Sample records for yac128 mouse model

  1. Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

    PubMed

    Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

    2013-01-01

    Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy

  2. In Vivo MRI Evidence that Neuropathology is Attenuated by Cognitive Enrichment in the Yac128 Huntington's Disease Mouse Model.

    PubMed

    Steventon, Jessica J; Harrison, David J; Trueman, Rebecca C; Rosser, Anne E; Jones, Derek K; Brooks, Simon P

    2015-01-01

    Environmental enrichment has been shown to improve symptoms and reduce neuropathology in mouse models of Huntington's disease (HD); however results are limited to ex vivo techniques with associated shortcomings. In-vivo magnetic resonance imaging (MRI) can overcome some of the shortcomings and is applied for the first time here to assess the effect of a cognitive intervention in a mouse model of HD. We aimed to investigate whether in-vivo high-field MRI can detect a disease-modifying effect in tissue macrostructure following a cognitive enrichment regime. YAC128 transgenic and wild type mice were exposed to cognitive enrichment throughout their lifetime. At 20-months old, mice were scanned with a T2-weighted MRI sequence and a region-of-interest (ROI) approach was used to examine structural changes. Locomotor activity and performance on the rotarod and serial discrimination watermaze task were assessed to measure motor and cognitive function respectively. Mice exposed to cognitive enrichment were more active and able to stay on a rotating rod longer compared to control mice, with comparable rotarod performance between HD enriched mice and wild-type mice. YAC128 mice demonstrated cognitive impairments which were not improved by cognitive enrichment. In-vivo MRI revealed a reduction in the degree of caudate-putamen atrophy in the enriched HD mice. We provide in vivo evidence of a beneficial effect of environmental enrichment on neuropathology and motor function in a HD mouse model. This demonstrates the efficacy of MRI in a model of HD and provides the basis for an in-vivo non-destructive outcome measure necessary for longitudinal study designs to understand the effect of enrichment with disease progression.

  3. Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington's Disease Mice.

    PubMed

    Berggren, Kiersten L; Lu, Zhen; Fox, Julia A; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H

    2016-01-01

    Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington's disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363-74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Female neonatal mice were supplemented daily from days 10-17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later.

  4. Neonatal Iron Supplementation Induces Striatal Atrophy in Female YAC128 Huntington’s Disease Mice

    PubMed Central

    Berggren, Kiersten L.; Lu, Zhen; Fox, Julia A.; Dudenhoeffer, Megan; Agrawal, Sonal; Fox, Jonathan H.

    2016-01-01

    Background: Dysregulation of iron homeostasis is implicated in the pathogenesis of Huntington’s disease. We have previously shown that increased iron intake in R6/2 HD neonatal mice, but not adult R6/2 HD mice potentiates disease outcomes at 12-weeks of age corresponding to advanced HD [Redox Biol. 2015;4 : 363–74]. However, whether these findings extend to other HD models is unknown. In particular, it is unclear if increased neonatal iron intake can promote neurodegeneration in mouse HD models where disease onset is delayed to mid-adult life. Objective: To determine if increased dietary iron intake in neonatal and adult life-stages potentiates HD in the slowly progressive YAC128 HD mouse model. Methods: Female neonatal mice were supplemented daily from days 10–17 with 120μg/g body weight of carbonyl iron. Adult mice were provided diets containing low (50 ppm), medium (150 ppm) and high (500 ppm) iron concentrations from 2-months of age. HD progression was determined using behavioral, brain morphometric and biochemical approaches. Results: Neonatal-iron supplemented YAC128 HD mice had significantly lower striatal volumes and striatal neuronal cell body volumes as compared to control HD mice at 1-year of age. Neonatal-iron supplementation of HD mice had no effect on rota-rod motor endurance and brain iron or glutathione status. Adult iron intake level had no effect on HD progression. YAC128 HD mice had altered peripheral responses to iron intake compared to iron-matched wild-type controls. Conclusions: Female YAC128 HD mice supplemented with nutritionally-relevant levels of iron as neonates demonstrate increased striatal degeneration 1-year later. PMID:27079948

  5. YAC128 Huntington's disease transgenic mice show enhanced short-term hippocampal synaptic plasticity early in the course of the disease.

    PubMed

    Ghilan, Mohamed; Bostrom, Crystal A; Hryciw, Brett N; Simpson, Jessica M; Christie, Brian R; Gil-Mohapel, Joana

    2014-09-18

    Huntington's disease (HD) is a progressive and fatal neurodegenerative disorder caused by a polyglutamine expansion in the gene encoding the protein huntingtin. The disease progresses over decades, but often patients develop cognitive impairments that precede the onset of the classical motor symptoms. Similar to the disease progression in humans, the yeast artificial chromosome (YAC) 128 HD mouse model also exhibits cognitive dysfunction that precedes the onset of the neuropathological and motor impairments characteristic of HD. Thus, the purpose of this study was to evaluate whether short- and long-term synaptic plasticity in the hippocampus, two related biological models of learning and memory processes, were altered in YAC128 mice in early stages of disease progression. We show that the YAC128 hippocampal dentate gyrus (DG) displays marked reductions in paired-pulse depression both at 3 and 6 months of age. In addition, significantly enhanced post-tetanic and short-term potentiation are apparent in YAC128 mice after high-frequency stimulation at this time. Early and late forms of long-term plasticity were not altered at this stage. Together these findings indicate that there may be elevated neurotransmitter release in response to synaptic stimulation in YAC128 mice during the initial phase of disease progression. These abnormalities in short-term plasticity detected at this stage in YAC128 HD transgenic mice indicate that aberrant information processing at the level of the synapses may contribute, at least in part, to the early onset of cognitive deficits that are characteristic of this devastating neurodegenerative disorder. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. AAV-dominant negative tumor necrosis factor (DN-TNF) gene transfer to the striatum does not rescue medium spiny neurons in the YAC128 mouse model of Huntington's disease.

    PubMed

    Alto, Laura Taylor; Chen, Xi; Ruhn, Kelly A; Treviño, Isaac; Tansey, Malú G

    2014-01-01

    CNS inflammation is a hallmark of neurodegenerative disease, and recent studies suggest that the inflammatory response may contribute to neuronal demise. In particular, increased tumor necrosis factor (TNF) signaling is implicated in the pathology of both Parkinson's disease (PD) and Alzheimer's disease (AD). We have previously shown that localized gene delivery of dominant negative TNF to the degenerating brain region can limit pathology in animal models of PD and AD. TNF is upregulated in Huntington's disease (HD), like in PD and AD, but it is unknown whether TNF signaling contributes to neuronal degeneration in HD. We used in vivo gene delivery to test whether selective reduction of soluble TNF signaling could attenuate medium spiny neuron (MSN) degeneration in the YAC128 transgenic (TG) mouse model of Huntington's disease (HD). AAV vectors encoding cDNA for dominant-negative tumor necrosis factor (DN-TNF) or GFP (control) were injected into the striatum of young adult wild type WT and YAC128 TG mice and achieved 30-50% target coverage. Expression of dominant negative TNF protein was confirmed immunohistologically and biochemically and was maintained as mice aged to one year, but declined significantly over time. However, the extent of striatal DN-TNF gene transfer achieved in our studies was not sufficient to achieve robust effects on neuroinflammation, rescue degenerating MSNs or improve motor function in treated mice. Our findings suggest that alternative drug delivery strategies should be explored to determine whether greater target coverage by DN-TNF protein might afford some level of neuroprotection against HD-like pathology and/or that soluble TNF signaling may not be the primary driver of striatal neuroinflammation and MSN loss in YAC128 TG mice.

  7. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

    PubMed

    Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

    2011-11-25

    Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as

  8. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

    PubMed Central

    2011-01-01

    Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2

  9. Cellular, Molecular and Functional Characterisation of YAC Transgenic Mouse Models of Friedreich Ataxia

    PubMed Central

    Anjomani Virmouni, Sara; Sandi, Chiranjeevi; Al-Mahdawi, Sahar; Pook, Mark A.

    2014-01-01

    Background Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder, caused by a GAA repeat expansion mutation within intron 1 of the FXN gene. We have previously established and performed preliminary characterisation of several human FXN yeast artificial chromosome (YAC) transgenic FRDA mouse models containing GAA repeat expansions, Y47R (9 GAA repeats), YG8R (90 and 190 GAA repeats) and YG22R (190 GAA repeats). Methodology/Principal Findings We now report extended cellular, molecular and functional characterisation of these FXN YAC transgenic mouse models. FXN transgene copy number analysis of the FRDA mice demonstrated that the YG22R and Y47R lines each have a single copy of the FXN transgene while the YG8R line has two copies. Single integration sites of all transgenes were confirmed by fluorescence in situ hybridisation (FISH) analysis of metaphase and interphase chromosomes. We identified significant functional deficits, together with a degree of glucose intolerance and insulin hypersensitivity, in YG8R and YG22R FRDA mice compared to Y47R and wild-type control mice. We also confirmed increased somatic GAA repeat instability in the cerebellum and brain of YG22R and YG8R mice, together with significantly reduced levels of FXN mRNA and protein in the brain and liver of YG8R and YG22R compared to Y47R. Conclusions/Significance Together these studies provide a detailed characterisation of our GAA repeat expansion-based YAC transgenic FRDA mouse models that will help investigations of FRDA disease mechanisms and therapy. PMID:25198290

  10. Changes in the striatal proteome of YAC128Q mice exhibit gene-environment interactions between mutant huntingtin and manganese.

    PubMed

    Wegrzynowicz, Michal; Holt, Hunter K; Friedman, David B; Bowman, Aaron B

    2012-02-03

    Huntington's disease (HD) is a neurodegenerative disorder caused by expansion of a CAG repeat within the Huntingtin (HTT) gene, though the clinical presentation of disease and age-of-onset are strongly influenced by ill-defined environmental factors. We recently reported a gene-environment interaction wherein expression of mutant HTT is associated with neuroprotection against manganese (Mn) toxicity. Here, we are testing the hypothesis that this interaction may be manifested by altered protein expression patterns in striatum, a primary target of both neurodegeneration in HD and neurotoxicity of Mn. To this end, we compared striatal proteomes of wild-type and HD (YAC128Q) mice exposed to vehicle or Mn. Principal component analysis of proteomic data revealed that Mn exposure disrupted a segregation of WT versus mutant proteomes by the major principal component observed in vehicle-exposed mice. Identification of altered proteins revealed novel markers of Mn toxicity, particularly proteins involved in glycolysis, excitotoxicity, and cytoskeletal dynamics. In addition, YAC128Q-dependent changes suggest that axonal pathology may be an early feature in HD pathogenesis. Finally, for several proteins, genotype-specific responses to Mn were observed. These differences include increased sensitivity to exposure in YAC128Q mice (UBQLN1) and amelioration of some mutant HTT-induced alterations (SAE1, ENO1). We conclude that the interaction of Mn and mutant HTT may suppress proteomic phenotypes of YAC128Q mice, which could reveal potential targets in novel treatment strategies for HD.

  11. IGF-1 intranasal administration rescues Huntington's disease phenotypes in YAC128 mice.

    PubMed

    Lopes, Carla; Ribeiro, Márcio; Duarte, Ana I; Humbert, Sandrine; Saudou, Frederic; Pereira de Almeida, Luís; Hayden, Michael; Rego, A Cristina

    2014-06-01

    Huntington's disease (HD) is an autosomal dominant disease caused by an expansion of CAG repeats in the gene encoding for huntingtin. Brain metabolic dysfunction and altered Akt signaling pathways have been associated with disease progression. Nevertheless, conflicting results persist regarding the role of insulin-like growth factor-1 (IGF-1)/Akt pathway in HD. While high plasma levels of IGF-1 correlated with cognitive decline in HD patients, other data showed protective effects of IGF-1 in HD striatal neurons and R6/2 mice. Thus, in the present study, we investigated motor phenotype, peripheral and central metabolic profile, and striatal and cortical signaling pathways in YAC128 mice subjected to intranasal administration of recombinant human IGF-1 (rhIGF-1) for 2 weeks, in order to promote IGF-1 delivery to the brain. We show that IGF-1 supplementation enhances IGF-1 cortical levels and improves motor activity and both peripheral and central metabolic abnormalities in YAC128 mice. Moreover, decreased Akt activation in HD mice brain was ameliorated following IGF-1 administration. Upregulation of Akt following rhIGF-1 treatment occurred concomitantly with increased phosphorylation of mutant huntingtin on Ser421. These data suggest that intranasal administration of rhIGF-1 ameliorates HD-associated glucose metabolic brain abnormalities and mice phenotype.

  12. A novel humanized mouse model of Huntington disease for preclinical development of therapeutics targeting mutant huntingtin alleles.

    PubMed

    Southwell, Amber L; Skotte, Niels H; Villanueva, Erika B; Østergaard, Michael E; Gu, Xiaofeng; Kordasiewicz, Holly B; Kay, Chris; Cheung, Daphne; Xie, Yuanyun; Waltl, Sabine; Dal Cengio, Louisa; Findlay-Black, Hailey; Doty, Crystal N; Petoukhov, Eugenia; Iworima, Diepiriye; Slama, Ramy; Ooi, Jolene; Pouladi, Mahmoud A; Yang, X William; Swayze, Eric E; Seth, Punit P; Hayden, Michael R

    2017-03-15

    Huntington disease (HD) is a neurodegenerative disease caused by a mutation in the huntingtin (HTT) gene. HTT is a large protein, interacts with many partners and is involved in many cellular pathways, which are perturbed in HD. Therapies targeting HTT directly are likely to provide the most global benefit. Thus there is a need for preclinical models of HD recapitulating human HTT genetics. We previously generated a humanized mouse model of HD, Hu97/18, by intercrossing BACHD and YAC18 mice with knockout of the endogenous mouse HD homolog (Hdh). Hu97/18 mice recapitulate the genetics of HD, having two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of Caucasian descent. We have now generated a companion model, Hu128/21, by intercrossing YAC128 and BAC21 mice on the Hdh-/- background. Hu128/21 mice have two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of East Asian descent and in a minority of patients from other ethnic groups. Hu128/21 mice display a wide variety of HD-like phenotypes that are similar to YAC128 mice. Additionally, both transgenes in Hu128/21 mice match the human HTT exon 1 reference sequence. Conversely, the BACHD transgene carries a floxed, synthetic exon 1 sequence. Hu128/21 mice will be useful for investigations of human HTT that cannot be addressed in Hu97/18 mice, for developing therapies targeted to exon 1, and for preclinical screening of personalized HTT lowering therapies in HD patients of East Asian descent. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Treatment with the MAO-A inhibitor clorgyline elevates monoamine neurotransmitter levels and improves affective phenotypes in a mouse model of Huntington disease.

    PubMed

    Garcia-Miralles, Marta; Ooi, Jolene; Ferrari Bardile, Costanza; Tan, Liang Juin; George, Maya; Drum, Chester L; Lin, Rachel Yanping; Hayden, Michael R; Pouladi, Mahmoud A

    2016-04-01

    Abnormal monoamine oxidase A and B (MAO-A/B) activity and an imbalance in monoamine neurotransmitters have been suggested to underlie the pathobiology of depression, a major psychiatric symptom observed in patients with neurodegenerative diseases, such as Huntington disease (HD). Increased MAO-A/B activity has been observed in brain tissue from patients with HD and in human and rodent HD neural cells. Using the YAC128 mouse model of HD, we studied the effect of an irreversible MAO-A inhibitor, clorgyline, on the levels of select monoamine neurotransmitters associated with affective function. We observed a decrease in striatal levels of the MAO-A/B substrates, dopamine and norepinephrine, in YAC128 HD mice compared with wild-type mice, which was accompanied by increased anxiety- and depressive-like behaviour at five months of age. Treatment for 26 days with clorgyline restored dopamine, serotonin, and norepinephrine neurotransmitter levels in the striatum and reduced anxiety- and depressive-like behaviour in YAC128 HD mice. This study supports a potential therapeutic use for MAO-A inhibitors in the treatment of depression and anxiety in patients with HD. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. YAC cloning Mus musculus telomeric DNA: physical, genetic, in situ and STS markers for the distal telomere of chromosome 10.

    PubMed

    Kipling, D; Wilson, H E; Thomson, E J; Cooke, H J

    1995-06-01

    Three Mus musculus DBA/2 YAC libraries were constructed using a half-YAC telomere cloning vector. This functional complementation approach yields libraries which include terminal restriction fragments of the mouse genome. Screening all three libraries led to the isolation of 32 independent clones which carry linear YACs containing the mouse terminal repeat sequence, (TTAGGG)n. These YACs provide a resource to isolate regions of the mouse genome close to chromosome termini and excluded from existing conventional YAC libraries. To demonstrate their utility, a hybridization probe was isolated from Mtel-1, the first (TTAGGG)n-containing YAC isolated. This probe detects a approximately 70 kb Kpnl fragment in the mouse genome which is sensitive to pretreatment with BAL31 exonuclease. A PCR-based genetic marker generated from the sequence of this probe maps 4.4 cM from the most distal anchor locus on chromosome 10 in the EUCIB interspecific backcross. STS primers for this locus, D10Hgu1, were used to isolate YAC 110F4 from a commercially available mouse YAC library. Fluorescence in situ hybridization demonstrates that YAC 110F4 hybridizes to the distal telomere of chromosome 10. Clones in this collection of telomere YACs therefore partially overlap clones in conventional YAC libraries, and thus the previously unavailable terminal regions of the mouse genome can now be linked with the developing mouse STS YAC contig. Genetic markers such as D10Hgu1 allow the ends of the mouse genetic map to be defined, thus closing the map.

  15. Embryonic Mutant Huntingtin Aggregate Formation in Mouse Models of Huntington's Disease.

    PubMed

    Osmand, Alexander P; Bichell, Terry Jo; Bowman, Aaron B; Bates, Gillian P

    2016-12-15

    The role of aggregate formation in the pathophysiology of Huntington's disease (HD) remains uncertain. However, the temporal appearance of aggregates tends to correlate with the onset of symptoms and the numbers of neuropil aggregates correlate with the progression of clinical disease. Using highly sensitive immunohistochemical methods we have detected the appearance of diffuse aggregates during embryonic development in the R6/2 and YAC128 mouse models of HD. These are initially seen in developing axonal tracts and appear to spread throughout the cerebrum in the early neonate.

  16. Comparison of mHTT Antibodies in Huntington’s Disease Mouse Models Reveal Specific Binding Profiles and Steady-State Ubiquitin Levels with Disease Development

    PubMed Central

    Bayram-Weston, Zubeyde; Jones, Lesley; Dunnett, Stephen B.; Brooks, Simon P.

    2016-01-01

    Huntington’s disease (HD) cellular pathology is characterised by the aggregation of mutant huntingtin (mHTT) protein into inclusion bodies. The present paper compared the sensitivity of five widely used mHTT antibodies (S830; MW8; EM48; 1C2; ubiquitin) against mice from five commonly used HD mouse models (R6/1; YAC128; HdhQ92; B6 HdhQ150; B6 x129/Ola HdhQ150) at two ages to determine: the most sensitive antibodies for each model; whether mHTT antibody binding differed depending on aggregation stage (diffuse versus frank inclusion); the role of ubiquitin during aggregation as the ubiquitin proteosome system has been implicated in disease development. The models demonstrated unique profiles of antibody binding even when the models varied only by background strain (HdhQ150). MW8 was highly sensitive for detecting frank inclusions in all lines whereas EM48, ubiquitin and 1C2 demonstrated consistent staining in all models irrespective of age or form of mHTT. MW8 and S830 were the most sensitive antibodies with 1C2 the least. Ubiquitin levels were stable for each model regardless of age. Ubiquitin was particularly sensitive in young YAC128 mice that demonstrate an absence of inclusions until ~12 months of age suggesting high affinity to mHTT in its diffuse form. The data indicate that generalisations across models regarding the quantification of aggregations may not be valid and that mHTT antibody binding is unique to the mouse model and sensitive to changes in inclusion development. PMID:27196694

  17. Striatal Direct and Indirect Pathway Output Structures are Differentially Altered in Mouse Models of Huntington's Disease.

    PubMed

    Barry, Joshua; Akopian, Garnik; Cepeda, Carlos; Levine, Michael S

    2018-04-24

    The present study examined synaptic communication between direct and indirect output pathway striatal medium-sized spiny neurons (MSNs) and their target structures, the substantia nigra pars reticulata (SNr) and the external globus pallidus (GPe) in two mouse models of Huntington's disease (HD). Cre-recombination, optogenetics, and whole-cell patch clamp recordings were used to determine alterations in intrinsic and synaptic properties of SNr and GPe neurons from both male and female symptomatic R6/2 (>60 days) and pre- (2 months) or symptomatic (10-12 months) YAC128 mice. Cell membrane capacitance was decreased whereas input resistance was increased in SNr neurons from R6/2, but not YAC128 mice. The amplitude of GABAergic responses evoked by optogenetic stimulation of direct pathway terminals was reduced in SNr neurons of symptomatic mice of both models. A decrease in spontaneous GABA synaptic activity, in particular large-amplitude events, in SNr neurons also was observed. Passive membrane properties of GPe neurons were not different between R6/2 or YAC128 mice and their control littermates. Similarly, the amplitude of GABA responses evoked by activation of indirect pathway MSN terminals and the frequency of spontaneous GABA synaptic activity were similar in HD and control animals. In contrast, the decay time of the evoked GABA response was significantly longer in cells from HD mice. Interestingly, activation of indirect pathway MSNs within the striatum evoked larger-amplitude responses in direct pathway MSNs. Together, these results demonstrate differential alterations in responses evoked by direct and indirect pathway terminals in SNr and GPe leading to striatal output imbalance and motor dysfunction. SIGNIFICANCE STATEMENT Previous work on Huntington's disease (HD) focused on striatal medium-sized spiny neurons (MSNs) almost exclusively. Little is known about the effects that alterations in the striatum have on output structures of the direct and indirect

  18. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  19. Combined Treatment with the Mood Stabilizers Lithium and Valproate Produces Multiple Beneficial Effects in Transgenic Mouse Models of Huntington's Disease

    PubMed Central

    Chiu, Chi-Tso; Liu, Guangping; Leeds, Peter; Chuang, De-Maw

    2011-01-01

    Emerging evidence suggests that the mood stabilizers lithium and valproate (VPA) have broad neuroprotective and neurotrophic properties, and that these occur via inhibition of glycogen synthase kinase 3 (GSK-3) and histone deacetylases (HDACs), respectively. Huntington's disease (HD) is an inherited neurodegenerative disorder characterized by impaired movement, cognitive and psychiatric disturbances, and premature death. We treated N171-82Q and YAC128 mice, two mouse models of HD varying in genetic backgrounds and pathological progressions, with a diet containing therapeutic doses of lithium, VPA, or both. Untreated, these transgenic mice displayed a decrease in levels of GSK-3β serine 9 phosphorylation and histone H3 acetylation in the striatum and cerebral cortex around the onset of behavioral deficits, indicating a hyperactivity of GSK-3β and HDACs. Using multiple well-validated behavioral tests, we found that co-treatment with lithium and VPA more effectively alleviated spontaneous locomotor deficits and depressive-like behaviors in both models of HD mice. Furthermore, compared with monotherapy with either drug alone, co-treatment more successfully improved motor skill learning and coordination in N171-82Q mice, and suppressed anxiety-like behaviors in YAC128 mice. This combined treatment consistently inhibited GSK-3β and HDACs, and caused a sustained elevation in striatal as well as cortical brain-derived neurotrophic factor and heat shock protein 70. Importantly, co-treatment markedly prolonged median survival of N171-82Q mice from 31.6 to 41.6 weeks. Given that there is presently no proven treatment for HD, our results suggest that combined treatment with lithium and VPA, two mood stabilizers with a long history of safe use in humans, may have important therapeutic potential for HD patients. PMID:21796107

  20. Assembly of YAC contigs on the long arm of human chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, J.; Fujiwara, T.M.; Wang, J.X.

    1994-09-01

    We have previously identified approximately 2,000 chromosome 2-specific YACs by screening the CEPH Mark I YAC library (`Midi- YACs`). Using STS content mapping, we have been able to order groups of these YACs along chromosome 2q. The four biggest YAC groups were associated with VIL (2q35), FN (2q34), PAX3 (2q36), ALPI (2q37) and contained 113, 107, 79, and 63 YACs, respectively. We have identified the minimal tiling paths for most YAC groups and determined the insert sizes of over 300 YACs. Furthermore, on human chromosome 2q31-q37, 15 microsatellite markers were linked to various expressed genes through overlapping YACs and themore » physical distance of microsatellites to expressed genes was determined. The precise mapping of a set of highly informative microsatellite markers with respect to known genes provides a useful tool for linkage studies and the identification of disease genes from the long arm of human chromosome 2.« less

  1. Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

    PubMed

    Fedosyuk, Halyna; Peterson, Kenneth R

    2007-01-01

    A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

  2. Assembly of ordered contigs of cosmids selected with YACs of human chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fischer, S.G.; Cayanis, E.; Boukhgalter, B.

    1994-06-01

    The authors have developed an efficient method for assembling ordered cosmid contigs aligned to mega-YACs and midi-YACs (average insert sizes of 1.0 and 0.35 Mb, respectively) and used this general method to initiate high-resolution physical mapping of human chromosome 13 (Chr 13). Chr 13-enriched midi-YAC (mYAC) and mega-YAC (MYAC) sublibraries were obtained from corresponding CEPH total human YAC libraries by selecting colonies with inter-Alu PCR probes derived from Chr 13 monochromosomal cell hybrid DNA. These sublibraries were arrayed on filters at high density. In this approach, the MYAC 13 sublibrary is screened by hybridization with cytogenetically assigned Chr 13 DNAmore » probes to select one or a small subset of MYACs. Inter-Alu PCR products from each mYAC are then hybridized to the MYAC and mYAC sublibraries to identify overlapping YACs and to an arrayed Chr 13-specific cosmid library to select corresponding cosmids. The set of selected cosmids, gridded on filters at high density, is hybridized with inter-Alu PCR products from each of the overlapping YACs to identify subsets of cosmids and also with riboprobes from each cosmid of the arrayed set ({open_quotes}cosmid matrix cross-hybridization{close_quotes}). From these data, cosmid contigs are assembled by a specifically designed computer program. Application of this method generates cosmid contigs spanning the length of a MYAC with few gaps. To provide a high-resolution map, ends of cosmids are sequenced at preselected sites to position densely spaced sequence-tagged sites. 33 refs., 7 figs., 1 tab.« less

  3. Dysregulation of mitochondrial calcium signaling and superoxide flashes cause mitochondrial genomic DNA damage in Huntington disease.

    PubMed

    Wang, Jiu-Qiang; Chen, Qian; Wang, Xianhua; Wang, Qiao-Chu; Wang, Yun; Cheng, He-Ping; Guo, Caixia; Sun, Qinmiao; Chen, Quan; Tang, Tie-Shan

    2013-02-01

    Huntington disease (HD) is an inherited, fatal neurodegenerative disorder characterized by the progressive loss of striatal medium spiny neurons. Indications of oxidative stress are apparent in brain tissues from both HD patients and HD mouse models; however, the origin of this oxidant stress remains a mystery. Here, we used a yeast artificial chromosome transgenic mouse model of HD (YAC128) to investigate the potential connections between dysregulation of cytosolic Ca(2+) signaling and mitochondrial oxidative damage in HD cells. We found that YAC128 mouse embryonic fibroblasts exhibit a strikingly higher level of mitochondrial matrix Ca(2+) loading and elevated superoxide generation compared with WT cells, indicating that both mitochondrial Ca(2+) signaling and superoxide generation are dysregulated in HD cells. The excessive mitochondrial oxidant stress is critically dependent on mitochondrial Ca(2+) loading in HD cells, because blocking mitochondrial Ca(2+) uptake abolished elevated superoxide generation. Similar results were obtained using neurons from HD model mice and fibroblast cells from HD patients. More importantly, mitochondrial Ca(2+) loading in HD cells caused a 2-fold higher level of mitochondrial genomic DNA (mtDNA) damage due to the excessive oxidant generation. This study provides strong evidence to support a new causal link between dysregulated mitochondrial Ca(2+) signaling, elevated mitochondrial oxidant stress, and mtDNA damage in HD. Our results also indicate that reducing mitochondrial Ca(2+) uptake could be a therapeutic strategy for HD.

  4. A fully humanized transgenic mouse model of Huntington disease

    PubMed Central

    Southwell, Amber L.; Warby, Simon C.; Carroll, Jeffrey B.; Doty, Crystal N.; Skotte, Niels H.; Zhang, Weining; Villanueva, Erika B.; Kovalik, Vlad; Xie, Yuanyun; Pouladi, Mahmoud A.; Collins, Jennifer A.; Yang, X. William; Franciosi, Sonia; Hayden, Michael R.

    2013-01-01

    Silencing the mutant huntingtin gene (muHTT) is a direct and simple therapeutic strategy for the treatment of Huntington disease (HD) in principle. However, targeting the HD mutation presents challenges because it is an expansion of a common genetic element (a CAG tract) that is found throughout the genome. Moreover, the HTT protein is important for neuronal health throughout life, and silencing strategies that also reduce the wild-type HTT allele may not be well tolerated during the long-term treatment of HD. Several HTT silencing strategies are in development that target genetic sites in HTT that are outside of the CAG expansion, including HD mutation-linked single-nucleotide polymorphisms and the HTT promoter. Preclinical testing of these genetic therapies has required the development of a new mouse model of HD that carries these human-specific genetic targets. To generate a fully humanized mouse model of HD, we have cross-bred BACHD and YAC18 on the Hdh−/− background. The resulting line, Hu97/18, is the first murine model of HD that fully genetically recapitulates human HD having two human HTT genes, no mouse Hdh genes and heterozygosity of the HD mutation. We find that Hu97/18 mice display many of the behavioral changes associated with HD including motor, psychiatric and cognitive deficits, as well as canonical neuropathological abnormalities. This mouse line will be useful for gaining additional insights into the disease mechanisms of HD as well as for testing genetic therapies targeting human HTT. PMID:23001568

  5. GAA repeat expansion mutation mouse models of Friedreich ataxia exhibit oxidative stress leading to progressive neuronal and cardiac pathology.

    PubMed

    Al-Mahdawi, Sahar; Pinto, Ricardo Mouro; Varshney, Dhaval; Lawrence, Lorraine; Lowrie, Margaret B; Hughes, Sian; Webster, Zoe; Blake, Julian; Cooper, J Mark; King, Rosalind; Pook, Mark A

    2006-11-01

    Friedreich ataxia (FRDA) is a neurodegenerative disorder caused by an unstable GAA repeat expansion mutation within intron 1 of the FXN gene. However, the origins of the GAA repeat expansion, its unstable dynamics within different cells and tissues, and its effects on frataxin expression are not yet completely understood. Therefore, we have chosen to generate representative FRDA mouse models by using the human FXN GAA repeat expansion itself as the genetically modified mutation. We have previously reported the establishment of two lines of human FXN YAC transgenic mice that contain unstable GAA repeat expansions within the appropriate genomic context. We now describe the generation of FRDA mouse models by crossbreeding of both lines of human FXN YAC transgenic mice with heterozygous Fxn knockout mice. The resultant FRDA mice that express only human-derived frataxin show comparatively reduced levels of frataxin mRNA and protein expression, decreased aconitase activity, and oxidative stress, leading to progressive neurodegenerative and cardiac pathological phenotypes. Coordination deficits are present, as measured by accelerating rotarod analysis, together with a progressive decrease in locomotor activity and increase in weight. Large vacuoles are detected within neurons of the dorsal root ganglia (DRG), predominantly within the lumbar regions in 6-month-old mice, but spreading to the cervical regions after 1 year of age. Secondary demyelination of large axons is also detected within the lumbar roots of older mice. Lipofuscin deposition is increased in both DRG neurons and cardiomyocytes, and iron deposition is detected in cardiomyocytes after 1 year of age. These mice represent the first GAA repeat expansion-based FRDA mouse models that exhibit progressive FRDA-like pathology and thus will be of use in testing potential therapeutic strategies, particularly GAA repeat-based strategies.

  6. Impaired development of cortico-striatal synaptic connectivity in a cell culture model of Huntington's disease.

    PubMed

    Buren, Caodu; Parsons, Matthew P; Smith-Dijak, Amy; Raymond, Lynn A

    2016-03-01

    Huntington's disease (HD) is a genetically inherited neurodegenerative disease caused by a mutation in the gene encoding the huntingtin protein. This mutation results in progressive cell death that is particularly striking in the striatum. Recent evidence indicates that early HD is initially a disease of the synapse, in which subtle alterations in synaptic neurotransmission, particularly at the cortico-striatal (C-S) synapse, can be detected well in advance of cell death. Here, we used a cell culture model in which striatal neurons are co-cultured with cortical neurons, and monitored the development of C-S connectivity up to 21days in vitro (DIV) in cells cultured from either the YAC128 mouse model of HD or the background strain, FVB/N (wild-type; WT) mice. Our data demonstrate that while C-S connectivity in WT co-cultures develops rapidly and continuously from DIV 7 to 21, YAC128 C-S connectivity shows no significant growth from DIV 14 onward. Morphological and electrophysiological data suggest that a combination of pre- and postsynaptic mechanisms contribute to this effect, including a reduction in both the postsynaptic dendritic arborization and the size and replenishment rate of the presynaptic readily releasable pool of excitatory vesicles. Moreover, a chimeric culture strategy confirmed that the most robust impairment in C-S connectivity was only observed when mutant huntingtin was expressed both pre- and postsynaptically. In all, our data demonstrate a progressive HD synaptic phenotype in this co-culture system that may be exploited as a platform for identifying promising therapeutic strategies to prevent early HD-associated synaptopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. The influence of convection drying on the physicochemical properties of yacón (Smallanthus sonchifolius)

    NASA Astrophysics Data System (ADS)

    Salinas, Juan Gabriel; Alvarado, Juan Antonio; Bergenståhl, Björn; Tornberg, Eva

    2018-04-01

    Yacón root is a natural source of fructans, which has many potential benefits. Convective drying has been applied to increase the shelf life of yacón roots. However, this processing may lead to detrimental effects on the physicochemical functionality. The drying was investigated using different conditions (drying temperatures of 45 °C, 50 °C and 55 °C at a drying air velocity of 2 m/s and 60 °C at a drying air velocity of 2 m/s, 3 m/s and 4 m/s). The dried samples were compared to the original yacón with regard to their physicochemical properties. From all the properties that were studied, the color of the dried material and the elastic modulus of the reconstituted yacón were the most important properties being minimized respectively. The results of this investigation indicate that the best drying conditions, where the physicochemical properties of the samples are kept closest to the original material, are obtained either by using temperatures of 55 °C and 2 m/s or using higher temperatures but increasing the air velocity.

  8. The nature of youth care tasks in families experiencing chronic illness/disability: development of the Youth Activities of Caregiving Scale (YACS).

    PubMed

    Ireland, Michael James; Pakenham, Kenneth Ian

    2010-07-01

    The purpose of this study was to develop an empirically derived multi-item scale of care tasks performed by young people in the context of family illness/disability: the Youth Activities of Caregiving Scale (YACS). A total of 135 youngsters aged 10-24 years with an ill/disabled family member completed questionnaires. Factor analyses performed on the YACS yielded four factors, instrumental care, social/emotional care, personal/intimate care and domestic/household care, accounting for 57.78% of the variance. The internal reliabilities of all factors ranged from 0.74 to 0.92. Higher scores on the YACS related to higher youth age and several caregiving context variables (i.e. household type [single or dual-parent household], relationship with care-recipient and perceived choice in caregiving). Higher scores on the YACS also related to care-recipient illness/disability variables (onset, functional impairment, prognosis, predictability and illness/disability type). Strong positive correlations between the YACS and a conceptually related measure of young caregiving experiences provided good convergent validity data. Criterion validity was established with evidence that the YACS predicted youth adjustment in the domains of health and prosocial behaviour.

  9. Fermented herbal formula KIOM-MA-128 protects against acute colitis induced by dextran sodium sulfate in mice.

    PubMed

    Kim, Dong-Gun; Lee, Mi-Ra; Yoo, Jae-Myung; Park, Kwang-Il; Ma, Jin-Yeul

    2017-07-05

    Colitis is a well-known subtype of inflammatory bowel disease and is caused by diverse factors. Previous research has shown that KIOM-MA elicits anti-inflammatory and anti-allergic effects on various diseases. KIOM-MA-128, our novel herbal formula, was generated from KIOM-MA using probiotics to improve the therapeutic efficacy. We investigated whether KIOM-MA-128 has protective activity in a mouse model of acute colitis induced by dextran sodium sulfate (DSS). Colitis was induced by DSS administered to ICR mice in drinking water. KIOM-MA-128 (125 or 250 mg/kg) was orally administered once per day. The body weights of the mice were measured daily, and colonic endoscopies were performed at 5 and 8 days. Colon length as well as histological and cytokine changes were observed at the end of drug administration. KIOM-MA-128 has pharmacological activity in an acute colitis model. KIOM-MA-128 reduced the loss of body weight and disease activity index (DAI) and inhibited the abnormally short colon lengths and the colonic damage in this mouse model of acute colitis. Moreover, KIOM-MA-128 suppressed pro-inflammatory cytokine expression and maintained the integrity of the tight junctions during DSS-induced colitis. The results indicated that KIOM-MA-128 protects against DSS-induced colitis in mice and suggested that this formula might be a candidate treatment for inflammatory bowel disease (IBD).

  10. The isolation of cDNAs from OATL1 at Xp11.2 using a 480-kb YAC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geraghty, M.T.; Brody, L.C.; Martin, L.S.

    1993-05-01

    Using an ornithine-{delta}-aminotransferase (OAT) cDNA, the authors identified five YACs that cover two nonadjacent OAT-related loci in Xp11.2-p11.3, designated OATL1 (distal) and OATL2 (proximal). Because several retinal degenerative disorders map to this region, they used YAC2 (480 kb), which covers the most distal part of OATL1, as a probe to screen a retinal cDNA library. From 8 {times} 10{sup 4} plaques screened, they isolated 13 clones. Two were OAT cDNAs. The remaining 11 were divided into eight groups by cross-hybridization. Groups 1-4 contain cDNAs that originate from single-copy X-linked genes in YAC2. Each has an open reading frame of >500more » bp and detects one or more transcripts on a Northern blot. The gene for each was sublocalized and ordered in YAC2. The cDNAs in groups 5-8 contained two or more Alu sequences, had no open reading frames, and did not detect transcripts. The cDNAs from groups 1-4 provide expressed sequence tags and identify candidate genes for the genetic disorders that map to this region. 28 refs., 5 figs., 1 tab.« less

  11. Development of a YAC contig covering the minimal region of a CSNB1 locus in Xp11

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boycott, K.M.; Gratton, K.J.; Moore, B.J.

    1994-09-01

    X-linked congenital stationary night blindness (CSNB1) is an eye disorder that includes impairment of night vision, reduced visual acuity and, in some cases, myopia and congenital nystagmus. Electroretinography reveals a marked reduction of the b-wave in affected individuals suggesting that X-linked CSNB is due to a molecular defect in the bipolar layer of the retina. Based on our studies of a large four generation family with X-linked CSNB, a CSNB1 locus was mapped to a 4-5 cM region at Xp11.23-Xp11.22 bounded telomerically by DXS426 and centromerically by DXS988. Using a panel of radiation and conventional somatic cell hybrids, a detailedmore » map of new and published STSs has been generated for the minimal region of CSNB1. PCR primer pairs for STSs has been generated for the minimal region of CSNB1. PCR primer pairs for twenty-five STSs, including eleven end-clones, were used to isolate YAC clones from CEPH, mega-CEPH, and X chromosome-specific YAC libraries. In total, fifty-two YACs were characterized for STS overlaps and assembled to provide a minimum of 3 Mb of physical coverage in the region between DXS426 and DXS988. Five gaps proximal to SYP are still to be closed. Our physical map suggests the following gene order: Xpter-OTAL1-GF1-DXS1011E-MG81-HUMCRAS2P-SYP-Xcen. STS analysis of the YACs revealed three subregions of the physical map which appear to be particularly susceptible to internal deletions and end-clone analysis demonstrated chimerism in six of seventeen YACs. A physical map of Xp11.23-Xp11.22 will provide a resource for the isolation of candidate genes for the X-linked CSNB gene which maps to this region.« less

  12. A YAC contig encompassing the chromosome 7p locus for autosomal dominant retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inglehearn, C.F.; Keen, T.J.; Ratel, R.

    1994-09-01

    Retinitis pigmentosa is an inherited retinal degeneration characterized by night blindness and loss of peripheral vision, often leading to complete blindness. The autosomal dominant form (adRP) maps to at least six different loci, including the rhodopsin and peripherin/Rds genes and four loci identified only by linkage analysis on chromosomes 7p, 7q, 8cen and 19q. The 7p locus was reported by this laboratory in a large English family, with a lod score of 16.5. Several new genetic markers have been tested in the family and this locus has now been refined to an interval of approximately 1 cM between markers D7S795more » and D7S484 in the 7p13-15 region. In order to clone the gene for adRP, we have used microsatellites and STSs from the region to identify over 80 YACs, from four different libraries, which map to this interval. End clones from key YACs were isolated for the generation of additional STSs. Eleven microsatellite markers between D7S435 (distal) and D7S484 (proximal) have been ordered by a combination of both physical and genetic mapping. In this way we have now obtained a YAC contig spanning approximately 3 megabases of chromosome 7p within which the adRP gene must lie. One gene (aquaporin) and one chromosome 7 brain EST have been placed on the contig but both map distal to the region of interest. Sixteen other ESTs and three further known 7p genes mapping in the region have been excluded. We are now attempting to build a cosmid contig in the defined interval and identify further expressed sequences from both YACs and cosmids to test as candidates for the adRP gene.« less

  13. Construction of a YAC contig and STS map spanning 2.5 Mbp in Xq25, the critical region for the X-linked lymphoproliferative (XLP) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lanyi, A.; Li, B.F.; Li, S.

    1994-09-01

    X-linked lymphoproliferative disease (XLP) is characterized by a marked vulnerability in Epstein-Barr virus (EBV) infection. Infection of XLP patients with EBV invariably results in fatal mononucleosis, agammaglobulinemia or B-cell lymphoma. The XLP gene lies within a 10 cM region in Xq25 between DXS42 and DXS10. Initial chromosome studies revealed an interstitial, cytogenetically visible deletion in Xq25 in one XLP family (43-004). We estimated the size of the Xq25 deletion by dual laser flow karyotyping to involve 2% of the X chromosome, or approximately 3 Mbp of DNA sequences. To further delineate the deletion we performed a series of pulsed fieldmore » gel electrophoresis (PFGE) analyses which showed that DXS6 and DXS100, two Xq25-specific markers, are missing from 45-004 DNA. Five yeast artificial chromosomes (YACs) from a chromosome X specific YAC library containing sequences deleted in patient`s 43-004 DNA were isolated. These five YACs did not overlap, and their end fragments were used to screen the CEPH MegaYAC library. Seven YACs were isolated from the CEPH MegaYAC library. They could be arranged into a contig which spans between DXS6 and DXS100. The contig contains a minimum of 2.5 Mbp of human DNA. A total of 12 YAC end clone, lambda subclones and STS probes have been used to order clones within the contig. These reagents were also used in Southern blot and patients showed interstitial deletions in Xq25. The size of these deletions range between 0.5 and 2.5 Mbp. The shortest deletion probably represents the critical region for the XLP gene.« less

  14. Genome-wide loss of 5-hmC is a novel epigenetic feature of Huntington's disease.

    PubMed

    Wang, Fengli; Yang, Yeran; Lin, Xiwen; Wang, Jiu-Qiang; Wu, Yong-Sheng; Xie, Wenjuan; Wang, Dandan; Zhu, Shu; Liao, You-Qi; Sun, Qinmiao; Yang, Yun-Gui; Luo, Huai-Rong; Guo, Caixia; Han, Chunsheng; Tang, Tie-Shan

    2013-09-15

    5-Hydroxymethylcytosine (5-hmC) may represent a new epigenetic modification of cytosine. While the dynamics of 5-hmC during neurodevelopment have recently been reported, little is known about its genomic distribution and function(s) in neurodegenerative diseases such as Huntington's disease (HD). We here observed a marked reduction of the 5-hmC signal in YAC128 (yeast artificial chromosome transgene with 128 CAG repeats) HD mouse brain tissues when compared with age-matched wild-type (WT) mice, suggesting a deficiency of 5-hmC reconstruction in HD brains during postnatal development. Genome-wide distribution analysis of 5-hmC further confirmed the diminishment of the 5-hmC signal in striatum and cortex in YAC128 HD mice. General genomic features of 5-hmC are highly conserved, not being affected by either disease or brain regions. Intriguingly, we have identified disease-specific (YAC128 versus WT) differentially hydroxymethylated regions (DhMRs), and found that acquisition of DhmRs in gene body is a positive epigenetic regulator for gene expression. Ingenuity pathway analysis (IPA) of genotype-specific DhMR-annotated genes revealed that alternation of a number of canonical pathways involving neuronal development/differentiation (Wnt/β-catenin/Sox pathway, axonal guidance signaling pathway) and neuronal function/survival (glutamate receptor/calcium/CREB, GABA receptor signaling, dopamine-DARPP32 feedback pathway, etc.) could be important for the onset of HD. Our results indicate that loss of the 5-hmC marker is a novel epigenetic feature in HD, and that this aberrant epigenetic regulation may impair the neurogenesis, neuronal function and survival in HD brain. Our study also opens a new avenue for HD treatment; re-establishing the native 5-hmC landscape may have the potential to slow/halt the progression of HD.

  15. A complete YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13) and refined localization of the SNRPN gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mutirangura, A.; Jayakumar, A.; Sutcliffe, J.S.

    1993-12-01

    Since a previous report of a partial YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13), a complete contig spanning approximately 3.5 Mb has been developed. YACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of [approximately]1 per 200 kb. Overlaps between YAC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of YAC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contigmore » between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/Angelman chromosome region contig are ordered as follows: cen-IR39-ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10-1-CMW1-tel. This YAC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. 36 refs., 2 figs., 2 tabs.« less

  16. A YAC contig encompassing the Treacher Collins syndrome critical region at 5q31. 3-32

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixon, J.; Gladwin, A.J.; Perveen, R.

    Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development the features of which include conductive hearing loss and cleft palate. Previous studies have localized the TCOF1 locus between D5S519 (proximal) and SPARC (distal), a region of 22 centirays as estimated by radiation hybrid mapping. In the current investigation the authors have created a contig across the TCOF1 critical region, using YAC clones. Isolation of a novel short tandem repeat polymorphism corresponding to the end of one of the YACs has allowed reduction of the size of the critical region to [approximately] 840 kb, which has been coveredmore » with three nonchimeric YACs. Restriction mapping has revealed that the region contains a high density of clustered rare-cutter restriction sites, suggesting that it may contain a number of different genes. The results of the present investigation have further allowed confirmation that the RPS14 locus lies proximal to the critical region and can thereby be excluded from a role in the pathogenesis of TCOF1, while ANX6 lies within the TCOF1 critical region and remains a potential candidate for the mutated gene. 26 refs., 4 figs., 1 tab.« less

  17. Comparative studies using the Morris water maze to assess spatial memory deficits in two transgenic mouse models of Alzheimer's disease.

    PubMed

    Edwards, Stephen R; Hamlin, Adam S; Marks, Nicola; Coulson, Elizabeth J; Smith, Maree T

    2014-10-01

    Evaluation of the efficacy of novel therapeutics for potential treatment of Alzheimer's disease (AD) requires an animal model that develops age-related cognitive deficits reproducibly between independent groups of investigators. Herein we assessed comparative temporal changes in spatial memory function in two commercially available transgenic mouse models of AD using the Morris water maze (MWM), incorporating both visible and hidden platform training. Individual cohorts of cDNA-based 'line 85'-derived double-transgenic mice coexpressing the 'Swedish' mutation of amyloid precursor protein (APPSwe) and the presenillin 1 (PS1) 'dE9' mutation were assessed in the MWM at mean ages of 3.6, 9.3 and 14.8 months. We found significant deficits in spatial memory retention in APPSwe/PS1dE9 mice aged 3.6 months and robust deficits in spatial memory acquisition and retention in APPSwe/PS1dE9 mice aged 9.3 months, with a further significant decline by age 14.8 months. β-Amyloid deposits were present in brain sections by 7.25 months of age. In contrast, MWM studies with individual cohorts (aged 4-21 months) of single-transgenic genomic-based APPSwe mice expressing APPSwe on a yeast artificial chromosomal (YAC) construct showed no significant deficits in spatial memory acquisition until 21 months of age. There were no significant deficits in spatial memory retention up to 21 months of age and β-amyloid deposits were not present in brain sections up to 24 months of age. These data, generated using comprehensive study designs, show that APPSwe/PS1dE9 but not APPSwe YAC mice appear to provide a suitably robust model of AD for efficacy assessment of novel AD treatments in development. © 2014 Wiley Publishing Asia Pty Ltd.

