Sample records for yadernye g-faktory vysokospinovykh

  1. Factors Influencing the Transition to a New Leadership Position in Serbian Armed Forces Organizational Units

    DTIC Science & Technology

    2014-12-12

    staff group/section to be efficient?) 3. Koji unutršnji faktori najviše utiču na rad grupe/odseka u Generalštabu? (What, within the command, most...influences the staff group/section’s performance?) 4. Koji spoljni faktori najviše utiču na rad grupe/odseka u Generalštabu? (What, from...dužnosti načelnika grupe/odseka u Generalštabu uspešan? (What are the indicators that successful transition has occurred?) 7. Koji unutrašnji

  2. Comparative Analysis of gO Isoforms Reveals that Strains of Human Cytomegalovirus Differ in the Ratio of gH/gL/gO and gH/gL/UL128-131 in the Virion Envelope

    PubMed Central

    Zhou, Momei; Yu, Qin; Wechsler, Anya

    2013-01-01

    Herpesvirus glycoprotein complex gH/gL provides a core entry function through interactions with the fusion protein gB and can also influence tropism through receptor interactions. The Epstein-Barr virus gH/gL and gH/gL/gp42 serve both functions for entry into epithelial and B cells, respectively. Human cytomegalovirus (HCMV) gH/gL can be bound by the UL128-131 proteins or gO. The phenotypes of gO and UL128-131 mutants suggest that gO-gH/gL interactions are necessary for the core entry function on all cell types, whereas the binding of UL128-131 to gH/gL likely relates to a distinct receptor-binding function for entry into some specific cell types (e.g., epithelial) but not others (e.g., fibroblasts and neurons). There are at least eight isoforms of gO that differ by 10 to 30% of amino acids, and previous analysis of two HCMV strains suggested that some isoforms of gO function like chaperones, disassociating during assembly to leave unbound gH/gL in the virion envelope, while others remain bound to gH/gL. For the current report, we analyzed the gH/gL complexes present in the virion envelope of several HCMV strains, each of which encodes a distinct gO isoform. Results indicate that all strains of HCMV contain stable gH/gL/gO trimers and gH/gL/UL128-131 pentamers and little, if any, unbound gH/gL. TR, TB40/e, AD169, and PH virions contained vastly more gH/gL/gO than gH/gL/UL128-131, whereas Merlin virions contained mostly gH/gL/UL128-131, despite abundant unbound gO remaining in the infected cells. Suppression of UL128-131 expression during Merlin replication dramatically shifted the ratio toward gH/gL/gO. These data suggest that Merlin gO is less efficient than other gO isoforms at competing with UL128-131 for binding to gH/gL. Thus, gO diversity may influence the pathogenesis of HCMV through effects on the assembly of the core versus tropism gH/gL complexes. PMID:23804643

  3. Overview of Shipyard coast line with Piers G1, G2, G3, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Overview of Shipyard coast line with Piers G-1, G-2, G-3, G-4, and G-5 in view, view facing east-southeast - U.S. Naval Base, Pearl Harbor, Pier & Quay Walls, Entrance to Dry Dock No. 2 & Repair Wharfs, east & west sides of Dry Dock No. 2 & west side of Dry Dock No. 3, Pearl City, Honolulu County, HI

  4. G4RNA: an RNA G-quadruplex database

    PubMed Central

    Garant, Jean-Michel; Luce, Mikael J.; Scott, Michelle S.

    2015-01-01

    Abstract G-quadruplexes (G4) are tetrahelical structures formed from planar arrangement of guanines in nucleic acids. A simple, regular motif was originally proposed to describe G4-forming sequences. More recently, however, formation of G4 was discovered to depend, at least in part, on the contextual backdrop of neighboring sequences. Prediction of G4 folding is thus becoming more challenging as G4 outlier structures, not described by the originally proposed motif, are increasingly reported. Recent observations thus call for a comprehensive tool, capable of consolidating the expanding information on tested G4s, in order to conduct systematic comparative analyses of G4-promoting sequences. The G4RNA Database we propose was designed to help meet the need for easily-retrievable data on known RNA G4s. A user-friendly, flexible query system allows for data retrieval on experimentally tested sequences, from many separate genes, to assess G4-folding potential. Query output sorts data according to sequence position, G4 likelihood, experimental outcomes and associated bibliographical references. G4RNA also provides an ideal foundation to collect and store additional sequence and experimental data, considering the growing interest G4s currently generate. Database URL: scottgroup.med.usherbrooke.ca/G4RNA PMID:26200754

  5. Echinococcus canadensis (Cestoda: Taeniidae) is a valid species consisting of the mitochondrial genotypes G6, G7, G8 and G10

    USDA-ARS?s Scientific Manuscript database

    The species status of Echinococcus canadensis has long been controversial, mainly because it consists of the mitochondrial genotypes G6, G7, G8 and G10 with different host affinity: G6 (camel strain) and G7 (pig strain) with domestic cycles and G8 (cervid strain) and G10 (Fennoscandian cervid strain...

