    Son, Aoi; Nakamura, Hajime; Kondo, Norihiko; Matsuo, Yoshiyuki; Liu, Wenrui; Oka, Shin-ichi; Ishii, Yasuyuki; Yodoi, Junji

    2006-02-01

    Thioredoxin-1 (TRX) is a stress-inducible redox-regulatory protein with antioxidative and anti-inflammatory effects. Here we show that the release of histamine from mast cells elicited by cross-linking of high-affinity receptor for IgE (FcepsilonRI) was significantly suppressed in TRX transgenic (TRX-tg) mice compared to wild type (WT) mice. Intracellular reactive oxygen species (ROS) of mast cells stimulated by IgE and antigen was also reduced in TRX-tg mice compared to WT mice. Whereas there was no difference in the production of cytokines (IL-6 and TNF-alpha) from mast cells in response to 2,4-dinitrophenylated bovine serum albumin (DNP-BSA) stimulation in TRX-tg and WT mice. Immunological status of TRX-tg mice inclined to T helper (Th) 2 dominant in primary immune response, although there was no difference in the population of dendritic cells (DCs) and regulatory T cells. We conclude that the histamine release from mast cells in TRX-tg mice is suppressed by inhibition of ROS generation. As ROS are involved in mast cell activation and facilitate mediator release, TRX may be a key signaling molecule regulating the early events in the IgE signaling in mast cells and the allergic inflammation.

  4. Development of ghrelin transgenic mice for elucidation of clinical implication of ghrelin.

    PubMed

    Aotani, Daisuke; Ariyasu, Hiroyuki; Shimazu-Kuwahara, Satoko; Shimizu, Yoshiyuki; Nomura, Hidenari; Murofushi, Yoshiteru; Kaneko, Kentaro; Izumi, Ryota; Matsubara, Masaki; Kanda, Hajime; Noguchi, Michio; Tanaka, Tomohiro; Kusakabe, Toru; Miyazawa, Takashi; Nakao, Kazuwa

    2017-01-01

    To elucidate the clinical implication of ghrelin, we have been trying to generate variable models of transgenic (Tg) mice overexpressing ghrelin. We generated Tg mice overexpressing des-acyl ghrelin in a wide variety of tissues under the control of β-actin promoter. While plasma des-acyl ghrelin level in the Tg mice was 44-fold greater than that of control mice, there was no differences in the plasma ghrelin level between des-acyl ghrelin Tg and the control mice. The des-acyl ghrelin Tg mice exhibited the lower body weight and the shorter body length due to modulation of GH-IGF-1 axis. We tried to generate Tg mice expressing a ghrelin analog, which possessed ghrelin-like activity (Trp 3 -ghrelin Tg mice). The plasma Trp 3 -ghrelin concentration in Trp 3 -ghrelin Tg mice was approximately 85-fold higher than plasma ghrelin (acylated ghrelin) concentration seen in the control mice. Because Trp 3 -ghrelin is approximately 24-fold less potent than ghrelin, the plasma Trp 3 -ghrelin concentration in Trp 3 -ghrelin Tg mice was calculated to have approximately 3.5-fold biological activity greater than that of ghrelin (acylated ghrelin) in the control mice. Trp 3 -ghrelin Tg mice did not show any phenotypes except for reduced insulin sensitivity in 1-year old. After the identification of ghrelin O-acyltransferase (GOAT), we generated doubly Tg mice overexpressing both mouse des-acyl ghrelin and mouse GOAT in the liver by cross-mating the two kinds of Tg mice. The plasma ghrelin concentration of doubly Tg mice was approximately 2-fold higher than that of the control mice. No apparent phenotypic changes in body weight and food intake were observed in doubly Tg mice. Further studies are ongoing in our laboratory to generate Tg mice with the increased plasma ghrelin level to a greater extent. The better understanding of physiological and pathophysiological significance of ghrelin from experiments using an excellent animal model may provide a new therapeutic approach for human

  5. A complete YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13) and refined localization of the SNRPN gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mutirangura, A.; Jayakumar, A.; Sutcliffe, J.S.

    1993-12-01

    Since a previous report of a partial YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13), a complete contig spanning approximately 3.5 Mb has been developed. YACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of [approximately]1 per 200 kb. Overlaps between YAC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of YAC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contigmore » between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/Angelman chromosome region contig are ordered as follows: cen-IR39-ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10-1-CMW1-tel. This YAC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. 36 refs., 2 figs., 2 tabs.« less

  6. A nonpolio enterovirus with respiratory tropism causes poliomyelitis in intercellular adhesion molecule 1 transgenic mice.

    PubMed

    Dufresne, Andrew T; Gromeier, Matthias

    2004-09-14

    Coxsackievirus A21 (CAV21) is classified within the species Human enterovirus C (HEV-C) of the Enterovirus genus of picornaviruses. HEV-C share striking homology with the polioviruses (PV), their closest kin among the enteroviruses. Despite a high level of sequence identity, CAV21 and PV cause distinct clinical disease typically attributed to their differential use of host receptors. PV cause poliomyelitis, whereas CAV21 shares a receptor and a propensity to cause upper respiratory tract infections with the major group rhinoviruses. As a model for CAV21 infection, we have developed transgenic mice that express human intercellular adhesion molecule 1, the cell-surface receptor for CAV21. Surprisingly, CAV21 administered to these mice via the intramuscular route causes a paralytic condition consistent with poliomyelitis. The virus appears to invade the CNS by retrograde axonal transport, as has been demonstrated to occur in analogous PV infections. We detected human intercellular adhesion molecule 1 expression on both transgenic mouse and human spinal cord anterior horn motor neurons, indicating that members of HEV-C may share PV's potential to elicit poliomyelitis in humans.

  7. Redox Proteomic Profiling of Specifically Carbonylated Proteins in the Serum of Triple Transgenic Alzheimer's Disease Mice.

    PubMed

    Shen, Liming; Chen, Youjiao; Yang, Aochu; Chen, Cheng; Liao, Liping; Li, Shuiming; Ying, Ming; Tian, Jing; Liu, Qiong; Ni, Jiazuan

    2016-04-12

    Oxidative stress is a key event in the onset and progression of neurodegenerative diseases, including Alzheimer's disease (AD). To investigate the role of oxidative stress in AD and to search for potential biomarkers in peripheral blood, serums were collected in this study from the 3-, 6-, and 12-month-old triple transgenic AD mice (3×Tg-AD mice) and the age- and sex-matched non-transgenic (non-Tg) littermates. The serum oxidized proteins were quantified by slot-blot analysis and enzyme-linked immunosorbent assay (ELISA) to investigate the total levels of serum protein carbonyl groups. Western blotting, in conjunction with two-dimensional gel electrophoresis (2D-Oxyblot), was employed to identify and quantify the specifically-carbonylated proteins in the serum of 3×Tg-AD mice. The results showed that the levels of serum protein carbonyls were increased in the three month old 3×Tg-AD mice compared with the non-Tg control mice, whereas no significant differences were observed in the six and 12 months old AD mice, suggesting that oxidative stress is an early event in AD progression. With the application of 2D-Oxyblot analysis, (immunoglobin) Ig gamma-2B chain C region (IGH-3), Ig lambda-2 chain C region (IGLC2), Ig kappa chain C region (IGKC), and Ig kappa chain V-V region HP R16.7 were identified as significantly oxidized proteins compared with the control. Among them IGH-3 and IGKC were validated via immunoprecipitation and Western blot analysis. Identification of oxidized proteins in the serums of 3×Tg-AD mice can not only reveal potential roles of those proteins in the pathogenesis of AD but also provide potential biomarkers of AD at the early stage.

  8. Xenografted islet cell clusters from INSLEA29Y transgenic pigs rescue diabetes and prevent immune rejection in humanized mice.

    PubMed

    Klymiuk, Nikolai; van Buerck, Lelia; Bähr, Andrea; Offers, Monika; Kessler, Barbara; Wuensch, Annegret; Kurome, Mayuko; Thormann, Michael; Lochner, Katharina; Nagashima, Hiroshi; Herbach, Nadja; Wanke, Rüdiger; Seissler, Jochen; Wolf, Eckhard

    2012-06-01

    Islet transplantation is a potential treatment for type 1 diabetes, but the shortage of donor organs limits its routine application. As potential donor animals, we generated transgenic pigs expressing LEA29Y, a high-affinity variant of the T-cell costimulation inhibitor CTLA-4Ig, under the control of the porcine insulin gene promoter. Neonatal islet cell clusters (ICCs) from INSLEA29Y transgenic (LEA-tg) pigs and wild-type controls were transplanted into streptozotocin-induced hyperglycemic NOD-scid IL2Rγ(null) mice. Cloned LEA-tg pigs are healthy and exhibit a strong β-cell-specific transgene expression. LEA-tg ICCs displayed the same potential to normalize glucose homeostasis as wild-type ICCs after transplantation. After adoptive transfer of human peripheral blood mononuclear cells, transplanted LEA-tg ICCs were completely protected from rejection, whereas reoccurrence of hyperglycemia was observed in 80% of mice transplanted with wild-type ICCs. In the current study, we provide the first proof-of-principle report on transgenic pigs with β-cell-specific expression of LEA29Y and their successful application as donors in a xenotransplantation model. This approach may represent a major step toward the development of a novel strategy for pig-to-human islet transplantation without side effects of systemic immunosuppression.

  9. α-Synuclein transgenic mice reveal compensatory increases in Parkinson's disease-associated proteins DJ-1 and parkin and have enhanced α-synuclein and PINK1 levels after rotenone treatment.

    PubMed

    George, Sonia; Mok, Su San; Nurjono, Milawaty; Ayton, Scott; Finkelstein, David I; Masters, Colin L; Li, Qiao-Xin; Culvenor, Janetta G

    2010-10-01

    Parkinson's disease (PD) is a severe neurodegenerative disorder characterised by loss of dopaminergic neurons of the substantia nigra. The pathological hallmarks are cytoplasmic inclusions termed Lewy bodies consisting primarily of aggregated alpha-synuclein (alphaSN). Different lines of transgenic mice have been developed to model PD but have failed to recapitulate the hallmarks of this disease. Since treatment of rodents with the pesticide rotenone can reproduce nigrostriatal cell loss and other features of PD, we aimed to test chronic oral administration of rotenone to transgenic mice over-expressing human alphaSN with the A53T mutation. Initial assessment of this transgenic line for compensatory molecular changes indicated decreased brain beta-synuclein expression and significantly increased levels of the PD-associated oxidative stress response protein, DJ-1, and the E3 ubiquitin ligase enzyme, Parkin. Rotenone treatment of 30 mg/kg for 25 doses over a 35-day period was tolerated in the transgenic mice and resulted in decreased spontaneous locomotor movement and increased cytoplasmic alphaSN expression. The mitochondrial Parkinson's-associated PTEN-induced kinase 1 protein levels were also increased in transgenic mouse brain after rotenone treatment; there was no change in brain dopamine levels or nigrostriatal cell loss. These hA53T alphaSN transgenic mice provide a useful model for presymptomatic Parkinson's features and are valuable for study of associated compensatory changes in early Parkinson's disease stages.

  10. Prostate and mammary adenocarcinoma in transgenic mice carrying a rat C3(1) simian virus 40 large tumor antigen fusion gene.

    PubMed Central

    Maroulakou, I G; Anver, M; Garrett, L; Green, J E

    1994-01-01

    A transgenic mouse model for prostate and mammary cancer has been developed in mice containing a recombinant gene expressing the simian virus 40 early-region transforming sequences under the regulatory control of the rat prostatic steroid binding protein [C3(1)] gene. Male transgenic mice develop prostatic hyperplasia in early life that progresses to adenoma or adenocarcinoma in most animals surviving to longer than 7 months of age. Prostate cancer metastases to lung have been observed. Female animals from the same founder lines generally develop mammary hyperplasia by 3 months of age with subsequent development of mammary adenocarcinoma by 6 months of age in 100% of the animals. The development of tumors correlates with the expression of the transgene as determined by Northern blot and immunohistochemical analyses. The results of these experiments demonstrate that the C3(1) regulatory region used in these experiments is useful for targeting expression to the prostate and mammary gland. To our knowledge, this experimental system is the first reported transgenic mouse model for prostate cancer. These transgenic animals offer the opportunity to study hormone response elements in vivo and the multistage progression from normal tissue to carcinoma in the prostate and mammary glands. Images PMID:7972041

  11. Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo.

    PubMed

    Bidlack, Felicitas B; Xia, Yan; Pugach, Megan K

    2017-01-01

    Mice lacking amelogenin (KO) have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes ( Tg ) representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180 Tg , CTRNC Tg and LRAP Tg mice to generate M180 Tg and CTRNC Tg double transgene and M180 Tg , CTRNC Tg , LRAP Tg triple transgene mice with transgene hemizygosity (on one allelle) or homozygosity (on both alleles). Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene ( p < 0.05). The presence of the LRAP Tg did not improve the phenotype of M180 Tg /CTRNC Tg /KO enamel. In the absence of endogenous amelogenin, the addition of amelogenin transgenes representing the

  12. Effects of apoA-V on HDL and VLDL metabolism in APOC3 transgenic mice1

    PubMed Central

    Qu, Shen; Perdomo, German; Su, Dongming; D’Souza, Fiona M.; Shachter, Neil S.; Dong, H. Henry

    2009-01-01

    Apolipoprotein A-V (apoA-V) and apoC-III are exchangeable constituents of VLDL and HDL. ApoA-V counteracts the effect of apoC-III on triglyceride (TG) metabolism with poorly defined mechanisms. To better understand the effects of apoA-V on TG and cholesterol metabolism, we delivered apoA-V cDNA into livers of hypertriglyceridemic APOC3 transgenic mice by adenovirus-mediated gene transfer. In response to hepatic apoA-V production, plasma TG levels were reduced significantly as a result of enhanced VLDL catabolism without alternations in VLDL production. This effect was associated with reduced apoC-III content in VLDL. Increased apoA-V production also resulted in decreased apoC-III and increased apoA-I content in HDL. Furthermore, apoA-V-enriched HDL was associated with enhanced LCAT activity and increased cholesterol efflux. This effect, along with apoE enrichment in HDL, contributed to HDL core expansion and α-HDL formation, accounting for significant increases in both the number and size of HDL particles. As a result, apoA-V-treated APOC3 transgenic mice exhibited decreased VLDL-cholesterol and increased HDL-cholesterol levels. ApoA-V-mediated reduction of apoC-III content in VLDL represents an important mechanism by which apoA-V acts to ameliorate hypertriglyceridemia in adult APOC3 transgenic mice. In addition, increased apoA-V levels accounted for cholesterol redistribution from VLDL to larger HDL particles. These data suggest that in addition to its TG-lowering effect, apoA-V plays a significant role in modulating HDL maturation and cholesterol metabolism PMID:17438339

  13. Expression of recombinant human lysozyme in bacterial artificial chromosome transgenic mice promotes the growth of Bifidobacterium and inhibits the growth of Salmonella in the intestine.

    PubMed

    Dan, Lu; Liu, Shen; Shang, Shengzhe; Zhang, Huihua; Zhang, Ran; Li, Ning

    2018-04-20

    Targeted gene modification is a novel intervention strategy to increase disease resistance more quickly than traditional animal breeding. Human lysozyme, a natural, non-specific immune factor, participates in innate immunity, exerts a wide range of antimicrobial activities against pathogens, and has immuneregulatory effects. Therefore, it is a candidate gene for improved disease resistance in animals. In this study, we successfully generated a transgenic mouse model by microinjecting a modified bacterial artificial chromosome containing a recombinant human lysozyme (rhLZ) gene into the pronuclei of fertilized mouse embryos. rhLZ was expressed in serum, liver, spleen, lung, kidney, stomach, small intestine, and large intestine but not in milk. rhLZ protein concentrations in the serum of transgenic mice ranged from 2.09 to 2.60 mg/l. To examine the effect of rhLZ on intestinal microbiota, total aerobes, total anaerobes, Clostridium, Enterococcus, Streptococcus, Salmonella, Escherichia coli, Staphylococcus, Bifidobacterium, and Lactobacillus were measured in the intestines of transgenic and wild type mice. Results showed that Bifidobacteria were significantly increased (p < 0.001), whereas Salmonella were significantly decreased (p < 0.001) in transgenic mice compared to wild type mice. Our study suggests that rhLZ expression is a potential strategy to increase animal disease resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. No effect of C-reactive protein on early atherosclerosis development in apolipoprotein E*3-leiden/human C-reactive protein transgenic mice.

    PubMed

    Trion, A; de Maat, M P M; Jukema, J W; van der Laarse, A; Maas, M C; Offerman, E H; Havekes, L M; Szalai, A J; Princen, H M G; Emeis, J J

    2005-08-01

    C-reactive protein (CRP) has been associated with risk of cardiovascular disease. It is not clear whether CRP is causally involved in the development of atherosclerosis. Mouse CRP is not expressed at high levels under normal conditions and increases in concentration only several-fold during an acute phase response. Because the dynamic range of human CRP is much larger, apolipoprotein E*3-Leiden (E3L) transgenic mice carrying the human CRP gene offer a unique model to study the role(s) of CRP in atherosclerosis development. Atherosclerosis development was studied in 15 male and 15 female E3L/CRP mice; E3L transgenic littermates were used as controls. The mice were fed a hypercholesterolemic diet to induce atherosclerosis development. Cholesterol exposure did not differ between E3L/CRP and E3L mice. Plasma CRP levels were on average 10.2+/-6.5 mg/L in male E3L/CRP mice, 0.2+/-0.1 mg/L in female E3L/CRP mice, and undetectable in E3L mice. Quantification of atherosclerosis showed that lesion area in E3L/CRP mice was not different from that in E3L mice. This study demonstrates that mildly elevated levels of CRP in plasma do not contribute to the development of early atherosclerosis in hypercholesterolemic E3L/CRP mice.

  15. A YAC contig encompassing the Treacher Collins syndrome critical region at 5q31. 3-32

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixon, J.; Gladwin, A.J.; Perveen, R.

    Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development the features of which include conductive hearing loss and cleft palate. Previous studies have localized the TCOF1 locus between D5S519 (proximal) and SPARC (distal), a region of 22 centirays as estimated by radiation hybrid mapping. In the current investigation the authors have created a contig across the TCOF1 critical region, using YAC clones. Isolation of a novel short tandem repeat polymorphism corresponding to the end of one of the YACs has allowed reduction of the size of the critical region to [approximately] 840 kb, which has been coveredmore » with three nonchimeric YACs. Restriction mapping has revealed that the region contains a high density of clustered rare-cutter restriction sites, suggesting that it may contain a number of different genes. The results of the present investigation have further allowed confirmation that the RPS14 locus lies proximal to the critical region and can thereby be excluded from a role in the pathogenesis of TCOF1, while ANX6 lies within the TCOF1 critical region and remains a potential candidate for the mutated gene. 26 refs., 4 figs., 1 tab.« less

  16. Active Immunization Against hIAPP Oligomers Ameliorates the Diabetes- Associated Phenotype in a Transgenic Mice Model.

    PubMed

    Bram, Yaron; Peled, Sivan; Brahmachari, Sayanti; Harlev, Michael; Gazit, Ehud

    2017-10-25

    Type 2 diabetes is characterized by insulin tolerance in target cells followed by a reduction of pancreatic β-cell mass. Islet amyloid polypeptide oligomeric assemblies were shown to contribute to β-cell apoptosis by forming discrete pores that destabilize the cellular membrane. We previously characterized α-helical cytotoxic islet amyloid polypeptide oligomers which interact with cell membranes, following a complete internalization that leads to cellular apoptosis. Moreover, antibodies which bind the oligomers and neutralize the cytotoxicity were exclusively identified in the serum of type 2 diabetes patients. Here, we examined the usage of the newly characterized oligomers as an active immunization agent targeting amyloid self- assembly in a diabetes-associated phenotype transgenic mice model. Immunized transgenic mice showed an increase in hIAPP-antibody serum titer as well as improvement in diabetes-associated parameters. Lower fasting blood glucose levels, higher insulin, and lower islet amyloid polypeptide accumulation were observed. Furthermore, antibodies derived from the immunized mice reduced hIAPP oligomers cytotoxicity towards β-cells in a dose-dependent manner. This study highlights the significance of targeting the early amyloid self-assembly events for potential disease management. Furthermore, it demonstrates that α-helical oligomers conformers are valid epitope for the development of future immunization therapy.

  17. Transgenic mice as an alternative to monkeys for neurovirulence testing of live oral poliovirus vaccine: validation by a WHO collaborative study.

    PubMed Central

    Dragunsky, Eugenia; Nomura, Tatsuji; Karpinski, Kazimir; Furesz, John; Wood, David J.; Pervikov, Yuri; Abe, Shinobu; Kurata, Takeshi; Vanloocke, Olivier; Karganova, Galina; Taffs, Rolf; Heath, Alan; Ivshina, Anna; Levenbook, Inessa

    2003-01-01

    OBJECTIVE: Extensive WHO collaborative studies were performed to evaluate the suitability of transgenic mice susceptible to poliovirus (TgPVR mice, strain 21, bred and provided by the Central Institute for Experimental Animals, Japan) as an alternative to monkeys in the neurovirulence test (NVT) of oral poliovirus vaccine (OPV). METHODS: Nine laboratories participated in the collaborative study on testing neurovirulence of 94 preparations of OPV and vaccine derivatives of all three serotypes in TgPVR21 mice. FINDINGS: Statistical analysis of the data demonstrated that the TgPVR21 mouse NVT was of comparable sensitivity and reproducibility to the conventional WHO NVT in simians. A statistical model for acceptance/rejection of OPV lots in the mouse test was developed, validated, and shown to be suitable for all three vaccine types. The assessment of the transgenic mouse NVT is based on clinical evaluation of paralysed mice. Unlike the monkey NVT, histological examination of central nervous system tissue of each mouse offered no advantage over careful and detailed clinical observation. CONCLUSIONS: Based on data from the collaborative studies the WHO Expert Committee for Biological Standardization approved the mouse NVT as an alternative to the monkey test for all three OPV types and defined a standard implementation process for laboratories that wish to use the test. This represents the first successful introduction of transgenic animals into control of biologicals. PMID:12764491

  18. Periodontitis induced by bacterial infection exacerbates features of Alzheimer's disease in transgenic mice.

    PubMed

    Ishida, Naoyuki; Ishihara, Yuichi; Ishida, Kazuto; Tada, Hiroyuki; Funaki-Kato, Yoshiko; Hagiwara, Makoto; Ferdous, Taslima; Abdullah, Mohammad; Mitani, Akio; Michikawa, Makoto; Matsushita, Kenji

    2017-01-01

    Periodontitis is a localized infectious disease caused by periodontopathic bacteria, such as Porphyromonas gingivalis . Recently, it has been suggested that bacterial infections may contribute to the onset and the progression of Alzheimer's disease (AD). However, we do not have any evidence about a causative relationship between periodontitis and AD. In this study, we investigated by using a transgenic mouse model of AD whether periodontitis evoked by P. gingivalis modulates the pathological features of AD. Cognitive function was significantly impaired in periodontitis-induced APP-Tg mice, compared to that in control APP-Tg mice. Levels of Amiloid β (Aβ) deposition, Aβ40, and Aβ42 in both the hippocampus and cortex were higher in inoculated APP-Tg mice than in control APP-Tg mice. Furthermore, levels of IL-1β and TNF-α in the brain were higher in inoculated mice than in control mice. The levels of LPS were increased in the serum and brain of P. gingivalis -inoculated mice. P. gingivalis LPS-induced production of Aβ40 and Aβ42 in neural cell cultures and strongly enhanced TNF-α and IL-1β production in a culture of microglial cells primed with Aβ. Periodontitis evoked by P. gingivalis may exacerbate brain Aβ deposition, leading to enhanced cognitive impairments, by a mechanism that involves triggering brain inflammation.

  19. c-RET Molecule in Malignant Melanoma from Oncogenic RET-Carrying Transgenic Mice and Human Cell Lines

    PubMed Central

    Takeda, Kozue; Iida, Machiko; Kumasaka, Mayuko; Matsumoto, Yoshinari; Kato, Masashi

    2010-01-01

    Malignant melanoma is one of the most aggressive cancers and its incidence worldwide has been increasing at a greater rate than that of any other cancer. We previously reported that constitutively activated RFP-RET-carrying transgenic mice (RET-mice) spontaneously develop malignant melanoma. In this study, we showed that expression levels of intrinsic c-Ret, glial cell line-derived neurotrophic factor (Gdnf) and Gdnf receptor alpha 1 (Gfra1) transcripts in malignant melanomas from RET-transgenic mice were significantly upregulated compared with those in benign melanocytic tumors. These results suggest that not only introduced oncogenic RET but also intrinsic c-Ret/Gdnf are involved in murine melanomagenesis in RET-mice. We then showed that c-RET and GDNF transcript expression levels in human malignant melanoma cell lines (HM3KO and MNT-1) were higher than those in primary cultured normal human epithelial melanocytes (NHEM), while GFRa1 transcript expression levels were comparable among NHEM, HM3KO and MNT-1. We next showed c-RET and GFRa1 protein expression in HM3KO cells and GDNF-mediated increased levels of their phosphorylated c-RET tyrosine kinase and signal transduction molecules (ERK and AKT) sited potentially downstream of c-RET. Taken together with the finding of augmented proliferation of HM3KO cells after GDNF stimulation, our results suggest that GDNF-mediated c-RET kinase activation is associated with the pathogenesis of malignant melanoma. PMID:20422010

  20. c-RET molecule in malignant melanoma from oncogenic RET-carrying transgenic mice and human cell lines.

    PubMed

    Ohshima, Yuichiro; Yajima, Ichiro; Takeda, Kozue; Iida, Machiko; Kumasaka, Mayuko; Matsumoto, Yoshinari; Kato, Masashi

    2010-04-21

    Malignant melanoma is one of the most aggressive cancers and its incidence worldwide has been increasing at a greater rate than that of any other cancer. We previously reported that constitutively activated RFP-RET-carrying transgenic mice (RET-mice) spontaneously develop malignant melanoma. In this study, we showed that expression levels of intrinsic c-Ret, glial cell line-derived neurotrophic factor (Gdnf) and Gdnf receptor alpha 1 (Gfra1) transcripts in malignant melanomas from RET-transgenic mice were significantly upregulated compared with those in benign melanocytic tumors. These results suggest that not only introduced oncogenic RET but also intrinsic c-Ret/Gdnf are involved in murine melanomagenesis in RET-mice. We then showed that c-RET and GDNF transcript expression levels in human malignant melanoma cell lines (HM3KO and MNT-1) were higher than those in primary cultured normal human epithelial melanocytes (NHEM), while GFRa1 transcript expression levels were comparable among NHEM, HM3KO and MNT-1. We next showed c-RET and GFRa1 protein expression in HM3KO cells and GDNF-mediated increased levels of their phosphorylated c-RET tyrosine kinase and signal transduction molecules (ERK and AKT) sited potentially downstream of c-RET. Taken together with the finding of augmented proliferation of HM3KO cells after GDNF stimulation, our results suggest that GDNF-mediated c-RET kinase activation is associated with the pathogenesis of malignant melanoma.

  1. Erythropoietin and the use of a transgenic model of erythropoietin-deficient mice

    PubMed Central

    Pichon, Aurélien; Jeton, Florine; El Hasnaoui-Saadani, Raja; Hagström, Luciana; Launay, Thierry; Beaudry, Michèle; Marchant, Dominique; Quidu, Patricia; Macarlupu, Jose-Luis; Favret, Fabrice; Richalet, Jean-Paul; Voituron, Nicolas

    2016-01-01

    Despite its well-known role in red blood cell production, it is now accepted that erythropoietin (Epo) has other physiological functions. Epo and its receptors are expressed in many tissues, such as the brain and heart. The presence of Epo/Epo receptors in these organs suggests other roles than those usually assigned to this protein. Thus, the aim of this review is to describe the effects of Epo deficiency on adaptation to normoxic and hypoxic environments and to suggest a key role of Epo on main physiological adaptive functions. Our original model of Epo-deficient (Epo-TAgh) mice allowed us to improve our knowledge of the possible role of Epo in O2 homeostasis. The use of anemic transgenic mice revealed Epo as a crucial component of adaptation to hypoxia. Epo-TAgh mice survive well in hypoxic conditions despite low hematocrit. Furthermore, Epo plays a key role in neural control of ventilatory acclimatization and response to hypoxia, in deformability of red blood cells, in cerebral and cardiac angiogenesis, and in neuro- and cardioprotection. PMID:27800506

  2. GAA repeat expansion mutation mouse models of Friedreich ataxia exhibit oxidative stress leading to progressive neuronal and cardiac pathology.

    PubMed

    Al-Mahdawi, Sahar; Pinto, Ricardo Mouro; Varshney, Dhaval; Lawrence, Lorraine; Lowrie, Margaret B; Hughes, Sian; Webster, Zoe; Blake, Julian; Cooper, J Mark; King, Rosalind; Pook, Mark A

    2006-11-01

    Friedreich ataxia (FRDA) is a neurodegenerative disorder caused by an unstable GAA repeat expansion mutation within intron 1 of the FXN gene. However, the origins of the GAA repeat expansion, its unstable dynamics within different cells and tissues, and its effects on frataxin expression are not yet completely understood. Therefore, we have chosen to generate representative FRDA mouse models by using the human FXN GAA repeat expansion itself as the genetically modified mutation. We have previously reported the establishment of two lines of human FXN YAC transgenic mice that contain unstable GAA repeat expansions within the appropriate genomic context. We now describe the generation of FRDA mouse models by crossbreeding of both lines of human FXN YAC transgenic mice with heterozygous Fxn knockout mice. The resultant FRDA mice that express only human-derived frataxin show comparatively reduced levels of frataxin mRNA and protein expression, decreased aconitase activity, and oxidative stress, leading to progressive neurodegenerative and cardiac pathological phenotypes. Coordination deficits are present, as measured by accelerating rotarod analysis, together with a progressive decrease in locomotor activity and increase in weight. Large vacuoles are detected within neurons of the dorsal root ganglia (DRG), predominantly within the lumbar regions in 6-month-old mice, but spreading to the cervical regions after 1 year of age. Secondary demyelination of large axons is also detected within the lumbar roots of older mice. Lipofuscin deposition is increased in both DRG neurons and cardiomyocytes, and iron deposition is detected in cardiomyocytes after 1 year of age. These mice represent the first GAA repeat expansion-based FRDA mouse models that exhibit progressive FRDA-like pathology and thus will be of use in testing potential therapeutic strategies, particularly GAA repeat-based strategies.

  3. IDENTIFICATION OF DIFFERENTIALLY EXPRESSED GENES IN THE KIDNEYS OF GROWTH HORMONE TRANSGENIC MICE

    PubMed Central

    Coschigano, K.T.; Wetzel, A.N.; Obichere, N.; Sharma, A.; Lee, S.; Rasch, R.; Guigneaux, M.M.; Flyvbjerg, A.; Wood, T.G.; Kopchick, J.J.

    2010-01-01

    Objective Bovine growth hormone (bGH) transgenic mice develop severe kidney damage. This damage may be due, at least in part, to changes in gene expression. Identification of genes with altered expression in the bGH kidney may identify mechanisms leading to damage in this system that may also be relevant to other models of kidney damage. Design cDNA subtraction libraries, northern blot analyses, microarray analyses and real-time reverse transcription polymerase chain reaction (RT/PCR) assays were used to identify and verify specific genes exhibiting differential RNA expression between kidneys of bGH mice and their non-transgenic (NT) littermates. Results Immunoglobulins were the vast majority of genes identified by the cDNA subtractions and the microarray analyses as being up-regulated in bGH. Several glycoprotein genes and inflammation-related genes also showed increased RNA expression in the bGH kidney. In contrast, only a few genes were identified as being significantly down-regulated in the bGH kidney. The most notable decrease in RNA expression was for the gene encoding kidney androgen-regulated protein. Conclusions A number of genes were identified as being differentially expressed in the bGH kidney. Inclusion of two groups, immunoglobulins and inflammation-related genes, suggests a role of the immune system in bGH kidney damage. PMID:20655258

  4. Genomic Methylation Inhibits Expression of Hepatitis B Virus Envelope Protein in Transgenic Mice: A Non-Infectious Mouse Model to Study Silencing of HBV Surface Antigen Genes.

    PubMed

    Graumann, Franziska; Churin, Yuri; Tschuschner, Annette; Reifenberg, Kurt; Glebe, Dieter; Roderfeld, Martin; Roeb, Elke

    2015-01-01

    The Hepatitis B virus genome persists in the nucleus of virus infected hepatocytes where it serves as template for viral mRNA synthesis. Epigenetic modifications, including methylation of the CpG islands contribute to the regulation of viral gene expression. The present study investigates the effects of spontaneous age dependent loss of hepatitis B surface protein- (HBs) expression due to HBV-genome specific methylation as well as its proximate positive effects in HBs transgenic mice. Liver and serum of HBs transgenic mice aged 5-33 weeks were analyzed by Western blot, immunohistochemistry, serum analysis, PCR, and qRT-PCR. From the third month of age hepatic loss of HBs was observed in 20% of transgenic mice. The size of HBs-free area and the relative number of animals with these effects increased with age and struck about 55% of animals aged 33 weeks. Loss of HBs-expression was strongly correlated with amelioration of serum parameters ALT and AST. In addition lower HBs-expression went on with decreased ER-stress. The loss of surface protein expression started on transcriptional level and appeared to be regulated epigenetically by DNA methylation. The amount of the HBs-expression correlated negatively with methylation of HBV DNA in the mouse genome. Our data suggest that methylation of specific CpG sites controls gene expression even in HBs-transgenic mice with truncated HBV genome. More important, the loss of HBs expression and intracellular aggregation ameliorated cell stress and liver integrity. Thus, targeted modulation of HBs expression may offer new therapeutic approaches. Furthermore, HBs-transgenic mice depict a non-infectious mouse model to study one possible mechanism of HBs gene silencing by hypermethylation.

  5. Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

    PubMed

    Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

    2015-06-01

    Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by

  6. Hepatic oxidative stress in ovariectomized transgenic mice expressing the hepatitis C virus polyprotein is augmented through suppression of adenosine monophosphate-activated protein kinase/proliferator-activated receptor gamma co-activator 1 alpha signaling.

    PubMed

    Tomiyama, Yasuyuki; Nishina, Sohji; Hara, Yuichi; Kawase, Tomoya; Hino, Keisuke

    2014-10-01

    Oxidative stress plays an important role in hepatocarcinogenesis of hepatitis C virus (HCV)-related chronic liver diseases. Despite the evidence of an increased proportion of females among elderly patients with HCV-related hepatocellular carcinoma (HCC), it remains unknown whether HCV augments hepatic oxidative stress in postmenopausal women. The aim of this study was to determine whether oxidative stress was augmented in ovariectomized (OVX) transgenic mice expressing the HCV polyprotein and to investigate its underlying mechanisms. OVX and sham-operated female transgenic mice expressing the HCV polyprotein and non-transgenic littermates were assessed for the production of reactive oxygen species (ROS), expression of inflammatory cytokines and antioxidant potential in the liver. Compared with OVX non-transgenic mice, OVX transgenic mice showed marked hepatic steatosis and ROS production without increased induction of inflammatory cytokines, but there was no increase in ROS-detoxifying enzymes such as superoxide dismutase 2 and glutathione peroxidase 1. In accordance with these results, OVX transgenic mice showed less activation of peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α), which is required for the induction of ROS-detoxifying enzymes, and no activation of adenosine monophosphate-activated protein kinase-α (AMPKα), which regulates the activity of PGC-1α. Our study demonstrated that hepatic oxidative stress was augmented in OVX transgenic mice expressing the HCV polyprotein by attenuation of antioxidant potential through inhibition of AMPK/PGC-1α signaling. These results may account in part for the mechanisms by which HCV-infected women are at high risk for HCC development when some period has passed after menopause. © 2013 The Japan Society of Hepatology.

  7. Photoacoustic imaging of vascular networks in transgenic mice

    NASA Astrophysics Data System (ADS)

    Laufer, J. G.; Cleary, J. O.; Zhang, E. Z.; Lythgoe, M. F.; Beard, P. C.

    2010-02-01

    The preferential absorption of near infrared light by blood makes photoacoustic imaging well suited to visualising vascular structures in soft tissue. In addition, the spectroscopic specificity of tissue chromophores can be exploited by acquiring images at multiple excitation wavelengths. This allows the quantification of endogenous chromophores, such as oxy- and deoxyhaemoglobin, and hence blood oxygenation, and the detection of exogenous chromophores, such as functionalised contrast agents. More importantly, this approach has the potential to visualise the spatial distribution of low concentrations of functionalised contrast agents against the strong background absorption of the endogenous chromophores. This has a large number of applications in the life sciences. One example is the structural and functional phenotyping of transgenic mice for the study of the genetic origins of vascular malformations, such as heart defects. In this study, photoacoustic images of mouse embryos have been acquired to study the development of the vasculature following specific genetic knockouts.

  8. Aβ-Induced Inflammatory Processes in Microglia Cells of APP23 Transgenic Mice

    PubMed Central

    Bornemann, Klaus D.; Wiederhold, Karl-Heinz; Pauli, Chantal; Ermini, Florian; Stalder, Martina; Schnell, Lisa; Sommer, Bernd; Jucker, Mathias; Staufenbiel, Matthias

    2001-01-01

    A microglial response is part of the inflammatory processes in Alzheimer’s disease (AD). We have used APP23 transgenic mice overexpressing human amyloid precursor protein with the Swedish mutation to characterize this microglia response to amyloid deposits in aged mice. Analyses with MAC-1 and F4/80 antibodies as well as in vivo labeling with bromodeoxyuridine demonstrate that microglia in the plaque vicinity are in an activated state and that proliferation contributes to their accumulation at the plaque periphery. The amyloid-induced microglia activation may be mediated by scavenger receptor A, which is generally elevated, whereas the increased immunostaining of the receptor for advanced glycation end products is more restricted. Although components of the phagocytic machinery such as macrosialin and Fc receptors are increased in activated microglia, efficient clearance of amyloid is missing seemingly because of the lack of amyloid-bound autoantibodies. Similarly, although up-regulation of major histocompatibility complex class II (IA) points toward an intact antigen-presenting function of microglia, lack of T and B lymphocytes does not indicate a cell-mediated immune response in the brains of APP23 mice. The similar characteristics of microglia in the APP23 mice and in AD render the mouse model suitable to study the role of inflammatory processes during AD pathogenesis. PMID:11141480

  9. Global Overexpression of ET-1 Decreases Blood Pressure - A Systematic Review and Meta-Analysis of ET-1 Transgenic Mice.

    PubMed

    Lu, Yong Ping; Tsuprykov, Oleg; Vignon-Zellweger, Nicolas; Heiden, Susi; Hocher, Berthold

    2016-01-01

    ET-1 has independent effects on blood pressure regulation in vivo, it is involved in tubular water and salt excretion, promotes constriction of smooth muscle cells, modulates sympathetic nerve activity, and activates the liberation of nitric oxide. To determine the net effect of these partially counteracting mechanisms on blood pressure, a systematic meta-analysis was performed. Based on the principles of Cochrane systematic reviews, we searched in major literature databases - MEDLINE (PubMed), Embase, Google Scholar, and the China Biological Medicine Database (CBM-disc) - for articles relevant to the topic of the blood pressure phenotype of endothelin-1 transgenic (ET-1+/+) mice from January 1, 1988 to March 31, 2016. Review Manager Version 5.0 (Rev-Man 5.0) software was applied for statistical analysis. In total thirteen studies reported blood pressure data. The meta-analysis of blood pressure data showed that homozygous ET-1 transgenic mice (ET-1+/+ mice) had a significantly lower blood pressure as compared to WT mice (mean difference: -2.57 mmHg, 95% CI: -4.98∼ -0.16, P = 0.04), with minimal heterogeneity (P = 0.86). A subgroup analysis of mice older than 6 months revealed that the blood pressure difference between ET-1+/+ mice and WT mice was even more pronounced (mean difference: -6.19 mmHg, 95% CI: -10.76∼ -1.62, P = 0.008), with minimal heterogeneity (P = 0.91). This meta-analysis provides robust evidence that global ET-1 overexpression in mice lowers blood pressure in an age-dependent manner. Older ET-1+/+ mice have a somewhat more pronounced reduction of blood pressure. © 2016 The Author(s) Published by S. Karger AG, Basel.