  18. Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

    PubMed Central

    Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

    1996-01-01

    Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

  19. A YAC contig spanning the dominant retinitis pigmentosa locus (RP9) on chromosome 7p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keen, T.J.; Inglehearn, C.F.; Patel, R.J.

    1995-08-10

    The dominant retinitis pigmentosa locus RP9 has previously been localized to 7p13-p15, in the interval D7S526-D7S484. We now report refinement of the locus to the interval D7S795-D7S484 and YAC contig of approximately 4.8 Mb spanning this region and extending both distally and proximally from it. The contig was constructed by STS content mapping and physically orders 29 STSs in 28 YAC clones. The order of polymorphic markers in the contig is consistent with a genetic map that has been assembled using haplotype data from the CEPH pedigrees. This contig will provide a primary resource for the construction of a transcriptionalmore » map of this region and for the identification of the defective gene causing this form of adRP. 27 refs., 3 figs., 1 tab.« less

  20. mTOR ATP-competitive inhibitor INK128 inhibits neuroblastoma growth via blocking mTORC signaling

    PubMed Central

    Zhang, Huiyuan; Dou, Jun; Yu, Yang; Zhao, Yanling; Fan, Yihui; Cheng, Jin; Xu, Xin; Liu, Wei; Guan, Shan; Chen, Zhenghu; shi, Yan; Patel, Roma; Vasudevan, Sanjeev A; Zage, Peter E; Zhang, Hong; Nuchtern, Jed G; Kim, Eugene S; Fu, Songbin; Yang, Jianhua

    2015-01-01

    High-risk neuroblastoma often develops resistance to high-dose chemotherapy. The mTOR signaling cascade is frequently deregulated in human cancers and targeting mTOR signaling sensitizes many cancer types to chemotherapy. Here, using a panel of neuroblastoma cell lines, we found that the mTOR inhibitor INK128 showed inhibitory effects on both anchorage-dependent and independent growth of neuroblastoma cells and significantly enhanced the cytotoxic effects of doxorubicin (Dox) on these cell lines. Treatment of neuroblastoma cells with INK128 blocked the activation of downstream mTOR signaling and enhanced Dox-induced apoptosis. Moreover, INK128 was able to overcome the established chemoresistance in the LA-N-6 cell line. Using an orthotopic neuroblastoma mouse model, we found that INK128 significantly inhibited tumor growth in vivo. In conclusion, we have shown that INK128-mediated mTOR inhibition possessed substantial antitumor activity and could significantly increase the sensitivity of neuroblastoma cells to Doxorubicin therapy. Taken together, our results indicate that using INK128 can provide additional efficacy to current chemotherapeutic regimens and represent a new paradigm in restoring drug sensitivity in neuroblastoma. PMID:25425103

  1. Towards cloning the WAS-gene locus: YAC-contigs and PFGE analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meindi, A.; Schindelhauer, D.; Hellebrand, H.

    1994-09-01

    Patients with X-linked recessive Wiskott-Aldrich syndrome (WAS) manifest eczema, thrombocytopenia and severe immunodeficiency. Mapping studies place the WAS gene locus between the markers TIMP and DXS255 which both have been shown to be recombinant with the disease locus. Linkage analysis in eight families including a large Swiss family showed tight linkage of the disease to the loci DXS255 and DXS1126 and exclusion of TIMP as well as polymorphic loci adjacent to the OATL1 pseudogene cluster (e.g., DXS6616). Physical mapping with established YAC contigs and a radiation hybrid encompassing the Xp11.22-11.3 region revealed the loci order TIMP-PFC-elk1-DXS1367-DXS6616-OATL1-(DXS11260DXS226)-C5-3-TGE-3, SYP and (DXS255-DXS146). Themore » markers TIMP and C5-3 are contained on the same 1.6 Mb MluI-fragment. A novel expressed sequence (R1) could be placed between elk-1 and the PFC gene while the STS C5-3 could be localized adjacent to DXS1126. The gene cluster around DXS1126 could be connected with the TFE-3 and synaptophysin genes which map on the same 400 kb MluI fragment and two overlapping YACs. The minimum distance between SYP and DXS255 is 1.2 Mb; the maximum distance is 2.2 Mb. Expressed sequences which are obtained from a cosmid contig around DXS1126 and C5-3 are being used for mutation screening in WAS patients.« less

  2. Antiasthmatic Effects of Herbal Complex MA and Its Fermented Product MA128.

    PubMed

    Kim, Dong-Seon; Kim, Seung-Hyung; Kim, Bok-Kyu; Yang, Min Cheol; Ma, Jin Yeul

    2012-01-01

    This study was conducted to determine if oral administration of the novel herbal medicine, MA, and its Lactobacillus acidophilus fermented product, MA128, have therapeutic properties for the treatment of asthma. Asthma was induced in BALB/c mice by systemic sensitization to ovalbumin (OVA) followed by intratracheal, intraperitoneal, and aerosol allergen challenges. MA and MA128 were orally administered 6 times a week for 4 weeks. At 1 day after the last ovalbumin exposure, airway hyperresponsiveness was assessed and samples of bronchoalveolar lavage fluid, lung cells, and serum were collected for further analysis. We investigated the effect of MA and MA128 on airway hyperresponsiveness, pulmonary eosinophilic infiltration, various immune cell phenotypes, Th2 cytokine production, OVA-specific IgE production, and Th1/Th2 cytokine production in this mouse model of asthma. In BALB/c mice, we found that MA and MA128 treatment suppressed eosinophil infiltration into airways and blood, allergic airway inflammation and AHR by suppressing the production of IL-5, IL-13, IL-17, Eotaxin, and OVA-specific IgE, by upregulating the production of OVA-specific Th1 cytokine (IFN-γ), and by downregulating OVA-specific Th2 cytokine (IL-4) in the culture supernatant of spleen cells. The effectiveness of MA was increased by fermentation with Lactobacillus acidophilus.

  3. Regulatory mechanism of microRNA-128 in osteosarcoma tumorigenesis and evolution through targeting SASH1

    PubMed Central

    Li, Zi; Ni, Jiangdong; Song, Deye; Ding, Muliang

    2018-01-01

    Osteosarcoma, which commonly occurs in young individuals, is a type of malignant tumor of growing bones. MicroRNAs (miRNAs) have been found to be involved in various cancer-related processes. In the present study, it was reported that miRNA-128 (miR-128) was overexpressed in pathological tissues from patients with osteosarcoma. The present study investigated the possible regulatory mechanism of miR-128 on the progression of osteosarcoma and offered a foundation for clinical therapeutics in osteosarcoma. First, the expressions levels of miR-128 and its target gene, SAM and SH3 domain-containing 1 (SASH1), were measured in tissues from patients with osteosarcoma, and their correlation with osteosarcoma in terms of the pathological level were examined. The effects of miR-128 on osteosarcoma cell proliferation and apoptosis were examined, and its regulation of the expression levels of SASH1 and associated proteins was analyzed. Subsequently, the association between SASH1 and miR-128 was evaluated using a dual luciferase gene reporter assay. Finally, an in vivo xenograft tumor mouse model of osteosarcoma was established to confirm the in vitro results. The results demonstrated a higher expression of miR-128 in pathological tissues, compared with that in normal tissues. From examining the patient osteosarcoma tissues, marked correlations were found between the expression of miR-128 and that of SASH1, particularly with tumor size, invasion depth, lymph node metastasis, and tumor-node-metastasis stage. Compared with the negative control group and blank control group, the results showed that the inhibition of miR-128 led to a lower cell proliferation rate and higher apoptotic rate in MG-63 cells (P<0.05). Additionally, the expression of B-cell lymphoma 2 (Bcl-2) was downregulated in the miR-128-inhibited group, compared with that in the control group, whereas the expression levels of SASH1, Bcl-2-associated X protein and caspase-3 were upregulated in the group with miR-128

  4. Regulatory mechanism of microRNA-128 in osteosarcoma tumorigenesis and evolution through targeting SASH1.

    PubMed

    Li, Zi; Ni, Jiangdong; Song, Deye; Ding, Muliang

    2018-06-01

    Osteosarcoma, which commonly occurs in young individuals, is a type of malignant tumor of growing bones. MicroRNAs (miRNAs) have been found to be involved in various cancer-related processes. In the present study, it was reported that miRNA-128 (miR-128) was overexpressed in pathological tissues from patients with osteosarcoma. The present study investigated the possible regulatory mechanism of miR-128 on the progression of osteosarcoma and offered a foundation for clinical therapeutics in osteosarcoma. First, the expressions levels of miR-128 and its target gene, SAM and SH3 domain-containing 1 (SASH1), were measured in tissues from patients with osteosarcoma, and their correlation with osteosarcoma in terms of the pathological level were examined. The effects of miR-128 on osteosarcoma cell proliferation and apoptosis were examined, and its regulation of the expression levels of SASH1 and associated proteins was analyzed. Subsequently, the association between SASH1 and miR-128 was evaluated using a dual luciferase gene reporter assay. Finally, an in vivo xenograft tumor mouse model of osteosarcoma was established to confirm the in vitro results. The results demonstrated a higher expression of miR-128 in pathological tissues, compared with that in normal tissues. From examining the patient osteosarcoma tissues, marked correlations were found between the expression of miR-128 and that of SASH1, particularly with tumor size, invasion depth, lymph node metastasis, and tumor-node-metastasis stage. Compared with the negative control group and blank control group, the results showed that the inhibition of miR-128 led to a lower cell proliferation rate and higher apoptotic rate in MG-63 cells (P<0.05). Additionally, the expression of B-cell lymphoma 2 (Bcl-2) was downregulated in the miR-128-inhibited group, compared with that in the control group, whereas the expression levels of SASH1, Bcl-2-associated X protein and caspase-3 were upregulated in the group with miR-128

  5. Suppressing aberrant GluN3A expression rescues NMDA receptor dysfunction, synapse loss and motor and cognitive decline in Huntington's disease models

    PubMed Central

    Marco, Sonia; Giralt, Albert; Petrovic, Milos M.; Pouladi, Mahmoud A.; Martínez-Turrillas, Rebeca; Martínez-Hernández, José; Kaltenbach, Linda S.; Torres-Peraza, Jesús; Graham, Rona K.; Watanabe, Masahiko; Luján, Rafael; Nakanishi, Nobuki; Lipton, Stuart A.; Lo, Donald C.; Hayden, Michael R.; Alberch, Jordi; Wesseling, John F.

    2013-01-01

    Huntington's disease is caused by an expanded polyglutamine repeat in huntingtin (Htt), but the pathophysiological sequence of events that trigger synaptic failure and neuronal loss are not fully understood. Alterations in NMDA-type glutamate receptors (NMDARs) have been implicated, yet it remains unclear how the Htt mutation impacts NMDAR function and direct evidence for a causative role is missing. Here we show that mutant Htt re-directs an intracellular store of juvenile NMDARs to the surface of striatal neurons by sequestering and disrupting the subcellular localization of the GluN3A subunit-specific endocytic adaptor PACSIN1. Overexpressing GluN3A in wild-type striatum mimicked the synapse loss observed in Huntington's disease mouse models, whereas genetic deletion of GluN3A prevented synapse degeneration, ameliorated motor and cognitive decline, and reduced striatal atrophy and neuronal loss in the YAC128 model. Furthermore, GluN3A deletion corrected the abnormally enhanced NMDAR currents, which have been linked to cell death in Huntington's disease and other neurodegenerative conditions. Our findings reveal an early pathogenic role of GluN3A dysregulation in Huntington's disease, and suggest that therapies targeting GluN3A or pathogenic Htt-PACSIN1 interactions might prevent or delay disease progression. PMID:23852340

  6. YAC and cosmid contigs encompassing the Fukuyama-type congenital muscular dystrophy (FCMD) candidate region on 9q31

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyake, Masashi; Nakahori, Yutaka; Matsushita, Ikumi

    1997-03-01

    Fukuyama-type congenital muscular dystrophy (FCMD), the second most common form of childhood muscular dystrophy in Japan, is an autosomal recessive severe muscular dystrophy associated with an anomaly of the brain. We had mapped the FCMD gene to an approximately 5-cM interval between D9S127 and D9S2111 on 9q31-q33 and had also found evidence for linkage disequilibrium between FCMD and D9S306 in this candidate region. Through further analysis, we have defined another marker, D9S172, which showed stronger linkage disequilibrium than D9S306. A yeast artificial chromosome (YAC) contig spanning 3.5 Mb, which includes this D9S306-D9S172 interval on 9q31, has been constructed by amore » combination of sequence-tagged site, Alu-PCR, and restriction mapping. Also, cosmid clones subcloned from the YAC were assembled into three contigs, one of which contains D9S2107, which showed the strongest linkage disequilibrium with FCMD. These contigs also allowed us to order the markers as follows: cen-D9S127-({approximately}800 kb)-D9S306 (identical to D9S53)-({approximately}700 kb)-A107XF9-({approximately}500 kb)-D9S172-({approximately}30 kb)-D9S299 (identical to D9S774)-({approximately}120 kb)-WI2269-tel. Thus, we have constructed the first high-resolution physical map of the FCMD candidate region. The YAC and cosmid contigs established here will be a crucial resource for identification of the FCMD gene and other genes in this region. 37 refs., 7 figs., 2 tabs.« less

  7. Preventing mutant huntingtin proteolysis and intermittent fasting promote autophagy in models of Huntington disease.

    PubMed

    Ehrnhoefer, Dagmar E; Martin, Dale D O; Schmidt, Mandi E; Qiu, Xiaofan; Ladha, Safia; Caron, Nicholas S; Skotte, Niels H; Nguyen, Yen T N; Vaid, Kuljeet; Southwell, Amber L; Engemann, Sabine; Franciosi, Sonia; Hayden, Michael R

    2018-03-06

    Huntington disease (HD) is caused by the expression of mutant huntingtin (mHTT) bearing a polyglutamine expansion. In HD, mHTT accumulation is accompanied by a dysfunction in basal autophagy, which manifests as specific defects in cargo loading during selective autophagy. Here we show that the expression of mHTT resistant to proteolysis at the caspase cleavage site D586 (C6R mHTT) increases autophagy, which may be due to its increased binding to the autophagy adapter p62. This is accompanied by faster degradation of C6R mHTT in vitro and a lack of mHTT accumulation the C6R mouse model with age. These findings may explain the previously observed neuroprotective properties of C6R mHTT. As the C6R mutation cannot be easily translated into a therapeutic approach, we show that a scheduled feeding paradigm is sufficient to lower mHTT levels in YAC128 mice expressing cleavable mHTT. This is consistent with a previous model, where the presence of cleavable mHTT impairs basal autophagy, while fasting-induced autophagy remains functional. In HD, mHTT clearance and autophagy may become increasingly impaired as a function of age and disease stage, because of gradually increased activity of mHTT-processing enzymes. Our findings imply that mHTT clearance could be enhanced by a regulated dietary schedule that promotes autophagy.

  8. Brain mitochondrial iron accumulates in Huntington's disease, mediates mitochondrial dysfunction, and can be removed pharmacologically.

    PubMed

    Agrawal, Sonal; Fox, Julia; Thyagarajan, Baskaran; Fox, Jonathan H

    2018-05-20

    Mitochondrial bioenergetic dysfunction is involved in neurodegeneration in Huntington's disease (HD). Iron is critical for normal mitochondrial bioenergetics but can also contribute to pathogenic oxidation. The accumulation of iron in the brain occurs in mouse models and in human HD. Yet the role of mitochondria-related iron dysregulation as a contributor to bioenergetic pathophysiology in HD is unclear. We demonstrate here that human HD and mouse model HD (12-week R6/2 and 12-month YAC128) brains accumulated mitochondrial iron and showed increased expression of iron uptake protein mitoferrin 2 and decreased iron-sulfur cluster synthesis protein frataxin. Mitochondria-enriched fractions from mouse HD brains had deficits in membrane potential and oxygen uptake and increased lipid peroxidation. In addition, the membrane-permeable iron-selective chelator deferiprone (1 μM) rescued these effects ex-vivo, whereas hydrophilic iron and copper chelators did not. A 10-day oral deferiprone treatment in 9-week R6/2 HD mice indicated that deferiprone removed mitochondrial iron, restored mitochondrial potentials, decreased lipid peroxidation, and improved motor endurance. Neonatal iron supplementation potentiates neurodegeneration in mouse models of HD by unknown mechanisms. We found that neonatal iron supplementation increased brain mitochondrial iron accumulation and potentiated markers of mitochondrial dysfunction in HD mice. Therefore, bi-directional manipulation of mitochondrial iron can potentiate and protect against markers of mouse HD. Our findings thus demonstrate the significance of iron as a mediator of mitochondrial dysfunction and injury in mouse models of human HD and suggest that targeting the iron-mitochondrial pathway may be protective. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

    PubMed

    Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

    1998-01-01

    Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

  10. Cyclosporin a inhibits T cell-mediated augmentation of mouse natural killer activity.

    PubMed

    Yanagihara, R H; Adler, W H

    1982-06-01

    Cyclosporin A (CSA) in vitro inhibited the spontaneous cytotoxic activity of mouse spleen cells against YAC target cells in a 4 hr 51Cr release assay. While natural killer (NK) cells were inhibited directly by CSA, these suppressive effects were largely reversible by coculture of effector cells for an optimal period with polyinosinic-polycytidylic acid (Poly I:C) or lipopolysaccharide (LPS). In contrast concanavalin A (Con A), in the presence of CSA, was unable to augment NK activity. The supernatant, however, of mouse spleen cells cultured with Con A was fully able to augment the NK the activity by freshly cultured spleen cells in the presence of CSA. The results indicate that CSA inhibits NK activity by two distinct mechanisms: a) a direct inactivation of NK cells and b) a suppression of production or release of an NK-activating factor from T cells, but not B cells or macrophages.

  11. Inhibitors of ORAI1 Prevent Cytosolic Calcium-Associated Injury of Human Pancreatic Acinar Cells and Acute Pancreatitis in 3 Mouse Models

    PubMed Central

    Wen, Li; Voronina, Svetlana; Javed, Muhammad A.; Awais, Muhammad; Szatmary, Peter; Latawiec, Diane; Chvanov, Michael; Collier, David; Huang, Wei; Barrett, John; Begg, Malcolm; Stauderman, Ken; Roos, Jack; Grigoryev, Sergey; Ramos, Stephanie; Rogers, Evan; Whitten, Jeff; Velicelebi, Gonul; Dunn, Michael; Tepikin, Alexei V.; Criddle, David N.; Sutton, Robert

    2015-01-01

    Background & Aims Sustained activation of the cytosolic calcium concentration induces injury to pancreatic acinar cells and necrosis. The calcium release–activated calcium modulator ORAI1 is the most abundant Ca2+ entry channel in pancreatic acinar cells; it sustains calcium overload in mice exposed to toxins that induce pancreatitis. We investigated the roles of ORAI1 in pancreatic acinar cell injury and the development of acute pancreatitis in mice. Methods Mouse and human acinar cells, as well as HEK 293 cells transfected to express human ORAI1 with human stromal interaction molecule 1, were hyperstimulated or incubated with human bile acid, thapsigargin, or cyclopiazonic acid to induce calcium entry. GSK-7975A or CM_128 were added to some cells, which were analyzed by confocal and video microscopy and patch clamp recordings. Acute pancreatitis was induced in C57BL/6J mice by ductal injection of taurolithocholic acid 3-sulfate or intravenous' administration of cerulein or ethanol and palmitoleic acid. Some mice then were given GSK-7975A or CM_128, which inhibit ORAI1, at different time points to assess local and systemic effects. Results GSK-7975A and CM_128 each separately inhibited toxin-induced activation of ORAI1 and/or activation of Ca2+ currents after Ca2+ release, in a concentration-dependent manner, in mouse and human pancreatic acinar cells (inhibition >90% of the levels observed in control cells). The ORAI1 inhibitors also prevented activation of the necrotic cell death pathway in mouse and human pancreatic acinar cells. GSK-7975A and CM_128 each inhibited all local and systemic features of acute pancreatitis in all 3 models, in dose- and time-dependent manners. The agents were significantly more effective, in a range of parameters, when given at 1 vs 6 hours after induction of pancreatitis. Conclusions Cytosolic calcium overload, mediated via ORAI1, contributes to the pathogenesis of acute pancreatitis. ORAI1 inhibitors might be developed

  12. Drug discovery in prostate cancer mouse models.

    PubMed

    Valkenburg, Kenneth C; Pienta, Kenneth J

    2015-01-01

    The mouse is an important, though imperfect, organism with which to model human disease and to discover and test novel drugs in a preclinical setting. Many experimental strategies have been used to discover new biological and molecular targets in the mouse, with the hopes of translating these discoveries into novel drugs to treat prostate cancer in humans. Modeling prostate cancer in the mouse, however, has been challenging, and often drugs that work in mice have failed in human trials. The authors discuss the similarities and differences between mice and men; the types of mouse models that exist to model prostate cancer; practical questions one must ask when using a mouse as a model; and potential reasons that drugs do not often translate to humans. They also discuss the current value in using mouse models for drug discovery to treat prostate cancer and what needs are still unmet in field. With proper planning and following practical guidelines by the researcher, the mouse is a powerful experimental tool. The field lacks genetically engineered metastatic models, and xenograft models do not allow for the study of the immune system during the metastatic process. There remain several important limitations to discovering and testing novel drugs in mice for eventual human use, but these can often be overcome. Overall, mouse modeling is an essential part of prostate cancer research and drug discovery. Emerging technologies and better and ever-increasing forms of communication are moving the field in a hopeful direction.

  13. Amyloid Precursor Protein Haploinsufficiency Preferentially Mediates Brain Iron Accumulation in Mice Transgenic for The Huntington's Disease Mutation.

    PubMed

    Berggren, Kiersten; Agrawal, Sonal; Fox, Julia A; Hildenbrand, Justin; Nelson, Ryan; Bush, Ashley I; Fox, Jonathan H

    2017-01-01

    Huntington's disease (HD) is an autosomal dominant disorder caused by a CAG expansion in the huntingtin gene that results in expression of mutant huntingtin protein. Iron accumulates in HD brain neurons. Amyloid precursor protein (APP) promotes neuronal iron export. However, the role of APP in brain iron accumulation in HD is unclear. To determine the effects of APP insufficiency on HD in YAC128 mice. We crossed APP hemizygous mice (APP+/-) with YAC128 mice that are transgenic (Tg) for human mutant huntingtin (hmHTT) to generate APP+/+ hmHTT-/-, APP+/- hmHTT-/-, APP+/+ hmHTT+/- and APP+/- hmHTT+/- progeny. Mice were evaluated for behavioral, biochemical and neuropathology HD outcomes at 2-12 months of age. APP heterozygosity decreased cortical APP 25% and 60% in non-Tg and Tg mice, respectively. Cerebral and striatal iron levels were increased by APP knockdown in Tg mice only. Nest-building behavior was decreased in Tg mice; APP knockdown decreased nest building in non-Tg but not Tg mice. Rota-rod endurance was decreased in Tg mice. APP+/- hHTT+/- mice demonstrated additional decreases in rota-rod endurance from 4-10 months of age. Tg mice had smaller striatal volumes and fewer striatal neurons but were not affected by APP knockdown. APP heterozygosity results in greater decreases of cortical APP in Tg versus non-Tg mice. Mutant huntingtin transgenic mice develop brain iron accumulation as a result of greater suppression of APP levels. Elevated brain iron in Tg mice was associated with a decline in motor endurance consistent with a disease promoting effect of iron in the YAC128 model of human HD.

  14. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice

    PubMed Central

    Vidal, Ruben; Sammeta, Neeraja; Garringer, Holly J.; Sambamurti, Kumar; Miravalle, Leticia; Lamb, Bruce T.; Ghetti, Bernardino

    2012-01-01

    Genetically engineered mice have been generated to model cerebral β-amyloidosis, one of the hallmarks of Alzheimer disease (AD) pathology, based on the overexpression of a mutated cDNA of the amyloid-β precursor protein (AβPP) or by knock-in of the murine Aβpp gene alone or with presenilin1 mutations. Here we describe the generation and initial characterization of a new mouse line based on the presence of 2 copies of the human genomic region encoding the wild-type AβPP and the L166P presenilin 1 mutation. At ∼6 mo of age, double-mutant mice develop amyloid pathology, with signs of neuritic dystrophy, intracellular Aβ accumulation, and glial inflammation, an increase in AβPP C-terminal fragments, and an 8 times increase in Aβ42 levels with a 40% decrease in Aβ40 levels, leading to a significant increase (14 times) of Aβ42/Aβ40 ratios, with minimal effects on presenilin or the Notch1 pathway in the brain. We conclude that in mice, neither mutations in AβPP nor overexpression of an AβPP isoform are a prerequisite for Aβ pathology. This model will allow the study of AD pathogenesis and testing of therapeutic strategies in a more relevant environment without experimental artifacts due to the overexpression of a single-mutant AβPP isoform using exogenous promoters.—Vidal, R., Sammeta, N., Garringer, H. J., Sambamurti, K., Miravalle, L., Lamb B. T., Ghetti, B. The Psen1-L166P-knock-in mutation leads to amyloid deposition in human wild-type amyloid precursor protein YAC transgenic mice. PMID:22459153

  15. KRAS Mouse Models

    PubMed Central

    O’Hagan, Rónán C.; Heyer, Joerg

    2011-01-01

    KRAS is a potent oncogene and is mutated in about 30% of all human cancers. However, the biological context of KRAS-dependent oncogenesis is poorly understood. Genetically engineered mouse models of cancer provide invaluable tools to study the oncogenic process, and insights from KRAS-driven models have significantly increased our understanding of the genetic, cellular, and tissue contexts in which KRAS is competent for oncogenesis. Moreover, variation among tumors arising in mouse models can provide insight into the mechanisms underlying response or resistance to therapy in KRAS-dependent cancers. Hence, it is essential that models of KRAS-driven cancers accurately reflect the genetics of human tumors and recapitulate the complex tumor-stromal intercommunication that is manifest in human cancers. Here, we highlight the progress made in modeling KRAS-dependent cancers and the impact that these models have had on our understanding of cancer biology. In particular, the development of models that recapitulate the complex biology of human cancers enables translational insights into mechanisms of therapeutic intervention in KRAS-dependent cancers. PMID:21779503

  16. Mouse Tumor Biology (MTB): a database of mouse models for human cancer.

    PubMed

    Bult, Carol J; Krupke, Debra M; Begley, Dale A; Richardson, Joel E; Neuhauser, Steven B; Sundberg, John P; Eppig, Janan T

    2015-01-01

    The Mouse Tumor Biology (MTB; http://tumor.informatics.jax.org) database is a unique online compendium of mouse models for human cancer. MTB provides online access to expertly curated information on diverse mouse models for human cancer and interfaces for searching and visualizing data associated with these models. The information in MTB is designed to facilitate the selection of strains for cancer research and is a platform for mining data on tumor development and patterns of metastases. MTB curators acquire data through manual curation of peer-reviewed scientific literature and from direct submissions by researchers. Data in MTB are also obtained from other bioinformatics resources including PathBase, the Gene Expression Omnibus and ArrayExpress. Recent enhancements to MTB improve the association between mouse models and human genes commonly mutated in a variety of cancers as identified in large-scale cancer genomics studies, provide new interfaces for exploring regions of the mouse genome associated with cancer phenotypes and incorporate data and information related to Patient-Derived Xenograft models of human cancers. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Identification of a YAC spanning the translocation breakpoints in uterine leiomyomata, pulmonary chondroid hamartoma, and lipoma: Physical mapping of the 12q14-q15 breakpoint region in uterine leiomyomata

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fejzo, M.S.; Yoon, S.J.; Kucherlapati, R.S.

    1995-03-20

    Uterine leiomyomata are the most common tumors in women and can cause abnormal uterine bleeding, pelvic pain, and infertility. Approximately 200,000 hysterectomies are performed annually in the U.S. to relieve patients of the medical sequelae of these benign neoplasms. Our efforts have focused on cloning the t(12;14)(q14-q15;q23-q24) breakpoint in uterine leiomyoma to further our understanding of the biology of these tumors. Thirty-nine YACs and six cosmids mapping to 12q14-q15 have been mapped by fluorescence in situ hybridization to tumor metaphase chromosomes containing a t(12;14). One YAC spanned the translocation breakpoint and was mapped to tumor metaphases from a pulmonary chondroidmore » hamartoma containing a t(12;14)(q14-q15;q23-q24) and a lipoma containing a t(12;15)(q15;q24); this YAC also spanned the breakpoint in these two tumors, suggesting that the same gene on chromosome 12 may be involved in the pathobiology of these distinct benign neoplasms. 41 refs., 2 figs., 1 tab.« less

  18. The Mouse Tumor Biology Database: A Comprehensive Resource for Mouse Models of Human Cancer.

    PubMed

    Krupke, Debra M; Begley, Dale A; Sundberg, John P; Richardson, Joel E; Neuhauser, Steven B; Bult, Carol J

    2017-11-01

    Research using laboratory mice has led to fundamental insights into the molecular genetic processes that govern cancer initiation, progression, and treatment response. Although thousands of scientific articles have been published about mouse models of human cancer, collating information and data for a specific model is hampered by the fact that many authors do not adhere to existing annotation standards when describing models. The interpretation of experimental results in mouse models can also be confounded when researchers do not factor in the effect of genetic background on tumor biology. The Mouse Tumor Biology (MTB) database is an expertly curated, comprehensive compendium of mouse models of human cancer. Through the enforcement of nomenclature and related annotation standards, MTB supports aggregation of data about a cancer model from diverse sources and assessment of how genetic background of a mouse strain influences the biological properties of a specific tumor type and model utility. Cancer Res; 77(21); e67-70. ©2017 AACR . ©2017 American Association for Cancer Research.

  19. Refined mapping and YAC contig construction of the X-linked cleft palate and ankyloglossia locus (CPX) including the proximal X-Y homology breakpoint within Xq21.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Forbes, S.A.; Brennan, L.; Richardson, M.

    1996-01-01

    The gene for X-linked cleft palate (CPX) has previously been mapped in an Icelandic kindred between the unordered proximal markers DXS1002/DXS349/DXS95 and the distal marker DXYS1X, which maps to the proximal end of the X-Y homology region in Xq21.3. Using six sequence-tagged sites (STSs) within the region, a total of 91 yeast artificial chromosome (YAC) clones were isolated and overlapped in a single contig that spans approximately 3.1 Mb between DXS1002 and DXYS1X. The order of microsatellite and STS markers in this was established as DXS1002-DXS1168-DXS349-DXS95-DXS364-DXS1196-DXS472-DXS1217-DXYS1X. A long-range restriction map of this region was created using eight nonchimeric, overlapping YACmore » clones. Analysis of newly positioned polymorphic markers in recombinant individuals from the Icelandic family has enabled us to identify DXS1196 and DXS1217 as the flanking markers for CPX. The maximum physical distance containing the CPX gene has been estimated to be 2.0 Mb, which is spanned by a minimum set of five nonchimeric YAC clones. In addition, YAC end clone and STS analyses have pinpointed the location of the proximal boundary of the X-Y homology region within the map. 40 refs., 2 figs., 2 tabs.« less

  20. Mouse Models of Gastric Cancer

    PubMed Central

    Hayakawa, Yoku; Fox, James G.; Gonda, Tamas; Worthley, Daniel L.; Muthupalani, Sureshkumar; Wang, Timothy C.

    2013-01-01

    Animal models have greatly enriched our understanding of the molecular mechanisms of numerous types of cancers. Gastric cancer is one of the most common cancers worldwide, with a poor prognosis and high incidence of drug-resistance. However, most inbred strains of mice have proven resistant to gastric carcinogenesis. To establish useful models which mimic human gastric cancer phenotypes, investigators have utilized animals infected with Helicobacter species and treated with carcinogens. In addition, by exploiting genetic engineering, a variety of transgenic and knockout mouse models of gastric cancer have emerged, such as INS-GAS mice and TFF1 knockout mice. Investigators have used the combination of carcinogens and gene alteration to accelerate gastric cancer development, but rarely do mouse models show an aggressive and metastatic gastric cancer phenotype that could be relevant to preclinical studies, which may require more specific targeting of gastric progenitor cells. Here, we review current gastric carcinogenesis mouse models and provide our future perspectives on this field. PMID:24216700

  1. Huntington disease iPSCs show early molecular changes in intracellular signaling, the expression of oxidative stress proteins and the p53 pathway

    PubMed Central

    Szlachcic, Wojciech J.; Switonski, Pawel M.; Krzyzosiak, Wlodzimierz J.; Figlerowicz, Marek; Figiel, Maciej

    2015-01-01

    ABSTRACT Huntington disease (HD) is a brain disorder characterized by the late onset of motor and cognitive symptoms, even though the neurons in the brain begin to suffer dysfunction and degeneration long before symptoms appear. There is currently no cure. Several molecular and developmental effects of HD have been identified using neural stem cells (NSCs) and differentiated cells, such as neurons and astrocytes. Still, little is known regarding the molecular pathogenesis of HD in pluripotent cells, such as embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). Therefore, we examined putative signaling pathways and processes involved in HD pathogenesis in pluripotent cells. We tested naïve mouse HD YAC128 iPSCs and two types of human HD iPSC that were generated from HD and juvenile-HD patients. Surprisingly, we found that a number of changes affecting cellular processes in HD were also present in undifferentiated pluripotent HD iPSCs, including the dysregulation of the MAPK and Wnt signaling pathways and the dysregulation of the expression of genes related to oxidative stress, such as Sod1. Interestingly, a common protein interactor of the huntingtin protein and the proteins in the above pathways is p53, and the expression of p53 was dysregulated in HD YAC128 iPSCs and human HD iPSCs. In summary, our findings demonstrate that multiple molecular pathways that are characteristically dysregulated in HD are already altered in undifferentiated pluripotent cells and that the pathogenesis of HD might begin during the early stages of life. PMID:26092128

  2. MicroRNA-128 targets myostatin at coding domain sequence to regulate myoblasts in skeletal muscle development.

    PubMed

    Shi, Lei; Zhou, Bo; Li, Pinghua; Schinckel, Allan P; Liang, Tingting; Wang, Han; Li, Huizhi; Fu, Lingling; Chu, Qingpo; Huang, Ruihua

    2015-09-01

    MicroRNAs (miRNAs or miRs) play a critical role in skeletal muscle development. In a previous study we observed that miR-128 was highly expressed in skeletal muscle. However, its function in regulating skeletal muscle development is not clear. Our hypothesis was that miR-128 is involved in the regulation of the proliferation and differentiation of skeletal myoblasts. In this study, through bioinformatics analyses, we demonstrate that miR-128 specifically targeted mRNA of myostatin (MSTN), a critical inhibitor of skeletal myogenesis, at coding domain sequence (CDS) region, resulting in down-regulating of myostatin post-transcription. Overexpression of miR-128 inhibited proliferation of mouse C2C12 myoblast cells but promoted myotube formation; whereas knockdown of miR-128 had completely opposite effects. In addition, ectopic miR-128 regulated the expression of myogenic factor 5 (Myf5), myogenin (MyoG), paired box (Pax) 3 and 7. Furthermore, an inverse relationship was found between the expression of miR-128 and MSTN protein expression in vivo and in vitro. Taken together, these results reveal that there is a novel pathway in skeletal muscle development in which miR-128 regulates myostatin at CDS region to inhibit proliferation but promote differentiation of myoblast cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Naruse, Kuniko; Nomiyama, Hisayuki; Miura, Retsu

    1996-06-01

    CC chemokines are cytokines that attract and activate leukocytes. The human genes for the CC chemokines are clustered on chromosome 17. To elucidate the genomic organization of the CC chemokine genes, we constructed a YAC contig comprising 34 clones. The contig was shown to contain all 10 CC chemokine genes reported so far, except for one gene whose nucleotide sequence is not available. The contig also contains 4 CC chemokine-like genes, which were deposited in GenBank as ESTs and are here referred to as NCC-1, NCC-2, NCC-3, and NCC-4. Within the contig, the CC chemokine genes were localized in twomore » regions. In addition, the CC chemokine genes were localized in two regions. In addition, the CC chemokine genes were more precisely mapped on chromosome 17q11.2 using a somatic cell hybrid cell DNA panel containing various portions of human chromosome 17. Interestingly, a reciprocal translocation t(Y;17) breakpoint, contained in the hybrid cell line Y1741, lay between the two chromosome 17 chemokine gene regions covered by our YAC contig. From these results, the order and the orientation of CC chemokine genes on chromosome 17 were determined as follows: centromere-neurofibromatosis 1-(MCP-3, MCP-1, NCC-1, I-309)-Y1741 breakpoint-RANTES-(LD78{gamma}, AT744.2, LD78{beta})-(NCC-3, NCC-2, AT744.1, LD78{alpha})-NCC-4-retinoic acid receptor {alpha}-telomere. 22 refs., 1 fig., 2 tabs.« less

  4. A brain-specific gene cluster isolated from the region of the mouse obesity locus is expressed in the adult hypothalamus and during mouse development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laig-Webster, M.; Lim, M.E.; Chehab, F.F.

    1994-09-01

    The molecular defect underlying an autosomal recessive form of genetic obesity in a classical mouse model C57 BL/6J-ob/ob has not yet been elucidated. Whereas metabolic and physiological disturbances such as diabetes and hypertension are associated with obesity, the site of expression and the nature of the primary lesion responsible for this cascade of events remains elusive. Our efforts aimed at the positional cloning of the ob gene by YAC contig mapping and gene identification have resulted in the cloning of a brain-specific gene cluster from the ob critical region. The expression of this gene cluster is remarkably complex owing tomore » the multitude of brain-specific mRNA transcripts detected on Northern blots. cDNA cloning of these transcripts suggests that they are expressed from different genes as well as by alternate splicing mechanisms. Furthermore, the genomic organization of the cluster appears to consist of at least two identical promoters displaying CpG islands characteristic of housekeeping genes, yet clearly involving tissue-specific expression. Sense and anti-sense synthetic RNA probes were derived from a common DNA sequence on 3 cDNA clones and hybridized to 8-16 days mouse embryonic stages and mouse adult brain sections. Expression in development was noticeable as of the 11th day of gestation and confined to the central nervous system mainly in the telencephalon and spinal cord. Coronal and sagittal sections of the adult mouse brain showed expression only in 3 different regions of the brain stem. In situ hybridization to mouse hypothalamus sections revealed the presence of a localized and specialized group of cells expressing high levels of mRNA, suggesting that this gene cluster may also be involved in the regulation of hypothalamic activities. The hypothalamus has long been hypothesized as a primary candidate tissue for the expression of the obesity gene mainly because of its well-established role in the regulation of energy metabolism and

  5. Finding mouse models of human lymphomas and leukemia's using the Jackson laboratory mouse tumor biology database.

    PubMed

    Begley, Dale A; Sundberg, John P; Krupke, Debra M; Neuhauser, Steven B; Bult, Carol J; Eppig, Janan T; Morse, Herbert C; Ward, Jerrold M

    2015-12-01

    Many mouse models have been created to study hematopoietic cancer types. There are over thirty hematopoietic tumor types and subtypes, both human and mouse, with various origins, characteristics and clinical prognoses. Determining the specific type of hematopoietic lesion produced in a mouse model and identifying mouse models that correspond to the human subtypes of these lesions has been a continuing challenge for the scientific community. The Mouse Tumor Biology Database (MTB; http://tumor.informatics.jax.org) is designed to facilitate use of mouse models of human cancer by providing detailed histopathologic and molecular information on lymphoma subtypes, including expertly annotated, on line, whole slide scans, and providing a repository for storing information on and querying these data for specific lymphoma models. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

    PubMed Central

    Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

  7. Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

    PubMed

    Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

    2012-01-01

    Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

  8. Genetically engineered mouse models of melanoma.

    PubMed

    Pérez-Guijarro, Eva; Day, Chi-Ping; Merlino, Glenn; Zaidi, M Raza

    2017-06-01

    Melanoma is a complex disease that exhibits highly heterogeneous etiological, histopathological, and genetic features, as well as therapeutic responses. Genetically engineered mouse (GEM) models provide powerful tools to unravel the molecular mechanisms critical for melanoma development and drug resistance. Here, we expound briefly the basis of the mouse modeling design, the available technology for genetic engineering, and the aspects influencing the use of GEMs to model melanoma. Furthermore, we describe in detail the currently available GEM models of melanoma. Cancer 2017;123:2089-103. © 2017 American Cancer Society. © 2017 American Cancer Society.

  9. Genetically Engineered Mouse Models for Studying Inflammatory Bowel Disease

    PubMed Central

    Mizoguchi, Atsushi; Takeuchi, Takahito; Himuro, Hidetomo; Okada, Toshiyuki; Mizoguchi, Emiko

    2015-01-01

    Inflammatory bowel disease (IBD) is a chronic intestinal inflammatory condition that is mediated by very complex mechanisms controlled by genetic, immune, and environmental factors. More than 74 kinds of genetically engineered mouse strains have been established since 1993 for studying IBD. Although mouse models cannot fully reflect human IBD, they have provided significant contributions for not only understanding the mechanism, but also developing new therapeutic means for IBD. Indeed, 20 kinds of genetically engineered mouse models carry the susceptibility genes identified in human IBD, and the functions of some other IBD susceptibility genes have also been dissected out using mouse models. Cutting-edge technologies such as cell-specific and inducible knockout systems, which were recently employed to mouse IBD models, have further enhanced the ability of investigators to provide important and unexpected rationales for developing new therapeutic strategies for IBD. In this review article, we briefly introduce 74 kinds of genetically engineered mouse models that spontaneously develop intestinal inflammation. PMID:26387641

  10. STS-128 patch Pathd

    NASA Image and Video Library

    2009-04-14

    STS128-S-001 (April 2009) --- The STS-128 patch symbolizes the 17A mission and represents the hardware, people and partner nations that contribute to the flight. The Space shuttle Discovery is shown in the orbit configuration with the Multi-Purpose Logistics Module (MPLM) Leonardo in the payload bay. Earth and the International Space Station wrap around the Astronaut Office symbol reminding us of the continuous human presence in space. The names of the STS-128 crew members border the patch in an unfurled manner. Included in the names is the expedition crew member who will launch on STS-128 and remain on board ISS, replacing another Expedition crew member who will return home with STS-128. The banner also completes the Astronaut Office symbol and contains the U.S. and Swedish flags representing the countries of the STS-128 crew. The NASA insignia design for space shuttle flights is reserved for use by the astronauts and for other official use as the NASA Administrator may authorize. Public availability has been approved only in the forms of illustrations by the various news media. When and if there is any change in this policy, which is not anticipated, the change will be publicly announced. Photo credit: NASA

  11. Genetically engineered mouse models for studying inflammatory bowel disease.

    PubMed

    Mizoguchi, Atsushi; Takeuchi, Takahito; Himuro, Hidetomo; Okada, Toshiyuki; Mizoguchi, Emiko

    2016-01-01

    Inflammatory bowel disease (IBD) is a chronic intestinal inflammatory condition that is mediated by very complex mechanisms controlled by genetic, immune, and environmental factors. More than 74 kinds of genetically engineered mouse strains have been established since 1993 for studying IBD. Although mouse models cannot fully reflect human IBD, they have provided significant contributions for not only understanding the mechanism, but also developing new therapeutic means for IBD. Indeed, 20 kinds of genetically engineered mouse models carry the susceptibility genes identified in human IBD, and the functions of some other IBD susceptibility genes have also been dissected out using mouse models. Cutting-edge technologies such as cell-specific and inducible knockout systems, which were recently employed to mouse IBD models, have further enhanced the ability of investigators to provide important and unexpected rationales for developing new therapeutic strategies for IBD. In this review article, we briefly introduce 74 kinds of genetically engineered mouse models that spontaneously develop intestinal inflammation. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  12. In vivo axonal transport deficits in a mouse model of fronto-temporal dementia

    PubMed Central

    Majid, Tabassum; Ali, Yousuf O.; Venkitaramani, Deepa V.; Jang, Ming-Kuei; Lu, Hui-Chen; Pautler, Robia G.

    2014-01-01

    Background Axonal transport is vital for neurons and deficits in this process have been previously reported in a few mouse models of Alzheimer's disease prior to the appearance of plaques and tangles. However, it remains to be determined whether axonal transport is defective prior to the onset of neurodegeneration. The rTg4510 mouse, a fronto-temporal dementia and parkinsonism-17 (FTDP-17) tauopathy model, over-express tau-P301L mutation found in familial forms of FTDP-17, in the forebrain driven by the calcium–calmodulin kinase II promoter. This mouse model exhibits tau pathology, neurodegeneration in the forebrain, and associated behavioral deficits beginning at 4–5 months of age. Animal model rTg4510 transgenic mice were used in these studies. Mice were given 2 μL of MnCl2 in each nostril 1 h prior to Magnetic Resonance Imaging (MRI). Following MnCl2 nasal lavage, mice were imaged using Manganese enhanced Magnetic Resonance Imaging (MEMRI) Protocol with TE = 8.5 ms, TR = 504 ms, FOV = 3.0 cm, matrix size = 128 × 128 × 128, number of cycles = 15 with each cycle taking approximately 2 min, 9 s, and 24 ms using Paravision software (BrukerBioSpin, Billerica, MA). During imaging, body temperature was maintained at 37.0 °C using an animal heating system (SA Instruments, Stony Brook, NY). Data analysis Resulting images were analyzed using Paravision software. Regions of interest (ROI) within the olfactory neuronal layer (ONL) and the water phantom consisting of one pixel (ONL) and 9 pixels (water) were selected and copied across each of the 15 cycles. Signal intensities (SI) of ONL and water phantom ROIs were measured. SI values obtained for ONL were then normalized the water phantom SI values. The correlation between normalized signal intensity in the ONL and time were assessed using Prism (GraphPad Software, San Diego, CA). Results Using the MEMRI technique on 1.5, 3, 5, and 10-month old rTg4510 mice and littermate controls, we found

  13. 7 CFR 1220.128 - Soybeans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Soybeans. 1220.128 Section 1220.128 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.128 Soybeans. The term...

  14. 7 CFR 1220.128 - Soybeans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Soybeans. 1220.128 Section 1220.128 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH, AND CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.128 Soybeans. The term...

  15. 28 CFR 0.128 - Organization.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Organization. 0.128 Section 0.128 Judicial Administration DEPARTMENT OF JUSTICE ORGANIZATION OF THE DEPARTMENT OF JUSTICE 1-Foreign Claims Settlement Commission § 0.128 Organization. The Foreign Claims Settlement Commission of the United States is...

  16. Rational Design of Mouse Models for Cancer Research.

    PubMed

    Landgraf, Marietta; McGovern, Jacqui A; Friedl, Peter; Hutmacher, Dietmar W

    2018-03-01

    The laboratory mouse is widely considered as a valid and affordable model organism to study human disease. Attempts to improve the relevance of murine models for the investigation of human pathologies led to the development of various genetically engineered, xenograft and humanized mouse models. Nevertheless, most preclinical studies in mice suffer from insufficient predictive value when compared with cancer biology and therapy response of human patients. We propose an innovative strategy to improve the predictive power of preclinical cancer models. Combining (i) genomic, tissue engineering and regenerative medicine approaches for rational design of mouse models with (ii) rapid prototyping and computational benchmarking against human clinical data will enable fast and nonbiased validation of newly generated models. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Mouse models of neurodegenerative diseases: criteria and general methodology.

    PubMed

    Janus, Christopher; Welzl, Hans

    2010-01-01

    The major symptom of Alzheimer's disease is rapidly progressing dementia, coinciding with the formation of amyloid and tau deposits in the central nervous system, and neuronal death. At present familial cases of dementias provide the most promising foundation for modelling neurodegeneration. We describe the mnemonic and other major behavioral symptoms of tauopathies, briefly outline the genetics underlying familiar cases and discuss the arising implications for modelling the disease in mostly transgenic mouse lines. We then depict to what degree the most recent mouse models replicate pathological and cognitive characteristics observed in patients.There is no universally valid behavioral test battery to evaluate mouse models. The selection of individual tests depends on the behavioral and/or memory system in focus, the type of a model and how well it replicates the pathology of a disease and the amount of control over the genetic background of the mouse model. However it is possible to provide guidelines and criteria for modelling the neurodegeneration, setting up the experiments and choosing relevant tests. One should not adopt a "one (trans)gene, one disease" interpretation, but should try to understand how the mouse genome copes with the protein expression of the transgene in question. Further, it is not possible to recommend some mouse models over others since each model is valuable within its own constraints, and the way experiments are performed often reflects the idiosyncratic reality of specific laboratories. Our purpose is to improve bridging molecular and behavioural approaches in translational research.