  6. 76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-07

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

  7. 76 FR 24910 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Forms G- 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of...

  8. Importance of Highly Conserved Peptide Sites of Human Cytomegalovirus gO for Formation of the gH/gL/gO Complex

    PubMed Central

    Stegmann, Cora; Abdellatif, Mohamed E. A.; Laib Sampaio, Kerstin; Walther, Paul

    2016-01-01

    ABSTRACT The glycoprotein O (gO) is betaherpesvirus specific. Together with the viral glycoproteins H and L, gO forms a covalent trimeric complex that is part of the viral envelope. This trimer is crucial for cell-free infectivity of human cytomegalovirus (HCMV) but dispensable for cell-associated spread. We hypothesized that the amino acids that are conserved among gOs of different cytomegaloviruses are important for the formation of the trimeric complex and hence for efficient virus spread. In a mutational approach, nine peptide sites, containing all 13 highly conserved amino acids, were analyzed in the context of HCMV strain TB40-BAC4 with regard to infection efficiency and formation of the gH/gL/gO complex. Mutation of amino acids (aa) 181 to 186 or aa 193 to 198 resulted in the loss of the trimer and a complete small-plaque phenotype, whereas mutation of aa 108 or aa 249 to 254 caused an intermediate phenotype. While individual mutations of the five conserved cysteines had little impact, their relevance was revealed in a combined mutation, which abrogated both complex formation and cell-free infectivity. C343 was unique, as it was sufficient and necessary for covalent binding of gO to gH/gL. Remarkably, however, C218 together with C167 rescued infectivity in the absence of detectable covalent complex formation. We conclude that all highly conserved amino acids contribute to the function of gO to some extent but that aa 181 to 198 and cysteines 343, 218, and 167 are particularly relevant. Surprisingly, covalent binding of gO to gH/gL is required neither for its incorporation into virions nor for proper function in cell-free infection. IMPORTANCE Like all herpesviruses, the widespread human pathogen HCMV depends on glycoproteins gB, gH, and gL for entry into target cells. Additionally, gH and gL have to bind gO in a trimeric complex for efficient cell-free infection. Homologs of gO are shared by all cytomegaloviruses, with 13 amino acids being highly conserved

  9. Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

    PubMed

    Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

    1997-01-01

    The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

  10. Human cytomegalovirus glycoprotein complex gH/gL/gO uses PDGFR-α as a key for entry

    PubMed Central

    Boos, Simone; Resch, Moritz; Brizic, Ilija; Mach, Michael; Scrivano, Laura

    2017-01-01

    Herpesvirus gH/gL envelope glycoprotein complexes are key players in virus entry as ligands for host cell receptors and by promoting fusion of viral envelopes with cellular membranes. Human cytomegalovirus (HCMV) has two alternative gH/gL complexes, gH/gL/gO and gH/gL/UL128,130,131A which both shape the HCMV tropism. By studying binding of HCMV particles to fibroblasts, we could for the first time show that virion gH/gL/gO binds to platelet-derived growth factor-α (PDGFR-α) on the surface of fibroblasts and that gH/gL/gO either directly or indirectly recruits gB to this complex. PDGFR-α functions as an entry receptor for HCMV expressing gH/gL/gO, but not for HCMV mutants lacking the gH/gL/gO complex. PDGFR-α-dependent entry is not dependent on activation of PDGFR-α. We could also show that the gH/gL/gO—PDGFR-α interaction starts the predominant entry pathway for infection of fibroblasts with free virus. Cell-associated virus spread is either driven by gH/gL/gO interacting with PDGFR-α or by the gH/gL/UL128,130,131A complex. PDGFR-α-positive cells may thus be preferred first target cells for infections with free virus which might have implications for the design of future HCMV vaccines or anti-HCMV drugs. PMID:28403202

  11. 7 CFR Exhibit G to Subpart G of... - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 13 2011-01-01 2009-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

  12. 7 CFR Exhibit G to Subpart G of... - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 13 2012-01-01 2012-01-01 false [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

  13. 7 CFR Exhibit G to Subpart G of... - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 13 2013-01-01 2013-01-01 false [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

  14. 7 CFR Exhibit G to Subpart G of... - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 13 2014-01-01 2013-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

  15. 7 CFR Exhibit G to Subpart G of... - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 13 2010-01-01 2009-01-01 true [Reserved] G Exhibit G to Subpart G of Part 1940 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS...) PROGRAM REGULATIONS (CONTINUED) GENERAL Environmental Program Exhibit G to Subpart G of Part 1940...