  10. Concurrent overexpression of ornithine decarboxylase and spermidine/spermine N(1)-acetyltransferase further accelerates the catabolism of hepatic polyamines in transgenic mice.

    PubMed Central

    Suppola, S; Heikkinen, S; Parkkinen, J J; Uusi-Oukari, M; Korhonen, V P; Keinänen, T; Alhonen, L; Jänne, J

    2001-01-01

    We have generated a hybrid transgenic mouse line overexpressing both ornithine decarboxylase (ODC) and spermidine/spermine N(1)-acetyltransferase (SSAT) under the control of the mouse metallothionein (MT) I promoter. In comparison with singly transgenic animals overexpressing SSAT, the doubly transgenic mice unexpectedly displayed much more striking signs of activated polyamine catabolism, as exemplified by a massive putrescine accumulation and an extreme reduction of hepatic spermidine and spermine pools. Interestingly, the profound depletion of the higher polyamines in the hybrid animals occurred in the presence of strikingly high ODC activity and tremendous putrescine accumulation. Polyamine catabolism in the doubly transgenic mice could be enhanced further by administration of zinc or the polyamine analogue N(1),N(11)-diethylnorspermine. In tracer experiments with [(14)C]spermidine we found that, in comparison with syngenic animals, both MT-ODC and MT-SSAT mice possessed an enhanced efflux mechanism for hepatic spermidine. In the MT-ODC animals this mechanism apparently operated in the absence of measurable SSAT activity. In the hybrid animals, spermidine efflux was stimulated further in comparison with the singly transgenic animals. In spite of a dramatic accumulation of putrescine and a profound reduction of the spermidine and spermine pools, only marginal changes were seen in the level of ODC antizyme. Even though the hybrid animals showed no liver or other organ-specific overt toxicity, except an early and permanent loss of hair, their life span was greatly reduced. These results can be understood from the perspective that catabolism is the overriding regulatory mechanism in the metabolism of the polyamines and that, even under conditions of severe depletion of spermidine and spermine, extremely high tissue pools of putrescine are not driven further to replenish the pools of the higher polyamines. PMID:11513732

  11. [Neuroprotective effect of curcumin to Aβ of double transgenic mice with Alzheimer's disease].

    PubMed

    Feng, Hui-Li; Fan, Hui; Dang, Hui-Zi; Chen, Xiao-Pei; Ren, Ying; Yang, Jin-Duo; Wang, Peng-Wen

    2014-10-01

    To observe the changes in Aβ40, Aβ42 and ADDLs in brains of 3 month-old APPswe/PS1dE9 double transgenic mice after six-month intervention with curcumin, in order to discuss the neuroprotective effect of curcumin. APPswe/PS1dE9dtg mice were randomly divided into the model group, the Rosiglitazone group (10 mg x kg(-1) x d(-1)) and curcumin high (400 mg x kg9-1) x d(-1)), medium (200 mg x kg(-1) x d(-1)) and low (100 mg x kg(-1) x d(-1)) dosage groups, with C57/BL6J mice of the same age and the same background in the normal control group. After 6 months, the immunohistochemical staining (IHC) and the Western blot method were used to observe the changes in positive cell of Aβ40, Aβ42 and ADDLs in hippocampal CA1 area, their distribution and protein expressions. Both of the immunohistochemical staining and the Western blot method showed more positive cell of Aβ40, Aβ42 and ADDLs in hippocampal CA1 area and higher protein expressions in the model group than the normal group (P < 0.01). IHC showed a lower result in the Rosiglitazone group than the model group (P < 0.05), while Western blot showed a much lower result (P < 0.01). The number of Aβ40, Aβ42 and ADDLs positive cells and the protein expressions decreased in the curcumin high group, the medium group showed a significant decrease (P < 0.01), and the low dose group also showed reductions in the protein expressions of Aβ40 and Aβ42. The six-month intervention with curcumin can significantly reduce the expressions of hippocampal Aβ40, Aβ42 and ADDLs in brains of APPswe/PS1dE9 double transgenic mice. Whether curcumin can impact Aβ cascade reaction by down-regulating expressions of Aβ40, Aβ42 and ADDLs and show the neuroprotective effect needs further studies.

  12. Squamous epithelial proliferation induced by walleye dermal sarcoma retrovirus cyclin in transgenic mice

    PubMed Central

    Lairmore, Michael D.; Stanley, James R.; Weber, Stacy A.; Holzschu, Donald L.

    2000-01-01

    Walleye dermal sarcoma (WDS) is a common disease of walleye fish in the United States and Canada. These proliferative lesions are present autumn through winter and regress in the spring. Walleye dermal sarcoma virus (WDSV), a retrovirus distantly related to other members of the family Retroviridae, has been etiologically linked to the development of WDS. We have reported that the D-cyclin homologue [retroviral (rv) cyclin] encoded by WDSV rescues yeast conditionally deficient for cyclin synthesis from growth arrest and that WDSV-cyclin mRNA is present in developing tumors. These data strongly suggest that the rv-cyclin plays a central role in the development of WDS. To test the ability of the WDSV rv-cyclin to induce cell proliferation, we have generated transgenic mice expressing the rv-cyclin in squamous epithelia from the bovine keratin-5 promoter. The transgenic animals were smaller than littermates, had reduced numbers of hair follicles, and transgenic females did not lactate properly. Following injury the transgenic animals developed severe squamous epithelial hyperplasia and dysplasia with ultrastructural characteristics of neoplastic squamous epithelium. Immunocytochemistry studies demonstrated that the hyperplastic epithelium stained positive for cytokeratin and were abnormally differentiated. Furthermore, the rv-cyclin protein was detected in the thickened basal cell layers of the proliferating lesions. These data are the first to indicate that the highly divergent WDSV rv-cyclin is a very potent stimulator of eukaryotic cell proliferation and to demonstrate the potential of a cyclin homologue encoded by a retrovirus to induce hyperplastic skin lesions. PMID:10811912

  13. Linalool reverses neuropathological and behavioral impairments in old triple transgenic Alzheimer’s mice

    PubMed Central

    Maria, Sabogal-Guáqueta Angélica; Edison, Osorio; Patricia, Cardona-Gómez Gloria

    2015-01-01

    Alzheimer’s disease (AD) is an age-related progressive neurodegenerative disorder. Several types of treatments have been tested to block or delay the onset of the disease, but none have been completely successful. Diet, lifestyle and natural products are currently the main scientific focuses. Here, we evaluate the effects of oral administration of the monoterpene linalool (25 mg / kg), every 48 hours for 3 months, on aged (21–24 months old) mice with a triple transgenic model of AD (3xTg-AD) mice. Linalool-treated 3xTg-AD mice showed improved learning and spatial memory and greater risk assessment behavior during the elevated plus maze. Hippocampi and amygdalae from linalool-treated 3xTg-AD mice exhibited a significant reduction in extracellular β-amyloidosis, tauopathy, astrogliosis and microgliosis as well as a significant reduction in the levels of the pro-inflammatory markers p38 MAPK, NOS2, COX2 and IL-1β. Together, our findings suggest that linalool reverses the histopathological hallmarks of AD and restores cognitive and emotional functions via an anti-inflammatory effect. Thus, linalool may be an AD prevention candidate for preclinical studies. PMID:26549854

  14. Premature death of TDP-43 (A315T) transgenic mice due to gastrointestinal complications prior to development of full neurological symptoms of amyotrophic lateral sclerosis.

    PubMed

    Esmaeili, Mohammad A; Panahi, Marzieh; Yadav, Shilpi; Hennings, Leah; Kiaei, Mahmoud

    2013-02-01

    Abnormal distribution, modification and aggregation of transactivation response DNA-binding protein 43 (TDP-43) are the hallmarks of multiple neurodegenerative diseases, especially frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U) and amyotrophic lateral sclerosis (ALS). Transgenic mouse lines overexpressing wild-type or mutant TDP-43 exhibit ALS-like symptom, motor abnormalities and early paralysis followed by death. Reports on lifespan and phenotypic behaviour in Prp-TDP-43 (A315T) vary, and these animals are not fully characterized. Although it has been proposed that the approximate 20% loss of motor neurons at end stage is responsible for the severe weakness and death in TDP-43 mice, this degree of neurologic damage appears insufficient to cause death. Hence we studied these mice to further characterize and determine the reason for the death. Our characterization of TDP-43 transgenic mice showed that these mice develop ALS-like symptoms that later become compounded by gastrointestinal (GI) complications that resulted in death. This is the first report of a set of pathological evidence in the GI track that is strong indicator for the cause of death of Prp-hTDP-43 (A315T) transgenic mice. © 2012 The Authors. International Journal of Experimental Pathology © 2012 International Journal of Experimental Pathology.

  15. Reducing blood glucose levels in TIDM mice with an orally administered extract of sericin from hIGF-I-transgenic silkworm cocoons.

    PubMed

    Song, Zuowei; Zhang, Mengyao; Xue, Renyu; Cao, Guangli; Gong, Chengliang

    2014-05-01

    In previous studies, we reported that the blood glucose levels of mice with type I diabetes mellitus (TIDM) was reduced with orally administered silk gland powder from silkworms transgenic for human insulin-like growth factor-I (hIGF-I). However, potential safety hazards could not be eliminated because the transgenic silk gland powder contained heterologous DNA, including the green fluorescent protein (gfp) and neomycin resistance (neo) genes. These shortcomings might be overcome if the recombinant hIGF-I were secreted into the sericin layer of the cocoon. In this study, silkworm eggs were transfected with a novel piggyBac transposon vector, pigA3GFP-serHS-hIGF-I-neo, containing the neo, gfp, and hIGF-I genes controlled by the sericin-1 (ser-1) promoter with the signal peptide DNA sequence of the fibrin heavy chain (Fib-H) and a helper plasmid containing the piggyBac transposase sequence under the control of the Bombyx mori actin 3 (A3) promoter, using sperm-mediated gene transfer to generate the transformed silkworms. The hIGF-I content estimated by enzyme-linked immunosorbent assay was approximately 162.7 ng/g. To estimate the biological activity of the expressed hIGF-I, streptozotocin-induced TIDM mice were orally administered sericin from the transgenic silkworm. The blood glucose levels of the mice were significantly reduced, suggesting that the extract from the transgenic hIGF-I silkworm cocoons can be used as an orally administered drug. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice

    PubMed Central

    Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A.; Stumpf, Sina K.; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine

    2016-01-01

    Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions. PMID:28149504

  17. Inducible targeting of CNS astrocytes in Aldh1l1-CreERT2 BAC transgenic mice.

    PubMed

    Winchenbach, Jan; Düking, Tim; Berghoff, Stefan A; Stumpf, Sina K; Hülsmann, Swen; Nave, Klaus-Armin; Saher, Gesine

    2016-01-01

    Background: Studying astrocytes in higher brain functions has been hampered by the lack of genetic tools for the efficient expression of inducible Cre recombinase throughout the CNS, including the neocortex. Methods: Therefore, we generated BAC transgenic mice, in which CreERT2 is expressed under control of the Aldh1l1 regulatory region. Results: When crossbred to Cre reporter mice, adult Aldh1l1-CreERT2 mice show efficient gene targeting in astrocytes. No such Cre-mediated recombination was detectable in CNS neurons, oligodendrocytes, and microglia. As expected, Aldh1l1-CreERT2 expression was evident in several peripheral organs, including liver and kidney. Conclusions: Taken together, Aldh1l1-CreERT2 mice are a useful tool for studying astrocytes in neurovascular coupling, brain metabolism, synaptic plasticity and other aspects of neuron-glia interactions.

  18. Lipofuscin accumulation, abnormal electrophysiology, and photoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macular degeneration.

    PubMed

    Karan, G; Lillo, C; Yang, Z; Cameron, D J; Locke, K G; Zhao, Y; Thirumalaichary, S; Li, C; Birch, D G; Vollmer-Snarr, H R; Williams, D S; Zhang, K

    2005-03-15

    Macular degeneration is a heterogeneous group of disorders characterized by photoreceptor degeneration and atrophy of the retinal pigment epithelium (RPE) in the central retina. An autosomal dominant form of Stargardt macular degeneration (STGD) is caused by mutations in ELOVL4, which is predicted to encode an enzyme involved in the elongation of long-chain fatty acids. We generated transgenic mice expressing a mutant form of human ELOVL4 that causes STGD. In these mice, we show that accumulation by the RPE of undigested phagosomes and lipofuscin, including the fluorophore, 2-[2,6-dimethyl-8-(2,6,6-trimethyl-1-cyclohexen-1-yl)-1E,3E,5E,7E-octatetraenyl]-1-(2-hyydroxyethyl)-4-[4-methyl-6-(2,6,6,-trimethyl-1-cyclohexen-1-yl)-1E,3E,5E-hexatrienyl]-pyridinium (A2E) is followed by RPE atrophy. Subsequently, photoreceptor degeneration occurs in the central retina in a pattern closely resembling that of human STGD and age-related macular degeneration. The ELOVL4 transgenic mice thus provide a good model for both STGD and dry age-related macular degeneration, and represent a valuable tool for studies on therapeutic intervention in these forms of blindness.

  19. Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

    PubMed Central

    Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

    1996-01-01

    Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

  20. Striatal Distribution and Cytoarchitecture of Dopamine Receptor Subtype 1 and 2: Evidence from Double-Labeling Transgenic Mice

    PubMed Central

    Ren, Keke; Guo, Baolin; Dai, Chunqiu; Yao, Han; Sun, Tangna; Liu, Xia; Bai, Zhantao; Wang, Wenting; Wu, Shengxi

    2017-01-01

    As the main input nucleus of the basal ganglion, the striatum executes different functions, including motivation, reward and attention. The functions of the striatum highly rely on its subregions that receive projections from various cortical areas and the distribution of striatonigral neurons that express D1 dopamine (DA) receptors (or D1 medium-sized spiny neurons, D1 MSNs) and striatopallidal neurons that express D2 DA receptors (or D2 MSNs). Using bacterial artificial chromosome (BAC) transgenic mice, several studies have recently been performed on the spatial distribution of D1 and D2 MSNs. However, these studies mainly focused on enumeration of either D1-enhanced fluorescent protein (eGFP) or D2-eGFP in mice. In the present work, we used Drd1a-tdTamato and Drd2-eGFP double BAC transgenic mice to evaluate the spatial pattern of D1 MSNs (red fluorescence) and D2 MSNs (green fluorescence) along the rostro-caudal axis of the dorsal striatum. The dorsal striatum was divided into three subregions: rostral caudoputamen (CPr), intermediate CP (CPi), and caudal CP (CPc) across the rostral–caudal extent of the striatum. The results demonstrate that D1 and D2 MSNs were intermingled with each other in most of these regions. The cell density of D1 MSNs was slightly higher than D2 MSNs through CPr, CPi, and CPc, though it did not reach significance. However, in CPi, the ratio of D1/D2 in the ventromedial CPi group was significantly higher than those in dorsolateral, dorsomedial, and ventrolateral CPi. There was similar proportion of cells that co-expressed D1 and D2 receptors. Moreover, we demonstrated a pathway-specific activation pattern of D1 MSNs and D2 MSNs in a manic like mouse model induced by D-Amphetamine by utilizing this double transgenic mice and c-fos immunoreactivity. Our results may provide a morphological basis for the function or pathophysiology of striatonigral and striatopallidal neurons with diverse cortical inputs to the dorsal striatum. PMID

  1. C9orf72 BAC Transgenic Mice Display Typical Pathologic Features of ALS/FTD.

    PubMed

    O'Rourke, Jacqueline G; Bogdanik, Laurent; Muhammad, A K M G; Gendron, Tania F; Kim, Kevin J; Austin, Andrew; Cady, Janet; Liu, Elaine Y; Zarrow, Jonah; Grant, Sharday; Ho, Ritchie; Bell, Shaughn; Carmona, Sharon; Simpkinson, Megan; Lall, Deepti; Wu, Kathryn; Daughrity, Lillian; Dickson, Dennis W; Harms, Matthew B; Petrucelli, Leonard; Lee, Edward B; Lutz, Cathleen M; Baloh, Robert H

    2015-12-02

    Noncoding expansions of a hexanucleotide repeat (GGGGCC) in the C9orf72 gene are the most common cause of familial amyotrophic lateral sclerosis and frontotemporal dementia. Here we report transgenic mice carrying a bacterial artificial chromosome (BAC) containing the full human C9orf72 gene with either a normal allele (15 repeats) or disease-associated expansion (∼100-1,000 repeats; C9-BACexp). C9-BACexp mice displayed pathologic features seen in C9orf72 expansion patients, including widespread RNA foci and repeat-associated non-ATG (RAN) translated dipeptides, which were suppressed by antisense oligonucleotides targeting human C9orf72. Nucleolin distribution was altered, supporting that either C9orf72 transcripts or RAN dipeptides promote nucleolar dysfunction. Despite early and widespread production of RNA foci and RAN dipeptides in C9-BACexp mice, behavioral abnormalities and neurodegeneration were not observed even at advanced ages, supporting the hypothesis that RNA foci and RAN dipeptides occur presymptomatically and are not sufficient to drive neurodegeneration in mice at levels seen in patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Mito-Apocynin Prevents Mitochondrial Dysfunction, Microglial Activation, Oxidative Damage, and Progressive Neurodegeneration in MitoPark Transgenic Mice.

    PubMed

    Langley, Monica; Ghosh, Anamitra; Charli, Adhithiya; Sarkar, Souvarish; Ay, Muhammet; Luo, Jie; Zielonka, Jacek; Brenza, Timothy; Bennett, Brian; Jin, Huajun; Ghaisas, Shivani; Schlichtmann, Benjamin; Kim, Dongsuk; Anantharam, Vellareddy; Kanthasamy, Arthi; Narasimhan, Balaji; Kalyanaraman, Balaraman; Kanthasamy, Anumantha G

    2017-11-10

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by progressive motor deficits and degeneration of dopaminergic neurons. Caused by a number of genetic and environmental factors, mitochondrial dysfunction and oxidative stress play a role in neurodegeneration in PD. By selectively knocking out mitochondrial transcription factor A (TFAM) in dopaminergic neurons, the transgenic MitoPark mice recapitulate many signature features of the disease, including progressive motor deficits, neuronal loss, and protein inclusions. In the present study, we evaluated the neuroprotective efficacy of a novel mitochondrially targeted antioxidant, Mito-apocynin, in MitoPark mice and cell culture models of neuroinflammation and mitochondrial dysfunction. Oral administration of Mito-apocynin (10 mg/kg, thrice a week) showed excellent central nervous system bioavailability and significantly improved locomotor activity and coordination in MitoPark mice. Importantly, Mito-apocynin also partially attenuated severe nigrostriatal degeneration in MitoPark mice. Mechanistic studies revealed that Mito-apo improves mitochondrial function and inhibits NOX2 activation, oxidative damage, and neuroinflammation. The properties of Mito-apocynin identified in the MitoPark transgenic mouse model strongly support potential clinical applications for Mito-apocynin as a viable neuroprotective and anti-neuroinflammatory drug for treating PD when compared to conventional therapeutic approaches. Collectively, our data demonstrate, for the first time, that a novel orally active apocynin derivative improves behavioral, inflammatory, and neurodegenerative processes in a severe progressive dopaminergic neurodegenerative model of PD. Antioxid. Redox Signal. 27, 1048-1066.

  3. A YAC contig spanning the dominant retinitis pigmentosa locus (RP9) on chromosome 7p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keen, T.J.; Inglehearn, C.F.; Patel, R.J.

    1995-08-10

    The dominant retinitis pigmentosa locus RP9 has previously been localized to 7p13-p15, in the interval D7S526-D7S484. We now report refinement of the locus to the interval D7S795-D7S484 and YAC contig of approximately 4.8 Mb spanning this region and extending both distally and proximally from it. The contig was constructed by STS content mapping and physically orders 29 STSs in 28 YAC clones. The order of polymorphic markers in the contig is consistent with a genetic map that has been assembled using haplotype data from the CEPH pedigrees. This contig will provide a primary resource for the construction of a transcriptionalmore » map of this region and for the identification of the defective gene causing this form of adRP. 27 refs., 3 figs., 1 tab.« less

  4. Human FGF1 promoter is active in ependymal cells and dopaminergic neurons in the brains of F1B-GFP transgenic mice.

    PubMed

    Chen, Mei-Shu; Lin, Hua-Kuo; Chiu, Hsun; Lee, Don-Ching; Chung, Yu-Fen; Chiu, Ing-Ming

    2015-03-01

    FGF1 is involved in multiple biological functions and exhibits the importance in neuroprotective effects. Our previous studies indicated that, in human brain and retina, the FGF1B promoter controlled the expression of FGF1. However, the exact function and regulation of FGF1 in brain is still unclear. Here, we generated F1B-GFP transgenic mice that expressed the GFP reporter gene under the control of human FGF1B promoter (-540 to +31). Using the fresh brain sections of F1B-GFP transgenic mice, we found that the F1B-GFP cells expressed strong fluorescent signals in the ventricular system throughout the brain. The results of immunohistochemistry further showed that two distinct populations of F1B-GFP(+) cells existed in the brains of F1B-GFP transgenic mice. We demonstrated that one population of F1B-GFP(+) cells was ependymal cells, which distributed along the entire ventricles, and the second population of F1B-GFP(+) cells was neuronal cells that projected their long processes into multiple directions in specific areas of the brain. The double labeling of F1B-GFP(+) cells and tyrosine hydroxylase indicated that a subpopulation of F1B-GFP(+) -neuronal cells was dopaminergic neurons. Importantly, these F1B-GFP(+) /TH(+) cells were distributed in the main dopaminergic neuronal groups including hypothalamus, ventral tegmental area, and raphe nuclei. These results suggested that human FGF1B promoter was active in ependymal cells, neurons, and a portion of dopaminergic neurons. Thus, the F1B-GFP transgenic mice provide an animal model not only for studying FGF1 gene expression in vivo but also for understanding the role of FGF1 contribution in neurodegenerative disorders such as Parkinson's disease and Alzheimer's disease. © 2014 The Authors Developmental Neurobiology Published by Wiley Periodicals, Inc.

  5. Olfactory abnormalities in Huntington's disease: decreased plasticity in the primary olfactory cortex of R6/1 transgenic mice and reduced olfactory discrimination in patients.

    PubMed

    Lazic, Stanley E; Goodman, Anna O G; Grote, Helen E; Blakemore, Colin; Morton, A Jennifer; Hannan, Anthony J; van Dellen, Anton; Barker, Roger A

    2007-06-02

    Reduced neuronal plasticity in the striatum, hippocampus, and neocortex is a common feature of transgenic mouse models of Huntington's disease (HD). Doublecortin (DCX) and polysialylated neural cell adhesion molecule (PSA-NCAM) are associated with structural plasticity in the adult mammalian brain, are markers of newly formed neurons in the dentate gyrus of the adult hippocampus, and are highly expressed in primary olfactory (piriform) cortex. Animal studies have demonstrated that a reduction in plasticity in the piriform cortex is associated with a selective impairment in odour discrimination. Therefore, the number of DCX and PSA-NCAM immunoreactive cells in the piriform cortex were quantified as measures of plasticity in early stage (fifteen week old) R6/1 transgenic HD mice. The transgenic mice had a large reduction in the number of DCX and PSA-NCAM immunoreactive cells in the piriform cortex, similar to that previously reported in the R6/2 mice. We also tested whether odour discrimination, as well as identification and detection, were impaired in HD patients and found that patients (at a similar disease stage as the mice) had an impairment in odour discrimination and identification, but not odour detection. These results suggest that olfactory impairments observed in HD patients may be the result of reduced plasticity in the primary olfactory cortex.

  6. Isolation of Novel Synthetic Prion Strains by Amplification in Transgenic Mice Coexpressing Wild-Type and Anchorless Prion Proteins

    PubMed Central

    Raymond, Gregory J.; Race, Brent; Hollister, Jason R.; Offerdahl, Danielle K.; Moore, Roger A.; Kodali, Ravindra; Raymond, Lynne D.; Hughson, Andrew G.; Rosenke, Rebecca; Long, Dan; Dorward, David W.

    2012-01-01

    Mammalian prions are thought to consist of misfolded aggregates (protease-resistant isoform of the prion protein [PrPres]) of the cellular prion protein (PrPC). Transmissible spongiform encephalopathy (TSE) can be induced in animals inoculated with recombinant PrP (rPrP) amyloid fibrils lacking mammalian posttranslational modifications, but this induction is inefficient in hamsters or transgenic mice overexpressing glycosylphosphatidylinositol (GPI)-anchored PrPC. Here we show that TSE can be initiated by inoculation of misfolded rPrP into mice that express wild-type (wt) levels of PrPC and that synthetic prion strain propagation and selection can be affected by GPI anchoring of the host's PrPC. To create prions de novo, we fibrillized mouse rPrP in the absence of molecular cofactors, generating fibrils with a PrPres-like protease-resistant banding profile. These fibrils induced the formation of PrPres deposits in transgenic mice coexpressing wt and GPI-anchorless PrPC (wt/GPI−) at a combined level comparable to that of PrPC expression in wt mice. Secondary passage into mice expressing wt, GPI−, or wt plus GPI− PrPC induced TSE disease with novel clinical, histopathological, and biochemical phenotypes. Contrary to laboratory-adapted mouse scrapie strains, the synthetic prion agents exhibited a preference for conversion of GPI− PrPC and, in one case, caused disease only in GPI− mice. Our data show that novel TSE agents can be generated de novo solely from purified mouse rPrP after amplification in mice coexpressing normal levels of wt and anchorless PrPC. These observations provide insight into the minimal elements required to create prions in vitro and suggest that the PrPC GPI anchor can modulate the propagation of synthetic TSE strains. PMID:22915801

  7. A New Animal Model of Gastric Lymphomagenesis: APRIL Transgenic Mice Infected by Helicobacter Species.

    PubMed

    Floch, Pauline; Izotte, Julien; Guillemaud, Julien; Sifré, Elodie; Costet, Pierre; Rousseau, Benoit; Laur, Amandine Marine; Giese, Alban; Korolik, Victoria; Mégraud, Francis; Dubus, Pierre; Hahne, Michael; Lehours, Philippe

    2017-07-01

    APRIL is a member of the tumor necrosis factor cytokine family involved in the regulation of B-cell immunity. We present a study of the infection by Helicobacter species of transgenic (Tg) C57BL6 mice, ectopically expressing the human form of APRIL. Wild-type (WT) and APRIL Tg mice were infected with Helicobacter felis and Helicobacter pylori and compared with noninfected animals. Mice were euthanized 18 months after infection, and inflammatory responses and histologic alterations were analyzed. Flow cytometry results revealed that WT-infected mice had less leukocyte infiltration than APRIL Tg-infected mice. In WT-infected mice, infiltrates in gastric tissues were predominantly composed of T cells, mainly CD4 + for H. pylori and CD8 + for H. felis. In APRIL Tg-infected mice, leukocyte infiltrates were composed of B cells with few CD4 + T cells for both species. B cells expressed B surface markers compatible with a marginal zone origin. These results were confirmed by immunohistochemistry. B cells in particular were involved in lymphoepithelial lesions, a hallmark of gastric MALT lymphoma. Monoclonality was observed in a few infiltrates in the presence of lymphoepithelial lesions. These results confirm the importance of APRIL in the development of gastric lymphoid infiltrates induced by Helicobacter species in vivo. We believe that APRIL Tg mice infected by Helicobacter species may represent a novel animal model of gastric lymphomagenesis. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  8. T(2)-weighted microMRI and evoked potential of the visual system measurements during the development of hypomyelinated transgenic mice.

    PubMed

    Martin, Melanie; Reyes, Samuel D; Hiltner, Timothy D; Givogri, M Irene; Tyszka, J Michael; Fisher, Robin; Campagnoni, Anthony T; Fraser, Scott E; Jacobs, Russell E; Readhead, Carol

    2007-02-01

    Our objective was to follow the course of a dysmyelinating disease followed by partial recovery in transgenic mice using non-invasive high-resolution (117 x 117 x 70 microm) magnetic resonance (microMRI) and evoked potential of the visual system (VEP) techniques. We used JOE (for J37 golli overexpressing) transgenic mice engineered to overexpress golli J37, a product of the Golli-mbp gene complex, specifically in oligodendrocytes. Individual JOE transgenics and their unaffected siblings were followed from 21 until 75-days-old using non-invasive in vivo VEPs and 3D T2-weighted microMRI on an 11.7 T scanner, performing what we believe is the first longitudinal study of its kind. The microMRI data indicated clear, global hypomyelination during the period of peak myelination (21-42 days), which was partially corrected at later ages (>60 days) in the JOE mice compared to controls. These microMRI data correlated well with [Campagnoni AT (1995) "Molecular biology of myelination". In: Ransom B, Kettenmann H (eds) Neuroglia--a Treatise. Oxford University Press, London, pp 555-570] myelin staining, [Campagnoni AT, Macklin WB (1988) Cellular and molecular aspects of myelin protein gene-expression. Mol Neurobiol 2:41-89] a transient intention tremor during the peak period of myelination, which abated at later ages, and [Lees MB, Brostoff SW (1984) Proteins in myelin. In: Morell (ed) Myelin. Plenum Press, New York and London, pp 197-224] VEPs which all indicated a significant delay of CNS myelin development and persistent hypomyelination in JOE mice. Overall these non-invasive techniques are capable of spatially resolving the increase in myelination in the normally developing and developmentally delayed mouse brain.

  9. Impaired glucose homeostasis in transgenic mice expressing the human transient neonatal diabetes mellitus locus, TNDM

    PubMed Central

    Ma, Dan; Shield, Julian P.H.; Dean, Wendy; Leclerc, Isabelle; Knauf, Claude; Burcelin, Rémy; Rutter, Guy A.; Kelsey, Gavin

    2004-01-01

    Transient neonatal diabetes mellitus (TNDM) is a rare inherited diabetic syndrome apparent in the first weeks of life and again during early adulthood. The relative contributions of reduced islet β cell number and impaired β cell function to the observed hypoinsulinemia are unclear. The inheritance pattern of this imprinted disorder implicates overexpression of one or both genes within the TNDM locus: ZAC, which encodes a proapoptotic zinc finger protein, and HYMAI, which encodes an untranslated mRNA. To investigate the consequences for pancreatic function, we have developed a high-copy transgenic mouse line, TNDM29, carrying the human TNDM locus. TNDM29 neonates display hyperglycemia, and older adults, impaired glucose tolerance. Neonatal hyperglycemia occurs only on paternal transmission, analogous to paternal dependence of TNDM in humans. Embryonic pancreata of TNDM29 mice showed reductions in expression of endocrine differentiation factors and numbers of insulin-staining structures. By contrast, β cell mass was normal or elevated at all postnatal stages, whereas pancreatic insulin content in neonates and peak serum insulin levels after glucose infusion in adults were reduced. Expression of human ZAC and HYMAI in these transgenic mice thus recapitulates key features of TNDM and implicates impaired development of the endocrine pancreas and β cell function in disease pathogenesis. PMID:15286800

  10. Amyotrophic lateral sclerosis mutant vesicle-associated membrane protein-associated protein-B transgenic mice develop TAR-DNA-binding protein-43 pathology.

    PubMed

    Tudor, E L; Galtrey, C M; Perkinton, M S; Lau, K-F; De Vos, K J; Mitchell, J C; Ackerley, S; Hortobágyi, T; Vámos, E; Leigh, P N; Klasen, C; McLoughlin, D M; Shaw, C E; Miller, C C J

    2010-05-19

    Cytoplasmic ubiquitin-positive inclusions containing TAR-DNA-binding protein-43 (TDP-43) within motor neurons are the hallmark pathology of sporadic amyotrophic lateral sclerosis (ALS). TDP-43 is a nuclear protein and the mechanisms by which it becomes mislocalized and aggregated in ALS are not properly understood. A mutation in the vesicle-associated membrane protein-associated protein-B (VAPB) involving a proline to serine substitution at position 56 (VAPBP56S) is the cause of familial ALS type-8. To gain insight into the molecular mechanisms by which VAPBP56S induces disease, we created transgenic mice that express either wild-type VAPB (VAPBwt) or VAPBP56S in the nervous system. Analyses of both sets of mice revealed no overt motor phenotype nor alterations in survival. However, VAPBP56S but not VAPBwt transgenic mice develop cytoplasmic TDP-43 accumulations within spinal cord motor neurons that were first detected at 18 months of age. Our results suggest a link between abnormal VAPBP56S function and TDP-43 mislocalization. Copyright 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  11. Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

    PubMed

    Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

    2012-02-28

    Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

  12. Airway-Specific Inducible Transgene Expression Using Aerosolized Doxycycline

    PubMed Central

    Tata, Purushothama Rao; Pardo-Saganta, Ana; Prabhu, Mythili; Vinarsky, Vladimir; Law, Brandon M.; Fontaine, Benjamin A.; Tager, Andrew M.

    2013-01-01

    Tissue-specific transgene expression using tetracycline (tet)-regulated promoter/operator elements has been used to revolutionize our understanding of cellular and molecular processes. However, because most tet-regulated mouse strains use promoters of genes expressed in multiple tissues, to achieve exclusive expression in an organ of interest is often impossible. Indeed, in the extreme case, unwanted transgene expression in other organ systems causes lethality and precludes the study of the transgene in the actual organ of interest. Here, we describe a novel approach to activating tet-inducible transgene expression solely in the airway by administering aerosolized doxycycline. By optimizing the dose and duration of aerosolized doxycycline exposure in mice possessing a ubiquitously expressed Rosa26 promoter–driven reverse tet-controlled transcriptional activator (rtTA) element, we induce transgene expression exclusively in the airways. We detect no changes in the cellular composition or proliferative behavior of airway cells. We used this newly developed method to achieve airway basal stem cell–specific transgene expression using a cytokeratin 5 (also known as keratin 5)–driven rtTA driver line to induce Notch pathway activation. We observed a more robust mucous metaplasia phenotype than in mice receiving doxycycline systemically. In addition, unwanted phenotypes outside of the lung that were evident when doxycycline was received systemically were now absent. Thus, our approach allows for rapid and efficient airway-specific transgene expression. After the careful strain by strain titration of the dose and timing of doxycycline inhalation, a suite of preexisting transgenic mice can now be used to study airway biology specifically in cases where transient transgene expression is sufficient to induce a phenotype. PMID:23848320

  13. Learning Impairments, Memory Deficits, and Neuropathology in Aged Tau Transgenic Mice Are Dependent on Leukotrienes Biosynthesis: Role of the cdk5 Kinase Pathway.

    PubMed

    Giannopoulos, Phillip F; Chiu, Jian; Praticò, Domenico

    2018-06-07

    Previous studies showed that the leukotrienes pathway is increased in human tauopathy and that its manipulation may modulate the onset and development of the pathological phenotype of tau transgenic mice. However, whether interfering with leukotrienes biosynthesis is beneficial after the behavioral deficits and the neuropathology have fully developed in these mice is not known. To test this hypothesis, aged tau transgenic mice were randomized to receive zileuton, a specific leukotriene biosynthesis inhibitor, or vehicle starting at 12 months of age for 16 weeks and then assessed in their functional and pathological phenotype. Compared with baseline, we observed that untreated tau mice had a worsening of their memory and spatial learning. By contrast, tau mice treated with zileuton had a reversal of these deficits and behaved in an undistinguishable manner from wild-type mice. Leukotriene-inhibited tau mice had an amelioration of synaptic integrity, lower levels of neuroinflammation, and a significant reduction in tau phosphorylation and pathology, which was secondary to an involvement of the cdk5 kinase pathway. Taken together, our findings represent the first demonstration that the leukotriene biosynthesis is functionally involved at the later stages of the tau pathological phenotype and represents an ideal target with viable therapeutic potential for treating human tauopathies.

  14. Antihyperalgesic activity of a novel nonpeptide bradykinin B1 receptor antagonist in transgenic mice expressing the human B1 receptor

    PubMed Central

    Fox, Alyson; Kaur, Satbir; Li, Bifang; Panesar, Moh; Saha, Uma; Davis, Clare; Dragoni, Ilaria; Colley, Sian; Ritchie, Tim; Bevan, Stuart; Burgess, Gillian; McIntyre, Peter

    2005-01-01

    We describe the properties of a novel nonpeptide kinin B1 receptor antagonist, NVP-SAA164, and demonstrate its in vivo activity in models of inflammatory pain in transgenic mice expressing the human B1 receptor. NVP-SAA164 showed high affinity for the human B1 receptor expressed in HEK293 cells (Ki 8 nM), and inhibited increases in intracellular calcium induced by desArg10kallidin (desArg10KD) (IC50 33 nM). While a similar high affinity was observed in monkey fibroblasts (Ki 7.7 nM), NVP-SAA164 showed no affinity for the rat B1 receptor expressed in Cos-7 cells. In transgenic mice in which the native B1 receptor was deleted and the gene encoding the human B1 receptor was inserted (hB1 knockin, hB1-KI), hB1 receptor mRNA was induced in tissues following LPS treatment. No mRNA encoding the mouse or human B1 receptor was detected in mouse B1 receptor knockout (mB1-KO) mice following LPS treatment. Freund's complete adjuvant-induced mechanical hyperalgesia was similar in wild-type and hB1-KI mice, but was significantly reduced in mB1-KO animals. Mechanical hyperalgesia induced by injection of the B1 agonist desArg10KD into the contralateral paw 24 h following FCA injection was similar in wild-type and hB1-KI mice, but was absent in mB1-KO animals. Oral administration of NVP-SAA164 produced a dose-related reversal of FCA-induced mechanical hyperalgesia and desArg10KD-induced hyperalgesia in hB1-KI mice, but was inactive against inflammatory pain in wild-type mice. These data demonstrate the use of transgenic technology to investigate the in vivo efficacy of species selective agents and show that NVP-SAA164 is a novel orally active B1 receptor antagonist, providing further support for the utility of B1 receptor antagonists in inflammatory pain conditions in man. PMID:15685199

  15. HTLV-1 Tax transgenic mice develop spontaneous osteolytic bone metastases prevented by osteoclast inhibition

    PubMed Central

    Gao, Ling; Deng, Hongju; Zhao, Haibo; Hirbe, Angela; Harding, John; Ratner, Lee; Weilbaecher, Katherine

    2005-01-01

    One in 20 carriers of human T-cell leukemia virus type 1 (HTLV-1) will develop adult T-cell leukemia/lymphoma (ATL), a disease frequently associated with hypercalcemia, bone destruction, and a fatal course refractory to current therapies. Overexpression of the HTLV-1–encoded Tax oncoprotein under the human granzyme B promoter causes large granular lymphocytic leukemia/lymphomas in mice. We found that Tax+ mice spontaneously developed hypercalcemia, high-frequency osteolytic bone metastases, and enhanced osteoclast activity. We evaluated Tax tumors for the production of osteoclast-activating factors. Purification of Tax+ tumor cells and nonmalignant tumor-infiltrating lymphocytes demonstrated that each of these populations expressed transcripts for distinct osteoclast-activating factors. We then evaluated the effect of osteoclast inhibition on tumor formation. Mice doubly transgenic for Tax and the osteoclast inhibitory factor, osteoprotegerin, were protected from osteolytic bone disease and developed fewer soft-tissue tumors. Likewise, osteoclast inhibition with bone-targeted zoledronic acid protected Tax+ mice from bone and soft-tissue tumors and prolonged survival. Tax+ mice represent the first animal model of high-penetrance spontaneous osteolytic bone metastasis and underscore the critical role of nonmalignant host cells recruited by tumor cells in the process of cancer progression and metastasis. PMID:16118323

  16. Comparison of the antiviral potential among soluble forms of herpes simplex virus type-2 glycoprotein D receptors, herpes virus entry mediator A, nectin-1 and nectin-2, in transgenic mice.