  18. 7 CFR 1.28 - Petitions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Petitions. 1.28 Section 1.28 Agriculture Office of the Secretary of Agriculture ADMINISTRATIVE REGULATIONS Departmental Proceedings § 1.28 Petitions. Petitions by... filed with the official that issued or is authorized to issue the rule. All such petitions will be given...

  19. 22 CFR 128.8 - Hearings.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Hearings. 128.8 Section 128.8 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS ADMINISTRATIVE PROCEDURES § 128.8 Hearings. (a) A respondent who had not filed a timely written answer is not entitled to a hearing, and the case...

  20. 22 CFR 128.8 - Hearings.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Hearings. 128.8 Section 128.8 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS ADMINISTRATIVE PROCEDURES § 128.8 Hearings. (a) A respondent who had not filed a timely written answer is not entitled to a hearing, and the case...

  1. 22 CFR 128.8 - Hearings.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Hearings. 128.8 Section 128.8 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS ADMINISTRATIVE PROCEDURES § 128.8 Hearings. (a) A respondent who had not filed a timely written answer is not entitled to a hearing, and the case...

  2. 22 CFR 128.8 - Hearings.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Hearings. 128.8 Section 128.8 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS ADMINISTRATIVE PROCEDURES § 128.8 Hearings. (a) A respondent who had not filed a timely written answer is not entitled to a hearing, and the case...

  3. The Mouse Genome Database (MGD): facilitating mouse as a model for human biology and disease.

    PubMed

    Eppig, Janan T; Blake, Judith A; Bult, Carol J; Kadin, James A; Richardson, Joel E

    2015-01-01

    The Mouse Genome Database (MGD, http://www.informatics.jax.org) serves the international biomedical research community as the central resource for integrated genomic, genetic and biological data on the laboratory mouse. To facilitate use of mouse as a model in translational studies, MGD maintains a core of high-quality curated data and integrates experimentally and computationally generated data sets. MGD maintains a unified catalog of genes and genome features, including functional RNAs, QTL and phenotypic loci. MGD curates and provides functional and phenotype annotations for mouse genes using the Gene Ontology and Mammalian Phenotype Ontology. MGD integrates phenotype data and associates mouse genotypes to human diseases, providing critical mouse-human relationships and access to repositories holding mouse models. MGD is the authoritative source of nomenclature for genes, genome features, alleles and strains following guidelines of the International Committee on Standardized Genetic Nomenclature for Mice. A new addition to MGD, the Human-Mouse: Disease Connection, allows users to explore gene-phenotype-disease relationships between human and mouse. MGD has also updated search paradigms for phenotypic allele attributes, incorporated incidental mutation data, added a module for display and exploration of genes and microRNA interactions and adopted the JBrowse genome browser. MGD resources are freely available to the scientific community. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. 7 CFR 1.28 - Petitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 1 2013-01-01 2013-01-01 false Petitions. 1.28 Section 1.28 Agriculture Office of the Secretary of Agriculture ADMINISTRATIVE REGULATIONS Departmental Proceedings § 1.28 Petitions. Petitions by interested persons in accordance with 5 U.S.C. 553(e) for the issuance, amendment or repeal of a rule may be...

  5. In vivo axonal transport deficits in a mouse model of fronto-temporal dementia.

    PubMed

    Majid, Tabassum; Ali, Yousuf O; Venkitaramani, Deepa V; Jang, Ming-Kuei; Lu, Hui-Chen; Pautler, Robia G

    2014-01-01

    Axonal transport is vital for neurons and deficits in this process have been previously reported in a few mouse models of Alzheimer's disease prior to the appearance of plaques and tangles. However, it remains to be determined whether axonal transport is defective prior to the onset of neurodegeneration. The rTg4510 mouse, a fronto-temporal dementia and parkinsonism-17 (FTDP-17) tauopathy model, over-express tau-P301L mutation found in familial forms of FTDP-17, in the forebrain driven by the calcium-calmodulin kinase II promoter. This mouse model exhibits tau pathology, neurodegeneration in the forebrain, and associated behavioral deficits beginning at 4-5 months of age. rTg4510 transgenic mice were used in these studies. Mice were given 2 μL of MnCl2 in each nostril 1 h prior to Magnetic Resonance Imaging (MRI). Following MnCl2 nasal lavage, mice were imaged using Manganese enhanced Magnetic Resonance Imaging (MEMRI) Protocol with TE = 8.5 ms, TR = 504 ms, FOV = 3.0 cm, matrix size = 128 × 128 × 128, number of cycles = 15 with each cycle taking approximately 2 min, 9 s, and 24 ms using Paravision software (BrukerBioSpin, Billerica, MA). During imaging, body temperature was maintained at 37.0 °C using an animal heating system (SA Instruments, Stony Brook, NY). Resulting images were analyzed using Paravision software. Regions of interest (ROI) within the olfactory neuronal layer (ONL) and the water phantom consisting of one pixel (ONL) and 9 pixels (water) were selected and copied across each of the 15 cycles. Signal intensities (SI) of ONL and water phantom ROIs were measured. SI values obtained for ONL were then normalized the water phantom SI values. The correlation between normalized signal intensity in the ONL and time were assessed using Prism (GraphPad Software, San Diego, CA). Using the MEMRI technique on 1.5, 3, 5, and 10-month old rTg4510 mice and littermate controls, we found significant axonal transport deficits present in

  6. Generation Of A Mouse Model For Schwannomatosis

    DTIC Science & Technology

    2010-09-01

    TITLE: Generation of a Mouse Model for Schwannomatosis PRINCIPAL INVESTIGATOR: Long-Sheng Chang, Ph.D. CONTRACTING ORGANIZATION: The...Annual 3. DATES COVERED (From - To) 1 Sep 2009 - 31 Aug 2010 4. TITLE AND SUBTITLE Generation of a Mouse Model for Schwannomatosis 5a. CONTRACT...hypothesis involving inactivation of both the INI1/SNF5 and NF2 tumor suppressor genes in the formation of schwannomatosis -associated tumors. To

  7. 46 CFR 128.310 - Fuel.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fuel. 128.310 Section 128.310 Shipping COAST GUARD... Main and Auxiliary Machinery § 128.310 Fuel. (a) Except as provided by paragraph (b) of this section..., must be driven by a fuel having a flashpoint of not lower than 43 °C (110 °F) as determined by ASTM D...

  8. 46 CFR 128.310 - Fuel.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Fuel. 128.310 Section 128.310 Shipping COAST GUARD... Main and Auxiliary Machinery § 128.310 Fuel. (a) OSVs of less than 6,000 GT ITC (500 GRT if GT ITC is... main propulsion or for auxiliaries, must be driven by a fuel having a flashpoint of not lower than 43...

  9. 46 CFR 128.310 - Fuel.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Fuel. 128.310 Section 128.310 Shipping COAST GUARD... Main and Auxiliary Machinery § 128.310 Fuel. (a) Except as provided by paragraph (b) of this section..., must be driven by a fuel having a flashpoint of not lower than 43 °C (110 °F) as determined by ASTM D...

  10. 46 CFR 128.310 - Fuel.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Fuel. 128.310 Section 128.310 Shipping COAST GUARD... Main and Auxiliary Machinery § 128.310 Fuel. (a) Except as provided by paragraph (b) of this section..., must be driven by a fuel having a flashpoint of not lower than 43 °C (110 °F) as determined by ASTM D...

  11. 46 CFR 128.310 - Fuel.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Fuel. 128.310 Section 128.310 Shipping COAST GUARD... Main and Auxiliary Machinery § 128.310 Fuel. (a) Except as provided by paragraph (b) of this section..., must be driven by a fuel having a flashpoint of not lower than 43 °C (110 °F) as determined by ASTM D...

  12. Behavioral phenotypes of genetic mouse models of autism

    PubMed Central

    Kazdoba, T. M.; Leach, P. T.; Crawley, J. N.

    2016-01-01

    More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. PMID:26403076

  13. System parameters for erythropoiesis control model: Comparison of normal values in human and mouse model

    NASA Technical Reports Server (NTRS)

    1979-01-01

    The computer model for erythropoietic control was adapted to the mouse system by altering system parameters originally given for the human to those which more realistically represent the mouse. Parameter values were obtained from a variety of literature sources. Using the mouse model, the mouse was studied as a potential experimental model for spaceflight. Simulation studies of dehydration and hypoxia were performed. A comparison of system parameters for the mouse and human models is presented. Aside from the obvious differences expected in fluid volumes, blood flows and metabolic rates, larger differences were observed in the following: erythrocyte life span, erythropoietin half-life, and normal arterial pO2.

  14. microRNA-128a dysregulation in transgenic Huntington's disease monkeys.

    PubMed

    Kocerha, Jannet; Xu, Yan; Prucha, Melinda S; Zhao, Dongming; Chan, Anthony W S

    2014-06-13

    Huntington's Disease (HD) is a progressive neurodegenerative disorder with a single causal mutation in the Huntingtin (HTT) gene. MicroRNAs (miRNAs) have recently been implicated as epigenetic regulators of neurological disorders, however, their role in HD pathogenesis is not well defined. Here we study transgenic HD monkeys (HD monkeys) to examine miRNA dysregulation in a primate model of the disease. In this report, 11 miRNAs were found to be significantly associated (P value < 0.05) with HD in the frontal cortex of the HD monkeys. We further focused on one of those candidates, miR-128a, due to the corresponding disruption in humans and mice with HD as well as its intriguing lists of gene targets. miR-128a was downregulated in our HD monkey model by the time of birth. We then confirmed that miR-128a was also downregulated in the brains of pre-symptomatic and post-symptomatic HD patients. Additionally, our studies confirmed a panel of canonical HD signaling genes regulated by miR-128a, including HTT and Huntingtin Interaction Protein 1 (HIP1). Our studies found that miR-128a may play a critical role in HD and could be a viable candidate as a therapeutic or biomarker of the disease.

  15. 12 CFR 12.8 - Waivers.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Waivers. 12.8 Section 12.8 Banks and Banking... SECURITIES TRANSACTIONS § 12.8 Waivers. A national bank may file a written request with the OCC for waiver of one or more of the requirements set forth in §§ 12.2 through 12.7, either in whole or in part. The OCC...

  16. Behavioral phenotypes of genetic mouse models of autism.

    PubMed

    Kazdoba, T M; Leach, P T; Crawley, J N

    2016-01-01

    More than a hundred de novo single gene mutations and copy-number variants have been implicated in autism, each occurring in a small subset of cases. Mutant mouse models with syntenic mutations offer research tools to gain an understanding of the role of each gene in modulating biological and behavioral phenotypes relevant to autism. Knockout, knockin and transgenic mice incorporating risk gene mutations detected in autism spectrum disorder and comorbid neurodevelopmental disorders are now widely available. At present, autism spectrum disorder is diagnosed solely by behavioral criteria. We developed a constellation of mouse behavioral assays designed to maximize face validity to the types of social deficits and repetitive behaviors that are central to an autism diagnosis. Mouse behavioral assays for associated symptoms of autism, which include cognitive inflexibility, anxiety, hyperactivity, and unusual reactivity to sensory stimuli, are frequently included in the phenotypic analyses. Over the past 10 years, we and many other laboratories around the world have employed these and additional behavioral tests to phenotype a large number of mutant mouse models of autism. In this review, we highlight mouse models with mutations in genes that have been identified as risk genes for autism, which work through synaptic mechanisms and through the mTOR signaling pathway. Robust, replicated autism-relevant behavioral outcomes in a genetic mouse model lend credence to a causal role for specific gene contributions and downstream biological mechanisms in the etiology of autism. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  17. Generation of transgenic mouse model using PTTG as an oncogene.

    PubMed

    Kakar, Sham S; Kakar, Cohin

    2015-01-01

    The close physiological similarity between the mouse and human has provided tools to understanding the biological function of particular genes in vivo by introduction or deletion of a gene of interest. Using a mouse as a model has provided a wealth of resources, knowledge, and technology, helping scientists to understand the biological functions, translocation, trafficking, and interaction of a candidate gene with other intracellular molecules, transcriptional regulation, posttranslational modification, and discovery of novel signaling pathways for a particular gene. Most importantly, the generation of the mouse model for a specific human disease has provided a powerful tool to understand the etiology of a disease and discovery of novel therapeutics. This chapter describes in detail the step-by-step generation of the transgenic mouse model, which can be helpful in guiding new investigators in developing successful models. For practical purposes, we will describe the generation of a mouse model using pituitary tumor transforming gene (PTTG) as the candidate gene of interest.

  18. Optimizing mouse models of neurodegenerative disorders: are therapeutics in sight?

    PubMed

    Lutz, Cathleen M; Osborne, Melissa A

    2013-01-01

    The genomic and biologic conservation between mice and humans, along with our increasing ability to manipulate the mouse genome, places the mouse as a premier model for deciphering disease mechanisms and testing potential new therapies. Despite these advantages, mouse models of neurodegenerative disease are sometimes difficult to generate and can present challenges that must be carefully addressed when used for preclinical studies. For those models that do exist, the standardization and optimization of the models is a critical step in ensuring success in both basic research and preclinical use. This review looks back on the history of model development for neurodegenerative diseases and highlights the key strategies that have been learned in order to improve the design, development and use of mouse models in the study of neurodegenerative disease.

  19. A 128 x 128 InGaAs detector array for 1.0 - 1.7 microns

    NASA Technical Reports Server (NTRS)

    Olsen, G.; Joshi, A.; Lange, M.; Woodruff, K.; Mykietyn, E.; Gay, D.; Ackley, D.; Erickson, G.; Ban, V.; Staller, C.

    1990-01-01

    A two-dimensional 128 x 128 detector array for the 1.0 - 1.7 micron spectral region has been demonstrated with indium gallium arsenide. The 30 micron square pixels had 60 micron spacing in both directions and were designed to be compatible with a 2D Reticon multiplexer. Dark currents below 100 pA, capacitance near 0.1 pF, and quantum efficiencies above 80 percent were measured. Probe maps of dark current and quantum efficiency are presented along with pixel dropout data and wafer yield which was as high as 99.89 percent (7 dropouts) in an area of 6528 pixels and 99.37 percent (103 dropouts) over an entire 128 x 128 pixel region.

  20. Behavioural phenotyping assays for mouse models of autism

    PubMed Central

    Silverman, Jill L.; Yang, Mu; Lord, Catherine; Crawley, Jacqueline N.

    2011-01-01

    Autism is a heterogeneous neurodevelopmental disorder of unknown aetiology that affects 1 in 100–150 individuals. Diagnosis is based on three categories of behavioural criteria: abnormal social interactions, communication deficits and repetitive behaviours. Strong evidence for a genetic basis has prompted the development of mouse models with targeted mutations in candidate genes for autism. As the diagnostic criteria for autism are behavioural, phenotyping these mouse models requires behavioural assays with high relevance to each category of the diagnostic symptoms. Behavioural neuroscientists are generating a comprehensive set of assays for social interaction, communication and repetitive behaviours to test hypotheses about the causes of austism. Robust phenotypes in mouse models hold great promise as translational tools for discovering effective treatments for components of autism spectrum disorders. PMID:20559336

  1. Applications and Limitations of Mouse Models for Understanding Human Atherosclerosis

    PubMed Central

    von Scheidt, Moritz; Zhao, Yuqi; Kurt, Zeyneb; Pan, Calvin; Zeng, Lingyao; Yang, Xia; Schunkert, Heribert; Lusis, Aldons J.

    2017-01-01

    Most of the biological understanding of mechanisms underlying coronary artery disease (CAD) derives from studies of mouse models. The identification of multiple CAD loci and strong candidate genes in large human genome-wide association studies (GWAS) presented an opportunity to examine the relevance of mouse models for the human disease. We comprehensively reviewed the mouse literature, including 827 literature-derived genes, and compared it to human data. First, we observed striking concordance of risk factors for atherosclerosis in mice and humans. Second, there was highly significant overlap of mouse genes with human genes identified by GWAS. In particular, of the 46 genes with strong association signals in CAD-GWAS that were studied in mouse models all but one exhibited consistent effects on atherosclerosis-related phenotypes. Third, we compared 178 CAD-associated pathways derived from human GWAS with 263 from mouse studies and observed that over 50% were consistent between both species. PMID:27916529

  2. 46 CFR 128.320 - Exhaust systems.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Exhaust systems. 128.320 Section 128.320 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS MARINE ENGINEERING: EQUIPMENT AND SYSTEMS Main and Auxiliary Machinery § 128.320 Exhaust systems. No diesel-engine exhaust system...

  3. 46 CFR 128.320 - Exhaust systems.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Exhaust systems. 128.320 Section 128.320 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS MARINE ENGINEERING: EQUIPMENT AND SYSTEMS Main and Auxiliary Machinery § 128.320 Exhaust systems. No diesel-engine exhaust system...

  4. 46 CFR 128.320 - Exhaust systems.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Exhaust systems. 128.320 Section 128.320 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS MARINE ENGINEERING: EQUIPMENT AND SYSTEMS Main and Auxiliary Machinery § 128.320 Exhaust systems. No diesel-engine exhaust system...

  5. 46 CFR 128.320 - Exhaust systems.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Exhaust systems. 128.320 Section 128.320 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS MARINE ENGINEERING: EQUIPMENT AND SYSTEMS Main and Auxiliary Machinery § 128.320 Exhaust systems. No diesel-engine exhaust system...

  6. 46 CFR 128.320 - Exhaust systems.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Exhaust systems. 128.320 Section 128.320 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS MARINE ENGINEERING: EQUIPMENT AND SYSTEMS Main and Auxiliary Machinery § 128.320 Exhaust systems. No diesel-engine exhaust system...

  7. 10 CFR 4.128 - New construction.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false New construction. 4.128 Section 4.128 Energy NUCLEAR... 1973, as Amended Discriminatory Practices § 4.128 New construction. (a) Design, construction, and... Federal Accessibility Standards. (1) Effective as of January 18, 1991, design, construction, or alteration...

  8. 10 CFR 4.128 - New construction.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false New construction. 4.128 Section 4.128 Energy NUCLEAR... 1973, as Amended Discriminatory Practices § 4.128 New construction. (a) Design, construction, and... Federal Accessibility Standards. (1) Effective as of January 18, 1991, design, construction, or alteration...

  9. 41 CFR 128-1.8008 - Exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Exemptions. 128-1.8008 Section 128-1.8008 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8008 Exemptions. The...

  10. 41 CFR 128-1.8007 - Reporting.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Reporting. 128-1.8007 Section 128-1.8007 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8007 Reporting. The...

  11. 10 CFR 4.128 - New construction.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false New construction. 4.128 Section 4.128 Energy NUCLEAR... 1973, as Amended Discriminatory Practices § 4.128 New construction. (a) Design, construction, and... Accessibility Standards. (1) Effective as of January 18, 1991, design, construction, or alteration of buildings...

  12. 10 CFR 4.128 - New construction.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false New construction. 4.128 Section 4.128 Energy NUCLEAR... 1973, as Amended Discriminatory Practices § 4.128 New construction. (a) Design, construction, and... Accessibility Standards. (1) Effective as of January 18, 1991, design, construction, or alteration of buildings...

  13. 28 CFR 0.128b - Regulations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Regulations. 0.128b Section 0.128b Judicial Administration DEPARTMENT OF JUSTICE ORGANIZATION OF THE DEPARTMENT OF JUSTICE 1-Foreign Claims Settlement Commission § 0.128b Regulations. All rules of practice and regulations applicable to the...

  14. 28 CFR 0.128b - Regulations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Regulations. 0.128b Section 0.128b Judicial Administration DEPARTMENT OF JUSTICE ORGANIZATION OF THE DEPARTMENT OF JUSTICE 1-Foreign Claims Settlement Commission § 0.128b Regulations. All rules of practice and regulations applicable to the...

  15. Collision attack against Tav-128 hash function

    NASA Astrophysics Data System (ADS)

    Hariyanto, Fajar; Hayat Susanti, Bety

    2017-10-01

    Tav-128 is a hash function which is designed for Radio Frequency Identification (RFID) authentication protocol. Tav-128 is expected to be a cryptographically secure hash function which meets collision resistance properties. In this research, a collision attack is done to prove whether Tav-128 is a collision resistant hash function. The results show that collisions can be obtained in Tav-128 hash function which means in other word, Tav-128 is not a collision resistant hash function.

  16. Mouse Models in Bone Marrow Transplantation and Adoptive Cellular Therapy

    PubMed Central

    Arber, Caroline; Brenner, Malcolm K.; Reddy, Pavan

    2014-01-01

    Mouse models of transplantation have been indispensable to the development of bone marrow transplantation (BMT). Their role in the generation of basic science knowledge is invaluable and is subject to discussion below. However, this article focuses on the direct role and relevance of mouse models towards the clinical development and advances in BMT and adoptive T-cell therapy for human diseases. The authors aim to present a thoughtful perspective on the pros and cons of mouse models while noting that despite imperfections these models are obligatory for the development of science-based medicine. PMID:24216170

  17. 41 CFR 128-1.152 - Citation.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Citation. 128-1.152 Section 128-1.152 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.152 Citation. The JPMR will be...

  18. 41 CFR 128-1.8000 - Scope.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Scope. 128-1.8000 Section 128-1.8000 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8000 Scope. This subpart...

  19. Construction of human chromosome 21-specific yeast artificial chromosomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCormick, M.K.; Shero, J.H.; Hieter, P.A.

    1989-12-01

    Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less

  20. 21 CFR 133.128 - Cottage cheese.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Cottage cheese. 133.128 Section 133.128 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.128 Cottage cheese. (a) Cottage cheese is the soft uncured cheese prepared by mixing cottage...

  1. 21 CFR 133.128 - Cottage cheese.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Cottage cheese. 133.128 Section 133.128 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.128 Cottage cheese. (a) Cottage cheese is the soft uncured cheese prepared by mixing cottage...

  2. 22 CFR 128.11 - Consent agreements.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Consent agreements. 128.11 Section 128.11... § 128.11 Consent agreements. (a) The Directorate of Defense Trade Controls and the respondent may, by agreement, submit to the Administrative Law Judge a proposal for the issuance of a consent order. The...

  3. 22 CFR 128.11 - Consent agreements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Consent agreements. 128.11 Section 128.11... § 128.11 Consent agreements. (a) The Directorate of Defense Trade Controls and the respondent may, by agreement, submit to the Administrative Law Judge a proposal for the issuance of a consent order. The...

  4. 22 CFR 128.11 - Consent agreements.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Consent agreements. 128.11 Section 128.11... § 128.11 Consent agreements. (a) The Directorate of Defense Trade Controls and the respondent may, by agreement, submit to the Administrative Law Judge a proposal for the issuance of a consent order. The...

  5. 46 CFR 128.120 - Plan approval.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Plan approval. 128.120 Section 128.120 Shipping COAST... AND SYSTEMS General § 128.120 Plan approval. The plans required by subchapter F of this chapter need not be submitted if the plans required by § 127.110(d) of this subchapter have been. ...

  6. How Genetically Engineered Mouse Tumor Models Provide Insights Into Human Cancers

    PubMed Central

    Politi, Katerina; Pao, William

    2011-01-01

    Genetically engineered mouse models (GEMMs) of human cancer were first created nearly 30 years ago. These early transgenic models demonstrated that mouse cells could be transformed in vivo by expression of an oncogene. A new field emerged, dedicated to generating and using mouse models of human cancer to address a wide variety of questions in cancer biology. The aim of this review is to highlight the contributions of mouse models to the diagnosis and treatment of human cancers. Because of the breadth of the topic, we have selected representative examples of how GEMMs are clinically relevant rather than provided an exhaustive list of experiments. Today, as detailed here, sophisticated mouse models are being created to study many aspects of cancer biology, including but not limited to mechanisms of sensitivity and resistance to drug treatment, oncogene cooperation, early detection, and metastasis. Alternatives to GEMMs, such as chemically induced or spontaneous tumor models, are not discussed in this review. PMID:21263096

  7. 46 CFR 128.440 - Bilge systems.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Bilge systems. 128.440 Section 128.440 Shipping COAST... AND SYSTEMS Design Requirements for Specific Systems § 128.440 Bilge systems. (a) Except as provided by this section, each bilge system must comply with §§ 56.50-50 and 56.50-55 of this chapter. (b) If...

  8. 46 CFR 128.440 - Bilge systems.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Bilge systems. 128.440 Section 128.440 Shipping COAST... AND SYSTEMS Design Requirements for Specific Systems § 128.440 Bilge systems. (a) Except as provided by this section, each bilge system must comply with §§ 56.50-50 and 56.50-55 of this chapter. (b) If...

  9. Genetics of SLE: evidence from mouse models.

    PubMed

    Morel, Laurence

    2010-06-01

    Great progress has been made in the field of lupus genetics in the past few years, notably with the publication of genome-wide association studies in humans and the identification of susceptibility genes (including Fcgr2b, Ly108, Kallikrein genes and Coronin-1A) in mouse models of spontaneous lupus. This influx of new information has revealed an ever-increasing interdependence between the mouse and human systems for unraveling the genetic basis of lupus susceptibility. Studies in the 1980s and 1990s established that mice prone to spontaneous lupus constitute excellent models of the genetic architecture of human systemic lupus erythematosus (SLE). This notion has been greatly strengthened by the convergence of the functional pathways that are defective in both human and murine lupus. Within these pathways, variants in a number of genes have now been shown to be directly associated with lupus in both species. Consequently, mouse models will continue to serve a pre-eminent role in lupus genetics research, with an increased emphasis on mechanistic and molecular studies of human susceptibility alleles.

  10. Mouse and Guinea Pig Models of Tuberculosis.

    PubMed

    Orme, Ian M; Ordway, Diane J

    2016-08-01

    This article describes the nature of the host response to Mycobacterium tuberculosis in the mouse and guinea pig models of infection. It describes the great wealth of information obtained from the mouse model, reflecting the general availability of immunological reagents, as well as genetic manipulations of the mouse strains themselves. This has led to a good understanding of the nature of the T-cell response to the infection, as well as an appreciation of the complexity of the response involving multiple cytokine- and chemokine-mediated systems. As described here and elsewhere, we have a growing understanding of how multiple CD4-positive T-cell subsets are involved, including regulatory T cells, TH17 cells, as well as the subsequent emergence of effector and central memory T-cell subsets. While, in contrast, our understanding of the host response in the guinea pig model is less advanced, considerable strides have been made in the past decade in terms of defining the basis of the immune response, as well as a better understanding of the immunopathologic process. This model has long been the gold standard for vaccine testing, and more recently is being revisited as a model for testing new drug regimens (bedaquiline being the latest example).

  11. Mouse Models for Down Syndrome-Associated Developmental Cognitive Disabilities

    PubMed Central

    Liu, Chunhong; Belichenko, Pavel V.; Zhang, Li; Fu, Dawei; Kleschevnikov, Alexander M.; Baldini, Antonio; Antonarakis, Stylianos E.; Mobley, William C.; Yu, Y. Eugene

    2011-01-01

    Down syndrome (DS) is mainly caused by the presence of an extra copy of human chromosome 21 (Hsa21) and is a leading genetic cause for developmental cognitive disabilities in humans. The mouse is a premier model organism for DS because the regions on Hsa21 are syntenically conserved with three regions in the mouse genome, which are located on mouse chromosome 10 (Mmu10), Mmu16 and Mmu17. With the advance of chromosomal manipulation technologies, new mouse mutants have been generated to mimic DS at both the genotypic and phenotypic levels. Further mouse-based molecular genetic studies in the future may lead to the unraveling of the mechanisms underlying DS-associated developmental cognitive disabilities, which would lay the groundwork for developing effective treatments for this phenotypic manifestation. In this review, we will discuss recent progress and future challenges in modeling DS-associated developmental cognitive disability in mice with an emphasis on hippocampus-related phenotypes. PMID:21865664

  12. Head Transplantation in Mouse Model.

    PubMed

    Ren, Xiao-Ping; Ye, Yi-Jie; Li, Peng-Wei; Shen, Zi-Long; Han, Ke-Cheng; Song, Yang

    2015-08-01

    The mouse model of allo-head and body reconstruction (AHBR) has recently been established to further the clinical development of this strategy for patients who are suffering from mortal bodily trauma or disease, yet whose mind remains healthy. Animal model studies are indispensable for developing such novel surgical practices. The goal of this work was to establish head transplant mouse model, then the next step through the feasible biological model to investigate immune rejection and brain function in next step, thereby promoting the goal of translation of AHBR to the clinic in the future. Our approach involves retaining adequate blood perfusion in the transplanted head throughout the surgical procedure by establishing donor-to-recipient cross-circulation by cannulating and anastomosing the carotid artery on one side of the body and the jugular vein on the other side. Neurological function was preserved by this strategy as indicated by electroencephalogram and intact cranial nerve reflexes. The results of this study support the feasibility of this method for avoiding brain ischemia during transplantation, thereby allowing for the possibility of long-term studies of head transplantation. © 2015 John Wiley & Sons Ltd.

  13. An Immunocompetent Mouse Model of Zika Virus Infection.

    PubMed

    Gorman, Matthew J; Caine, Elizabeth A; Zaitsev, Konstantin; Begley, Matthew C; Weger-Lucarelli, James; Uccellini, Melissa B; Tripathi, Shashank; Morrison, Juliet; Yount, Boyd L; Dinnon, Kenneth H; Rückert, Claudia; Young, Michael C; Zhu, Zhe; Robertson, Shelly J; McNally, Kristin L; Ye, Jing; Cao, Bin; Mysorekar, Indira U; Ebel, Gregory D; Baric, Ralph S; Best, Sonja M; Artyomov, Maxim N; Garcia-Sastre, Adolfo; Diamond, Michael S

    2018-05-09

    Progress toward understanding Zika virus (ZIKV) pathogenesis is hindered by lack of immunocompetent small animal models, in part because ZIKV fails to effectively antagonize Stat2-dependent interferon (IFN) responses in mice. To address this limitation, we first passaged an African ZIKV strain (ZIKV-Dak-41525) through Rag1 -/- mice to obtain a mouse-adapted virus (ZIKV-Dak-MA) that was more virulent than ZIKV-Dak-41525 in mice treated with an anti-Ifnar1 antibody. A G18R substitution in NS4B was the genetic basis for the increased replication, and resulted in decreased IFN-β production, diminished IFN-stimulated gene expression, and the greater brain infection observed with ZIKV-Dak-MA. To generate a fully immunocompetent mouse model of ZIKV infection, human STAT2 was introduced into the mouse Stat2 locus (hSTAT2 KI). Subcutaneous inoculation of pregnant hSTAT2 KI mice with ZIKV-Dak-MA resulted in spread to the placenta and fetal brain. An immunocompetent mouse model of ZIKV infection may prove valuable for evaluating countermeasures to limit disease. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Mouse models rarely mimic the transcriptome of human neurodegenerative diseases: A systematic bioinformatics-based critique of preclinical models.

    PubMed

    Burns, Terry C; Li, Matthew D; Mehta, Swapnil; Awad, Ahmed J; Morgan, Alexander A

    2015-07-15

    Translational research for neurodegenerative disease depends intimately upon animal models. Unfortunately, promising therapies developed using mouse models mostly fail in clinical trials, highlighting uncertainty about how well mouse models mimic human neurodegenerative disease at the molecular level. We compared the transcriptional signature of neurodegeneration in mouse models of Alzheimer׳s disease (AD), Parkinson׳s disease (PD), Huntington׳s disease (HD) and amyotrophic lateral sclerosis (ALS) to human disease. In contrast to aging, which demonstrated a conserved transcriptome between humans and mice, only 3 of 19 animal models showed significant enrichment for gene sets comprising the most dysregulated up- and down-regulated human genes. Spearman׳s correlation analysis revealed even healthy human aging to be more closely related to human neurodegeneration than any mouse model of AD, PD, ALS or HD. Remarkably, mouse models frequently upregulated stress response genes that were consistently downregulated in human diseases. Among potential alternate models of neurodegeneration, mouse prion disease outperformed all other disease-specific models. Even among the best available animal models, conserved differences between mouse and human transcriptomes were found across multiple animal model versus human disease comparisons, surprisingly, even including aging. Relative to mouse models, mouse disease signatures demonstrated consistent trends toward preserved mitochondrial function protein catabolism, DNA repair responses, and chromatin maintenance. These findings suggest a more complex and multifactorial pathophysiology in human neurodegeneration than is captured through standard animal models, and suggest that even among conserved physiological processes such as aging, mice are less prone to exhibit neurodegeneration-like changes. This work may help explain the poor track record of mouse-based translational therapies for neurodegeneration and provides a path

  15. Germ line transmission of a yeast artificial chromosome spanning the murine [alpha][sub 1](I) collagen locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauss, W.M.; Dausman, J.; Beard, C.

    Molecular complementation of mutant phenotypes by transgenic technology is a potentially important tool for gene identification. A technology was developed to allow the transfer of a physically intact yeast artificial chromosome (YAC) into the germ line of the mouse. A purified 150-kilobase YAC encompassing the murine gene Col1a1 was efficiently introduced into embryonic stem (ES) cells via lipofection. Chimeric founder mice were derived from two transfected ES cell clones. These chimeras transmitted the full length transgene through the germ line, generating two transgenic mouse strains. Transgene expression was visualized as nascent transcripts in interphase nuclei and quantitated by ribonuclease protectionmore » analysis. Both assays indicated that the transgene was expressed at levels comparable to the endogenous collagen gene. 32 refs., 3 figs., 1 tab.« less

  16. Preclinical Mouse Models of Neurofibromatosis

    DTIC Science & Technology

    2004-10-01

    collaborated closely and have shared expertise and reagents extensively. This NF Consortium is a member of the Moue Models of Human Cancer Consortium...of the National Cancer Institute and is participating fully in the activities of the group. The current award will support these collaborative...studies through 2005. 14. SUBJECT TERMS 15. NUMBER OF PAGES Neurofibromatosis, cancer , mouse models 48 16. PRICE CODE 17. SECURITY CLASSIFICATION 78

  17. microRNA-128a dysregulation in transgenic Huntington’s disease monkeys

    PubMed Central

    2014-01-01

    Background Huntington’s Disease (HD) is a progressive neurodegenerative disorder with a single causal mutation in the Huntingtin (HTT) gene. MicroRNAs (miRNAs) have recently been implicated as epigenetic regulators of neurological disorders, however, their role in HD pathogenesis is not well defined. Here we study transgenic HD monkeys (HD monkeys) to examine miRNA dysregulation in a primate model of the disease. Results In this report, 11 miRNAs were found to be significantly associated (P value < 0.05) with HD in the frontal cortex of the HD monkeys. We further focused on one of those candidates, miR-128a, due to the corresponding disruption in humans and mice with HD as well as its intriguing lists of gene targets. miR-128a was downregulated in our HD monkey model by the time of birth. We then confirmed that miR-128a was also downregulated in the brains of pre-symptomatic and post-symptomatic HD patients. Additionally, our studies confirmed a panel of canonical HD signaling genes regulated by miR-128a, including HTT and Huntingtin Interaction Protein 1 (HIP1). Conclusion Our studies found that miR-128a may play a critical role in HD and could be a viable candidate as a therapeutic or biomarker of the disease. PMID:24929669

  18. 14 CFR 1264.128 - Sanctions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Sanctions. 1264.128 Section 1264.128 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION IMPLEMENTATION OF THE PROGRAM FRAUD CIVIL... for admission, the presiding officer may— (1) Draw an inference in favor of the requesting party with...

  19. Chimeric PD-1:28 Receptor Upgrades Low-Avidity T cells and Restores Effector Function of Tumor-Infiltrating Lymphocytes for Adoptive Cell Therapy.

    PubMed

    Schlenker, Ramona; Olguín-Contreras, Luis Felipe; Leisegang, Matthias; Schnappinger, Julia; Disovic, Anja; Rühland, Svenja; Nelson, Peter J; Leonhardt, Heinrich; Harz, Hartmann; Wilde, Susanne; Schendel, Dolores J; Uckert, Wolfgang; Willimsky, Gerald; Noessner, Elfriede

    2017-07-01

    Inherent intermediate- to low-affinity T-cell receptors (TCR) that develop during the natural course of immune responses may not allow sufficient activation for tumor elimination, making the majority of T cells suboptimal for adoptive T-cell therapy (ATT). TCR affinity enhancement has been implemented to provide stronger T-cell activity but carries the risk of creating undesired cross-reactivity leading to potential serious adverse effects in clinical application. We demonstrate here that engineering of low-avidity T cells recognizing a naturally processed and presented tumor-associated antigen with a chimeric PD-1:28 receptor increases effector function to levels seen with high-avidity T cells of identical specificity. Upgrading the function of low-avidity T cells without changing the TCR affinity will allow a large arsenal of low-avidity T cells previously thought to be therapeutically inefficient to be considered for ATT. PD-1:28 engineering reinstated Th1 function in tumor-infiltrating lymphocytes that had been functionally disabled in the human renal cell carcinoma environment without unleashing undesired Th2 cytokines or IL10. Involved mechanisms may be correlated to restoration of ERK and AKT signaling pathways. In mouse tumor models of ATT, PD-1:28 engineering enabled low-avidity T cells to proliferate stronger and prevented PD-L1 upregulation and Th2 polarization in the tumor milieu. Engineered T cells combined with checkpoint blockade secreted significantly more IFNγ compared with T cells without PD-1:28, suggesting a beneficial combination with checkpoint blockade therapy or other therapeutic strategies. Altogether, the supportive effects of PD-1:28 engineering on T-cell function make it an attractive tool for ATT. Cancer Res; 77(13); 3577-90. ©2017 AACR . ©2017 American Association for Cancer Research.

  20. 22 CFR 128.6 - Discovery.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...

  1. 22 CFR 128.6 - Discovery.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...

  2. 22 CFR 128.6 - Discovery.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...

  3. 22 CFR 128.6 - Discovery.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...

  4. 22 CFR 128.6 - Discovery.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...

  5. 32 CFR 842.128 - Delegations of authority.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 6 2011-07-01 2011-07-01 false Delegations of authority. 842.128 Section 842.128 National Defense Department of Defense (Continued) DEPARTMENT OF THE AIR FORCE CLAIMS AND LITIGATION ADMINISTRATIVE CLAIMS Nonappropriated Fund Claims § 842.128 Delegations of authority. (a...

  6. 7 CFR 1703.128 - Submission of applications.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Submission of applications. 1703.128 Section 1703.128 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Grant Program § 1703.128 Submission of...

  7. 7 CFR 1703.128 - Submission of applications.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 11 2013-01-01 2013-01-01 false Submission of applications. 1703.128 Section 1703.128 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Grant Program § 1703.128 Submission of...

  8. 7 CFR 1703.128 - Submission of applications.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 11 2014-01-01 2014-01-01 false Submission of applications. 1703.128 Section 1703.128 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Grant Program § 1703.128 Submission of...

  9. 7 CFR 1703.128 - Submission of applications.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 11 2011-01-01 2011-01-01 false Submission of applications. 1703.128 Section 1703.128 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Grant Program § 1703.128 Submission of...

  10. 7 CFR 1703.128 - Submission of applications.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 11 2012-01-01 2012-01-01 false Submission of applications. 1703.128 Section 1703.128 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Grant Program § 1703.128 Submission of...

  11. 7 CFR 800.128 - Conflicts of interest.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Conflicts of interest. 800.128 Section 800.128 Agriculture Regulations of the Department of Agriculture (Continued) GRAIN INSPECTION, PACKERS AND STOCKYARD... Reinspection Services and Review of Weighing Services § 800.128 Conflicts of interest. Official personnel...

  12. 29 CFR 452.128 - Under-strength representation.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Under-strength representation. 452.128 Section 452.128 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR... AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.128 Under-strength...

  13. 29 CFR 452.128 - Under-strength representation.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 2 2011-07-01 2011-07-01 false Under-strength representation. 452.128 Section 452.128 Labor Regulations Relating to Labor OFFICE OF LABOR-MANAGEMENT STANDARDS, DEPARTMENT OF LABOR LABOR... AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.128 Under-strength...

  14. Practical use of advanced mouse models for lung cancer.

    PubMed

    Safari, Roghaiyeh; Meuwissen, Ralph

    2015-01-01

    To date a variety of non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) mouse models have been developed that mimic human lung cancer. Chemically induced or spontaneous lung cancer in susceptible inbred strains has been widely used, but the more recent genetically engineered somatic mouse models recapitulate much better the genotype-phenotype correlations found in human lung cancer. Additionally, improved orthotopic transplantation of primary human cancer tissue fragments or cells into lungs of immune-compromised mice can be valuable tools for preclinical research such as antitumor drug tests. Here we give a short overview of most somatic mouse models for lung cancer that are currently in use. We accompany each different model with a description of its practical use and application for all major lung tumor types, as well as the intratracheal injection or direct injection of fresh or freeze-thawed tumor cells or tumor cell lines into lung parenchyma of recipient mice. All here presented somatic mouse models are based on the ability to (in) activate specific alleles at a time, and in a tissue-specific cell type, of choice. This spatial-temporal controlled induction of genetic lesions allows the selective introduction of main genetic lesions in an adult mouse lung as found in human lung cancer. The resulting conditional somatic mouse models can be used as versatile powerful tools in basic lung cancer research and preclinical translational studies alike. These distinctively advanced lung cancer models permit us to investigate initiation (cell of origin) and progression of lung cancer, along with response and resistance to drug therapy. Cre/lox or FLP/frt recombinase-mediated methods are now well-used techniques to develop tissue-restricted lung cancer in mice with tumor-suppressor gene and/or oncogene (in)activation. Intranasal or intratracheal administration of engineered adenovirus-Cre or lentivirus-Cre has been optimized for introducing Cre

  15. 31 CFR 128.23 - Special survey reports.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Special survey reports. 128.23... § 128.23 Special survey reports. The Secretary may prescribe special survey reports with respect to.... Notice of special survey reports will be published in accordance with § 128.1(c). ...

  16. 31 CFR 33.128 - Periodic evaluation requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Periodic evaluation requirements. 33.128 Section 33.128 Money and Finance: Treasury Office of the Secretary of the Treasury WAIVERS FOR STATE INNOVATION § 33.128 Periodic evaluation requirements. (a) The Secretary and the Secretary of...

  17. 31 CFR 33.128 - Periodic evaluation requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Periodic evaluation requirements. 33.128 Section 33.128 Money and Finance: Treasury Office of the Secretary of the Treasury WAIVERS FOR STATE INNOVATION § 33.128 Periodic evaluation requirements. (a) The Secretary and the Secretary of...

  18. 31 CFR 33.128 - Periodic evaluation requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Periodic evaluation requirements. 33.128 Section 33.128 Money and Finance: Treasury Office of the Secretary of the Treasury WAIVERS FOR STATE INNOVATION § 33.128 Periodic evaluation requirements. (a) The Secretary and the Secretary of...

  19. 34 CFR 300.125-300.128 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 34 Education 2 2012-07-01 2012-07-01 false [Reserved] 300.125-300.128 Section 300.125-300.128 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION... CHILDREN WITH DISABILITIES State Eligibility Additional Eligibility Requirements §§ 300.125-300.128...

  20. 34 CFR 300.125-300.128 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 34 Education 2 2014-07-01 2013-07-01 true [Reserved] 300.125-300.128 Section 300.125-300.128 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION... CHILDREN WITH DISABILITIES State Eligibility Additional Eligibility Requirements §§ 300.125-300.128...

  1. 34 CFR 300.125-300.128 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 34 Education 2 2013-07-01 2013-07-01 false [Reserved] 300.125-300.128 Section 300.125-300.128 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION... CHILDREN WITH DISABILITIES State Eligibility Additional Eligibility Requirements §§ 300.125-300.128...

  2. 9 CFR 354.128 - Certification of carcasses.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Certification of carcasses. 354.128 Section 354.128 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Inspection § 354.128 Certification of carcasses. Each carcass and all parts and organs thereof which are...

  3. 27 CFR 71.128 - What constitutes record.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2014-04-01 2014-04-01 false What constitutes record. 71.128 Section 71.128 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Miscellaneous Record § 71.128 What constitutes record. The transcript of testimony, pleadings and exhibits, all...

  4. 27 CFR 71.128 - What constitutes record.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false What constitutes record. 71.128 Section 71.128 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Miscellaneous Record § 71.128 What constitutes record. The transcript of testimony, pleadings and exhibits, all...

  5. 31 CFR 128.13 - Special survey reports.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Special survey reports. 128.13... Transactions and Positions § 128.13 Special survey reports. The Secretary may prescribe special survey reports... respect to such data. Notice of special survey reports will be published in accordance with § 128.1(c). ...

  6. 29 CFR 570.128 - Good faith defense.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Good faith defense. 570.128 Section 570.128 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION, DEPARTMENT OF LABOR REGULATIONS CHILD LABOR... Provisions of the Fair Labor Standards Act of 1938, as Amended Enforcement § 570.128 Good faith defense. Link...

  7. 22 CFR 128.2 - Administrative Law Judge.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Administrative Law Judge. 128.2 Section 128.2... § 128.2 Administrative Law Judge. The Administrative Law Judge referred to in this part is an Administrative Law Judge appointed by the Department of State. The Administrative Law Judge is authorized to...

  8. 22 CFR 128.2 - Administrative Law Judge.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Administrative Law Judge. 128.2 Section 128.2... § 128.2 Administrative Law Judge. The Administrative Law Judge referred to in this part is an Administrative Law Judge appointed by the Department of State. The Administrative Law Judge is authorized to...

  9. 29 CFR 1917.128 - Signs and marking.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Signs and marking. 1917.128 Section 1917.128 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR (CONTINUED) MARINE TERMINALS Terminal Facilities § 1917.128 Signs and marking. (a) General. Signs required by this part shall be clearly worded and...

  10. 46 CFR 128.450 - Liquid-mud systems.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Liquid-mud systems. 128.450 Section 128.450 Shipping...: EQUIPMENT AND SYSTEMS Design Requirements for Specific Systems § 128.450 Liquid-mud systems. (a) Liquid-mud... this chapter. (b) Tanks for oil-based liquid mud must be fitted with tank vents equipped with flame...

  11. A candidate model for Angelman syndrome in the mouse.

    PubMed

    Cattanach, B M; Barr, J A; Beechey, C V; Martin, J; Noebels, J; Jones, J

    1997-07-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are well-recognized examples of imprinting in humans. They occur most commonly with paternal and maternal 15q11-13 deletions, but also with maternal and paternal disomy. Both syndromes have also occurred more rarely in association with smaller deletions seemingly causing abnormal imprinting. A putative mouse model of PWS, occurring with maternal duplication (partial maternal disomy) for the homologous region, has been described in a previous paper but, although a second imprinting effect that could have provided a mouse model of AS was found, it appeared to be associated with a slightly different region of the chromosome. Here, we provide evidence that the same region is in fact involved and further demonstrate that animals with paternal duplication for the region exhibit characteristics of AS patients. A mouse model of AS is, therefore, strongly indicated.

  12. A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer.

    PubMed

    Betzler, Alexander M; Kochall, Susan; Blickensdörfer, Linda; Garcia, Sebastian A; Thepkaysone, May-Linn; Nanduri, Lahiri K; Muders, Michael H; Weitz, Jürgen; Reissfelder, Christoph; Schölch, Sebastian

    2017-07-06

    Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired. As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

  13. In vivo quantitative bioluminescence tomography using heterogeneous and homogeneous mouse models.

    PubMed

    Liu, Junting; Wang, Yabin; Qu, Xiaochao; Li, Xiangsi; Ma, Xiaopeng; Han, Runqiang; Hu, Zhenhua; Chen, Xueli; Sun, Dongdong; Zhang, Rongqing; Chen, Duofang; Chen, Dan; Chen, Xiaoyuan; Liang, Jimin; Cao, Feng; Tian, Jie

    2010-06-07

    Bioluminescence tomography (BLT) is a new optical molecular imaging modality, which can monitor both physiological and pathological processes by using bioluminescent light-emitting probes in small living animal. Especially, this technology possesses great potential in drug development, early detection, and therapy monitoring in preclinical settings. In the present study, we developed a dual modality BLT prototype system with Micro-computed tomography (MicroCT) registration approach, and improved the quantitative reconstruction algorithm based on adaptive hp finite element method (hp-FEM). Detailed comparisons of source reconstruction between the heterogeneous and homogeneous mouse models were performed. The models include mice with implanted luminescence source and tumor-bearing mice with firefly luciferase report gene. Our data suggest that the reconstruction based on heterogeneous mouse model is more accurate in localization and quantification than the homogeneous mouse model with appropriate optical parameters and that BLT allows super-early tumor detection in vivo based on tomographic reconstruction of heterogeneous mouse model signal.