  16. Towards G2G: Systems of Technology Database Systems

    NASA Technical Reports Server (NTRS)

    Maluf, David A.; Bell, David

    2005-01-01

    We present an approach and methodology for developing Government-to-Government (G2G) Systems of Technology Database Systems. G2G will deliver technologies for distributed and remote integration of technology data for internal use in analysis and planning as well as for external communications. G2G enables NASA managers, engineers, operational teams and information systems to "compose" technology roadmaps and plans by selecting, combining, extending, specializing and modifying components of technology database systems. G2G will interoperate information and knowledge that is distributed across organizational entities involved that is ideal for NASA future Exploration Enterprise. Key contributions of the G2G system will include the creation of an integrated approach to sustain effective management of technology investments that supports the ability of various technology database systems to be independently managed. The integration technology will comply with emerging open standards. Applications can thus be customized for local needs while enabling an integrated management of technology approach that serves the global needs of NASA. The G2G capabilities will use NASA s breakthrough in database "composition" and integration technology, will use and advance emerging open standards, and will use commercial information technologies to enable effective System of Technology Database systems.

  17. Penicillin G Benzathine and Penicillin G Procaine Injection

    MedlinePlus

    ... to treat and prevent certain infections caused by bacteria. Penicillin G benzathine and penicillin G procaine injection ... of medications called penicillins. It works by killing bacteria that cause infections.Antibiotics such as penicillin G ...

  18. Plasminogen activator inhibitor 1 4G/5G and -844G/A variants in idiopathic recurrent pregnancy loss.

    PubMed

    Magdoud, Kalthoum; Herbepin, Viviana G; Touraine, Renaud; Almawi, Wassim Y; Mahjoub, Touhami

    2013-09-01

    Plasminogen activator inhibitor type 1 (PAI-1) regulates fibrinolysis, and the common promoter region variants -675G/A (4G/5G) and -844G/A are associated with increased thrombotic risk. Despite evidence linking altered fibrinolysis with adverse pregnancy events, including idiopathic recurrent pregnancy loss (RPL), the contribution of PAI-1 variants to RPL risk remains controversial. We investigated the association between the PAI-1 -844G/A and 4G/5G (-675G/A) variants with altered risk of RPL. This was a case-control study involving 304 women with confirmed RPL and 371 age- and ethnically matched control women. PAI-1 genotyping was performed by PCR single-specific primer -675 (G/A) and real-time PCR (-844G/A) analysis. Minor allele frequency (MAF) of 4G/5G (P < 0.001), but not -844G/A (P = 0.507), was higher in RPL cases. PAI-1 4G/5G single-nucleotide polymorphism (SNP) was significantly associated with RPL under additive, dominant, and recessive genetic models; no association of -844G/A with RPL was seen irrespective of the genetic model tested. Taking common -844G/5G haplotype as reference (OR = 1.00), multivariate analysis confirmed the association of 4G-containing -844A/4G (P < 0.001) and -844G/4G (P = 0.011) haplotypes with increased RPL risk. 4G/5G, but not -844G/A, PAI-1 variant is associated with an increased risk of RPL. © 2013 John Wiley & Sons Ltd.

  19. Sensitivity of solar g-modes to varying G cosmologies

    NASA Technical Reports Server (NTRS)

    Guenther, D. B.; Sills, Ken; Demarque, Pierre; Krauss, Lawrence M.

    1995-01-01

    The sensitivity of the solar g-mode oscillation spectrum to variability in the universal gravitational constant G is described. Solar models in varying G cosmologies were constructed by evolving a zero-age main-sequence stellar model to the Sun's current age, while allowing the value of G to change according to the power law G(t) proportional to t(exp -beta), where Beta approximately equals delta G/GH and H is the Hubble constant. All solar models were constrained to the observed luminosity and radius at the current age of the Sun by adjusting the helium abundance and the mixing-length parameter of the models in the usual way for standard stellar models. Low-l g-mode oscillation periods were calculated for each of the models and compared to the claimed observation of the solar g-mode oscillation spectrum by Hill & Gu (1990). If one accepts Hill & Gu's claims, then within the uncertainties of the physics of the solar model calculation, our models rule out all but (delta G/GH) less than approximately 0.05. In other words, we conclude that G could not have varied by more than 2% over the past 4.5 Gyr, the lifetime of the present-day Sun. This result lends independent support to the validity of the standard solar model.