    PubMed

    Fujimoto, Yoshikazu; Tomioka, Yukiko; Ozaki, Kinuyo; Takeda, Keiko; Suyama, Haruka; Yamamoto, Sayo; Takakuwa, Hiroki; Morimatsu, Masami; Uede, Toshimitsu; Ono, Etsuro

    2017-07-01

    Herpesvirus entry mediator A (HVEM), nectin-1 and nectin-2 are cellular receptors of glycoprotein D (gD) of herpes simplex virus type-2 (HSV-2). It has been shown that soluble forms of HSV gD receptors have the antiviral potential in cultured cells and transgenic mice. Here, to compare antiviral potential of soluble forms of HVEM, nectin-1 and nectin-2 against HSV-2 infections in vivo, transgenic mice expressing fusion proteins consisting of the entire ectodomain of HVEM, nectin-1 or nectin-2 and the Fc portion of human IgG (HVEMIg, nectin-1Ig and nectin-2Ig, respectively) were intraperitoneally infected with HSV-2. In the infection with 3 MLD50 (50 % mouse lethal dose), effective resistance was not observed in transgenic mice expressing nectin-2Ig. In a transgenic mouse line with high expression of nectin-1Ig, significant protection from the infection with 30 and 300 MLD50 was observed (survival rate of 100 and 71 %, respectively). On the other hand, transgenic mice expressing HVEMIg showed a complete resistance to the lethal infection even with 300 MLD50 (survival rate of 100 %). These results demonstrated that HVEMIg could exert effective antiviral activities against HSV-2 infections in vivo as compared with other soluble forms of HSV gD receptors.

  17. Msh3 is a limiting factor in the formation of intergenerational CTG expansions in DM1 transgenic mice.

    PubMed

    Foiry, Laurent; Dong, Li; Savouret, Cédric; Hubert, Laurence; te Riele, Hein; Junien, Claudine; Gourdon, Geneviève

    2006-06-01

    The CTG repeat involved in myotonic dystrophy is one of the most unstable trinucleotide repeats. However, the molecular mechanisms underlying this particular form of genetic instability-biased towards expansions-have not yet been completely elucidated. We previously showed, with highly unstable CTG repeat arrays in DM1 transgenic mice, that Msh2 is required for the formation of intergenerational and somatic expansions. To identify the partners of Msh2 in the formation of intergenerational CTG repeat expansions, we investigated the involvement of Msh3 and Msh6, partners of Msh2 in mismatch repair. Transgenic mice with CTG expansions were crossed with Msh3- or Msh6-deficient mice and CTG repeats were analysed after maternal and paternal transmissions. We demonstrated that Msh3 but not Msh6 plays also a key role in the formation of expansions over successive generation. Furthermore, the absence of one Msh3 allele was sufficient to decrease the formation of expansions, indicating that Msh3 is rate-limiting in this process. In the absence of Msh6, the frequency of expansions decreased only in maternal transmissions. However, the significantly lower levels of Msh2 and Msh3 proteins in Msh6 -/- ovaries suggest that the absence of Msh6 may have an indirect effect.

  18. Glial S100B Positive Vacuoles In Purkinje Cells: Earliest Morphological Abnormality In SCA1 Transgenic Mice

    PubMed Central

    VIG, Parminder J.S.; LOPEZ, Maripar E.; WEI, Jinrong; D’SOUZA, David R.; SUBRAMONY, SH; HENEGAR, Jeffrey; FRATKIN, Jonathan D.

    2007-01-01

    Spinocerebellar ataxia-1 (SCA1) is caused by the expansion of a polyglutamine repeat within the disease protein, ataxin-1. The overexpression of mutant ataxin-1 in SCA1 transgenic mice results in the formation of cytoplasmic vacuoles in Purkinje neurons (PKN) of the cerebellum. PKN are closely associated with neighboring Bergmann glia. To elucidate the role of Bergmann glia in SCA1 pathogenesis, cerebellar tissue from 7 days to 6 wks old SCA1 transgenic and wildtype mice were used. We observed that Bergmann glial S100B protein is localized to the cytoplasmic vacuoles in SCA1 PKN. These S100B positive cytoplasmic vacuoles began appearing much before the onset of behavioral abnormalities, and were negative for other glial and PKN marker proteins. Electron micrographs revealed that vacuoles have a double membrane. In the vacuoles, S100B colocalized with receptors of advanced glycation end-products (RAGE), and S100B co-immunoprecipated with cerebellar RAGE. In SCA1 PKN cultures, exogenous S100B protein interacted with the PKN membranes and was internalized. These data suggest that glial S100B though extrinsic to PKN is sequestered into cytoplasmic vacuoles in SCA1 mice at early postnatal ages. Further, S100B may be binding to RAGE on Purkinje cell membranes before these membranes are internalized. PMID:18176630

  19. Cardioprotective effects of 70-kDa heat shock protein in transgenic mice.

    PubMed

    Radford, N B; Fina, M; Benjamin, I J; Moreadith, R W; Graves, K H; Zhao, P; Gavva, S; Wiethoff, A; Sherry, A D; Malloy, C R; Williams, R S

    1996-03-19

    Heat shock proteins are proposed to limit injury resulting from diverse environmental stresses, but direct metabolic evidence for such a cytoprotective function in vertebrates has been largely limited to studies of cultured cells. We generated lines of transgenic mice to express human 70-kDa heat shock protein constitutively in the myocardium. Hearts isolated from these animals demonstrated enhanced recovery of high energy phosphate stores and correction of metabolic acidosis following brief periods of global ischemia sufficient to induce sustained abnormalities of these variables in hearts from nontransgenic littermates. These data demonstrate a direct cardioprotective effect of 70-kDa heat shock protein to enhance postischemic recovery of the intact heart.

  20. Cardiac phenotype induced by a dysfunctional α 1C transgene: a general problem for the transgenic approach.

    PubMed

    Asemu, Girma; Fishbein, Kenneth; Lao, Qi Zong; Ravindran, Arippa; Herbert, Ron; Canuto, Holly C; Spencer, Richard G; Soldatov, Nikolai M

    2011-01-01

    Based on stable integration of recombinant DNA into a host genome, transgenic technology has become an important genetic engineering methodology. An organism whose genetic characteristics have been altered by the insertion of foreign DNA is supposed to exhibit a new phenotype associated with the function of the transgene. However, successful insertion may not be sufficient to achieve specific modification of function. In this study we describe a strain of transgenic mouse, G7-882, generated by incorporation into the mouse genome of human CaV 1.2 α(1C) cDNA deprived of 3'-UTR to exclude transcription. We found that, in response to chronic infusion of isoproterenol, G7-882 develops dilated cardiomyopathy, a misleading "transgenic artifact" compatible with the expected function of the incorporated "correct" transgene. Specifically, using magnetic resonance imaging (MRI), we found that chronic β-adrenergic stimulation of G7-882 mice caused left ventricular hypertrophy and aggravated development of dilated cardiomyopathy, although no significant changes in the kinetics, density and voltage dependence of the calcium current were observed in G7-882 cardiomyocytes as compared to cells from wild type mice. This result illustrates the possibility that even when a functional transgene is expressed, an observed change in phenotype may be due to the artifact of "incidental incorporation" leading to misleading conclusions. To exclude this possibility and thus provide a robust tool for exploring biological function, the new transgenic phenotype must be replicated in several independently generated transgenic strains.

  1. Skeletal phenotype of growing transgenic mice that express a function-perturbing form of beta1 integrin in osteoblasts

    NASA Technical Reports Server (NTRS)

    Globus, R. K.; Amblard, D.; Nishimura, Y.; Iwaniec, U. T.; Kim, J-B; Almeida, E. A. C.; Damsky, C. D.; Wronski, T. J.; van der Meulen, M. C. H.

    2005-01-01

    Skeletal modeling entails the deposition of large amounts of extracellular matrix (ECM) to form structures tailored to withstand increasing mechanical loads during rapid growth. Specific ECM molecules bind to integrin receptors on the cell surface, thereby triggering a cascade of signaling events that affect critical cell functions. To evaluate the role of integrins during skeletal growth, transgenic mice were engineered to express a function-perturbing fragment of beta1 integrin consisting of the transmembrane domain and cytoplasmic tail under the control of the osteocalcin promoter (TG mice). Thus, transgene expression was targeted to mature cells of the osteoblast lineage, and herein we show that cultured cells resembling osteocytes from 90-day-old TG mice display impaired adhesion to collagen I, a ligand for beta1 integrin. To determine the influence of beta1 integrin on bones that are responsible for providing structural support during periods of rapid growth, we examined the phenotype of the appendicular skeleton in TG mice compared to wild type (WT) mice. According to radiographs, bones from mice of both genotypes between 14 and 90 days of age appeared similar in gross structure and density, although proximal tibiae from 35-90 days old TG mice were less curved than those of WT mice (72-92% TG/WT). Although there were only mild and transient differences in absolute bone mass and strength, once normalized to body mass, the tibial dry mass (79.1% TG/WT females), ash mass (78.5% TG/WT females), and femoral strength in torsion (71.6% TG/WT females) were reduced in TG mice compared to WT mice at 90 days of age. Similar effects of genotype on bone mass and curvature were observed in 1-year-old retired breeders, indicating that these phenotypic differences between TG and WT mice were stable well into adulthood. Effects of genotype on histomorphometric indices of cancellous bone turnover were minimal and evident only transiently during growth, but when present they

  2. Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

    PubMed Central

    Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

    1993-01-01

    The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

  3. Regulation of COL1A1 expression in type I collagen producing tissues: identification of a 49 base pair region which is required for transgene expression in bone of transgenic mice

    NASA Technical Reports Server (NTRS)

    Bedalov, A.; Salvatori, R.; Dodig, M.; Kronenberg, M. S.; Kapural, B.; Bogdanovic, Z.; Kream, B. E.; Woody, C. O.; Clark, S. H.; Mack, K.; hide

    1995-01-01

    Previous deletion studies using a series of COL1A1-CAT fusion genes have indicated that the 625 bp region of the COL1A1 upstream promoter between -2295 and -1670 bp is required for high levels of expression in bone, tendon, and skin of transgenic mice. To further define the important sequences within this region, a new series of deletion constructs extending to -1997, -1794, -1763, and -1719 bp has been analyzed in transgenic mice. Transgene activity, determined by measuring CAT activity in tissue extracts of 6- to 8-day-old transgenic mouse calvariae, remains high for all the new deletion constructs and drops to undetectable levels in calvariae containing the -1670 bp construct. These results indicate that the 49 bp region of the COL1A1 promoter between -1719 and -1670 bp is required for high COL1A1 expression in bone. Although deletion of the same region caused a substantial reduction of promoter activity in tail tendon, the construct extending to -1670 bp is still expressed in this tissue. However, further deletion of the promoter to -944 bp abolished activity in tendon. Gel mobility shift studies identified a protein in calvarial nuclear extracts that is not found in tendon nuclear extracts, which binds within this 49 bp region. Our study has delineated sequences in the COL1A1 promoter required for expression of the COL1A1 gene in high type I collagen-producing tissues, and suggests that different cis elements control expression of the COL1A1 gene in bone and tendon.

  4. High-Efficiency Synthesis of Human α-Endorphin and Magainin in the Erythrocytes of Transgenic Mice: A Production System for Therapeutic Peptides

    NASA Astrophysics Data System (ADS)

    Sharma, Ajay; Khoury-Christianson, Anastasia M.; White, Steven P.; Dhanjal, Nirpal K.; Huang, Wen; Paulhiac, Clara; Friedman, Eric J.; Manjula, Belur N.; Kumar, Ramesh

    1994-09-01

    Chemical synthesis of peptides, though feasible, is hindered by considerations of cost, purity, and efficiency of synthesizing longer chains. Here we describe a transgenic system for producing peptides of therapeutic interest as fusion proteins at low cost and high purity. Transgenic hemoglobin expression technology using the locus control region was employed to produce fusion hemoglobins in the erythrocytes of mice. The fusion hemoglobin contains the desired peptide as an extension at the C end of human α-globin. A protein cleavage site is inserted between the C end of the α-globin chain and the N-terminal residue of the desired peptide. The peptide is recovered after cleavage of the fusion protein with enzymes that recognize this cleavage signal as their substrate. Due to the selective compartmentalization of hemoglobin in the erythrocytes, purification of the fusion hemoglobin is easy and efficient. Because of its compact and highly ordered structure, the internal sites of hemoglobin are resistant to protease digestion and the desired peptide is efficiently released and recovered. The applicability of this approach was established by producing a 16-mer α-endorphin peptide and a 26-mer magainin peptide in transgenic mice. Transgenic animals and their progeny expressing these fusion proteins remain healthy, even when the fusion protein is expressed at >25% of the total hemoglobin in the erythrocytes. Additional applications and potential improvements of this methodology are discussed.

  5. Transgenic carrot expressing fusion protein comprising M. tuberculosis antigens induces immune response in mice.

    PubMed

    Permyakova, Natalia V; Zagorskaya, Alla A; Belavin, Pavel A; Uvarova, Elena A; Nosareva, Olesya V; Nesterov, Andrey E; Novikovskaya, Anna A; Zav'yalov, Evgeniy L; Moshkin, Mikhail P; Deineko, Elena V

    2015-01-01

    Tuberculosis remains one of the major infectious diseases, which continues to pose a major global health problem. Transgenic plants may serve as bioreactors to produce heterologous proteins including antibodies, antigens, and hormones. In the present study, a genetic construct has been designed that comprises the Mycobacterium tuberculosis genes cfp10, esat6 and dIFN gene, which encode deltaferon, a recombinant analog of the human γ-interferon designed for expression in plant tissues. This construct was transferred to the carrot (Daucus carota L.) genome by Agrobacterium-mediated transformation. This study demonstrates that the fusion protein CFP10-ESAT6-dIFN is synthesized in the transgenic carrot storage roots. The protein is able to induce both humoral and cell-mediated immune responses in laboratory animals (mice) when administered either orally or by injection. It should be emphasized that M. tuberculosis antigens contained in the fusion protein have no cytotoxic effect on peripheral blood mononuclear cells.

  6. Age-related changes in core body temperature and activity in triple-transgenic Alzheimer's disease (3xTgAD) mice.

    PubMed

    Knight, Elysse M; Brown, Timothy M; Gümüsgöz, Sarah; Smith, Jennifer C M; Waters, Elizabeth J; Allan, Stuart M; Lawrence, Catherine B

    2013-01-01

    Alzheimer's disease (AD) is characterised, not only by cognitive deficits and neuropathological changes, but also by several non-cognitive behavioural symptoms that can lead to a poorer quality of life. Circadian disturbances in core body temperature and physical activity are reported in AD patients, although the cause and consequences of these changes are unknown. We therefore characterised circadian patterns of body temperature and activity in male triple transgenic AD mice (3xTgAD) and non-transgenic (Non-Tg) control mice by remote radiotelemetry. At 4 months of age, daily temperature rhythms were phase advanced and by 6 months of age an increase in mean core body temperature and amplitude of temperature rhythms were observed in 3xTgAD mice. No differences in daily activity rhythms were seen in 4- to 9-month-old 3xTgAD mice, but by 10 months of age an increase in mean daily activity and the amplitude of activity profiles for 3xTgAD mice were detected. At all ages (4-10 months), 3xTgAD mice exhibited greater food intake compared with Non-Tg mice. The changes in temperature did not appear to be solely due to increased food intake and were not cyclooxygenase dependent because the temperature rise was not abolished by chronic ibuprofen treatment. No β-amyloid (Aβ) plaques or neurofibrillary tangles were noted in the hypothalamus of 3xTgAD mice, a key area involved in temperature regulation, although these pathological features were observed in the hippocampus and amygdala of 3xTgAD mice from 10 months of age. These data demonstrate age-dependent changes in core body temperature and activity in 3xTgAD mice that are present before significant AD-related neuropathology and are analogous to those observed in AD patients. The 3xTgAD mouse might therefore be an appropriate model for studying the underlying mechanisms involved in non-cognitive behavioural changes in AD.

  7. Comprehensive Corticospinal Labeling with mu-crystallin Transgene Reveals Axon Regeneration after Spinal Cord Trauma in ngr1−/− Mice

    PubMed Central

    Fink, Kathren L.

    2015-01-01

    Spinal cord injury interrupts descending motor tracts and creates persistent functional deficits due to the absence of spontaneous axon regeneration. Of descending pathways, the corticospinal tract (CST) is thought to be the most critical for voluntary function in primates. Even with multiple tracer injections and genetic tools, the CST is visualized to only a minor degree in experimental studies. Here, we identify and validate the mu-crystallin (crym) gene as a high-fidelity marker of the CST. In transgenic mice expressing green fluorescent protein (GFP) under crym regulatory elements (crym-GFP), comprehensive and near complete CST labeling is achieved throughout the spinal cord. Bilateral pyramidotomy eliminated the 17,000 GFP-positive CST axons that were reproducibly labeled in brainstem from the spinal cord. We show that CST tracing with crym-GFP is 10-fold more efficient than tracing with biotinylated dextran amine (BDA). Using crym-GFP, we reevaluated the CST in mice lacking nogo receptor 1 (NgR1), a protein implicated in limiting neural repair. The number and trajectory of CST axons in ngr1−/− mice without injury was indistinguishable from ngr1+/+ mice. After dorsal hemisection in the midthoracic cord, CST axons did not significantly regenerate in ngr1+/+ mice, but an average of 162 of the 6000 labeled thoracic CST axons (2.68%) regenerated >100 μm past the lesion site in crym-GFP ngr1−/− mice. Although traditional BDA tracing cannot reliably visualize regenerating ngr1−/− CST axons, their regenerative course is clear with crym-GFP. Therefore the crym-GFP transgenic mouse is a useful tool for studies of CST anatomy in experimental studies of motor pathways. SIGNIFICANCE STATEMENT Axon regeneration fails in the adult CNS, resulting in permanent functional deficits. Traditionally, inefficient extrinsic tracers such a biotinylated dextran amine (BDA) are used to label regenerating fibers after therapeutic intervention. We introduce crym

  8. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice.

    PubMed

    Zhou, Haibo; Liu, Junlai; Zhou, Changyang; Gao, Ni; Rao, Zhiping; Li, He; Hu, Xinde; Li, Changlin; Yao, Xuan; Shen, Xiaowen; Sun, Yidi; Wei, Yu; Liu, Fei; Ying, Wenqin; Zhang, Junming; Tang, Cheng; Zhang, Xu; Xu, Huatai; Shi, Linyu; Cheng, Leping; Huang, Pengyu; Yang, Hui

    2018-03-01

    Despite rapid progresses in the genome-editing field, in vivo simultaneous overexpression of multiple genes remains challenging. We generated a transgenic mouse using an improved dCas9 system that enables simultaneous and precise in vivo transcriptional activation of multiple genes and long noncoding RNAs in the nervous system. As proof of concept, we were able to use targeted activation of endogenous neurogenic genes in these transgenic mice to directly and efficiently convert astrocytes into functional neurons in vivo. This system provides a flexible and rapid screening platform for studying complex gene networks and gain-of-function phenotypes in the mammalian brain.

  9. Inhibitory effect of the peptide epitalon on the development of spontaneous mammary tumors in HER-2/neu transgenic mice.

    PubMed

    Anisimov, Vladimir N; Khavinson, Vladimir K H; Provinciali, Mauro; Alimova, Irina N; Baturin, Dmitri A; Popovich, Irina G; Zabezhinski, Mark A; Imyanitov, Eugeni N; Mancini, Romina; Franceschi, Claudio

    2002-09-01

    Female FVB/N HER-2/neu transgenic mice from the age of 2 months were subcutaneously injected with saline, the peptide Epitalon(R) (Ala-Glu-Asp-Gly) or with the peptide Vilon(R) (Lys-Glu) in a single dose of 1 microg/mouse for 5 consecutive days every month. Epitalon treatment reduced the cumulative number and the maximum size of tumors (p < 0.05). Furthermore, the number of mice bearing 1 mammary tumor was increased, whereas the number of mice bearing 2 or more mammary tumors was reduced in Epitalon-treated in comparison to saline-treated animals (p < 0.05). The size but not the number of lung metastases was reduced in Epitalon-treated compared to saline-treated mice (p < 0.05). The treatment with Vilon produced significant negative effects when compared to the control group, with an increased incidence of mammary cancer development (p < 0.05), a shorter mean latent period of tumors (p < 0.05) and an increased cumulative number of tumors (p < 0.05). A 3.7-fold reduction in the expression of HER-2/neu mRNA was found in mammary tumors from HER-2/neu transgenic mice treated with Epitalon compared to control animals. The expression of mRNA for HER-2/neu was also partially reduced in Vilon-treated mice, but it remained significantly higher in Vilon- than in Epitalon-treated animals (1.9-fold increase). The data demonstrate the inhibitory effect of Epitalon in the development of spontaneous mammary tumors in HER-2/neu mice, suggesting that a downregulation of HER-2/neu gene expression in mammary adenocarcinoma may be responsible, at least in part, for the antitumor effect of the peptide. Copyright 2002 Wiley-Liss, Inc.

  10. A 3,387 bp 5'-flanking sequence of the goat alpha-S1-casein gene provides correct tissue-specific expression of human granulocyte colony-stimulating factor (hG-CSF) in the mammary gland of transgenic mice.

    PubMed

    Serova, Irina A; Dvoryanchikov, Gennady A; Andreeva, Ludmila E; Burkov, Ivan A; Dias, Luciene P B; Battulin, Nariman R; Smirnov, Alexander V; Serov, Oleg L

    2012-06-01

    A new expression vector containing the 1,944 bp 5'-flanking regulatory region together with exon 1 and intron 1 of the goat alpha-S1-casein gene (CSN1S1), the full-sized human granulocyte colony-stimulating factor gene (hGCSF) and the 3'-flanking sequence of the bovine CSN1S1, was created. The vector DNA was used for generation of four mouse transgenic lines. The transgene was integrated into chromosomes 8 and 12 of two founders as 2 and 5 copies, respectively. Tissue-specific secretion of hG-CSF into the milk of transgenic mice was in the range of 19-40 μg/ml. RT-PCR analysis of various tissues of the transgenic mice demonstrated that expression of hGCSF was detected in only the mammary gland in the progeny of all founders. Moreover, cells were shown to be positive for hG-CSF by immunofluorescent analysis in the mammary glands but not in any other tissues. There were no signs of mosaic expression in the mammary gland. Trace amounts of hG-CSF were detected in the serum of females of two transgenic lines during lactation only. However, no transgenic mice showed any changes in hematopoiesis based on the number of granulocytes in blood. Immunoblotting of hG-CSF in the milk of transgenic mice revealed two forms, presumably the glycosylated and non-glycosylated forms. The hematopoietic activity of hG-CSF in the milk of transgenic females is comparable to that of recombinant G-CSF. In general, the data obtained in this study show that the new expression vector is able to provide correct tissue-specific expression of hG-CSF with high biological activity in transgenic mice.

  11. Stable expression of calpain 3 from a muscle transgene in vivo: Immature muscle in transgenic mice suggests a role for calpain 3 in muscle maturation

    PubMed Central

    Spencer, M. J.; Guyon, J. R.; Sorimachi, H.; Potts, A.; Richard, I.; Herasse, M.; Chamberlain, J.; Dalkilic, I.; Kunkel, L. M.; Beckmann, J. S.

    2002-01-01

    Limb-girdle muscular dystrophy, type 2A (LGMD 2A), is an autosomal recessive disorder that causes late-onset muscle-wasting, and is due to mutations in the muscle-specific protease calpain 3 (C3). Although LGMD 2A would be a feasible candidate for gene therapy, the reported instability of C3 in vitro raised questions about the potential of obtaining a stable, high-level expression of C3 from a transgene in vivo. We have generated transgenic (Tg) mice with muscle-specific overexpression of full-length C3 or C3 isoforms, which arise from alternative splicing, to test whether stable expression of C3 transgenes could occur in vivo. Unexpectedly, we found that full-length C3 can be overexpressed at high levels in vivo, without toxicity. In addition, we found that Tg expressing C3 lacking exon 6, an isoform expressed embryonically, have muscles that resemble regenerating or developing muscle. Tg expressing C3 lacking exon 15 shared this morphology in the soleus, but not other muscles. Assays of inflammation or muscle membrane damage indicated that the Tg muscles were not degenerative, suggesting that the immature muscle resulted from a developmental block rather than degeneration and regeneration. These studies show that C3 can be expressed stably in vivo from a transgene, and indicate that alternatively spliced C3 isoforms should not be used in gene-therapy applications because they impair proper muscle development. PMID:12084932

  12. Abeta42-driven cerebral amyloidosis in transgenic mice reveals early and robust pathology.

    PubMed

    Radde, Rebecca; Bolmont, Tristan; Kaeser, Stephan A; Coomaraswamy, Janaky; Lindau, Dennis; Stoltze, Lars; Calhoun, Michael E; Jäggi, Fabienne; Wolburg, Hartwig; Gengler, Simon; Haass, Christian; Ghetti, Bernardino; Czech, Christian; Hölscher, Christian; Mathews, Paul M; Jucker, Mathias

    2006-09-01

    We have generated a novel transgenic mouse model on a C57BL/6J genetic background that coexpresses KM670/671NL mutated amyloid precursor protein and L166P mutated presenilin 1 under the control of a neuron-specific Thy1 promoter element (APPPS1 mice). Cerebral amyloidosis starts at 6-8 weeks and the ratio of human amyloid (A)beta42 to Abeta40 is 1.5 and 5 in pre-depositing and amyloid-depositing mice, respectively. Consistent with this ratio, extensive congophilic parenchymal amyloid but minimal amyloid angiopathy is observed. Amyloid-associated pathologies include dystrophic synaptic boutons, hyperphosphorylated tau-positive neuritic structures and robust gliosis, with neocortical microglia number increasing threefold from 1 to 8 months of age. Global neocortical neuron loss is not apparent up to 8 months of age, but local neuron loss in the dentate gyrus is observed. Because of the early onset of amyloid lesions, the defined genetic background of the model and the facile breeding characteristics, APPPS1 mice are well suited for studying therapeutic strategies and the pathomechanism of amyloidosis by cross-breeding to other genetically engineered mouse models.

  13. Aβ42-driven cerebral amyloidosis in transgenic mice reveals early and robust pathology

    PubMed Central

    Radde, Rebecca; Bolmont, Tristan; Kaeser, Stephan A; Coomaraswamy, Janaky; Lindau, Dennis; Stoltze, Lars; Calhoun, Michael E; Jäggi, Fabienne; Wolburg, Hartwig; Gengler, Simon; Haass, Christian; Ghetti, Bernardino; Czech, Christian; Hölscher, Christian; Mathews, Paul M; Jucker, Mathias

    2006-01-01

    We have generated a novel transgenic mouse model on a C57BL/6J genetic background that coexpresses KM670/671NL mutated amyloid precursor protein and L166P mutated presenilin 1 under the control of a neuron-specific Thy1 promoter element (APPPS1 mice). Cerebral amyloidosis starts at 6–8 weeks and the ratio of human amyloid (A)β42 to Aβ40 is 1.5 and 5 in pre-depositing and amyloid-depositing mice, respectively. Consistent with this ratio, extensive congophilic parenchymal amyloid but minimal amyloid angiopathy is observed. Amyloid-associated pathologies include dystrophic synaptic boutons, hyperphosphorylated tau-positive neuritic structures and robust gliosis, with neocortical microglia number increasing threefold from 1 to 8 months of age. Global neocortical neuron loss is not apparent up to 8 months of age, but local neuron loss in the dentate gyrus is observed. Because of the early onset of amyloid lesions, the defined genetic background of the model and the facile breeding characteristics, APPPS1 mice are well suited for studying therapeutic strategies and the pathomechanism of amyloidosis by cross-breeding to other genetically engineered mouse models. PMID:16906128

  14. A Co-Receptor Independent Transgenic Human TCR Mediates Anti-Tumor and Anti-Self Immunity in Mice

    PubMed Central

    Mehrotra, Shikhar; Al-Khami, Amir A.; Klarquist, Jared; Husain, Shahid; Naga, Osama; Eby, Jonathan M.; Murali, Anuradha K.; Lyons, Gretchen E.; Li, Mingli; Spivey, Natali D.; Norell, Håkan; Martins da Palma, Telma; Onicescu, Georgiana; Diaz-Montero, C. Marcela; Garrett-Mayer, Elizabeth; Cole, David J.; Le Poole, I. Caroline; Nishimura, Michael I.

    2013-01-01

    Recent advancements in T cell immunotherapy suggest that T cells engineered with high affinity T cell receptors (TCR) can offer better tumor regression. However, whether a high affinity TCR alone is sufficient to control tumor growth, or the T cell subset bearing the TCR is also important remains unclear. Using the human tyrosinase epitope reactive, CD8 independent, high affinity TCR isolated from MHC class-I restricted CD4+ T cells obtained from tumor infiltrating lymphocytes of a metastatic melanoma patient, we developed a novel TCR transgenic mouse with a C57BL/6 background. This HLA-A2 restricted TCR was positively selected on both CD4+ and CD8+ single-positive (SP) cells. However, when the TCR transgenic mouse was developed with an HLA-A2 background, the transgenic TCR was primarily expressed by CD3+CD4-CD8- double-negative (DN) T cells. TIL 1383I TCR transgenic CD4+, CD8+ and CD4-CD8- T cells were functional and retained the ability to control tumor growth without the need for vaccination or cytokine support in vivo. Furthermore, the HLA-A2+/human tyrosinase TCR double transgenic mice developed spontaneous hair depigmentation and had visual defects that progressed with age. Our data show that the expression of the high affinity TIL 1383I TCR alone in CD3+ T cells is sufficient to control the growth of murine and human melanoma and the presence or absence of CD4 and CD8 co-receptors had little effect on its functional capacity. PMID:22798675

  15. Antibody-induced albuminuria and accelerated focal glomerulosclerosis in the Thy-1.1 transgenic mouse.

    PubMed

    Assmann, Karel J M; van Son, Jacco P H F; Dïjkman, Henry B P M; Mentzel, Stef; Wetzels, Jack F M

    2002-07-01

    Podocytes play an important role in the development of proteinuria and focal glomerulosclerosis. Previously we have demonstrated that a combination of two monoclonal antibodies (mAb) against aminopeptidase A (APA), an enzyme present on podocytes, induces a massive acute albuminuria in mice. The present study examined the relationship between the acute antibody-induced albuminuria and the development of focal glomerulosclerosis in the Thy-1.1 transgenic mouse. This mouse expresses a hybrid human-mouse Thy-1.1 antigen on the podocytes, and slowly but spontaneously develops albuminuria and focal glomerulosclerosis. Five-week-old non-albuminuric Thy-1.1 transgenic and non-transgenic control mice were injected with anti-APA and anti-Thy-1.1 mAb or saline. Albuminuria was measured at days 1, 7, 14 and 21. At day 21 kidneys were processed for light microscopy, immunofluorescence, and electron microscopy. Injection of anti-APA and anti-Thy1.1 mAb in Thy-1.1 transgenic mice induced an albuminuria at day 1 that persisted at day 21. The acute albuminuria after injection of anti-APA mAb was more prominent but transient in non-transgenic mice. In non-trangenic mice no albuminuria could be induced with anti-Thy 1.1 mAb. Light microscopy revealed normal glomeruli at day 1 in all transgenic mice, however, at day 21 advanced glomerulosclerotic lesions were seen in mice injected with either anti-APA mAb (37+/-19% of glomeruli affected) or anti-Thy-1.1 mAb (71+/-5%). Non-transgenic mice did not reveal sclerotic lesions at any time investigated. In the transgenic mice the percentage of focal glomerulosclerosis at day 21 did not correlate with albuminuria at day 21. However, we found a highly significant correlation between percentage of focal glomerulosclerosis and the time-averaged albuminuria over the three-week study period (P < 0.001). Injection of a combination of anti-APA or anti-Thy-1.1 mAb into one mo old, non-albuminuric Thy-1.1 transgenic mice induces an acute albuminuria at

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, S.D.; Cooper, P.; Fung, J.

    Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

  17. Genetically Augmenting Aβ42 Levels in Skeletal Muscle Exacerbates Inclusion Body Myositis-Like Pathology and Motor Deficits in Transgenic Mice

    PubMed Central

    Kitazawa, Masashi; Green, Kim N.; Caccamo, Antonella; LaFerla, Frank M.

    2006-01-01

    The pathogenic basis of inclusion body myositis (IBM), the leading muscle degenerative disease afflicting the elderly, is unknown, although the histopathological features are remarkably similar to those observed in Alzheimer’s disease. One leading hypothesis is that the buildup of amyloid-β (Aβ) peptide within selective skeletal muscle fibers contributes to the degenerative phenotype. Aβ is a small peptide derived via endoproteolysis of the amyloid precursor protein (APP). To determine the pathogenic effect of augmenting Aβ42 levels in skeletal muscle, we used a genetic approach to replace the endogenous wild-type presenilin-1 (PS1) allele with the PS1M146V allele in MCK-APP mice. Although APP transgene expression was unaltered, Aβ levels, particularly Aβ42, were elevated in skeletal muscle of the double transgenic (MCK-APP/PS1) mice compared to the parental MCK-APP line. Elevated phospho-tau accumulation was found in the MCK-APP/PS1 mice, and the greater activation of GSK-3β and cdk5 were observed. Other IBM-like pathological features, such as inclusion bodies and inflammatory infiltrates, were more severe and prominent in the MCK-APP/PS1 mice. Motor coordination and balance were more adversely affected and manifested at an earlier age in the MCK-APP/PS1 mice. The data presented here provide experimental evidence that Aβ42 plays a proximal and critical role in the muscle degenerative process. PMID:16723713

  18. Enlargement of interscapular brown adipose tissue in growth hormone antagonist transgenic and in growth hormone receptor gene-disrupted dwarf mice.

    PubMed

    Li, Yuesheng; Knapp, Joanne R; Kopchick, John J

    2003-02-01

    Growth hormone (GH) acts on adipose tissue by accelerating fat expenditure, preventing triglyceride accumulation, and facilitating lipid mobilization. To investigate whether GH is involved in the development and metabolism of interscapular brown adipose tissue (BAT), a site of nonshivering thermogenesis, we employed three lines of transgenic mice. Two of the lines are dwarf due to expression of a GH antagonist (GHA) or disruption of the GH receptor/binding-protein gene. A third mouse line is giant due to overexpression of a bovine GH (bGH) transgene. We have found that the body weights of those animals are proportional to their body lengths at 10 weeks of age. However, GHA dwarf mice tend to catch up with the nontransgenic (NT) littermates in body weight but not in body length at 52 weeks of age. The increase of body mass index (BMI) for GHA mice accelerates rapidly relative to controls as a function of age. We have also observed that BAT in both dwarf mouse lines but not in giant mice is enlarged in contrast to nontransgenic littermates. This enlargement occurs as a function of age. Northern analysis suggests that BAT can be a GH-responsive tissue because GHR/BP mRNAs were found there. Finally, the level of uncoupling protein-1 (UCP1) RNA was found to be higher in dwarf mice and lower in giant animals relative to controls, suggesting that GH-mediated signaling may negatively regulate UCP1 gene expression in BAT.

  19. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to expressmore » diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.« less

  20. Centrosomal Nlp is an oncogenic protein that is gene-amplified in human tumors and causes spontaneous tumorigenesis in transgenic mice.

    PubMed

    Shao, Shujuan; Liu, Rong; Wang, Yang; Song, Yongmei; Zuo, Lihui; Xue, Liyan; Lu, Ning; Hou, Ning; Wang, Mingrong; Yang, Xiao; Zhan, Qimin

    2010-02-01

    Disruption of mitotic events contributes greatly to genomic instability and results in mutator phenotypes. Indeed, abnormalities of mitotic components are closely associated with malignant transformation and tumorigenesis. Here we show that ninein-like protein (Nlp), a recently identified BRCA1-associated centrosomal protein involved in microtubule nucleation and spindle formation, is an oncogenic protein. Nlp was found to be overexpressed in approximately 80% of human breast and lung carcinomas analyzed. In human lung cancers, this deregulated expression was associated with NLP gene amplification. Further analysis revealed that Nlp exhibited strong oncogenic properties; for example, it conferred to NIH3T3 rodent fibroblasts the capacity for anchorage-independent growth in vitro and tumor formation in nude mice. Consistent with these data, transgenic mice overexpressing Nlp displayed spontaneous tumorigenesis in the breast, ovary, and testicle within 60 weeks. In addition, Nlp overexpression induced more rapid onset of radiation-induced lymphoma. Furthermore, mouse embryonic fibroblasts (MEFs) derived from Nlp transgenic mice showed centrosome amplification, suggesting that Nlp overexpression mimics BRCA1 loss. These findings demonstrate that Nlp abnormalities may contribute to genomic instability and tumorigenesis and suggest that Nlp might serve as a potential biomarker for clinical diagnosis and therapeutic target.

  1. Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

    PubMed Central

    Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

    2008-01-01

    Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

  2. Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

    PubMed

    Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

    2008-05-01

    Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

  3. Cardioprotective effects of 70-kDa heat shock protein in transgenic mice.

    PubMed Central

    Radford, N B; Fina, M; Benjamin, I J; Moreadith, R W; Graves, K H; Zhao, P; Gavva, S; Wiethoff, A; Sherry, A D; Malloy, C R; Williams, R S

    1996-01-01

    Heat shock proteins are proposed to limit injury resulting from diverse environmental stresses, but direct metabolic evidence for such a cytoprotective function in vertebrates has been largely limited to studies of cultured cells. We generated lines of transgenic mice to express human 70-kDa heat shock protein constitutively in the myocardium. Hearts isolated from these animals demonstrated enhanced recovery of high energy phosphate stores and correction of metabolic acidosis following brief periods of global ischemia sufficient to induce sustained abnormalities of these variables in hearts from nontransgenic littermates. These data demonstrate a direct cardioprotective effect of 70-kDa heat shock protein to enhance postischemic recovery of the intact heart. Images Fig. 1 Fig. 3 PMID:8637874

  4. Expression of a partially deleted gene of human type II procollagen (COL2A1) in transgenic mice produces a chondrodysplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vandenberg, P.; Khillan, J.S.; Prockop, D.J.

    A minigene version of the human gene for type II procollagen (COL2AI) was prepared that lacked a large central region containing 12 of the 52 exons and therefore 291 of the 1523 codons of the gene. The construct was modeled after sporadic in-frame deletions of collagen genes that cause synthesis of shortened pro{alpha} chains that associate with normal pro{alpha} chains and thereby cause degradation of the shortened and normal pro{alpha} chains through a process called procollagen suicide. The gene construct was used to prepare five lines of transgenic mice expressing the minigene. A large proportion of the mice expressing themore » minigene developed a phenotype of a chondrodysplasia with dwarfism, short and thick limbs, a short snout, a cranial bulge, a cleft palate, and delayed mineralization of bone. A number of mice died shortly after birth. Microscopic examination of cartilage revealed decreased density and organization of collagen fibrils. In cultured chondrocytes from the transgenic mice, the minigene was expressed as shortened pro{alpha}1(II) chains that were disulfide-linked to normal mouse pro{alpha}1(II) chains. Therefore, the phenotype is probably explained by depletion of the endogenous mouse type II procollagen through the phenomenon of procollagen suicide.« less

  5. A heterologous hormone response element enhances expression of rat beta-casein promoter-driven chloramphenicol acetyltransferase fusion genes in the mammary gland of transgenic mice.