  14. Current State of Animal (Mouse) Modeling in Melanoma Research.

    PubMed

    Kuzu, Omer F; Nguyen, Felix D; Noory, Mohammad A; Sharma, Arati

    2015-01-01

    Despite the considerable progress in understanding the biology of human cancer and technological advancement in drug discovery, treatment failure remains an inevitable outcome for most cancer patients with advanced diseases, including melanoma. Despite FDA-approved BRAF-targeted therapies for advanced stage melanoma showed a great deal of promise, development of rapid resistance limits the success. Hence, the overall success rate of melanoma therapy still remains to be one of the worst compared to other malignancies. Advancement of next-generation sequencing technology allowed better identification of alterations that trigger melanoma development. As development of successful therapies strongly depends on clinically relevant preclinical models, together with the new findings, more advanced melanoma models have been generated. In this article, besides traditional mouse models of melanoma, we will discuss recent ones, such as patient-derived tumor xenografts, topically inducible BRAF mouse model and RCAS/TVA-based model, and their advantages as well as limitations. Although mouse models of melanoma are often criticized as poor predictors of whether an experimental drug would be an effective treatment, development of new and more relevant models could circumvent this problem in the near future.

  15. A unified model of the excitability of mouse sensory and motor axons.

    PubMed

    Makker, Preet G S; Matamala, José Manuel; Park, Susanna B; Lees, Justin G; Kiernan, Matthew C; Burke, David; Moalem-Taylor, Gila; Howells, James

    2018-06-19

    Non-invasive nerve excitability techniques have provided valuable insight into the understanding of neurological disorders. The widespread use of mice in translational research on peripheral nerve disorders and by pharmaceutical companies during drug development requires valid and reliable models that can be compared to humans. This study established a novel experimental protocol that enables comparative assessment of the excitability properties of motor and sensory axons at the same site in mouse caudal nerve, compared the mouse data to data for motor and sensory axons in human median nerve at the wrist, and constructed a mathematical model of the excitability of mouse axons. In a separate study, ischaemia was employed as an experimental manoeuvre to test the translational utility of this preparation. The patterns of mouse sensory and motor excitability were qualitatively similar to human studies under normal and ischaemic conditions. The most conspicuous differences between mouse and human studies were observed in the recovery cycle and the response to hyperpolarization. Modelling showed that an increase in temperature in mouse axons could account for most of the differences in the recovery cycle. The modelling also suggested a larger hyperpolarization-activated conductance in mouse axons. The kinetics of this conductance appeared to be much slower raising the possibility that an additional or different hyperpolarization-activated cyclic-nucleotide gated (HCN) channel isoform underlies the accommodation to hyperpolarization in mouse axons. Given a possible difference in HCN isoforms, caution should be exercised in extrapolating from studies of mouse motor and sensory axons to human nerve disorders. This article is protected by copyright. All rights reserved.

  16. STS-128 crew visits Stennis

    NASA Technical Reports Server (NTRS)

    2009-01-01

    Astronauts C.J. Sturckow (seated, left) and Pat Forrester (seated, right) sign autographs during their Oct. 7 visit to Stennis Space Center. The astronauts visited the rocket engine testing facility to thank Stennis employees for contributions to their recent STS-128 space shuttle mission. All three of the main engines used on the mission were tested at Stennis. Sturckow served as commander for the STS-128 flight; Forrester was a mission specialist. During a 14-day mission aboard space shuttle discovery, the STS-128 crew delivered equipment and supplies to the International Space Station, including science and storage racks, a freezer to store research samples, a new sleeping compartment and an exercise treadmill. The mission featured three spacewalks to replace experiments and install new equipment at the space station.

  17. Mouse-based genetic modeling and analysis of Down syndrome

    PubMed Central

    Xing, Zhuo; Li, Yichen; Pao, Annie; Bennett, Abigail S.; Tycko, Benjamin; Mobley, William C.; Yu, Y. Eugene

    2016-01-01

    Introduction Down syndrome (DS), caused by human trisomy 21 (Ts21), can be considered as a prototypical model for understanding the effects of chromosomal aneuploidies in other diseases. Human chromosome 21 (Hsa21) is syntenically conserved with three regions in the mouse genome. Sources of data A review of recent advances in genetic modeling and analysis of DS. Using Cre/loxP-mediated chromosome engineering, a substantial number of new mouse models of DS have recently been generated, which facilitates better understanding of disease mechanisms in DS. Areas of agreement Based on evolutionary conservation, Ts21 can be modeled by engineered triplication of Hsa21 syntenic regions in mice. The validity of the models is supported by the exhibition of DS-related phenotypes. Areas of controversy Although substantial progress has been made, it remains a challenge to unravel the relative importance of specific candidate genes and molecular mechanisms underlying the various clinical phenotypes. Growing points Further understanding of mechanisms based on data from mouse models, in parallel with human studies, may lead to novel therapies for clinical manifestations of Ts21 and insights to the roles of aneuploidies in other developmental disorders and cancers. PMID:27789459

  18. The clinical implications of mouse models of enhanced anxiety

    PubMed Central

    Sartori, Simone B; Landgraf, Rainer; Singewald, Nicolas

    2011-01-01

    Mice are increasingly overtaking the rat model organism in important aspects of anxiety research, including drug development. However, translating the results obtained in mouse studies into information that can be applied in clinics remains challenging. One reason may be that most of the studies so far have used animals displaying ‘normal’ anxiety rather than ‘psychopathological’ animal models with abnormal (elevated) anxiety, which more closely reflect core features and sensitivities to therapeutic interventions of human anxiety disorders, and which would, thus, narrow the translational gap. Here, we discuss manipulations aimed at persistently enhancing anxiety-related behavior in the laboratory mouse using phenotypic selection, genetic techniques and/or environmental manipulations. It is hoped that such models with enhanced construct validity will provide improved ways of studying the neurobiology and treatment of pathological anxiety. Examples of findings from mouse models of enhanced anxiety-related behavior will be discussed, as well as their relation to findings in anxiety disorder patients regarding neuroanatomy, neurobiology, genetic involvement and epigenetic modifications. Finally, we highlight novel targets for potential anxiolytic pharmacotherapeutics that have been established with the help of research involving mice. Since the use of psychopathological mouse models is only just beginning to increase, it is still unclear as to the extent to which such approaches will enhance the success rate of drug development in translating identified therapeutic targets into clinical trials and, thus, helping to introduce the next anxiolytic class of drugs. PMID:21901080

  19. 10 CFR 4.128 - New construction.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false New construction. 4.128 Section 4.128 Energy NUCLEAR REGULATORY COMMISSION NONDISCRIMINATION IN FEDERALLY ASSISTED PROGRAMS OR ACTIVITIES RECEIVING FEDERAL... interpreted to exempt from the requirements of UFAS only mechanical rooms and other spaces that, because of...

  20. The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

    PubMed

    Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

    1992-05-01

    Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

  1. Lack of species-specific difference in pulmonary function when using mouse versus human plasma in a mouse model of hemorrhagic shock.

    PubMed

    Peng, Zhanglong; Pati, Shibani; Fontaine, Magali J; Hall, Kelly; Herrera, Anthony V; Kozar, Rosemary A

    2016-11-01

    Clinical studies have demonstrated that the early and empiric use of plasma improves survival after hemorrhagic shock. We have demonstrated in rodent models of hemorrhagic shock that resuscitation with plasma is protective to the lungs compared with lactated Ringer's solution. As our long-term objective is to determine the molecular mechanisms that modulate plasma's protective effects in injured bleeding patients, we have used human plasma in a mouse model of hemorrhagic shock. The goal of the current experiments is to determine if there are significant adverse effects on lung injury when using human versus mouse plasma in an established murine model of hemorrhagic shock and laparotomy. Mice underwent laparotomy and 90 minutes of hemorrhagic shock to a mean arterial pressure (MAP) of 35 ± 5 mm Hg followed by resuscitation at 1× shed blood using either mouse fresh frozen plasma (FFP), human FFP, or human lyophilized plasma. Mean arterial pressure was recorded during shock and for the first 30 minutes of resuscitation. After 3 hours, animals were killed, and lungs collected for analysis. There was a significant increase in early MAP when mouse FFP was used to resuscitate animals compared with human FFP or human lyophilized plasma. However, despite these differences, analysis of the mouse lungs revealed no significant differences in pulmonary histopathology, lung permeability, or lung edema between all three plasma groups. Analysis of neutrophil infiltration in the lungs revealed that mouse FFP decreased neutrophil influx as measured by neutrophil staining; however, myeloperoxidase immunostaining revealed no significant differences in between groups. The study of human plasma in a mouse model of hemorrhagic shock is feasible but does reveal some differences compared with mouse plasma-based resuscitation in physiologic measures such as MAP postresuscitation. Measures of end organ function such as lung injury appear to be comparable in this acute model of hemorrhagic

  2. Humanized mouse models: Application to human diseases.

    PubMed

    Ito, Ryoji; Takahashi, Takeshi; Ito, Mamoru

    2018-05-01

    Humanized mice are superior to rodents for preclinical evaluation of the efficacy and safety of drug candidates using human cells or tissues. During the past decade, humanized mouse technology has been greatly advanced by the establishment of novel platforms of genetically modified immunodeficient mice. Several human diseases can be recapitulated using humanized mice due to the improved engraftment and differentiation capacity of human cells or tissues. In this review, we discuss current advanced humanized mouse models that recapitulate human diseases including cancer, allergy, and graft-versus-host disease. © 2017 Wiley Periodicals, Inc.

  3. 12 CFR 128.4 - Nondiscriminatory advertising.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Nondiscriminatory advertising. 128.4 Section... REQUIREMENTS § 128.4 Nondiscriminatory advertising. No savings association may directly or indirectly engage in any form of advertising that implies or suggests a policy of discrimination or exclusion in violation...

  4. 12 CFR 128.4 - Nondiscriminatory advertising.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Nondiscriminatory advertising. 128.4 Section... REQUIREMENTS § 128.4 Nondiscriminatory advertising. No savings association may directly or indirectly engage in any form of advertising that implies or suggests a policy of discrimination or exclusion in violation...

  5. 12 CFR 128.4 - Nondiscriminatory advertising.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Nondiscriminatory advertising. 128.4 Section... REQUIREMENTS § 128.4 Nondiscriminatory advertising. No savings association may directly or indirectly engage in any form of advertising that implies or suggests a policy of discrimination or exclusion in violation...

  6. Mapping of the locus for autosomal dominant amelogenesis imperfecta (AIH2) to a 4-Mb YAC contig on chromosome 4q11-q21

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaerrman, C.; Holmgren, G.; Forsman, K.

    1997-01-15

    Amelogenesis imperfecta (Al) is a clinically and genetically heterogeneous group of inherited enamel defects. We recently mapped a locus for autosomal dominant local hypoplastic amelogenesis imperfecta (AIH2) to the long arm of chromosome 4. The disease gene was localized to a 17.6-cM region between the markers D4S392 and D4S395. The albumin gene (ALB), located in the same interval, was a candidate gene for autosomal dominant AI (ADAI) since albumin has a potential role in enamel maturation. Here we describe refined mapping of the AIH2 locus and the construction of marker maps by radiation hybrid mapping and yeast artificial chromosome (YAC)-basedmore » sequence tagged site-content mapping. A radiation hybrid map consisting of 11 microsatellite markers in the 5-cM interval between D4S409 and D4S1558 was constructed. Recombinant haplotypes in six Swedish ADAI families suggest that the disease gene is located in the interval between D4S2421 and ALB. ALB is therefore not likely to be the disease-causing gene. Affected members in all six families share the same allele haplotypes, indicating a common ancestral mutation in all families. The AIH2 critical region is less than 4 cM and spans a physical distance of approximately 4 Mb as judged from radiation hybrid maps. A YAC contig over the AIH2 critical region including several potential candidate genes was constructed. 35 refs., 4 figs., 1 tab.« less

  7. A YAC contig spanning the nevoid basal cell carcinoma syndrome, Fanconi anaemia group C, and xeroderma pigmentosum group A loci on chromosome 9q

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, D.J.; Reis, A.

    1994-09-01

    Nevoid basal cell carcinoma syndrome (NBCCS, Gorlin syndrome) is an autosomal dominant disorder, characterized primarily by multiple basal cell carcinomas, epithelium-lined jaw cysts, and palmar and plantar pits, as well as various other features. Loss of heterozygosity studies and linkage analysis have mapped the NBCCS gene to chromosome 9q and suggested that it is a tumor suppressor. The apparent sensitivity of NBCCS patients to UV and X-irradiation raises the possibility of hypersensitivity to DNA-damaging reagents or defective DNA repair being etiological in the disorder. The recent mapping of the Fanconi anaemia group C (FACC) and xeroderma pigmentosum complementing group Amore » (XPAC) genes to the same region on 9q has led us to begin the molecular dissection of the 9q22-q31 region. PCR analysis of the presence or absence of 10 microsatellite markers and exons 3 and 4 of the XPAC and FACC genes, respectively, allowed us to order 12 YACs into an overlapping contig and to order the markers as follows: D9S151/D9S12P1-D9S12P2-D9S197-D9S196-D9S280-FACC-D9S287/XPAC-D9S180-D9S6-D9S176. Sizing of the YACs has provided an initial estimate of the size of the NBCCS candidate region between D9S12 and D9S180 to be less than 1.65 Mb. 45 refs., 1 fig., 1 tab.« less

  8. Mouse Genome Database: From sequence to phenotypes and disease models

    PubMed Central

    Richardson, Joel E.; Kadin, James A.; Smith, Cynthia L.; Blake, Judith A.; Bult, Carol J.

    2015-01-01

    Summary The Mouse Genome Database (MGD, www.informatics.jax.org) is the international scientific database for genetic, genomic, and biological data on the laboratory mouse to support the research requirements of the biomedical community. To accomplish this goal, MGD provides broad data coverage, serves as the authoritative standard for mouse nomenclature for genes, mutants, and strains, and curates and integrates many types of data from literature and electronic sources. Among the key data sets MGD supports are: the complete catalog of mouse genes and genome features, comparative homology data for mouse and vertebrate genes, the authoritative set of Gene Ontology (GO) annotations for mouse gene functions, a comprehensive catalog of mouse mutations and their phenotypes, and a curated compendium of mouse models of human diseases. Here, we describe the data acquisition process, specifics about MGD's key data areas, methods to access and query MGD data, and outreach and user help facilities. genesis 53:458–473, 2015. © 2015 The Authors. Genesis Published by Wiley Periodicals, Inc. PMID:26150326

  9. 7 CFR 762.128 - Environmental and special laws.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Environmental and special laws. 762.128 Section 762.128 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS GUARANTEED FARM LOANS § 762.128 Environmental and special laws. (a...

  10. 23 CFR 1.28 - Diversion of highway revenues.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 23 Highways 1 2012-04-01 2012-04-01 false Diversion of highway revenues. 1.28 Section 1.28 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL MANAGEMENT AND ADMINISTRATION GENERAL § 1.28 Diversion of highway revenues. (a) Reduction in apportionment. If the Secretary shall find...

  11. 9 CFR 3.128 - Space requirements.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Space requirements. 3.128 Section 3... Mammals Facilities and Operating Standards § 3.128 Space requirements. Enclosures shall be constructed and maintained so as to provide sufficient space to allow each animal to make normal postural and social...

  12. 9 CFR 3.128 - Space requirements.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Space requirements. 3.128 Section 3... Mammals Facilities and Operating Standards § 3.128 Space requirements. Enclosures shall be constructed and maintained so as to provide sufficient space to allow each animal to make normal postural and social...

  13. 9 CFR 3.128 - Space requirements.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Space requirements. 3.128 Section 3... Mammals Facilities and Operating Standards § 3.128 Space requirements. Enclosures shall be constructed and maintained so as to provide sufficient space to allow each animal to make normal postural and social...

  14. 9 CFR 3.128 - Space requirements.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Space requirements. 3.128 Section 3... Mammals Facilities and Operating Standards § 3.128 Space requirements. Enclosures shall be constructed and maintained so as to provide sufficient space to allow each animal to make normal postural and social...

  15. 9 CFR 3.128 - Space requirements.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Space requirements. 3.128 Section 3... Mammals Facilities and Operating Standards § 3.128 Space requirements. Enclosures shall be constructed and maintained so as to provide sufficient space to allow each animal to make normal postural and social...

  16. 27 CFR 21.128 - Sodium (metallic).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Sodium (metallic). 21.128....128 Sodium (metallic). (a) Color. Silvery-white (metallic luster) when freshly cut. (b) Identification... it into the sample. Hold the wire in the Bunsen flame and note the color. Sodium produces a golden...

  17. 27 CFR 21.128 - Sodium (metallic).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Sodium (metallic). 21.128....128 Sodium (metallic). (a) Color. Silvery-white (metallic luster) when freshly cut. (b) Identification... it into the sample. Hold the wire in the Bunsen flame and note the color. Sodium produces a golden...

  18. 27 CFR 21.128 - Sodium (metallic).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Sodium (metallic). 21.128....128 Sodium (metallic). (a) Color. Silvery-white (metallic luster) when freshly cut. (b) Identification... it into the sample. Hold the wire in the Bunsen flame and note the color. Sodium produces a golden...

  19. 27 CFR 21.128 - Sodium (metallic).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Sodium (metallic). 21.128....128 Sodium (metallic). (a) Color. Silvery-white (metallic luster) when freshly cut. (b) Identification... it into the sample. Hold the wire in the Bunsen flame and note the color. Sodium produces a golden...

  20. 27 CFR 21.128 - Sodium (metallic).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Sodium (metallic). 21.128....128 Sodium (metallic). (a) Color. Silvery-white (metallic luster) when freshly cut. (b) Identification... it into the sample. Hold the wire in the Bunsen flame and note the color. Sodium produces a golden...

  1. Defining the role of polyamines in colon carcinogenesis using mouse models

    PubMed Central

    Ignatenko, Natalia A.; Gerner, Eugene W.; Besselsen, David G.

    2011-01-01

    Genetics and diet are both considered important risk determinants for colorectal cancer, a leading cause of death in the US and worldwide. Genetically engineered mouse (GEM) models have made a significant contribution to the characterization of colorectal cancer risk factors. Reliable, reproducible, and clinically relevant animal models help in the identification of the molecular events associated with disease progression and in the development of effictive treatment strategies. This review is focused on the use of mouse models for studying the role of polyamines in colon carcinogenesis. We describe how the available mouse models of colon cancer such as the multiple intestinal neoplasia (Min) mice and knockout genetic models facilitate understanding of the role of polyamines in colon carcinogenesis and help in the development of a rational strategy for colon cancer chemoprevention. PMID:21712957

  2. 41 CFR 128-1.8005 - Seismic safety standards.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Seismic safety standards. 128-1.8005 Section 128-1.8005 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8005...

  3. 41 CFR 128-1.105 - Authority for JPMR.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Authority for JPMR. 128-1.105 Section 128-1.105 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.105...

  4. 41 CFR 128-1.8002 - Definitions of terms.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Definitions of terms. 128-1.8002 Section 128-1.8002 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8002...

  5. 41 CFR 128-1.5001 - Scope of subpart.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Scope of subpart. 128-1.5001 Section 128-1.5001 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5001 Scope of subpart. This subpart sets forth general definitions of...

  6. 41 CFR 128-1.5001 - Scope of subpart.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Scope of subpart. 128-1.5001 Section 128-1.5001 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5001 Scope of subpart. This subpart sets forth general definitions of...

  7. 9 CFR 2.128 - Inspection for missing animals.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 9 Animals and Animal Products 1 2013-01-01 2013-01-01 false Inspection for missing animals. 2.128 Section 2.128 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.128 Inspection for missing animals. Each dealer...

  8. 9 CFR 2.128 - Inspection for missing animals.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 9 Animals and Animal Products 1 2011-01-01 2011-01-01 false Inspection for missing animals. 2.128 Section 2.128 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.128 Inspection for missing animals. Each dealer...

  9. 9 CFR 2.128 - Inspection for missing animals.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Inspection for missing animals. 2.128 Section 2.128 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.128 Inspection for missing animals. Each dealer...

  10. 9 CFR 2.128 - Inspection for missing animals.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 9 Animals and Animal Products 1 2014-01-01 2014-01-01 false Inspection for missing animals. 2.128 Section 2.128 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.128 Inspection for missing animals. Each dealer...

  11. 9 CFR 2.128 - Inspection for missing animals.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 9 Animals and Animal Products 1 2012-01-01 2012-01-01 false Inspection for missing animals. 2.128 Section 2.128 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.128 Inspection for missing animals. Each dealer...

  12. Human mammary microenvironment better regulates the biology of human breast cancer in humanized mouse model.

    PubMed

    Zheng, Ming-Jie; Wang, Jue; Xu, Lu; Zha, Xiao-Ming; Zhao, Yi; Ling, Li-Jun; Wang, Shui

    2015-02-01

    During the past decades, many efforts have been made in mimicking the clinical progress of human cancer in mouse models. Previously, we developed a human breast tissue-derived (HB) mouse model. Theoretically, it may mimic the interactions between "species-specific" mammary microenvironment of human origin and human breast cancer cells. However, detailed evidences are absent. The present study (in vivo, cellular, and molecular experiments) was designed to explore the regulatory role of human mammary microenvironment in the progress of human breast cancer cells. Subcutaneous (SUB), mammary fat pad (MFP), and HB mouse models were developed for in vivo comparisons. Then, the orthotopic tumor masses from three different mouse models were collected for primary culture. Finally, the biology of primary cultured human breast cancer cells was compared by cellular and molecular experiments. Results of in vivo mouse models indicated that human breast cancer cells grew better in human mammary microenvironment. Cellular and molecular experiments confirmed that primary cultured human breast cancer cells from HB mouse model showed a better proliferative and anti-apoptotic biology than those from SUB to MFP mouse models. Meanwhile, primary cultured human breast cancer cells from HB mouse model also obtained the migratory and invasive biology for "species-specific" tissue metastasis to human tissues. Comprehensive analyses suggest that "species-specific" mammary microenvironment of human origin better regulates the biology of human breast cancer cells in our humanized mouse model of breast cancer, which is more consistent with the clinical progress of human breast cancer.

  13. 41 CFR 128-1.5002-5 - Personal property.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Personal property. 128-1.5002-5 Section 128-1.5002-5 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5002-5 Personal property. Property of any kind or interest therein...

  14. 41 CFR 128-1.5002-5 - Personal property.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Personal property. 128-1.5002-5 Section 128-1.5002-5 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5002-5 Personal property. Property of any kind or interest therein...

  15. 41 CFR 128-1.5002-5 - Personal property.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Personal property. 128-1.5002-5 Section 128-1.5002-5 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5002-5 Personal property. Property of any kind or interest therein...

  16. 41 CFR 128-1.5002-5 - Personal property.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Personal property. 128-1.5002-5 Section 128-1.5002-5 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5002-5 Personal property. Property of any kind or interest therein...

  17. 41 CFR 128-1.5002-5 - Personal property.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Personal property. 128-1.5002-5 Section 128-1.5002-5 Public Contracts and Property Management Federal Property Management... Personal Property Management § 128-1.5002-5 Personal property. Property of any kind or interest therein...

  18. A 128 x 128 CMOS Active Pixel Image Sensor for Highly Integrated Imaging Systems

    NASA Technical Reports Server (NTRS)

    Mendis, Sunetra K.; Kemeny, Sabrina E.; Fossum, Eric R.

    1993-01-01

    A new CMOS-based image sensor that is intrinsically compatible with on-chip CMOS circuitry is reported. The new CMOS active pixel image sensor achieves low noise, high sensitivity, X-Y addressability, and has simple timing requirements. The image sensor was fabricated using a 2 micrometer p-well CMOS process, and consists of a 128 x 128 array of 40 micrometer x 40 micrometer pixels. The CMOS image sensor technology enables highly integrated smart image sensors, and makes the design, incorporation and fabrication of such sensors widely accessible to the integrated circuit community.

  19. Establishment of a patient-derived orthotopic osteosarcoma mouse model.

    PubMed

    Blattmann, Claudia; Thiemann, Markus; Stenzinger, Albrecht; Roth, Eva K; Dittmar, Anne; Witt, Hendrik; Lehner, Burkhard; Renker, Eva; Jugold, Manfred; Eichwald, Viktoria; Weichert, Wilko; Huber, Peter E; Kulozik, Andreas E

    2015-04-30

    Osteosarcoma (OS) is the most common pediatric primary malignant bone tumor. As the prognosis for patients following standard treatment did not improve for almost three decades, functional preclinical models that closely reflect important clinical cancer characteristics are urgently needed to develop and evaluate new treatment strategies. The objective of this study was to establish an orthotopic xenotransplanted mouse model using patient-derived tumor tissue. Fresh tumor tissue from an adolescent female patient with osteosarcoma after relapse was surgically xenografted into the right tibia of 6 immunodeficient BALB/c Nu/Nu mice as well as cultured into medium. Tumor growth was serially assessed by palpation and with magnetic resonance imaging (MRI). In parallel, a primary cell line of the same tumor was established. Histology and high-resolution array-based comparative genomic hybridization (aCGH) were used to investigate both phenotypic and genotypic characteristics of different passages of human xenografts and the cell line compared to the tissue of origin. A primary OS cell line and a primary patient-derived orthotopic xenotranplanted mouse model were established. MRI analyses and histopathology demonstrated an identical architecture in the primary tumor and in the xenografts. Array-CGH analyses of the cell line and all xenografts showed highly comparable patterns of genomic progression. So far, three further primary patient-derived orthotopic xenotranplanted mouse models could be established. We report the first orthotopic OS mouse model generated by transplantation of tumor fragments directly harvested from the patient. This model represents the morphologic and genomic identity of the primary tumor and provides a preclinical platform to evaluate new treatment strategies in OS.

  20. Mouse Models as Predictors of Human Responses: Evolutionary Medicine.

    PubMed

    Uhl, Elizabeth W; Warner, Natalie J

    Mice offer a number of advantages and are extensively used to model human diseases and drug responses. Selective breeding and genetic manipulation of mice have made many different genotypes and phenotypes available for research. However, in many cases, mouse models have failed to be predictive. Important sources of the prediction problem have been the failure to consider the evolutionary basis for species differences, especially in drug metabolism, and disease definitions that do not reflect the complexity of gene expression underlying disease phenotypes. Incorporating evolutionary insights into mouse models allow for unique opportunities to characterize the effects of diet, different gene expression profiles, and microbiomics underlying human drug responses and disease phenotypes.

  1. Mouse models for gastric cancer: Matching models to biological questions

    PubMed Central

    Poh, Ashleigh R; O'Donoghue, Robert J J

    2016-01-01

    Abstract Gastric cancer is the third leading cause of cancer‐related mortality worldwide. This is in part due to the asymptomatic nature of the disease, which often results in late‐stage diagnosis, at which point there are limited treatment options. Even when treated successfully, gastric cancer patients have a high risk of tumor recurrence and acquired drug resistance. It is vital to gain a better understanding of the molecular mechanisms underlying gastric cancer pathogenesis to facilitate the design of new‐targeted therapies that may improve patient survival. A number of chemically and genetically engineered mouse models of gastric cancer have provided significant insight into the contribution of genetic and environmental factors to disease onset and progression. This review outlines the strengths and limitations of current mouse models of gastric cancer and their relevance to the pre‐clinical development of new therapeutics. PMID:26809278

  2. 12 CFR 128.5 - Equal Housing Lender Poster.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Equal Housing Lender Poster. 128.5 Section 128... REQUIREMENTS § 128.5 Equal Housing Lender Poster. (a) Each savings association shall post and maintain one or more Equal Housing Lender Posters, the text of which is prescribed in paragraph (b) of this section, in...

  3. 12 CFR 128.5 - Equal Housing Lender Poster.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Equal Housing Lender Poster. 128.5 Section 128... REQUIREMENTS § 128.5 Equal Housing Lender Poster. (a) Each savings association shall post and maintain one or more Equal Housing Lender Posters, the text of which is prescribed in paragraph (b) of this section, in...

  4. 12 CFR 128.5 - Equal Housing Lender Poster.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Equal Housing Lender Poster. 128.5 Section 128... REQUIREMENTS § 128.5 Equal Housing Lender Poster. (a) Each savings association shall post and maintain one or more Equal Housing Lender Posters, the text of which is prescribed in paragraph (b) of this section, in...

  5. Histologic scoring of gastritis and gastric cancer in mouse models.

    PubMed

    Rogers, Arlin B

    2012-01-01

    Histopathology is a defining endpoint in mouse models of experimental gastritis and gastric adenocarcinoma. Presented here is an overview of the histology of gastritis and gastric cancer in mice experimentally infected with Helicobacter pylori or H. felis. A modular histopathologic scoring scheme is provided that incorporates relevant disease-associated changes. Whereas the guide uses Helicobacter infection as the prototype challenge, features may be applied to chemical and genetically engineered mouse models of stomach cancer as well. Specific criteria included in the combined gastric histologic activity index (HAI) include inflammation, epithelial defects, oxyntic atrophy, hyperplasia, pseudopyloric metaplasia, and dysplasia or neoplasia. Representative photomicrographs accompany descriptions for each lesion grade. Differentiation of genuine tumor invasion from pseudoinvasion is highlighted. A brief comparison of normal rodent versus human stomach anatomy and physiology is accompanied by an introduction to mouse-specific lesions including mucous metaplasia and eosinophilic droplets (hyalinosis). In conjunction with qualified pathology support, this guide is intended to assist research scientists, postdoctoral fellows, graduate students, and medical professionals from affiliated disciplines in the interpretation and histologic grading of chronic gastritis and gastric carcinoma in mouse models.

  6. Stellar and Planetary Characterization of the Ross 128 Exoplanetary System from APOGEE Spectra

    NASA Astrophysics Data System (ADS)

    Souto, Diogo; Unterborn, Cayman T.; Smith, Verne V.; Cunha, Katia; Teske, Johanna; Covey, Kevin; Rojas-Ayala, Bárbara; García-Hernández, D. A.; Stassun, Keivan; Zamora, Olga; Masseron, Thomas; Johnson, J. A.; Majewski, Steven R.; Jönsson, Henrik; Gilhool, Steven; Blake, Cullen; Santana, Felipe

    2018-06-01

    The first detailed chemical abundance analysis of the M-dwarf (M4.0) exoplanet-hosting star Ross 128 is presented here, based upon near-infrared (1.5–1.7 μm), high-resolution (R ∼ 22,500) spectra from the SDSS Apache Point Galactic Evolution Experiment survey. We determined precise atmospheric parameters T eff = 3231 ± 100 K, log g = 4.96 ± 0.11 dex and chemical abundances of eight elements (C, O, Mg, Al, K, Ca, Ti, and Fe), finding Ross 128 to have near solar metallicity ([Fe/H] = +0.03 ± 0.09 dex). The derived results were obtained via spectral synthesis (1D LTE) adopting both MARCS and PHOENIX model atmospheres; stellar parameters and chemical abundances derived from the different adopted models do not show significant offsets. Mass–radius modeling of Ross 128b indicates that it lies below the pure-rock composition curve, suggesting that it contains a mixture of rock and iron, with the relative amounts of each set by the ratio of Fe/Mg. If Ross 128b formed with a subsolar Si abundance, and assuming the planet’s composition matches that of the host star, it likely has a larger core size relative to the Earth despite this producing a planet with a Si/Mg abundance ratio ∼34% greater than the Sun. The derived planetary parameters—insolation flux (S Earth = 1.79 ± 0.26) and equilibrium temperature (T eq = 294 ± 10 K)—support previous findings that Ross 128b is a temperate exoplanet in the inner edge of the habitable zone.

  7. Aging Research Using Mouse Models

    PubMed Central

    Ackert-Bicknell, Cheryl L.; Anderson, Laura; Sheehan, Susan; Hill, Warren G.; Chang, Bo; Churchill, Gary A.; Chesler, Elissa J.; Korstanje, Ron; Peters, Luanne L.

    2015-01-01

    Despite the dramatic increase in human lifespan over the past century, there remains pronounced variability in “health-span”, or the period of time in which one is generally healthy and free of disease. Much of the variability in health-span and lifespan is thought to be genetic in origin. Understanding the genetic mechanisms of aging and identifying ways to boost longevity is a primary goal in aging research. Here, we describe a pipeline of phenotypic assays for assessing mouse models of aging. This pipeline includes behavior/cognition testing, body composition analysis, and tests of kidney function, hematopoiesis, immune function and physical parameters. We also describe study design methods for assessing lifespan and health-span, and other important considerations when conducting aging research in the laboratory mouse. The tools and assays provided can assist researchers with understanding the correlative relationships between age-associated phenotypes and, ultimately, the role of specific genes in the aging process. PMID:26069080

  8. The STR/ort mouse model of spontaneous osteoarthritis - an update.

    PubMed

    Staines, K A; Poulet, B; Wentworth, D N; Pitsillides, A A

    2017-06-01

    Osteoarthritis is a degenerative joint disease and a world-wide healthcare burden. Characterized by cartilage degradation, subchondral bone thickening and osteophyte formation, osteoarthritis inflicts much pain and suffering, for which there are currently no disease-modifying treatments available. Mouse models of osteoarthritis are proving critical in advancing our understanding of the underpinning molecular mechanisms. The STR/ort mouse is a well-recognized model which develops a natural form of osteoarthritis very similar to the human disease. In this Review we discuss the use of the STR/ort mouse in understanding this multifactorial disease with an emphasis on recent advances in its genetics and its bone, endochondral and immune phenotypes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Human androgen deficiency: insights gained from androgen receptor knockout mouse models

    PubMed Central

    Rana, Kesha; Davey, Rachel A; Zajac, Jeffrey D

    2014-01-01

    The mechanism of androgen action is complex. Recently, significant advances have been made into our understanding of how androgens act via the androgen receptor (AR) through the use of genetically modified mouse models. A number of global and tissue-specific AR knockout (ARKO) models have been generated using the Cre-loxP system which allows tissue- and/or cell-specific deletion. These ARKO models have examined a number of sites of androgen action including the cardiovascular system, the immune and hemopoetic system, bone, muscle, adipose tissue, the prostate and the brain. This review focuses on the insights that have been gained into human androgen deficiency through the use of ARKO mouse models at each of these sites of action, and highlights the strengths and limitations of these Cre-loxP mouse models that should be considered to ensure accurate interpretation of the phenotype. PMID:24480924

  10. Mouse models of ciliopathies: the state of the art

    PubMed Central

    Norris, Dominic P.; Grimes, Daniel T.

    2012-01-01

    The ciliopathies are an apparently disparate group of human diseases that all result from defects in the formation and/or function of cilia. They include disorders such as Meckel-Grüber syndrome (MKS), Joubert syndrome (JBTS), Bardet-Biedl syndrome (BBS) and Alström syndrome (ALS). Reflecting the manifold requirements for cilia in signalling, sensation and motility, different ciliopathies exhibit common elements. The mouse has been used widely as a model organism for the study of ciliopathies. Although many mutant alleles have proved lethal, continued investigations have led to the development of better models. Here, we review current mouse models of a core set of ciliopathies, their utility and future prospects. PMID:22566558

  11. Investigating Mechanisms of Chronic Kidney Disease in Mouse Models

    PubMed Central

    Eddy, Allison A.; Okamura, Daryl M.; Yamaguchi, Ikuyo; López-Guisa, Jesús M.

    2011-01-01

    Animal models of chronic kidney disease (CKD) are important experimental tools that are used to investigate novel mechanistic pathways and to validate potential new therapeutic interventions prior to pre-clinical testing in humans. Over the past several years, mouse CKD models have been extensively used for these purposes. Despite significant limitations, the model of unilateral ureteral obstruction (UUO) has essentially become the high throughput in vivo model, as it recapitulates the fundamental pathogenetic mechanisms that typify all forms of CKD in a relatively short time span. In addition, several alternative mouse models are available that can be used to validate new mechanistic paradigms and/or novel therapies. Several models are reviewed – both genetic and experimentally induced – that provide investigators with an opportunity to include renal functional study end-points together with quantitative measures of fibrosis severity, something that is not possible with the UUO model. PMID:21695449

  12. Properties and mutation studies of a bacteriophage-derived chimeric recombinant staphylolytic protein P128

    PubMed Central

    Saravanan, Sanjeev Rajagopalan; Paul, Vivek Daniel; George, Shilpa; Sundarrajan, Sudarson; Kumar, Nirmal; Hebbur, Madhavi; Kumar, Naveen; Veena, Ananda; Maheshwari, Uma; Appaiah, Chemira Biddappa; Chidambaran, Muralidharan; Bhat, Anuradha Gopal; Hariharan, Sukumar; Padmanabhan, Sriram

    2013-01-01

    P128 is a chimeric anti-staphylococcal protein having a catalytic domain from a Staphylococcus bacteriophage K tail associated structural protein and a cell wall targeting domain from the Staphylococcus bacteriocin-lysostaphin. In this study, we disclose additional properties of P128 and compared the same with lysostaphin. While lysostaphin was found to get inactivated by heat and was inactive on its parent strain S. simulans biovar staphylolyticus, P128 was thermostable and was lytic towards S. simulans biovar staphylolyticus demonstrating a difference in their mechanism of action. Selected mutation studies of the catalytic domain of P128 showed that arginine and cysteine, at 40th and 76th positions respectively, are critical for the staphylolytic activity of P128, although these amino acids are not conserved residues. In comparison to native P128, only the R40S mutant (P301) was catalytically active on zymogram gel and had a similar secondary structure, as assessed by circular dichroism analysis and in silico modeling with similar cell binding properties. Mutation of the arginine residue at 40th position of the P128 molecule caused dramatic reduction in the Vmax (∆OD600 [mg/min]) value (nearly 270 fold) and the recombinant lysostaphin also showed lesser Vmax value (nearly 1.5 fold) in comparison to the unmodified P128 protein. The kinetic parameters such as apparent Km (Km APP) and apparent Kcat (KcatAPP) of the native P128 protein also showed significant differences in comparison to the values observed for P301 and lysostaphin. PMID:24251076

  13. Mutational landscape of a chemically-induced mouse model of liver cancer.

    PubMed

    Connor, Frances; Rayner, Tim F; Aitken, Sarah J; Feig, Christine; Lukk, Margus; Santoyo-Lopez, Javier; Odom, Duncan T

    2018-06-26

    Carcinogen-induced mouse models of liver cancer are used extensively to study pathogenesis of the disease and have a critical role in validating candidate therapeutics. These models can recapitulate molecular and histological features of human disease. However, it is not known if the genomic alterations driving these mouse tumour genomes are comparable to those found in human tumours. Here, we provide a detailed genomic characterisation of tumours from a commonly used mouse model of hepatocellular carcinoma (HCC). We analysed whole exome sequences of liver tumours arising in mice exposed to diethylnitrosamine (DEN). DEN-initiated tumours had a high, uniform number of somatic single nucleotide variants (SNVs), with few insertions, deletions or copy number alterations, consistent with the known genotoxic action of DEN. Exposure of hepatocytes to DEN left a reproducible mutational imprint in resulting tumour exomes which we could computationally reconstruct using six known COSMIC mutational signatures. The tumours carried a high diversity of low-incidence, non-synonymous point mutations in many oncogenes and tumour suppressors, reflecting the stochastic introduction of SNVs into the hepatocyte genome by the carcinogen. We identified four recurrently mutated genes that were putative oncogenic drivers of HCC in this model. Every neoplasm carried activating hotspot mutations either in codon 61 of Hras, in codon 584 of Braf or in codon 254 of Egfr. Truncating mutations of Apc occurred in 21% of neoplasms, which were exclusively carcinomas supporting a role for deregulation of Wnt/β-catenin signalling in cancer progression. Our study provides detailed insight into the mutational landscape of tumours arising in a commonly-used carcinogen model of HCC, facilitating the future use of this model to understand the human disease. Mouse models are widely used to study the biology of cancer and to test potential therapies. Here, we have described the mutational landscape of

  14. A Consensus Definition of Cataplexy in Mouse Models of Narcolepsy

    PubMed Central

    Scammell, Thomas E.; Willie, Jon T.; Guilleminault, Christian; Siegel, Jerome M.

    2009-01-01

    People with narcolepsy often have episodes of cataplexy, brief periods of muscle weakness triggered by strong emotions. Many researchers are now studying mouse models of narcolepsy, but definitions of cataplexy-like behavior in mice differ across labs. To establish a common language, the International Working Group on Rodent Models of Narcolepsy reviewed the literature on cataplexy in people with narcolepsy and in dog and mouse models of narcolepsy and then developed a consensus definition of murine cataplexy. The group concluded that murine cataplexy is an abrupt episode of nuchal atonia lasting at least 10 seconds. In addition, theta activity dominates the EEG during the episode, and video recordings document immobility. To distinguish a cataplexy episode from REM sleep after a brief awakening, at least 40 seconds of wakefulness must precede the episode. Bouts of cataplexy fitting this definition are common in mice with disrupted orexin/hypocretin signaling, but these events almost never occur in wild type mice. It remains unclear whether murine cataplexy is triggered by strong emotions or whether mice remain conscious during the episodes as in people with narcolepsy. This working definition provides helpful insights into murine cataplexy and should allow objective and accurate comparisons of cataplexy in future studies using mouse models of narcolepsy. Citation: Scammell TE; Willie JT; Guilleminault C; Siegel JM. A consensus definition of cataplexy in mouse models of narcolepsy. SLEEP 2009;32(1):111-116. PMID:19189786

  15. 7 CFR 993.128 - Nominations for membership.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 8 2013-01-01 2013-01-01 false Nominations for membership. 993.128 Section 993.128 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; FRUITS, VEGETABLES, NUTS), DEPARTMENT OF AGRICULTURE DRIED PRUNES PRODUCED IN...

  16. 7 CFR 993.128 - Nominations for membership.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 8 2011-01-01 2011-01-01 false Nominations for membership. 993.128 Section 993.128 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DRIED PRUNES PRODUCED IN...

  17. 7 CFR 993.128 - Nominations for membership.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 8 2012-01-01 2012-01-01 false Nominations for membership. 993.128 Section 993.128 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DRIED PRUNES PRODUCED IN...

  18. The 128-channel fully differential digital integrated neural recording and stimulation interface.

    PubMed

    Shahrokhi, Farzaneh; Abdelhalim, Karim; Serletis, Demitre; Carlen, Peter L; Genov, Roman

    2010-06-01

    We present a fully differential 128-channel integrated neural interface. It consists of an array of 8 X 16 low-power low-noise signal-recording and generation circuits for electrical neural activity monitoring and stimulation, respectively. The recording channel has two stages of signal amplification and conditioning with and a fully differential 8-b column-parallel successive approximation (SAR) analog-to-digital converter (ADC). The total measured power consumption of each recording channel, including the SAR ADC, is 15.5 ¿W. The measured input-referred noise is 6.08 ¿ Vrms over a 5-kHz bandwidth, resulting in a noise efficiency factor of 5.6. The stimulation channel performs monophasic or biphasic voltage-mode stimulation, with a maximum stimulation current of 5 mA and a quiescent power dissipation of 51.5 ¿W. The design is implemented in 0.35-¿m complementary metal-oxide semiconductor technology with the channel pitch of 200 ¿m for a total die size of 3.4 mm × 2.5 mm and a total power consumption of 9.33 mW. The neural interface was validated in in vitro recording of a low-Mg(2+)/high-K(+) epileptic seizure model in an intact hippocampus of a mouse.

  19. 14 CFR 21.128 - Tests: aircraft engines.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Tests: aircraft engines. 21.128 Section 21.128 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT... engine (except rocket engines for which the manufacturer must establish a sampling technique) to an...

  20. 14 CFR 21.128 - Tests: aircraft engines.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 1 2011-01-01 2011-01-01 false Tests: aircraft engines. 21.128 Section 21.128 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT... engine (except rocket engines for which the manufacturer must establish a sampling technique) to an...

  1. 45 CFR 147.128 - Rules regarding rescissions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ....128 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.128 Rules regarding rescissions. (a) Prohibition on rescissions—(1) A group health plan, or a health...

  2. 45 CFR 147.128 - Rules regarding rescissions.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ....128 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.128 Rules regarding rescissions. (a) Prohibition on rescissions—(1) A group health plan, or a health...

  3. 45 CFR 147.128 - Rules regarding rescissions.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ....128 Public Welfare Department of Health and Human Services REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.128 Rules regarding rescissions. (a) Prohibition on rescissions—(1) A group health plan, or a health...

  4. 45 CFR 147.128 - Rules regarding rescissions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ....128 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.128 Rules regarding rescissions. (a) Prohibition on rescissions—(1) A group health plan, or a health...

  5. 41 CFR 128-48.503 - General procedures.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false General procedures. 128-48.503 Section 128-48.503 Public Contracts and Property Management Federal Property Management... bills of sale, contracts, mortgages, or other satisfactory documentary evidence. (3) The facts and...

  6. 15 CFR 923.128 - Revisions to assessments and strategies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... strategies. 923.128 Section 923.128 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign... COASTAL RESOURCE MANAGEMENT COASTAL ZONE MANAGEMENT PROGRAM REGULATIONS Coastal Zone Enhancement Grants Program § 923.128 Revisions to assessments and strategies. (a) A State, in consultation with the Assistant...

  7. Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis.

    PubMed

    Swindell, William R; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P; Voorhees, John J; Elder, James T; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P; DiGiovanni, John; Pittelkow, Mark R; Ward, Nicole L; Gudjonsson, Johann E

    2011-04-04

    Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis.

  8. Lgn1, a gene that determines susceptibility to Legionella pneumophila, maps to mouse chromosome 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dietrich, W.F.; Damron, D.M.; Lander, E.S.

    1995-04-10

    The intracellular pathogen Legionella pneumophila is unable to replicate in macrophages derived from most inbred mouse strains. Here, we report the mapping of a gene, called Lgn1, that determines whether mouse macrophages are permissive for the intracellular replication of L. pneumophila. Although Lgn1 has been previously reported to map to mouse chromosome 15, we show here that it actually maps to chromosome 13, between D13Mit128 and D13Mit70. In the absence of any regional candidates for Lgn1, this map position will facilitate positional cloning attempts directed at this gene. 22 refs., 2 figs., 2 tabs.

  9. An Orthotopic Mouse Model of Spontaneous Breast Cancer Metastasis.

    PubMed

    Paschall, Amy V; Liu, Kebin

    2016-08-14

    Metastasis is the primary cause of mortality of breast cancer patients. The mechanism underlying cancer cell metastasis, including breast cancer metastasis, is largely unknown and is a focus in cancer research. Various breast cancer spontaneous metastasis mouse models have been established. Here, we report a simplified procedure to establish orthotopic transplanted breast cancer primary tumor and resultant spontaneous metastasis that mimic human breast cancer metastasis. Combined with the bioluminescence live tumor imaging, this mouse model allows tumor growth and progression kinetics to be monitored and quantified. In this model, a low dose (1 x 10(4) cells) of 4T1-Luc breast cancer cells was injected into BALB/c mouse mammary fat pad using a tuberculin syringe. Mice were injected with luciferin and imaged at various time points using a bioluminescent imaging system. When the primary tumors grew to the size limit as in the IACUC-approved protocol (approximately 30 days), mice were anesthetized under constant flow of 2% isoflurane and oxygen. The tumor area was sterilized with 70% ethanol. The mouse skin around the tumor was excised to expose the tumor which was removed with a pair of sterile scissors. Removal of the primary tumor extends the survival of the 4T-1 tumor-bearing mice for one month. The mice were then repeatedly imaged for metastatic tumor spreading to distant organs. Therapeutic agents can be administered to suppress tumor metastasis at this point. This model is simple and yet sensitive in quantifying breast cancer cell growth in the primary site and progression kinetics to distant organs, and thus is an excellent model for studying breast cancer growth and progression, and for testing anti-metastasis therapeutic and immunotherapeutic agents in vivo.

  10. 31 CFR 128.1 - General reporting requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false General reporting requirements. 128.1 Section 128.1 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... mobile capital, including transactions by large United States business enterprises (as determined by the...

  11. 31 CFR 128.1 - General reporting requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false General reporting requirements. 128.1 Section 128.1 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... mobile capital, including transactions by large United States business enterprises (as determined by the...

  12. 31 CFR 128.1 - General reporting requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false General reporting requirements. 128.1 Section 128.1 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... mobile capital, including transactions by large United States business enterprises (as determined by the...

  13. 31 CFR 128.1 - General reporting requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false General reporting requirements. 128.1 Section 128.1 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... mobile capital, including transactions by large United States business enterprises (as determined by the...

  14. 7 CFR 993.128 - Nominations for membership.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Nominations for membership. 993.128 Section 993.128 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... member as prescribed therein. (ii) In any election year in which four member positions and four alternate...