  20. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  1. Conformational organizations of G-quadruplexes composed of d(G(4)T(n))(3)G(4).

    PubMed

    Wong, Wan Chi; Zhuang, Jinyi; Ng, Selina Ling Ling; New, Lilian Li Lin; Hiew, Shuhui; Guo, Juanjuan; Yang, Zhaoqi; Li, Tianhu

    2010-08-01

    Structural polymorphism is one of the important issues with regard to G-quadruplexes because the structural diversity may significantly affect their biological functions in vivo and their physical property in nano-material. A series of oligonucleotides with four repeat guanines sequence [d(G(4)T(n))(3)G(4) (n=1-6)] were designed. In this study, the effects of loop length on the formation of structures of G-quadruplex were investigated through the result of CD (circular dichroism) and 20% non-denatured polyacrylamide gel electrophoresis. Our studies demonstrate that the length of loop in 100mM KCl solution could predict the conformation of G-quadruplex. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. Mapping regions of Epstein-Barr virus (EBV) glycoprotein B (gB) important for fusion function with gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Plate, Aileen E.; Reimer, Jessica J.; Jardetzky, Theodore S.

    Glycoproteins gB and gH/gL are required for entry of Epstein-Barr virus (EBV) into cells, but the role of each glycoprotein and how they function together to mediate fusion is unclear. Analysis of the functional homology of gB from the closely related primate gammaherpesvirus, rhesus lymphocryptovirus (Rh-LCV), showed that EBV gB could not complement Rh gB due to a species-specific dependence between gB and gL. To map domains of gB required for this interaction, we constructed a panel of EBV/Rh gB chimeric proteins. Analysis showed that insertion of Rh gB from residues 456 to 807 restored fusion function of EBV gBmore » with Rh gH/gL, suggesting this region of gB is important for interaction with gH/gL. Split YFP bimolecular complementation (BiFC) provided evidence of an interaction between EBV gB and gH/gL. Together, our results suggest the importance of a gB-gH/gL interaction in EBV-mediated fusion with B cells requiring the region of EBV gB from 456 to 807.« less

  3. Demonstration of IgG Subclass (IgG1 and IgG3) in Immuno-Related Hemocytopenia.

    PubMed

    Shao, Yuanyuan; Qi, Xiao; Fu, Rong; Liu, Hui; Wang, Yihao; Ding, Shaoxue; Wang, Huaquan; Li, Lijuan; Shao, Zonghong

    2018-06-01

    Immuno-related hemocytopenia (IRH) is defined as idiopathic cytopenia of undetermined significance (ICUS) patients with autoantibodies. In our previous studies, we found that IgG1 levels were increased in IRH patients and might cause the destruction of hematopoietic cells. In this study, we analyzed IgG subclasses in 30 IRH patients (male:female = 13:17, median age 32 years, range 18 - 56), 15 IRH remission patients (IRH-R) (male:female = 6:9, median age 34, range 20 - 52) and 20 normal controls (male:female = 8:12, median age 27, range 24 - 36) by Cytometric Bead Array, Flow Cytometry and Immunohistochemical staining. Levels of IgG1/IgG3 in the bone marrow supernatant of IRH patents, as well as the proportion of CD5+ B lymphocytes and Th2 cells (CD3+CD8-IL-4+) were higher than those of IRH-R patients and normal controls, and IgG1 levels had a positive correlation with the proportion of Th2 cells. In IRH patients, IgG1 and IgG3 were positive on nucleated erythrocytes and granulocytes, which were negative in IRH-R patients and healthy controls and had inverse correlations with hematopoietic function. Using immunohistochemical staining, IgG1 were also detected on bone marrow biopsies of IRH patients. The results indicated that IgG1 and IgG3 autoantibodies in IRH patients might play a key role in the IRH pathogenesis and in the abnormal immune function of IRH patients.