    PubMed

    Greenberg, N M; Reding, T V; Duffy, T; Rosen, J M

    1991-10-01

    Previous studies have demonstrated that the entire rat beta-casein (R beta C) gene and a -524/+490 R beta C fragment-chloramphenicol acetyltransferase (CAT) fusion gene are expressed preferentially in the mammary gland of transgenic mice in a developmentally regulated fashion. However, transgene expression was infrequent, less than 1% of that observed for the endogenous gene, and varied as much as 500-fold, presumably due to the site of chromosomal integration. To determine whether a heterologous hormone-responsive enhancer could be used to increase both the level and frequency of expression in the mammary gland, a fragment derived from the mouse mammary tumor virus long terminal repeat containing four hormone response elements (HREs) was inserted into the R beta C promoter at a site not known to contain transcriptional regulatory elements. Transgenic mice generated which carried HRE-enhanced R beta C-CAT fusion genes expressed CAT activity in the mammary glands of all founder lines examined at levels that were on average 13-fold greater than for lines generated with similar constructs not carrying HREs. In the highest expressing line, the level of HRE-enhanced transgene expression was found to be developmentally regulated, increasing 14-fold in the mammary gland from virgin to day 10 of lactation. In this line, expression was also observed in the thymus and spleen; however, the level of CAT activity was 4-fold lower than in the mammary gland and was not developmentally regulated. In adrenalectomized mice, the administration of dexamethasone stimulated CAT expression in the mammary gland but not in the thymus and spleen. These studies demonstrate that in the context of the R beta C promoter, the HRE functions in the mammary gland to increase both the frequency and level of transgene expression.

  6. Chronic cannabidiol treatment improves social and object recognition in double transgenic APPswe/PS1∆E9 mice.

    PubMed

    Cheng, David; Low, Jac Kee; Logge, Warren; Garner, Brett; Karl, Tim

    2014-08-01

    Patients suffering from Alzheimer's disease (AD) exhibit a decline in cognitive abilities including an inability to recognise familiar faces. Hallmark pathological changes in AD include the aggregation of amyloid-β (Aβ), tau protein hyperphosphorylation as well as pronounced neurodegeneration, neuroinflammation, neurotoxicity and oxidative damage. The non-psychoactive phytocannabinoid cannabidiol (CBD) exerts neuroprotective, anti-oxidant and anti-inflammatory effects and promotes neurogenesis. CBD also reverses Aβ-induced spatial memory deficits in rodents. Thus we determined the therapeutic-like effects of chronic CBD treatment (20 mg/kg, daily intraperitoneal injections for 3 weeks) on the APPswe/PS1∆E9 (APPxPS1) transgenic mouse model for AD in a number of cognitive tests, including the social preference test, the novel object recognition task and the fear conditioning paradigm. We also analysed the impact of CBD on anxiety behaviours in the elevated plus maze. Vehicle-treated APPxPS1 mice demonstrated impairments in social recognition and novel object recognition compared to wild type-like mice. Chronic CBD treatment reversed these cognitive deficits in APPxPS1 mice without affecting anxiety-related behaviours. This is the first study to investigate the effect of chronic CBD treatment on cognition in an AD transgenic mouse model. Our findings suggest that CBD may have therapeutic potential for specific cognitive impairments associated with AD.

  7. Tumorigenic potential of pituitary tumor transforming gene (PTTG) in vivo investigated using a transgenic mouse model, and effects of cross breeding with p53 (+/-) transgenic mice.

    PubMed

    Fong, Miranda Y; Farghaly, Hanan; Kakar, Sham S

    2012-11-20

    Pituitary tumor-transforming gene (PTTG) is an oncogene that is overexpressed in variety of tumors and exhibits characteristics of a transforming gene. Previous transgenic mouse models to access the tumorigenic potential in the pituitary and ovary have resulted in dysplasia without formation of visible tumors, possibly due to the insufficient expression of PTTG. PTTG expression level is critical for ovarian tumorigenesis in a xenograft model. Therefore, the tumorigenic function of PTTG in vivo remains unclear. We generated a transgenic mouse that overexpresses PTTG driven by the CMV promoter to determine whether PTTG functions as a transforming oncogene that is capable of initiating tumorigenesis. Transgenic animals were generated by microinjection of PTTG transgene into the male pronucleus of FVB 0.5 day old embryos. Expression levels of PTTG in tissues of transgenic animals were analyzed using an immunohistochemical analysis. H&E staining and immunohistostaining were performed to examine the type of tumor in transgenic and PTTG transgenic/p53+/- animals. PTTG transgenic offspring (TgPTTG) were monitored for tumor development at various ages. H&E analysis was performed to identify the presence of cancer and hyperplastic conditions verified with the proliferation marker PCNA and the microvessel marker CD31. Immunohistochemistry was performed to determine transgene expression, revealing localization to the epithelium of the fallopian tube, with more generalized expression in the liver, lung, kidney, and spleen. At eight months of age, 2 out of 15 TgPTTG developed ovarian cancer, 2 out of 15 developed benign tumors, 2 out of 15 developed cervical dysplasia, and 3 out of 15 developed adenomyosis of the uterus. At ten months of age, 2 out of 10 TgPTTG developed adenocarcinoma of the ovary, 1 out of 10 developed a papillary serous adenocarcinoma, and 2 out of 10 presented with atypia of ovarian epithelial cells. Tumorigenesis is a multi-step process, often requiring

  8. Age-related changes in core body temperature and activity in triple-transgenic Alzheimer’s disease (3xTgAD) mice

    PubMed Central

    Knight, Elysse M.; Brown, Timothy M.; Gümüsgöz, Sarah; Smith, Jennifer C. M.; Waters, Elizabeth J.; Allan, Stuart M.; Lawrence, Catherine B.

    2013-01-01

    SUMMARY Alzheimer’s disease (AD) is characterised, not only by cognitive deficits and neuropathological changes, but also by several non-cognitive behavioural symptoms that can lead to a poorer quality of life. Circadian disturbances in core body temperature and physical activity are reported in AD patients, although the cause and consequences of these changes are unknown. We therefore characterised circadian patterns of body temperature and activity in male triple transgenic AD mice (3xTgAD) and non-transgenic (Non-Tg) control mice by remote radiotelemetry. At 4 months of age, daily temperature rhythms were phase advanced and by 6 months of age an increase in mean core body temperature and amplitude of temperature rhythms were observed in 3xTgAD mice. No differences in daily activity rhythms were seen in 4- to 9-month-old 3xTgAD mice, but by 10 months of age an increase in mean daily activity and the amplitude of activity profiles for 3xTgAD mice were detected. At all ages (4–10 months), 3xTgAD mice exhibited greater food intake compared with Non-Tg mice. The changes in temperature did not appear to be solely due to increased food intake and were not cyclooxygenase dependent because the temperature rise was not abolished by chronic ibuprofen treatment. No β-amyloid (Aβ) plaques or neurofibrillary tangles were noted in the hypothalamus of 3xTgAD mice, a key area involved in temperature regulation, although these pathological features were observed in the hippocampus and amygdala of 3xTgAD mice from 10 months of age. These data demonstrate age-dependent changes in core body temperature and activity in 3xTgAD mice that are present before significant AD-related neuropathology and are analogous to those observed in AD patients. The 3xTgAD mouse might therefore be an appropriate model for studying the underlying mechanisms involved in non-cognitive behavioural changes in AD. PMID:22864021

  9. Nuclear microscopy of diffuse plaques in the brains of transgenic mice

    NASA Astrophysics Data System (ADS)

    Rajendran, Reshmi; Ren, Minqin; Casadesus, Gemma; Smith, Mark A.; Perry, George; Huang, En; Ong, Wei Yi; Halliwell, Barry; Watt, Frank

    2005-04-01

    Using nuclear microscopy, extracellular diffuse amyloid deposits in fresh unstained brain tissue from Alzheimer's disease transgenic mice Tg2576 have been identified and analyzed for trace element content. Off-axis scanning transmission ion microscopy (STIM) images can be obtained which are similar to the images produced using direct STIM. Since the proton beam current required for off-axis STIM is compatible with PIXE and RBS, we can identify the plaque location and analyze for trace elements simultaneously. Analysis of the diffuse plaques showed an increase in the transition metals iron and zinc compared with the surrounding area of comparable areal density. This supports the theory that redox interactions between Aβ and metals could be at the heart of a pathological feedback system wherein Aβ amyloidosis and oxidative stress promote each other, possibly via Fenton chemistry.

  10. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    PubMed

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  11. Defective renal water handling in transgenic mice over-expressing human CD39/NTPDase1

    PubMed Central

    Zhang, Yue; Morris, Kaiya L.; Sparrow, Shannon K.; Dwyer, Karen M.; Enjyoji, Keiichi; Robson, Simon C.

    2012-01-01

    Ectonucleoside triphosphate diphosphohydrolase-1 hydrolyzes extracellular ATP and ADP to AMP. Previously, we showed that CD39 is expressed at several sites within the kidney and thus may impact the availability of type 2 purinergic receptor (P2-R) ligands. Because P2-Rs appear to regulate urinary concentrating ability, we have evaluated renal water handling in transgenic mice (TG) globally overexpressing hCD39. Under basal conditions, TG mice exhibited significantly impaired urinary concentration and decreased protein abundance of AQP2 in the kidney compared with wild-type (WT) mice. Urinary excretion of total nitrates/nitrites was significantly higher in TG mice, but the excretion of AVP or PGE2 was equivalent to control WT mice. There were no significant differences in electrolyte-free water clearance or fractional excretion of sodium. Under stable hydrated conditions (gelled diet feeding), the differences between the WT and TG mice were negated, but the decrease in urine osmolality persisted. When water deprived, TG mice failed to adequately concentrate urine and exhibited impaired AVP responses. However, the increases in urinary osmolalities in response to subacute dDAVP or chronic AVP treatment were similar in TG and WT mice. These observations suggest that TG mice have impaired urinary concentrating ability despite normal AVP levels. We also note impaired AVP release in response to water deprivation but that TG kidneys are responsive to exogenous dDAVP or AVP. We infer that heightened nucleotide scavenging by increased levels of CD39 altered the release of endogenous AVP in response to dehydration. We propose that ectonucleotidases and modulated purinergic signaling impact urinary concentration and indicate potential utility of targeted therapy for the treatment of water balance disorders. PMID:22622462

  12. An Efficient and Versatile System for Visualization and Genetic Modification of Dopaminergic Neurons in Transgenic Mice

    PubMed Central

    Kramer, Edgar R.

    2015-01-01

    Background & Aims The brain dopaminergic (DA) system is involved in fine tuning many behaviors and several human diseases are associated with pathological alterations of the DA system such as Parkinson’s disease (PD) and drug addiction. Because of its complex network integration, detailed analyses of physiological and pathophysiological conditions are only possible in a whole organism with a sophisticated tool box for visualization and functional modification. Methods & Results Here, we have generated transgenic mice expressing the tetracycline-regulated transactivator (tTA) or the reverse tetracycline-regulated transactivator (rtTA) under control of the tyrosine hydroxylase (TH) promoter, TH-tTA (tet-OFF) and TH-rtTA (tet-ON) mice, to visualize and genetically modify DA neurons. We show their tight regulation and efficient use to overexpress proteins under the control of tet-responsive elements or to delete genes of interest with tet-responsive Cre. In combination with mice encoding tet-responsive luciferase, we visualized the DA system in living mice progressively over time. Conclusion These experiments establish TH-tTA and TH-rtTA mice as a powerful tool to generate and monitor mouse models for DA system diseases. PMID:26291828

  13. The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

    PubMed Central

    Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

    1994-01-01

    The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

  14. Anthrax Lethal Factor as an Immune Target in Humans and Transgenic Mice and the Impact of HLA Polymorphism on CD4+ T Cell Immunity

    PubMed Central

    Ascough, Stephanie; Ingram, Rebecca J.; Chu, Karen K.; Reynolds, Catherine J.; Musson, Julie A.; Doganay, Mehmet; Metan, Gökhan; Ozkul, Yusuf; Baillie, Les; Sriskandan, Shiranee; Moore, Stephen J.; Gallagher, Theresa B.; Dyson, Hugh; Williamson, E. Diane; Robinson, John H.; Maillere, Bernard; Boyton, Rosemary J.; Altmann, Daniel M.

    2014-01-01

    Bacillus anthracis produces a binary toxin composed of protective antigen (PA) and one of two subunits, lethal factor (LF) or edema factor (EF). Most studies have concentrated on induction of toxin-specific antibodies as the correlate of protective immunity, in contrast to which understanding of cellular immunity to these toxins and its impact on infection is limited. We characterized CD4+ T cell immunity to LF in a panel of humanized HLA-DR and DQ transgenic mice and in naturally exposed patients. As the variation in antigen presentation governed by HLA polymorphism has a major impact on protective immunity to specific epitopes, we examined relative binding affinities of LF peptides to purified HLA class II molecules, identifying those regions likely to be of broad applicability to human immune studies through their ability to bind multiple alleles. Transgenics differing only in their expression of human HLA class II alleles showed a marked hierarchy of immunity to LF. Immunogenicity in HLA transgenics was primarily restricted to epitopes from domains II and IV of LF and promiscuous, dominant epitopes, common to all HLA types, were identified in domain II. The relevance of this model was further demonstrated by the fact that a number of the immunodominant epitopes identified in mice were recognized by T cells from humans previously infected with cutaneous anthrax and from vaccinated individuals. The ability of the identified epitopes to confer protective immunity was demonstrated by lethal anthrax challenge of HLA transgenic mice immunized with a peptide subunit vaccine comprising the immunodominant epitopes that we identified. PMID:24788397

  15. Alternations of central insulin-like growth factor-1 sensitivity in APP/PS1 transgenic mice and neuronal models.

    PubMed

    Zhang, Bing; Tang, Xi Can; Zhang, Hai Yan

    2013-05-01

    Although many post-mortem studies have found evidence of central insulin resistance in Alzheimer's disease (AD) patients, results on changes of central insulin-like growth factor-1 (IGF-1) signaling in the pathological process of AD remain controversial. In the present study, we observed the activation states of IGF-1 downstream signaling in brain slices of transgenic mice carrying APPswe/PS1dE9 mutations (APP/PS1 mice) at both early and late stages (ex vivo) and further investigated the involvement of oligomeric β-amyloid (Aβ) and Aβ-enriched culture medium (CM) on IGF-1 sensitivity employing neuronal models (in vitro). In 6- and 18-month-old APP/PS1 mice, the phosphorylations of IGF-1 receptor (IGF-1R) and Akt in response to IGF-1 stimulation were significantly reduced in the hippocampal and cortical slices, whereas IGF-1R protein expression and mRNA levels of IGF-1 and IGF-1R in the hippocampal slices were significantly higher than that in wild-type mice. In agreement with these results, reduced IGF-1 sensitivity was verified in APP and PS1 double stably transfected CHO cells; moreover, IGF-1 stimulated phosphorylations of IGF-1R and Akt were also markedly weakened by oligomeric Aβ or Aβ-enriched CM posttreatment in CHO cells without APP/PS1-transfected (K1 cells) and primary hippocampal neurons. These observations indicate that the impaired central IGF-1 sensitivity at early and late stages of APP/PS1 transgenic mice might be attributable, at least partially, to the overproduced Aβ, especially the oligomeric Aβ. These findings may shed new light on the mechanisms underlying the defective IGF-1 signaling in AD pathogenesis and provide important clues for AD drug discovery. Copyright © 2013 Wiley Periodicals, Inc.

  16. Morphofunctional changes underlying intestinal dysmotility in diabetic RIP-I/hIFNβ transgenic mice

    PubMed Central

    Domènech, Anna; Pasquinelli, Gianandrea; De Giorgio, Roberto; Gori, Alessandra; Bosch, Fàtima; Pumarola, Martí; Jiménez, Marcel

    2011-01-01

    The pathogenetic mechanisms underlying gastrointestinal dysmotility in diabetic patients remain poorly understood, although enteric neuropathy, damage to interstitial cells of Cajal (ICC) and smooth muscle cell injury are believed to play a role. The aim of this study was to investigate the morphological and functional changes underlying intestinal dysmotility in RIP-I/hIFNβ transgenic mice treated with multiple very low doses of streptozotocin (20 mg/kg, i.p., 5 days). Compared with vehicle-treated mice, streptozotocin-treated animals developed type 1 diabetes mellitus, with sustained hyperglycaemia for 3.5 months, polyphagia, polydipsia and increased faecal output without changes in faecal water content (metabolic cages). Diabetic mice had a longer intestine, longer ileal villi and wider colonic crypts (conventional microscopy) and displayed faster gastric emptying and intestinal transit. Contractility studies showed selective impaired neurotransmission in the ileum and mid-colon of diabetic mice. Compared with controls, the ileal and colonic myenteric plexus of diabetic mice revealed ultrastructural features of neuronal degeneration and HuD immunohistochemistry on whole-mount preparations showed 15% reduction in neuronal numbers. However, no immunohistochemical changes in apoptosis-related markers were noted. Lower absolute numbers of neuronal nitric oxide synthase- and choline acetyltransferase-immunopositive neurons and enhanced vasoactive intestinal polypeptide and substance P immunopositivity were observed. Ultrastructural and immunohistochemical analyses did not reveal changes in the enteric glial or ICC networks. In conclusion, this model of diabetic enteropathy shows enhanced intestinal transit associated with intestinal remodelling, including neuroplastic changes, and overt myenteric neuropathy. Such abnormalities are likely to reflect neuroadaptive and neuropathological changes occurring in this diabetic model. PMID:22050417

  17. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine and cervid prion protein

    USDA-ARS?s Scientific Manuscript database

    Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...

  18. Combined riluzole and sodium phenylbutyrate therapy in transgenic amyotrophic lateral sclerosis mice.

    PubMed

    Del Signore, Steven J; Amante, Daniel J; Kim, Jinho; Stack, Edward C; Goodrich, Sarah; Cormier, Kerry; Smith, Karen; Cudkowicz, Merit E; Ferrante, Robert J

    2009-04-01

    Recent evidence suggests that transcriptional dysregulation may play a role in the pathogenesis of amyotrophic lateral sclerosis (ALS). The histone deacetylase inhibitor, sodium phenylbutyrate (NaPB), is neuroprotective and corrects aberrant gene transcription in ALS mice and has recently been shown to be safe and tolerable in ALS patients while improving hypoacetylation. Since many patients are already on riluzole, it is important to ensure that any proposed therapy does not result in negative synergy with riluzole. The combined treatment of riluzole and NaPB significantly extended survival and improved both the clinical and neuropathological phenotypes in G93A transgenic ALS mice beyond either agent alone. Combination therapy increased survival by 21.5%, compared to the separate administration of riluzole (7.5%) and NaPB (12.8%), while improving both body weight loss and grip strength. The data show that the combined treatment was synergistic. In addition, riluzole/NaPB treatment ameliorated gross lumbar and ventral horn atrophy, attenuated lumbar ventral horn neuronal cell death, and decreased reactive astrogliosis. Riluzole/NaPB administration increased acetylation at H4 and increased NF-kappaB p50 translocation to the nucleus in G93A mice, consistent with a therapeutic effect. These data suggest that NaPB may not interfere with the pharmacologic action of riluzole in ALS patients.

  19. Utilizing GCaMP transgenic mice to monitor endogenous Gq/11-coupled receptors

    PubMed Central

    Partridge, John G.

    2015-01-01

    The family of GCaMPs are engineered proteins that contain Ca2+ binding motifs within a circularly permutated variant of the Aequorea Victoria green fluorescent protein (cp-GFP). The rapidly advancing field of utilizing GCaMP reporter constructs represents a major step forward in our ability to monitor intracellular Ca2+ dynamics. With the use of these genetically encoded Ca2+ sensors, investigators have studied activation of endogenous Gq types of G protein-coupled receptors (GPCRs) and subsequent rises in intracellular calcium. Escalations in intracellular Ca2+ from GPCR activation can be faithfully monitored in space and time as an increase in fluorescent emission from these proteins. Further, transgenic mice are now commercially available that express GCaMPs in a Cre recombinase dependent fashion. These GCaMP reporter mice can be bred to distinct Cre recombinase driver mice to direct expression of this sensor in unique populations of cells. Concerning the central nervous system (CNS), sources of calcium influx, including those arising from Gq activation can be observed in targeted cell types like neurons or astrocytes. This powerful genetic method allows simultaneous monitoring of the activity of dozens of cells upon activation of endogenous Gq-coupled GPCRs. Therefore, in combination with pharmacological tools, this strategy of monitoring GPCR activation is amenable to analysis of orthosteric and allosteric ligands of Gq-coupled receptors in their endogenous environments. PMID:25805995

  20. Identification of NY-BR-1-specific CD4(+) T cell epitopes using HLA-transgenic mice.

    PubMed

    Gardyan, Adriane; Osen, Wolfram; Zörnig, Inka; Podola, Lilli; Agarwal, Maria; Aulmann, Sebastian; Ruggiero, Eliana; Schmidt, Manfred; Halama, Niels; Leuchs, Barbara; von Kalle, Christof; Beckhove, Philipp; Schneeweiss, Andreas; Jäger, Dirk; Eichmüller, Stefan B

    2015-06-01

    Breast cancer represents the second most common cancer type worldwide and has remained the leading cause of cancer-related deaths among women. The differentiation antigen NY-BR-1 appears overexpressed in invasive mammary carcinomas compared to healthy breast tissue, thus representing a promising target antigen for T cell based tumor immunotherapy approaches. Since efficient immune attack of tumors depends on the activity of tumor antigen-specific CD4(+) effector T cells, NY-BR-1 was screened for the presence of HLA-restricted CD4(+) T cell epitopes that could be included in immunological treatment approaches. Upon NY-BR-1-specific DNA immunization of HLA-transgenic mice and functional ex vivo analysis, a panel of NY-BR-1-derived library peptides was determined that specifically stimulated IFNγ secretion among splenocytes of immunized mice. Following in silico analyses, four candidate epitopes were determined which were successfully used for peptide immunization to establish NY-BR-1-specific, HLA-DRB1*0301- or HLA-DRB1*0401-restricted CD4(+) T cell lines from splenocytes of peptide immunized HLA-transgenic mice. Notably, all four CD4(+) T cell lines recognized human HLA-DR-matched dendritic cells (DC) pulsed with lysates of NY-BR-1 expressing human tumor cells, demonstrating natural processing of these epitopes also within the human system. Finally, CD4(+) T cells specific for all four CD4(+) T cell epitopes were detectable among PBMC of breast cancer patients, showing that CD4(+) T cell responses against the new epitopes are not deleted nor inactivated by self-tolerance mechanisms. Our results present the first NY-BR-1-specific HLA-DRB1*0301- and HLA-DRB1*0401-restricted T cell epitopes that could be exploited for therapeutic intervention against breast cancer. © 2014 UICC.

  1. [Aliskiren inhibits proliferation of cardiac fibroblasts in AGT-REN double transgenic hypertensive mice in vitro].

    PubMed

    Wang, Li-Ping; Fan, Su-Jing; Li, Shu-Min; Wang, Xiao-Jun; Sun, Na

    2016-10-25

    The purpose of the present study is to explore the effect of aliskiren on the proliferation of cardiac fibroblasts (CFs) in AGT-REN double transgenic hypertensive (dTH) mice. The cultured CFs from AGT-REN dTH mice were divided into AGT-REN group (dTH) and aliskiren group (ALIS). Cultured CFs from C57B6 mice were served as control (WT). The effect of different concentration of aliskiren (1 × 10 -6 , 1 × 10 -7 , 1 × 10 -8 , 1 × 10 -9 mol/L) on CFs proliferation was determined by MTT assay. After treatment with 1 × 10 -7 mol/L aliskiren for 24 h, α-SMA, collagen I, III and NADPH oxidase (NOX) protein expression in CFs of AGT-REN dTH mice were detected by Western blot. The collagen synthesis in CFs was assessed by hydroxyproline kit. The expression of ROS was determined by DHE. Results showed that the blood pressure and plasma Ang II levels were significantly increased and CFs proliferation was significantly increased as well in AGT-REN dTH mice compared with WT group. However, aliskiren intervention decreased CFs proliferation, myofibroblast transformation, as well as the collagen I and III synthesis in CFs of AGT-REN dTH mice. Meanwhile, aliskiren inhibited ROS content and NOX2/NOX4 protein expression in CFs of AGT-REN dTH mice. These results suggest that aliskiren decreases the cell proliferation, myofibroblast transformation and collagen production in CFs of AGT-REN dTH mice, which might be through inhibition of oxidative stress response.

  2. Diabetic neuropathy: electrophysiological and morphological study of peripheral nerve degeneration and regeneration in transgenic mice that express IFNbeta in beta cells.

    PubMed

    Serafín, Anna; Molín, Jessica; Márquez, Merce; Blasco, Ester; Vidal, Enric; Foradada, Laia; Añor, Sonia; Rabanal, Rosa M; Fondevila, Dolors; Bosch, Fàtima; Pumarola, Martí

    2010-05-01

    Diabetic neuropathy is one of the most frequent complications in diabetes but there are no treatments beyond glucose control, due in part to the lack of an appropriate animal model to assess an effective therapy. This study was undertaken to characterize the degenerative and regenerative responses of peripheral nerves after induced sciatic nerve damage in transgenic rat insulin I promoter / human interferon beta (RIP/IFNbeta) mice made diabetic with a low dose of streptozotocin (STZ) as an animal model of diabetic complications. In vivo, histological and immunohistological studies of cutaneous and sciatic nerves were performed after left sciatic crush. Functional tests, cutaneous innervation, and sciatic nerve evaluation showed pronounced neurological reduction in all groups 2 weeks after crush. All animals showed a gradual recovery but this was markedly slower in diabetic animals in comparison with normoglycemic animals. The delay in regeneration in diabetic RIP/IFNbeta mice resulted in an increase in active Schwann cells and regenerating neurites 8 weeks after surgery. These findings indicate that diabetic-RIP/IFNbeta animals mimic human diabetic neuropathy. Moreover, when these animals are submitted to nerve crush they have substantial deficits in nerve regrowth, similar to that observed in diabetic patients. When wildtype animals were treated with the same dose of STZ, no differences were observed with respect to nontreated animals, indicating that low doses of STZ and the transgene are not implicated in development of the degenerative and regenerative events observed in our study. All these findings indicate that RIP/IFNbeta transgenic mice are a good model for diabetic neuropathy.

  3. Towards cloning the WAS-gene locus: YAC-contigs and PFGE analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meindi, A.; Schindelhauer, D.; Hellebrand, H.

    1994-09-01

    Patients with X-linked recessive Wiskott-Aldrich syndrome (WAS) manifest eczema, thrombocytopenia and severe immunodeficiency. Mapping studies place the WAS gene locus between the markers TIMP and DXS255 which both have been shown to be recombinant with the disease locus. Linkage analysis in eight families including a large Swiss family showed tight linkage of the disease to the loci DXS255 and DXS1126 and exclusion of TIMP as well as polymorphic loci adjacent to the OATL1 pseudogene cluster (e.g., DXS6616). Physical mapping with established YAC contigs and a radiation hybrid encompassing the Xp11.22-11.3 region revealed the loci order TIMP-PFC-elk1-DXS1367-DXS6616-OATL1-(DXS11260DXS226)-C5-3-TGE-3, SYP and (DXS255-DXS146). Themore » markers TIMP and C5-3 are contained on the same 1.6 Mb MluI-fragment. A novel expressed sequence (R1) could be placed between elk-1 and the PFC gene while the STS C5-3 could be localized adjacent to DXS1126. The gene cluster around DXS1126 could be connected with the TFE-3 and synaptophysin genes which map on the same 400 kb MluI fragment and two overlapping YACs. The minimum distance between SYP and DXS255 is 1.2 Mb; the maximum distance is 2.2 Mb. Expressed sequences which are obtained from a cosmid contig around DXS1126 and C5-3 are being used for mutation screening in WAS patients.« less

  4. Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

    PubMed Central

    Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

    1999-01-01

    Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

  5. CaMKIIα underlies spontaneous and evoked pain behaviors in Berkeley sickle cell transgenic mice.

    PubMed

    He, Ying; Chen, Yan; Tian, Xuebi; Yang, Cheng; Lu, Jian; Xiao, Chun; DeSimone, Joseph; Wilkie, Diana J; Molokie, Robert E; Wang, Zaijie Jim

    2016-12-01

    Pain is one of the most challenging and stressful conditions to patients with sickle cell disease (SCD) and their clinicians. Patients with SCD start experiencing pain as early as 3 months old and continue having it throughout their lives. Although many aspects of the disease are well understood, little progress has been made in understanding and treating pain in SCD. This study aimed to investigate the functional involvement of Ca/calmodulin-dependent protein kinase II (CaMKIIα) in the persistent and refractory pain associated with SCD. We found that nonevoked ongoing pain as well as evoked hypersensitivity to mechanical and thermal stimuli were present in Berkeley sickle cell transgenic mice (BERK mice), but not nonsickle control littermates. Prominent activation of CaMKIIα was observed in the dorsal root ganglia and spinal cord dorsal horn region of BERK mice. Intrathecal administration of KN93, a selective inhibitor of CaMKII, significantly attenuated mechanical allodynia and heat hyperalgesia in BERK mice. Meanwhile, spinal inhibition of CaMKII elicited conditioned place preference in the BERK mice, indicating the contribution of CaMKII in the ongoing spontaneous pain of SCD. We further targeted CaMKIIα by siRNA knockdown. Both evoked pain and ongoing spontaneous pain were effectively attenuated in BERK mice. These findings elucidated, for the first time, an essential role of CaMKIIα as a cellular mechanism in the development and maintenance of spontaneous and evoked pain in SCD, which can potentially offer new targets for pharmacological intervention of pain in SCD.

  6. Efficient mapping of transgene integration sites and local structural changes in Cre transgenic mice using targeted locus amplification

    PubMed Central

    Cain-Hom, Carol; Splinter, Erik; van Min, Max; Simonis, Marieke; van de Heijning, Monique; Martinez, Maria; Asghari, Vida

    2017-01-01

    Abstract Cre/LoxP technology is widely used in the field of mouse genetics for spatial and/or temporal regulation of gene function. For Cre lines generated via pronuclear microinjection of a Cre transgene construct, the integration site is random and in most cases not known. Integration of a transgene can disrupt an endogenous gene, potentially interfering with interpretation of the phenotype. In addition, knowledge of where the transgene is integrated is important for planning of crosses between animals carrying a conditional allele and a given Cre allele in case the alleles are on the same chromosome. We have used targeted locus amplification (TLA) to efficiently map the transgene location in seven previously published Cre and CreERT2 transgenic lines. In all lines, transgene insertion was associated with structural changes of variable complexity, illustrating the importance of testing for rearrangements around the integration site. In all seven lines the exact integration site and breakpoint sequences were identified. Our methods, data and genotyping assays can be used as a resource for the mouse community and our results illustrate the power of the TLA method to not only efficiently map the integration site of any transgene, but also provide additional information regarding the transgene integration events. PMID:28053125

  7. Morphological Characterization of Thioflavin-S-Positive Amyloid Plaques in Transgenic Alzheimer Mice and Effect of Passive Aβ Immunotherapy on Their Clearance

    PubMed Central

    Bussière, Thierry; Bard, Frédérique; Barbour, Robin; Grajeda, Henry; Guido, Terry; Khan, Karen; Schenk, Dale; Games, Dora; Seubert, Peter; Buttini, Manuel

    2004-01-01

    Transgenic mice mimicking certain features of Alzheimer’s disease (AD)-pathology, namely amyloid plaques and neurofibrillary tangles, have been developed in an effort to better understand the mechanism leading to the formation of these characteristic cerebral lesions. More recently, these animal models have been widely used to investigate emergent therapies aimed at the reduction of the cerebral amyloid load. Several studies have shown that immunotherapy targeting the amyloid peptide (Aβ) is efficacious at clearing the amyloid plaques or preventing their formation, and at reducing the memory/behavior impairment observed in these animals. In AD, different types of plaques likely have different pathogenic significance, and further characterization of plaque pathology in the PDAPP transgenic mice would enhance the evaluation of potential therapeutics. In the present study, a morphological classification of amyloid plaques present in the brains of PDAPP mice was established by using Thioflavin-S staining. Neuritic dystrophy associated with amyloid plaques was also investigated. Finally, the efficacy of passive immunization with anti-Aβ antibodies on the clearance of Thio-S positive amyloid plaques was studied. Our results show that distinct morphological types of plaques are differentially cleared depending upon the isotype of the antibody. PMID:15331422

  8. Long-term overexpression of human granulocyte colony-stimulating factor in transgenic mice: persistent neutrophilia with no increased mortality for more than one year.

    PubMed

    Serizawa, I; Amano, K; Ishii, H; Ichikawa, T; Kusaka, M; Taguchi, T; Kiyokawa, N; Fujimoto, J

    2000-06-01

    To investigate possible adverse consequences of persistent neutrophil overproduction, mice transgenic for human granulocyte colony-stimulating factor (hG-CSF) were studied for more than 1 year. They showed marked granulocytopoiesis and neutrophilia. Continuous medullary and extramedullary granulocytopoiesis resulted in marked changes in bone and liver. In the liver, haemorrhage and focal necrosis and a few haemangiosarcomas were present, presumably caused by the destructive granulocytopoiesis. Despite the high incidence of lung infiltration by mature neutrophils, lung lesions rarely appeared. Although there was a persistent increase in neutrophils, mortality of the mice did not differ from that of non-transgenic littermates at least within 1 year after birth. Factors other than overproduction of G-CSF and extensive neutrophilia could be required for the development of neutrophil-mediated acute and chronic tissue damage. Copyright 2000 Academic Press.

  9. Morphine Tolerance and Physical Dependence Are Altered in Conditional HIV-1 Tat Transgenic Mice.

    PubMed

    Fitting, Sylvia; Stevens, David L; Khan, Fayez A; Scoggins, Krista L; Enga, Rachel M; Beardsley, Patrick M; Knapp, Pamela E; Dewey, William L; Hauser, Kurt F

    2016-01-01

    Despite considerable evidence that chronic opiate use selectively affects the pathophysiologic consequences of human immunodeficiency virus type 1 (HIV-1) infection in the nervous system, few studies have examined whether neuro-acquired immune deficiency syndrome (neuroAIDS) might intrinsically alter the pharmacologic responses to chronic opiate exposure. This is an important matter because HIV-1 and opiate abuse are interrelated epidemics, and HIV-1 patients are often prescribed opiates as a treatment of HIV-1-related neuropathic pain. Tolerance and physical dependence are inevitable consequences of frequent and repeated administration of morphine. In the present study, mice expressing HIV-1 Tat in a doxycycline (DOX)-inducible manner [Tat(+)], their Tat(-) controls, and control C57BL/6 mice were chronically exposed to placebo or 75-mg morphine pellets to explore the effects of Tat induction on morphine tolerance and dependence. Antinociceptive tolerance and locomotor activity tolerance were assessed using tail-flick and locomotor activity assays, respectively, and physical dependence was measured with the platform-jumping assay and recording of other withdrawal signs. We found that Tat(+) mice treated with DOX [Tat(+)/DOX] developed an increased tolerance in the tail-flick assay compared with control Tat(-)/DOX and/or C57/DOX mice. Equivalent tolerance was developed in all mice when assessed by locomotor activity. Further, Tat(+)/DOX mice expressed reduced levels of physical dependence to chronic morphine exposure after a 1-mg/kg naloxone challenge compared with control Tat(-)/DOX and/or C57/DOX mice. Assuming the results seen in Tat transgenic mice can be generalized to neuroAIDS, our findings suggest that HIV-1-infected individuals may display heightened analgesic tolerance to similar doses of opiates compared with uninfected individuals and show fewer symptoms of physical dependence. Copyright © 2015 by The American Society for Pharmacology and Experimental

  10. Lethal cutaneous disease in transgenic mice conditionally expressing type I human T cell leukemia virus Tax.

    PubMed

    Kwon, Hakju; Ogle, Louise; Benitez, Bobby; Bohuslav, Jan; Montano, Mauricio; Felsher, Dean W; Greene, Warner C

    2005-10-21

    Type I human T cell leukemia virus (HTLV-I) is etiologically linked with adult T cell leukemia, an aggressive and usually fatal expansion of activated CD4+ T lymphocytes that frequently traffic to skin. T cell transformation induced by HTLV-I involves the action of the 40-kDa viral Tax transactivator protein. Tax both stimulates the HTLV-I long terminal repeat and deregulates the expression of select cellular genes by altering the activity of specific host transcription factors, including cyclic AMP-responsive element-binding protein (CREB)/activating transcription factor, NF-kappaB/Rel, and serum response factor. To study initiating events involved in HTLV-I Tax-induced T cell transformation, we generated "Tet-off" transgenic mice conditionally expressing in a lymphocyte-restricted manner (EmuSR alpha promoter-enhancer) either wild-type Tax or mutant forms of Tax that selectively compromise the NF-kappaB (M22) or CREB/activating transcription factor (M47) activation pathways. Wild-type Tax and M47 Tax-expressing mice, but not M22-Tax expressing mice, developed progressive alopecia, hyperkeratosis, and skin lesions containing profuse activated CD4 T cell infiltrates with evidence of deregulated inflammatory cytokine production. In addition, these animals displayed systemic lymphadenopathy and splenomegaly. These findings suggest that Tax-mediated activation of NF-kappaB plays a key role in the development of this aggressive skin disease that shares several features in common with the skin disease occurring during the preleukemic stage in HTLV-I-infected patients. Of note, this skin disease completely resolved when Tax transgene expression was suppressed by administration of doxycycline, emphasizing the key role played by this viral oncoprotein in the observed pathology.

  11. Transgenic Mice Expressing a Truncated Form of CREB-Binding Protein (CBP) Exhibit Deficits in Hippocampal Synaptic Plasticity and Memory Storage

    ERIC Educational Resources Information Center

    Wood, Marcelo A.; Kaplan, Michael P.; Park, Alice; Blanchard, Edward J.; Oliveira, Ana M. M.; Lombardi, Thomas L.; Abel, Ted

    2005-01-01

    Deletions, translocations, or point mutations in the CREB-binding protein (CBP) gene have been associated with Rubinstein-Taybi Syndrome; a human developmental disorder characterized by retarded growth and reduced mental function. To examine the role of CBP in memory, transgenic mice were generated in which the CaMKII[alpha] promoter drives…

  12. Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

    PubMed

    Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

    2013-11-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

  13. Atypical Scrapie Prions from Sheep and Lack of Disease in Transgenic Mice Overexpressing Human Prion Protein

    PubMed Central

    Joiner, Susan; Linehan, Jacqueline M.; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M.; Griffiths, Peter C.; Groschup, Martin H.; Hope, James; Brandner, Sebastian; Asante, Emmanuel A.; Collinge, John

    2013-01-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants. PMID:24188521

  14. The targeted overexpression of a Claudin mutant in the epidermis of transgenic mice elicits striking epidermal and hair follicle abnormalities.