  15. Preclinical Mouse Models of Neurofibromatosis

    DTIC Science & Technology

    2009-10-01

    these tumors became evident 7-33 weeks after injury (average 25 ± 9 weeks), requiring the mice to be euthanized. Tumor histopathology closely mimicked...arose in a K-rasG12D-only mouse following adeno-Cre administration (1/7). However, the histopathology of this tumor differed significantly from that...Arf mice did not develop detectable tumors in this study (0/6). Figure 1. The full spectrum of meningioma histopathology can be modeled by Nf2

  16. Development and Characterization of a Mouse Model for Marburg Hemorrhagic Fever

    DTIC Science & Technology

    2009-07-01

    Microbiology. All Rights Reserved. Development and Characterization of a Mouse Model for Marburg Hemorrhagic Fever Kelly L. Warfield,* Steven B...mouse model has hampered an understanding of the pathogenesis and immunity of Marburg hemorrhagic fever (MHF), the disease caused by marburgvirus (MARV...cause severe hemorrhagic fevers in humans and non- human primates (27). The incubation time is estimated to be 3 to 21 days, with human case fatality

  17. 31 CFR 128.21 - Purpose of reports.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Purpose of reports. 128.21 Section 128.21 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... currency positions provide data on the nature and source of flows of mobile capital, including transactions...

  18. 31 CFR 128.21 - Purpose of reports.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Purpose of reports. 128.21 Section 128.21 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... currency positions provide data on the nature and source of flows of mobile capital, including transactions...

  19. 31 CFR 128.21 - Purpose of reports.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Purpose of reports. 128.21 Section 128.21 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... currency positions provide data on the nature and source of flows of mobile capital, including transactions...

  20. 31 CFR 128.21 - Purpose of reports.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Purpose of reports. 128.21 Section 128.21 Money and Finance: Treasury Regulations Relating to Money and Finance REPORTING OF... nature and source of flows of mobile capital, including transactions by large United States business...

  1. 31 CFR 128.21 - Purpose of reports.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Purpose of reports. 128.21 Section 128.21 Money and Finance: Treasury Regulations Relating to Money and Finance MONETARY OFFICES... currency positions provide data on the nature and source of flows of mobile capital, including transactions...

  2. 41 CFR 128-50.101 - Inventory records.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Inventory records. 128... Seized Personal Property § 128-50.101 Inventory records. Each bureau shall be responsible for establishing and maintaining inventory records of its seized personal property to ensure that: (a) The date the...

  3. 34 CFR 300.125-300.128 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 34 Education 2 2011-07-01 2010-07-01 true [Reserved] 300.125-300.128 Section 300.125-300.128 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION ASSISTANCE TO STATES FOR THE EDUCATION OF...

  4. 34 CFR 300.125-300.128 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 2 2010-07-01 2010-07-01 false [Reserved] 300.125-300.128 Section 300.125-300.128 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION ASSISTANCE TO STATES FOR THE EDUCATION OF...

  5. 50 CFR 648.128 - Scup possession restrictions.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 10 2011-10-01 2011-10-01 false Scup possession restrictions. 648.128 Section 648.128 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND... landing by dividing fillet number by 2. If scup are filleted into a single (butterfly) fillet, such fillet...

  6. 41 CFR 128-1.101 - Justice Property Management Regulations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Justice Property Management Regulations. 128-1.101 Section 128-1.101 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1...

  7. Development and testing of a mouse simulated space flight model

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1987-01-01

    The development and testing of a mouse model for simulating some aspects of weightlessness that occurs during space flight, and the carrying out of immunological experiments on animals undergoing space flight is examined. The mouse model developed was an antiorthostatic, hypokinetic, hypodynamic suspension model similar to one used with rats. The study was divided into two parts. The first involved determination of which immunological parameters should be observed on animals flown during space flight or studied in the suspension model. The second involved suspending mice and determining which of those immunological parameters were altered by the suspension. Rats that were actually flown in Space Shuttle SL-3 were used to test the hypotheses.

  8. 33 CFR 110.128b - Island of Hawaii, Hawaii.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Island of Hawaii, Hawaii. 110.128b Section 110.128b Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.128b Island of Hawaii, Hawaii. (a) Hilo Bay...

  9. 31 CFR 128.13 - Special survey reports.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Special survey reports. 128.13... Reports on International Capital Transactions and Positions § 128.13 Special survey reports. The Secretary may prescribe special survey reports at such times as the Secretary determines there is a need for...

  10. 31 CFR 128.13 - Special survey reports.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Special survey reports. 128.13... Reports on International Capital Transactions and Positions § 128.13 Special survey reports. The Secretary may prescribe special survey reports at such times as the Secretary determines there is a need for...

  11. 31 CFR 128.23 - Special survey reports.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Special survey reports. 128.23... Reports on Foreign Currency Positions § 128.23 Special survey reports. The Secretary may prescribe special survey reports with respect to foreign exchange positions and related information at such times as the...

  12. 31 CFR 128.23 - Special survey reports.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Special survey reports. 128.23... Reports on Foreign Currency Positions § 128.23 Special survey reports. The Secretary may prescribe special survey reports with respect to foreign exchange positions and related information at such times as the...

  13. 31 CFR 128.23 - Special survey reports.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Special survey reports. 128.23... Reports on Foreign Currency Positions § 128.23 Special survey reports. The Secretary may prescribe special survey reports with respect to foreign exchange positions and related information at such times as the...

  14. 31 CFR 128.13 - Special survey reports.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Special survey reports. 128.13... Reports on International Capital Transactions and Positions § 128.13 Special survey reports. The Secretary may prescribe special survey reports at such times as the Secretary determines there is a need for...

  15. 31 CFR 128.13 - Special survey reports.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Special survey reports. 128.13... Reports on International Capital Transactions and Positions § 128.13 Special survey reports. The Secretary may prescribe special survey reports at such times as the Secretary determines there is a need for...

  16. 31 CFR 128.23 - Special survey reports.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Special survey reports. 128.23... Reports on Foreign Currency Positions § 128.23 Special survey reports. The Secretary may prescribe special survey reports with respect to foreign exchange positions and related information at such times as the...

  17. 31 CFR 128.1 - General reporting requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false General reporting requirements. 128.1 Section 128.1 Money and Finance: Treasury Regulations Relating to Money and Finance REPORTING OF... positions. (1) In order to provide data on the nature and source of flows of mobile capital, including...

  18. 41 CFR 128-1.8010 - Judicial review.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... procedural, enforceable at law by a party against the Department of Justice, its Seismic Safety Coordinators... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Judicial review. 128-1... Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program § 128-1.8010...

  19. Genome-Wide Expression Profiling of Five Mouse Models Identifies Similarities and Differences with Human Psoriasis

    PubMed Central

    Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.

    2011-01-01

    Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750

  20. 7 CFR 60.128 - United States country of origin.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false United States country of origin. 60.128 Section 60.128... FOR FISH AND SHELLFISH General Provisions Definitions § 60.128 United States country of origin. United...: From fish or shellfish hatched, raised, harvested, and processed in the United States, and that has not...

  1. 7 CFR 60.128 - United States country of origin.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false United States country of origin. 60.128 Section 60.128... FOR FISH AND SHELLFISH General Provisions Definitions § 60.128 United States country of origin. United...: From fish or shellfish hatched, raised, harvested, and processed in the United States, and that has not...

  2. 33 CFR 110.128c - Island of Kauai, Hawaii.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Island of Kauai, Hawaii. 110.128c Section 110.128c Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.128c Island of Kauai, Hawaii. (a) Nawiliwili Bay. The...

  3. Application of Mouse Models to Research in Hearing and Balance.

    PubMed

    Ohlemiller, Kevin K; Jones, Sherri M; Johnson, Kenneth R

    2016-12-01

    Laboratory mice (Mus musculus) have become the major model species for inner ear research. The major uses of mice include gene discovery, characterization, and confirmation. Every application of mice is founded on assumptions about what mice represent and how the information gained may be generalized. A host of successes support the continued use of mice to understand hearing and balance. Depending on the research question, however, some mouse models and research designs will be more appropriate than others. Here, we recount some of the history and successes of the use of mice in hearing and vestibular studies and offer guidelines to those considering how to apply mouse models.

  4. Ultrastructural study of Rift Valley fever virus in the mouse model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reed, Christopher; Steele, Keith E.; Honko, Anna

    Detailed ultrastructural studies of Rift Valley fever virus (RVFV) in the mouse model are needed to develop and characterize a small animal model of RVF for the evaluation of potential vaccines and therapeutics. In this study, the ultrastructural features of RVFV infection in the mouse model were analyzed. The main changes in the liver included the presence of viral particles in hepatocytes and hepatic stem cells accompanied by hepatocyte apoptosis. However, viral particles were observed rarely in the liver; in contrast, particles were extremely abundant in the CNS. Despite extensive lymphocytolysis, direct evidence of viral replication was not observed inmore » the lymphoid tissue. These results correlate with the acute-onset hepatitis and delayed-onset encephalitis that are dominant features of severe human RVF, but suggest that host immune-mediated mechanisms contribute significantly to pathology. The results of this study expand our knowledge of RVFV-host interactions and further characterize the mouse model of RVF.« less

  5. Priceless GEMMs: genetically engineered mouse models for colorectal cancer drug development.

    PubMed

    Roper, Jatin; Hung, Kenneth E

    2012-08-01

    To establish effective drug development for colorectal cancer (CRC), preclinical models that are robust surrogates for human disease are crucial. Mouse models are an attractive platform because of their relatively low cost, short life span, and ease of use. There are two main categories of mouse CRC models: xenografts derived from implantation of CRC cells or tumors in immunodeficient mice; and genetically engineered mouse models (GEMMs) derived from modification of human cancer predisposition genes, resulting in spontaneous tumor formation. Here, we review xenografts and GEMMs and focus on their potential application in translational research. Furthermore, we describe newer GEMMs for sporadic CRC that are particularly suitable for drug testing. Finally, we discuss recent advances in small-animal imaging, such as optical colonoscopy, which allow in vivo assessment of tumors. With the increasing sophistication of GEMMs, our preclinical armamentarium provides new hope for the ongoing war against CRC. Copyright © 2012. Published by Elsevier Ltd.

  6. A humanoid mouse model of autism.

    PubMed

    Takumi, Toru

    2010-10-01

    Even now fruit of the human genome project is available, we have difficulties to approach neuropsychiatric disorders at the molecular level. Autism is a complex psychiatric illness but has received considerable attention as a developmental brain disorder not only from basic researchers but also from society. Substantial evidence suggests that chromosomal abnormalities contribute to autism risk. The duplication of human chromosome 15q11-13 is known to be the most frequent cytogenetic abnormality in autism. We succeeded to generate mice with a 6.3-Mb-wide interstitial duplication in mouse chromosome 7c that is highly syntenic to human 15q11-13 by using a Cre-loxP-based chromosome-engineering technique. The only paternally duplicated mice display autistic behavioral features such as poor social interaction and stereotypical behavior, and exhibit a developmental abnormality in ultrasonic vocalizations as well as anxiety. The detailed analysis focusing on a non-coding small nucleolar RNA, MBII52, within the duplicated region, revealed that the paternally duplicated mice alter the editing ratio of serotonin (5-HT) 2c receptor pre-mRNA and intracellular calcium responses by a 5-HT2c receptor specific agonist are changed in neurons. This result may explain one of molecular mechanisms of abnormal behaviors in the paternal duplicated mice. The first chromosome-engineered mouse model for human chromosome 15q11-13 duplication fulfills not only face validity of human autistic phenotypes but also construct validity based on human chromosome abnormality. This model will be a founder mouse for forward genetics of autistic disease and an invaluable tool for its therapeutic development. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Engineering a new mouse model for vitiligo.

    PubMed

    Manga, Prashiela; Orlow, Seth J

    2012-07-01

    Although the precise mechanisms that trigger vitiligo remain elusive, autoimmune responses mediate its progression. The development of therapies has been impeded by a paucity of animal models, since mice lack interfollicular melanocytes, the primary targets in vitiligo. In this issue, Harris et al. describe a mouse model in which interfollicular melanocytes are retained by Kit ligand overexpression and an immune response is initiated by transplanting melanocyte-targeting CD8+ T cells.

  8. A Progressive Translational Mouse Model of Human VCP Disease: The VCP R155H/+ Mouse

    PubMed Central

    Nalbandian, Angèle; Llewellyn, Katrina J.; Badadani, Mallikarjun; Yin, Hong Z.; Nguyen, Christopher; Katheria, Veeral; Watts, Giles; Mukherjee, Jogeshwar; Vesa, Jouni; Caiozzo, Vincent; Mozaffar, Tahseen; Weiss, John H.; Kimonis, Virginia E.

    2012-01-01

    Introduction Mutations in the valosin containing protein (VCP) gene cause hereditary Inclusion Body Myopathy (hIBM) associated with Paget disease of bone (PDB), and frontotemporal dementia (FTD). More recently they have been linked to 2% of familial ALS cases. A knock-in mouse model offers the opportunity to study VCP-associated pathogenesis. Methods The VCPR155H/+ knock-in mouse model was assessed for muscle strength, immunohistochemical, Western, apoptosis, autophagy and MicroPET/CT imaging analyses. Results VCPR155H/+ mice developed significant progressive muscle weakness, and the quadriceps and brain developed progressive cytoplasmic accumulation of TDP-43, ubiquitin-positive inclusion bodies and increased LC3-II staining. MicroCT analyses revealed Paget-like lesions at the ends of long bones. Spinal cord demonstrated neurodegenerative changes, ubiquitin, and TDP-43 pathology of motor neurons. Discussion VCPR155H/+ knock-in mice represent an excellent pre-clinical model for understanding VCP-associated disease mechanisms and future treatments. PMID:23169451

  9. Taltirelin alleviates fatigue-like behavior in mouse models of cancer-related fatigue.

    PubMed

    Dougherty, John P; Wolff, Brian S; Cullen, Mary J; Saligan, Leorey N; Gershengorn, Marvin C

    2017-10-01

    Fatigue affects most cancer patients and has numerous potential causes, including cancer itself and cancer treatment. Cancer-related fatigue (CRF) is not relieved by rest, can decrease quality of life, and has no FDA-approved therapy. Thyrotropin-releasing hormone (TRH) has been proposed as a potential novel treatment for CRF, but its efficacy against CRF remains largely untested. Thus, we tested the TRH analog, taltirelin (TAL), in mouse models of CRF. To model fatigue, we used a mouse model of chemotherapy, a mouse model of radiation therapy, and mice bearing colon 26 carcinoma tumors. We used the treadmill fatigue test to assess fatigue-like behavior after treatment with TAL. Additionally, we used wild-type and TRH receptor knockout mice to determine which TRH receptor was necessary for the actions of TAL. Tumor-bearing mice displayed muscle wasting and all models caused fatigue-like behavior, with mice running a shorter distance in the treadmill fatigue test than controls. TAL reversed fatigue-like behavior in all three models and the mouse TRH 1 receptor was necessary for the effects of TAL. These data suggest that TAL may be useful in alleviating fatigue in all cancer patients and provide further support for evaluating TAL as a potential therapy for CRF in humans. Published by Elsevier Ltd.

  10. RNAi-Based GluN3A Silencing Prevents and Reverses Disease Phenotypes Induced by Mutant huntingtin.

    PubMed

    Marco, Sonia; Murillo, Alvaro; Pérez-Otaño, Isabel

    2018-06-15

    Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by expansion of a polyglutamine tract in the huntingtin protein. HD symptoms include severe motor, cognitive, and psychiatric impairments that result from dysfunction and later degeneration of medium-sized spiny neurons (MSNs) in the striatum. A key early pathogenic mechanism is dysregulated synaptic transmission due to enhanced surface expression of juvenile NMDA-type glutamate receptors containing GluN3A subunits, which trigger the aberrant pruning of synapses formed by cortical afferents onto MSNs. Here, we tested the therapeutic potential of silencing GluN3A expression in YAC128 mice, a well-established HD model. Recombinant adeno-associated viruses encoding a short-hairpin RNA against GluN3A (rAAV-shGluN3A) were generated, and the ability of different serotypes to transduce MSNs was compared. A single injection of rAAV9-shGluN3A into the striatum of 1-month-old mice drove potent (>90%) and long-lasting reductions of GluN3A expression in MSNs, prevented dendritic spine loss and improved motor performance in YAC128 mice. Later delivery, when spine pathology is already apparent, was also effective. Our data provide proof-of-concept for GluN3A silencing as a beneficial strategy to prevent or reverse corticostriatal disconnectivity and motor impairment in HD and support the use of RNAi-based or small-molecule approaches for harnessing this therapeutic potential. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  11. 28 CFR 0.128a - General functions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... of military operations during World War II and claims of U.S. military personnel and civilian American citizens for having been held in a captured status in specified areas during World War II, the... 28 Judicial Administration 1 2011-07-01 2011-07-01 false General functions. 0.128a Section 0.128a...

  12. 28 CFR 0.128a - General functions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... of military operations during World War II and claims of U.S. military personnel and civilian American citizens for having been held in a captured status in specified areas during World War II, the... 28 Judicial Administration 1 2010-07-01 2010-07-01 false General functions. 0.128a Section 0.128a...

  13. 28 CFR 0.128a - General functions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... of military operations during World War II and claims of U.S. military personnel and civilian American citizens for having been held in a captured status in specified areas during World War II, the... 28 Judicial Administration 1 2013-07-01 2013-07-01 false General functions. 0.128a Section 0.128a...

  14. 28 CFR 0.128a - General functions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... of military operations during World War II and claims of U.S. military personnel and civilian American citizens for having been held in a captured status in specified areas during World War II, the... 28 Judicial Administration 1 2014-07-01 2014-07-01 false General functions. 0.128a Section 0.128a...

  15. 28 CFR 0.128a - General functions.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... of military operations during World War II and claims of U.S. military personnel and civilian American citizens for having been held in a captured status in specified areas during World War II, the... 28 Judicial Administration 1 2012-07-01 2012-07-01 false General functions. 0.128a Section 0.128a...

  16. Congenic mice demonstrate the presence of QTLs conferring obesity and hypercholesterolemia on chromosome 1 in the TALLYHO mouse.

    PubMed

    Parkman, Jacaline K; Denvir, James; Mao, Xia; Dillon, Kristy D; Romero, Sofia; Saxton, Arnold M; Kim, Jung Han

    2017-12-01

    The TALLYHO (TH) mouse presents a metabolic syndrome of obesity, type 2 diabetes, and hyperlipidemia. Highly significant quantitative trait loci (QTLs) linked to adiposity and hypercholesterolemia were previously identified on chromosome (Chr) 1 in a genome-wide scan of F2 mice from C57BL/6J (B6) x TH. In this study, we generated congenic mouse strains that carry the Chr 1 QTLs derived from TH on a B6 background; B6.TH-Chr1-128Mb (128Mb in size) and B6.TH-Chr1-92Mb (92Mb in size, proximally overlapping). We characterized these congenic mice on chow and high fat (HF) diets. On chow, B6.TH-Chr1-128Mb congenic mice exhibited a slightly larger body fat mass compared with B6.TH-Chr1-92Mb congenic and B6 mice, while body fat mass between B6.TH-Chr1-92Mb congenic and B6 mice was comparable. Plasma total cholesterol levels were significantly higher in B6.TH-Chr1-128Mb congenics compared to B6.TH-Chr1-92Mb congenic and B6 mice. Again, there was no difference in plasma total cholesterol levels between B6.TH-Chr1-92Mb congenic and B6 mice. All animals gained more body fat and exhibited higher plasma total cholesterol levels when fed HF diets than fed chow, but these increases were greater in B6.TH-Chr1-128Mb congenics than in B6.TH-Chr1-92Mb congenic and B6 mice. These results confirmed the effect of the 128Mb TH segment from Chr 1 on body fat and plasma cholesterol values and showed that the distal segment of Chr 1 from TH is necessary to cause both phenotypes. Through bioinformatic approaches, we generated a list of potential candidate genes within the distal region of Chr 1 and tested Ifi202b and Apoa2. We conclude that Chr 1 QTLs largely confer obesity and hypercholesterolemia in TH mice and can be promising targets for identifying susceptibility genes. Congenic mouse strains will be a valuable resource for gene identification.

  17. ISBT 128: a global information standard

    PubMed Central

    2010-01-01

    ISBT 128 is the global standard for the identification, labeling and information transfer of human blood, cell, tissue and organ products across international borders and disparate health care systems. The system has been designed and perfected over almost two decades to ensure accuracy, safety and efficiency for the benefit of donors, patients and health care workers worldwide. The use of the ISBT 128 standard has grown steadily since a blood bank in Estonia first implemented it in 1997. Today, more than 3,500 facility identifiers for the use of ISBT 128 have been assigned to organizations in 67 countries on six continents. The standard has been accepted by a variety of international standard setting organizations and government regulators. It is managed by ICCBBA, a not-for-profit organization based in the USA that is governed by an international volunteer board of directors. Members of the Board of Directors represent the fields of practice affected by the standard. Advisory groups comprising international experts guide the ongoing development of the ISBT 128 standard to ensure it continues to meet the needs of its users. While there is a cost associated with the implementation and use of the standard, the clear benefits in terms of improved patient safety and ability to meet regulatory traceability requirements justify the costs. PMID:20652420

  18. Spallanzani's mouse: a model of restoration and regeneration.

    PubMed

    Heber-Katz, E; Leferovich, J M; Bedelbaeva, K; Gourevitch, D

    2004-01-01

    The ability to regenerate is thought to be a lost phenotype in mammals, though there are certainly sporadic examples of mammalian regeneration. Our laboratory has identified a strain of mouse, the MRL mouse, which has a unique capacity to heal complex tissue in an epimorphic fashion, i.e., to restore a damaged limb or organ to its normal structure and function. Initial studies using through-and-through ear punches showed rapid full closure of the ear holes with cartilage growth, new hair follicles, and normal tissue architecture reminiscent of regeneration seen in amphibians as opposed to the scarring usually seen in mammals. Since the ear hole closure phenotype is a quantitative trait, this has been used to show-through extensive breeding and backcrossing--that the trait is heritable. Such analysis reveals that there is a complex genetic basis for this trait with multiple loci. One of the major phenotypes of the MRL mouse is a potent remodeling response with the absence or a reduced level of scarring. MRL healing is associated with the upregulation of the metalloproteinases MMP-2 and MMP-9 and the downregulation of their inhibitors TIMP-2 and TIMP-3, both present in inflammatory cells such as neutrophils and macrophages. This model has more recently been extended to the heart. In this case, a cryoinjury to the right ventricle leads to near complete scarless healing in the MRL mouse whereas scarring is seen in the control mouse. In the MRL heart, bromodeoxyuridine uptake by cardiomyocytes filling the wound site can be seen 60 days after injury. This does not occur in the control mouse. Function in the MRL heart, as measured by echocardiography, returns to normal.

  19. Circulating miR-128 as a potential diagnostic biomarker for glioma.

    PubMed

    Liang, Ruo-Fei; Li, Mao; Yang, Yuan; Wang, Xiang; Mao, Qing; Liu, Yan-Hui

    2017-09-01

    miR-128 in circulation is a promising marker for early diagnosis of glioma. A meta-analysis was performed to evaluate the diagnostic accuracy and clinical value of circulating miR-128 in patients with glioma. A comprehensive literature search for relevant published articles (last search updated on December 29, 2016) was conducted in the Chinese Biomedical Literature Database, PubMed, and Embase. The quality assessment of diagnostic accuracy studies (QUADAS) tool was used to score the quality of the eligible studies. Meta-Disc 1.4 software was used to test for heterogeneity and to perform the meta-analysis. The three studies included in our study enrolled a total of 191 patients with glioma and 73 individuals without tumor. Using a fixed-effect model analysis, the summary assessments revealed that the pooled sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio were 0.89 (95% CI: 0.84-0.93), 0.90 (95% CI: 0.81-0.96), 8.07 (95% CI: 4.21-15.46), and 0.13 (95% CI: 0.09-0.19), respectively. The diagnostic odds ratio (DOR) of miR-128 was 65.00 (95% CI: 26.90-157.10), indicating that the overall accuracy of the miR-128 test for detecting glioma was high. The value of I 2 was 0.0%, indicating that there was no significant heterogeneity among studies. The present meta-analysis showed that circulating miR-128 might be a promising noninvasive biomarker for diagnosing glioma. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. A chimeric human-mouse model of Sjögren's syndrome.

    PubMed

    Young, Nicholas A; Wu, Lai-Chu; Bruss, Michael; Kaffenberger, Benjamin H; Hampton, Jeffrey; Bolon, Brad; Jarjour, Wael N

    2015-01-01

    Despite recent advances in the understanding of Sjögren's Syndrome (SjS), the pathogenic mechanisms remain elusive and an ideal model for early drug discovery is not yet available. To establish a humanized mouse model of SjS, peripheral blood mononuclear cells (PBMCs) from healthy volunteers or patients with SjS were transferred into immunodeficient NOD-scid IL-2rγ(null) mouse recipients to produce chimeric mice. While no difference was observed in the distribution of cells, chimeric mice transferred with PBMCs from SjS patients produced enhanced cytokine levels, most significantly IFN-γ and IL-10. Histological examination revealed enhanced inflammatory responses in the lacrimal and salivary glands of SjS chimeras, as measured by digital image analysis and blinded histopathological scoring. Infiltrates were primarily CD4+, with minimal detection of CD8+ T-cells and B-cells. These results demonstrate a novel chimeric mouse model of human SjS that provides a unique in vivo environment to test experimental therapeutics and investigate T-cell disease pathology. Copyright © 2014. Published by Elsevier Inc.

  1. Development and testing of a mouse simulated space flight model

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1985-01-01

    The development and testing of a mouse model for simulating some aspects of weightlessness that occur during space flight, and the carrying out of immunological flight experiments on animals was discussed. The mouse model is an antiorthostatic, hypokinetic, hypodynamic suspension model similar to the one used with rats. It is shown that this murine model yield similar results to the rat model of antiorthostatic suspension for simulating some aspects of weightlessness. It is also shown that mice suspended in this model have decreased interferon-alpha/beta production as compared to control, nonsuspended mice or to orthostatically suspended mice. It is suggested that the conditions occuring during space flight could possibly affect interferon production. The regulatory role of interferon in nonviral diseases is demonstrated including several bacterial and protozoan infections indicating the great significance of interferon in resistance to many types of infectious diseases.

  2. Combination radiotherapy in an orthotopic mouse brain tumor model.

    PubMed

    Kramp, Tamalee R; Camphausen, Kevin

    2012-03-06

    Glioblastoma multiforme (GBM) are the most common and aggressive adult primary brain tumors. In recent years there has been substantial progress in the understanding of the mechanics of tumor invasion, and direct intracerebral inoculation of tumor provides the opportunity of observing the invasive process in a physiologically appropriate environment. As far as human brain tumors are concerned, the orthotopic models currently available are established either by stereotaxic injection of cell suspensions or implantation of a solid piece of tumor through a complicated craniotomy procedure. In our technique we harvest cells from tissue culture to create a cell suspension used to implant directly into the brain. The duration of the surgery is approximately 30 minutes, and as the mouse needs to be in a constant surgical plane, an injectable anesthetic is used. The mouse is placed in a stereotaxic jig made by Stoetling (figure 1). After the surgical area is cleaned and prepared, an incision is made; and the bregma is located to determine the location of the craniotomy. The location of the craniotomy is 2 mm to the right and 1 mm rostral to the bregma. The depth is 3 mm from the surface of the skull, and cells are injected at a rate of 2 μl every 2 minutes. The skin is sutured with 5-0 PDS, and the mouse is allowed to wake up on a heating pad. From our experience, depending on the cell line, treatment can take place from 7-10 days after surgery. Drug delivery is dependent on the drug composition. For radiation treatment the mice are anesthetized, and put into a custom made jig. Lead covers the mouse's body and exposes only the brain of the mouse. The study of tumorigenesis and the evaluation of new therapies for GBM require accurate and reproducible brain tumor animal models. Thus we use this orthotopic brain model to study the interaction of the microenvironment of the brain and the tumor, to test the effectiveness of different therapeutic agents with and without

  3. Mouse models for the study of colon carcinogenesis

    PubMed Central

    Rosenberg, Daniel W.; Giardina, Charles; Tanaka, Takuji

    2009-01-01

    The study of experimental colon carcinogenesis in rodents has a long history, dating back almost 80 years. There are many advantages to studying the pathogenesis of carcinogen-induced colon cancer in mouse models, including rapid and reproducible tumor induction and the recapitulation of the adenoma–carcinoma sequence that occurs in humans. The availability of recombinant inbred mouse panels and the existence of transgenic, knock-out and knock-in genetic models further increase the value of these studies. In this review, we discuss the general mechanisms of tumor initiation elicited by commonly used chemical carcinogens and how genetic background influences the extent of disease. We will also describe the general features of lesions formed in response to carcinogen treatment, including the underlying molecular aberrations and how these changes may relate to the pathogenesis of human colorectal cancer. PMID:19037092

  4. Indirubin Treatment of Lipopolysaccharide-Induced Mastitis in a Mouse Model and Activity in Mouse Mammary Epithelial Cells.

    PubMed

    Lai, Jin-Lun; Liu, Yu-Hui; Peng, Yong-Chong; Ge, Pan; He, Chen-Fei; Liu, Chang; Chen, Ying-Yu; Guo, Ai-Zhen; Hu, Chang-Min

    2017-01-01

    Indirubin is a Chinese medicine extracted from indigo and known to be effective for treating chronic myelogenous leukemia, neoplasia, and inflammatory disease. This study evaluated the in vivo anti-inflammatory activity of indirubin in a lipopolysaccharide- (LPS-) induced mouse mastitis model. The indirubin mechanism and targets were evaluated in vitro in mouse mammary epithelial cells. In the mouse model, indirubin significantly attenuated the severity of inflammatory lesions, edema, inflammatory hyperemia, milk stasis and local tissue necrosis, and neutrophil infiltration. Indirubin significantly decreased myeloperoxidase activity and downregulated the production of tumor necrosis factor- α , interleukin-1 β (IL-1 β ), and IL-6 caused by LPS. In vitro, indirubin inhibited LPS-stimulated expression of proinflammatory cytokines in a dose-dependent manner. It also downregulated LPS-induced toll-like receptor 4 (TLR4) expression and inhibited phosphorylation of LPS-induced nuclear transcription factor-kappa B (NF- κ B) P65 protein and inhibitor of kappa B. In addition to its effect on the NF- κ B signaling pathway, indirubin suppressed the mitogen-activated protein kinase (MAPK) signaling by inhibiting phosphorylation of extracellular signal-regulated kinase (ERK), P38, and c-jun NH2-terminal kinase (JNK). Indirubin improved LPS-induced mouse mastitis by suppressing TLR4 and downstream NF- κ B and MAPK pathway inflammatory signals and might be a potential treatment of mastitis and other inflammatory diseases.

  5. Comparative mRNA analysis of behavioral and genetic mouse models of aggression.

    PubMed

    Malki, Karim; Tosto, Maria G; Pain, Oliver; Sluyter, Frans; Mineur, Yann S; Crusio, Wim E; de Boer, Sietse; Sandnabba, Kenneth N; Kesserwani, Jad; Robinson, Edward; Schalkwyk, Leonard C; Asherson, Philip

    2016-04-01

    Mouse models of aggression have traditionally compared strains, most notably BALB/cJ and C57BL/6. However, these strains were not designed to study aggression despite differences in aggression-related traits and distinct reactivity to stress. This study evaluated expression of genes differentially regulated in a stress (behavioral) mouse model of aggression with those from a recent genetic mouse model aggression. The study used a discovery-replication design using two independent mRNA studies from mouse brain tissue. The discovery study identified strain (BALB/cJ and C57BL/6J) × stress (chronic mild stress or control) interactions. Probe sets differentially regulated in the discovery set were intersected with those uncovered in the replication study, which evaluated differences between high and low aggressive animals from three strains specifically bred to study aggression. Network analysis was conducted on overlapping genes uncovered across both studies. A significant overlap was found with the genetic mouse study sharing 1,916 probe sets with the stress model. Fifty-one probe sets were found to be strongly dysregulated across both studies mapping to 50 known genes. Network analysis revealed two plausible pathways including one centered on the UBC gene hub which encodes ubiquitin, a protein well-known for protein degradation, and another on P38 MAPK. Findings from this study support the stress model of aggression, which showed remarkable molecular overlap with a genetic model. The study uncovered a set of candidate genes including the Erg2 gene, which has previously been implicated in different psychopathologies. The gene networks uncovered points at a Redox pathway as potentially being implicated in aggressive related behaviors. © 2016 Wiley Periodicals, Inc.

  6. Technical approaches for mouse models of human disease.

    PubMed

    Justice, Monica J; Siracusa, Linda D; Stewart, A Francis

    2011-05-01

    The mouse is the leading organism for disease research. A rich resource of genetic variation occurs naturally in inbred and special strains owing to spontaneous mutations. However, one can also obtain desired gene mutations by using the following processes: targeted mutations that eliminate function in the whole organism or in a specific tissue; forward genetic screens using chemicals or transposons; or the introduction of exogenous transgenes as DNAs, bacterial artificial chromosomes (BACs) or reporter constructs. The mouse is the only mammal that provides such a rich resource of genetic diversity coupled with the potential for extensive genome manipulation, and is therefore a powerful application for modeling human disease. This poster review outlines the major genome manipulations available in the mouse that are used to understand human disease: natural variation, reverse genetics, forward genetics, transgenics and transposons. Each of these applications will be essential for understanding the diversity that is being discovered within the human population.

  7. Centralized mouse repositories.

    PubMed

    Donahue, Leah Rae; Hrabe de Angelis, Martin; Hagn, Michael; Franklin, Craig; Lloyd, K C Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T

    2012-10-01

    Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world.

  8. Genetically Engineered Mouse Models of Pituitary Tumors

    PubMed Central

    Cano, David A.; Soto-Moreno, Alfonso; Leal-Cerro, Alfonso

    2014-01-01

    Animal models constitute valuable tools for investigating the pathogenesis of cancer as well as for preclinical testing of novel therapeutics approaches. However, the pathogenic mechanisms of pituitary-tumor formation remain poorly understood, particularly in sporadic adenomas, thus, making it a challenge to model pituitary tumors in mice. Nevertheless, genetically engineered mouse models (GEMMs) of pituitary tumors have provided important insight into pituitary tumor biology. In this paper, we review various GEMMs of pituitary tumors, highlighting their contributions and limitations, and discuss opportunities for research in the field. PMID:25136513

  9. A mouse model for human anal cancer.

    PubMed

    Stelzer, Marie K; Pitot, Henry C; Liem, Amy; Schweizer, Johannes; Mahoney, Charles; Lambert, Paul F

    2010-12-01

    Human anal cancers are associated with high-risk human papillomaviruses (HPV) that cause other anogenital cancers and head and neck cancers. As with other cancers, HPV16 is the most common high-risk HPV in anal cancers. We describe the generation and characterization of a mouse model for human anal cancer. This model makes use of K14E6 and K14E7 transgenic mice in which the HPV16 E6 and E7 genes are directed in their expression to stratified squamous epithelia. HPV16 E6 and E7 possess oncogenic properties including, but not limited to, their capacity to inactivate the cellular tumor suppressors p53 and pRb, respectively. Both E6 and E7 were found to be functionally expressed in the anal epithelia of K14E6/K14E7 transgenic mice. To assess the susceptibility of these mice to anal cancer, mice were treated topically with dimethylbenz[a]anthracene (DMBA), a chemical carcinogen that is known to induce squamous cell carcinomas in other sites. Nearly 50% of DMBA-treated HPV16 E6/E7 transgenic mice showed overt signs of tumors, whereas none of the like-treated nontransgenic mice showed tumors. Histopathologic analyses confirmed that the HPV16 transgenic mice were increased in their susceptibility to anal cancers and precancerous lesions. Biomarker analyses demonstrated that these mouse anal cancers exhibit properties that are similar to those observed in HPV-positive precursors to human anal cancer. This is the first mouse model for investigating the contributions of viral and cellular factors in anal carcinogenesis, and should provide a platform for assessing new therapeutic modalities for treating and/or preventing this type of cancer. ©2010 AACR.

  10. A Mouse Model for Human Anal Cancer

    PubMed Central

    Stelzer, Marie K.; Pitot, Henry C.; Liem, Amy; Schweizer, Johannes; Mahoney, Charles; Lambert, Paul F.

    2010-01-01

    Human anal cancers are associated with high-risk human papillomaviruses (HPVs) that cause other anogenital cancers and head and neck cancers. As with other cancers, HPV16 is the most common high-risk HPV in anal cancers. We describe the generation and characterization of a mouse model for human anal cancer. This model makes use of K14E6 and K14E7 transgenic mice in which the HPV16 E6 and E7 genes are directed in their expression to stratified squamous epithelia. HPV16 E6 and E7 possess oncogenic properties including but not limited to their capacity to inactivate the cellular tumor suppressors p53 and pRb, respectively. Both E6 and E7 were found to be functionally expressed in the anal epithelia of K14E6/K14E7 transgenic mice. To assess the susceptibility of these mice to anal cancer, mice were treated topically with dimethylbenz[a]anthracene (DMBA), a chemical carcinogen that is known to induce squamous cell carcinomas in other sites. Nearly 50% of DMBA-treated HPV16 E6/E7 transgenic mice showed overt signs of tumors; whereas, none of the like treated non-transgenic mice showed tumors. Histopathological analyses confirmed that the HPV16 transgenic mice were increased in their susceptibility to anal cancers and precancerous lesions. Biomarker analyses demonstrated that these mouse anal cancers exhibit properties that are similar to those observed in HPV-positive precursors to human anal cancer. This is the first mouse model for investigating the contributions of viral and cellular factors in anal carcinogenesis, and should provide a platform for assessing new therapeutic modalities for treating and/or preventing this type of cancer. PMID:20947489

  11. A Humanized Mouse Model Generated Using Surplus Neonatal Tissue.

    PubMed

    Brown, Matthew E; Zhou, Ying; McIntosh, Brian E; Norman, Ian G; Lou, Hannah E; Biermann, Mitch; Sullivan, Jeremy A; Kamp, Timothy J; Thomson, James A; Anagnostopoulos, Petros V; Burlingham, William J

    2018-04-10

    Here, we describe the NeoThy humanized mouse model created using non-fetal human tissue sources, cryopreserved neonatal thymus and umbilical cord blood hematopoietic stem cells (HSCs). Conventional humanized mouse models are made by engrafting human fetal thymus and HSCs into immunocompromised mice. These mice harbor functional human T cells that have matured in the presence of human self-peptides and human leukocyte antigen molecules. Neonatal thymus tissue is more abundant and developmentally mature and allows for creation of up to ∼50-fold more mice per donor compared with fetal tissue models. The NeoThy has equivalent frequencies of engrafted human immune cells compared with fetal tissue humanized mice and exhibits T cell function in assays of ex vivo cell proliferation, interferon γ secretion, and in vivo graft infiltration. The NeoThy model may provide significant advantages for induced pluripotent stem cell immunogenicity studies, while bypassing the requirement for fetal tissue. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Modeling fragile X syndrome in the Fmr1 knockout mouse

    PubMed Central

    Kazdoba, Tatiana M.; Leach, Prescott T.; Silverman, Jill L.; Crawley, Jacqueline N.

    2014-01-01

    Summary Fragile X Syndrome (FXS) is a commonly inherited form of intellectual disability and one of the leading genetic causes for autism spectrum disorder. Clinical symptoms of FXS can include impaired cognition, anxiety, hyperactivity, social phobia, and repetitive behaviors. FXS is caused by a CGG repeat mutation which expands a region on the X chromosome containing the FMR1 gene. In FXS, a full mutation (> 200 repeats) leads to hypermethylation of FMR1, an epigenetic mechanism that effectively silences FMR1 gene expression and reduces levels of the FMR1 gene product, fragile X mental retardation protein (FMRP). FMRP is an RNA-binding protein that is important for the regulation of protein expression. In an effort to further understand how loss of FMR1 and FMRP contribute to FXS symptomology, several FXS animal models have been created. The most well characterized rodent model is the Fmr1 knockout (KO) mouse, which lacks FMRP protein due to a disruption in its Fmr1 gene. Here, we review the behavioral phenotyping of the Fmr1 KO mouse to date, and discuss the clinical relevance of this mouse model to the human FXS condition. While much remains to be learned about FXS, the Fmr1 KO mouse is a valuable tool for understanding the repercussions of functional loss of FMRP and assessing the efficacy of pharmacological compounds in ameliorating the molecular and behavioral phenotypes relevant to FXS. PMID:25606362

  13. 46 CFR 128.410 - Ship's service refrigeration systems.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Ship's service refrigeration systems. 128.410 Section 128.410 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS... service refrigeration systems. No self-contained unit either for air-conditioning or for refrigerated...

  14. 46 CFR 128.410 - Ship's service refrigeration systems.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Ship's service refrigeration systems. 128.410 Section 128.410 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS... service refrigeration systems. No self-contained unit either for air-conditioning or for refrigerated...

  15. 46 CFR 128.410 - Ship's service refrigeration systems.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Ship's service refrigeration systems. 128.410 Section 128.410 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS... service refrigeration systems. No self-contained unit either for air-conditioning or for refrigerated...

  16. 46 CFR 128.410 - Ship's service refrigeration systems.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Ship's service refrigeration systems. 128.410 Section 128.410 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS... service refrigeration systems. No self-contained unit either for air-conditioning or for refrigerated...

  17. 46 CFR 128.410 - Ship's service refrigeration systems.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 4 2013-10-01 2013-10-01 false Ship's service refrigeration systems. 128.410 Section 128.410 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS... service refrigeration systems. No self-contained unit either for air-conditioning or for refrigerated...

  18. STS-128 Administrator Visit

    NASA Image and Video Library

    2009-11-03

    NASA Administrator Charles F. Bolden, seated left, smiles as Deputy Administrator Lori Garver greets STS-128 astronauts Patrick Forrester, Jose Hernandez and Christer Fugelsang, of the European Space Agency, during a meeting at NASA Headquarters, Tuesday, Nov. 3, 2009, in Washington. Photo Credit: (NASA/Paul E. Alers)

  19. A consensus definition of cataplexy in mouse models of narcolepsy.

    PubMed

    Scammell, Thomas E; Willie, Jon T; Guilleminault, Christian; Siegel, Jerome M

    2009-01-01

    People with narcolepsy often have episodes of cataplexy, brief periods of muscle weakness triggered by strong emotions. Many researchers are now studying mouse models of narcolepsy, but definitions of cataplexy-like behavior in mice differ across labs. To establish a common language, the International Working Group on Rodent Models of Narcolepsy reviewed the literature on cataplexy in people with narcolepsy and in dog and mouse models of narcolepsy and then developed a consensus definition of murine cataplexy. The group concluded that murine cataplexy is an abrupt episode of nuchal atonia lasting at least 10 seconds. In addition, theta activity dominates the EEG during the episode, and video recordings document immobility. To distinguish a cataplexy episode from REM sleep after a brief awakening, at least 40 seconds of wakefulness must precede the episode. Bouts of cataplexy fitting this definition are common in mice with disrupted orexin/hypocretin signaling, but these events almost never occur in wild type mice. It remains unclear whether murine cataplexy is triggered by strong emotions or whether mice remain conscious during the episodes as in people with narcolepsy. This working definition provides helpful insights into murine cataplexy and should allow objective and accurate comparisons of cataplexy in future studies using mouse models of narcolepsy.

  20. Spatial and temporal activity of the foxtail millet (Setaria italica) seed-specific promoter pF128.

    PubMed

    Pan, Yanlin; Ma, Xin; Liang, Hanwen; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan

    2015-01-01

    pF128 drives GUS specifically expressed in transgenic seeds of foxtail millet and Zea mays with higher activity than the constitutive CaMV35S promoter and the maize seed-specific 19Z promoter. Foxtail millet (Setaria italica), a member of the Poaceae family, is an important food and fodder crop in arid regions. Foxtail millet is an excellent C4 crop model owing to its small genome (~490 Mb), self-pollination and availability of a complete genome sequence. F128 was isolated from a cDNA library of foxtail millet immature seeds. Real-time PCR analysis revealed that F128 mRNA was specifically expressed in immature and mature seeds. The highest F128 mRNA level was observed 5 days after pollination and gradually decreased as the seed matured. Sequence analysis suggested that the protein encoded by F128 is likely a protease inhibitor/seed storage protein/lipid-transfer protein. The 1,053 bp 5' flanking sequence of F128 (pF128) was isolated and fused to the GUS reporter gene. The corresponding vector was then transformed into Arabidopsis thaliana, foxtail millet and Zea mays. GUS analysis revealed that pF128 drove GUS expression efficiently and specifically in the seeds of transgenic Arabidopsis, foxtail millet and Zea mays. GUS activity was also detected in Arabidopsis cotyledons. Activity of pF128 was higher than that observed for the constitutive CaMV35S promoter and the maize seed-specific 19 Zein (19Z) promoter. These results indicate that pF128 is a seed-specific promoter. Its application is expected to be of considerable value in plant genetic engineering.

  1. Development and function of human innate immune cells in a humanized mouse model.

    PubMed

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  2. Development and function of human innate immune cells in a humanized mouse model

    PubMed Central

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V.; Teichmann, Lino L.; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A. Karolina; Manz, Markus G.; Flavell, Richard A.

    2014-01-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models are unable to support development of human innate immune cells, including myeloid cells and NK cells. Here we describe a mouse strain, called MI(S)TRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked in to their respective mouse loci. The human cytokines support the development and function of monocytes/macrophages and natural killer cells derived from human fetal liver or adult CD34+ progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MI(S)TRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology. PMID:24633240

  3. A 1.8-Mb YAC contig in Xp11.23: identification of CpG islands and physical mapping of CA repeats in a region of high gene density.

    PubMed

    Coleman, M P; Németh, A H; Campbell, L; Raut, C P; Weissenbach, J; Davies, K E

    1994-05-15

    The genes ARAF1, SYN1, TIMP, and PFC are clustered within 70 kb of one another, and, as reported in the accompanying paper (J. Knight et al., 1994, Genomics 21: 180-187), at least four more genes map within 400 kb: a cluster of Krüppel-type zinc finger genes (including ZNF21, ZNF41, and ZNF81) and ELK-1, a member of the ets oncogene superfamily. This gene-rich region is of particular interest because of the large number of disease genes mapping to Xp11.23: at least three eye diseases (retinitis pigmentosa type 2, congenital stationary night blindness CSNB1, and Aland Island eye disease), Wiskott-Aldrich syndrome, X-linked nephrolithiasis, and a translocation breakpoint associated with synovial sarcoma. We have constructed a 1.8-Mb YAC contig in this region, confirming the link between TIMP and OATL1 reported by Knight et al. (1994) and extending the map in the distal direction. To investigate the likelihood that more genes are located within this region, we have carried out detailed mapping of rare-cutter restriction sites in these YACs and identified seven CpG islands. At least six of these islands are located over 50 kb from any known gene locations, suggesting that the region contains at least this many as yet unidentified genes. We have also mapped the physical locations of six highly polymorphic CA repeats within the contig, thus integrating the physical, genetic, and transcriptional maps of the region and facilitating the mapping and identification of disease genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Evaluation of synthetic vascular grafts in a mouse carotid grafting model.

    PubMed

    Chan, Alex H P; Tan, Richard P; Michael, Praveesuda L; Lee, Bob S L; Vanags, Laura Z; Ng, Martin K C; Bursill, Christina A; Wise, Steven G

    2017-01-01

    Current animal models for the evaluation of synthetic grafts are lacking many of the molecular tools and transgenic studies available to other branches of biology. A mouse model of vascular grafting would allow for the study of molecular mechanisms of graft failure, including in the context of clinically relevant disease states. In this study, we comprehensively characterise a sutureless grafting model which facilitates the evaluation of synthetic grafts in the mouse carotid artery. Using conduits electrospun from polycaprolactone (PCL) we show the gradual development of a significant neointima within 28 days, found to be greatest at the anastomoses. Histological analysis showed temporal increases in smooth muscle cell and collagen content within the neointima, demonstrating its maturation. Endothelialisation of the PCL grafts, assessed by scanning electron microscopy (SEM) analysis and CD31 staining, was near complete within 28 days, together replicating two critical aspects of graft performance. To further demonstrate the potential of this mouse model, we used longitudinal non-invasive tracking of bone-marrow mononuclear cells from a transgenic mouse strain with a dual reporter construct encoding both luciferase and green fluorescent protein (GFP). This enabled characterisation of mononuclear cell homing and engraftment to PCL using bioluminescence imaging and histological staining over time (7, 14 and 28 days). We observed peak luminescence at 7 days post-graft implantation that persisted until sacrifice at 28 days. Collectively, we have established and characterised a high-throughput model of grafting that allows for the evaluation of key clinical drivers of graft performance.

  5. 41 CFR 128-48.500 - Scope of subpart.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Scope of subpart. 128-48.500 Section 128-48.500 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 48-UTILIZATION, DONATION, OR DISPOSAL OF ABANDONED AND...

  6. 41 CFR 128-48.500 - Scope of subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Scope of subpart. 128-48.500 Section 128-48.500 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 48-UTILIZATION, DONATION, OR DISPOSAL OF ABANDONED AND...

  7. 41 CFR 128-48.500 - Scope of subpart.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Scope of subpart. 128-48.500 Section 128-48.500 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 48-UTILIZATION, DONATION, OR DISPOSAL OF ABANDONED AND...