  4. Molecular Characterization of Echinococcus granulosus Cysts in North Indian Patients: Identification of G1, G3, G5 and G6 Genotypes

    PubMed Central

    Sharma, Monika; Sehgal, Rakesh; Fomda, Bashir Ahmad; Malhotra, Anil; Malla, Nancy

    2013-01-01

    Background Cystic echinococcosis (CE) caused by the Echinococcus granulosus, is a major public health problem worldwide, including India. The different genotypes of E. granulosus responsible for human hydatidosis have been reported from endemic areas throughout the world. However, the genetic characterization of E. granulosus infecting the human population in India is lacking. The aim of study was to ascertain the genotype(s) of the parasite responsible for human hydatidosis in North India. Methodology/Principal Findings To study the transmission patterns of E. granulosus, genotypic analysis was performed on hydatid cysts obtained from 32 cystic echinococcosis (CE) patients residing in 7 different states of North India. Mitochondrial cytochrome c oxidase subunit1 (cox1) sequencing was done for molecular identification of the isolates. Most of the CE patients (30/32) were found to be infected with hydatid cyst of either G3 (53.1%) or G1 (40.62%) genotype and one each of G5 (cattle strain) and G6 (camel strain) genotype. Conclusions/Significance These findings demonstrate the zoonotic potential of G1 (sheep strain) and G3 (buffalo strain) genotypes of E. granulosus as these emerged as predominant genotypes infecting the humans in India. In addition to this, the present study reports the first human CE case infected with G5 genotype (cattle strain) in an Asian country and presence of G6 genotype (camel strain) in India. The results may have important implications in the planning of control strategies for human hydatidosis. PMID:23785531

  5. PcG and trxG in plants - friends or foes.

    PubMed

    Pu, Li; Sung, Zinmay Renee

    2015-05-01

    The highly-conserved Polycomb group (PcG) and trithorax group (trxG) proteins play major roles in regulating gene expression and maintaining developmental states in many organisms. However, neither the recruitment of Polycomb repressive complexes (PRC) nor the mechanisms of PcG and trxG-mediated gene silencing and activation are well understood. Recent progress in Arabidopsis research challenges the dominant model of PRC2-dependent recruitment of PRC1 to target genes. Moreover, evidence indicates that diverse forms of PRC1, with shared components, are a common theme in plants and mammals. Although trxG is known to antagonize PcG, emerging data reveal that trxG can also repress gene expression, acting cooperatively with PcG. We discuss these recent findings and highlight the employment of diverse epigenetic mechanisms during development in plants and animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. G-38, G-39 and G-40: Art in space, a divergent exploration

    NASA Technical Reports Server (NTRS)

    Mcshane, J. W.

    1986-01-01

    The results of the Get Away Special (GAS) Arts-Science payload G-38, processed in orbit on board the Space Shuttle Challenger during mission 41-G STS 17, October 5 to 13, l984 are explained. The payload G-38 was created as a unified Arts-Science payload that simultaneously explored the process of vapor deposition in the vacuum and weightlessness of the shuttle environment and created a series of space sculptures utilizing this process. The purpose of the experiment was to test the sputter deposition process in space and to create five subtle spherical sculptures with metallic coatings of gold, silver, platinum and chrome.

  7. Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

    PubMed Central

    2013-01-01

    Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active

  8. Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

    PubMed

    Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

    2014-01-01

    Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Measuring the performance of G2G services in Iran

    NASA Astrophysics Data System (ADS)

    Zarei, Behrouz; Safdari, Maryam

    To highlight the growth of e-government and the importance of its services it is essential to evaluate the performance of the service delivery to customers. Research indicates that traditional performance indexes are not suitable for this evaluation; moreover, it is noticeable that the e-government services are intangible and invisible. Among different e-government services, measurement of quality government to government (G2G) services has been less attractive for researchers while crucial for government policy-makers. This calls for a better understanding of the specific needs of users of these services in order to provide appropriate type and level of services that meets those needs. In this paper, the performance of the G2G services is measured in the Iranian context. For this purpose, SERVQUAL, which is a well-known method for assessing service quality, is employed. This study proposes and tests a five-factor of SERVQUAL instrument to explain user satisfaction and gap analysis, between expectations and perceptions of its customers, consisting thirty ministries and main governmental organizations. Based on a Chi-square test, factor analysis, gap analysis and correlations, it is concluded the gap between expectations and perceptions of G2G customers is significant and customer satisfaction of G2G services is at low level.