    PubMed

    Troy, Tammy-Claire; Turksen, Kursad

    2007-06-01

    Skin is one of the largest organs of the body, and is formed during development through a highly orchestrated process involving mesenchymal-epithelial interactions, cell commitment, and terminal differentiation. It protects against microorganism invasion and UV irradiation, inhibits water loss, regulates body temperature, and is an important part of the immune system. Using transgenic mouse technology, we have demonstrated that Claudin (Cldn)-containing tight junctions (TJs) are intricately involved in cell signaling during epidermal differentiation and that an epidermal suprabasal overexpression of Cldn6 results in a perturbed epidermal terminal differentiation program with distinct phenotypic abnormalities. To delineate the role of the Cldn cytoplasmic tail domain in epidermal differentiation, we engineered transgenic mice targeting the overexpression of a Cldn6 cytoplasmic tail-truncation mutant in the epidermis. Transgenic mice were characterized by a lethal barrier dysfunction in addition to the existence of hyperproliferative squamous invaginations/cysts replacing hair follicles. Immunohistochemical analysis revealed an epidermal cytoplasmic accumulation of Cldn6, Cldn11, Cldn12, and Cldn18, downregulation of Cldn1 and aberrant expression of various classical markers of epidermal differentiation; namely the basal keratins as well as K1, involucrin, loricrin, and filaggrin. Collectively these studies suggest an important role for Cldns in epidermal/hair follicle differentiation programs likely involving cross talk to signaling pathways (e.g., Notch) directing cell fate selection and differentiation.

  15. Generation of Cre-transgenic mice using Dlx1/Dlx2 enhancers and their characterization in GABAergic interneurons

    PubMed Central

    Potter, Gregory B.; Petryniak, Magdalena A.; Shevchenko, Eugenia; McKinsey, Gabriel L.; Ekker, Marc; Rubenstein, John L.R.

    2009-01-01

    DLX1 and DLX2 transcription factors are necessary for forebrain GABAergic neuron differentiation, migration, and survival. We generated transgenic mice that express Cre-recombinase under the control of two ultra-conserved DNA elements near the Dlx1&2 locus termed I12b and URE2. We show that Cre-recombinase is active in a “Dlx-pattern” in the embryonic forebrain of transgenic mice. I12b-Cre is more active than URE2-Cre in the medial ganglionic eminences and its derivatives. Fate-mapping of EGFP+ cells in adult Cre;Z/EG animals demonstrated that GABAergic neurons, but not glia, are labeled. Most NPY+, nNOS+, parvalbumin+, and somatostatin+ cells are marked by I12b-Cre in the cortex and hippocampus, while 25-40% of these interneuron subtypes are labeled by URE2-Cre. Labeling of neurons generated between E12.5 to E15.5 indicated differences in birth-dates of EGFP+ cells that populate the olfactory bulb, hippocampus, and cortex. Finally, we provide the first in vivo evidence that both I12b and URE2 are direct targets of DLX2 and require Dlx1 and Dlx2 expression for proper activity. PMID:19026749

  16. Centrosomal Nlp is an oncogenic protein that is gene-amplified in human tumors and causes spontaneous tumorigenesis in transgenic mice

    PubMed Central

    Shao, Shujuan; Liu, Rong; Wang, Yang; Song, Yongmei; Zuo, Lihui; Xue, Liyan; Lu, Ning; Hou, Ning; Wang, Mingrong; Yang, Xiao; Zhan, Qimin

    2010-01-01

    Disruption of mitotic events contributes greatly to genomic instability and results in mutator phenotypes. Indeed, abnormalities of mitotic components are closely associated with malignant transformation and tumorigenesis. Here we show that ninein-like protein (Nlp), a recently identified BRCA1-associated centrosomal protein involved in microtubule nucleation and spindle formation, is an oncogenic protein. Nlp was found to be overexpressed in approximately 80% of human breast and lung carcinomas analyzed. In human lung cancers, this deregulated expression was associated with NLP gene amplification. Further analysis revealed that Nlp exhibited strong oncogenic properties; for example, it conferred to NIH3T3 rodent fibroblasts the capacity for anchorage-independent growth in vitro and tumor formation in nude mice. Consistent with these data, transgenic mice overexpressing Nlp displayed spontaneous tumorigenesis in the breast, ovary, and testicle within 60 weeks. In addition, Nlp overexpression induced more rapid onset of radiation-induced lymphoma. Furthermore, mouse embryonic fibroblasts (MEFs) derived from Nlp transgenic mice showed centrosome amplification, suggesting that Nlp overexpression mimics BRCA1 loss. These findings demonstrate that Nlp abnormalities may contribute to genomic instability and tumorigenesis and suggest that Nlp might serve as a potential biomarker for clinical diagnosis and therapeutic target. PMID:20093778

  17. Aerobic exercise improves reverse cholesterol transport in cholesteryl ester transfer protein transgenic mice.

    PubMed

    Rocco, D D F M; Okuda, L S; Pinto, R S; Ferreira, F D; Kubo, S K; Nakandakare, E R; Quintão, E C R; Catanozi, S; Passarelli, M

    2011-07-01

    We analyzed the effect of a 6-week aerobic exercise training program on the in vivo macrophage reverse cholesterol transport (RCT) in human cholesteryl ester transfer protein (CETP) transgenic (CETP-tg) mice. Male CETP-tg mice were randomly assigned to a sedentary group or a carefully supervised exercise training group (treadmill 15 m/min, 30 min sessions, five sessions per week). The levels of plasma lipids were determined by enzymatic methods, and the lipoprotein profile was determined by fast protein liquid chromatography (FPLC). CETP activity was determined by measuring the transfer rate of ¹⁴C-cholesterol from HDL to apo-B containing lipoproteins, using plasma from CETP-tg mice as a source of CETP. The reverse cholesterol transport was determined in vivo by measuring the [³H]-cholesterol recovery in plasma and feces (24 and 48 h) and in the liver (48 h) following a peritoneal injection of [³H]-cholesterol labeled J774-macrophages into both sedentary and exercise trained mice. The protein levels of liver receptors were determined by immunoblot, and the mRNA levels for liver enzymes were measured using RT-PCR. Exercise training did not significantly affect the levels of plasma lipids or CETP activity. The HDL fraction assessed by FPLC was higher in exercise-trained compared to sedentary mice. In comparison to the sedentary group, a greater recovery of [³H]-cholesterol from the injected macrophages was found in the plasma, liver and feces of exercise-trained animals. The latter occurred even with a reduction in the liver CYP7A1 mRNA level in exercised trained animals. Exercise training increased the liver LDL receptor and ABCA-1 protein levels, although the SR-BI protein content was unchanged. The RCT benefit in CETP-tg mice elicited by exercise training helps to elucidate the role of exercise in the prevention of atherosclerosis in humans.

  18. A novel phosphodiesterase-5 Inhibitor: Yonkenafil modulates neurogenesis, gliosis to improve cognitive function and ameliorates amyloid burden in an APP/PS1 transgenic mice model.

    PubMed

    Zhu, Lei; Yang, Jing-yu; Xue, Xue; Dong, Ying-xu; Liu, Yang; Miao, Feng-rong; Wang, Yong-feng; Xue, Hong; Wu, Chun-fu

    2015-09-01

    In Alzheimer's disease (AD), activated microglia invade and surround β-amyloid plaques, possibly contributing to the aggregation of amyloid β (Aβ), which affect the survival of neurons and lead to memory loss. Phosphodiesterase-5 (PDE-5) inhibitors have recently been shown a potential therapeutic effect on AD. In this study, the effects of yonkenafil (yonk), a novel PDE-5 inhibitor, on cognitive behaviors as well as the pathological features in transgenic AD mice were investigated. Seven-month-old APP/PS1 transgenic mice were treated with yonk (2, 6, or 18 mg/kg, intraperitoneal injection (i.p.)) or sildenafil (sild) (6 mg/kg, i.p.) daily for 3 months and then behavioral tests were performed. The results demonstrated that yonk improved nesting-building ability, ameliorated working memory deficits in the Y-maze tasks, and significantly improved learning and memory function in the Morris water maze (MWM) tasks. In addition, yonk reduced the area of Aβ plaques, and inhibited over-activation of microglia and astrocytes. Furthermore, yonk increased neurogenesis in the dentate granule brain region of APP/PS1 mice, indicated by increased BrdU(+)/NeuN(+) and BrdU(+)/DCX(+) cells compared to vehicle-treated transgenic mice. These results suggest that yonk could rescue cognitive deficits by ameliorated amyloid burden through regulating APP processing, inhibited the over-activation of microglia and astrocytes as well as restored neurogenesis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  19. Efficient mapping of transgene integration sites and local structural changes in Cre transgenic mice using targeted locus amplification.

    PubMed

    Cain-Hom, Carol; Splinter, Erik; van Min, Max; Simonis, Marieke; van de Heijning, Monique; Martinez, Maria; Asghari, Vida; Cox, J Colin; Warming, Søren

    2017-05-05

    Cre/LoxP technology is widely used in the field of mouse genetics for spatial and/or temporal regulation of gene function. For Cre lines generated via pronuclear microinjection of a Cre transgene construct, the integration site is random and in most cases not known. Integration of a transgene can disrupt an endogenous gene, potentially interfering with interpretation of the phenotype. In addition, knowledge of where the transgene is integrated is important for planning of crosses between animals carrying a conditional allele and a given Cre allele in case the alleles are on the same chromosome. We have used targeted locus amplification (TLA) to efficiently map the transgene location in seven previously published Cre and CreERT2 transgenic lines. In all lines, transgene insertion was associated with structural changes of variable complexity, illustrating the importance of testing for rearrangements around the integration site. In all seven lines the exact integration site and breakpoint sequences were identified. Our methods, data and genotyping assays can be used as a resource for the mouse community and our results illustrate the power of the TLA method to not only efficiently map the integration site of any transgene, but also provide additional information regarding the transgene integration events. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Mouse genetic corneal disease resulting from transgenic insertional mutagenesis

    PubMed Central

    Ramalho, J S; Gregory-Evans, K; Huxley, C; Seabra, M C

    2004-01-01

    Background/aims: To report the generation of a new mouse model for a genetically determined corneal abnormality that occurred in transgenesis experiments. Methods: Transgenic mice expressing mutant forms of Rab27a, a GTPase that has been implicated in the pathogenesis of choroideremia, were generated. Results: Only one transgenic line (T27aT15) exhibited an unexpected eye phenotype. T27aT15 mice developed corneal opacities, usually unilateral, and cataracts, resulting in some cases in phthisical eyes. Histologically, the corneal stroma was thickened and vacuolated, and both epithelium and endothelium were thinned. The posterior segment of the eye was also affected with abnormal pigmentation, vessel narrowing, and abnormal leakage of dye upon angiography but was histologically normal. Conclusion: Eye abnormality in T27aT15 mice results from random insertional mutagenesis of the transgene as it was only observed in one line. The corneal lesion observed in T27aT15 mice most closely resembles posterior polymorphous corneal dystrophy and might result from the disruption of the equivalent mouse locus. PMID:14977782

  1. Histaminergic regulation of natural killer cell-mediated clearance of tumour cells in mice.

    PubMed

    Asea, A; Hermodsson, S; Hellstrand, K

    1996-01-01

    Treatment of Swiss albino mice with histamine enhanced the clearance of natural killer (NK)-cell sensitive YAC-1 lymphoma and B16/F10 melanoma cells from lung tissue in vivo, but did not affect the elimination of NK-cell-insensitive P815 mastocytoma cells. The effect of histamine was apparently mediated by H2-type histamine receptors (H2R) since it was blocked by ranitidine, and H2R antagonist. Histamine did not affect clearance of tumour cells in animals depleted of NK cells in vivo by treatment with antibodies to asialo-GM1 or NK1.1. The effect of histamine was time-dependent: pretreatment with histamine for 3 h significantly augmented the clearance of YAC-1 cells, whereas, pretreatment with histamine for 5 min was ineffective. Histamine potentiated the anti-tumour properties of NK-cell activators such as interleukin-2 (IL-2) or interferon-alpha (IFN-alpha) in vivo. None of these lymphokines significantly affected the clearance of YAC-1 cells unless animals were concomitantly treated with histamine. Treatment with ranitidine alone reduced the in vivo clearance of YAC-1 cells from lungs but did not affect the clearance of NK-cell-insensitive P815 cells. Effects of ranitidine on NK-cell function in vivo were not shared by a chemical control to ranitidine, AH20239AA, thus indicating that the inhibition of NK-cells results from H2R antagonism rather than non-specific toxicity. It is concluded that histaminergic mechanisms may be involved in the regulation of NK cell function in vivo.

  2. In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA

    PubMed Central

    Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D

    2016-01-01

    Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405

  3. Arabidopsis thaliana plants expressing Rift Valley fever virus antigens: Mice exhibit systemic immune responses as the result of oral administration of the transgenic plants.

    PubMed

    Kalbina, Irina; Lagerqvist, Nina; Moiane, Bélisario; Ahlm, Clas; Andersson, Sören; Strid, Åke; Falk, Kerstin I

    2016-11-01

    The zoonotic Rift Valley fever virus affects livestock and humans in Africa and on the Arabian Peninsula. The economic impact of this pathogen due to livestock losses, as well as its relevance to public health, underscores the importance of developing effective and easily distributed vaccines. Vaccines that can be delivered orally are of particular interest. Here, we report the expression in transformed plants (Arabidopsis thaliana) of Rift Valley fever virus antigens. The antigens used in this study were the N protein and a deletion mutant of the Gn glycoprotein. Transformed lines were analysed for specific mRNA and protein content by RT-PCR and Western blotting, respectively. Furthermore, the plant-expressed antigens were evaluated for their immunogenicity in mice fed the transgenic plants. After oral intake of fresh transgenic plant material, a proportion of the mice elicited specific IgG antibody responses, as compared to the control animals that were fed wild-type plants and of which none sero-converted. Thus, we show that transgenic plants can be readily used to express and produce Rift Valley Fever virus proteins, and that the plants are immunogenic when given orally to mice. These are promising findings and provide a basis for further studies on edible plant vaccines against the Rift Valley fever virus. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Ligand-induced rapid skeletal muscle atrophy in HSA-Fv2E-PERK transgenic mice.

    PubMed

    Miyake, Masato; Kuroda, Masashi; Kiyonari, Hiroshi; Takehana, Kenji; Hisanaga, Satoshi; Morimoto, Masatoshi; Zhang, Jun; Oyadomari, Miho; Sakaue, Hiroshi; Oyadomari, Seiichi

    2017-01-01

    Formation of 43S and 48S preinitiation complexes plays an important role in muscle protein synthesis. There is no muscle-wasting mouse model caused by a repressed 43S preinitiation complex assembly. The aim of the present study was to develop a convenient mouse model of skeletal muscle wasting with repressed 43S preinitiation complex assembly. A ligand-activatable PERK derivative Fv2E-PERK causes the phosphorylation of eukaryotic initiation factor 2α (eIF2α), which inhibits 43S preinitiation complex assembly. Thus, muscle atrophic phenotypes, intracellular signaling pathways, and intracellular free amino acid profiles were investigated in human skeletal muscle α-actin (HSA) promoter-driven Fv2E-PERK transgenic (Tg) mice. HSA-Fv2E-PERK Tg mice treated with the artificial dimerizer AP20187 phosphorylates eIF2α in skeletal muscles and leads to severe muscle atrophy within a few days of ligand injection. Muscle atrophy was accompanied by a counter regulatory activation of mTORC1 signaling. Moreover, intracellular free amino acid levels were distinctively altered in the skeletal muscles of HSA-Fv2E-PERK Tg mice. As a novel model of muscle wasting, HSA-Fv2E-PERK Tg mice provide a convenient tool for studying the pathogenesis of muscle loss and for assessing putative therapeutics.

  5. Non-invasive fluorescent imaging of gliosis in transgenic mice for profiling developmental neurotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Gideon; Zhang Chunyan; Zhuo Lang

    2007-05-15

    Gliosis is a universal response of Brain to almost all types of neural insults, including neurotoxicity, neurodegeneration, viral infection, and stroke. A hallmark of gliotic reaction is the up-regulation of the astrocytic biomarker GFAP (glial fibrillary acidic protein), which often precedes the anatomically apparent damages in Brain. In this study, neonatal transgenic mice at postnatal day (PD) 4 expressing GFP (green fluorescent protein) under the control of a widely used 2.2-kb human GFAP promoter in Brain are treated with two model neurotoxicants, 1-methyl-4(2'-methylphenyl)-1,2,3,6-tetrahydropyridine (2'-CH{sub 3}-MPTP), and kainic acid (KA), respectively, to induce gliosis. Here we show that the neurotoxicant-induced acutemore » gliosis can be non-invasively imaged and quantified in Brain of conscious (un-anesthetized) mice in real-time, at 0, 2, 4, 6, and 8 h post-toxicant dosing. Therefore the current methodology could be a useful tool for studying the developmental aspects of neuropathies and neurotoxicity.« less

  6. GENE EXPRESSION PROFILING OF MOUSE SKIN AND PAPILLOMAS FOLLOWING CHRONIC EXPOSURE TO MONOMETHYLARSONOUS ACID IN K6/ODC TRANSGENIC MICE

    EPA Science Inventory

    Methylarsonous acid [MMA(III)], a common metabolite of inorganic arsenic metabolism, increases tumor frequency in the skin of K6/ODC transgenic mice following a chronic exposure. To characterize gene expression profiles predictive of MMA(III) exposure and mode of action of carcin...

  7. Maladaptive exploratory behavior and neuropathology of the PS-1 P117L Alzheimer transgenic mice.

    PubMed

    Zufferey, Valérie; Vallet, Philippe G; Moeri, Michaël; Moulin-Sallanon, Marcelle; Piotton, Françoise; Marin, Pascale; Savioz, Armand

    2013-05-01

    Patients with the early-onset Alzheimer's disease P117L mutation in the presenilin-1 gene (PS-1) present pathological hallmarks in the hippocampus, the frontal cortex and the basal ganglia. In the present work we determined by immunohistochemistry which brain regions were injured in the transgenic PS-1 P117L mice, in comparison to their littermates, the B6D2 mice. Furthermore, as these regions are involved in novelty detection, we investigated the behavior of these mice in tests for object and place novelty recognition. Limited numbers of senile plaques and neurofibrillary tangles were detected in aged PS-1 P117L mice in the CA1 only, indicating that the disease is restrained to an initial neuropathological stage. Western blots showed a change in PSD-95 expression (p=0.03), not in NR2A subunit, NR2B subunit and synaptophysin expressions in the frontal cortex, suggesting specific synaptic alterations. The behavioral tests repeatedly revealed, despite a non-significant preference for object or place novelty, maladaptive exploratory behavior of the PS-1 P117L mice in novel environmental conditions, not due to locomotor problems. These mice, unlike the B6D2 mice, were less inhibited to visit the center of the cages (p=0.01) and they continued to move excessively in the presence of a displaced object (p=0.021). Overall, the PS-1 P117L mice appear to be in an initial Alzheimer's disease-like neuropathological stage, and they showed a lack of reaction toward novel environmental conditions. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Parvalbumin overexpression alters immune-mediated increases in intracellular calcium, and delays disease onset in a transgenic model of familial amyotrophic lateral sclerosis

    NASA Technical Reports Server (NTRS)

    Beers, D. R.; Ho, B. K.; Siklos, L.; Alexianu, M. E.; Mosier, D. R.; Mohamed, A. H.; Otsuka, Y.; Kozovska, M. E.; McAlhany, R. E.; Smith, R. G.; hide

    2001-01-01

    Intracellular calcium is increased in vulnerable spinal motoneurons in immune-mediated as well as transgenic models of amyotrophic lateral sclerosis (ALS). To determine whether intracellular calcium levels are influenced by the calcium-binding protein parvalbumin, we developed transgenic mice overexpressing parvalbumin in spinal motoneurons. ALS immunoglobulins increased intracellular calcium and spontaneous transmitter release at motoneuron terminals in control animals, but not in parvalbumin overexpressing transgenic mice. Parvalbumin transgenic mice interbred with mutant SOD1 (mSOD1) transgenic mice, an animal model of familial ALS, had significantly reduced motoneuron loss, and had delayed disease onset (17%) and prolonged survival (11%) when compared with mice with only the mSOD1 transgene. These results affirm the importance of the calcium binding protein parvalbumin in altering calcium homeostasis in motoneurons. The increased motoneuron parvalbumin can significantly attenuate the immune-mediated increases in calcium and to a lesser extent compensate for the mSOD1-mediated 'toxic-gain-of-function' in transgenic mice.

  9. Case Study: Polycystic Livers in a Transgenic Mouse Line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lovaglio, Jamie A.; Artwohl, James E.; Ward, Christopher J.

    Three mice (2 male, 1 female; age, 5 to 16 mo) from a mouse line transgenic for keratin 14 (K14)-driven LacZ expression and on an outbred Crl:CD1(ICR) background, were identified as having distended abdomens and livers that were diffusely enlarged by numerous cysts (diameter, 0.1 to 2.0 cm). Histopathology revealed hepatic cysts lined by biliary type epithelium and mild chronic inflammation, and confirmed the absence of parasites. Among 21 related mice, 5 additional affected mice were identified via laparotomy. Breeding of these 5 mice (after 5 mo of age) did not result in any offspring; the K14 mice with olycysticmore » livers failed to reproduce. Affected male mice had degenerative testicular lesions, and their sperm was immotile. Nonpolycystic K14 control male mice bred well, had no testicular lesions, and had appropriate sperm motility. Genetic analysis did not identify an association of this phenotype with the transgene or insertion site.« less

  10. Suppressed rate of carcinogenesis and decreases in tumour volume and lung metastasis in CXCL14/BRAK transgenic mice.

    PubMed

    Hata, Ryu-Ichiro; Izukuri, Kazuhito; Kato, Yasumasa; Sasaki, Soichiro; Mukaida, Naofumi; Maehata, Yojiro; Miyamoto, Chihiro; Akasaka, Tetsu; Yang, Xiaoyan; Nagashima, Yoji; Takeda, Kazuyoshi; Kiyono, Tohru; Taniguchi, Masaru

    2015-03-13

    Cancer progression involves carcinogenesis, an increase in tumour size, and metastasis. Here, we investigated the effect of overexpressed CXC chemokine ligand 14 (CXCL14) on these processes by using CXCL14/BRAK (CXCL14) transgenic (Tg) mice. The rate of AOM/DSS-induced colorectal carcinogenesis in these mice was significantly lower compared with that for isogenic wild type C57BL/6 (Wt) mice. When tumour cells were injected into these mice, the size of the tumours that developed and the number of metastatic nodules in the lungs of the animals were always significantly lower in the Tg mice than in the Wt ones. Injection of anti-asialo-GM1 antibodies to the mice before and after injection of tumour cells attenuated the suppressing effects of CXCL14 on the tumor growth and metastasis, suggesting that NK cell activity played an important role during CXCL14-mediated suppression of tumour growth and metastasis. The importance of NK cells on the metastasis was also supported when CXCL14 was expressed in B16 melanoma cells. Further, the survival rates after tumour cell injection were significantly increased for the Tg mice. As these Tg mice showed no obvious abnormality, we propose that CXCL14 to be a promising molecular target for cancer suppression/prevention.

  11. Expression profile of microRNA-146a along HPV-induced multistep carcinogenesis: a study in HPV16 transgenic mice.

    PubMed

    Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M

    2018-02-01

    Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.

  12. A Novel 1,4-Dihydropyridine Derivative Improves Spatial Learning and Memory and Modifies Brain Protein Expression in Wild Type and Transgenic APPSweDI Mice.

    PubMed

    Jansone, Baiba; Kadish, Inga; van Groen, Thomas; Beitnere, Ulrika; Moore, Doyle Ray; Plotniece, Aiva; Pajuste, Karlis; Klusa, Vija

    2015-01-01

    Ca2+ blockers, particularly those capable of crossing the blood-brain barrier (BBB), have been suggested as a possible treatment or disease modifying agents for neurodegenerative disorders, e.g., Alzheimer's disease. The present study investigated the effects of a novel 4-(N-dodecyl) pyridinium group-containing 1,4-dihydropyridine derivative (AP-12) on cognition and synaptic protein expression in the brain. Treatment of AP-12 was investigated in wild type C57BL/6J mice and transgenic Alzheimer's disease model mice (Tg APPSweDI) using behavioral tests and immunohistochemistry, as well as mass spectrometry to assess the blood-brain barrier (BBB) penetration. The data demonstrated the ability of AP-12 to cross the BBB, improve spatial learning and memory in both mice strains, induce anxiolytic action in transgenic mice, and increase expression of hippocampal and cortical proteins (GAD67, Homer-1) related to synaptic plasticity. The compound AP-12 can be seen as a prototype molecule for use in the design of novel drugs useful to halt progression of clinical symptoms (more specifically, anxiety and decline in memory) of neurodegenerative diseases, particularly Alzheimer's disease.

  13. Establishing a laboratory animal model from a transgenic animal: RasH2 mice as a model for carcinogenicity studies in regulatory science.

    PubMed

    Urano, K; Tamaoki, N; Nomura, T

    2012-01-01

    Transgenic animal models have been used in small numbers in gene function studies in vivo for a period of time, but more recently, the use of a single transgenic animal model has been approved as a second species, 6-month alternative (to the routine 2-year, 2-animal model) used in short-term carcinogenicity studies for generating regulatory application data of new drugs. This article addresses many of the issues associated with the creation and use of one of these transgenic models, the rasH2 mouse, for regulatory science. The discussion includes strategies for mass producing mice with the same stable phenotype, including constructing the transgene, choosing a founder mouse, and controlling both the transgene and background genes; strategies for developing the model for regulatory science, including measurements of carcinogen susceptibility, stability of a large-scale production system, and monitoring for uniform carcinogenicity responses; and finally, efficient use of the transgenic animal model on study. Approximately 20% of mouse carcinogenicity studies for new drug applications in the United States currently use transgenic models, typically the rasH2 mouse. The rasH2 mouse could contribute to animal welfare by reducing the numbers of animals used as well as reducing the cost of carcinogenicity studies. A better understanding of the advantages and disadvantages of the transgenic rasH2 mouse will result in greater and more efficient use of this animal model in the future.

  14. Expression and Distribution of Arylsulfatase B are Closely Associated with Neuron Death in SOD1 G93A Transgenic Mice.

    PubMed

    Zhang, Jie; Liang, Huiting; Zhu, Lei; Gan, Weiming; Tang, Chunyan; Li, Jiao; Xu, Renshi

    2018-02-01

    The known proteins only explained the partial pathogenesis of amyotrophic lateral sclerosis (ALS). Therefore, this study aimed to search the novel proteins possibly involved in ALS. In this study, we analyzed the expression and distribution of the candidate protein arylsulfatase B (ARSB) in the different segments, anatomic regions, and neural cells of spinal cord at the different stages of the wild-type and [Cu/Zn] superoxide dismutase 1 (SOD1) G93A transgenic mice using the fluorescent immunohistochemistry and the western blot. The results revealed that the ARSB was extensively expressed and distributed in the entire spinal cord; the expression and distribution of ARSB was significantly different in the different regions of spinal cord, the anterior horn of gray matter (AHGM) was significantly more than that in the posterior horn of gray matter (PHGM) and significantly more than that in the central canal, and ARSB was mainly distributed in the microglia and neuron cells in the wild-type mice. The expression of ARSB significantly increased in other anatomic regions besides the thoracic PHGM, significantly decreased at the progression stage, occurred in the redistribution from the AHGM and the PHGM to the central canal at the onset and progression stages, and no any alteration of ARSB expression and distribution occurred between the different neural cells in the SOD1 G93A mice compared with the wild-type mice. The increase of ARSB expression and distribution followed with the increased of neuron death. Our data suggested that the abnormal expression and distribution of ARSB were closely associated with the neuron death in the SOD1 G93A transgenic mice.

  15. DNaseI Hypersensitivity and Ultraconservation Reveal Novel, Interdependent Long-Range Enhancers at the Complex Pax6 Cis-Regulatory Region

    PubMed Central

    McBride, David J.; Buckle, Adam; van Heyningen, Veronica; Kleinjan, Dirk A.

    2011-01-01

    The PAX6 gene plays a crucial role in development of the eye, brain, olfactory system and endocrine pancreas. Consistent with its pleiotropic role the gene exhibits a complex developmental expression pattern which is subject to strict spatial, temporal and quantitative regulation. Control of expression depends on a large array of cis-elements residing in an extended genomic domain around the coding region of the gene. The minimal essential region required for proper regulation of this complex locus has been defined through analysis of human aniridia-associated breakpoints and YAC transgenic rescue studies of the mouse smalleye mutant. We have carried out a systematic DNase I hypersensitive site (HS) analysis across 200 kb of this critical region of mouse chromosome 2E3 to identify putative regulatory elements. Mapping the identified HSs onto a percent identity plot (PIP) shows many HSs correspond to recognisable genomic features such as evolutionarily conserved sequences, CpG islands and retrotransposon derived repeats. We then focussed on a region previously shown to contain essential long range cis-regulatory information, the Pax6 downstream regulatory region (DRR), allowing comparison of mouse HS data with previous human HS data for this region. Reporter transgenic mice for two of the HS sites, HS5 and HS6, show that they function as tissue specific regulatory elements. In addition we have characterised enhancer activity of an ultra-conserved cis-regulatory region located near Pax6, termed E60. All three cis-elements exhibit multiple spatio-temporal activities in the embryo that overlap between themselves and other elements in the locus. Using a deletion set of YAC reporter transgenic mice we demonstrate functional interdependence of the elements. Finally, we use the HS6 enhancer as a marker for the migration of precerebellar neuro-epithelium cells to the hindbrain precerebellar nuclei along the posterior and anterior extramural streams allowing visualisation of

  16. Genital herpes simplex virus type 2 infection in humanized HIV-transgenic mice triggers HIV shedding and is associated with greater neurological disease.

    PubMed

    Nixon, Briana; Fakioglu, Esra; Stefanidou, Martha; Wang, Yanhua; Dutta, Monica; Goldstein, Harris; Herold, Betsy C

    2014-02-15

    Epidemiological studies consistently demonstrate synergy between herpes simplex virus type 2 (HSV-2) and human immunodeficiency virus type 1 (HIV-1). Higher HIV-1 loads are observed in coinfected individuals, and conversely, HIV-1 is associated with more-severe herpetic disease. A small animal model of coinfection would facilitate identification of the biological mechanisms underlying this synergy and provide the opportunity to evaluate interventions. Mice transgenic for HIV-1 provirus and human cyclin T1 under the control of a CD4 promoter (JR-CSF/hu-cycT1) were intravaginally infected with HSV-2 and evaluated for disease progression, HIV shedding, and mucosal immune responses. HSV-2 infection resulted in higher vaginal HIV loads and genital tissue expression of HIV RNA, compared with HSV-uninfected JR-CSF/hu-cycT1 mice. There was an increase in genital tract inflammatory cells, cytokines, chemokines, and interferons in response to HSV-2, although the kinetics of the response were delayed in HIV-transgenic, compared with control mice. Moreover, the JR-CSF/hu-cycT1 mice exhibited earlier and more-severe neurological disease. The latter was associated with downregulation of secretory leukocyte protease inhibitor expression in neuronal tissue, a molecule with antiinflammatory, antiviral, and neuroprotective properties. JR-CSF/hu-cycT1 mice provide a valuable model to study HIV/HSV-2 coinfection and identify potential mechanisms by which HSV-2 facilitates HIV-1 transmission and HIV modulates HSV-2-mediated disease.

  17. Overexpression of Heparin-Binding Epidermal Growth Factor-Like Growth Factor Mediates Liver Fibrosis in Transgenic Mice.

    PubMed

    Guo, Yongze; Ding, Qian; Chen, Lei; Ji, Chenguang; Hao, Huiyao; Wang, Jia; Qi, Wei; Xie, Xiaoli; Ma, Junji; Li, Aidi; Jiang, Xiaoyu; Li, Xiaotian; Jiang, Huiqing

    2017-08-01

    The role of heparin-binding epidermal growth factor-like growth factor (HB-EGF) in liver fibrosis is not clear and is sometimes even contradictory. To clarify this role, a HB-EGF transgenic (Tg) mouse model was, for the first time, used to evaluate the functions of HB-EGF in liver fibrosis. For the in vivo study, carbon tetrachloride injection and bile duct ligation treatment were used to induce liver fibrosis in HB-EGF Tg mice and wild-type (WT) mice, respectively. Primary hepatic satellite cells (HSCs) were isolated from HB-EGF Tg and WT mice for the in vitro study. Compared with the WT mice, HB-EGF Tg mice were shown to develop more severe liver fibrosis when treated with carbon tetrachloride or bile duct ligation, with increased matrix metalloproteinases 13 activity and enhanced expression of fibrogenic genes including α-smooth muscle actin and collagen I. HB-EGF gene transfer led to an increase in proliferation and a decrease in apoptosis in primary HSCs. The ERK signaling pathway was more highly activated in primary HSCs from HB-EGF Tg mice than in those from WT mice. Our investigation confirmed the profibrotic effect of HB-EGF on the liver using a Tg mouse model. This result may contribute to the elucidation of HB-EGF as a therapeutic target in liver fibrosis. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

  18. Differential proteomic and behavioral effects of long-term voluntary exercise in wild-type and APP-overexpressing transgenics.

    PubMed

    Rao, Shailaja Kishan; Ross, Jordan M; Harrison, Fiona E; Bernardo, Alexandra; Reiserer, Randall S; Reiserer, Ronald S; Mobley, James A; McDonald, Michael P

    2015-06-01

    Physical exercise may provide protection against the cognitive decline and neuropathology associated with Alzheimer's disease, although the mechanisms are not clear. In the present study, APP/PSEN1 double-transgenic and wild-type mice were allowed unlimited voluntary exercise for 7months. Consistent with previous reports, wheel-running improved cognition in the double-transgenic mice. Interestingly, the average daily distance run was strongly correlated with spatial memory in the water maze in wild-type mice (r(2)=.959), but uncorrelated in transgenics (r(2)=.013). Proteomics analysis showed that sedentary transgenic mice differed significantly from sedentary wild-types with respect to proteins involved in synaptic transmission, cytoskeletal regulation, and neurogenesis. When given an opportunity to exercise, the transgenics' deficiencies in cytoskeletal regulation and neurogenesis largely normalized, but abnormal synaptic proteins did not change. In contrast, exercise enhanced proteins associated with cytoskeletal regulation, oxidative phosphorylation, and synaptic transmission in wild-type mice. Soluble and insoluble Aβ40 and Aβ42 levels were significantly decreased in both cortex and hippocampus of active transgenics, suggesting that this may have played a role in the cognitive improvement in APP/PSEN1 mice. β-secretase was significantly reduced in active APP/PSEN1 mice compared to sedentary controls, suggesting a mechanism for reduced Aβ. Taken together, these data illustrate that exercise improves memory in wild-type and APP-overexpressing mice in fundamentally different ways. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Long-term insulin-like growth factor-I expression in skeletal muscles attenuates the enhanced in vitro proliferation ability of the resident satellite cells in transgenic mice

    NASA Technical Reports Server (NTRS)

    Chakravarthy, M. V.; Fiorotto, M. L.; Schwartz, R. J.; Booth, F. W.

    2001-01-01

    Insulin-like growth factor-I (IGF-I) overexpression for 1-month in mouse skeletal muscle increases satellite cell proliferation potential. However, it is unknown whether this beneficial enhancement by IGF-I expression would persist over a longer-term duration in aged mice. This is an important issue to address if a prolonged course of IGF-I is to be used clinically in muscle-wasting conditions where satellite cells may become limiting. Using the IGF-I transgenic (IGF-I Tg) mouse that selectively expresses the IGF-I transgene in striated muscles, we found that 18-months of continuous IGF-I overexpression led to a loss in the enhanced in vitro proliferative capacity of satellite cells from Tg skeletal muscles. Also 18-month-old IGF-I Tg satellite cells lost the enhanced BrdU incorporation, greater pRb and Akt phosphorylations, and decreased p27(Kip1) levels initially observed in cells from 1-month-old IGF-I Tg mice. The levels of those biochemical markers reverted to similar values seen in the 18-months WT littermates. These findings, therefore, suggest that there is no further beneficial effect on enhancing satellite cell proliferation ability with persistent long-term expression of IGF-I in skeletal muscles of these transgenic mice.

  20. The role of microglial cells and astrocytes in fibrillar plaque evolution in transgenic APP(SW) mice.

    PubMed

    Wegiel, J; Wang, K C; Imaki, H; Rubenstein, R; Wronska, A; Osuchowski, M; Lipinski, W J; Walker, L C; LeVine, H

    2001-01-01

    Ultrastructural reconstruction of 27 fibrillar plaques in different stages of formation and maturation was undertaken to characterize the development of fibrillar plaques in the brains of human APP(SW) transgenic mice (Tg2576). The study suggests that microglial cells are not engaged in Abeta removal and plaque degradation, but in contrast, are a driving force in plaque formation and development. Fibrillar Abeta deposition at the amyloid pole of microglial cells appears to initiate three types of neuropil response: degeneration of neurons, protective activation of astrocytes, and attraction and activation of microglial cells sustaining plaque growth. Enlargement of neuronal processes and synapses with accumulation of degenerated mitochondria, dense bodies, and Hirano-type bodies is the marker of toxic injury of neurons by fibrillar Abeta. Separation of amyloid cores from neurons and degradation of amyloid cores by cytoplasmic processes of hypertrophic astrocytes suggest the protective and defensive character of astrocytic response to fibrillar Abeta. The growth of cored plaque from a small plaque with one microglial cell with an amyloid star and a few dystrophic neurites to a large plaque formed by several dozen microglial cells seen in old mice is the effect of attraction and activation of microglial cells residing outside of the plaque perimeter. This mechanism of growth of plaques appears to be characteristic of cored plaques in transgenic mice. Other features in mouse microglial cells that are absent in human brain are clusters of vacuoles, probably of lysosomal origin. They evolve into circular cisternae and finally into large vacuoles filled with osmiophilic, amorphous material and bundles of fibrils that are poorly labeled with antibody to Abeta. Microglial cells appear to release large amounts of fibrillar Abeta and accumulate traces of fibrillar Abeta in a lysosomal pathway.