  8. 41 CFR 128-48.500 - Scope of subpart.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Scope of subpart. 128-48.500 Section 128-48.500 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 48-UTILIZATION, DONATION, OR DISPOSAL OF ABANDONED AND...

  9. 41 CFR 128-48.500 - Scope of subpart.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Scope of subpart. 128-48.500 Section 128-48.500 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 48-UTILIZATION, DONATION, OR DISPOSAL OF ABANDONED AND...

  10. 42 CFR 422.128 - Information on advance directives.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    .... (ii) The MA organization's written policies respecting the implementation of those rights, including a... 42 Public Health 3 2010-10-01 2010-10-01 false Information on advance directives. 422.128 Section 422.128 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN...

  11. Functions of MiRNA-128 on the regulation of head and neck squamous cell carcinoma growth and apoptosis.

    PubMed

    Hauser, Belinda; Zhao, Yuan; Pang, Xiaowu; Ling, Zhiqiang; Myers, Ernest; Wang, Paul; Califano, Joseph; Gu, Xinbin

    2015-01-01

    Incidence of head and neck squamous cell carcinoma (HNSCC) has continuously increased in past years while its survival rate has not been significantly improved. There is a critical need to better understand the genetic regulation of HNSCC tumorigenesis and progression. In this study, we comprehensively analyzed the function of miRNA-128 (miR-128) in the regulation of HNSCC growth and its putative targets in vitro and in vivo systems. The function and targets of miR-128 were investigated in human HNSCC cell lines (JHU-13 and JHU-22), which were stably transfected with the miR-128 gene using a lentiviral delivery system. The expression levels of miR-128 and its targeted proteins were analyzed with qRT-PCR, Western blotting and flow cytometry. The binding capacity of miRNA-128 to its putative targets was determined using a luciferase report assay. MTT, colony formation, and a tumor xenograft model further evaluated the effects of miR-128 on HNSCC growth. We generated two miR-128 stably transfected human HNSCC cell lines (JHU-13miR-128 and JHU-22miR-128). Enforced expression of miR-128 was detected in both cultured JHU-13miR-128 and JHU-22miR-128 cell lines, approximately seventeen to twenty folds higher than in vector control cell lines. miRNA-128 was able to bind with the 3'-untranslated regions of BMI-1, BAG-2, BAX, H3f3b, and Paip2 mRNAs, resulting in significant reduction of the targeted protein levels. We found that upregulated miR-128 expression significantly inhibited both JHU-13miR-128 and JHU-22miR-128 cell viability approximately 20 to 40%, and the JHU-22miR-128 tumor xenograft growth compared to the vector control groups. miR-128 acted as a tumor suppressor inhibiting the HNSCC growth by directly mediating the expression of putative targets. Our results provide a better understanding of miRNA-128 function and its potential targets, which may be valuable for developing novel diagnostic markers and targeted therapy.

  12. Centralized Mouse Repositories

    PubMed Central

    Donahue, Leah Rae; de Angelis, Martin Hrabe; Hagn, Michael; Franklin, Craig; Lloyd, K. C. Kent; Magnuson, Terry; McKerlie, Colin; Nakagata, Naomi; Obata, Yuichi; Read, Stuart; Wurst, Wolfgang; Hörlein, Andreas; Davisson, Muriel T.

    2013-01-01

    Because the mouse is used so widely for biomedical research and the number of mouse models being generated is increasing rapidly, centralized repositories are essential if the valuable mouse strains and models that have been developed are to be securely preserved and fully exploited. Ensuring the ongoing availability of these mouse strains preserves the investment made in creating and characterizing them and creates a global resource of enormous value. The establishment of centralized mouse repositories around the world for distributing and archiving these resources has provided critical access to and preservation of these strains. This article describes the common and specialized activities provided by major mouse repositories around the world. PMID:22945696

  13. Dissecting Alzheimer disease in Down syndrome using mouse models

    PubMed Central

    Choong, Xun Yu; Tosh, Justin L.; Pulford, Laura J.; Fisher, Elizabeth M. C.

    2015-01-01

    Down syndrome (DS) is a common genetic condition caused by the presence of three copies of chromosome 21 (trisomy 21). This greatly increases the risk of Alzheimer disease (AD), but although virtually all people with DS have AD neuropathology by 40 years of age, not all develop dementia. To dissect the genetic contribution of trisomy 21 to DS phenotypes including those relevant to AD, a range of DS mouse models has been generated which are trisomic for chromosome segments syntenic to human chromosome 21. Here, we consider key characteristics of human AD in DS (AD-DS), and our current state of knowledge on related phenotypes in AD and DS mouse models. We go on to review important features needed in future models of AD-DS, to understand this type of dementia and so highlight pathogenic mechanisms relevant to all populations at risk of AD. PMID:26528151

  14. Dissecting Alzheimer disease in Down syndrome using mouse models.

    PubMed

    Choong, Xun Yu; Tosh, Justin L; Pulford, Laura J; Fisher, Elizabeth M C

    2015-01-01

    Down syndrome (DS) is a common genetic condition caused by the presence of three copies of chromosome 21 (trisomy 21). This greatly increases the risk of Alzheimer disease (AD), but although virtually all people with DS have AD neuropathology by 40 years of age, not all develop dementia. To dissect the genetic contribution of trisomy 21 to DS phenotypes including those relevant to AD, a range of DS mouse models has been generated which are trisomic for chromosome segments syntenic to human chromosome 21. Here, we consider key characteristics of human AD in DS (AD-DS), and our current state of knowledge on related phenotypes in AD and DS mouse models. We go on to review important features needed in future models of AD-DS, to understand this type of dementia and so highlight pathogenic mechanisms relevant to all populations at risk of AD.

  15. 41 CFR 128-1.5005-1 - Primary delegations.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Primary delegations. 128... Personal Property Management § 128-1.5005-1 Primary delegations. The following authorities are redelegated... individual as PMO and PC providing that the functions and responsibilities are compatible and are within the...

  16. 41 CFR 128-1.5005-1 - Primary delegations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Primary delegations. 128... Personal Property Management § 128-1.5005-1 Primary delegations. The following authorities are redelegated... individual as PMO and PC providing that the functions and responsibilities are compatible and are within the...

  17. 41 CFR 128-1.5005-1 - Primary delegations.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Primary delegations. 128... Personal Property Management § 128-1.5005-1 Primary delegations. The following authorities are redelegated... individual as PMO and PC providing that the functions and responsibilities are compatible and are within the...

  18. 41 CFR 128-1.5005-1 - Primary delegations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Primary delegations. 128... Personal Property Management § 128-1.5005-1 Primary delegations. The following authorities are redelegated... individual as PMO and PC providing that the functions and responsibilities are compatible and are within the...

  19. 41 CFR 128-1.5005-1 - Primary delegations.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Primary delegations. 128... Personal Property Management § 128-1.5005-1 Primary delegations. The following authorities are redelegated... individual as PMO and PC providing that the functions and responsibilities are compatible and are within the...

  20. Complete genome of Nitrosospira briensis C-128, an ammonia-oxidizing bacterium from agricultural soil

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rice, Marlen C.; Norton, Jeanette M.; Valois, Frederica

    Nitrosospira briensis C-128 is an ammonia-oxidizing bacterium isolated from an acid agricultural soil. N. briensis C-128 was sequenced with PacBio RS technologies at the DOE-Joint Genome Institute through their Community Science Program (2010). The high-quality finished genome contains one chromosome of 3.21 Mb and no plasmids. We identified 3073 gene models, 3018 of which are protein coding. The two-way average nucleotide identity between the chromosomes of Nitrosospira multiformis ATCC 25196 and Nitrosospira briensis C-128 was found to be 77.2 %. Multiple copies of modules encoding chemolithotrophic metabolism were identified in their genomic context. The gene inventory supports chemolithotrophic metabolism withmore » implications for function in soil environments.« less

  1. Complete genome of Nitrosospira briensis C-128, an ammonia-oxidizing bacterium from agricultural soil

    DOE PAGES

    Rice, Marlen C.; Norton, Jeanette M.; Valois, Frederica; ...

    2016-07-28

    Nitrosospira briensis C-128 is an ammonia-oxidizing bacterium isolated from an acid agricultural soil. N. briensis C-128 was sequenced with PacBio RS technologies at the DOE-Joint Genome Institute through their Community Science Program (2010). The high-quality finished genome contains one chromosome of 3.21 Mb and no plasmids. We identified 3073 gene models, 3018 of which are protein coding. The two-way average nucleotide identity between the chromosomes of Nitrosospira multiformis ATCC 25196 and Nitrosospira briensis C-128 was found to be 77.2 %. Multiple copies of modules encoding chemolithotrophic metabolism were identified in their genomic context. The gene inventory supports chemolithotrophic metabolism withmore » implications for function in soil environments.« less

  2. 41 CFR 128-48.150 - Determination of type of property.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Determination of type of property. 128-48.150 Section 128-48.150 Public Contracts and Property Management Federal Property... § 128-48.150 Determination of type of property. If a bureau is unable to determine whether the personal...

  3. 41 CFR 128-48.150 - Determination of type of property.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Determination of type of property. 128-48.150 Section 128-48.150 Public Contracts and Property Management Federal Property... § 128-48.150 Determination of type of property. If a bureau is unable to determine whether the personal...

  4. 41 CFR 128-48.150 - Determination of type of property.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Determination of type of property. 128-48.150 Section 128-48.150 Public Contracts and Property Management Federal Property... § 128-48.150 Determination of type of property. If a bureau is unable to determine whether the personal...

  5. 41 CFR 128-48.150 - Determination of type of property.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Determination of type of property. 128-48.150 Section 128-48.150 Public Contracts and Property Management Federal Property... § 128-48.150 Determination of type of property. If a bureau is unable to determine whether the personal...

  6. 41 CFR 128-48.150 - Determination of type of property.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Determination of type of property. 128-48.150 Section 128-48.150 Public Contracts and Property Management Federal Property... § 128-48.150 Determination of type of property. If a bureau is unable to determine whether the personal...

  7. STS-128 Administrator Visit

    NASA Image and Video Library

    2009-11-03

    NASA Deputy Administrator Lori Garver, right, along with Assistant Administrator for Legislative and Intergovernmental Affairs L. Seth Statler, meets with STS-128 astronauts Patrick Forrester, left, Jose Hernandez and Christer Fugelsang, of the European Space Agency, at NASA Headquarters, Tuesday, Nov. 3, 2009, in Washington. Photo Credit: (NASA/Paul E. Alers)

  8. 41 CFR 128-1.100 - Scope of subpart.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 41 Public Contracts and Property Management 3 2014-01-01 2014-01-01 false Scope of subpart. 128-1... System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.100 Scope of... of the Federal Property Management Regulations System (FPMR) (41 CFR part 101); states its...

  9. 41 CFR 128-1.100 - Scope of subpart.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Scope of subpart. 128-1... System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.100 Scope of... of the Federal Property Management Regulations System (FPMR) (41 CFR part 101); states its...

  10. 41 CFR 128-1.100 - Scope of subpart.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Scope of subpart. 128-1... System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.100 Scope of... of the Federal Property Management Regulations System (FPMR) (41 CFR part 101); states its...

  11. 41 CFR 128-1.100 - Scope of subpart.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Scope of subpart. 128-1... System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.100 Scope of... of the Federal Property Management Regulations System (FPMR) (41 CFR part 101); states its...

  12. 41 CFR 128-1.100 - Scope of subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Scope of subpart. 128-1... System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.1-Regulation System § 128-1.100 Scope of... of the Federal Property Management Regulations System (FPMR) (41 CFR part 101); states its...

  13. 23 CFR 1.28 - Diversion of highway revenues.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Diversion of highway revenues. 1.28 Section 1.28 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL MANAGEMENT AND ADMINISTRATION..., secondary and urban funds made to the State after the date of such finding. In any such reduction, each of...

  14. Use of mouse models to study the mechanisms and consequences of RBC clearance

    PubMed Central

    Hod, E. A.; Arinsburg, S. A.; Francis, R. O.; Hendrickson, J. E.; Zimring, J. C.; Spitalnik, S. L.

    2013-01-01

    Mice provide tractable animal models for studying the pathophysiology of various human disorders. This review discusses the use of mouse models for understanding red-blood-cell (RBC) clearance. These models provide important insights into the pathophysiology of various clinically relevant entities, such as autoimmune haemolytic anaemia, haemolytic transfusion reactions, other complications of RBC transfusions and immunomodulation by Rh immune globulin therapy. Mouse models of both antibody- and non-antibody-mediated RBC clearance are reviewed. Approaches for exploring unanswered questions in transfusion medicine using these models are also discussed. PMID:20345515

  15. Establishment of mouse neuron and microglial cell co-cultured models and its action mechanism.

    PubMed

    Zhang, Bo; Yang, Yunfeng; Tang, Jun; Tao, Yihao; Jiang, Bing; Chen, Zhi; Feng, Hua; Yang, Liming; Zhu, Gang

    2017-06-27

    The objective of this study is to establish a co-culture model of mouse neurons and microglial cells, and to analyze the mechanism of action of oxygen glucose deprivation (OGD) and transient oxygen glucose deprivation (tOGD) preconditioning cell models. Mouse primary neurons and BV2 microglial cells were successfully cultured, and the OGD and tOGD models were also established. In the co-culture of mouse primary neurons and microglial cells, the cell number of tOGD mouse neurons and microglial cells was larger than the OGD cell number, observed by a microscope. CCK-8 assay result showed that at 1h after treatment, the OD value in the control group is lower compared to all the other three groups (P < 0.05). The treatment group exhibited the highest OD value among the four groups. The results observed at 5h were consistent with the results at 1 h. Flow cytometry results showed that at 1h after treatment the apoptosis percentages is higher in the control group compared to other three groups (P < 0.05). Mouse brain tissues were collected and primary neurons cells were cultured. In the meantime mouse BV2 microglia cells were cultured. Two types of cells were co-cultured, and OGD and tOGD cell models were established. There were four groups in the experiment: control group (OGD), treatment group (tOGD+OGD), placebo group (tOGD+OGD+saline) and minocycline intervention group (tOGD+OGD+minocycline). CCK-8 kit was used to detect cell viability and flow cytometry was used to detect apoptosis. In this study, mouse primary neurons and microglial cells were co-cultured. The OGD and tOGD models were established successfully. tOGD was able to effectively protect neurons and microglial cells from damage, and inhibit the apoptosis caused by oxygen glucose deprivation.

  16. 7 CFR 1280.128 - Wool.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE LAMB PROMOTION, RESEARCH, AND INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.128 Wool. Wool means fiber from the fleece of a lamb. ...

  17. 41 CFR 128-50.100 - Storage and care.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 41 Public Contracts and Property Management 3 2013-07-01 2013-07-01 false Storage and care. 128-50... Regulations System (Continued) DEPARTMENT OF JUSTICE 50-SEIZED PERSONAL PROPERTY 50.1-Storage and Care of Seized Personal Property § 128-50.100 Storage and care. (a) Each bureau shall be responsible for...

  18. 41 CFR 128-50.100 - Storage and care.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 41 Public Contracts and Property Management 3 2012-01-01 2012-01-01 false Storage and care. 128-50... Regulations System (Continued) DEPARTMENT OF JUSTICE 50-SEIZED PERSONAL PROPERTY 50.1-Storage and Care of Seized Personal Property § 128-50.100 Storage and care. (a) Each bureau shall be responsible for...

  19. 41 CFR 128-50.100 - Storage and care.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Storage and care. 128-50... Regulations System (Continued) DEPARTMENT OF JUSTICE 50-SEIZED PERSONAL PROPERTY 50.1-Storage and Care of Seized Personal Property § 128-50.100 Storage and care. (a) Each bureau shall be responsible for...

  20. 41 CFR 128-50.100 - Storage and care.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Storage and care. 128-50... Regulations System (Continued) DEPARTMENT OF JUSTICE 50-SEIZED PERSONAL PROPERTY 50.1-Storage and Care of Seized Personal Property § 128-50.100 Storage and care. (a) Each bureau shall be responsible for...

  1. Behavioral assays with mouse models of Alzheimer’s disease: practical considerations and guidelines

    PubMed Central

    Puzzo, Daniela; Lee, Linda; Palmeri, Agostino; Calabrese, Giorgio; Arancio, Ottavio

    2014-01-01

    In Alzheimer’s disease (AD) basic research and drug discovery, mouse models are essential resources for uncovering biological mechanisms, validating molecular targets and screening potential compounds. Both transgenic and non-genetically modified mouse models enable access to different types of AD-like pathology in vivo. Although there is a wealth of genetic and biochemical studies on proposed AD pathogenic pathways, as a disease that centrally features cognitive failure, the ultimate readout for any interventions should be measures of learning and memory. This is particularly important given the lack of knowledge on disease etiology – assessment by cognitive assays offers the advantage of targeting relevant memory systems without requiring assumptions about pathogenesis. A multitude of behavioral assays are available for assessing cognitive functioning in mouse models, including ones specific for hippocampal-dependent learning and memory. Here we review the basics of available transgenic and non-transgenic AD mouse models and detail three well-established behavioral tasks commonly used for testing hippocampal-dependent cognition in mice – contextual fear conditioning, radial arm water maze and Morris water maze. In particular, we discuss the practical considerations, requirements and caveats of these behavioral testing paradigms. PMID:24462904

  2. Effect of Toxoplasma lysate antigen (TLA) on feline cytotoxicity against FeLV positive lymphoma cells.

    PubMed

    Yang, M P; Goitsuka, R; Ono, K; Suzuki, N; Hasegawa, A

    1990-08-01

    The cytotoxic activities of feline spleen cells treated with Toxoplasma lysate antigen (TLA) were assayed against feline leukemia virus (FeLV)-producing lymphoma. FL74 cells, and xenogeneic target lymphoma, mouse YAC-1 cells. The TLA treatments were performed in vivo alone, in vitro alone, and in vivo plus in vitro, respectively. In vivo plus in vitro treatments with TLA induced a marked augmentation in cytotoxic activity of spleen cells to FL74 cells. The treatment with TLA in vivo alone showed an enhancement of cytotoxic activity but in vitro alone did not. The cytotoxic effects of TLA-treated spleen cells obtained from the cats which had been previously immunized with live FL74 cells were similar to those of spleen cells from non-immunized cats treated with TLA. However, no increase of cytotoxicity was shown in the response to mouse YAC-1 cells regardless of TLA treatments. These results indicated that the in vivo TLA treatment augmented the cytotoxicity of feline spleen cells against FeLV-producing lymphoma cell.

  3. Using Genetic Mouse Models to Gain Insight into Glaucoma: Past Results and Future Possibilities

    PubMed Central

    Fernandes, Kimberly A.; Harder, Jeffrey M.; Williams, Pete A.; Rausch, Rebecca L.; Kiernan, Amy E.; Nair, K. Saidas; Anderson, Michael G.; John, Simon W.; Howell, Gareth R.; Libby, Richard T.

    2015-01-01

    While all forms of glaucoma are characterized by a specific pattern of retinal ganglion cell death, they are clinically divided into several distinct subclasses, including normal tension glaucoma, primary open angle glaucoma, congenital glaucoma, and secondary glaucoma. For each type of glaucoma there are likely numerous molecular pathways that control susceptibility to the disease. Given this complexity, a single animal model will never precisely model all aspects of all the different types of human glaucoma. Therefore, multiple animal models have been utilized to study glaucoma but more are needed. Because of the powerful genetic tools available to use in the laboratory mouse, it has proven to be a highly useful mammalian system for studying the pathophysiology of human disease. The similarity between human and mouse eyes coupled with the ability to use a combination of advanced cell biological and genetic tools in mice have led to a large increase in the number of studies using mice to model specific glaucoma phenotypes. Over the last decade, numerous new mouse models and genetic tools have emerged, providing important insight into the cell biology and genetics of glaucoma. In this review, we describe available mouse genetic models that can be used to study glaucoma-relevant disease/pathobiology. Furthermore, we discuss how these models have been used to gain insights into ocular hypertension (a major risk factor for glaucoma) and glaucomatous retinal ganglion cell death. Finally, the potential for developing new mouse models and using advanced genetic tools and resources for studying glaucoma are discussed. PMID:26116903

  4. Mouse Models for Investigating the Developmental Bases of Human Birth Defects

    PubMed Central

    MOON, ANNE M.

    2006-01-01

    Clinicians and basic scientists share an interest in discovering how genetic or environmental factors interact to perturb normal development and cause birth defects and human disease. Given the complexity of such interactions, it is not surprising that 4% of human infants are born with a congenital malformation, and cardiovascular defects occur in nearly 1%. Our research is based on the fundamental hypothesis that an understanding of normal and abnormal development will permit us to generate effective strategies for both prevention and treatment of human birth defects. Animal models are invaluable in these efforts because they allow one to interrogate the genetic, molecular and cellular events that distinguish normal from abnormal development. Several features of the mouse make it a particularly powerful experimental model: it is a mammalian system with similar embryology, anatomy and physiology to humans; genes, proteins and regulatory programs are largely conserved between human and mouse; and finally, gene targeting in murine embryonic stem cells has made the mouse genome amenable to sophisticated genetic manipulation currently unavailable in any other model organism. PMID:16641221

  5. Mouse phenotyping.

    PubMed

    Fuchs, Helmut; Gailus-Durner, Valérie; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Becker, Lore; Calzada-Wack, Julia; Da Silva-Buttkus, Patricia; Neff, Frauke; Götz, Alexander; Hans, Wolfgang; Hölter, Sabine M; Horsch, Marion; Kastenmüller, Gabi; Kemter, Elisabeth; Lengger, Christoph; Maier, Holger; Matloka, Mikolaj; Möller, Gabriele; Naton, Beatrix; Prehn, Cornelia; Puk, Oliver; Rácz, Ildikó; Rathkolb, Birgit; Römisch-Margl, Werner; Rozman, Jan; Wang-Sattler, Rui; Schrewe, Anja; Stöger, Claudia; Tost, Monica; Adamski, Jerzy; Aigner, Bernhard; Beckers, Johannes; Behrendt, Heidrun; Busch, Dirk H; Esposito, Irene; Graw, Jochen; Illig, Thomas; Ivandic, Boris; Klingenspor, Martin; Klopstock, Thomas; Kremmer, Elisabeth; Mempel, Martin; Neschen, Susanne; Ollert, Markus; Schulz, Holger; Suhre, Karsten; Wolf, Eckhard; Wurst, Wolfgang; Zimmer, Andreas; Hrabě de Angelis, Martin

    2011-02-01

    Model organisms like the mouse are important tools to learn more about gene function in man. Within the last 20 years many mutant mouse lines have been generated by different methods such as ENU mutagenesis, constitutive and conditional knock-out approaches, knock-down, introduction of human genes, and knock-in techniques, thus creating models which mimic human conditions. Due to pleiotropic effects, one gene may have different functions in different organ systems or time points during development. Therefore mutant mouse lines have to be phenotyped comprehensively in a highly standardized manner to enable the detection of phenotypes which might otherwise remain hidden. The German Mouse Clinic (GMC) has been established at the Helmholtz Zentrum München as a phenotyping platform with open access to the scientific community (www.mousclinic.de; [1]). The GMC is a member of the EUMODIC consortium which created the European standard workflow EMPReSSslim for the systemic phenotyping of mouse models (http://www.eumodic.org/[2]). Copyright © 2010 Elsevier Inc. All rights reserved.

  6. A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN

    DTIC Science & Technology

    2014-09-01

    AWARD NUMBER: W81XWH-13-1-0220 TITLE: A Genetically Engineered Mouse Model of Neuroblastoma ...CONTRACT NUMBER A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN 5b. GRANT NUMBER W81XWH-13-1-0220 5c...common ALK mutations in neuroblastoma , F1174L and R1275Q. We have determined that in tumors cells expressing mutated ALK, different downstream

  7. STS-128 Administrator Visit

    NASA Image and Video Library

    2009-11-03

    NASA Administrator Charles F. Bolden, left, Deputy Administrator Lori Garver, along with Assistant Administrator for Legislative and Intergovernmental Affairs L. Seth Statler, meet with STS-128 astronauts Patrick Forrester, Jose Hernandez and Christer Fugelsang, of the European Space Agency, at NASA Headquarters, Tuesday, Nov. 3, 2009, in Washington. Photo Credit: (NASA/Paul E. Alers)

  8. Mouse Models for Drug Discovery. Can New Tools and Technology Improve Translational Power?

    PubMed

    Zuberi, Aamir; Lutz, Cathleen

    2016-12-01

    The use of mouse models in biomedical research and preclinical drug evaluation is on the rise. The advent of new molecular genome-altering technologies such as CRISPR/Cas9 allows for genetic mutations to be introduced into the germ line of a mouse faster and less expensively than previous methods. In addition, the rapid progress in the development and use of somatic transgenesis using viral vectors, as well as manipulations of gene expression with siRNAs and antisense oligonucleotides, allow for even greater exploration into genomics and systems biology. These technological advances come at a time when cost reductions in genome sequencing have led to the identification of pathogenic mutations in patient populations, providing unprecedented opportunities in the use of mice to model human disease. The ease of genetic engineering in mice also offers a potential paradigm shift in resource sharing and the speed by which models are made available in the public domain. Predictively, the knowledge alone that a model can be quickly remade will provide relief to resources encumbered by licensing and Material Transfer Agreements. For decades, mouse strains have provided an exquisite experimental tool to study the pathophysiology of the disease and assess therapeutic options in a genetically defined system. However, a major limitation of the mouse has been the limited genetic diversity associated with common laboratory mice. This has been overcome with the recent development of the Collaborative Cross and Diversity Outbred mice. These strains provide new tools capable of replicating genetic diversity to that approaching the diversity found in human populations. The Collaborative Cross and Diversity Outbred strains thus provide a means to observe and characterize toxicity or efficacy of new therapeutic drugs for a given population. The combination of traditional and contemporary mouse genome editing tools, along with the addition of genetic diversity in new modeling systems

  9. Mouse Models for Drug Discovery. Can New Tools and Technology Improve Translational Power?

    PubMed Central

    Zuberi, Aamir; Lutz, Cathleen

    2016-01-01

    Abstract The use of mouse models in biomedical research and preclinical drug evaluation is on the rise. The advent of new molecular genome-altering technologies such as CRISPR/Cas9 allows for genetic mutations to be introduced into the germ line of a mouse faster and less expensively than previous methods. In addition, the rapid progress in the development and use of somatic transgenesis using viral vectors, as well as manipulations of gene expression with siRNAs and antisense oligonucleotides, allow for even greater exploration into genomics and systems biology. These technological advances come at a time when cost reductions in genome sequencing have led to the identification of pathogenic mutations in patient populations, providing unprecedented opportunities in the use of mice to model human disease. The ease of genetic engineering in mice also offers a potential paradigm shift in resource sharing and the speed by which models are made available in the public domain. Predictively, the knowledge alone that a model can be quickly remade will provide relief to resources encumbered by licensing and Material Transfer Agreements. For decades, mouse strains have provided an exquisite experimental tool to study the pathophysiology of the disease and assess therapeutic options in a genetically defined system. However, a major limitation of the mouse has been the limited genetic diversity associated with common laboratory mice. This has been overcome with the recent development of the Collaborative Cross and Diversity Outbred mice. These strains provide new tools capable of replicating genetic diversity to that approaching the diversity found in human populations. The Collaborative Cross and Diversity Outbred strains thus provide a means to observe and characterize toxicity or efficacy of new therapeutic drugs for a given population. The combination of traditional and contemporary mouse genome editing tools, along with the addition of genetic diversity in new modeling

  10. Characterization of individual mouse cerebrospinal fluid proteomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smith, Jeffrey S.; Angel, Thomas E.; Chavkin, Charles

    2014-03-20

    Analysis of cerebrospinal fluid (CSF) offers key insight into the status of the central nervous system. Characterization of murine CSF proteomes can provide a valuable resource for studying central nervous system injury and disease in animal models. However, the small volume of CSF in mice has thus far limited individual mouse proteome characterization. Through non-terminal CSF extractions in C57Bl/6 mice and high-resolution liquid chromatography-mass spectrometry analysis of individual murine samples, we report the most comprehensive proteome characterization of individual murine CSF to date. Utilizing stringent protein inclusion criteria that required the identification of at least two unique peptides (1% falsemore » discovery rate at the peptide level) we identified a total of 566 unique proteins, including 128 proteins from three individual CSF samples that have been previously identified in brain tissue. Our methods and analysis provide a mechanism for individual murine CSF proteome analysis.« less

  11. Validation of the Glaucoma Filtration Surgical Mouse Model for Antifibrotic Drug Evaluation

    PubMed Central

    Seet, Li-Fong; Lee, Wing Sum; Su, Roseline; Finger, Sharon N; Crowston, Jonathan G; Wong, Tina T

    2011-01-01

    Glaucoma is a progressive optic neuropathy, which, if left untreated, leads to blindness. The most common and most modifiable risk factor in glaucoma is elevated intraocular pressure (IOP), which can be managed surgically by filtration surgery. The postoperative subconjunctival scarring response, however, remains the major obstacle to achieving long-term surgical success. Antiproliferatives such as mitomycin C are commonly used to prevent postoperative scarring. Efficacy of these agents has been tested extensively on monkey and rabbit models of glaucoma filtration surgery. As these models have inherent limitations, we have developed a model of glaucoma filtration surgery in the mouse. We show, for the first time, that the mouse model typically scarred within 14 d, but when augmented with mitomycin C, more animals maintained lower intraocular pressures for a longer period of time concomitant with prolonged bleb survival to beyond 28 d. The morphology of the blebs following mitomycin C treatment also resembled well-documented clinical observations, thus confirming the validity and clinical relevance of this model. We demonstrate that the antiscarring response to mitomycin C is likely to be due to its effects on conjunctival fibroblast proliferation, apoptosis and collagen deposition and the suppression of inflammation. Indeed, we verified some of these properties on mouse conjunctival fibroblasts cultured in vitro. These data support the suitability of this mouse model for studying the wound healing response in glaucoma filtration surgery, and as a potentially useful tool for the in vivo evaluation of antifibrotic therapeutics in the eye. PMID:21229189

  12. Ultrasonic vocalizations: a tool for behavioural phenotyping of mouse models of neurodevelopmental disorders

    PubMed Central

    Scattoni, Maria Luisa; Crawley, Jacqueline; Ricceri, Laura

    2009-01-01

    In neonatal mice ultrasonic vocalizations have been studied both as an early communicative behavior of the pup-mother dyad and as a sign of an aversive affective state. Adult mice of both sexes produce complex ultrasonic vocalization patterns in different experimental/social contexts. All these vocalizations are becoming an increasingly valuable assay for behavioral phenotyping throughout the mouse life-span and alterations of the ultrasound patterns have been reported in several mouse models of neurodevelopmental disorders. Here we also show that the modulation of vocalizations by maternal cues (maternal potentiation paradigm) – originally identified and investigated in rats - can be measured in C57Bl/6 mouse pups with appropriate modifications of the rat protocol and can likely be applied to mouse behavioral phenotyping. In addition we suggest that a detailed qualitative evaluation of neonatal calls together with analysis of adult mouse vocalization patterns in both sexes in social settings, may lead to a greater understanding of the communication value of vocalizations in mice. Importantly, both neonatal and adult USV altered patterns can be determined during the behavioural phenotyping of mouse models of human neurodevelopmental and neuropsychiatric disorders, starting from those in which deficits in communication are a primary symptom. PMID:18771687

  13. 23 CFR 1.28 - Diversion of highway revenues.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 23 Highways 1 2014-04-01 2014-04-01 false Diversion of highway revenues. 1.28 Section 1.28... that any State has diverted funds contrary to 23 U.S.C. 126, he shall take such action as he may deem... Secretary in carrying out the provisions of 23 U.S.C. 126 and paragraph (a) of this section. ...

  14. 23 CFR 1.28 - Diversion of highway revenues.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 23 Highways 1 2011-04-01 2011-04-01 false Diversion of highway revenues. 1.28 Section 1.28... that any State has diverted funds contrary to 23 U.S.C. 126, he shall take such action as he may deem... Secretary in carrying out the provisions of 23 U.S.C. 126 and paragraph (a) of this section. ...

  15. 23 CFR 1.28 - Diversion of highway revenues.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 23 Highways 1 2013-04-01 2013-04-01 false Diversion of highway revenues. 1.28 Section 1.28... that any State has diverted funds contrary to 23 U.S.C. 126, he shall take such action as he may deem... Secretary in carrying out the provisions of 23 U.S.C. 126 and paragraph (a) of this section. ...

  16. Integrating model behavior, optimization, and sensitivity/uncertainty analysis: overview and application of the MOUSE software toolbox

    USDA-ARS?s Scientific Manuscript database

    This paper provides an overview of the Model Optimization, Uncertainty, and SEnsitivity Analysis (MOUSE) software application, an open-source, Java-based toolbox of visual and numerical analysis components for the evaluation of environmental models. MOUSE is based on the OPTAS model calibration syst...

  17. 17 CFR 1.28 - Appraisal of instruments purchased with customer funds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... purchased with customer funds. 1.28 Section 1.28 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION GENERAL REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Customers' Money, Securities, and Property § 1.28 Appraisal of instruments purchased with customer funds. Futures commission merchants who...

  18. STS-128 Administrator Visit

    NASA Image and Video Library

    2009-11-03

    NASA Administrator Charles F. Bolden, left, and Deputy Administrator Lori Garver along with Assistant Administrator for Legislative and Intergovernmental Affairs L. Seth Statler, seated right, meet with STS-128 astronauts Patrick Forrester, Jose Hernandez and Christer Fugelsang, of the European Space Agency, at NASA Headquarters, Tuesday, Nov. 3, 2009, in Washington. Photo Credit: (NASA/Paul E. Alers)

  19. Nucleotide excision repair deficient mouse models and neurological disease

    PubMed Central

    Niedernhofer, Laura J.

    2008-01-01

    Nucleotide excision repair (NER) is a highly conserved mechanism to remove helix-distorting DNA base damage. A major substrate for NER is DNA damage caused by environmental genotoxins, most notably ultraviolet radiation. Xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy are three human diseases caused by inherited defects in NER. The symptoms and severity of these diseases vary dramatically, ranging from profound developmental delay to cancer predisposition and accelerated aging. All three syndromes include neurological disease, indicating an important role for NER in protecting against spontaneous DNA damage as well. To study the pathophysiology caused by DNA damage, numerous mouse models of NER deficiency were generated by knocking-out genes required for NER or knocking-in disease-causing human mutations. This review explores the utility of these mouse models to study neurological disease caused by NER deficiency. PMID:18272436

  20. Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix.

    PubMed

    Inoguchi, Noriko; Oshlo, Jake R; Natarajan, Chandrasekhar; Weber, Roy E; Fago, Angela; Storz, Jay F; Moriyama, Hideaki

    2013-04-01

    The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128.

  1. Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix

    PubMed Central

    Inoguchi, Noriko; Oshlo, Jake R.; Natarajan, Chandrasekhar; Weber, Roy E.; Fago, Angela; Storz, Jay F.; Moriyama, Hideaki

    2013-01-01

    The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128. PMID:23545644

  2. Biology and therapy of inherited retinal degenerative disease: insights from mouse models

    PubMed Central

    Veleri, Shobi; Lazar, Csilla H.; Chang, Bo; Sieving, Paul A.; Banin, Eyal; Swaroop, Anand

    2015-01-01

    Retinal neurodegeneration associated with the dysfunction or death of photoreceptors is a major cause of incurable vision loss. Tremendous progress has been made over the last two decades in discovering genes and genetic defects that lead to retinal diseases. The primary focus has now shifted to uncovering disease mechanisms and designing treatment strategies, especially inspired by the successful application of gene therapy in some forms of congenital blindness in humans. Both spontaneous and laboratory-generated mouse mutants have been valuable for providing fundamental insights into normal retinal development and for deciphering disease pathology. Here, we provide a review of mouse models of human retinal degeneration, with a primary focus on diseases affecting photoreceptor function. We also describe models associated with retinal pigment epithelium dysfunction or synaptic abnormalities. Furthermore, we highlight the crucial role of mouse models in elucidating retinal and photoreceptor biology in health and disease, and in the assessment of novel therapeutic modalities, including gene- and stem-cell-based therapies, for retinal degenerative diseases. PMID:25650393

  3. Mouse Models as Tools to Identify Genetic Pathways for Retinal Degeneration, as Exemplified by Leber's Congenital Amaurosis.

    PubMed

    Chang, Bo

    2016-01-01

    Leber's congenital amaurosis (LCA) is an inherited retinal degenerative disease characterized by severe loss of vision in the first year of life. In addition to early vision loss, a variety of other eye-related abnormalities including roving eye movements, deep-set eyes, and sensitivity to bright light also occur with this disease. Many animal models of LCA are available and the study them has led to a better understanding of the pathology of the disease, and has led to the development of therapeutic strategies aimed at curing or slowing down LCA. Mouse models, with their well-developed genetics and similarity to human physiology and anatomy, serve as powerful tools with which to investigate the etiology of human LCA. Such mice provide reproducible, experimental systems for elucidating pathways of normal development, function, designing strategies and testing compounds for translational research and gene-based therapies aimed at delaying the diseases progression. In this chapter, I describe tools used in the discovery and evaluation of mouse models of LCA including a Phoenix Image-Guided Optical Coherence Tomography (OCT) and a Diagnosys Espion Visual Electrophysiology System. Three mouse models are described, the rd3 mouse model for LCA12 and LCA1, the rd12 mouse model for LCA2, and the rd16 mouse model for LCA10.

  4. Bacteriophage-derived CHAP domain protein, P128, kills Staphylococcus cells by cleaving interpeptide cross-bridge of peptidoglycan.

    PubMed

    Sundarrajan, Sudarson; Raghupatil, Junjappa; Vipra, Aradhana; Narasimhaswamy, Nagalakshmi; Saravanan, Sanjeev; Appaiah, Chemira; Poonacha, Nethravathi; Desai, Srividya; Nair, Sandhya; Bhatt, Rajagopala Narayana; Roy, Panchali; Chikkamadaiah, Ravisha; Durgaiah, Murali; Sriram, Bharathi; Padmanabhan, Sriram; Sharma, Umender

    2014-10-01

    P128 is an anti-staphylococcal protein consisting of the Staphylococcus aureus phage-K-derived tail-associated muralytic enzyme (TAME) catalytic domain (Lys16) fused with the cell-wall-binding SH3b domain of lysostaphin. In order to understand the mechanism of action and emergence of resistance to P128, we isolated mutants of Staphylococcus spp., including meticillin-resistant Staphylococcus aureus (MRSA), resistant to P128. In addition to P128, the mutants also showed resistance to Lys16, the catalytic domain of P128. The mutants showed loss of fitness as shown by reduced rate of growth in vitro. One of the mutants tested was found to show reduced virulence in animal models of S. aureus septicaemia suggesting loss of fitness in vivo as well. Analysis of the antibiotic sensitivity pattern showed that the mutants derived from MRSA strains had become sensitive to meticillin and other β-lactams. Interestingly, the mutant cells were resistant to the lytic action of phage K, although the phage was able to adsorb to these cells. Sequencing of the femA gene of three P128-resistant mutants showed either a truncation or deletion in femA, suggesting that improper cross-bridge formation in S. aureus could be causing resistance to P128. Using glutathione S-transferase (GST) fusion peptides as substrates it was found that both P128 and Lys16 were capable of cleaving a pentaglycine sequence, suggesting that P128 might be killing S. aureus by cleaving the pentaglycine cross-bridge of peptidoglycan. Moreover, peptides corresponding to the reported cross-bridge of Staphylococcus haemolyticus (GGSGG, AGSGG), which were not cleaved by lysostaphin, were cleaved efficiently by P128. This was also reflected in high sensitivity of S. haemolyticus to P128. This showed that in spite of sharing a common mechanism of action with lysostaphin, P128 has unique properties, which allow it to act on certain lysostaphin-resistant Staphylococcus strains. © 2014 The Authors.

  5. Transcranial magnetic stimulation of mouse brain using high-resolution anatomical models

    NASA Astrophysics Data System (ADS)

    Crowther, L. J.; Hadimani, R. L.; Kanthasamy, A. G.; Jiles, D. C.

    2014-05-01

    Transcranial magnetic stimulation (TMS) offers the possibility of non-invasive treatment of brain disorders in humans. Studies on animals can allow rapid progress of the research including exploring a variety of different treatment conditions. Numerical calculations using animal models are needed to help design suitable TMS coils for use in animal experiments, in particular, to estimate the electric field induced in animal brains. In this paper, we have implemented a high-resolution anatomical MRI-derived mouse model consisting of 50 tissue types to accurately calculate induced electric field in the mouse brain. Magnetic field measurements have been performed on the surface of the coil and compared with the calculations in order to validate the calculated magnetic and induced electric fields in the brain. Results show how the induced electric field is distributed in a mouse brain and allow investigation of how this could be improved for TMS studies using mice. The findings have important implications in further preclinical development of TMS for treatment of human diseases.

  6. In vivo characterization of a bigenic fluorescent mouse model of Alzheimer's disease with neurodegeneration.

    PubMed

    Crowe, Sarah E; Ellis-Davies, Graham C R

    2013-07-01

    The loss of cognitive function in Alzheimer's disease (AD) patients is strongly correlated with the loss of neurons in various regions of the brain. We have created a new fluorescent bigenic mouse model of AD by crossing "H-line" yellow fluorescent protein (YFP) mice with the 5xFAD mouse model, which we call the 5XY mouse model. The 5xFAD mouse has been shown to have significant loss of L5 pyramidal neurons by 12 months of age. These neurons are transgenically labeled with YFP in the 5XY mouse, which enable longitudinal imaging of structural changes. In the 5XY mice, we observed an appearance of axonal dystrophies, with two distinct morphologies in the early stages of the disease progression. Simple swelling dystrophies are transient in nature and are not directly associated with amyloid plaques. Rosette dystrophies are more complex structures that remained stable throughout all imaging sessions, and always surrounded an amyloid plaque. Plaque growth was followed over 4 weeks, and significant growth was seen between weekly imaging sessions. In addition to axonal dystrophy appearance and plaque growth, we were able to follow spine stability in 4-month old 5XY mice, which revealed no significant loss of spines. 5XY mice also showed a striking shrinkage of the neocortex at older ages (12-14 months). The 5XY mouse model may be a valuable tool for studying specific events in the degeneration of the neocortex, and may suggest new avenues for therapeutic intervention. Copyright © 2013 Wiley Periodicals, Inc.

  7. Impaired spatial processing in a mouse model of fragile X syndrome.

    PubMed

    Ghilan, Mohamed; Bettio, Luis E B; Noonan, Athena; Brocardo, Patricia S; Gil-Mohapel, Joana; Christie, Brian R

    2018-05-17

    Fragile X syndrome (FXS) is the most common form of inherited intellectual impairment. The Fmr1 -/y mouse model has been previously shown to have deficits in context discrimination tasks but not in the elevated plus-maze. To further characterize this FXS mouse model and determine whether hippocampal-mediated behaviours are affected in these mice, dentate gyrus (DG)-dependent spatial processing and Cornu ammonis 1 (CA1)-dependent temporal order discrimination tasks were evaluated. In agreement with previous findings of long-term potentiation deficits in the DG of this transgenic model of FXS, the results reported here demonstrate that Fmr1 -/y mice perform poorly in the DG-dependent metric change spatial processing task. However, Fmr1 -/y mice did not present deficits in the CA1-dependent temporal order discrimination task, and were able to remember the order in which objects were presented to them to the same extent as their wild-type littermate controls. These data suggest that the previously reported subregional-specific differences in hippocampal synaptic plasticity observed in the Fmr1 -/y mouse model may manifest as selective behavioural deficits in hippocampal-dependent tasks. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  8. Discovery of cancer biomarkers through the use of mouse models.

    PubMed

    Kuick, Rork; Misek, David E; Monsma, David J; Webb, Craig P; Wang, Hong; Peterson, Kelli J; Pisano, Michael; Omenn, Gilbert S; Hanash, Samir M

    2007-04-28

    Although our understanding of the molecular pathogenesis of common types of cancer has improved considerably, the development of effective strategies for cancer diagnosis and treatment have lagged behind. Mouse models of cancer potentially represent an efficient means for uncovering diagnostic markers as genetic alterations associated with human tumors can be engineered in mice. In addition, defined stages of tumor development, breeding conditions, and blood sampling can all be controlled and standardized to limit heterogeneity. Alternatively human cancer cells can be injected into mice and tumor development monitored in xenotransplants. Mouse-based studies promise to elucidate a repertoire of protein changes that occur in blood and biological fluids during tumor development. This is illustrated in a study in which we have applied a three-dimensional intact protein analysis system (IPAS) to elucidate detectable protein changes in serum from immunodeficient mice with lung xenografts from orthotopically implanted human A549 lung adenocarcinoma cells. With sufficiently detailed protein sequence identifications, the observed protein changes can be attributed to either the host mouse or the human tumor cells. It is noteworthy that the majority of increases identified have corresponded to relatively abundant serum proteins, some of which have previously been reported as increased in the sera of cancer patients. Proteomic studies of mouse models of cancer allow assessment of the range of changes in plasma proteins that occur with tumor development and may lead to the identification of potential cancer markers applicable to humans.

  9. ISBT 128 Standard for Coding Medical Products of Human Origin

    PubMed Central

    Ashford, Paul; Delgado, Matthew

    2017-01-01

    Background ISBT 128 is an international standard for the terminology, coding, labeling, and identification of medical products of human origin (MPHO). Full implementation of ISBT 128 improves traceability, transparency, vigilance and surveillance, and interoperability. Methods ICCBBA maintains the ISBT 128 standard through the activities of a network of expert volunteers, including representatives from professional scientific societies, governments and users, to standardize and maintain MPHO identification. These individuals are organized into Technical Advisory Groups and work within a structured framework as part of a quality-controlled standards development process. Results The extensive involvement of international scientific and professional societies in the development of the standard has ensured that ISBT 128 has gained widespread recognition. The user community has developed confidence in the ability of the standard to adapt to new developments in their fields of interest. The standard is fully compatible with Single European Code requirements for tissues and cells and is utilized by many European tissue establishments. ISBT 128's flexibility and robustness has allowed for expansions into subject areas such as cellular therapy, regenerative medicine, and tissue banking. Conclusion ISBT 128 is the internationally recognized standard for coding MPHO and has gained widespread use globally throughout the past two decades. PMID:29344013

  10. 41 CFR 128-1.5003 - Primary authority and responsibility.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Primary authority and responsibility. 128-1.5003 Section 128-1.5003 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.50-Authorities and...

  11. 38 CFR 4.128 - Convalescence ratings following extended hospitalization.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Convalescence ratings following extended hospitalization. 4.128 Section 4.128 Pensions, Bonuses, and Veterans' Relief DEPARTMENT... Convalescence ratings following extended hospitalization. If a mental disorder has been assigned a total...

  12. 38 CFR 4.128 - Convalescence ratings following extended hospitalization.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2012-07-01 2012-07-01 false Convalescence ratings following extended hospitalization. 4.128 Section 4.128 Pensions, Bonuses, and Veterans' Relief DEPARTMENT... Convalescence ratings following extended hospitalization. If a mental disorder has been assigned a total...

  13. 38 CFR 4.128 - Convalescence ratings following extended hospitalization.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2011-07-01 2011-07-01 false Convalescence ratings following extended hospitalization. 4.128 Section 4.128 Pensions, Bonuses, and Veterans' Relief DEPARTMENT... Convalescence ratings following extended hospitalization. If a mental disorder has been assigned a total...

  14. 38 CFR 4.128 - Convalescence ratings following extended hospitalization.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2013-07-01 2013-07-01 false Convalescence ratings following extended hospitalization. 4.128 Section 4.128 Pensions, Bonuses, and Veterans' Relief DEPARTMENT... Convalescence ratings following extended hospitalization. If a mental disorder has been assigned a total...

  15. 38 CFR 4.128 - Convalescence ratings following extended hospitalization.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2014-07-01 2014-07-01 false Convalescence ratings following extended hospitalization. 4.128 Section 4.128 Pensions, Bonuses, and Veterans' Relief DEPARTMENT... Convalescence ratings following extended hospitalization. If a mental disorder has been assigned a total...

  16. New animal models to study the role of tyrosinase in normal retinal development.

    PubMed

    Lavado, Alfonso; Montoliu, Lluis

    2006-01-01

    Albino animals display a hypopigmented phenotype associated with several visual abnormalities, including rod photoreceptor cell deficits, abnormal patterns of connections between the eye and the brain and a general underdevelopment of central retina. Oculocutaneous albinism type I, a common form of albinism, is caused by mutations in the tyrosinase gene. In mice, the albino phenotype can be corrected by functional tyrosinase transgenes. Tyrosinase transgenic animals not only show normal pigmentation but the correction of all visual abnormalities associated with albinism, confirming a role of tyrosinase, a key enzyme in melanin biosynthesis, in normal retinal development. Here, we will discuss recent work carried out with new tyrosinase transgenic mouse models, to further analyse the role of tyrosinase in retinal development. We will first report a transgenic model with inducible tyrosinase expression that has been used to address the regulated activation of this gene and its associated effects on the development of the visual system. Second, we will comment on an interesting yeast artificial chromosome (YAC)-tyrosinase transgene, lacking important regulatory elements, that has highlighted the significance of local interactions between the retinal pigment epithelium (RPE) and developing neural retina.