  10. Application and expression of HSV gG1 protein from a recombinant strain.

    PubMed

    Yan, Hua; Yan, Huishen; Huang, Tao; Li, Guocai; Gong, Weijuan; Jiao, Hongmei; Chen, Hongju; Ji, Mingchun

    2010-11-01

    According to the homologous sequence of glycoprotein G1 (gG1) genes from different strains of herpes simplex virus type 1 (HSV-1), a pair of primers was designed to amplify the gG1 gene fragment by PCR. Both the PCR product and the pGEX-4T-1 vector were digested with EcoR I and Sal I. The gG1 gene fragment was subcloned into the digested pGEX-4T-1 vector to construct a recombinant plasmid (pGEX-4T-1-gG1). The resultant plasmid was identified by dual-enzyme digestion and sequence analysis, and then transformed into Escherichia coli BL21 for expression under the induction of isopropyl β-D-1-thiogalactoside (IPTG). The expressed GST-gG1 fragment was detected by SDS-PAGE and purified by affinity chromatography. The properties of GST-gG1 fragment were evaluated by immunoblot analysis. Enzyme-linked immunosorbent assays (ELISAs) based on the GST-gG1 fragment were used for determining IgG or IgM to HSV-1. The GST-gG1 fragment-specific ELISA was also compared with ELISA with whole-HSV-1 antigen and commercial ELISA kits. The gG1-specific IgG and IFN-γ producing CD8+ T cells were induced in mice immunized with the GST-gG1 fragment. These results indicated that the GST-gG1 fragment could be used for replacing whole-virus antigen to detect IgM and IgG to HSV-1 in human sera, which provided a strategy for developing vaccines to protect HSV-1 infection using gG1 fragment. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Crystal structure of the conserved herpesvirus fusion regulator complex gH—gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chowdary, Tirumala K.; Cairns, Tina M.; Atanasiu, Doina

    2015-02-09

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH–gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH–gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, wemore » propose that gH–gL activates gB for fusion, possibly through direct binding. Formation of a gB–gH–gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB–gH–gL interface a promising antiviral target.« less

  12. Secure Military Communications on 3G, 4G and WiMAX

    DTIC Science & Technology

    2013-09-01

    per bit, low latency, good quality of service, good coverage and support for mobility at high speeds. Thus, 4G wireless technologies are based on 3G ...security for military communications. 87 LIST OF REFERENCES [1] C. Blanchard, “Security for the third generation ( 3G ) mobile system,” Elsevier Science...COMMUNICATIONS ON 3G , 4G AND WIMAX by Panagiotis Schoinas September 2013 Thesis Advisor: Gurminder Singh Co-Advisor: John H. Gibson

  13. Physiologic bases of G-induced loss of consciousness (G-LOC).

    PubMed

    Werchan, P M

    1991-07-01

    Exposure of pilots to high sustained +Gz (head to feet) or rapid onset of +Gz can produce a variety of pathophysiologic effects ranging from the loss of peripheral vision to total blackout and, finally, G-induced loss of consciousness (G-LOC). A G-LOC research program divided into four phases has been organized at USAFSAM/Crew Technology Division. In contrast to previous studies in acceleration, this program will focus exclusively on the ultimate problem in G-LOC; namely, inadequate cerebral perfusion leading to impaired brain energy metabolism, structure and function. The primary objective of this research program is to identify and arrange chronologically the numerous physiological and biochemical alterations in the brain that comprise the mechanism of G-LOC.

  14. Prothrombin polymorphism A19911G, factor V HR2 haplotype A4070G, and plasminogen activator-inhibitor-1 polymorphism 4G/5G and the risk of retinal vein occlusion.

    PubMed

    Kuhli-Hattenbach, Claudia; Hellstern, Peter; Nägler, Dorit Karin; Kohnen, Thomas; Hattenbach, Lars-Olof

    2017-01-01

    Thus far, no data has become available to evaluate systematically the prevalences of prothrombin polymorphism A19911G (PT A19911G), factor V HR2 haplotype A4070G (FV A4070G), or plasminogen activator-inhibitor-1 polymorphism 4G/5G (PAI-1 4G/5G) in patients who develop retinal vein occlusion (RVO) without cardiovascular risk factors. We retrospectively evaluated comprehensive thrombophilia data from 42 preselected RVO patients without cardiovascular risk factors. The prevalences of different gene mutations and polymorphisms including factor V Leiden mutation G1691A (FVL), FV A4070G, prothrombin mutation G20210A, PT A19911G, and PAI-1 4G/5G were compared with 241 healthy controls matched for age and sex. A total of 20 patients (47.7%) were found to carry thrombophilic gene polymorphisms including FVL, FV A4070G, and homozygous PT A19911G compared with 72 of 241 controls (29.9%; p = 0.03). Subgroup analysis of patients with a significant personal or family history of thromboembolism revealed a high prevalence of FVL, FV A4070G, and homozygous PT A19911G (p = 0.005). FV A4070G was found to be significantly associated with at least two other heterozygous or one homozygous gene polymorphisms (p = 0.02). Multivariate analysis revealed the presence of FVL (p = 0.0017) and homozygous PT A19911G (p = 0.03) polymorphism as independent risk factors for the development of RVO. Our results indicate that in selected RVO patients screening for thrombophilic gene polymorphisms including FVL, FV A4070G and homozygous PT G19911A may be helpful in a high percentage of cases. Our findings suggest that hereditary thrombophilia associated with RVO is more likely to be multigenic than caused by any single risk factor.