  1. A Novel mouse model of enhanced proteostasis: Full-length human heat shock factor 1 transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pierce, Anson, E-mail: piercea2@uthscsa.edu; Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center at San Antonio, San Antonio, Texas, 78229; The Department of Veteran's Affairs, South Texas Veterans Health Care System, San Antonio, Texas, 78284

    2010-11-05

    Research highlights: {yields} Development of mouse overexpressing native human HSF1 in all tissues including CNS. {yields} HSF1 overexpression enhances heat shock response at whole-animal and cellular level. {yields} HSF1 overexpression protects from polyglutamine toxicity and favors aggresomes. {yields} HSF1 overexpression enhances proteostasis at the whole-animal and cellular level. -- Abstract: The heat shock response (HSR) is controlled by the master transcriptional regulator heat shock factor 1 (HSF1). HSF1 maintains proteostasis and resistance to stress through production of heat shock proteins (HSPs). No transgenic model exists that overexpresses HSF1 in tissues of the central nervous system (CNS). We generated a transgenicmore » mouse overexpressing full-length non-mutant HSF1 and observed a 2-4-fold increase in HSF1 mRNA and protein expression in all tissues studied of HSF1 transgenic (HSF1{sup +/0}) mice compared to wild type (WT) littermates, including several regions of the CNS. Basal expression of HSP70 and 90 showed only mild tissue-specific changes; however, in response to forced exercise, the skeletal muscle HSR was more elevated in HSF1{sup +/0} mice compared to WT littermates and in fibroblasts following heat shock, as indicated by levels of inducible HSP70 mRNA and protein. HSF1{sup +/0} cells elicited a significantly more robust HSR in response to expression of the 82 repeat polyglutamine-YFP fusion construct (Q82YFP) and maintained proteasome-dependent processing of Q82YFP compared to WT fibroblasts. Overexpression of HSF1 was associated with fewer, but larger Q82YFP aggregates resembling aggresomes in HSF1{sup +/0} cells, and increased viability. Therefore, our data demonstrate that tissues and cells from mice overexpressing full-length non-mutant HSF1 exhibit enhanced proteostasis.« less

  2. Arginine supplementation of sickle transgenic mice reduces red cell density and Gardos channel activity.

    PubMed

    Romero, José R; Suzuka, Sandra M; Nagel, Ronald L; Fabry, Mary E

    2002-02-15

    Nitric oxide (NO), essential for maintaining vascular tone, is produced from arginine by nitric oxide synthase. Plasma arginine levels are low in sickle cell anemia, and it is reported here that low plasma arginine is also found in our sickle transgenic mouse model that expresses human alpha, human beta(S), and human beta(S-Antilles) and is homozygous for the mouse beta(major) deletion (S+S-Antilles). S+S-Antilles mice were supplemented with a 4-fold increase in arginine that was maintained for several months. Mean corpuscular hemoglobin concentration (MCHC) decreased and the percent high-density red cells was reduced. Deoxy K(+) efflux is characteristic of red cells in sickle cell disease and contributes to the disease process by increasing the MCHC and rendering the cells more susceptible to polymer formation. This flux versus the room air flux was reduced in S+S-Antilles red cells from an average value of 1.6 +/- 0.3 mmol per liter of red cells x minute (FU) in nonsupplemented mice to 0.9 +/- 0.3 FU (n = 4, P < .02, paired t test) in supplemented mice. In room air, V(max) of the Ca(++)-activated K(+) channel (Gardos) was reduced from 4.1 +/- 0.6 FU (off diet) to 2.6 +/- 0.4 FU (n = 7 and 8, P < .04, t test) in arginine-supplemented mice versus clotrimazole. In conclusion, the major mechanism by which arginine supplementation reduces red cell density (MCHC) in S+S-Antilles mice is by inhibiting the Ca(++)-activated K(+) channel.

  3. Expression and immunogenicity of enterotoxigenic Escherichia coli heat-labile toxin B subunit in transgenic rice callus.

    PubMed

    Kim, Tae-Geum; Kim, Bang-Geul; Kim, Mi-Young; Choi, Jae-Kwon; Jung, Eun-Sun; Yang, Moon-Sik

    2010-01-01

    Enterotoxigenic Escherichia coli is one of the leading causes of diarrhea in developing countries, and the disease may be fatal in the absence of treatment. Enterotoxigenic E. coli heat-labile toxin B subunit (LTB) can be used as an adjuvant, as a carrier of fused antigens, or as an antigen itself. The synthetic LTB (sLTB) gene, optimized for plant codon usage, has been introduced into rice cells by particle bombardment-mediated transformation. The integration and expression of the sLTB gene were observed via genomic DNA PCR and western blot analysis, respectively. The binding activity of LTB protein expressed in transgenic rice callus to G(M1)-ganglioside, a receptor for biologically active LTB, was confirmed by G(M1)-ELISA. Oral inoculation of mice with lyophilized transgenic rice calli containing LTB generated significant IgG antibody titers against bacterial LTB, and the sera of immunized mice inhibited the binding of bacterial LTB to G(M1)-ganglioside. Mice orally immunized with non-transgenic rice calli failed to generate detectable anti-LTB IgG antibody titers. Mice immunized with plant-produced LTB generated higher IgG1 antibody titers than IgG2a, indicating a Th2-type immune response. Mice orally immunized with lyophilized transgenic rice calli containing LTB elicited higher fecal IgA antibody titers than mice immunized with non-transgenic rice calli. These experimental results demonstrate that LTB proteins produced in transgenic rice callus and given to mice by oral administration induce humoral and secreted antibody immune responses. We suggest that transgenic rice callus may be suitable as a plant-based edible vaccine to provide effective protection against enterotoxigenic E. coli heat-labile toxin.

  4. Genomic interval engineering of mice identified a novel modulator of triglyceride production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Y.; Jong, M.C.; Frazer, K.A.

    1999-10-01

    To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

  5. Combined Allogeneic Tumor Cell Vaccination and Systemic Interleukin 12 Prevents Mammary Carcinogenesis in HER-2/neu Transgenic Mice

    PubMed Central

    Nanni, Patrizia; Nicoletti, Giordano; De Giovanni, Carla; Landuzzi, Lorena; Di Carlo, Emma; Cavallo, Federica; Pupa, Serenella M.; Rossi, Ilaria; Colombo, Mario P.; Ricci, Cinzia; Astolfi, Annalisa; Musiani, Piero; Forni, Guido; Lollini, Pier-Luigi

    2001-01-01

    Transgenic Balb/c mice expressing the transforming rat HER-2/neu oncogene develop early and multifocal mammary carcinomas. Within the first 5 months of life the tissue-specific expression of HER-2/neu causes a progression in all their 10 mammary glands from atypical hyperplasia to invasive carcinoma. It was previously observed that chronic administration of interleukin (IL)-12 increased tumor latency, but every mouse eventually succumbed to multiple carcinomas. A significant improvement in tumor prevention was sought by administering allogeneic mammary carcinoma cells expressing HER-2/neu combined with systemic IL-12. This treatment reduced tumor incidence by 90% and more than doubled mouse lifetime. For the maximum prevention p185neu antigen must be expressed by allogeneic cells. IL-12 treatment strongly increased the cell vaccine efficacy. The mammary glands of mice receiving the combined treatment displayed a markedly reduced epithelial cell proliferation, angiogenesis, and HER-2/neu expression, while the few hyperplastic foci were heavily infiltrated by granulocytes, macrophages, and CD8+ lymphocytes. Specific anti–HER-2/neu antibodies were produced and a nonpolarized activation of CD4+ and CD8+ cells secreting IL-4 and interferon (IFN)-γ were evident. A central role for IFN-γ in the preventive effect was proven by the lack of efficacy of vaccination in IFN-γ gene knockout HER-2/neu transgenic Balb/c mice. A possible requirement for IFN-γ is related to its effect on antibody production, in particular on IgG2a and IgG2b subclasses, that were not induced in IFN-γ knockout HER-2/neu mice. In conclusion, our data show that an allogeneic HER-2/neu–expressing cell vaccine combined with IL-12 systemic treatment can prevent the onset of genetically determined tumors. PMID:11696586

  6. Erinacine A-enriched Hericium erinaceus mycelium ameliorates Alzheimer's disease-related pathologies in APPswe/PS1dE9 transgenic mice.

    PubMed

    Tsai-Teng, Tzeng; Chin-Chu, Chen; Li-Ya, Lee; Wan-Ping, Chen; Chung-Kuang, Lu; Chien-Chang, Shen; Chi-Ying, Huang F; Chien-Chih, Chen; Shiao, Young-Ji

    2016-06-27

    The fruiting body of Hericium erinaceus has been demonstrated to possess anti-dementia activity in mouse model of Alzheimer's disease and people with mild cognitive impairment. However, the therapeutic potential of Hericium erinaceus mycelia on Alzheimer's disease remains unclear. In this study, the effects of erinacine A-enriched Hericium erinaceus mycelia (HE-My) on the pathological changes in APPswe/PS1dE9 transgenic mouse model of Alzheimer's disease are studied. After a 30 day oral administration to 5 month-old female APPswe/PS1dE9 transgenic mice, we found that HE-My and its ethanol extracts (HE-Et) attenuated cerebral Aβ plaque burden. It's worth noting that the attenuated portion of a plaque is the non-compact structure. The level of insulin-degrading enzyme was elevated by both HE-My and HE-Et in cerebral cortex. On the other hand, the number of plaque-activated microglia and astrocytes in cerebral cortex and hippocampus were diminished, the ratio of nerve growth factor (NGF) to NGF precursor (proNGF) was increased and hippocampal neurogenesis was promoted after these administrations. All the mentioned benefits of these administrations may therefore improve the declined activity of daily living skill in APPswe/PS1dE9 transgenic mice. These results highlight the therapeutic potential of HE-My and HE-Et on Alzheimer's disease. Therefore, the effective components of HE-My and HE-Et are worth to be developed to become a therapeutic drug for Alzheimer's disease.

  7. Chromosomal position effects in chicken lysozyme gene transgenic mice are correlated with suppression of DNase I hypersensitive site formation.

    PubMed Central

    Huber, M C; Bosch, F X; Sippel, A E; Bonifer, C

    1994-01-01

    The complete chicken lysozyme gene locus is expressed copy number dependently and at a high level in macrophages of transgenic mice. Gene expression independent of genomic position can only be achieved by the concerted action of all cis regulatory elements located on the lysozyme gene domain. Position independency of expression is lost if one essential cis regulatory region is deleted. Here we compared the DNase I hypersensitive site (DHS) pattern formed on the chromatin of position independently and position dependently expressed transgenes in order to assess the influence of deletions within the gene domain on active chromatin formation. We demonstrate, that in position independently expressed transgene all DHSs are formed with the authentic relative frequency on all genes. This is not the case for position dependently expressed transgenes. Our results show that the formation of a DHS during cellular differentiation does not occur autonomously. In case essential regulatory elements of the chicken lysozyme gene domain are lacking, the efficiency of DHS formation on remaining cis regulatory elements during myeloid differentiation is reduced and influenced by the chromosomal position. Hence, no individual regulatory element on the lysozyme domain is capable of organizing the chromatin structure of the whole locus in a dominant fashion. Images PMID:7937145

  8. Curcumin Suppresses Soluble Tau Dimers and Corrects Molecular Chaperone, Synaptic, and Behavioral Deficits in Aged Human Tau Transgenic Mice*

    PubMed Central

    Ma, Qiu-Lan; Zuo, Xiaohong; Yang, Fusheng; Ubeda, Oliver J.; Gant, Dana J.; Alaverdyan, Mher; Teng, Edmond; Hu, Shuxin; Chen, Ping-Ping; Maiti, Panchanan; Teter, Bruce; Cole, Greg M.; Frautschy, Sally A.

    2013-01-01

    The mechanisms underlying Tau-related synaptic and cognitive deficits and the interrelationships between Tau species, their clearance pathways, and synaptic impairments remain poorly understood. To gain insight into these mechanisms, we examined these interrelationships in aged non-mutant genomic human Tau mice, with established Tau pathology and neuron loss. We also examined how these interrelationships changed with an intervention by feeding mice either a control diet or one containing the brain permeable beta-amyloid and Tau aggregate binding molecule curcumin. Transgene-dependent elevations in soluble and insoluble phospho-Tau monomer and soluble Tau dimers accompanied deficits in behavior, hippocampal excitatory synaptic markers, and molecular chaperones (heat shock proteins (HSPs)) involved in Tau degradation and microtubule stability. In human Tau mice but not control mice, HSP70, HSP70/HSP72, and HSP90 were reduced in membrane-enriched fractions but not in cytosolic fractions. The synaptic proteins PSD95 and NR2B were reduced in dendritic fields and redistributed into perikarya, corresponding to changes observed by immunoblot. Curcumin selectively suppressed levels of soluble Tau dimers, but not of insoluble and monomeric phospho-Tau, while correcting behavioral, synaptic, and HSP deficits. Treatment increased PSD95 co-immunoprecipitating with NR2B and, independent of transgene, increased HSPs implicated in Tau clearance. It elevated HSP90 and HSC70 without increasing HSP mRNAs; that is, without induction of the heat shock response. Instead curcumin differentially impacted HSP90 client kinases, reducing Fyn without reducing Akt. In summary, curcumin reduced soluble Tau and elevated HSPs involved in Tau clearance, showing that even after tangles have formed, Tau-dependent behavioral and synaptic deficits can be corrected. PMID:23264626

  9. Hypoxia-activated cytotoxic agent tirapazamine enhances hepatic artery ligation-induced killing of liver tumor in HBx transgenic mice

    PubMed Central

    Lin, Wei-Hsiang; Yeh, Shiou-Hwei; Yeh, Kun-Huei; Chen, Kai-Wei; Cheng, Ya-Wen; Su, Tung-Hung; Jao, Ping; Ni, Lin-Chun; Chen, Pei-Jer; Chen, Ding-Shinn

    2016-01-01

    Transarterial chemoembolization (TACE) is the main treatment for intermediate stage hepatocellular carcinoma (HCC) with Barcelona Clinic Liver Cancer classification because of its exclusive arterial blood supply. Although TACE achieves substantial necrosis of the tumor, complete tumor necrosis is uncommon, and the residual tumor generally rapidly recurs. We combined tirapazamine (TPZ), a hypoxia-activated cytotoxic agent, with hepatic artery ligation (HAL), which recapitulates transarterial embolization in mouse models, to enhance the efficacy of TACE. The effectiveness of this combination treatment was examined in HCC that spontaneously developed in hepatitis B virus X protein (HBx) transgenic mice. We proved that the tumor blood flow in this model was exclusively supplied by the hepatic artery, in contrast to conventional orthotopic HCC xenografts that receive both arterial and venous blood supplies. At levels below the threshold oxygen levels created by HAL, TPZ was activated and killed the hypoxic cells, but spared the normoxic cells. This combination treatment clearly limited the toxicity of TPZ to HCC, which caused the rapid and near-complete necrosis of HCC. In conclusion, the combination of TPZ and HAL showed a synergistic tumor killing activity that was specific for HCC in HBx transgenic mice. This preclinical study forms the basis for the ongoing clinical program for the TPZ-TACE regimen in HCC treatment. PMID:27702890

  10. Characterization of pancreatic glucagon-producing tumors and pituitary gland tumors in transgenic mice overexpressing MYCN in hGFAP-positive cells.

    PubMed

    Fielitz, Kathrin; Althoff, Kristina; De Preter, Katleen; Nonnekens, Julie; Ohli, Jasmin; Elges, Sandra; Hartmann, Wolfgang; Klöppel, Günter; Knösel, Thomas; Schulte, Marc; Klein-Hitpass, Ludger; Beisser, Daniela; Reis, Henning; Eyking, Annette; Cario, Elke; Schulte, Johannes H; Schramm, Alexander; Schüller, Ulrich

    2016-11-15

    Amplification or overexpression of MYCN is involved in development and maintenance of multiple malignancies. A subset of these tumors originates from neural precursors, including the most aggressive forms of the childhood tumors, neuroblastoma and medulloblastoma. In order to model the spectrum of MYCN-driven neoplasms in mice, we transgenically overexpressed MYCN under the control of the human GFAP-promoter that, among other targets, drives expression in neural progenitor cells. However, LSL-MYCN;hGFAP-Cre double transgenic mice did neither develop neural crest tumors nor tumors of the central nervous system, but presented with neuroendocrine tumors of the pancreas and, less frequently, the pituitary gland. Pituitary tumors expressed chromogranin A and closely resembled human pituitary adenomas. Pancreatic tumors strongly produced and secreted glucagon, suggesting that they derived from glucagon- and GFAP-positive islet cells. Interestingly, 3 out of 9 human pancreatic neuroendocrine tumors expressed MYCN, supporting the similarity of the mouse tumors to the human system. Serial transplantations of mouse tumor cells into immunocompromised mice confirmed their fully transformed phenotype. MYCN-directed treatment by AuroraA- or Brd4-inhibitors resulted in significantly decreased cell proliferation in vitro and reduced tumor growth in vivo. In summary, we provide a novel mouse model for neuroendocrine tumors of the pancreas and pituitary gland that is dependent on MYCN expression and that may help to evaluate MYCN-directed therapies.

  11. Ocular inflammation in HLA-B27 transgenic mice reveals a potential role for MHC class I in corneal immune privilege.

    PubMed

    Lin, Aifeng; Guo, Xiaoxin; Inman, Robert D; Sivak, Jeremy M

    2015-01-01

    HLA-B27 is a major histocompatibility complex class I (MHCI) allele that has been closely associated with the development of ankylosing spondylitis and acute anterior uveitis (AAU), the most common form of uveitis worldwide. We have been characterizing the phenotypes of transgenic mice carrying a human HLA-B27 allele, but that are deficient in endogenous mouse MHCI genes (H-2K(-/-) and H-2D(-/-) double knockout, or DKO) to create the HLA-B27/DKO line. In maintaining and expanding this colony, we observed a rare sporadic severe central keratitis that developed in transgenic animals, but that was not present in wild-type (WT) animals. The corneas of affected HLA-B27/DKO and DKO mice were compared to their WT counterparts by staining with standard histological methods for markers of inflammation and neovascularization. A model of experimental corneal inflammation was subsequently used to test the responses of each genotype to insult. We identified a previously unreported corneal pathology in naïve HLA-B27/DKO mice, and we describe significantly prolonged CD4(+)- and CD8(+)-associated inflammation in these animals following an experimentally induced corneal injury. These results demonstrate an increased T-cell response in B27/DKO corneas due to the expression of the HLA-B27 allele, suggesting that low MHCI expression in WT corneas is an important contributor to immune privilege.

  12. Experimental sheep BSE prions generate the vCJD phenotype when serially passaged in transgenic mice expressing human prion protein.

    PubMed

    Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F

    2018-03-15

    The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Bone-derived mesenchymal stromal cells from HIV transgenic mice exhibit altered proliferation, differentiation capacity and paracrine functions along with impaired therapeutic potential in kidney injury

    PubMed Central

    Cheng, Kang; Rai, Partab; Lan, Xiqian; Plagov, Andrei; Malhotra, Ashwani; Gupta, Sanjeev; Singhal, Pravin C

    2013-01-01

    Mesenchymal stem cells (MSCs) secrete paracrine factors that could be cytoprotective and serve roles in immunoregulation during tissue injury. Although MSCs express HIV receptors, and co-receptors, and are susceptible to HIV infection, whether HIV-1 may affect biological properties of MSCs needs more study. We evaluated cellular proliferation, differentiation and paracrine functions of MSCs isolated from compact bones of healthy control mice and Tg26 HIV-1 transgenic mice. The ability of MSCs to protect against cisplatin toxicity was studied in cultured renal tubular cells as well as in intact mice. We successfully isolated MSCs from healthy mice and Tg26 HIV-1 transgenic mice and found the latter expressed viral Nef, Vpu, NL4-3 and Vif genes. The proliferation and differentiation of Tg26 HIV-1 MSCs was inferior to MSCs from healthy mice. Moreover, transplantation of Tg26 HIV-1 MSCs less effectively improved outcomes compared with healthy MSCs in mice with acute kidney injury. Also, Tg26 HIV-1 MSCs secreted multiple cytokines, but at significantly lower levels than healthy MSCs, which resulted in failure of conditioned medium from these MSCs to protect cultured renal tubular cells from cisplatin toxicity. Therefore, HIV-1 had adverse biological effects on MSCs extending to their proliferation, differentiation, function, and therapeutic potential. These findings will help in advancing mechanistical insight in renal injury and repair in the setting of HIV-1 infection. PMID:23806280

  14. Mini-dystrophin restores L-type calcium currents in skeletal muscle of transgenic mdx mice

    PubMed Central

    Friedrich, O; Both, M; Gillis, J M; Chamberlain, J S; Fink, RHA

    2004-01-01

    L-type calcium currents (iCa) were recorded using the two-microelectrode voltage-clamp technique in single short toe muscle fibres of three different mouse strains: (i) C57/SV129 wild-type mice (wt); (ii) mdx mice (an animal model for Duchenne muscular dystrophy; and (iii) transgenically engineered mini-dystrophin (MinD)-expressing mdx mice. The activation and inactivation properties of iCa were examined in 2- to 18-month-old animals. Ca2+ current densities at 0 mV in mdx fibres increased with age, but were always significantly smaller compared to age-matched wild-type fibres. Time-to-peak (TTP) of iCa was prolonged in mdx fibres compared to wt fibres. MinD fibres always showed similar TTP and current amplitudes compared to age-matched wt fibres. In all three genotypes, the voltage-dependent inactivation and deactivation of iCa were similar. Intracellular resting calcium concentration ([Ca2+]i) and the distribution of dihydropyridine binding sites were also not different in young animals of all three genotypes, whereas iCa was markedly reduced in mdx fibres. We conclude, that dystrophin influences L-type Ca2+ channels via a direct or indirect linkage which may be disrupted in mdx mice and may be crucial for proper excitation–contraction coupling initiating Ca2+ release from the sarcoplasmic reticulum. This linkage seems to be fully restored in the presence of mini-dystrophin. PMID:14594987

  15. Tcf4 transgenic female mice display delayed adaptation in an auditory latent inhibition paradigm.

    PubMed

    Brzózka, M M; Rossner, M J; de Hoz, L

    2016-09-01

    Schizophrenia (SZ) is a severe mental disorder affecting about 1 % of the human population. Patients show severe deficits in cognitive processing often characterized by an improper filtering of environmental stimuli. Independent genome-wide association studies confirmed a number of risk variants for SZ including several associated with the gene encoding the transcription factor 4 (TCF4). TCF4 is widely expressed in the central nervous system of mice and humans and seems to be important for brain development. Transgenic mice overexpressing murine Tcf4 (Tcf4tg) in the adult brain display cognitive impairments and sensorimotor gating disturbances. To address the question of whether increased Tcf4 gene dosage may affect cognitive flexibility in an auditory associative task, we tested latent inhibition (LI) in female Tcf4tg mice. LI is a widely accepted translational endophenotype of SZ and results from a maladaptive delay in switching a response to a previously unconditioned stimulus when this becomes conditioned. Using an Audiobox, we pre-exposed Tcf4tg mice and their wild-type littermates to either a 3- or a 12-kHz tone before conditioning them to a 12-kHz tone. Tcf4tg animals pre-exposed to a 12-kHz tone showed significantly delayed conditioning when the previously unconditioned tone became associated with an air puff. These results support findings that associate TCF4 dysfunction with cognitive inflexibility and improper filtering of sensory stimuli observed in SZ patients.

  16. Transgenic mice that accept Luciferase- or GFP-expressing syngeneic tumor cells at high efficiencies.

    PubMed

    Aoyama, Naoki; Miyoshi, Hiroyuki; Miyachi, Hitoshi; Sonoshita, Masahiro; Okabe, Masaru; Taketo, Makoto Mark

    2018-05-11

    Jellyfish green fluorescent protein (GFP) and firefly luciferase can serve as versatile tracking markers for identification and quantification of transplanted cancer cells in vivo. However, immune reactions against these markers can hamper the formation of syngraft tumors and metastasis that follows. Here, we report two transgenic (Tg) mouse lines that express nonfunctional mutant marker proteins, namely modified firefly luciferase (Luc2) or enhanced GFP (EGFP). These mice, named as Tg-mLuc2 and Tg-mEGFP, turned out to be immunologically tolerant to the respective tracking markers and thus efficiently accepted syngeneic cancer cells expressing the active forms of the markers. We then injected intrarectally the F 1 hybrid Tg mice (BALB/c × C57BL/6J) with Colon-26 (C26) colon cancer cells that originated from a BALB/c mouse. Even when C26 cells expressed active Luc2 or EGFP, they formed primary tumors in the Tg mice with only 10 4 cells per mouse compared with more than 10 6 cells required in the nontransgenic BALB/c hosts. Furthermore, we detected metastatic foci of C26 cells in the liver and lungs of the Tg mice by tracking the specific reporter activities. These results show the usefulness of the Tg mouse lines as recipients for transplantation experiments with the non-self tracking marker-expressing cells. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  17. Corneal NF-kappaB activity is necessary for the retention of transparency in the cornea of UV-B-exposed transgenic reporter mice.

    PubMed

    Alexander, George; Carlsen, Harald; Blomhoff, Rune

    2006-04-01

    To determine the dynamics of Nuclear Factor-kappaB (NF-kappaB) in murine corneal pathology and the role of NF-kappaB in maintaining corneal clarity after ultraviolet B radiation insult, transgenic mice containing NF-kappaB-luciferase reporter were exposed to LPS (bacterial lipopolysaccharide), TNF-alpha (Tumor Necrosis Factor-alpha) or 4 kJ m(-2) UV-B radiation. NF-kappaB decoy oligonucleotides were also administered in some of the UV-B experiments. Following various exposure times, the mice were sacrificed and whole eyes or corneal tissues were obtained. Whole eyes were examined for scattering using a point-source optical imaging technique. Tissue homogenates were examined for luciferase activity using a luminometer. TNF-alpha and LPS-injected NF-kappaB-luciferase transgenic mice demonstrated 3-10-fold increases in cornea NF-kappaB with peak activities at 4 and 6 hr post-injection, respectively. Mice exposed to 4 kJ m(-2) UV-B exhibited a 3-fold increase in NF-kappaB activity 4 hr post-exposure. The administration of NF-kappaB-decoy oligonucleotides to mice had the effect of reducing UV-B-induced NF-kappaB activity in the cornea and significantly increasing the amount of light scattering in UV-B exposed corneas 7 days post-UV-B exposure when compared to sham injected mice. These results indicate that NF-kappaB is activated in cornea in pathologies that involves increased plasma levels of LPS and TNF-alpha, as well as direct UV-B exposure, and suggest that NF-kappaB activation play an essential part in the corneal healing process.

  18. Transgenic Mice with Increased Astrocyte Expression of IL-6 Show Altered Effects of Acute Ethanol on Synaptic Function

    PubMed Central

    Hernandez, Ruben V.; Puro, Alana C.; Manos, Jessica C.; Huitron-Resendiz, Salvador; Reyes, Kenneth C.; Liu, Kevin; Vo, Khanh; Roberts, Amanda J.; Gruol, Donna L.

    2015-01-01

    A growing body of evidence has revealed that resident cells of the central nervous system (CNS), and particularly the glial cells, comprise a neuroimmune system that serves a number of functions in the normal CNS and during adverse conditions. Cells of the neuroimmune system regulate CNS functions through the production of signaling factors, referred to as neuroimmune factors. Recent studies show that ethanol can activate cells of the neuroimmune system, resulting in the elevated production of neuroimmune factors, including the cytokine interleukin-6 (IL-6). Here we analyzed the consequences of this CNS action of ethanol using transgenic mice that express elevated levels of IL-6 through increased astrocyte expression (IL-6-tg) to model the increased IL-6 expression that occurs with ethanol use. Results show that increased IL-6 expression induces neuroadaptive changes that alter the effects of ethanol. In hippocampal slices from non-transgenic (non-tg) littermate control mice, synaptically evoked dendritic field excitatory postsynaptic potential (fEPSP) and somatic population spike (PS) at the Schaffer collateral to CA1 pyramidal neuron synapse were reduced by acute ethanol (20 or 60 mM). In contrast, acute ethanol enhanced the fEPSP and PS in hippocampal slices from IL-6 tg mice. Long-term synaptic plasticity of the fEPSP (i.e., LTP) showed the expected dose-dependent reduction by acute ethanol in non-tg hippocampal slices, whereas LTP in the IL-6 tg hippocampal slices was resistant to this depressive effect of acute ethanol. Consistent with altered effects of acute ethanol on synaptic function in the IL-6 tg mice, EEG recordings showed a higher level of CNS activity in the IL-6 tg mice than in the non-tg mice during the period of withdrawal from an acute high dose of ethanol. These results suggest a potential role for neuroadaptive effects of ethanol-induced astrocyte production of IL-6 as a mediator or modulator of the actions of ethanol on the CNS, including

  19. Pesticide exposure exacerbates alpha-synucleinopathy in an A53T transgenic mouse model.

    PubMed

    Norris, Erin H; Uryu, Kunihiro; Leight, Susan; Giasson, Benoit I; Trojanowski, John Q; Lee, Virginia M-Y

    2007-02-01

    The factors initiating or contributing to the pathogenesis of Parkinson's disease and related neurodegenerative synucleinopathies are still largely unclear, but environmental factors such as pesticides have been implicated. In this study, A53T mutant human alpha-synuclein transgenic mice (M83), which develop alpha-synuclein neuropathology, were treated with the pesticides paraquat and maneb (either singly or together), and their effects were analyzed. Immunohistochemical and biochemical analyses showed that chronic treatment of M83 transgenic mice with both pesticides (but not with either pesticide alone) drastically increased neuronal alpha-synuclein pathology throughout the central nervous system including the hippocampus, cerebellum, and sensory and auditory cortices. alpha-Synuclein-associated mitochondrial degeneration was observed in M83 but not in wild-type alpha-synuclein transgenic mice. Because alpha-synuclein inclusions accumulated in pesticide-exposed M83 transgenic mice without a motor phenotype, we conclude that alpha-synuclein aggregate formation precedes disease onset. These studies support the notion that environmental factors causing nitrative damage are closely linked to mechanisms underlying the formation of alpha-synuclein pathologies and the onset of Parkinson's-like neurodegeneration.

  20. Construction of a Der p2-transgenic plant for the alleviation of airway inflammation

    PubMed Central

    Lee, CC; Ho, H; Lee, KT; Jeng, ST; Chiang, BL

    2011-01-01

    In clinical therapy, the amount of antigen administered to achieve oral tolerance for allergic diseases is large, and the cost is a major consideration. In this study, we used tobacco plants to develop a large-scale protein production system for allergen-specific immunotherapy, and we investigated the mechanisms of oral tolerance induced by a transgenic plant-derived antigen. We used plants (tobacco leaves) transgenic for the Dermatophagoides pteronyssinus 2 (Der p2) antigen to produce Der p2. Mice received total protein extract from Der p2 orally once per day over 6 days (days 0–2 and days 6–8). Mice were also sensitized and challenged with yeast-derived recombinant Der p2 (rDer p2), after which the mice were examined for airway hyper-responsiveness and airway inflammation. After sensitization and challenge with rDer p2, mice that were fed with total protein extracted from transgenic plants showed decreases in serum Der p2-specific IgE and IgG1 titers, decreased IL-5 and eotaxin levels in bronchial alveolar lavage fluid, and eosinophil infiltration in the airway. In addition, hyper-responsiveness was also decreased in mice that were fed with total protein extracted from transgenic plants, and CD4+CD25+Foxp3+ regulatory T cells were significantly increased in mediastinal and mesenteric lymph nodes. Furthermore, splenocytes isolated from transgenic plant protein-fed mice exhibited decreased proliferation and increased IL-10 secretion after stimulation with rDer p2. The data here suggest that allergen-expressing transgenic plants could be used for therapeutic purposes for allergic diseases. PMID:21602845

  1. GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice.

    PubMed

    Lew, D; Brady, H; Klausing, K; Yaginuma, K; Theill, L E; Stauber, C; Karin, M; Mellon, P L

    1993-04-01

    During pituitary development, the homeo domain protein GHF-1 is required for generation of somatotropes and lactotropes and for growth hormone (GH) and prolactin (PRL) gene expression. GHF-1 mRNA is detectable several days before the emergence of GH- or PRL-expressing cells, suggesting the existence of a somatotropic progenitor cell in which GHF-1 transcription is first activated. We have immortalized this cell type by using the GHF-1 regulatory region to target SV40 T-antigen (Tag) tumorigenesis in transgenic mice. The GHF-Tag transgene caused developmental entrapment of somatotropic progenitor cells that express GHF-1 but not GH or PRL, resulting in dwarfism. Immortalized cell lines derived from a transgenic pituitary tumor maintain the characteristics of the somato/lactotropic progenitor in that they express GHF-1 mRNA and protein yet fail to activate GH or PRL transcription. Using these cells, we identified an enhancer that activates GHF-1 transcription at this early stage of development yet is inactive in cells representing later developmental stages of the somatotropic lineage or in other cell types. These experiments not only demonstrate the potential for immortalization of developmental progenitor cells using the regulatory regions from cell type-specific transcription factor genes but illustrate the power of such model systems in the study of developmental control.

  2. Post-natal hypoxic activity of the central respiratory command is improved in transgenic mice overexpressing Epo in the brain.

    PubMed

    Caravagna, Céline; Kinkead, Richard; Soliz, Jorge

    2014-08-15

    Previous studies indicated that erythropoietin modulates central respiratory command in mice. Specifically, a one-hour incubation of the brainstems with erythropoietin attenuates hypoxia-induced central respiratory depression. Here, using transgenic mice constitutively overexpressing erythropoietin specifically in the brain (Tg21), we investigated the effect of chronic erythropoietin stimulation on central respiratory command activity during post-natal development. In vitro brainstem-spinal cord preparations from mice at 0 (P0) or 3 days of age (P3) were used to record the fictive inspiratory activity from the C4 ventral root. Our results show that erythropoietin already stimulates the hypoxic burst frequency at P0, and at P3, erythropoietin effectively stimulates the hypoxic burst frequency and amplitude. Because the maturation of the central respiratory command in mice is characterized by a decrease in the burst frequency with age, our results also suggest that erythropoietin accelerates the maturation of the newborn respiratory network and its response to hypoxia. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Hepatitis C virus core protein targets 4E-BP1 expression and phosphorylation and potentiates Myc-induced liver carcinogenesis in transgenic mice.

    PubMed

    Abdallah, Cosette; Lejamtel, Charlène; Benzoubir, Nassima; Battaglia, Serena; Sidahmed-Adrar, Nazha; Desterke, Christophe; Lemasson, Matthieu; Rosenberg, Arielle R; Samuel, Didier; Bréchot, Christian; Pflieger, Delphine; Le Naour, François; Bourgeade, Marie-Françoise

    2017-08-22

    Hepatitis C virus (HCV) is a leading cause of liver diseases including the development of hepatocellular carcinoma (HCC). Particularly, core protein has been involved in HCV-related liver pathologies. However, the impact of HCV core on signaling pathways supporting the genesis of HCC remains largely elusive. To decipher the host cell signaling pathways involved in the oncogenic potential of HCV core, a global quantitative phosphoproteomic approach was carried out. This study shed light on novel differentially phosphorylated proteins, in particular several components involved in translation. Among the eukaryotic initiation factors that govern the translational machinery, 4E-BP1 represents a master regulator of protein synthesis that is associated with the development and progression of cancers due to its ability to increase protein expression of oncogenic pathways. Enhanced levels of 4E-BP1 in non-modified and phosphorylated forms were validated in human hepatoma cells and in mouse primary hepatocytes expressing HCV core, in the livers of HCV core transgenic mice as well as in HCV-infected human primary hepatocytes. The contribution of HCV core in carcinogenesis and the status of 4E-BP1 expression and phosphorylation were studied in HCV core/Myc double transgenic mice. HCV core increased the levels of 4E-BP1 expression and phosphorylation and significantly accelerated the onset of Myc-induced tumorigenesis in these double transgenic mice. These results reveal a novel function of HCV core in liver carcinogenesis potentiation. They position 4E-BP1 as a tumor-specific target of HCV core and support the involvement of the 4E-BP1/eIF4E axis in hepatocarcinogenesis.

  4. Antagonist of peroxisome proliferator-activated receptor {gamma} induces cerebellar amyloid-{beta} levels and motor dysfunction in APP/PS1 transgenic mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Du, Jing; Sun, Bing; Chen, Kui

    2009-07-03

    Recent evidences show that peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) is involved in the modulation of the amyloid-{beta} (A{beta}) cascade causing Alzheimer's disease (AD) and treatment with PPAR{gamma} agonists protects against AD pathology. However, the function of PPAR{gamma} steady-state activity in A{beta} cascade and AD pathology remains unclear. In this study, an antagonist of PPAR{gamma}, GW9662, was injected into the fourth ventricle of APP/PS1 transgenic mice to inhibit PPAR{gamma} activity in cerebellum. The results show that inhibition of PPAR{gamma} significantly induced A{beta} levels in cerebellum and caused cerebellar motor dysfunction in APP/PS1 transgenic mice. Moreover, GW9662 treatment markedly decreased the cerebellarmore » levels of insulin-degrading enzyme (IDE), which is responsible for the cellular degradation of A{beta}. Since cerebellum is spared from significant A{beta} accumulation and neurotoxicity in AD patients and animal models, these findings suggest a crucial role of PPAR{gamma} steady-state activity in protection of cerebellum against AD pathology.« less

  5. Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

    PubMed

    Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

    2015-01-01

    High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

  6. Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

    PubMed Central

    Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

  7. Reduction of VLDL secretion decreases cholesterol excretion in niemann-pick C1-like 1 hepatic transgenic mice.

    PubMed

    Marshall, Stephanie M; Kelley, Kathryn L; Davis, Matthew A; Wilson, Martha D; McDaniel, Allison L; Lee, Richard G; Crooke, Rosanne M; Graham, Mark J; Rudel, Lawrence L; Brown, J Mark; Temel, Ryan E

    2014-01-01

    An effective way to reduce LDL cholesterol, the primary risk factor of atherosclerotic cardiovascular disease, is to increase cholesterol excretion from the body. Our group and others have recently found that cholesterol excretion can be facilitated by both hepatobiliary and transintestinal pathways. However, the lipoprotein that moves cholesterol through the plasma to the small intestine for transintestinal cholesterol efflux (TICE) is unknown. To test the hypothesis that hepatic very low-density lipoproteins (VLDL) support TICE, antisense oligonucleotides (ASO) were used to knockdown hepatic expression of microsomal triglyceride transfer protein (MTP), which is necessary for VLDL assembly. While maintained on a high cholesterol diet, Niemann-Pick C1-like 1 hepatic transgenic (L1Tg) mice, which predominantly excrete cholesterol via TICE, and wild type (WT) littermates were treated with control ASO or MTP ASO. In both WT and L1Tg mice, MTP ASO decreased VLDL triglyceride (TG) and cholesterol secretion. Regardless of treatment, L1Tg mice had reduced biliary cholesterol compared to WT mice. However, only L1Tg mice treated with MTP ASO had reduced fecal cholesterol excretion. Based upon these findings, we conclude that VLDL or a byproduct such as LDL can move cholesterol from the liver to the small intestine for TICE.

  8. Lead suppresses chimeric human transferrin gene expression in transgenic mouse liver.

    PubMed

    Adrian, G S; Rivera, E V; Adrian, E K; Lu, Y; Buchanan, J; Herbert, D C; Weaker, F J; Walter, C A; Bowman, B H

    1993-01-01

    The major iron-transport protein in serum is transferrin (TF) which also has the capacity to transport other metals. This report presents evidence that synthesis of human TF can be regulated by the metal lead. Transgenic mice carrying chimeric human TF-chloramphenicol acetyl transferase (CAT) genes received lead or sodium salts by intraperitoneal injections or in drinking water. Transgene expression in liver was suppressed 31 to 50% by the lead treatment. Lead regulates human TF transgenes at the mRNA level since liver CAT enzyme activity, CAT protein, and TF-CAT mRNA levels were all suppressed. The dosages of lead did not alter synthesis of the other liver proteins, mouse TF and albumin, as measured by Northern blot analysis of total liver RNA and rocket immunoelectrophoresis of mouse sera. Moderate levels of lead exposure were sufficient to evoke the human TF transgene response; blood lead levels in mice that received lead acetate in drinking water ranged from 30 micrograms/dl to 56 micrograms/dl. In addition to suppressing expression of TF-CAT genes in transgenic mice, lead also suppressed synthesis of TF protein in cultured human hepatoma HepG2 cells. The regulation of human TF apparently differs from the regulation of mouse TF which is unresponsive to lead exposure.