  17. Genetically Engineered Humanized Mouse Models for Preclinical Antibody Studies

    PubMed Central

    Proetzel, Gabriele; Wiles, Michael V.; Roopenian, Derry C.

    2015-01-01

    The use of genetic engineering has vastly improved our capabilities to create animal models relevant in preclinical research. With the recent advances in gene-editing technologies, it is now possible to very rapidly create highly tunable mouse models as needs arise. Here, we provide an overview of genetic engineering methods, as well as the development of humanized neonatal Fc receptor (FcRn) models and their use for monoclonal antibody in vivo studies. PMID:24150980

  18. CHARACTERIZATION OF AEROMONAS VIRULENCE USING AN IMMUNOCOMPROMISED MOUSE MODEL

    EPA Science Inventory

    An immunocompromised mouse model was used to characterize Aeromonas strains for their ability to cause opportunistic, extraintestinal infections. A total of 34 isolates of Aeromonas (A. hydrophila [n = 12]), A. veronii biotype sobria [n = 7], A. caviae [n = 4], A. enchelia [n = 4...

  19. 33 CFR 110.128d - Island of Oahu, Hawaii. (Datum: OHD)

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Island of Oahu, Hawaii. (Datum: OHD) 110.128d Section 110.128d Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.128d Island of Oahu, Hawaii. (Datum...

  20. Physiologically Based Pharmacokinetic (PBPK) Modeling of Interstrain Variability in Trichloroethylene Metabolism in the Mouse

    PubMed Central

    Campbell, Jerry L.; Clewell, Harvey J.; Zhou, Yi-Hui; Wright, Fred A.; Guyton, Kathryn Z.

    2014-01-01

    Background: Quantitative estimation of toxicokinetic variability in the human population is a persistent challenge in risk assessment of environmental chemicals. Traditionally, interindividual differences in the population are accounted for by default assumptions or, in rare cases, are based on human toxicokinetic data. Objectives: We evaluated the utility of genetically diverse mouse strains for estimating toxicokinetic population variability for risk assessment, using trichloroethylene (TCE) metabolism as a case study. Methods: We used data on oxidative and glutathione conjugation metabolism of TCE in 16 inbred and 1 hybrid mouse strains to calibrate and extend existing physiologically based pharmacokinetic (PBPK) models. We added one-compartment models for glutathione metabolites and a two-compartment model for dichloroacetic acid (DCA). We used a Bayesian population analysis of interstrain variability to quantify variability in TCE metabolism. Results: Concentration–time profiles for TCE metabolism to oxidative and glutathione conjugation metabolites varied across strains. Median predictions for the metabolic flux through oxidation were less variable (5-fold range) than that through glutathione conjugation (10-fold range). For oxidative metabolites, median predictions of trichloroacetic acid production were less variable (2-fold range) than DCA production (5-fold range), although the uncertainty bounds for DCA exceeded the predicted variability. Conclusions: Population PBPK modeling of genetically diverse mouse strains can provide useful quantitative estimates of toxicokinetic population variability. When extrapolated to lower doses more relevant to environmental exposures, mouse population-derived variability estimates for TCE metabolism closely matched population variability estimates previously derived from human toxicokinetic studies with TCE, highlighting the utility of mouse interstrain metabolism studies for addressing toxicokinetic variability

  1. Producing a Mouse Model to Explore the Linkages Between Tocopherol Biology and Prostate Cancer

    DTIC Science & Technology

    2005-07-01

    Edwards, Prostate cancer and supplementation with alpha-tocopherol and beta -carotene: incidence and mortality in a controlled trial. J Natl Cancer ...1-0153 TITLE: Producing a Mouse Model to Explore the Linkages Between Tocopherol Biology and Prostate Cancer ...TITLE AND SUBTITLE Producing a Mouse Model to Explore the Linkages Between Tocopherol 5a. CONTRACT NUMBER Biology and Prostate Cancer 5b. GRANT

  2. Genetically Engineered ERα positive breast cancer mouse models

    PubMed Central

    Dabydeen, Sarah A.; Furth, Priscilla A.

    2014-01-01

    The majority of human breast cancers are ER+ but this has proven challenging to model in genetically engineered mice. This review summarizes information on twenty-one mouse models that develop ER+ mammary cancer. Where available, information on cancer pathology and gene expression profiles is referenced to assist in understanding which histological subtype of ER+ human cancer each model might represent. Esr1, Ccdn1, prolactin, TGFα, AIB1, Espl1, and Wnt1 over-expression, Pik3ca gain of function, as well as loss of p53 or loss of Stat1 are associated with ER+ mammary cancer. Treatment with the PPARγ agonist efatutazone in a mouse with Brca1 and p53 deficiency and DMBA exposure in combination with an activated myristoylated form of AKT1 also induce ER+ mammary cancer. A spontaneous mutant in nude mice that develops metastatic ER+ mammary cancer is included. Age of cancer development ranges from three to 26 months and the percentages of cancers that are ER+ vary from 21% to 100%. Not all models are characterized as to their estrogen dependency and/or response to anti-hormonal therapy. Strain backgrounds include C57Bl/6, FVB, BALB/c, 129S6/SvEv, CB6F1 and NIH nude. Most models have only been studied on one strain background. In summary while a range of models is available for studies of pathogenesis and therapy of ER+ breast cancers, many could benefit from further characterization and opportunity for development of new models remains. PMID:24481326

  3. 41 CFR 128-1.5005-2 - Redelegations of authority.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Redelegations of authority. 128-1.5005-2 Section 128-1.5005-2 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.50-Authorities and...

  4. 41 CFR 128-1.5005-2 - Redelegations of authority.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Redelegations of authority. 128-1.5005-2 Section 128-1.5005-2 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.50-Authorities and...

  5. Rapamycin improves sociability in the BTBR T(+)Itpr3(tf)/J mouse model of autism spectrum disorders.

    PubMed

    Burket, Jessica A; Benson, Andrew D; Tang, Amy H; Deutsch, Stephen I

    2014-01-01

    Overactivation of the mammalian target of rapamycin (mTOR) has been implicated in the pathogenesis of syndromic forms of autism spectrum disorders (ASDs), such as tuberous sclerosis complex, neurofibromatosis 1, and fragile X syndrome. Administration of mTORC1 (mTOR complex 1) inhibitors (e.g. rapamycin) in syndromic mouse models of ASDs improved behavior, cognition, and neuropathology. However, since only a minority of ASDs are due to the effects of single genes (∼10%), there is a need to explore inhibition of mTOR activity in mouse models that may be more relevant to the majority of nonsyndromic presentations, such as the genetically inbred BTBR T(+)Itpr3(tf)/J (BTBR) mouse model of ASDs. BTBR mice have social impairment and exhibit increased stereotypic behavior. In prior work, d-cycloserine, a partial glycineB site agonist that targets the N-methyl-d-aspartate (NMDA) receptor, was shown to improve sociability in both Balb/c and BTBR mouse models of ASDs. Importantly, NMDA receptor activation regulates mTOR signaling activity. The current study investigated the ability of rapamycin (10mg/kg, i.p.×four days), an mTORC1 inhibitor, to improve sociability and stereotypic behavior in BTBR mice. Using a standard paradigm to assess mouse social behavior, rapamycin improved several measures of sociability in the BTBR mouse, suggesting that mTOR overactivation represents a therapeutic target that mediates or contributes to impaired sociability in the BTBR mouse model of ASDs. Interestingly, there was no effect of rapamycin on stereotypic behaviors in this mouse model. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Mouse Xenograft Model for Mesothelioma | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute is seeking parties interested in collaborative research to co-develop, evaluate, or commercialize a new mouse model for monoclonal antibodies and immunoconjugates that target malignant mesotheliomas. Applications of the technology include models for screening compounds as potential therapeutics for mesothelioma and for studying the pathology of mesothelioma.

  7. HUPO BPP Workshop on Mouse Models for Neurodegeneration--Choosing the right models.

    PubMed

    Hamacher, Michael; Marcus, Katrin; Stephan, Christian; van Hall, Andre; Meyer, Helmut E

    2005-09-01

    The HUPO Brain Proteome Project met during the 4th Dutch Endo-Neuro-Psycho Meeting in Doorwerth, The Netherlands, on June 1, 2005, in order to discuss appropriate (mouse) models for neurodegenerative diseases as well as to conceptualise sophisticated proteomics analyses strategies. Here, the topics of the meeting are summarised.

  8. Evaluation of an in vitro toxicogenetic mouse model for hepatotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinez, Stephanie M.; Bradford, Blair U.; Soldatow, Valerie Y.

    2010-12-15

    Numerous studies support the fact that a genetically diverse mouse population may be useful as an animal model to understand and predict toxicity in humans. We hypothesized that cultures of hepatocytes obtained from a large panel of inbred mouse strains can produce data indicative of inter-individual differences in in vivo responses to hepato-toxicants. In order to test this hypothesis and establish whether in vitro studies using cultured hepatocytes from genetically distinct mouse strains are feasible, we aimed to determine whether viable cells may be isolated from different mouse inbred strains, evaluate the reproducibility of cell yield, viability and functionality overmore » subsequent isolations, and assess the utility of the model for toxicity screening. Hepatocytes were isolated from 15 strains of mice (A/J, B6C3F1, BALB/cJ, C3H/HeJ, C57BL/6J, CAST/EiJ, DBA/2J, FVB/NJ, BALB/cByJ, AKR/J, MRL/MpJ, NOD/LtJ, NZW/LacJ, PWD/PhJ and WSB/EiJ males) and cultured for up to 7 days in traditional 2-dimensional culture. Cells from B6C3F1, C57BL/6J, and NOD/LtJ strains were treated with acetaminophen, WY-14,643 or rifampin and concentration-response effects on viability and function were established. Our data suggest that high yield and viability can be achieved across a panel of strains. Cell function and expression of key liver-specific genes of hepatocytes isolated from different strains and cultured under standardized conditions are comparable. Strain-specific responses to toxicant exposure have been observed in cultured hepatocytes and these experiments open new opportunities for further developments of in vitro models of hepatotoxicity in a genetically diverse population.« less

  9. 7 CFR 1955.128 - Appraisers.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... type of properties (such as large farms and business property) requiring valuation. For Farmer Programs... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property Use of Contractors to Dispose of Inventory Property § 1955.128 Appraisers. (a) Real property. The State Director may authorize the County...

  10. Antibiofilm Activity and Synergistic Inhibition of Staphylococcus aureus Biofilms by Bactericidal Protein P128 in Combination with Antibiotics

    PubMed Central

    Nair, Sandhya; Desai, Srividya; Poonacha, Nethravathi; Vipra, Aradhana

    2016-01-01

    P128 is an antistaphylococcal protein, comprising a cell wall-degrading enzymatic region and a Staphylococcus-specific binding region, which possesses specific and potent bactericidal activity against sensitive and drug-resistant strains of Staphylococcus aureus. To explore P128's ability to kill S. aureus in a range of environments relevant to clinical infection, we investigated the anti-S. aureus activity of P128 alone and in combination with standard-of-care antibiotics on planktonic and biofilm-embedded cells. P128 was found to have potent antibiofilm activity on preformed S. aureus biofilms as detected by CFU reduction and a colorimetric minimum biofilm inhibitory concentration (MBIC) assay. Scanning electron microscopic images of biofilms formed on the surfaces of microtiter plates and on catheters showed that P128 at low concentrations could destroy the biofilm structure and lyse the cells. When it was tested in combination with antibiotics which are known to be poor inhibitors of S. aureus in biofilms, such as vancomycin, gentamicin, ciprofloxacin, linezolid, and daptomycin, P128 showed highly synergistic antibiofilm activity that resulted in much reduced MBIC values for P128 and the individual antibiotics. The synergistic effect was seen for both sensitive and resistant isolates of S. aureus. Additionally, in an in vitro mixed-biofilm model mimicking the wound infection environment, P128 was able to prevent biofilm formation by virtue of its anti-Staphylococcus activity. The potent S. aureus biofilm-inhibiting activity of P128 both alone and in combination with antibiotics is an encouraging sign for the development of P128 for treatment of complicated S. aureus infections involving biofilms. PMID:27671070

  11. Mouse Models for Unraveling the Importance of Diet in Colon Cancer Prevention

    PubMed Central

    Tammariello, Alexandra E.; Milner, John A.

    2010-01-01

    Diet and genetics are both considered important risk determinants for colorectal cancer, a leading cause of death worldwide. Several genetically engineered mouse models have been created, including the ApcMin mouse, to aid in the identification of key cancer related processes and to assist with the characterization of environmental factors, including the diet, which influence risk. Current research using these models provides evidence that several bioactive food components can inhibit genetically predisposed colorectal cancer, while others increase risk. Specifically, calorie restriction or increased exposure to n-3 fatty acids, sulforaphane, chafuroside, curcumin, and dibenzoylmethane were reported protective. Total fat, calories and all-trans retinoic acid are associated with an increased risk. Unraveling the importance of specific dietary components in these models is complicated by the basal diet used, the quantity of test components provided, and interactions among food components. Newer models are increasingly available to evaluate fundamental cellular processes, including DNA mismatch repair, immune function and inflammation as markers for colon cancer risk. Unfortunately, these models have been used infrequently to examine the influence of specific dietary components. The enhanced use of these models can shed mechanistic insights about the involvement of specific bioactive food and components and energy as determinants of colon cancer risk. However, the use of available mouse models to exactly represent processes important to human gastrointestinal cancers will remain a continued scientific challenge. PMID:20122631

  12. Aging, Breast Cancer and the Mouse Model

    DTIC Science & Technology

    2005-05-01

    architecture and function of the of normal human cells in culture ( Hayflick , 1965). This limit surrounding tissue and stimulate (or inhibit) the... LIMITATION 18. NUMBER 19a. NAME OF RESPONSIBLE PERSON OF ABSTRACT OF PAGES USAMRMC a. REPORT b. ABSTRACT c. THIS PAGE 19b. TELEPHONE NUMBER (include area U...mammary cancers in the mouse and that these tumors have strikingly similar histology. Nonetheless, several limitations exists to this model system and

  13. Genetically engineered mouse models of craniopharyngioma: an opportunity for therapy development and understanding of tumor biology

    PubMed Central

    Martinez‐Barbera, Juan Pedro

    2017-01-01

    Abstract Adamantinomatous craniopharyngioma (ACP) is the commonest tumor of the sellar region in childhood. Two genetically engineered mouse models have been developed and are giving valuable insights into ACP biology. These models have identified novel pathways activated in tumors, revealed an important function of paracrine signalling and extended conventional theories about the role of organ‐specific stem cells in tumorigenesis. In this review, we summarize these mouse models, what has been learnt, their limitations and open questions for future research. We then discussed how these mouse models may be used to test novel therapeutics against potentially targetable pathways recently identified in human ACP. PMID:28414891

  14. A new multiple trauma model of the mouse.

    PubMed

    Fitschen-Oestern, Stefanie; Lippross, Sebastian; Klueter, Tim; Weuster, Matthias; Varoga, Deike; Tohidnezhad, Mersedeh; Pufe, Thomas; Rose-John, Stefan; Andruszkow, Hagen; Hildebrand, Frank; Steubesand, Nadine; Seekamp, Andreas; Neunaber, Claudia

    2017-11-21

    Blunt trauma is the most frequent mechanism of injury in multiple trauma, commonly resulting from road traffic collisions or falls. Two of the most frequent injuries in patients with multiple trauma are chest trauma and extremity fracture. Several trauma mouse models combine chest trauma and head injury, but no trauma mouse model to date includes the combination of long bone fractures and chest trauma. Outcome is essentially determined by the combination of these injuries. In this study, we attempted to establish a reproducible novel multiple trauma model in mice that combines blunt trauma, major injuries and simple practicability. Ninety-six male C57BL/6 N mice (n = 8/group) were subjected to trauma for isolated femur fracture and a combination of femur fracture and chest injury. Serum samples of mice were obtained by heart puncture at defined time points of 0 h (hour), 6 h, 12 h, 24 h, 3 d (days), and 7 d. A tendency toward reduced weight and temperature was observed at 24 h after chest trauma and femur fracture. Blood analyses revealed a decrease in hemoglobin during the first 24 h after trauma. Some animals were killed by heart puncture immediately after chest contusion; these animals showed the most severe lung contusion and hemorrhage. The extent of structural lung injury varied in different mice but was evident in all animals. Representative H&E-stained (Haematoxylin and Eosin-stained) paraffin lung sections of mice with multiple trauma revealed hemorrhage and an inflammatory immune response. Plasma samples of mice with chest trauma and femur fracture showed an up-regulation of IL-1β (Interleukin-1β), IL-6, IL-10, IL-12p70 and TNF-α (Tumor necrosis factor- α) compared with the control group. Mice with femur fracture and chest trauma showed a significant up-regulation of IL-6 compared to group with isolated femur fracture. The multiple trauma mouse model comprising chest trauma and femur fracture enables many analogies to clinical cases of

  15. Novel In Vivo Model for Combinatorial Fluorescence Labeling in Mouse Prostate

    PubMed Central

    Fang, Xiaolan; Gyabaah, Kenneth; Nickkholgh, Bita; Cline, J. Mark; Balaji, K.C.

    2015-01-01

    BACKGROUND The epithelial layer of prostate glands contains several types of cells, including luminal and basal cells. Yet there is paucity of animal models to study the cellular origin of normal or neoplastic development in the prostate to facilitate the treatment of heterogenous prostate diseases by targeting individual cell lineages. METHODS We developed a mouse model that expresses different types of fluorescent proteins (XFPs) specifically in prostatic cells. Using an in vivo stochastic fluorescent protein combinatorial strategy, XFP signals were expressed specifically in prostate of Protein Kinase D1 (PKD1) knock-out, K-RasG12D knock-in, and Phosphatase and tensin homolog (PTEN) and PKD1 double knock-out mice under the control of PB-Cre promoter. RESULTS In vivo XFP signals were observed in prostate of PKD1 knock-out, K-RasG12D knock-in, and PTEN PKD1 double knock-out mice, which developed normal, hyperplastic, and neoplastic prostate, respectively. The patchy expression pattern of XFPs in neoplasia tissue indicated the clonal origin of cancer cells in the prostate. CONCLUSIONS The transgenic mouse models demonstrate combinatorial fluorescent protein expression in normal and cancerous prostatic tissues. This novel prostate-specific fluorescent labeled mouse model, which we named Prorainbow, could be useful in studying benign and malignant pathology of prostate. PMID:25753731

  16. Novel In Vivo model for combinatorial fluorescence labeling in mouse prostate.

    PubMed

    Fang, Xiaolan; Gyabaah, Kenneth; Nickkholgh, Bita; Cline, J Mark; Balaji, K C

    2015-06-15

    The epithelial layer of prostate glands contains several types of cells, including luminal and basal cells. Yet there is paucity of animal models to study the cellular origin of normal or neoplastic development in the prostate to facilitate the treatment of heterogenous prostate diseases by targeting individual cell lineages. We developed a mouse model that expresses different types of fluorescent proteins (XFPs) specifically in prostatic cells. Using an in vivo stochastic fluorescent protein combinatorial strategy, XFP signals were expressed specifically in prostate of Protein Kinase D1 (PKD1) knock-out, K-Ras(G) (12) (D) knock-in, and Phosphatase and tensin homolog (PTEN) and PKD1 double knock-out mice under the control of PB-Cre promoter. In vivo XFP signals were observed in prostate of PKD1 knock-out, K-Ras(G) (12) (D) knock-in, and PTEN PKD1 double knock-out mice, which developed normal, hyperplastic, and neoplastic prostate, respectively. The patchy expression pattern of XFPs in neoplasia tissue indicated the clonal origin of cancer cells in the prostate. The transgenic mouse models demonstrate combinatorial fluorescent protein expression in normal and cancerous prostatic tissues. This novel prostate-specific fluorescent labeled mouse model, which we named Prorainbow, could be useful in studying benign and malignant pathology of prostate. © 2015 Wiley Periodicals, Inc.

  17. Omics analysis of mouse brain models of human diseases.

    PubMed

    Paban, Véronique; Loriod, Béatrice; Villard, Claude; Buee, Luc; Blum, David; Pietropaolo, Susanna; Cho, Yoon H; Gory-Faure, Sylvie; Mansour, Elodie; Gharbi, Ali; Alescio-Lautier, Béatrice

    2017-02-05

    The identification of common gene/protein profiles related to brain alterations, if they exist, may indicate the convergence of the pathogenic mechanisms driving brain disorders. Six genetically engineered mouse lines modelling neurodegenerative diseases and neuropsychiatric disorders were considered. Omics approaches, including transcriptomic and proteomic methods, were used. The gene/protein lists were used for inter-disease comparisons and further functional and network investigations. When the inter-disease comparison was performed using the gene symbol identifiers, the number of genes/proteins involved in multiple diseases decreased rapidly. Thus, no genes/proteins were shared by all 6 mouse models. Only one gene/protein (Gfap) was shared among 4 disorders, providing strong evidence that a common molecular signature does not exist among brain diseases. The inter-disease comparison of functional processes showed the involvement of a few major biological processes indicating that brain diseases of diverse aetiologies might utilize common biological pathways in the nervous system, without necessarily involving similar molecules. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. The Mouse Lemur, a Genetic Model Organism for Primate Biology, Behavior, and Health

    PubMed Central

    Ezran, Camille; Karanewsky, Caitlin J.; Pendleton, Jozeph L.; Sholtz, Alex; Krasnow, Maya R.; Willick, Jason; Razafindrakoto, Andriamahery; Zohdy, Sarah; Albertelli, Megan A.; Krasnow, Mark A.

    2017-01-01

    Systematic genetic studies of a handful of diverse organisms over the past 50 years have transformed our understanding of biology. However, many aspects of primate biology, behavior, and disease are absent or poorly modeled in any of the current genetic model organisms including mice. We surveyed the animal kingdom to find other animals with advantages similar to mice that might better exemplify primate biology, and identified mouse lemurs (Microcebus spp.) as the outstanding candidate. Mouse lemurs are prosimian primates, roughly half the genetic distance between mice and humans. They are the smallest, fastest developing, and among the most prolific and abundant primates in the world, distributed throughout the island of Madagascar, many in separate breeding populations due to habitat destruction. Their physiology, behavior, and phylogeny have been studied for decades in laboratory colonies in Europe and in field studies in Malagasy rainforests, and a high quality reference genome sequence has recently been completed. To initiate a classical genetic approach, we developed a deep phenotyping protocol and have screened hundreds of laboratory and wild mouse lemurs for interesting phenotypes and begun mapping the underlying mutations, in collaboration with leading mouse lemur biologists. We also seek to establish a mouse lemur gene “knockout” library by sequencing the genomes of thousands of mouse lemurs to identify null alleles in most genes from the large pool of natural genetic variants. As part of this effort, we have begun a citizen science project in which students across Madagascar explore the remarkable biology around their schools, including longitudinal studies of the local mouse lemurs. We hope this work spawns a new model organism and cultivates a deep genetic understanding of primate biology and health. We also hope it establishes a new and ethical method of genetics that bridges biological, behavioral, medical, and conservation disciplines, while

  19. The Mouse Lemur, a Genetic Model Organism for Primate Biology, Behavior, and Health.

    PubMed

    Ezran, Camille; Karanewsky, Caitlin J; Pendleton, Jozeph L; Sholtz, Alex; Krasnow, Maya R; Willick, Jason; Razafindrakoto, Andriamahery; Zohdy, Sarah; Albertelli, Megan A; Krasnow, Mark A

    2017-06-01

    Systematic genetic studies of a handful of diverse organisms over the past 50 years have transformed our understanding of biology. However, many aspects of primate biology, behavior, and disease are absent or poorly modeled in any of the current genetic model organisms including mice. We surveyed the animal kingdom to find other animals with advantages similar to mice that might better exemplify primate biology, and identified mouse lemurs ( Microcebus spp.) as the outstanding candidate. Mouse lemurs are prosimian primates, roughly half the genetic distance between mice and humans. They are the smallest, fastest developing, and among the most prolific and abundant primates in the world, distributed throughout the island of Madagascar, many in separate breeding populations due to habitat destruction. Their physiology, behavior, and phylogeny have been studied for decades in laboratory colonies in Europe and in field studies in Malagasy rainforests, and a high quality reference genome sequence has recently been completed. To initiate a classical genetic approach, we developed a deep phenotyping protocol and have screened hundreds of laboratory and wild mouse lemurs for interesting phenotypes and begun mapping the underlying mutations, in collaboration with leading mouse lemur biologists. We also seek to establish a mouse lemur gene "knockout" library by sequencing the genomes of thousands of mouse lemurs to identify null alleles in most genes from the large pool of natural genetic variants. As part of this effort, we have begun a citizen science project in which students across Madagascar explore the remarkable biology around their schools, including longitudinal studies of the local mouse lemurs. We hope this work spawns a new model organism and cultivates a deep genetic understanding of primate biology and health. We also hope it establishes a new and ethical method of genetics that bridges biological, behavioral, medical, and conservation disciplines, while

  20. 45 CFR 12.8 - Assignment of surplus real property.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 1 2011-10-01 2011-10-01 false Assignment of surplus real property. 12.8 Section... UTILIZATION OF SURPLUS REAL PROPERTY FOR PUBLIC HEALTH PURPOSES § 12.8 Assignment of surplus real property. (a... for assignment of surplus real property to the Department for transfer for public health purposes will...

  1. Sturckow uses Cycle Ergometer on Middeck (MDDK) during STS-128

    NASA Image and Video Library

    2009-08-29

    S128-E-006315 (29 Aug. 2009) --- Astronaut Rick Sturckow, STS-128 commander, gives a “thumbs-up” signal while exercising on a bicycle ergometer on the middeck of the Earth-orbiting Space Shuttle Discovery.

  2. Primary amines protect against retinal degeneration in mouse models of retinopathies

    PubMed Central

    Maeda, Akiko; Golczak, Marcin; Chen, Yu; Okano, Kiichiro; Kohno, Hideo; Shiose, Satomi; Ishikawa, Kaede; Harte, William; Palczewska, Grazyna; Maeda, Tadao; Palczewski, Krzysztof

    2011-01-01

    Vertebrate vision is initiated by photoisomerization of the visual pigment chromophore, 11-cis-retinal, and is maintained by continuous regeneration of this retinoid through a series of reactions termed the retinoid cycle. However, toxic side reaction products, especially those involving reactive aldehyde groups of the photoisomered product, all-trans-retinal, can cause severe retinal pathology. Here we lowered peak concentrations of free all-trans-retinal with primary amine-containing FDA-approved drugs that did not inhibit chromophore regeneration in mouse models of retinal degeneration. Schiff base adducts between all-trans-retinal and these amines were identified by mass spectrometry. Adducts were observed in mouse eyes only when an experimental drug protected the retina from degeneration in both short-term and long-term treatment experiments. This study demonstrates a molecular basis of all-trans-retinal-induced retinal pathology and identifies an assemblage of FDA-approved compounds with protective effects against this pathology in a mouse model that displays features of Stargardt’s and age-related retinal degeneration. PMID:22198730

  3. Intramyocardial Injection of siRNAs Can Efficiently Establish Myocardial Tissue-Specific Renalase Knockdown Mouse Model.

    PubMed

    Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili

    2016-01-01

    Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.

  4. 47 CFR 76.128 - Application of sports blackout rules.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false Application of sports blackout rules. 76.128... Sports Blackout § 76.128 Application of sports blackout rules. The cable and satellite sports blackout rules (§§ 76.111 and 76.127) may apply when the sports event is not available live on any of the...

  5. 20 CFR 220.128 - Age as a vocational factor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 20 Employees' Benefits 1 2013-04-01 2012-04-01 true Age as a vocational factor. 220.128 Section... DETERMINING DISABILITY Vocational Considerations § 220.128 Age as a vocational factor. (a) General. (1) Age refers to how old the claimaint is (chronological age) and the extent to which his or her age affects his...

  6. 20 CFR 220.128 - Age as a vocational factor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 20 Employees' Benefits 1 2011-04-01 2011-04-01 false Age as a vocational factor. 220.128 Section... DETERMINING DISABILITY Vocational Considerations § 220.128 Age as a vocational factor. (a) General. (1) Age refers to how old the claimaint is (chronological age) and the extent to which his or her age affects his...

  7. 20 CFR 220.128 - Age as a vocational factor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 20 Employees' Benefits 1 2014-04-01 2012-04-01 true Age as a vocational factor. 220.128 Section... DETERMINING DISABILITY Vocational Considerations § 220.128 Age as a vocational factor. (a) General. (1) Age refers to how old the claimaint is (chronological age) and the extent to which his or her age affects his...

  8. 20 CFR 220.128 - Age as a vocational factor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 20 Employees' Benefits 1 2012-04-01 2012-04-01 false Age as a vocational factor. 220.128 Section... DETERMINING DISABILITY Vocational Considerations § 220.128 Age as a vocational factor. (a) General. (1) Age refers to how old the claimaint is (chronological age) and the extent to which his or her age affects his...

  9. 47 CFR 76.128 - Application of sports blackout rules.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Application of sports blackout rules. 76.128... Sports Blackout § 76.128 Application of sports blackout rules. The cable and satellite sports blackout rules (§§ 76.111 and 76.127) may apply when the sports event is not available live on any of the...

  10. 47 CFR 76.128 - Application of sports blackout rules.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Application of sports blackout rules. 76.128... Sports Blackout § 76.128 Application of sports blackout rules. The cable and satellite sports blackout rules (§§ 76.111 and 76.127) may apply when the sports event is not available live on any of the...

  11. Interactions between Trichomonas vaginalis and vaginal flora in a mouse model.

    PubMed

    Meysick, K C; Garber, G E

    1992-02-01

    To study the role of vaginal flora and pH in the pathogenesis of Trichomonas vaginalis, an intravaginal mouse model of infection was established. By employing this model, the vaginal flora and pH of mice could be monitored for changes caused by the parasite. As a baseline, the endemic vaginal flora of BALB/c mice was examined first and found to consist mainly of Staphylococcus aureus and Enterococcus species (32-76%). Lactobacilli and enteric bacilli were moderate (16-32%) in their frequency of isolation, and the prevalence of both anaerobic species and coagulase-negative staphylococci was low (4-16%). Vaginal pH was recorded at 6.5 +/- 0.3. Estrogenization, which was required for a sustained T. vaginalis infection, did not significantly alter vaginal flora; however, a slight rise in the number of bacterial species isolated per mouse and a drop in vaginal pH (6.2 +/- 0.5) were observed. Trichomonas vaginalis-infected mice did not appear to show significant changes in vaginal flora although vaginal pH was slightly increased. This mouse model could have applications in both immunologic and pathogenic studies of T. vaginalis and, with further modifications, aid in the study of protist-bacterial interactions.

  12. The Oak Ridge Polycystic Kidney mouse: modeling ciliopathies of mice and men.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lehman, J M; Michaud III, Edward J; Schoeb, T

    2008-08-01

    The Oak Ridge Polycystic Kidney (ORPK) mouse was described nearly 14 years ago as a model for human recessive polycystic kidney disease. The ORPK mouse arose through integration of a transgene into an intron of the Ift88 gene resulting in a hypomorphic allele (Ift88Tg737Rpw). The Ift88Tg737Rpw mutation impairs intraflagellar transport (IFT), a process required for assembly of motile and immotile cilia. Historically, the primary immotile cilium was thought to have minimal importance for human health; however, a rapidly expanding number of human disorders have now been attributed to ciliary defects. Importantly, many of these phenotypes are present and can bemore » analyzed using the ORPK mouse. In this review, we highlight the research conducted using the OPRK mouse and the phenotypes shared with human cilia disorders. Furthermore, we describe an additional follicular dysplasia phenotype in the ORPK mouse, which alongside the ectodermal dysplasias seen in human Ellis-van Creveld and Sensenbrenner's syndromes, suggests an unappreciated role for primary cilia in the skin and hair follicle.« less

  13. Differences in amyloid-β clearance across mouse and human blood-brain barrier models: kinetic analysis and mechanistic modeling.

    PubMed

    Qosa, Hisham; Abuasal, Bilal S; Romero, Ignacio A; Weksler, Babette; Couraud, Pierre-Oliver; Keller, Jeffrey N; Kaddoumi, Amal

    2014-04-01

    Alzheimer's disease (AD) has a characteristic hallmark of amyloid-β (Aβ) accumulation in the brain. This accumulation of Aβ has been related to its faulty cerebral clearance. Indeed, preclinical studies that used mice to investigate Aβ clearance showed that efflux across blood-brain barrier (BBB) and brain degradation mediate efficient Aβ clearance. However, the contribution of each process to Aβ clearance remains unclear. Moreover, it is still uncertain how species differences between mouse and human could affect Aβ clearance. Here, a modified form of the brain efflux index method was used to estimate the contribution of BBB and brain degradation to Aβ clearance from the brain of wild type mice. We estimated that 62% of intracerebrally injected (125)I-Aβ40 is cleared across BBB while 38% is cleared by brain degradation. Furthermore, in vitro and in silico studies were performed to compare Aβ clearance between mouse and human BBB models. Kinetic studies for Aβ40 disposition in bEnd3 and hCMEC/D3 cells, representative in vitro mouse and human BBB models, respectively, demonstrated 30-fold higher rate of (125)I-Aβ40 uptake and 15-fold higher rate of degradation by bEnd3 compared to hCMEC/D3 cells. Expression studies showed both cells to express different levels of P-glycoprotein and RAGE, while LRP1 levels were comparable. Finally, we established a mechanistic model, which could successfully predict cellular levels of (125)I-Aβ40 and the rate of each process. Established mechanistic model suggested significantly higher rates of Aβ uptake and degradation in bEnd3 cells as rationale for the observed differences in (125)I-Aβ40 disposition between mouse and human BBB models. In conclusion, current study demonstrates the important role of BBB in the clearance of Aβ from the brain. Moreover, it provides insight into the differences between mouse and human BBB with regards to Aβ clearance and offer, for the first time, a mathematical model that describes

  14. Differences in amyloid-β clearance across mouse and human blood-brain barrier models: Kinetic analysis and mechanistic modeling

    PubMed Central

    Qosa, Hisham; Abuasal, Bilal S.; Romero, Ignacio A.; Weksler, Babette; Couraud, Pierre-Oliver; Keller, Jeffrey N.; Kaddoumi, Amal

    2014-01-01

    Alzheimer’s disease (AD) has a characteristic hallmark of amyloid-β (Aβ) accumulation in the brain. This accumulation of Aβ has been related to its faulty cerebral clearance. Indeed, preclinical studies that used mice to investigate Aβ clearance showed that efflux across blood-brain barrier (BBB) and brain degradation mediate efficient Aβ clearance. However, the contribution of each process to Aβ clearance remains unclear. Moreover, it is still uncertain how species differences between mouse and human could affect Aβ clearance. Here, a modified form of the brain efflux index method was used to estimate the contribution of BBB and brain degradation to Aβ clearance from the brain of wild type mice. We estimated that 62% of intracerebrally injected 125I-Aβ40 is cleared across BBB while 38% is cleared by brain degradation. Furthermore, in vitro and in silico studies were performed to compare Aβ clearance between mouse and human BBB models. Kinetic studies for Aβ40 disposition in bEnd3 and hCMEC/D3 cells, representative in vitro mouse and human BBB models, respectively, demonstrated 30-fold higher rate of 125I-Aβ40 uptake and 15-fold higher rate of degradation by bEnd3 compared to hCMEC/D3 cells. Expression studies showed both cells to express different levels of P-glycoprotein and RAGE, while LRP1 levels were comparable. Finally, we established a mechanistic model, which could successfully predict cellular levels of 125I-Aβ40 and the rate of each process. Established mechanistic model suggested significantly higher rates of Aβ uptake and degradation in bEnd3 cells as rationale for the observed differences in 125I-Aβ40 disposition between mouse and human BBB models. In conclusion, current study demonstrates the important role of BBB in the clearance of Aβ from the brain. Moreover, it provides insight into the differences between mouse and human BBB with regards to Aβ clearance and offer, for the first time, a mathematical model that describes A

  15. Therapeutic effects of autologous lymphocytes activated with trastuzumab for xenograft mouse models of human breast cancer.

    PubMed

    Nakagawa, Shinichiro; Matsuoka, Yusuke; Ichihara, Hideaki; Yoshida, Hitoji; Yoshida, Kenshi; Ueoka, Ryuichi

    2013-01-01

    Trastuzumab (TTZ) is molecular targeted drug used for metastatic breast cancer patients overexpressing human epidermal growth factor receptor 2 (HER2). Therapeutic effects of lymphocytes activated with TTZ (TTZ-LAK) using xenograft mouse models of human breast cancer (MDA-MB-453) cells were examined in vivo. Remarkable reduction of tumor volume in a xenograft mouse models intravenously treated with TTZ-LAK cells after the subcutaneously inoculated of MDA-MB-453 cells was verified in vivo. The migration of TTZ-LAK cells in tumor of mouse models subcutaneously inoculated MDA-MB-453 cells was observed on the basis of histological analysis using immunostaining with CD-3. Induction of apoptosis in tumor of xenograft mice treated with TTZ-LAK cells was observed in micrographs using terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) method. It was noteworthy that the therapeutic effects of TTZ-LAK cells along with apoptosis were obtained for xenograft mouse models of human breast tumor in vivo.

  16. 42 CFR 436.128 - Coverage for certain qualified aliens.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Coverage for certain qualified aliens. 436.128... Mandatory Coverage of the Categorically Needy § 436.128 Coverage for certain qualified aliens. The agency... § 440.255(c) of this chapter to those aliens described in § 436.406(c) of this subpart. [55 FR 36820...

  17. 42 CFR 436.128 - Coverage for certain qualified aliens.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 4 2011-10-01 2011-10-01 false Coverage for certain qualified aliens. 436.128... Mandatory Coverage of the Categorically Needy § 436.128 Coverage for certain qualified aliens. The agency... § 440.255(c) of this chapter to those aliens described in § 436.406(c) of this subpart. [55 FR 36820...

  18. 42 CFR 436.128 - Coverage for certain qualified aliens.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 4 2012-10-01 2012-10-01 false Coverage for certain qualified aliens. 436.128... Mandatory Coverage of the Categorically Needy § 436.128 Coverage for certain qualified aliens. The agency... § 440.255(c) of this chapter to those aliens described in § 436.406(c) of this subpart. [55 FR 36820...

  19. 42 CFR 436.128 - Coverage for certain qualified aliens.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 4 2014-10-01 2014-10-01 false Coverage for certain qualified aliens. 436.128... Mandatory Coverage of the Categorically Needy § 436.128 Coverage for certain qualified aliens. The agency... § 440.255(c) of this chapter to those aliens described in § 436.406(c) of this subpart. [55 FR 36820...

  20. 42 CFR 436.128 - Coverage for certain qualified aliens.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 4 2013-10-01 2013-10-01 false Coverage for certain qualified aliens. 436.128... Mandatory Coverage of the Categorically Needy § 436.128 Coverage for certain qualified aliens. The agency... § 440.255(c) of this chapter to those aliens described in § 436.406(c) of this subpart. [55 FR 36820...

  1. 7 CFR 1260.128 - Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.128 Act. Act means the Beef Promotion and Research Act of 1985, Title XVI, Subtitle A of the Food Security Act of 1985, Pub. L. 99-198 and any amendments thereto. ...

  2. Modeling anaplastic thyroid carcinoma in the mouse.

    PubMed

    Champa, Devora; Di Cristofano, Antonio

    2015-02-01

    Anaplastic thyroid carcinoma is the least common form of thyroid cancer; however, it accounts for the majority of deaths associated with this family of malignancies. A number of genetically engineered immunocompetent mouse models recapitulating the genetic and histological features of anaplastic thyroid cancer have been very recently generated and represent an invaluable tool to dissect the mechanisms involved in the progression from indolent, well-differentiated tumors to aggressive, undifferentiated carcinomas and to identify novel therapeutic targets. In this review, we focus on the relevant characteristics associated with these models and on what we have learned in terms of anaplastic thyroid cancer biology, genetics, and response to targeted therapy.

  3. Modeling anaplastic thyroid carcinoma in the mouse

    PubMed Central

    Champa, Devora; Di Cristofano, Antonio

    2014-01-01

    Anaplastic thyroid carcinoma is the least common form of thyroid cancer; however, it accounts for the majority of deaths associated with this family of malignancies. A number of genetically engineered immunocompetent mouse models recapitulating the genetic and histological features of anaplastic thyroid cancer have been very recently generated and represent an invaluable tool to dissect the mechanisms involved in the progression from indolent, well differentiated tumors to aggressive, undifferentiated carcinomas, and to identify novel therapeutic targets. In this review, we focus on the relevant characteristics associated with these models and on what we have learned in terms of anaplastic thyroid cancer biology, genetics, and response to targeted therapy. PMID:25420535

  4. Absence of Prenatal Forebrain Defects in the Dp(16)1Yey/+ Mouse Model of Down Syndrome

    PubMed Central

    Goodliffe, Joseph W.; Olmos-Serrano, Jose Luis; Aziz, Nadine M.; Pennings, Jeroen L.A.; Guedj, Faycal; Bianchi, Diana W.

    2016-01-01

    Studies in humans with Down syndrome (DS) show that alterations in fetal brain development are followed by postnatal deficits in neuronal numbers, synaptic plasticity, and cognitive and motor function. This same progression is replicated in several mouse models of DS. Dp(16)1Yey/+ (hereafter called Dp16) is a recently developed mouse model of DS in which the entire region of mouse chromosome 16 that is homologous to human chromosome 21 has been triplicated. As such, Dp16 mice may more closely reproduce neurodevelopmental changes occurring in humans with DS. Here, we present the first comprehensive cellular and behavioral study of the Dp16 forebrain from embryonic to adult stages. Unexpectedly, our results demonstrate that Dp16 mice do not have prenatal brain defects previously reported in human fetal neocortex and in the developing forebrains of other mouse models, including microcephaly, reduced neurogenesis, and abnormal cell proliferation. Nevertheless, we found impairments in postnatal developmental milestones, fewer inhibitory forebrain neurons, and deficits in motor and cognitive performance in Dp16 mice. Therefore, although this new model does not express prenatal morphological phenotypes associated with DS, abnormalities in the postnatal period appear sufficient to produce significant cognitive deficits in Dp16. SIGNIFICANCE STATEMENT Down syndrome (DS) leads to intellectual disability. Several mouse models have increased our understanding of the neuropathology of DS and are currently being used to test therapeutic strategies. A new mouse model that contains an expanded number of DS-related genes, known as Dp(16)1Yey/+ (Dp16), has been generated recently. We sought to determine whether the extended triplication creates a better phenocopy of DS-related brain pathologies. We measured embryonic development, forebrain maturation, and perinatal/adult behavior and revealed an absence of prenatal phenotypes in Dp16 fetal brain, but specific cellular and behavioral

  5. sts128-s-047

    NASA Image and Video Library

    2009-09-14

    STS128-S-047 (11 Sept. 2009) --- Space Shuttle Discovery?s main landing gear touches down at NASA's Dryden Flight Research Center at Edwards Air Force Base in California, concluding a successful mission to the International Space Station. Onboard are NASA astronauts Rick Sturckow, commander; Kevin Ford, pilot; John ?Danny? Olivas, Patrick Forrester, Jose Hernandez and Tim Kopra, all mission specialists; along with European Space Agency astronaut Christer Fuglesang, mission specialist. Discovery landed at 5:53 p.m. (PDT) on Sept. 11, 2009 to end the STS-128 mission, completing its almost 14-day journey of more than 5.7 million miles in space. The landing was diverted to California due to marginal weather at the Kennedy Space Center. Discovery?s mission featured three spacewalks and the delivery of two refrigerator-sized science racks to the space station. One rack will be used to conduct experiments on materials such as metals, glasses and ceramics. The results from these experiments could lead to the development of better materials on Earth. The other rack will be used for fluid physics research. Understanding how fluids react in microgravity could lead to improved designs for fuel tanks, water systems and other fluid-based systems.

  6. sts128-s-045

    NASA Image and Video Library

    2009-09-11

    STS128-S-045 (11 Sept. 2009) --- Space Shuttle Discovery?s main landing gear touches down at NASA's Dryden Flight Research Center at Edwards Air Force Base in California, concluding a successful mission to the International Space Station. Onboard are NASA astronauts Rick Sturckow, commander; Kevin Ford, pilot; John ?Danny? Olivas, Patrick Forrester, Jose Hernandez and Tim Kopra, all mission specialists; along with European Space Agency astronaut Christer Fuglesang, mission specialist. Discovery landed at 5:53 p.m. (PDT) on Sept. 11, 2009 to end the STS-128 mission, completing its almost 14-day journey of more than 5.7 million miles in space. The landing was diverted to California due to marginal weather at the Kennedy Space Center. Discovery?s mission featured three spacewalks and the delivery of two refrigerator-sized science racks to the space station. One rack will be used to conduct experiments on materials such as metals, glasses and ceramics. The results from these experiments could lead to the development of better materials on Earth. The other rack will be used for fluid physics research. Understanding how fluids react in microgravity could lead to improved designs for fuel tanks, water systems and other fluid-based systems.

  7. sts128-s-048

    NASA Image and Video Library

    2009-09-11

    STS128-S-048 (11 Sept. 2009) --- With its drag chute deployed, Space Shuttle Discovery slows to a stop after landing at NASA's Dryden Flight Research Center at Edwards Air Force Base in California, concluding a successful mission to the International Space Station. Onboard are NASA astronauts Rick Sturckow, commander; Kevin Ford, pilot; John ?Danny? Olivas, Patrick Forrester, Jose Hernandez and Tim Kopra, all mission specialists; along with European Space Agency astronaut Christer Fuglesang, mission specialist. Discovery landed at 5:53 p.m. (PDT) on Sept. 11, 2009 to end the STS-128 mission, completing its almost 14-day journey of more than 5.7 million miles in space. The landing was diverted to California due to marginal weather at the Kennedy Space Center. Discovery?s mission featured three spacewalks and the delivery of two refrigerator-sized science racks to the space station. One rack will be used to conduct experiments on materials such as metals, glasses and ceramics. The results from these experiments could lead to the development of better materials on Earth. The other rack will be used for fluid physics research. Understanding how fluids react in microgravity could lead to improved designs for fuel tanks, water systems and other fluid-based systems.

  8. sts128-s-046

    NASA Image and Video Library

    2009-09-11

    STS128-S-046 (11 Sept. 2009) --- Space Shuttle Discovery?s main landing gear touches down at NASA's Dryden Flight Research Center at Edwards Air Force Base in California, concluding a successful mission to the International Space Station. Onboard are NASA astronauts Rick Sturckow, commander; Kevin Ford, pilot; John ?Danny? Olivas, Patrick Forrester, Jose Hernandez and Tim Kopra, all mission specialists; along with European Space Agency astronaut Christer Fuglesang, mission specialist. Discovery landed at 5:53 p.m. (PDT) on Sept. 11, 2009 to end the STS-128 mission, completing its almost 14-day journey of more than 5.7 million miles in space. The landing was diverted to California due to marginal weather at the Kennedy Space Center. Discovery?s mission featured three spacewalks and the delivery of two refrigerator-sized science racks to the space station. One rack will be used to conduct experiments on materials such as metals, glasses and ceramics. The results from these experiments could lead to the development of better materials on Earth. The other rack will be used for fluid physics research. Understanding how fluids react in microgravity could lead to improved designs for fuel tanks, water systems and other fluid-based systems.