  15. 4G/5G polymorphism modulates PAI-1 circulating levels in obese women.

    PubMed

    Fernandes, Karla S; Sandrim, Valéria C

    2012-05-01

    The increase in plasminogen activator inhibitor type 1 (PAI-1) has been described as a risk factor to thrombosis-related diseases. In addition, it has been demonstrated that the variant 4G of polymorphism 4G/5G located in promoter region of PAI-1 gene is associated with higher PAI-1 levels. We investigate the role of this polymorphism on circulating PAI-1 concentration in a population of 57 obese women (23%, 4G/4G; 49%, 4G/5G and 28%, 5G/5G genotypes). Our results demonstrate a genotype-specific modulation on PAI-1 levels in obese women, thus 5G/5G genotype presented significantly lower levels of plasma PAI-1 when compared to 4G/4G group (46 ± 19 ng/mL vs. 63 ± 13 ng/mL, respectively). Our findings indicate that obese carriers of 4G/4G genotype may have increased risk to develop thrombotic diseases.

  16. Serum levels of IgG and IgG4 in Hashimoto thyroiditis.

    PubMed

    Kawashima, Sachiko-Tsukamoto; Tagami, Tetsuya; Nakao, Kanako; Nanba, Kazutaka; Tamanaha, Tamiko; Usui, Takeshi; Naruse, Mitsuhide; Minamiguchi, Sachiko; Mori, Yusuke; Tsuji, Jun; Tanaka, Issei; Shimatsu, Akira

    2014-03-01

    Although IgG4-related disease is characterized by extensive infiltration of IgG4-positive plasma cells and lymphocytes of various organs, the details of this systemic disease are still unclear. We screened serum total IgG levels in the patients with Hashimoto thyroiditis (HT) to illustrate the prevalence of IgG4-related thyroiditis in HT. Twenty-four of 94 patients with HT (25.5%) had elevated serum IgG levels and their serum IgG4 was measured. Five of the 24 cases had more than 135 mg/dL of IgG4, which is the serum criterion of IgG4-related disease. One was a female patient who was initially treated as Graves' disease and rapidly developed a firm goiter and hypothyroidism. The biopsy of her thyroid gland revealed that follicular cells were atrophic with squamous metaplasia, replaced with fibrosis, which was compatible with the fibrous variant of HT. Immunohistochemical examination revealed diffuse infiltration of IgG4-positive plasma cells, and the serum IgG4 level was 179 mg/dL. The levels of IgG and IgG4 were positively correlated with the titers of anti-thyroglobulin antibody or anti-thyroid peroxidase antibody. In conclusion, at least a small portion of patients with HT with high titers of anti-thyroid antibodies may overlap the IgG4-related thyroiditis.

  17. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  18. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  19. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  20. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  1. 17 CFR 240.12g-1 - Exemption from section 12(g).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... pursuant to section 12(g)(1) if on the last day of its most recent fiscal year the issuer had total assets...). 240.12g-1 Section 240.12g-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 Extensions and Temporary Exemptions; Definitions § 240.12g-1 Exemption from...

  2. G-warm inflation

    NASA Astrophysics Data System (ADS)

    Herrera, Ramón

    2017-05-01

    A warm inflationary universe in the context of Galileon model or G-model is studied. Under a general formalism we study the inflationary dynamics and the cosmological perturbations considering a coupling of the form G(phi,X)=g(phi) X. As a concrete example, we consider an exponential potential together with the cases in which the dissipation and Galilean coefficients are constants. Also, we study the weak regime given by the condition R<1+3gHdot phi, and the strong regime in which 1gHdot phi. Additionally, we obtain constraints on the parameters during the evolution of G-warm inflation, assuming the condition for warm inflation in which the temperature T>H, the conditions or the weak and strong regimes, together with the consistency relation r=r(ns) from Planck data.