  9. Transgenic overexpression of Niemann-Pick C2 protein promotes cholesterol gallstone formation in mice.

    PubMed

    Acuña, Mariana; González-Hódar, Lila; Amigo, Ludwig; Castro, Juan; Morales, M Gabriela; Cancino, Gonzalo I; Groen, Albert K; Young, Juan; Miquel, Juan Francisco; Zanlungo, Silvana

    2016-02-01

    Niemann-Pick C2 (NPC2) is a lysosomal protein involved in the egress of low-density lipoprotein-derived cholesterol from lysosomes to other intracellular compartments. NPC2 has been detected in several tissues and is also secreted from the liver into bile. We have previously shown that NPC2-deficient mice fed a lithogenic diet showed reduced biliary cholesterol secretion as well as cholesterol crystal and gallstone formation. This study aimed to investigate the consequences of NPC2 hepatic overexpression on liver cholesterol metabolism, biliary lipid secretion, gallstone formation and the effect of NPC2 on cholesterol crystallization in model bile. We generated NPC2 transgenic mice (Npc2.Tg) and fed them either chow or lithogenic diets. We studied liver cholesterol metabolism, biliary lipid secretion, bile acid composition and gallstone formation. We performed cholesterol crystallization studies in model bile using a recombinant NPC2 protein. No differences were observed in biliary cholesterol content or secretion between wild-type and Npc2.Tg mice fed the chow or lithogenic diets. Interestingly, Npc2.Tg mice showed an increased susceptibility to the lithogenic diet, developing more cholesterol gallstones at early times, but did not show differences in the bile acid hydrophobicity and gallbladder cholesterol saturation indices compared to wild-type mice. Finally, recombinant NPC2 decreased nucleation time in model bile. These results suggest that NPC2 promotes cholesterol gallstone formation by decreasing the cholesterol nucleation time, indicating a pro-nucleating function of NPC2 in bile. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  10. Effects of Astaxanthin and Docosahexaenoic-Acid-Acylated Astaxanthin on Alzheimer's Disease in APP/PS1 Double-Transgenic Mice.

    PubMed

    Che, Hongxia; Li, Qian; Zhang, Tiantian; Wang, Dandan; Yang, Lu; Xu, Jie; Yanagita, Teruyoshi; Xue, Changhu; Chang, Yaoguang; Wang, Yuming

    2018-05-16

    Alzheimer's disease (AD) is a progressive neurodegenerative disorder with the characteristics of senile plaques, neuroinflammation, neurofibrillary tangles, and destruction of synapse structure stability. Previous studies have verified the protective effects of astaxanthin (AST). However, whether synthesized docosahexaenoic-acid-acylated AST diesters (AST-DHA) could delay AD pathogenesis remains unclear. In the present study, APP/PSEN1 (APP/PS1) double-transgenic mice were administrated with AST and AST-DHA for 2 months. The results of radial 8-arm maze and Morris water maze tests showed that AST-DHA exerted more significant effects than AST in enhancing learning and memory levels of APP/PS1 mice. Further mechanical studies suggested that AST-DHA was superior to AST in regulating the parameters of oxidative stress, reducing tau hyperphosphorylation, suppressing neuroinflammation, and regulating inflammasome expression and activation in APP/PS1 mice. The findings suggested that AST-DHA attenuated cognitive disorders by reducing pathological features in APP/PS1 mice, suggesting that AST-DHA might be a potential therapeutic agent for AD.

  11. Obesity and altered glucose metabolism impact HDL composition in CETP transgenic mice: a role for ovarian hormones[S

    PubMed Central

    Martinez, Melissa N.; Emfinger, Christopher H.; Overton, Matthew; Hill, Salisha; Ramaswamy, Tara S.; Cappel, David A.; Wu, Ke; Fazio, Sergio; McDonald, W. Hayes; Hachey, David L.; Tabb, David L.; Stafford, John M.

    2012-01-01

    Mechanisms underlying changes in HDL composition caused by obesity are poorly defined, partly because mice lack expression of cholesteryl ester transfer protein (CETP), which shuttles triglyceride and cholesteryl ester between lipoproteins. Because menopause is associated with weight gain, altered glucose metabolism, and changes in HDL, we tested the effect of feeding a high-fat diet (HFD) and ovariectomy (OVX) on glucose metabolism and HDL composition in CETP transgenic mice. After OVX, female CETP-expressing mice had accelerated weight gain with HFD-feeding and impaired glucose tolerance by hyperglycemic clamp techniques, compared with OVX mice fed a low-fat diet (LFD). Sham-operated mice (SHAM) did not show HFD-induced weight gain and had less glucose intolerance than OVX mice. Using shotgun HDL proteomics, HFD-feeding in OVX mice had a large effect on HDL composition, including increased levels of apoA2, apoA4, apoC2, and apoC3, proteins involved in TG metabolism. These changes were associated with decreased hepatic expression of SR-B1, ABCA1, and LDL receptor, proteins involved in modulating the lipid content of HDL. In SHAM mice, there were minimal changes in HDL composition with HFD feeding. These studies suggest that the absence of ovarian hormones negatively influences the response to high-fat feeding in terms of glucose tolerance and HDL composition. CETP-expressing mice may represent a useful model to define how metabolic changes affect HDL composition and function. PMID:22215797

  12. Ablation of Prion Protein in Wild Type Human Amyloid Precursor Protein (APP) Transgenic Mice Does Not Alter The Proteolysis of APP, Levels of Amyloid-β or Pathologic Phenotype

    PubMed Central

    Baybutt, Herbert; Diack, Abigail B.; Kellett, Katherine A. B.; Piccardo, Pedro; Manson, Jean C.

    2016-01-01

    The cellular prion protein (PrPC) has been proposed to play an important role in the pathogenesis of Alzheimer’s disease. In cellular models PrPC inhibited the action of the β-secretase BACE1 on wild type amyloid precursor protein resulting in a reduction in amyloid-β (Aβ) peptides. Here we have assessed the effect of genetic ablation of PrPC in transgenic mice expressing human wild type amyloid precursor protein (line I5). Deletion of PrPC had no effect on the α- and β-secretase proteolysis of the amyloid precursor protein (APP) nor on the amount of Aβ38, Aβ40 or Aβ42 in the brains of the mice. In addition, ablation of PrPC did not alter Aβ deposition or histopathology phenotype in this transgenic model. Thus using this transgenic model we could not provide evidence to support the hypothesis that PrPC regulates Aβ production. PMID:27447728

  13. Transgenic Mouse Model for Reducing Oxidative Damage in Bone

    NASA Technical Reports Server (NTRS)

    Schreurs, A.-S.; Torres, S.; Truong, T.; Kumar, A.; Alwood, J. S.; Limoli, C. L.; Globus, R. K.

    2014-01-01

    Exposure to musculoskeletal disuse and radiation result in bone loss; we hypothesized that these catabolic treatments cause excess reactive oxygen species (ROS), and thereby alter the tight balance between bone resorption by osteoclasts and bone formation by osteoblasts, culminating in bone loss. To test this, we used transgenic mice which over-express the human gene for catalase, targeted to mitochondria (MCAT). Catalase is an anti-oxidant that converts the ROS hydrogen peroxide into water and oxygen. MCAT mice were shown previously to display reduced mitochondrial oxidative stress and radiosensitivity of the CNS compared to wild type controls (WT). As expected, MCAT mice expressed the transgene in skeletal tissue, and in marrow-derived osteoblasts and osteoclast precursors cultured ex vivo, and also showed greater catalase activity compared to wildtype (WT) mice (3-6 fold). Colony expansion in marrow cells cultured under osteoblastogenic conditions was 2-fold greater in the MCAT mice compared to WT mice, while the extent of mineralization was unaffected. MCAT mice had slightly longer tibiae than WT mice (2%, P less than 0.01), although cortical bone area was slightly lower in MCAT mice than WT mice (10%, p=0.09). To challenge the skeletal system, mice were treated by exposure to combined disuse (2 wk Hindlimb Unloading) and total body irradiation Cs(137) (2 Gy, 0.8 Gy/min), then bone parameters were analyzed by 2-factor ANOVA to detect possible interaction effects. Treatment caused a 2-fold increase (p=0.015) in malondialdehyde levels of bone tissue (ELISA) in WT mice, but had no effect in MCAT mice. These findings indicate that the transgene conferred protection from oxidative damage caused by treatment. Unexpected differences between WT and MCAT mice emerged in skeletal responses to treatment.. In WT mice, treatment did not alter osteoblastogenesis, cortical bone area, moment of inertia, or bone perimeter, whereas in MCAT mice, treatment increased these

  14. Rutin improves spatial memory in Alzheimer's disease transgenic mice by reducing Aβ oligomer level and attenuating oxidative stress and neuroinflammation.

    PubMed

    Xu, Peng-Xin; Wang, Shao-Wei; Yu, Xiao-Lin; Su, Ya-Jing; Wang, Teng; Zhou, Wei-Wei; Zhang, He; Wang, Yu-Jiong; Liu, Rui-Tian

    2014-05-01

    Alzheimer's disease (AD) is a progressive, neurodegenerative disease characterized by extracellular β-amyloid (Aβ) plaques and intracellular neurofibrillary tangles in the brain. Aβ aggregation is closely associated with neurotoxicity, oxidative stress, and neuronal inflammation. The soluble Aβ oligomers are believed to be the most neurotoxic form among all forms of Aβ aggregates. We have previously reported a polyphenol compound rutin that could inhibit Aβ aggregation and cytotoxicity, attenuate oxidative stress, and decrease the production of nitric oxide and proinflammatory cytokines in vitro. In the current study, we investigated the effect of rutin on APPswe/PS1dE9 transgenic mice. Results demonstrated that orally administered rutin significantly attenuated memory deficits in AD transgenic mice, decreased oligomeric Aβ level, increased super oxide dismutase (SOD) activity and glutathione (GSH)/glutathione disulfide (GSSG) ratio, reduced GSSG and malondialdehyde (MDA) levels, downregulated microgliosis and astrocytosis, and decreased interleukin (IL)-1β and IL-6 levels in the brain. These results indicated that rutin is a promising agent for AD treatment because of its antioxidant, anti-inflammatory, and reducing Aβ oligomer activities. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

    Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

  16. Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

    PubMed Central

    Balic, Anamaria; Mina, Mina

    2011-01-01

    Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

  17. Increased BMP6 levels in the brains of Alzheimer's disease patients and APP transgenic mice are accompanied by impaired neurogenesis.

    PubMed

    Crews, Leslie; Adame, Anthony; Patrick, Christina; Delaney, Alexandra; Pham, Emiley; Rockenstein, Edward; Hansen, Lawrence; Masliah, Eliezer

    2010-09-15

    During aging and in the progression of Alzheimer's disease (AD), synaptic plasticity and neuronal integrity are disturbed. In addition to the alterations in plasticity in mature neurons, the neurodegenerative process in AD has been shown to be accompanied by alterations in neurogenesis. Members of the bone morphogenetic protein (BMP) family of growth factors have been implicated as important regulators of neurogenesis and neuronal cell fate determination during development; however, their role in adult neurogenesis and in AD is less clear. We show here by qRT-PCR analysis that BMP6 mRNA levels were significantly increased in the hippocampus of human patients with AD and in APP transgenic mice compared to controls. Immunoblot and immunohistochemical analyses confirmed that BMP6 protein levels were increased in human AD brains and APP transgenic mouse brains compared to controls and accumulated around hippocampal plaques. The increased levels of BMP6 were accompanied by defects in hippocampal neurogenesis in AD patients and APP transgenic mice. In support of a role for BMP6 in defective neurogenesis in AD, we show in an in vitro model of adult neurogenesis that treatment with amyloid-β(1-42) protein (Aβ) resulted in increased expression of BMP6, and that exposure to recombinant BMP6 resulted in reduced proliferation with no toxic effects. Together, these results suggest that Aβ-associated increases in BMP6 expression in AD may have deleterious effects on neurogenesis in the hippocampus, and therapeutic approaches could focus on normalization of BMP6 levels to protect against AD-related neurogenic deficits.

  18. Cardiac compartment-specific overexpression of a modified retinoic acid receptor produces dilated cardiomyopathy and congestive heart failure in transgenic mice.

    PubMed

    Colbert, M C; Hall, D G; Kimball, T R; Witt, S A; Lorenz, J N; Kirby, M L; Hewett, T E; Klevitsky, R; Robbins, J

    1997-10-15

    Retinoids play a critical role in cardiac morphogenesis. To examine the effects of excessive retinoid signaling on myocardial development, transgenic mice that overexpress a constitutively active retinoic acid receptor (RAR) controlled by either the alpha- or beta-myosin heavy chain (MyHC) promoter were generated. Animals carrying the alpha-MyHC-RAR transgene expressed RARs in embryonic atria and in adult atria and ventricles, but developed no signs of either malformations or disease. In contrast, beta-MyHC-RAR animals, where expression was activated in fetal ventricles, developed a dilated cardiomyopathy that varied in severity with transgene copy number. Characteristic postmortem lesions included biventricular chamber dilation and left atrial thrombosis; the incidence and severity of these lesions increased with increasing copy number. Transcript analyses showed that molecular markers of hypertrophy, alpha-skeletal actin, atrial natriuretic factor and beta-MyHC, were upregulated. Cardiac performance of transgenic hearts was evaluated using the isolated perfused working heart model as well as in vivo, by transthoracic M-mode echocardiography. Both analyses showed moderate to severe impairment of left ventricular function and reduced cardiac contractility. Thus, expression of a constitutively active RAR in developing atria and/ or in postnatal ventricles is relatively benign, while ventricular expression during gestation can lead to significant cardiac dysfunction.

  19. Cardiac compartment-specific overexpression of a modified retinoic acid receptor produces dilated cardiomyopathy and congestive heart failure in transgenic mice.

    PubMed Central

    Colbert, M C; Hall, D G; Kimball, T R; Witt, S A; Lorenz, J N; Kirby, M L; Hewett, T E; Klevitsky, R; Robbins, J

    1997-01-01

    Retinoids play a critical role in cardiac morphogenesis. To examine the effects of excessive retinoid signaling on myocardial development, transgenic mice that overexpress a constitutively active retinoic acid receptor (RAR) controlled by either the alpha- or beta-myosin heavy chain (MyHC) promoter were generated. Animals carrying the alpha-MyHC-RAR transgene expressed RARs in embryonic atria and in adult atria and ventricles, but developed no signs of either malformations or disease. In contrast, beta-MyHC-RAR animals, where expression was activated in fetal ventricles, developed a dilated cardiomyopathy that varied in severity with transgene copy number. Characteristic postmortem lesions included biventricular chamber dilation and left atrial thrombosis; the incidence and severity of these lesions increased with increasing copy number. Transcript analyses showed that molecular markers of hypertrophy, alpha-skeletal actin, atrial natriuretic factor and beta-MyHC, were upregulated. Cardiac performance of transgenic hearts was evaluated using the isolated perfused working heart model as well as in vivo, by transthoracic M-mode echocardiography. Both analyses showed moderate to severe impairment of left ventricular function and reduced cardiac contractility. Thus, expression of a constitutively active RAR in developing atria and/ or in postnatal ventricles is relatively benign, while ventricular expression during gestation can lead to significant cardiac dysfunction. PMID:9329959

  20. Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

    PubMed

    Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

    1996-03-01

    Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

  1. ZyFISH: A Simple, Rapid and Reliable Zygosity Assay for Transgenic Mice

    PubMed Central

    McHugh, Donal; O’Connor, Tracy; Bremer, Juliane; Aguzzi, Adriano

    2012-01-01

    Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR) which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH). The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations. PMID:22666404

  2. Antisense oligonucleotide inhibition of cholesteryl ester transfer protein enhances RCT in hyperlipidemic, CETP transgenic, LDLr-/- mice.

    PubMed

    Bell, Thomas A; Graham, Mark J; Lee, Richard G; Mullick, Adam E; Fu, Wuxia; Norris, Dan; Crooke, Rosanne M

    2013-10-01

    Due to their ability to promote positive effects across all of the lipoprotein classes, cholesteryl ester transfer protein (CETP) inhibitors are currently being developed as therapeutic agents for cardiovascular disease. In these studies, we compared an antisense oligonucleotide (ASO) inhibitor of CETP to the CETP small molecule inhibitor anacetrapib. In hyperlipidemic CETP transgenic (tg) mice, both drugs provided comparable reductions in total plasma cholesterol, decreases in CETP activity, and increases in HDL cholesterol. However, only mice treated with the antisense inhibitor showed an enhanced effect on macrophage reverse cholesterol transport, presumably due to differences in HDL apolipoprotein composition and decreases in plasma triglyceride. Additionally, the ASO-mediated reductions in CETP mRNA were associated with less accumulation of aortic cholesterol. These preliminary findings suggest that CETP ASOs may represent an alternative means to inhibit that target and to support their continued development as a treatment for cardiovascular disease in man.

  3. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  4. Continuation of Exercise Is Necessary to Inhibit High Fat Diet-Induced β-Amyloid Deposition and Memory Deficit in Amyloid Precursor Protein Transgenic Mice

    PubMed Central

    Maesako, Masato; Uemura, Kengo; Iwata, Ayana; Kubota, Masakazu; Watanabe, Kiwamu; Uemura, Maiko; Noda, Yasuha; Asada-Utsugi, Megumi; Kihara, Takeshi; Takahashi, Ryosuke; Shimohama, Shun; Kinoshita, Ayae

    2013-01-01

    High fat diet (HFD) is prevalent in many modern societies and HFD-induced metabolic condition is a growing concern worldwide. It has been previously reported that HFD clearly worsens cognitive function in amyloid precursor protein (APP) transgenic mice. On the other hand, we have demonstrated that voluntary exercise in an enriched environment is an effective intervention to rescue HFD-induced β-amyloid (Aβ) deposition and memory deficit. However, it had been unclear whether consumption of HFD after exercising abolished the beneficial effect of exercise on the inhibition of Alzheimer's disease (AD) pathology. To examine this question, we exposed wild type (WT) and APP mice fed with HFD to exercise conditions at different time periods. In our previous experiment, we gave HFD to mice for 20 weeks and subjected them to exercise during weeks 10–20. In the present study, mice were subjected to exercise conditions during weeks 0–10 or weeks 5–15 while being on HFD. Interestingly, we found that the effect of exercise during weeks 0–10 or weeks 5–15 on memory function was not abolished in WT mice even if they kept having HFD after finishing exercise. However, in APP transgenic mice, HFD clearly disrupted the effect of exercise during weeks 0–10 or weeks 5–15 on memory function. Importantly, we observed that the level of Aβ oligomer was significantly elevated in the APP mice that exercised during weeks 0–10: this might have been caused by the up-regulation of Aβ production. These results provide solid evidence that continuation of exercise is necessary to rescue HFD-induced aggravation of cognitive decline in the pathological setting of AD. PMID:24023774

  5. Quantitative proteomics in A30P*A53T α-synuclein transgenic mice reveals upregulation of Sel1l.

    PubMed

    Yan, Jianguo; Zhang, Pei; Jiao, Fengjuan; Wang, Qingzhi; He, Feng; Zhang, Qian; Zhang, Zheng; Lv, Zexi; Peng, Xiang; Cai, Hongwei; Tian, Bo

    2017-01-01

    α-Synuclein is an abundantly expressed neuronal protein that is at the center of focus in understanding a group of neurodegenerative disorders called synucleinopathies, which are characterized by the intracellular presence of aggregated α-synuclein. However, the mechanism of α-synuclein biology in synucleinopathies pathogenesis is not fully understood. In this study, mice overexpressing human A30P*A53T α-synuclein were evaluated by a motor behavior test and count of TH-positive neurons, and then two-dimensional liquid chromatography-tandem mass spectrometry coupled with tandem mass tags (TMTs) labeling was employed to quantitatively identify the differentially expressed proteins of substantia nigra pars compacta (SNpc) tissue samples that were obtained from the α-synuclein transgenic mice and wild type controls. The number of SNpc dopaminergic neurons and the motor behavior were unchanged in A30P*A53T transgenic mice at the age of 6 months. Of the 4,715 proteins identified by proteomic techniques, 271 were differentially expressed, including 249 upregulated and 22 downregulated proteins. These alterations were primarily associated with mitochondrial dysfunction, oxidative stress, ubiquitin-proteasome system impairment, and endoplasmic reticulum (ER) stress. Some obviously changed proteins, which were validated by western blotting and immunofluorescence staining, including Sel1l and Sdhc, may be involved in the α-synuclein pathologies of synucleinopathies. A biological pathway analysis of common related proteins showed that the proteins were linked to a total of 31 KEGG pathways. Our findings suggest that these identified proteins may serve as novel therapeutic targets for synucleinopathies.

  6. Rapamycin rescues vascular, metabolic and learning deficits in apolipoprotein E4 transgenic mice with pre-symptomatic Alzheimer's disease.

    PubMed

    Lin, Ai-Ling; Jahrling, Jordan B; Zhang, Wei; DeRosa, Nicholas; Bakshi, Vikas; Romero, Peter; Galvan, Veronica; Richardson, Arlan

    2017-01-01

    Apolipoprotein E ɛ4 allele is a common susceptibility gene for late-onset Alzheimer's disease. Brain vascular and metabolic deficits can occur in cognitively normal apolipoprotein E ɛ4 carriers decades before the onset of Alzheimer's disease. The goal of this study was to determine whether early intervention using rapamycin could restore neurovascular and neurometabolic functions, and thus impede pathological progression of Alzheimer's disease-like symptoms in pre-symptomatic Apolipoprotein E ɛ4 transgenic mice. Using in vivo, multimodal neuroimaging, we found that apolipoprotein E ɛ4 mice treated with rapamycin had restored cerebral blood flow, blood-brain barrier integrity and glucose metabolism, compared to age- and gender-matched wild-type controls. The preserved vasculature and metabolism were associated with amelioration of incipient learning deficits. We also found that rapamycin restored the levels of the proinflammatory cyclophilin A in vasculature, which may contribute to the preservation of cerebrovascular function in the apolipoprotein E ɛ4 transgenics. Our results show that rapamycin improves functional outcomes in this mouse model and may have potential as an effective intervention to block progression of vascular, metabolic and early cognitive deficits in human Apolipoprotein E ɛ4 carriers. As rapamycin is FDA-approved and neuroimaging is readily used in humans, the results of the present study may provide the basis for future Alzheimer's disease intervention studies in human subjects. © The Author(s) 2015.

  7. Purification of adult hepatic progenitor cells using green fluorescent protein (GFP)-transgenic mice and fluorescence-activated cell sorting.

    PubMed

    Fujikawa, Takahisa; Hirose, Tetsuro; Fujii, Hideaki; Oe, Shoshiro; Yasuchika, Kentaro; Azuma, Hisaya; Yamaoka, Yoshio

    2003-08-01

    Recent advances in stem cell research have revealed that hepatic stem/progenitor cells may play an important role in liver development and regeneration. However, a lack of detectable definitive markers in viable cells has hindered their primary culture from adult livers. Enzymatically dissociated liver cells from green fluorescent protein (GFP)-transgenic mice, which express GFP highly in liver endodermal cells, were sorted by GFP expression using a fluorescence-activated cell sorter. Sorted cells were characterized, and also low-density cultured for extended periods to determine their proliferation and clonal differentiation capacities. When CD45(-)TER119(-) side-scatter(low) GFP(high) cells were sorted, alpha-fetoprotein-positive immature endoderm-characterized cells, having high growth potential, were present in this population. Clonal analysis and electron microscopic evaluation revealed that each single cell of this population could differentiate not only into hepatocytes, but also into biliary epithelial cells, showing their bilineage differentiation activity. When surface markers were analyzed, they were positive for Integrin-alpha6 and -beta1, but negative for c-Kit and Thy1.1. Combination of GFP-transgenic mice and fluorescence-activated cell sorting enabled purification of hepatic progenitor cells from adult mouse liver. Further analysis of this population may lead to purification of their human correspondence that would be an ideal cell-source candidate for regenerative medicine.

  8. Defective IL-17- and IL-22-dependent mucosal host response to Candida albicans determines susceptibility to oral candidiasis in mice expressing the HIV-1 transgene.

    PubMed

    Goupil, Mathieu; Cousineau-Côté, Vincent; Aumont, Francine; Sénéchal, Serge; Gaboury, Louis; Hanna, Zaher; Jolicoeur, Paul; de Repentigny, Louis

    2014-10-26

    The tissue-signaling cytokines IL-17 and IL-22 are critical to host defense against oral Candida albicans infection, by their induction of oral antimicrobial peptide expression and recruitment of neutrophils. Mucosal Th17 cells which produce these cytokines are preferentially depleted in HIV-infected patients. Here, we tested the hypothesis that defective IL-17- and IL-22-dependent host responses to C. albicans determine the phenotype of susceptibility to oropharyngeal candidiasis (OPC) in transgenic (Tg) mice expressing HIV-1. Naïve CD4+ T-cells and the differentiated Th1, Th2, Th17, Th1Th17 and Treg lineages were all profoundly depleted in cervical lymph nodes (CLNs) of these Tg mice. However, naive CD4+ cells from Tg mice maintained the capacity to differentiate into these lineages in response to polarizing cytokines in vitro. Expression of Il17, Il22, S100a8 and Ccl20 was enhanced in oral mucosal tissue of non-Tg, but not of Tg mice, after oral infection with C. albicans. Treatment of infected Tg mice with the combination of IL-17 and IL-22, but not IL-17 or Il-22 alone, significantly reduced oral burdens of C. albicans and abundance of Candida hyphae in the epithelium of tongues of infected Tg mice, and restored the ability of the Tg mice to up-regulate expression of S100a8 and Ccl20 in response to C. albicans infection. These findings demonstrate that defective IL-17- and IL-22-dependent induction of innate mucosal immunity to C. albicans is central to the phenotype of susceptibility to OPC in these HIV transgenic mice.

  9. Retarded axonal transport of R406W mutant tau in transgenic mice with a neurodegenerative tauopathy.

    PubMed

    Zhang, Bin; Higuchi, Makoto; Yoshiyama, Yasumasa; Ishihara, Takeshi; Forman, Mark S; Martinez, Dan; Joyce, Sonali; Trojanowski, John Q; Lee, Virginia M-Y

    2004-05-12

    Intracellular accumulations of filamentous tau inclusions are neuropathological hallmarks of neurodegenerative diseases known as tauopathies. The discovery of multiple pathogenic tau gene mutations in many kindreds with familial frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17) unequivocally confirmed the central role of tau abnormalities in the etiology of neurodegenerative disorders. To examine the effects of tau gene mutations and the role of tau abnormalities in neurodegenerative tauopathies, transgenic (Tg) mice were engineered to express the longest human tau isoform (T40) with or without the R406W mutation (RW and hWT Tg mice, respectively) that is pathogenic for FTDP-17 in several kindreds. RW but not hWT tau Tg mice developed an age-dependent accumulation of insoluble filamentous tau aggregates in neuronal perikarya of the cerebral cortex, hippocampus, cerebellum, and spinal cord. Significantly, CNS axons in RW mice contained reduced levels of tau when compared with hWT mice, and this was linked to retarded axonal transport and increased accumulation of an insoluble pool of RW but not hWT tau. Furthermore, RW but not hWT mice demonstrated neurodegeneration and a reduced lifespan. These data indicate that the R406W mutation causes reduced binding of this mutant tau to microtubules, resulting in slower axonal transport. This altered tau function caused by the RW mutation leads to increased accumulation and reduced solubility of RW tau in an age-dependent manner, culminating in the formation of filamentous intraneuronal tau aggregates similar to that observed in tauopathy patients.

  10. Specificity of Direct Transition from Wake to REM Sleep in Orexin/ataxin-3 Transgenic Narcoleptic Mice

    PubMed Central

    Fujiki, Nobuhiro; Cheng, Timothy; Yoshino, Fuyumi; Nishino, Seiji

    2009-01-01

    To create operational criteria for polygraphic assessments of direct transitions from wake to REM sleep (DREM), as a murine analog of human cataplexy, we have analyzed DREM episodes in congenic lines of orexin/ataxin-3 transgenic [TG] mice and wild-type littermates. The sleep stage of each 10-second epoch was visually scored using our standard criteria. Specificity of DREM for narcoleptic TG mice and sensitivity to detect DREM was evaluated using different DREM criteria. We found that DREM transitions by 10-second epoch scoring are not specific for narcoleptic TG mice and also occur in WT mice during light period. These wake-to-REM transitions in WT mice (also seen in TG mice during light period) were characteristically different from DREM transitions in TG mice during dark period; they tended to occur as brief bouts of wakefulness interrupting extended episodes of REM sleep, suggesting that these transitions do not represent abnormal manifestations of REM sleep. We therefore defined the DREM transitions by requiring a minimum number of preceding wake epochs. Requiring no fewer than four consecutive epochs of wakefulness produced the best combination of specificity (95.9%) and sensitivity (66.0%). By definition, DREM in dark-period is 100% specific to narcolepsy and was 95.9% specific overall. In addition, we found that desipramine, a trycyclic anticataplectic, potently reduces DREM, while two wake-promoting compounds have moderate (d-amphetamine) and no (modafinil) effect on DREM; the effects mirror the anticataplectic effects of these compounds reported in canine and human narcolepsy. Our definition of DREM in murine narcolepsy may provide good electrophysiological measure for cataplexy-equivalent episodes. PMID:19416673

  11. Quantitative analysis of antigen for the induction of tolerance in carcinoembryonic antigen transgenic mice.

    PubMed Central

    Hasegawa, T; Isobe, K; Nakashima, I; Shimokata, K

    1992-01-01

    In order to analyse the amounts of antigen in the thymus for the induction of tolerance, several carcinoembryonic antigen (CEA) transgenic lines were established which expressed human CEA antigen with different amounts. The chimeric KSN nude mice transplanted with the thymus of the B601 line (in which CEA mRNA and CEA protein could be detected in various tissues) to kidney capsule showed tolerance to human CEA. On the other hand, the chimeric KSN nude mice transplanted with the thymus of the B602 or BC60 line (in which neither CEA mRNA nor CEA protein could be detected by Northern blot analysis and flow cytometry analysis) or normal C57BL/6 (B6) did not develop the tolerance to human CEA. However, the chimeric KSN nude mice transplanted simultaneously with thymus of the B6 and spleen of the B601 line became tolerant to human CEA antigen. In the case of systemic immunization with cells which had CEA antigen, the B601 line was tolerant to human CEA. Surprisingly, the B602 and BC60 lines were also tolerant to CEA molecule. These results indicate that not only the antigen present in the thymus but also the antigen which flows from the peripheral organs to the thymus may be necessary for the induction of CEA tolerance. Images Figure 1 PMID:1493931

  12. Pesticide Exposure Exacerbates α-Synucleinopathy in an A53T Transgenic Mouse Model

    PubMed Central

    Norris, Erin H.; Uryu, Kunihiro; Leight, Susan; Giasson, Benoit I.; Trojanowski, John Q.; Lee, Virginia M.-Y.

    2007-01-01

    The factors initiating or contributing to the pathogenesis of Parkinson’s disease and related neurodegenerative synucleinopathies are still largely unclear, but environmental factors such as pesticides have been implicated. In this study, A53T mutant human α-synuclein transgenic mice (M83), which develop α-synuclein neuropathology, were treated with the pesticides paraquat and maneb (either singly or together), and their effects were analyzed. Immunohistochemical and biochemical analyses showed that chronic treatment of M83 transgenic mice with both pesticides (but not with either pesticide alone) drastically increased neuronal α-synuclein pathology throughout the central nervous system including the hippocampus, cerebellum, and sensory and auditory cortices. α-Synuclein-associated mitochondrial degeneration was observed in M83 but not in wild-type α-synuclein transgenic mice. Because α-synuclein inclusions accumulated in pesticide-exposed M83 transgenic mice without a motor phenotype, we conclude that α-synuclein aggregate formation precedes disease onset. These studies support the notion that environmental factors causing nitrative damage are closely linked to mechanisms underlying the formation of α-synuclein pathologies and the onset of Parkinson’s-like neurodegeneration. PMID:17255333

  13. YAC and cosmid contigs encompassing the Fukuyama-type congenital muscular dystrophy (FCMD) candidate region on 9q31

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyake, Masashi; Nakahori, Yutaka; Matsushita, Ikumi

    1997-03-01

    Fukuyama-type congenital muscular dystrophy (FCMD), the second most common form of childhood muscular dystrophy in Japan, is an autosomal recessive severe muscular dystrophy associated with an anomaly of the brain. We had mapped the FCMD gene to an approximately 5-cM interval between D9S127 and D9S2111 on 9q31-q33 and had also found evidence for linkage disequilibrium between FCMD and D9S306 in this candidate region. Through further analysis, we have defined another marker, D9S172, which showed stronger linkage disequilibrium than D9S306. A yeast artificial chromosome (YAC) contig spanning 3.5 Mb, which includes this D9S306-D9S172 interval on 9q31, has been constructed by amore » combination of sequence-tagged site, Alu-PCR, and restriction mapping. Also, cosmid clones subcloned from the YAC were assembled into three contigs, one of which contains D9S2107, which showed the strongest linkage disequilibrium with FCMD. These contigs also allowed us to order the markers as follows: cen-D9S127-({approximately}800 kb)-D9S306 (identical to D9S53)-({approximately}700 kb)-A107XF9-({approximately}500 kb)-D9S172-({approximately}30 kb)-D9S299 (identical to D9S774)-({approximately}120 kb)-WI2269-tel. Thus, we have constructed the first high-resolution physical map of the FCMD candidate region. The YAC and cosmid contigs established here will be a crucial resource for identification of the FCMD gene and other genes in this region. 37 refs., 7 figs., 2 tabs.« less

  14. Human HLA-Ev (147) Expression in Transgenic Animals.

    PubMed

    Matsuura, R; Maeda, A; Sakai, R; Eguchi, H; Lo, P-C; Hasuwa, H; Ikawa, M; Nakahata, K; Zenitani, M; Yamamichi, T; Umeda, S; Deguchi, K; Okuyama, H; Miyagawa, S

    2016-05-01

    In our previous study, we reported on the development of substituting S147C for HLA-E as a useful gene tool for xenotransplantation. In this study we exchanged the codon of HLA-Ev (147), checked its function, and established a line of transgenic mice. A new construct, a codon exchanging human HLA-Ev (147) + IRES + human beta 2-microgloblin, was established. The construct was subcloned into pCXN2 (the chick beta-actin promoter and cytomegalovirus enhancer) vector. Natural killer cell- and macrophage-mediated cytotoxicities were performed using the established the pig endothelial cell (PEC) line with the new gene. Transgenic mice with it were next produced using a micro-injection method. The expression of the molecule on PECs was confirmed by the transfection of the plasmid. The established molecules on PECs functioned well in regulating natural killer cell-mediated cytotoxicity and macrophage-mediated cytotoxicity. We have also successfully generated several lines of transgenic mice with this plasmid. The expression of HLA-Ev (147) in each mouse organ was confirmed by assessing the mRNA. The chick beta-actin promoter and cytomegalovirus enhancer resulted in a relatively broad expression of the gene in each organ, and a strong expression in the cases of the heart and lung. A synthetic HLA-Ev (147) gene with a codon usage optimized to a mammalian system represents a critical factor in the development of transgenic animals for xenotransplantation. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Vector-Free and Transgene-Free Human iPS Cells Differentiate into Functional Neurons and Enhance Functional Recovery after Ischemic Stroke in Mice

    PubMed Central

    Mohamad, Osama; Faulkner, Ben; Chen, Dongdong; Yu, Shan Ping; Wei, Ling

    2013-01-01

    Stroke is a leading cause of human death and disability in the adult population in the United States and around the world. While stroke treatment is limited, stem cell transplantation has emerged as a promising regenerative therapy to replace or repair damaged tissues and enhance functional recovery after stroke. Recently, the creation of induced pluripotent stem (iPS) cells through reprogramming of somatic cells has revolutionized cell therapy by providing an unlimited source of autologous cells for transplantation. In addition, the creation of vector-free and transgene-free human iPS (hiPS) cells provides a new generation of stem cells with a reduced risk of tumor formation that was associated with the random integration of viral vectors seen with previous techniques. However, the potential use of these cells in the treatment of ischemic stroke has not been explored. In the present investigation, we examined the neuronal differentiation of vector-free and transgene-free hiPS cells and the transplantation of hiPS cell-derived neural progenitor cells (hiPS-NPCs) in an ischemic stroke model in mice. Vector-free hiPS cells were maintained in feeder-free and serum-free conditions and differentiated into functional neurons in vitro using a newly developed differentiation protocol. Twenty eight days after transplantation in stroke mice, hiPS-NPCs showed mature neuronal markers in vivo. No tumor formation was seen up to 12 months after transplantation. Transplantation of hiPS-NPCs restored neurovascular coupling, increased trophic support and promoted behavioral recovery after stroke. These data suggest that using vector-free and transgene-free hiPS cells in stem cell therapy are safe and efficacious in enhancing recovery after focal ischemic stroke in mice. PMID:23717557

  16. Liver tumor formation by a mutant retinoblastoma protein in the transgenic mice is caused by an upregulation of c-Myc target genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Bo; Hikosaka, Keisuke; Sultana, Nishat

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Fifty percent of the mutant Rb transgenic mice produced liver tumors. Black-Right-Pointing-Pointer In the tumor, Foxm1, Skp2, Bmi1 and AP-1 mRNAs were up-regulated. Black-Right-Pointing-Pointer No increase in expression of the Myc-target genes was observed in the non-tumorous liver. Black-Right-Pointing-Pointer Tumor formation depends on up-regulation of the Myc-target genes. -- Abstract: The retinoblastoma (Rb) tumor suppressor encodes a nuclear phosphoprotein that regulates cellular proliferation, apoptosis and differentiation. In order to adapt itself to these biological functions, Rb is subjected to modification cycle, phosphorylation and dephosphorylation. To directly determine the effect of phosphorylation-resistant Rb on liver development and function, wemore » generated transgenic mice expressing phosphorylation-resistant human mutant Rb (mt-Rb) under the control of the rat hepatocyte nuclear factor-1 gene promoter/enhancer. Expression of mt-Rb in the liver resulted in macroscopic neoplastic nodules (adenomas) with {approx}50% incidence within 15 months old. Interestingly, quantitative reverse transcriptase-PCR analysis showed that c-Myc was up-regulated in the liver of mt-Rb transgenic mice irrespective of having tumor tissues or no tumor. In tumor tissues, several c-Myc target genes, Foxm1, c-Jun, c-Fos, Bmi1 and Skp2, were also up-regulated dramatically. We determined whether mt-Rb activated the Myc promoter in the HTP9 cells and demonstrated that mt-Rb acted as an inhibitor of wild-type Rb-induced repression on the Myc promoter. Our results suggest that continued upregulation of c-Myc target genes promotes the liver tumor formation after about 1 year of age.« less

  17. A transgenic model of transactivation by the Tax protein of HTLV-I.

    PubMed

    Bieberich, C J; King, C M; Tinkle, B T; Jay, G

    1993-09-01

    The human T-lymphotropic virus type I (HTLV-I) Tax protein is a transcriptional regulatory protein that has been suggested to play a causal role in the development of several HTLV-I-associated diseases. Tax regulates expression of its own LTR and of certain cellular promoters perhaps by usurping the function of the host transcriptional machinery. We have established a transgenic mouse model system to define the spectrum of tissues in vivo that are capable of supporting Tax-mediated transcriptional transactivation. Transgenic mice carrying the HTLV-I LTR driving expression of the Escherichia coli beta-galactosidase (beta gal) gene were generated, and this LTR-beta gal gene was transcriptionally inactive in all tissues. When LTR-beta gal mice were mated to transgenic mice carrying the same LTR driving expression of the HTLV-I tax gene, mice that carried both transgenes showed restricted expression of the beta gal reporter gene in several tissues including muscle, bone, salivary glands, skin, and nerve. In addition, a dramatic increase in the number of beta gal-expressing cells was seen in response to wounding. These observations provide direct evidence for viral transactivation in vivo, delimit the tissues capable of supporting that transactivation, and provide a model system to study the mechanism of gene regulation by Tax.