  9. A New Mouse Model That Spontaneously Develops Chronic Liver Inflammation and Fibrosis

    PubMed Central

    Fransén-Pettersson, Nina; Duarte, Nadia; Nilsson, Julia; Lundholm, Marie; Mayans, Sofia; Larefalk, Åsa; Hannibal, Tine D.; Hansen, Lisbeth; Schmidt-Christensen, Anja; Ivars, Fredrik; Cardell, Susanna; Palmqvist, Richard; Rozell, Björn

    2016-01-01

    Here we characterize a new animal model that spontaneously develops chronic inflammation and fibrosis in multiple organs, the non-obese diabetic inflammation and fibrosis (N-IF) mouse. In the liver, the N-IF mouse displays inflammation and fibrosis particularly evident around portal tracts and central veins and accompanied with evidence of abnormal intrahepatic bile ducts. The extensive cellular infiltration consists mainly of macrophages, granulocytes, particularly eosinophils, and mast cells. This inflammatory syndrome is mediated by a transgenic population of natural killer T cells (NKT) induced in an immunodeficient NOD genetic background. The disease is transferrable to immunodeficient recipients, while polyclonal T cells from unaffected syngeneic donors can inhibit the disease phenotype. Because of the fibrotic component, early on-set, spontaneous nature and reproducibility, this novel mouse model provides a unique tool to gain further insight into the underlying mechanisms mediating transformation of chronic inflammation into fibrosis and to evaluate intervention protocols for treating conditions of fibrotic disorders. PMID:27441847

  10. Humanized Mouse Models for the Study of Human Malaria Parasite Biology, Pathogenesis, and Immunity.

    PubMed

    Minkah, Nana K; Schafer, Carola; Kappe, Stefan H I

    2018-01-01

    Malaria parasite infection continues to inflict extensive morbidity and mortality in resource-poor countries. The insufficiently understood parasite biology, continuously evolving drug resistance and the lack of an effective vaccine necessitate intensive research on human malaria parasites that can inform the development of new intervention tools. Humanized mouse models have been greatly improved over the last decade and enable the direct study of human malaria parasites in vivo in the laboratory. Nevertheless, no small animal model developed so far is capable of maintaining the complete life cycle of Plasmodium parasites that infect humans. The ultimate goal is to develop humanized mouse systems in which a Plasmodium infection closely reproduces all stages of a parasite infection in humans, including pre-erythrocytic infection, blood stage infection and its associated pathology, transmission as well as the human immune response to infection. Here, we discuss current humanized mouse models and the future directions that should be taken to develop next-generation models for human malaria parasite research.

  11. Optimized Mouse Models for Liver Fibrosis.

    PubMed

    Kim, Yong Ook; Popov, Yury; Schuppan, Detlef

    2017-01-01

    Fibrosis is the excessive accumulation of extracellular matrix components due to chronic injury, with collagens as predominant structural components. Liver fibrosis can progress to cirrhosis, which is characterized by a severe distortion of the delicate hepatic vascular architecture, the shunting of the blood supply away from hepatocytes and the resultant functional liver failure. Cirrhosis is associated with a highly increased morbidity and mortality and represents the major hard endpoint in clinical studies of chronic liver diseases. Moreover, cirrhosis is a strong cofactor of primary liver cancer. In vivo models are indispensable tools to study the cellular and molecular mechanisms of liver fibrosis and to develop specific antifibrotic therapies towards clinical translation. Here, we provide a detailed description of select optimized mouse models of liver fibrosis and state-of-the-art fibrosis readouts.

  12. Longitudinal Multiplexed Measurement of Quantitative Proteomic Signatures in Mouse Lymphoma Models Using Magneto-Nanosensors.

    PubMed

    Lee, Jung-Rok; Appelmann, Iris; Miething, Cornelius; Shultz, Tyler O; Ruderman, Daniel; Kim, Dokyoon; Mallick, Parag; Lowe, Scott W; Wang, Shan X

    2018-01-01

    Cancer proteomics is the manifestation of relevant biological processes in cancer development. Thus, it reflects the activities of tumor cells, host-tumor interactions, and systemic responses to cancer therapy. To understand the causal effects of tumorigenesis or therapeutic intervention, longitudinal studies are greatly needed. However, most of the conventional mouse experiments are unlikely to accommodate frequent collection of serum samples with a large enough volume for multiple protein assays towards single-object analysis. Here, we present a technique based on magneto-nanosensors to longitudinally monitor the protein profiles in individual mice of lymphoma models using a small volume of a sample for multiplex assays. Methods: Drug-sensitive and -resistant cancer cell lines were used to develop the mouse models that render different outcomes upon the drug treatment. Two groups of mice were inoculated with each cell line, and treated with either cyclophosphamide or vehicle solution. Serum samples taken longitudinally from each mouse in the groups were measured with 6-plex magneto-nanosensor cytokine assays. To find the origin of IL-6, experiments were performed using IL-6 knock-out mice. Results: The differences in serum IL-6 and GCSF levels between the drug-treated and untreated groups were revealed by the magneto-nanosensor measurement on individual mice. Using the multiplex assays and mouse models, we found that IL-6 is secreted by the host in the presence of tumor cells upon the drug treatment. Conclusion: The multiplex magneto-nanosensor assays enable longitudinal proteomic studies on mouse tumor models to understand tumor development and therapy mechanisms more precisely within a single biological object.

  13. Mouse neuroblastoma cell based model and the effect of epileptic events on calcium oscillations and neural spikes

    NASA Astrophysics Data System (ADS)

    Kim, Suhwan; Baek, Juyeong; Jung, Unsang; Lee, Sangwon; Jung, Woonggyu; Kim, Jeehyun; Kang, Shinwon

    2013-05-01

    Recently, Mouse neuroblastoma cells are considered as an attractive model for the study of human neurological and prion diseases, and intensively used as a model system in different areas. Among those areas, differentiation of neuro2a (N2A) cells, receptor mediated ion current, and glutamate induced physiological response are actively investigated. The reason for the interest to mouse neuroblastoma N2A cells is that they have a fast growing rate than other cells in neural origin with a few another advantages. This study evaluated the calcium oscillations and neural spikes recording of mouse neuroblastoma N2A cells in an epileptic condition. Based on our observation of neural spikes in mouse N2A cell with our proposed imaging modality, we report that mouse neuroblastoma N2A cells can be an important model related to epileptic activity studies. It is concluded that the mouse neuroblastoma N2A cells produce the epileptic spikes in vitro in the same way as produced by the neurons or the astrocytes. This evidence advocates the increased and strong level of neurotransmitters release by enhancement in free calcium using the 4-aminopyridine which causes the mouse neuroblastoma N2A cells to produce the epileptic spikes and calcium oscillation.

  14. [Effect of topical application of a recombinant adenovirus carrying promyelocytic leukemia gene in a psoriasis-like mouse model].

    PubMed

    Wang, Qiongyu; Zhang, Aijun; Ma, Huiqun; Wang, Shijie; Ma, Yunyun; Zou, Xingwei; Li, Ruilian

    2013-03-01

    To investigate the effects of topical treatment with adenovirus-mediated promyelocytic leukemia gene (PML) gene in a psoriasis-like mouse model. The effect of adenovirus-mediated PML gene on the granular layer of mouse tail scale epidermis and epithelial mitosis were observed on longitudinal histological sections prepared from the tail skin and vaginal epithelium of the mice. Adenovirus-mediated PML gene significantly inhibited mitosis of mouse vaginal epithelial cells and promoted the formation of granular layer in mouse tail scale epidermis. The therapeutic effect of PML gene in the psoriasis-like mouse model may be associated with increased granular cells and suppressed epidemic cell proliferation.

  15. 24 CFR 1000.128 - Is income verification required for assistance under NAHASDA?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Is income verification required for assistance under NAHASDA? 1000.128 Section 1000.128 Housing and Urban Development Regulations Relating to... § 1000.128 Is income verification required for assistance under NAHASDA? (a) Yes, the recipient must...

  16. 40 CFR 98.128 - Definitions.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... GREENHOUSE GAS REPORTING Fluorinated Gas Production § 98.128 Definitions. Except as provided in this section... not in light liquid service; each barrier fluid system is equipped with a sensor that will detect... pressure; or (2) Equipped with a barrier fluid degassing reservoir that is routed to a process or fuel gas...

  17. EGFR-specific nanoprobe biodistribution in mouse models

    NASA Astrophysics Data System (ADS)

    Fashir, Samia A.; Castilho, Maiara L.; Hupman, Michael A.; Lee, Christopher L. D.; Raniero, Leandro J.; Alwayn, Ian; Hewitt, Kevin C.

    2015-06-01

    Nanotechnology offers a targeted approach to both imaging and treatment of cancer, the leading cause of death worldwide. Previous studies have found nanoparticles with a wide variety of coatings initiate an immune response leading to sequestration in the liver and spleen. In an effort to find a nanoparticle platform which does not elicit an immune response we created 43/44 nm gold or silver nanoparticles coated with biomolecules normally produced by the body, α-lipoic acid and the Epidermal Growth Factor (EGF), and have used mass spectroscopy to determine their biodistribution in mouse models, 24 hours following tail vein injection. Relative to controls, mouse EGF (mEGF) coated silver and gold nanoprobes are found at reduced levels in the liver and spleen. mEGF coated gold nanoprobes on the other hand do not appear to elicit any immune response, as they are found at background levels in these organs. As a result they should remain in circulation for longer and accumulate at high levels in tumors by the enhanced permeability retention (EPR) effect.

  18. Riluzole does not improve lifespan or motor function in three ALS mouse models.

    PubMed

    Hogg, Marion C; Halang, Luise; Woods, Ina; Coughlan, Karen S; Prehn, Jochen H M

    2018-08-01

    Riluzole is the most widespread therapeutic for treatment of the progressive degenerative disease amyotrophic lateral sclerosis (ALS). Riluzole gained FDA approval in 1995 before the development of ALS mouse models. We assessed riluzole in three transgenic ALS mouse models: the SOD1 G93A model, the TDP-43 A315T model, and the recently developed FUS (1-359) model. Age, sex and litter-matched mice were treated with riluzole (22 mg/kg) in drinking water or vehicle (DMSO) from symptom onset. Lifespan was assessed and motor function tests were carried out twice weekly to determine whether riluzole slowed disease progression. Riluzole treatment had no significant benefit on lifespan in any of the ALS mouse models tested. Riluzole had no significant impact on decline in motor performance in the FUS (1-359) and SOD1 G93A transgenic mice as assessed by Rotarod and stride length analysis. Riluzole is widely prescribed for ALS patients despite questions surrounding its efficacy. Our data suggest that if riluzole was identified as a therapeutic candidate today it would not progress past pre-clinical assessment. This raises questions about the standards used in pre-clinical assessment of therapeutic candidates for the treatment of ALS.

  19. Structure and polymorphism of the mouse prion protein gene.

    PubMed Central

    Westaway, D; Cooper, C; Turner, S; Da Costa, M; Carlson, G A; Prusiner, S B

    1994-01-01

    Missense mutations in the prion protein (PrP) gene, overexpression of the cellular isoform of PrP (PrPC), and infection with prions containing the scrapie isoform of PrP (PrPSc) all cause neurodegenerative disease. To understand better the physiology and expression of PrPC, we retrieved mouse PrP gene (Prn-p) yeast artificial chromosome (YAC), cosmid, phage, and cDNA clones. Physical mapping positions Prn-p approximately 300 kb from ecotropic virus integration site number 4 (Evi-4), compatible with failure to detect recombination between Prn-p and Evi-4 in genetic crosses. The Prn-pa allele encompasses three exons, with exons 1 and 2 encoding the mRNA 5' untranslated region. Exon 2 has no equivalent in the Syrian hamster and human PrP genes. The Prn-pb gene shares this intron/exon structure but harbors an approximately 6-kb deletion within intron 2. While the Prn-pb open reading frame encodes two amino acid substitutions linked to prolonged scrapie incubation periods, a deletion of intron 2 sequences also characterizes inbred strains such as RIII/S and MOLF/Ei with shorter incubation periods, making a relationship between intron 2 size and scrapie pathogenesis unlikely. The promoter regions of a and b Prn-p alleles include consensus Sp1 and AP-1 sites, as well as other conserved motifs which may represent binding sites for as yet unidentified transcription factors. Images PMID:7912827

  20. A mouse model of mitochondrial complex III dysfunction induced by myxothiazol

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davoudi, Mina; Kallijärvi, Jukka; Marjavaara, Sanna

    2014-04-18

    Highlights: • Reversible chemical inhibition of complex III in wild type mouse. • Myxothiazol causes decreased complex III activity in mouse liver. • The model is useful for therapeutic trials to improve mitochondrial function. - Abstract: Myxothiazol is a respiratory chain complex III (CIII) inhibitor that binds to the ubiquinol oxidation site Qo of CIII. It blocks electron transfer from ubiquinol to cytochrome b and thus inhibits CIII activity. It has been utilized as a tool in studies of respiratory chain function in in vitro and cell culture models. We developed a mouse model of biochemically induced and reversible CIIImore » inhibition using myxothiazol. We administered myxothiazol intraperitoneally at a dose of 0.56 mg/kg to C57Bl/J6 mice every 24 h and assessed CIII activity, histology, lipid content, supercomplex formation, and gene expression in the livers of the mice. A reversible CIII activity decrease to 50% of control value occurred at 2 h post-injection. At 74 h only minor histological changes in the liver were found, supercomplex formation was preserved and no significant changes in the expression of genes indicating hepatotoxicity or inflammation were found. Thus, myxothiazol-induced CIII inhibition can be induced in mice for four days in a row without overt hepatotoxicity or lethality. This model could be utilized in further studies of respiratory chain function and pharmacological approaches to mitochondrial hepatopathies.« less

  1. 128Xe Lifetime Measurement Using the Coulex-Plunger Technique in Inverse Kinematics

    NASA Astrophysics Data System (ADS)

    Konstantinopoulos, T.; Lagoyannis, A.; Harissopulos, S.; Dewald, A.; Rother, W.; Ilie, G.; Jones, P.; Rakhila, P.; Greenlees, P.; Grahn, T.; Julin, R.; Balabanski, D. L.

    2008-05-01

    The lifetimes of the lowest collective yrast and non-yrast states in 128Xe were measured in a Coulomb excitation experiment using the recoil distance method (RDM) in inverse kinematics. Hereby, the Cologne plunger apparatus was employed together with the JUROGAM spectrometer. Excited states in 128Xe were populated using a 128Xe beam impinging on a natFe target with E(128Xe)~525 MeV. Recoils were detected by means of an array of solar cells placed at forward angles. Recoil-gated γ-spectra were measured at different plunger distances.

  2. Sturckow uses Cycle Ergometer on Middeck (MDDK) during STS-128

    NASA Image and Video Library

    2009-08-29

    S128-E-006313 (29 Aug. 2009) --- Astronaut Rick Sturckow, STS-128 commander, gives a “thumbs-up” signal while exercising on a bicycle ergometer on the middeck of the Earth-orbiting Space Shuttle Discovery. Astronaut Nicole Stott, mission specialist, is visible at right.

  3. Genetically engineered mouse models of craniopharyngioma: an opportunity for therapy development and understanding of tumor biology.

    PubMed

    Apps, John Richard; Martinez-Barbera, Juan Pedro

    2017-05-01

    Adamantinomatous craniopharyngioma (ACP) is the commonest tumor of the sellar region in childhood. Two genetically engineered mouse models have been developed and are giving valuable insights into ACP biology. These models have identified novel pathways activated in tumors, revealed an important function of paracrine signalling and extended conventional theories about the role of organ-specific stem cells in tumorigenesis. In this review, we summarize these mouse models, what has been learnt, their limitations and open questions for future research. We then discussed how these mouse models may be used to test novel therapeutics against potentially targetable pathways recently identified in human ACP. © 2017 The Authors. Brain Pathology published by John Wiley & Sons Ltd on behalf of International Society of Neuropathology.

  4. 128×128 three-dimensional MEMS optical switch module with simultaneous optical path connection for optical cross-connect systems.

    PubMed

    Mizukami, Masato; Yamaguchi, Joji; Nemoto, Naru; Kawajiri, Yuko; Hirata, Hirooki; Uchiyama, Shingo; Makihara, Mitsuhiro; Sakata, Tomomi; Shimoyama, Nobuhiro; Oda, Kazuhiro

    2011-07-20

    A 128×128 three-dimensional MEMS optical switch module and a switching-control algorithm for high-speed connection and optical power stabilization are described. A prototype switch module enables the simultaneous switching of all optical paths. The insertion loss is less than 4.6 dB and is 2.3 dB on average. The switching time is less than 38 ms and is 8 ms on average. We confirmed that the maximum optical power can be obtained and optical power stabilization control is possible. The results confirm that the module is suitable for practical use in optical cross-connect systems. © 2011 Optical Society of America

  5. Galantamine improves olfactory learning in the Ts65Dn mouse model of Down syndrome

    PubMed Central

    Simoes de Souza, Fabio M.; Busquet, Nicolas; Blatner, Megan; Maclean, Kenneth N.; Restrepo, Diego

    2011-01-01

    Down syndrome (DS) is the most common form of congenital intellectual disability. Although DS involves multiple disturbances in various tissues, there is little doubt that in terms of quality of life cognitive impairment is the most serious facet and there is no effective treatment for this aspect of the syndrome. The Ts65Dn mouse model of DS recapitulates multiple aspects of DS including cognitive impairment. Here the Ts65Dn mouse model of DS was evaluated in an associative learning paradigm based on olfactory cues. In contrast to disomic controls, trisomic mice exhibited significant deficits in olfactory learning. Treatment of trisomic mice with the acetylcholinesterase inhibitor galantamine resulted in a significant improvement in olfactory learning. Collectively, our study indicates that olfactory learning can be a sensitive tool for evaluating deficits in associative learning in mouse models of DS and that galantamine has therapeutic potential for improving cognitive abilities. PMID:22355654

  6. Galantamine improves olfactory learning in the Ts65Dn mouse model of Down syndrome.

    PubMed

    de Souza, Fabio M Simoes; Busquet, Nicolas; Blatner, Megan; Maclean, Kenneth N; Restrepo, Diego

    2011-01-01

    Down syndrome (DS) is the most common form of congenital intellectual disability. Although DS involves multiple disturbances in various tissues, there is little doubt that in terms of quality of life cognitive impairment is the most serious facet and there is no effective treatment for this aspect of the syndrome. The Ts65Dn mouse model of DS recapitulates multiple aspects of DS including cognitive impairment. Here the Ts65Dn mouse model of DS was evaluated in an associative learning paradigm based on olfactory cues. In contrast to disomic controls, trisomic mice exhibited significant deficits in olfactory learning. Treatment of trisomic mice with the acetylcholinesterase inhibitor galantamine resulted in a significant improvement in olfactory learning. Collectively, our study indicates that olfactory learning can be a sensitive tool for evaluating deficits in associative learning in mouse models of DS and that galantamine has therapeutic potential for improving cognitive abilities.

  7. Magnolol inhibits the inflammatory response in mouse mammary epithelial cells and a mouse mastitis model.

    PubMed

    Wei, Wang; Dejie, Liang; Xiaojing, Song; Tiancheng, Wang; Yongguo, Cao; Zhengtao, Yang; Naisheng, Zhang

    2015-02-01

    Mastitis comprises an inflammation of the mammary gland, which is almost always linked with bacterial infection. The treatment of mastitis concerns antimicrobial substances, but not very successful. On the other hand, anti-inflammatory therapy with Chinese traditional medicine becomes an effective way for treating mastitis. Magnolol is a polyphenolic binaphthalene compound extracted from the stem bark of Magnolia sp., which has been shown to exert a potential for anti-inflammatory activity. The purpose of this study was to investigate the protective effects of magnolol on inflammation in lipopolysaccharide (LPS)-induced mastitis mouse model in vivo and the mechanism of this protective effects in LPS-stimulated mouse mammary epithelial cells (MMECs) in vitro. The damage of tissues was determined by histopathology and myeloperoxidase (MPO) assay. The expression of pro-inflammatory cytokines was determined by enzyme-linked immunosorbent assay (ELISA). Nuclear factor-kappa B (NF-κB), inhibitory kappa B (IκBα) protein, p38, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and Toll-like receptor 4 (TLR4) were determined by Western blot. The results showed that magnolol significantly inhibit the LPS-induced TNF-α, IL-6, and IL-1β production both in vivo and vitro. Magnolol declined the phosphorylation of IκBα, p65, p38, ERK, and JNK in LPS-stimulated MMECs. Furthermore, magnolol inhibited the expression of TLR4 in LPS-stimulated MMECs. In vivo study, it was also observed that magnolol attenuated the damage of mastitis tissues in the mouse models. These findings demonstrated that magnolol attenuate LPS-stimulated inflammatory response by suppressing TLR4/NF-κB/mitogen-activated protein kinase (MAPK) signaling system. Thereby, magnolol may be a therapeutic agent against mastitis.

  8. 41 CFR 128-1.8009 - Review of Seismic Safety Program.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Review of Seismic Safety Program. 128-1.8009 Section 128-1.8009 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF JUSTICE 1-INTRODUCTION 1.80-Seismic Safety Program...

  9. 41 CFR 128-1.5006-2 - Property management officer (PMO).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... leadership, guidance, and operating procedures for personal property management functions. (b) Ensuring... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Property management officer (PMO). 128-1.5006-2 Section 128-1.5006-2 Public Contracts and Property Management Federal Property...

  10. 32 CFR 701.128 - Exemptions for specific Navy record systems.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 32 National Defense 5 2013-07-01 2013-07-01 false Exemptions for specific Navy record systems. 701.128 Section 701.128 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND...

  11. 32 CFR 701.128 - Exemptions for specific Navy record systems.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 32 National Defense 5 2012-07-01 2012-07-01 false Exemptions for specific Navy record systems. 701.128 Section 701.128 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND...

  12. 32 CFR 701.128 - Exemptions for specific Navy record systems.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 5 2010-07-01 2010-07-01 false Exemptions for specific Navy record systems. 701.128 Section 701.128 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND...

  13. 32 CFR 701.128 - Exemptions for specific Navy record systems.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 5 2011-07-01 2011-07-01 false Exemptions for specific Navy record systems. 701.128 Section 701.128 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY UNITED STATES NAVY REGULATIONS AND OFFICIAL RECORDS AVAILABILITY OF DEPARTMENT OF THE NAVY RECORDS AND...

  14. Isolation of Circulating Tumor Cells in an Orthotopic Mouse Model of Colorectal Cancer.

    PubMed

    Kochall, Susan; Thepkaysone, May-Linn; García, Sebastián A; Betzler, Alexander M; Weitz, Jürgen; Reissfelder, Christoph; Schölch, Sebastian

    2017-07-18

    Despite the advantages of easy applicability and cost-effectiveness, subcutaneous mouse models have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Orthotopic mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in hollow organs such as the large bowel. In order to produce uniform tumors which reliably grow and metastasize, standardized techniques of tumor cell preparation and injection are critical. We have developed an orthotopic mouse model of colorectal cancer (CRC) which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor cells from either primary tumors, 2-dimensional (2D) cell lines or 3-dimensional (3D) organoids are injected into the cecum and, depending on the metastatic potential of the injected tumor cells, form highly metastatic tumors. In addition, CTCs can be found regularly. We here describe the technique of tumor cell preparation from both 2D cell lines and 3D organoids as well as primary tumor tissue, the surgical and injection techniques as well as the isolation of CTCs from the tumor-bearing mice, and present tips for troubleshooting.

  15. Understanding mental retardation in Down's syndrome using trisomy 16 mouse models.

    PubMed

    Galdzicki, Z; Siarey, R J

    2003-06-01

    Mental retardation in Down's syndrome, human trisomy 21, is characterized by developmental delays, language and memory deficits and other cognitive abnormalities. Neurophysiological and functional information is needed to understand the mechanisms of mental retardation in Down's syndrome. The trisomy mouse models provide windows into the molecular and developmental effects associated with abnormal chromosome numbers. The distal segment of mouse chromosome 16 is homologous to nearly the entire long arm of human chromosome 21. Therefore, mice with full or segmental trisomy 16 (Ts65Dn) are considered reliable animal models of Down's syndrome. Ts65Dn mice demonstrate impaired learning in spatial tests and abnormalities in hippocampal synaptic plasticity. We hypothesize that the physiological impairments in the Ts65Dn mouse hippocampus can model the suboptimal brain function occuring at various levels of Down's syndrome brain hierarchy, starting at a single neuron, and then affecting simple and complex neuronal networks. Once these elements create the gross brain structure, their dysfunctional activity cannot be overcome by extensive plasticity and redundancy, and therefore, at the end of the maturation period the mind inside this brain remains deficient and delayed in its capabilities. The complicated interactions that govern this aberrant developmental process cannot be rescued through existing compensatory mechanisms. In summary, overexpression of genes from chromosome 21 shifts biological homeostasis in the Down's syndrome brain to a new less functional state.

  16. 31 CFR 128.5 - Recordkeeping requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... General Information § 128.5 Recordkeeping requirements. Banks, other depository institutions, International Banking Facilities, bank holding companies, brokers and dealers, and nonbanking enterprises subject to the jurisdiction of the United States shall maintain all information necessary to make a...

  17. 31 CFR 128.5 - Recordkeeping requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... General Information § 128.5 Recordkeeping requirements. Banks, other depository institutions, International Banking Facilities, bank holding companies, brokers and dealers, and nonbanking enterprises subject to the jurisdiction of the United States shall maintain all information necessary to make a...

  18. 31 CFR 128.5 - Recordkeeping requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... General Information § 128.5 Recordkeeping requirements. Banks, other depository institutions, International Banking Facilities, bank holding companies, brokers and dealers, and nonbanking enterprises subject to the jurisdiction of the United States shall maintain all information necessary to make a...

  19. 31 CFR 128.5 - Recordkeeping requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... General Information § 128.5 Recordkeeping requirements. Banks, other depository institutions, International Banking Facilities, bank holding companies, brokers and dealers, and nonbanking enterprises subject to the jurisdiction of the United States shall maintain all information necessary to make a...

  20. What Is the Predictive Value of Animal Models for Vaccine Efficacy in Humans? Reevaluating the Potential of Mouse Models for the Human Immune System.

    PubMed

    Jameson, Stephen C; Masopust, David

    2018-04-02

    Much of what we understand about immunology, including the response to vaccines, come from studies in mice because they provide many practical advantages compared with research in higher mammals and humans. Nevertheless, modalities for preventing or treating disease do not always translate from mouse to humans, which has led to increasing scrutiny of the continued merits of mouse research. Here, we summarize the pros and cons of current laboratory mouse models for immunology research and discuss whether overreliance on nonphysiological, ultra-hygienic animal husbandry approaches has limited the ultimate translation potential of mouse-derived data to humans. Alternative approaches are discussed that may extend the use of the mouse model for preclinical studies. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  1. Experimental Mouse Model of Lumbar Ligamentum Flavum Hypertrophy.

    PubMed

    Saito, Takeyuki; Yokota, Kazuya; Kobayakawa, Kazu; Hara, Masamitsu; Kubota, Kensuke; Harimaya, Katsumi; Kawaguchi, Kenichi; Hayashida, Mitsumasa; Matsumoto, Yoshihiro; Doi, Toshio; Shiba, Keiichiro; Nakashima, Yasuharu; Okada, Seiji

    2017-01-01

    Lumbar spinal canal stenosis (LSCS) is one of the most common spinal disorders in elderly people, with the number of LSCS patients increasing due to the aging of the population. The ligamentum flavum (LF) is a spinal ligament located in the interior of the vertebral canal, and hypertrophy of the LF, which causes the direct compression of the nerve roots and/or cauda equine, is a major cause of LSCS. Although there have been previous studies on LF hypertrophy, its pathomechanism remains unclear. The purpose of this study is to establish a relevant mouse model of LF hypertrophy and to examine disease-related factors. First, we focused on mechanical stress and developed a loading device for applying consecutive mechanical flexion-extension stress to the mouse LF. After 12 weeks of mechanical stress loading, we found that the LF thickness in the stress group was significantly increased in comparison to the control group. In addition, there were significant increases in the area of collagen fibers, the number of LF cells, and the gene expression of several fibrosis-related factors. However, in this mecnanical stress model, there was no macrophage infiltration, angiogenesis, or increase in the expression of transforming growth factor-β1 (TGF-β1), which are characteristic features of LF hypertrophy in LSCS patients. We therefore examined the influence of infiltrating macrophages on LF hypertrophy. After inducing macrophage infiltration by micro-injury to the mouse LF, we found excessive collagen synthesis in the injured site with the increased TGF-β1 expression at 2 weeks after injury, and further confirmed LF hypertrophy at 6 weeks after injury. Our findings demonstrate that mechanical stress is a causative factor for LF hypertrophy and strongly suggest the importance of macrophage infiltration in the progression of LF hypertrophy via the stimulation of collagen production.

  2. Effect of CPAP in a Mouse Model of Hyperoxic Neonatal Lung Injury

    PubMed Central

    Reyburn, Brent; Fiore, Juliann M. Di; Raffay, Thomas; Martin, Richard J.; Y.S., Prakash; Jafri, Anjum; MacFarlane, Peter M.

    2015-01-01

    Background Continuous positive airway pressure [CPAP] and supplemental oxygen have become the mainstay of neonatal respiratory support in preterm infants. Although oxygen therapy is associated with respiratory morbidities including bronchopulmonary dysplasia [BPD], the long-term effects of CPAP on lung function are largely unknown. We used a hyperoxia-induced mouse model of BPD to explore the effects of daily CPAP during the first week of life on later respiratory system mechanics. Objective To test the hypothesis that daily CPAP in a newborn mouse model of BPD improves longer term respiratory mechanics. Methods Mouse pups from C57BL/6 pregnant dams were exposed to room air [RA] or hyperoxia [50% O2, 24hrs/day] for the first postnatal week with or without exposure to daily CPAP [6cmH2O, 3hrs/day]. Respiratory system resistance [Rrs] and compliance [Crs] were measured following a subsequent 2 week period of room RA recovery. Additional measurements included radial alveolar counts and macrophage counts. Results Mice exposed to hyperoxia had significantly elevated Rrs, decreased Crs, reduced alveolarization, and increased macrophage counts at three weeks compared to RA treated mice. Daily CPAP treatment significantly improved Rrs, Crs and alveolarization, and decreased lung macrophage infiltration in hyperoxia-exposed pups. Conclusions We have demonstrated that daily CPAP had a longer term benefit on baseline respiratory system mechanics in a neonatal mouse model of BPD. We speculate that this beneficial effect of CPAP was the consequence of a decrease in the inflammatory response and resultant alveolar injury associated with hyperoxic newborn lung injury. PMID:26394387

  3. Lessons learned using different mouse models during space radiation-induced lung tumorigenesis experiments

    NASA Astrophysics Data System (ADS)

    Wang, Jian; Zhang, Xiangming; Wang, Ping; Wang, Xiang; Farris, Alton B.; Wang, Ya

    2016-06-01

    Unlike terrestrial ionizing radiation, space radiation, especially galactic cosmic rays (GCR), contains high energy charged (HZE) particles with high linear energy transfer (LET). Due to a lack of epidemiologic data for high-LET radiation exposure, it is highly uncertain how high the carcinogenesis risk is for astronauts following exposure to space radiation during space missions. Therefore, using mouse models is necessary to evaluate the risk of space radiation-induced tumorigenesis; however, which mouse model is better for these studies remains uncertain. Since lung tumorigenesis is the leading cause of cancer death among both men and women, and low-LET radiation exposure increases human lung carcinogenesis, evaluating space radiation-induced lung tumorigenesis is critical to enable safe Mars missions. Here, by comparing lung tumorigenesis obtained from different mouse strains, as well as miR-21 in lung tissue/tumors and serum, we believe that wild type mice with a low spontaneous tumorigenesis background are ideal for evaluating the risk of space radiation-induced lung tumorigenesis, and circulating miR-21 from such mice model might be used as a biomarker for predicting the risk.

  4. A Novel ex vivo Mouse Mesometrium Culture Model for Investigating Angiogenesis in Microvascular Networks.

    PubMed

    Suarez-Martinez, Ariana D; Bierschenk, Susanne; Huang, Katie; Kaplan, Dana; Bayer, Carolyn L; Meadows, Stryder M; Sperandio, Markus; Murfee, Walter L

    2018-05-18

    The development of models that incorporate intact microvascular networks enables the investigation of multicellular dynamics during angiogenesis. Our laboratory introduced the rat mesentery culture model as such a tool, which would be enhanced with mouse tissue. Since mouse mesentery is avascular, an alternative is mouse mesometrium, the connective tissue of uterine horns. The study's objective was to demonstrate that mouse mesometrium contains microvascular networks that can be cultured to investigate multicellular dynamics during angiogenesis. Harvested mesometrium tissues from C57Bl/6 female mice were cultured in media with serum for up to 7 days. PECAM, NG2, αSMA, and LYVE-1 labeling identified endothelial cells, pericytes, smooth muscle cells, and lymphatic endothelial cells, respectively. These cells comprised microvascular networks with arterioles, venules, and capillaries. Compared to day 0, capillary sprouts per vascular length were increased by 3 and 5 days in culture (day 0, 0.08 ± 0.01; day 3, 3.19 ± 0.78; day 5, 2.49 ± 0.05 sprouts/mm; p < 0.05). Time-lapse imaging of cultured tissues from FlkEGFP mice showcases the use of the model for lineage studies. The impact is supported by the identification of endothelial cell jumping from one sprout to another. These results introduce a novel culture model for investigating multicellular dynamics during angiogenesis in real-time ex vivo microvascular networks. © 2018 S. Karger AG, Basel.

  5. Longitudinal Multiplexed Measurement of Quantitative Proteomic Signatures in Mouse Lymphoma Models Using Magneto-Nanosensors

    PubMed Central

    Lee, Jung-Rok; Appelmann, Iris; Miething, Cornelius; Shultz, Tyler O.; Ruderman, Daniel; Kim, Dokyoon; Mallick, Parag; Lowe, Scott W.; Wang, Shan X.

    2018-01-01

    Cancer proteomics is the manifestation of relevant biological processes in cancer development. Thus, it reflects the activities of tumor cells, host-tumor interactions, and systemic responses to cancer therapy. To understand the causal effects of tumorigenesis or therapeutic intervention, longitudinal studies are greatly needed. However, most of the conventional mouse experiments are unlikely to accommodate frequent collection of serum samples with a large enough volume for multiple protein assays towards single-object analysis. Here, we present a technique based on magneto-nanosensors to longitudinally monitor the protein profiles in individual mice of lymphoma models using a small volume of a sample for multiplex assays. Methods: Drug-sensitive and -resistant cancer cell lines were used to develop the mouse models that render different outcomes upon the drug treatment. Two groups of mice were inoculated with each cell line, and treated with either cyclophosphamide or vehicle solution. Serum samples taken longitudinally from each mouse in the groups were measured with 6-plex magneto-nanosensor cytokine assays. To find the origin of IL-6, experiments were performed using IL-6 knock-out mice. Results: The differences in serum IL-6 and GCSF levels between the drug-treated and untreated groups were revealed by the magneto-nanosensor measurement on individual mice. Using the multiplex assays and mouse models, we found that IL-6 is secreted by the host in the presence of tumor cells upon the drug treatment. Conclusion: The multiplex magneto-nanosensor assays enable longitudinal proteomic studies on mouse tumor models to understand tumor development and therapy mechanisms more precisely within a single biological object. PMID:29507628

  6. A Mouse Model to Investigate Postmenopausal Biology as an Etiology of Ovarian Cancer Risk

    DTIC Science & Technology

    2006-11-01

    Wv mice and genetic alterations such as p53, pten, or p27kip1, which are found in human ovarian cancer. 2. Body: Research Progress In the first year...press (Yang et al., Am. J. Pathology 2007). To collaborate with the mouse model study, we have also examined human ovaries obtained from prophylactic...results in the coming years. Xu, Xiangxi, Ph.D. 8 3. Key Research Accomplishments (1) Further verify the relevance of the Wv mouse model to human

  7. Establishment of a C57BL/6N mouse model of giardiasis.

    PubMed

    Lu, Siqi; Luo, Xiaobing; Chen, Xiaoning; Wang, Fengyun

    2002-10-01

    To establish a C57BL/6N mouse model infected with Giardia lamblia (G. lamblia) isolates from human origin. Two groups of C57BL/6N mouse were inoculated with purified cysts of two G. lamblia isolates (CD and XZ) by gavage separately. Patterns and curves of cyst excretion of the infected mice were observed and summarized. Histopathological changes of the small intestines of the infected mice were observed. Thirty-six mice receiving 1 x 10(4) cysts each were all infected. The C57BL/6N mouse showed high susceptibility to G. lamblia infection. There was no notable distinction between the two groups of the mice infected by the cysts of CD and XZ isolates. Cyst excretion occurred with intermittence. Of 36 infected mice, 32 (89%) passed cysts intermittently and 4 (11%) others persistently. The latent period of cyst excretion was 0 - 3 days p.i. (post-inoculation). The interruption of cyst excretion ranged from 12 to 20 days p.i. The fastigium of the cyst excretion was on day 6 p.i. The peak count of the cysts passed during a 2 h collection period was 2.3 x 10(7)/g fecal specimen. Edema, inflammation, cell infiltration, small blood vessels congestion, mitotic figures and mucosa necrosis appeared in sections of intestines. C57Bl/6N mouse is a suitable animal model of G. lamblia.

  8. 33 CFR 128.100 - Does this part apply to me?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Does this part apply to me? 128.100 Section 128.100 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... me? This part applies to all passenger terminals in the United States or its territories when being...

  9. 33 CFR 128.100 - Does this part apply to me?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 2 2011-07-01 2011-07-01 false Does this part apply to me? 128.100 Section 128.100 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... me? This part applies to all passenger terminals in the United States or its territories when being...

  10. 33 CFR 128.100 - Does this part apply to me?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Does this part apply to me? 128.100 Section 128.100 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... me? This part applies to all passenger terminals in the United States or its territories when being...

  11. 33 CFR 128.100 - Does this part apply to me?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Does this part apply to me? 128.100 Section 128.100 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... me? This part applies to all passenger terminals in the United States or its territories when being...

  12. Recent technological advances in using mouse models to study ovarian cancer.

    PubMed

    House, Carrie Danielle; Hernandez, Lidia; Annunziata, Christina Messineo

    2014-01-01

    Serous epithelial ovarian cancer (SEOC) is the most lethal gynecological cancer in the United States with disease recurrence being the major cause of morbidity and mortality. Despite recent advances in our understanding of the molecular mechanisms responsible for the development of SEOC, the survival rate for women with this disease has remained relatively unchanged in the last two decades. Preclinical mouse models of ovarian cancer, including xenograft, syngeneic, and genetically engineered mice, have been developed to provide a mechanism for studying the development and progression of SEOC. Such models strive to increase our understanding of the etiology and dissemination of ovarian cancer in order to overcome barriers to early detection and resistance to standard chemotherapy. Although there is not a single model that is most suitable for studying ovarian cancer, improvements have led to current models that more closely mimic human disease in their genotype and phenotype. Other advances in the field, such as live animal imaging techniques, allow effective monitoring of the microenvironment and therapeutic efficacy. New and improved preclinical mouse models, combined with technological advances to study such models, will undoubtedly render success of future human clinical trials for patients with SEOC.

  13. Recent Technological Advances in Using Mouse Models to Study Ovarian Cancer

    PubMed Central

    House, Carrie Danielle; Hernandez, Lidia; Annunziata, Christina Messineo

    2014-01-01

    Serous epithelial ovarian cancer (SEOC) is the most lethal gynecological cancer in the United States with disease recurrence being the major cause of morbidity and mortality. Despite recent advances in our understanding of the molecular mechanisms responsible for the development of SEOC, the survival rate for women with this disease has remained relatively unchanged in the last two decades. Preclinical mouse models of ovarian cancer, including xenograft, syngeneic, and genetically engineered mice, have been developed to provide a mechanism for studying the development and progression of SEOC. Such models strive to increase our understanding of the etiology and dissemination of ovarian cancer in order to overcome barriers to early detection and resistance to standard chemotherapy. Although there is not a single model that is most suitable for studying ovarian cancer, improvements have led to current models that more closely mimic human disease in their genotype and phenotype. Other advances in the field, such as live animal imaging techniques, allow effective monitoring of the microenvironment and therapeutic efficacy. New and improved preclinical mouse models, combined with technological advances to study such models, will undoubtedly render success of future human clinical trials for patients with SEOC. PMID:24592355

  14. A G542X cystic fibrosis mouse model for examining nonsense mutation directed therapies.

    PubMed

    McHugh, Daniel R; Steele, Miarasa S; Valerio, Dana M; Miron, Alexander; Mann, Rachel J; LePage, David F; Conlon, Ronald A; Cotton, Calvin U; Drumm, Mitchell L; Hodges, Craig A

    2018-01-01

    Nonsense mutations are present in 10% of patients with CF, produce a premature termination codon in CFTR mRNA causing early termination of translation, and lead to lack of CFTR function. There are no currently available animal models which contain a nonsense mutation in the endogenous Cftr locus that can be utilized to test nonsense mutation therapies. In this study, we create a CF mouse model carrying the G542X nonsense mutation in Cftr using CRISPR/Cas9 gene editing. The G542X mouse model has reduced Cftr mRNA levels, demonstrates absence of CFTR function, and displays characteristic manifestations of CF mice such as reduced growth and intestinal obstruction. Importantly, CFTR restoration is observed in G542X intestinal organoids treated with G418, an aminoglycoside with translational readthrough capabilities. The G542X mouse model provides an invaluable resource for the identification of potential therapies of CF nonsense mutations as well as the assessment of in vivo effectiveness of these potential therapies targeting nonsense mutations.

  15. 15-micro-m 128 x 128 GaAs/Al(x)Ga(1-x) As Quantum Well Infrared Photodetector Focal Plane Array Camera

    NASA Technical Reports Server (NTRS)

    Gunapala, Sarath D.; Park, Jin S.; Sarusi, Gabby; Lin, True-Lon; Liu, John K.; Maker, Paul D.; Muller, Richard E.; Shott, Craig A.; Hoelter, Ted

    1997-01-01

    In this paper, we discuss the development of very sensitive, very long wavelength infrared GaAs/Al(x)Ga(1-x)As quantum well infrared photodetectors (QWIP's) based on bound-to-quasi-bound intersubband transition, fabrication of random reflectors for efficient light coupling, and the demonstration of a 15 micro-m cutoff 128 x 128 focal plane array imaging camera. Excellent imagery, with a noise equivalent differential temperature (N E(delta T)) of 30 mK has been achieved.

  16. Characterization of a novel genetically obese mouse model demonstrating early onset hyperphagia and hyperleptinemia.

    PubMed

    Nakahara, Keiko; Bannai, Makoto; Maruyama, Keisuke; Suzuki, Yoshihiro; Okame, Rieko; Murakami, Noboru

    2013-08-01

    Obesity is a critical risk factor for the development of metabolic syndrome, and many obese animal models are used to investigate the mechanisms responsible for the appearance of symptoms. To establish a new obese mouse model, we screened ∼13,000 ICR mice and discovered a mouse demonstrating spontaneous obesity. We named this mouse "Daruma" after a traditional Japanese ornament. Following the fixation of the genotype, these animals exhibited obese phenotypes according to Mendel's law of inheritance. In the Daruma mouse, the leptin receptor gene sequence carried two base mutations that are good candidates for the variation(s) responsible for the obese phenotype. The Daruma mice developed characteristic visceral fat accumulation at 4 wk of age, and the white adipose and liver tissues exhibited increases in cell size and lipid droplets, respectively. No histological abnormalities were observed in other tissues of the Daruma mice, even after the mice reached 25 wk of age. Moreover, the onset of impaired leptin signaling was early and manifested as hyperleptinemia and hyperinsulinemia. Pair feeding completely inhibited obesity, although these mice rapidly developed hyperphagia and obesity followed by hyperleptinemia when pair feeding ceased and free-access feeding was permitted. Therefore, the Daruma mice exhibited unique characteristics and may be a good model for studying human metabolic syndrome.

  17. Effects of environmental enrichment on the amyotrophic lateral sclerosis mouse model.

    PubMed

    Sorrells, A D; Corcoran-Gomez, K; Eckert, K A; Fahey, A G; Hoots, B L; Charleston, L B; Charleston, J S; Roberts, C R; Markowitz, H

    2009-04-01

    The manner in which an animal's environment is furnished may have significant implications for animal welfare as well as research outcomes. We evaluated four different housing conditions to determine the effects of what has been considered standard rodent enrichment and the exercise opportunities those environments allow on disease progression in the amyotrophic lateral sclerosis mouse model. Forty-eight copper/zinc superoxide dismutase mice (strain: B6SJL-TgN [SOD1-G931]1Gur) (SOD1) and 48 control (C) (strain: B6SJL-TgN[SOD1]2Gur) male mice were randomly assigned to four different conditions where 12 SOD1 and 12 C animals were allotted to each condition (n = 96). Conditions tested the effects of standard housing, a forced exercise regime, access to a mouse house and opportunity for ad libitum exercise on a running wheel. In addition to the daily all-occurrence behavioural sampling, mice were weighed and tested twice per week on gait and Rotor-Rod performance until the mice reached the age of 150 days (C) or met the criteria for our humane endpoint (SOD1). The SOD1 mice exposed to the forced exercise regime and wheel access did better in average lifespan and Rotor-Rod performance, than SOD1 mice exposed to the standard cage and mouse house conditions. In SOD1 mice, stride length remained longest throughout the progression of the disease in mice exposed to the forced exercise regime compared with other SOD1 conditions. Within the control group, mice in the standard cage and forced exercise regime conditions performed significantly less than the mice with the mouse house and wheels on the Rotor-Rod. Alpha motor neuron counts were highest in mice with wheels and in mice exposed to forced exercise regime in both mouse strains. All SOD1 mice had significantly lower alpha neuron counts than controls (P < 0.05). These data show that different enrichment strategies affect behaviour and disease progression in a transgenic mouse model, and may have implications for the

  18. A recombinant lentiviral PDGF-driven mouse model of proneural glioblastoma.

    PubMed

    Rahme, Gilbert J; Luikart, Bryan W; Cheng, Chao; Israel, Mark A

    2018-02-19

    Mouse models of glioblastoma (GBM), the most aggressive primary brain tumor, are critical for understanding GBM pathology and can contribute to the preclinical evaluation of therapeutic agents. Platelet-derived growth factor (PDGF) signaling has been implicated in the development and pathogenesis of GBM, specifically the proneural subtype. Although multiple mouse models of PDGF-driven glioma have been described, they require transgenic mice engineered to activate PDGF signaling and/or impair tumor suppressor genes and typically represent lower-grade glioma. We designed recombinant lentiviruses expressing both PDGFB and a short hairpin RNA targeting Cdkn2a to induce gliomagenesis following stereotactic injection into the dentate gyrus of adult immunocompetent mice. We engineered these viruses to coexpress CreERT2 with PDGFB, allowing for deletion of floxed genes specifically in transduced cells, and designed another version of this recombinant lentivirus in which enhanced green fluorescent protein was coexpressed with PDGFB and CreERT2 to visualize transduced cells. The dentate gyrus of injected mice showed hypercellularity one week post-injection and subsequently developed bona fide tumors with the pathologic hallmarks of GBM leading to a median survival of 77 days post-injection. Transcriptomic analysis of these tumors revealed a proneural gene expression signature. Informed by the genetic alterations observed in human GBM, we engineered a novel mouse model of proneural GBM. While reflecting many of the advantages of transgenic mice, this model allows for the facile in vivo testing of gene function in tumor cells and makes possible the rapid production of large numbers of immunocompetent tumor-bearing mice for preclinical testing of therapeutics. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  19. Magnetic resonance imaging of amyloid plaques in transgenic mouse models of Alzheimer's disease

    PubMed Central

    Chamberlain, Ryan; Wengenack, Thomas M.; Poduslo, Joseph F.; Garwood, Michael; Jack, Clifford R.

    2011-01-01

    A major objective in the treatment of Alzheimer's disease is amyloid plaque reduction. Transgenic mouse models of Alzheimer's disease provide a controlled and consistent environment for studying amyloid plaque deposition in Alzheimer's disease. Magnetic resonance imaging is an attractive tool for longitudinal studies because it offers non-invasive monitoring of amyloid plaques. Recent studies have demonstrated the ability of magnetic resonance imaging to detect individual plaques in living mice. This review discusses the mouse models, MR pulse sequences, and parameters that have been used to image plaques and how they can be optimized for future studies. PMID:21499442

  20. Exploring molecular genetics of bladder cancer: lessons learned from mouse models

    PubMed Central

    Ahmad, Imran; Sansom, Owen J.; Leung, Hing Y.

    2012-01-01

    Urothelial cell carcinoma (UCC) of the bladder is one of the most common malignancies worldwide, causing considerable morbidity and mortality. It is unusual among the epithelial carcinomas because tumorigenesis can occur by two distinct pathways: low-grade, recurring papillary tumours usually contain oncogenic mutations in FGFR3 or HRAS, whereas high-grade, muscle-invasive tumours with metastatic potential generally have defects in the pathways controlled by the tumour suppressors p53 and retinoblastoma (RB). Over the past 20 years, a plethora of genetically engineered mouse (GEM) models of UCC have been developed, containing deletions or mutations of key tumour suppressor genes or oncogenes. In this review, we provide an up-to-date summary of these GEM models, analyse their flaws and weaknesses, discuss how they have advanced our understanding of UCC at the molecular level, and comment on their translational potential. We also highlight recent studies supporting a role for dysregulated Wnt signalling in UCC and the development of mouse models that recapitulate this dysregulation. PMID:22422829