  18. Bone-derived mesenchymal stromal cells from HIV transgenic mice exhibit altered proliferation, differentiation capacity and paracrine functions along with impaired therapeutic potential in kidney injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Kang; Rai, Partab; Lan, Xiqian

    Mesenchymal stem cells (MSCs) secrete paracrine factors that could be cytoprotective and serve roles in immunoregulation during tissue injury. Although MSCs express HIV receptors, and co-receptors, and are susceptible to HIV infection, whether HIV-1 may affect biological properties of MSCs needs more study. We evaluated cellular proliferation, differentiation and paracrine functions of MSCs isolated from compact bones of healthy control mice and Tg26 HIV-1 transgenic mice. The ability of MSCs to protect against cisplatin toxicity was studied in cultured renal tubular cells as well as in intact mice. We successfully isolated MSCs from healthy mice and Tg26 HIV-1 transgenic micemore » and found the latter expressed viral Nef, Vpu, NL4-3 and Vif genes. The proliferation and differentiation of Tg26 HIV-1 MSCs was inferior to MSCs from healthy mice. Moreover, transplantation of Tg26 HIV-1 MSCs less effectively improved outcomes compared with healthy MSCs in mice with acute kidney injury. Also, Tg26 HIV-1 MSCs secreted multiple cytokines, but at significantly lower levels than healthy MSCs, which resulted in failure of conditioned medium from these MSCs to protect cultured renal tubular cells from cisplatin toxicity. Therefore, HIV-1 had adverse biological effects on MSCs extending to their proliferation, differentiation, function, and therapeutic potential. These findings will help in advancing mechanistical insight in renal injury and repair in the setting of HIV-1 infection. -- Highlights: •MSCs isolated from HIV mice displayed HIV genes. •MSCs isolated from HIV mice exhibited attenuated growth and paracrine functions. •AKI mice with transplanted HIV-MSC displayed poor outcome. •HIV-1 MSC secreted multiple cytokines but at a lower level.« less

  19. Use of permethrin eradicated the tropical rat mite (Ornithonyssus bacoti) from a colony of mutagenized and transgenic mice.

    PubMed

    Hill, William A; Randolph, Mildred M; Boyd, Keli L; Mandrell, Timothy D

    2005-09-01

    The tropical rat mite, Ornithonyssus bacoti, was identified in a colony of mutagenized and transgenic mice at a large academic institution. O. bacoti is an obligate, blood-feeding ectoparasite with an extensive host range. Although the source of the infestation was likely feral rodents, none were found in the room housing infested mice. We hypothesize that construction on the floor above the vivarium and compromised ceiling integrity within the animal room provided for vermin entry and subsequent O. bacoti infestation. O. bacoti infestation was eliminated by environmental decontamination with synthetic pyrethroids and weekly application of 7.4% permethrin-impregnated cotton balls to mouse caging for five consecutive weeks. Visual examination of the macroenvironment, microenvironment, and colony for 38 days confirmed the efficacy of treatment. We noted no treatment-related toxicities or effects on colony production.

  20. Salt-Sensitive Hypertension and Cardiac Hypertrophy in Transgenic Mice Expressing a Corin Variant Identified in African Americans

    PubMed Central

    Wang, Wei; Cui, Yujie; Shen, Jianzhong; Jiang, Jingjing; Chen, Shenghan; Peng, Jianhao; Wu, Qingyu

    2012-01-01

    African Americans represent a high risk population for salt-sensitive hypertension and heart disease but the underlying mechanism remains unclear. Corin is a cardiac protease that regulates blood pressure by activating natriuretic peptides. A corin gene variant (T555I/Q568P) was identified in African Americans with hypertension and cardiac hypertrophy. In this study, we test the hypothesis that the corin variant contributes to the hypertensive and cardiac hypertrophic phenotype in vivo. Transgenic mice were generated to express wild-type or T555I/Q568P variant corin in the heart under the control of α-myosin heavy chain promoter. The mice were crossed into a corin knockout background to create KO/TgWT and KO/TgV mice that expressed WT or variant corin, respectively, in the heart. Functional studies showed that KO/TgV mice had significantly higher levels of pro-atrial natriuretic peptide in the heart compared with that in control KO/TgWT mice, indicating that the corin variant was defective in processing natriuretic peptides in vivo. By radiotelemetry, corin KO/TgV mice were found to have hypertension that was sensitive to dietary salt loading. The mice also developed cardiac hypertrophy at 12–14 months of age when fed a normal salt diet or at a younger age when fed a high salt diet. The phenotype of salt-sensitive hypertension and cardiac hypertrophy in KO/TgV mice closely resembles the pathological findings in African Americans who carry the corin variant. The results indicate that corin defects may represent an important mechanism in salt-sensitive hypertension and cardiac hypertrophy in African Americans. PMID:22987923

  1. Analysis of the Effect of Estrogen/Androgen Perturbation on Penile Development in Transgenic and Diethylstilbestrol-Treated Mice

    PubMed Central

    BLASCHKO, SARAH D.; MAHAWONG, PHITSANU; FERRETTI, MAX; CUNHA, TRISTAN J.; SINCLAIR, ADRIANE; WANG, HONG; SCHLOMER, BRUCE J.; RISBRIDGER, GAIL; BASKIN, LAURENCE S.; CUNHA, GERALD R.

    2013-01-01

    Because both androgens and estrogens have been implicated in penile morphogenesis, we evaluated penile morphology in transgenic mice with known imbalance of androgen and estrogen signaling using scanning electron microscopy (SEM), histology, and immunohistochemistry of androgen and estrogen receptors α/β. Penises of adult wild-type, estrogen receptor-α knockout (αERKO), estrogen receptor-β knockout (βERKO), aromatase knockout (Arom-KO), and aromatase overexpression (Arom+) mice were evaluated, as well as adult mice treated with diethylstilbestrol (DES) from birth to day 10. Adult penises were examined because the adult pattern is the endpoint of development. The urethral orifice is formed by fusion of the MUMP (male urogenital mating protuberance) with the MUMP ridge, which consists of several processes fused to each other and to the MUMP. Similarly, the internal prepuce is completed ventrally by fusion of a ventral cleft. In adult murine penises the stromal processes that form the MUMP ridge are separated from their neighbors by clefts. αERKO, βERKO, and Arom-KO mice have penises with a MUMP ridge clefting pattern similar to that of wild-type mice. In contrast, Arom+ mice and neonatally DES-treated mice exhibit profound malformations of the MUMP, MUMP ridge clefting pattern, and internal prepuce. Abnormalities observed in Arom+ and neonatally DES-treated mice correlate with the expression of estrogen receptor-beta (ERβ) in the affected structures. This study demonstrates that formation of the urethal orifice and internal prepuce is due to fusion of separate epithelial-surfaced mesenchymal elements, a process dependent upon both androgen and estrogen signaling, in which ERβ signaling is strongly implicated. PMID:23653160

  2. Ectopic bone formation and chondrodysplasia in transgenic mice carrying the rat C3(1)/T{sub AG} fusion gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Green, J.E.; Maroulakou, I.G.; Anver, M.

    Transgenic mice expressing the SV40 large T-antigen (T{sup AG}) under the regultory control of the hormone-responsive rat C3(1) prostatein promoter develop unusual bone and cartilage lesions, as well as ectopic bone and cartilage formation. Two lines of transgenic animals have been propagated in which the expression of the transgene in chondrocytes results in a mild to moderate generalized disorganization of cartilage growth which appears to affect multiple tissues, including the trachea, ear pinna and articular cartilage. The epiphyseal plates are also affected with normal architecture of the zones of proliferation and maturation, but marked elongation of the zone of hypertrophy.more » Immunocytochemistry demonstrates that expression of T{sup AG} is limited to the zone of hypertropny in the epiphyseal plates, suggesting that the chondrocytes become hormone-responsive at this particular stage of differentiation. Normal mineralization and trabecular formation in long bone appears to occur. Ectopic bone and cartilage formation occurs in the foot pads of the fore- and hind- feet over the course of several months. This is preceded by proliferation of sweat gland epithelial cells followed by the appearance of nodules of cartilage and bone. The nodules are closely associated with proliferating epithelium but are not contiguous with bony structures normally found in the feet. The roles of BMP`s, growth factors, oncogenes and hormones in the development of these lesions will be presented. These transgenic animals may provide new insights into hormone-responsiveness of chondrocytes, as well as factors involved in the processes of bone and cartilage differentiation and growth. These transgenic animals may serve as a useful model for human heterotopic bone formation.« less

  3. Atrial natriuretic peptide synthesis in atrial tumors of transgenic mice.

    PubMed

    Gardner, D G; Camargo, M J; Behringer, R R; Brinster, R L; Baxter, J D; Atlas, S A; Laragh, J H; Deschepper, C F

    1992-04-01

    Transgenic mice harboring a chimeric gene linking mouse protamine 1 5'-flanking sequence to the coding sequence of the simian virus 40 T-antigen develop spontaneous rhabdomyosarcomas of the right atria. The presence of the tumors is accompanied by dramatic elevations in plasma atrial natriuretic peptide (ANP) immunoreactivity (1,698 +/- 993 vs. 60 +/- 18 fmol/ml for controls) and hematocrit (56 +/- 8 vs. 51 +/- 2 for controls). The immunoreactive ANP (irANP) present in the tumors is similar in size to irANP found in normal mouse atria. ANP mRNA transcripts present in the tumors also appear to be very similar in overall size and 5'-termini to those produced in normal cardiac tissue. Microscopically, the tumors are composed of a disorganized array of densely packed abnormal-appearing cells. Immunocytochemistry and in situ hybridization analysis reveal considerable heterogeneity in ANP gene expression. ANP peptide and mRNA are detectable throughout the parenchyma of the tumors, but absolute levels of expression vary widely among different cells in the population. These tumors represent a potentially valuable model for the study of inappropriate ANP secretion and may provide a tissue source for the development of an ANP-producing atrial cell line.

  4. Effects of COX1-2/5-LOX blockade in Alzheimer transgenic 3xTg-AD mice.

    PubMed

    Bitto, Alessandra; Giuliani, Daniela; Pallio, Giovanni; Irrera, Natasha; Vandini, Eleonora; Canalini, Fabrizio; Zaffe, Davide; Ottani, Alessandra; Minutoli, Letteria; Rinaldi, Mariagrazia; Guarini, Salvatore; Squadrito, Francesco; Altavilla, Domenica

    2017-05-01

    Alzheimer's disease (AD) is associated with amyloid plaques (Aβ) and hyperphosphorylated tau protein tangles in the brain. We investigated the possible neuroprotective role of flavocoxid, a dual inhibitor of cyclooxygenases-1/2 (COX-1/2) and 5-Lipoxygenase (5-LOX), in triple-transgenic (3xTg-AD) mice. Mice were 3 months at the beginning of the study. Animals received once daily for 3-month saline solution or flavocoxid (20 mg/kg/ip). Morris water maze was used to assess learning and memory. Histology was performed to evidence Aβ plaques and neuronal loss, while inflammatory proteins were determined by western blot analysis. Saline-treated 3xTg-AD mice showed an impairment in spatial learning and memory (assessed at 6 months of age), and increased expression of inflammatory and apoptotic molecules. Treatment of 3xTg-AD mice with flavocoxid reduced: (1) learning and memory loss; (2) the increased eicosanoid production and the phosphorylation level of amyloid precursor protein (APP-pThr668), Aβ 1-42, p-tau (pThr181), pERK, and the activation of the NLRP3 inflammasome; (3) Aβ plaques; and (4) neuronal loss, compared to saline-treated animals. Pharmacological blockade of both COX-1/2 and 5-LOX was able to counteract the progression of AD by targeting pathophysiological mechanisms up- and downstream of Aβ and tau.

  5. Age-dependent neurodegeneration accompanying memory loss in transgenic mice defective in mitochondrial aldehyde dehydrogenase 2 activity.

    PubMed

    Ohsawa, Ikuroh; Nishimaki, Kiyomi; Murakami, Yayoi; Suzuki, Yuko; Ishikawa, Masahiro; Ohta, Shigeo

    2008-06-11

    Oxidative stress may underlie age-dependent memory loss and cognitive decline. Toxic aldehydes, including 4-hydroxy-2-nonenal (HNE), an end product of lipid peroxides, are known to accumulate in the brain in neurodegenerative disease. We have previously shown that mitochondrial aldehyde dehydrogenase 2 (ALDH2) detoxifies HNE by oxidizing its aldehyde group. To investigate the role of such toxic aldehydes, we produced transgenic mice, which expressed a dominant-negative form of ALDH2 in the brain. The mice had decreased ability to detoxify HNE in their cortical neurons and accelerated accumulation of HNE in the brain. Consequently, their lifespan was shortened and age-dependent neurodegeneration and hyperphosphorylation of tau were observed. Object recognition and Morris water maze tests revealed that the onset of cognitive impairment correlated with the degeneration, which was further accelerated by APOE (apolipoprotein E) knock-out; therefore, the accumulation of toxic aldehydes is by itself critical in the progression of neurodegenerative disease, which could be suppressed by ALDH2.

  6. New animal models to study the role of tyrosinase in normal retinal development.

    PubMed

    Lavado, Alfonso; Montoliu, Lluis

    2006-01-01

    Albino animals display a hypopigmented phenotype associated with several visual abnormalities, including rod photoreceptor cell deficits, abnormal patterns of connections between the eye and the brain and a general underdevelopment of central retina. Oculocutaneous albinism type I, a common form of albinism, is caused by mutations in the tyrosinase gene. In mice, the albino phenotype can be corrected by functional tyrosinase transgenes. Tyrosinase transgenic animals not only show normal pigmentation but the correction of all visual abnormalities associated with albinism, confirming a role of tyrosinase, a key enzyme in melanin biosynthesis, in normal retinal development. Here, we will discuss recent work carried out with new tyrosinase transgenic mouse models, to further analyse the role of tyrosinase in retinal development. We will first report a transgenic model with inducible tyrosinase expression that has been used to address the regulated activation of this gene and its associated effects on the development of the visual system. Second, we will comment on an interesting yeast artificial chromosome (YAC)-tyrosinase transgene, lacking important regulatory elements, that has highlighted the significance of local interactions between the retinal pigment epithelium (RPE) and developing neural retina.

  7. Prx1 and 3.2 kb Col1a1 promoters target distinct bone cell populations in transgenic mice

    PubMed Central

    Ouyang, Zhufeng; Chen, Zhijun; Ishikawa, Masakazu; Yue, Xiuzhen; Kawanami, Aya; Leahy, Patrick; Greenfield, Edward M.; Murakami, Shunichi

    2014-01-01

    Bones consist of a number of cell types including osteoblasts and their precursor cells at various stages of differentiation. To analyze cellular organization within the bone, we generated Col1a1CreER-DsRed transgenic mice that express, in osteoblasts, CreER and DsRed under the control of a mouse 3.2 kb Col1a1 promoter. We further crossed Col1a1CreER-DsRed mice with Prx1CreER-GFP mice that express CreER and GFP in osteochondro progenitor cells under the control of a 2.4 kb Prx1 promoter. Since the 3.2 kb Col1a1 promoter becomes active in osteoblasts at early stages of differentiation, and Prx1CreER-GFP-expressing periosteal cells show endogenous Col1a1 expression, we expected to find a cell population in which both the 2.4 kb Prx1 promoter and the 3.2 kb Col1a1 promoter are active. However, our histological and flow cytometric analyses demonstrated that these transgenes are expressed in distinct cell populations. In the periosteum of long bones, Col1a1CreER-DsRed is expressed in the innermost layer directly lining the bone surface, while Prx1CreER-GFP-expressing cells are localized immediately outside of the Col1a1CreER-DsRed-expressing osteoblasts. In the calvaria, Prx1CreER-GFP-expressing cells are also localized in the cranial suture mesenchyme. Our experiments further showed that Col1a1CreER-DsRed-expressing cells lack chondrogenic potential, while the Prx1CreER-GFP-expressing cells show both chondrogenic and osteogenic potential. Our results indicate that Col1a1CreER-DsRed-expressing cells are committed osteoblasts, while Prx1CreER-GFP-expressing cells are osteochondro progenitor cells. The Prx1CreER-GFP and Col1a1CreER-DsRed transgenes will offer novel approaches for analyzing lineage commitment and early stages of osteoblast differentiation under physiologic and pathologic conditions. PMID:24513582

  8. In vivo characterisation of the inflammatory reaction following mesh implantation in transgenic mice models.

    PubMed

    Fet, N; Alizai, P H; Fragoulis, A; Wruck, C; Pufe, T; Tolba, R H; Neumann, U P; Klinge, U

    2014-06-01

    Hernia repair with prosthetic meshes represents one of the most common surgical procedures in the field of surgery. This intervention is always associated with an ensuing inflammatory response, angiogenesis and fibrotic encapsulation forming a foreign body granuloma (FBG) around the mesh fibres. Several studies have described this inflammatory reaction by characterising inflammatory cell infiltrate around the FBG after mesh explantation. However, very little is known about the real-time progression of such an inflammatory response. The aim of this study was to investigate the feasibility of monitoring the ongoing inflammatory response to mesh implantation using bioluminescence in vivo. Three luciferase transgenic mice strains (FVB/N-Tg(Vegfr2-luc)-Xen, BALB/C-Tg(NFκB-RE-luc)-Xen and Tg(INS/EpRE-Luc)T20Rbl) were used. Mice were anaesthetized with 2 % isoflurane, and two incisions were made on the left and right sides of the abdomen of the mice. A 1-cm(2) propylene mesh was implanted subcutaneously in the right incision wound of each mouse, and the left wound served as control. Two hundred microliters of D-luciferin was injected into the mice, and bioluminescence measurements were done prior to the surgical intervention and subsequently every 3 days. After mesh explantation, histological analysis was done. Statistical analysis was done using prism GraphPad software. Bioluminescence results revealed different time points of maximum signal for the different mice strains. VEGFR2 gene expression peaked on day 6, NFkB on day 12 and ARE on day 3 post mesh implantation. We also observed much higher bioluminescent signal around the FBG surrounding the mesh as compared to the control wound, with p < 0.05 for all the different mice strains. Our results prove the possibility of monitoring the inflammatory reaction after mesh implantation in vivo using bioluminescence signal release. This provides a novel method of accessing and accurately describing the ongoing

  9. Inhibition of c-Met reduces lymphatic metastasis in RIP-Tag2 transgenic mice

    PubMed Central

    Sennino, Barbara; Ishiguro-Oonuma, Toshina; Schriver, Brian J.; Christensen, James G.; McDonald, Donald M.

    2013-01-01

    Inhibition of vascular endothelial growth factor (VEGF) signaling can promote lymph node metastasis in preclinical models, but the mechanism is not fully understood, and successful methods of prevention have not been found. Signaling of hepatocyte growth factor (HGF) and its receptor c-Met can promote the growth of lymphatics and metastasis of some tumors. We sought to explore the contributions of c-Met signaling to lymph node metastasis after inhibition of VEGF signaling. In particular, we examined whether c-Met is upregulated in lymphatics in or near pancreatic neuroendocrine tumors in RIP-Tag2 transgenic mice and whether lymph node metastasis can be reduced by concurrent inhibition of VEGF and c-Met signaling. Inhibition of VEGF signaling by anti-VEGF antibody or sunitinib in mice from age 14 to 17 weeks was accompanied by more intratumoral lymphatics, more tumor cells inside lymphatics, and more lymph node metastases. Under these conditions, lymphatic endothelial cells - like tumor cells - had strong immunoreactivity for c-Met and phospho-c-Met. c-Met blockade by the selective inhibitor PF-04217903 significantly reduced metastasis to local lymph nodes. Together, these results indicate that inhibition of VEGF signaling in RIP-Tag2 mice upregulates c-Met expression in lymphatic endothelial cells, increases the number of intratumoral lymphatics and number of tumor cells within lymphatics, and promotes metastasis to local lymph nodes. Prevention of lymph node metastasis by PF-04217903 in this setting implicates c-Met signaling in tumor cell spread to lymph nodes. PMID:23576559

  10. An Antidepressant Decreases CSF Aβ Production in Healthy Individuals and in Transgenic AD Mice

    PubMed Central

    Sheline, Yvette I.; West, Tim; Yarasheski, Kevin; Swarm, Robert; Jasielec, Mateusz S.; Fisher, Jonathan R.; Ficker, Whitney D.; Yan, Ping; Xiong, Chengjie; Frederiksen, Christine; Grzelak, Monica V.; Chott, Robert; Bateman, Randall J.; Morris, John C.; Mintun, Mark A.; Lee, Jin-Moo; Cirrito, John R.

    2014-01-01

    Serotonin signaling suppresses generation of amyloid-β (Aβ) in vitro and in animal models of Alzheimer’s disease (AD). We show that in an aged transgenic AD mouse model (APP/PS1 plaque-bearing mice), the antidepressant citalopram, a selective serotonin reuptake inhibitor (SSRI), decreased Aβ in brain interstitial fluid (ISF) in a dose-dependent manner. Growth of individual amyloid plaques was assessed in plaque-bearing mice that were chronically administered citalopram. Citalopram arrested the growth of pre-existing plaques and reduced the appearance of new plaques by 78%. In healthy human volunteers, citalopram’s effects on Aβ production and Aβ concentrations in cerebrospinal fluid (CSF) were measured prospectively using stable-isotope labeling kinetics (SILK), with CSF sampling during acute dosing of citalopram. Aβ production in CSF was slowed by 37% in the citalopram group compared to placebo. This change was associated with a 38% decrease in total CSF Aβ concentrations in the drug-treated group. The ability to safely decrease Aβ concentrations is potentially important as a preventive strategy for AD. This study demonstrates key target engagement for future AD prevention trials. PMID:24828079

  11. Vectored Intracerebral Immunization with the Anti-Tau Monoclonal Antibody PHF1 Markedly Reduces Tau Pathology in Mutant Tau Transgenic Mice.

    PubMed

    Liu, Wencheng; Zhao, Lingzhi; Blackman, Brittany; Parmar, Mayur; Wong, Man Ying; Woo, Thomas; Yu, Fangmin; Chiuchiolo, Maria J; Sondhi, Dolan; Kaminsky, Stephen M; Crystal, Ronald G; Paul, Steven M

    2016-12-07

    Passive immunization with anti-tau monoclonal antibodies has been shown by several laboratories to reduce age-dependent tau pathology and neurodegeneration in mutant tau transgenic mice. These studies have used repeated high weekly doses of various tau antibodies administered systemically for several months and have reported reduced tau pathology of ∼40-50% in various brain regions. Here we show that direct intrahippocampal administration of the adeno-associated virus (AAV)-vectored anti-phospho-tau antibody PHF1 to P301S tau transgenic mice results in high and durable antibody expression, primarily in neurons. Hippocampal antibody levels achieved after AAV delivery were ∼50-fold more than those reported following repeated systemic administration. In contrast to systemic passive immunization, we observed markedly reduced (≥80-90%) hippocampal insoluble pathological tau species and neurofibrillary tangles following a single dose of AAV-vectored PHF1 compared with mice treated with an AAV-IgG control vector. Moreover, the hippocampal atrophy observed in untreated P301S mice was fully rescued by treatment with the AAV-vectored PHF1 antibody. Vectored passive immunotherapy with an anti-tau monoclonal antibody may represent a viable therapeutic strategy for treating or preventing such tauopathies as frontotemporal dementia, progressive supranuclear palsy, or Alzheimer's disease. We have used an adeno-associated viral (AAV) vector to deliver the genes encoding an anti-phospho-tau monoclonal antibody, PHF1, directly to the brain of mice that develop neurodegeneration due to a tau mutation that causes frontotemporal dementia (FTD). When administered systemically, PHF1 has been shown to modestly reduce tau pathology and neurodegeneration. Since such antibodies do not readily cross the blood-brain barrier, we used an AAV vector to deliver antibody directly to the hippocampus and observed much higher antibody levels and a much greater reduction in tau pathology. Using

  12. Thioredoxin-1 overexpression in transgenic mice attenuates streptozotocin-induced diabetic osteopenia: a novel role of oxidative stress and therapeutic implications.

    PubMed

    Hamada, Yasuhiro; Fujii, Hideki; Kitazawa, Riko; Yodoi, Junji; Kitazawa, Sohei; Fukagawa, Masafumi

    2009-05-01

    Diabetes mellitus is associated with increased risk of osteopenia and bone fracture. However, the mechanisms accounting for diabetic bone disorder are unclear. We have previously reported that streptozotocin-induced diabetic mice develop low turnover osteopenia associated with increased oxidative stress in the diabetic condition. To determine the role of oxidative stress in the development of diabetic osteopenia, we presently investigated the effect of overexpression of thioredoxin-1 (TRX), a major intracellular antioxidant, on the development of diabetic osteopenia, using TRX transgenic mice (TRX-Tg). TRX-Tg are C57BL/6 mice that carry the human TRX transgene under the control of beta-actin promoter. Eight-week-old male TRX-Tg mice and wild type (WT) littermates were intraperitoneally injected with either streptozotocin or vehicle. Mice were grouped as 1) non-diabetic WT, 2) non-diabetic TRX-Tg, 3) diabetic WT, and 4) diabetic TRX-Tg. After 12 weeks of streptozotocin treatment, oxidative stress on the whole body and bone was evaluated, and the physical properties of the femora, and histomorphometry parameters of the tibiae were assessed. TRX overexpression did not affect either body weight or hemoglobin A1c levels. There were no significant differences in renal function and in serum levels of calcium, phosphate, and intact parathyroid hormone among the four groups. On the other hand, urinary excretion of 8-hydroxydeoxyguanosine (8-OHdG), a marker of oxidative DNA damage, was significantly elevated in diabetic WT and attenuated in diabetic TRX-Tg. Immunohistochemical staining for 8-OHdG revealed marked intensity in the bone tissue of diabetic WT compared with non-diabetic WT, while staining was attenuated in diabetic TRX-Tg. TRX overexpression partially restored reduced bone mineral density and prevented the suppression of bone formation observed in diabetic WT. Increased oxidative stress in diabetic condition contributes to the development of diabetic osteopenia

  13. Cardiac phenotype induced by a dysfunctional α1C transgene

    PubMed Central

    Lao, Qi Zong; Ravindran, Arippa; Herbert, Ron; Canuto, Holly C

    2011-01-01

    Based on stable integration of recombinant DNA into a host genome, transgenic technology has become an important genetic engineering methodology. An organism whose genetic characteristics have been altered by the insertion of foreign DNA is supposed to exhibit a new phenotype associated with the function of the transgene. However, successful insertion may not be sufficient to achieve specific modification of function. In this study we describe a strain of transgenic mouse, G7-882, generated by incorporation into the mouse genome of human Cav1.2 α1C cDNA deprived of 3′-UTR to exclude transcription. We found that, in response to chronic infusion of isoproterenol, G7-882 develops dilated cardiomyopathy, a misleading “transgenic artifact” compatible with the expected function of the incorporated “correct” transgene. Specifically, using magnetic resonance imaging (MRI), we found that chronic β-adrenergic stimulation of G7-882 mice caused left ventricular hypertrophy and aggravated development of dilated cardiomyopathy, although no significant changes in the kinetics, density and voltage dependence of the calcium current were observed in G7-882 cardiomyocytes as compared to cells from wild type mice. This result illustrates the possibility that even when a functional transgene is expressed, an observed change in phenotype may be due to the artifact of “incidental incorporation” leading to misleading conclusions. To exclude this possibility and thus provide a robust tool for exploring biological function, the new transgenic phenotype must be replicated in several independently generated transgenic strains. PMID:21224729

  14. The PreS2 activator MHBst of hepatitis B virus activates c-raf-1/Erk2 signaling in transgenic mice

    PubMed Central

    Hildt, Eberhard; Munz, Barbara; Saher, Gesine; Reifenberg, Kurt; Hofschneider, Peter Hans

    2002-01-01

    The large hepatitis B virus (HBV) surface protein (LHBs) and C-terminally truncated middle size surface proteins (MHBst) form the family of the PreS2 activator proteins of HBV. Their transcriptional activator function is based on the cytoplasmic orientation of the PreS2 domain. MHBst activators are paradigmatic for this class of activators. Here we report that MHBst is protein kinase C (PKC)-dependently phosphorylated at Ser28. The integrity of the phosphorylation site is essential for the activator function. MHBst triggers PKC-dependent activation of c-Raf-1/Erk2 signaling that is a prerequisite for MHBst-dependent activation of AP-1 and NF-κB. To analyze the pathophysiological relevance of these data in vivo, transgenic mice were established that produce the PreS2 activator MHBst specifically in the liver. In these mice, a permanent PreS2-dependent specific activation of c-Raf-1/Erk2 signaling was observed, resulting in an increased hepatocyte proliferation rate. In transgenics older than 15 months, an increased incidence of liver tumors occurs. These data suggest that PreS2 activators LHBs and MHBst exert a tumor promoter-like function by activation of key enzymes of proliferation control. PMID:11847101

  15. Transgenic Mouse Model for Reducing Oxidative Damage in Bone

    NASA Technical Reports Server (NTRS)

    Schreurs, Ann-Sofie; Torres, S.; Truong, T.; Moyer, E. L.; Kumar, A.; Tahimic, Candice C. G.; Alwood, J. S.; Limoli, C. L.; Globus, R. K.

    2016-01-01

    Bone loss can occur due to many challenges such age, radiation, microgravity, and Reactive Oxygen Species (ROS) play a critical role in bone resorption by osteoclasts (Bartell et al. 2014). We hypothesize that suppression of excess ROS in skeletal cells, both osteoblasts and osteoclasts, regulates skeletal growth and remodeling. To test our hypothesis, we used transgenic mCAT mice which overexpress the human anti-oxidant catalase gene targeted to the mitochondria, the main site for endogenous ROS production. mCAT mice have a longer life-span than wildtype controls and have been used to study various age-related disorders. To stimulate remodeling, 16 week old mCAT mice or wildtype mice were exposed to treatment (hindlimb-unloading and total body-irradiation) or sham treatment conditions (control). Tissues were harvested 2 weeks later for skeletal analysis (microcomputed tomography), biochemical analysis (gene expression and oxidative damage measurements), and ex vivo bone marrow derived cell culture (osteoblastogenesis and osteoclastogenesis). mCAT mice expressed the transgene and displayed elevated catalase activity in skeletal tissue and marrow-derived osteoblasts and osteoclasts grown ex vivo. In addition, when challenged with treatment, bone tissues from wildtype mice showed elevated levels of malondialdehyde (MDA), indicating oxidative damage) whereas mCAT mice did not. Correlation analysis revealed that increased catalase activity significantly correlated with decreased MDA levels and that increased oxidative damage correlated with decreased percent bone volume (BVTV). In addition, ex-vivo cultured osteoblast colony growth correlated with catalase activity in the osteoblasts. Thus, we showed that these transgenic mice can be used as a model to study the relationship between markers of oxidative damage and skeletal properties. mCAT mice displayed reduced BVTV and trabecular number relative to wildtype mice, as well as increased structural model index in the

  16. Transgenic APP expression during postnatal development causes persistent locomotor hyperactivity in the adult.

    PubMed

    Rodgers, Shaefali P; Born, Heather A; Das, Pritam; Jankowsky, Joanna L

    2012-06-18

    Transgenic mice expressing disease-associated proteins have become standard tools for studying human neurological disorders. Transgenes are often expressed using promoters chosen to drive continuous high-level expression throughout life rather than temporal and spatial fidelity to the endogenous gene. This approach has allowed us to recapitulate diseases of aging within the two-year lifespan of the laboratory mouse, but has the potential for creating aberrant phenotypes by mechanisms unrelated to the human disorder. We show that overexpression of the Alzheimer's-related amyloid precursor protein (APP) during early postnatal development leads to severe locomotor hyperactivity that can be significantly attenuated by delaying transgene onset until adulthood. Our data suggest that exposure to transgenic APP during maturation influences the development of neuronal circuits controlling motor activity. Both when matched for total duration of APP overexpression and when matched for cortical amyloid burden, animals exposed to transgenic APP as juveniles are more active in locomotor assays than animals in which APP overexpression was delayed until adulthood. In contrast to motor activity, the age of APP onset had no effect on thigmotaxis in the open field as a rough measure of anxiety, suggesting that the interaction between APP overexpression and brain development is not unilateral. Our findings indicate that locomotor hyperactivity displayed by the tet-off APP transgenic mice and several other transgenic models of Alzheimer's disease may result from overexpression of mutant APP during postnatal brain development. Our results serve as a reminder of the potential for unexpected interactions between foreign transgenes and brain development to cause long-lasting effects on neuronal function in the adult. The tet-off APP model provides an easy means of avoiding developmental confounds by allowing transgene expression to be delayed until the mice reach adulthood.

  17. Increased Vulnerability of the Hippocampus in Transgenic Mice Overexpressing APP and Triple Repeat Tau.

    PubMed

    Arner, Andrew; Rockenstein, Edward; Mante, Michael; Florio, Jazmin; Masliah, Deborah; Salehi, Bahar; Adame, Anthony; Overk, Cassia; Masliah, Eliezer; Rissman, Robert A

    2018-01-01

     Alzheimer's disease (AD) is the most common tauopathy, characterized by progressive accumulation of amyloid-β (Aβ) and hyperphosphorylated tau. While pathology associated with the 4-repeat (4R) tau isoform is more abundant in corticobasal degeneration and progressive supranuclear palsy, both 3R and 4R tau isoforms accumulate in AD. Many studies have investigated interactions between Aβ and 4R tau in double transgenic mice, but few, if any, have examined the effects of Aβ with 3R tau. To examine this relationship, we crossed our APP751 mutant line with our recently characterized 3R tau mutant model to create a bigenic line (hAPP-3RTau) to model AD neuropathology. Mice were analyzed at 3 and 6 months of age for pathological and behavioral endpoints. While both the 3RTau and the hAPP-3RTau mice showed neuronal loss, increased tau aggregation, Aβ plaques and exhibited more behavioral deficits compared to the non-tg control, the bigenic mice often displaying relatively worsening levels. We found that even in young animals we found that the presence of APP/Aβ increased the accumulation of 3R tau in the neocortex and hippocampus. This observation was accompanied by activation of GSK3 and neurodegeneration in the neocortex and CA1 region. These results suggest that in addition to 4R tau, APP/Aβ may also enhance accumulation of 3R tau, a process which may be directly relevant to pathogenic pathways in AD. Our results demonstrate that this bigenic model closely parallels the pathological course of AD and may serve as a valuable model for testing new pharmacological interventions.

  18. Formulation of the bivalent prostate cancer vaccine with surgifoam elicits antigen-specific effector T cells in PSA-transgenic mice.

    PubMed

    Karan, Dev

    2017-10-13

    We previously developed and characterized an adenoviral-based prostate cancer vaccine for simultaneous targeting of prostate-specific antigen (PSA) and prostate stem cell antigen (PSCA). We also demonstrated that immunization of mice with the bivalent vaccine (Ad 5 -PSA+PSCA) inhibited the growth of established prostate tumors. However, there are multiple challenges hindering the success of immunological therapies in the clinic. One of the prime concerns has been to overcome the immunological tolerance and maintenance of long-term effector T cells. In this study, we further characterized the use of the bivalent vaccine (Ad 5 -PSA+PSCA) in a transgenic mouse model expressing human PSA in the mouse prostate. We demonstrated the expression of PSA analyzed at the mRNA level (by RT-PCR) and protein level (by immunohistochemistry) in the prostate lobes harvested from the PSA-transgenic (PSA-Tg) mice. We established that the administration of the bivalent vaccine in surgifoam to the PSA-Tg mice induces strong PSA-specific effector CD8 + T cells as measured by IFN-γ secretion and in vitro cytotoxic T-cell assay. Furthermore, the use of surgifoam with Ad 5 -PSA+PSCA vaccine allows multiple boosting vaccinations with a significant increase in antigen-specific CD8 + T cells. These observations suggest that the formulation of the bivalent prostate cancer vaccine (Ad 5 -PSA+PSCA) with surgifoam bypasses the neutralizing antibody response, thus allowing multiple boosting. This formulation is also helpful for inducing an antigen-specific immune response in the presence of self-antigen, and maintains long-term effector CD8 + T cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  19. Thioredoxin 1 Enhances Neovascularization and Reduces Ventricular Remodeling During Chronic Myocardial Infarction: A Study Using Thioredoxin 1 Transgenic Mice

    PubMed Central

    Adluri, Ram Sudheer; Thirunavukkarasu, Mahesh; Zhan, Lijun; Akita, Yuzo; Samuel, Samson Mathews; Otani, Hajime; Ho, Ye-Shih; Maulik, Gautam; Maulik, Nilanjana

    2010-01-01

    Oxidative stress plays a crucial role in disruption of neovascularization by alterations in thioredoxin-1 (Trx1) expression and its interaction with other proteins after myocardial infarction (MI). We previously showed that Trx1 has angiogenic properties, but the possible therapeutic significance of overexpressing Trx1 in chronic MI has not been elucidated. Therefore, we explored the angiogenic and cardioprotective potential of Trx1 in an in vivo MI model using transgenic mice overexpressing Trx1. Wild type (W) and Trx1 transgenic (Trx1Tg/+) mice were randomized into W Sham (WS), Trx1Tg/+ Sham (TS), WMI and TMI. MI was induced by permanent occlusion of LAD coronary artery. Hearts from mice overexpressing Trx1 exhibited reduced fibrosis and oxidative stress, and attenuated cardiomyocyte apoptosis along with increased vessel formation compared to WMI. We found significant inhibition of Trx1 regulating proteins, TXNIP and AKAP 12, and increased p-Akt, p-eNOS and p-GSK-3β, HIF-1α, β-catenin, VEGF, Bcl-2 and survivin expression in TMI compared to WMI. Echocardiography performed 30 days after MI revealed significant improvement in myocardial functions in TMI compared to WMI. Our study identifies a potential role for Trx1 overexpression and its association with its regulatory proteins TXNIP, AKAP12 and subsequent activation of Akt/GSK-3β/β-catenin/HIF-1α-mediated VEGF and eNOS expression in inducing angiogenesis and reduced ventricular remodeling. Hence, Trx1 and other proteins identified in our study may prove to be potential therapeutic targets in the treatment of ischemic heart disease. PMID:21074540

  20. Neurodegenerative disorder FTDP-17-related tau intron 10 +16C → T mutation increases tau exon 10 splicing and causes tauopathy in transgenic mice.

    PubMed

    Umeda, Tomohiro; Yamashita, Takenari; Kimura, Tetsuya; Ohnishi, Kiyouhisa; Takuma, Hiroshi; Ozeki, Tomoko; Takashima, Akihiko; Tomiyama, Takami; Mori, Hiroshi

    2013-07-01

    Frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17) is a neurodegenerative disorder caused by mutations in the tau gene. Many mutations identified in FTDP-17 have been shown to affect tau exon 10 splicing in vitro, which presumably causes pathologic imbalances in exon 10(-) [3-repeat (3R)] and exon 10(+) [4-repeat (4R)] tau expression and leads to intracellular inclusions of hyperphosphorylated tau in patient brains. However, no reports have investigated this theory using model mice with a tau intronic mutation. Herein, we generated new transgenic mice harboring the tau intron 10 +16C → T mutation. We prepared a transgene construct containing intronic sequences required for exon 10 splicing in the longest tau isoform cDNA. Although mice bearing the construct without the intronic mutation showed normal developmental changes of the tau isoform from 3R tau to equal amounts of 3R and 4R tau, mice with the mutation showed much higher levels of 4R tau at the adult stage. 4R tau was selectively recovered in insoluble brain fractions in their old age. Furthermore, these mice displayed abnormal tau phosphorylation, synapse loss and dysfunction, memory impairment, glial activation, tangle formation, and neuronal loss in an age-dependent manner. These findings provide the first evidence in a mouse model that a tau intronic mutation-induced imbalance of 3R and 4R tau could be a cause of tauopathy. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.