  3. 14 CFR Appendix G to Part 151 - Appendix G to Part 151

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Appendix G to Part 151 G Appendix G to Part 151 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIRPORTS FEDERAL AID TO AIRPORTS Pt. 151, App. G Appendix G to Part 151 There is set forth below an...

  4. 14 CFR Appendix G to Part 151 - Appendix G to Part 151

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Appendix G to Part 151 G Appendix G to Part 151 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIRPORTS FEDERAL AID TO AIRPORTS Pt. 151, App. G Appendix G to Part 151 There is set forth below an...

  5. 14 CFR Appendix G to Part 151 - Appendix G to Part 151

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Appendix G to Part 151 G Appendix G to Part 151 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIRPORTS FEDERAL AID TO AIRPORTS Pt. 151, App. G Appendix G to Part 151 There is set forth below an...

  6. 14 CFR Appendix G to Part 151 - Appendix G to Part 151

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Appendix G to Part 151 G Appendix G to Part 151 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIRPORTS FEDERAL AID TO AIRPORTS Pt. 151, App. G Appendix G to Part 151 There is set forth below an...

  7. Cardiovascular effects of anti-G suit inflation at 1 and 2 G.

    PubMed

    Montmerle, Stéphanie; Linnarsson, Dag

    2005-06-01

    We sought to determine to which pressure a full-coverage anti-G suit needs to be inflated in order to obtain the same stroke volume during a brief exposure to twice the normal gravity (2 G) as that at 1 G without anti-G suit inflation. Nine sitting subjects were studied at normal (1 G) and during 20 s of exposure to 2 G. They wore anti-G suits, which were inflated at both G-levels to the following target pressures: 0, 70, 140 and 210 mmHg. Stroke volume was computed from cardiac output, which was measured by rebreathing. Heart rate and mean arterial pressure at heart level were recorded. Inflation to 70 mmHg compensated for the decrease in stroke volume and cardiac output caused by hypergravity. Mean arterial pressure at heart level was comparable at 1 G and at 2 G and increased gradually and similarly with inflation (P<0.001) at both gravity levels. Thus, anti-G suits act by increasing both preload and afterload but the two effects counteract each other in terms of cardiac output, so that cardiac output at 2 G is maintained at its 1 G level. This effect is reached already at 70 mmHg of inflation. Greater inflation pressure further increases mean arterial pressure at heart level and compensates for the increased difference in hydrostatic pressure between heart and head in moderate hypergravity.

  8. Definition of IgG- and albumin-binding regions of streptococcal protein G.

    PubMed

    Akerström, B; Nielsen, E; Björck, L

    1987-10-05

    Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

  9. Effects of 2.0-g 1.75-g and 1.5-g Hypergravity on Pregnancy Outcome in Rats (Rattus norvegicus)

    NASA Technical Reports Server (NTRS)

    Mills, Nicole A.; Baer, Lisa A.; Ronca, April E.

    2001-01-01

    In 1995, ten pregnant female rats were launched on the Space Shuttle (STS-70) on Gestational day(G) 11 of their 22-day pregnancy as part of the NASA/NIH.Rodent (R)2 Experiment. Following landing on G20, fetuses were harvested from half of the dams, while the remaining five dams underwent birth. Spaceflight did not interrupt pregnancy, alter litter sizes, or affect body weights or gender ratios of the fetuses or neonates. In the present study we used the NASA/NIH.R2 experimental paradigm to analyze the effects of hypergravity on pregnancy outcome. On G10, time-bred Sprague-Dawley rat dams were assigned to either G20 or Birth conditions, then further assigned to Hypergravity (HG) 2.0-g, HG 1.75-g, HG 1.5-g, Rotational Control (RC, 1.03), or Stationary Control (SC, 1.0-g) treatments. Dams were exposed to continuous centrifugation from G11 through G20, with brief daily stops for animal health checks and maintenance. For both the G20 and Birth dams, comparable litter sizes and litter gender ratios were observed across gravity conditions. However, centrifugation-exposed (HG and RC) fetuses and neonates showed significantly lower body masses (p less than 0.05) relative to SC offspring. HG 2.0-g offspring weighed significantly less than those in all other gravity conditions (p less than 0.05). The observed reductions in offspring body mass at 1.5-g and 1.75-g, can be attributed to the rotational component of centrifugation, rather than to increased gravitational load, whereas 2.0-g hypergravity exposure further exacerbated the gravity centrifugation effect on offspring body mass. Pregnant dams exposed to centrifugation weighed significantly less than SC dams (p less than 0.05), suggesting that centrifugation effects on maternal body mass may contribute to reduced size of the developing offspring. These findings are consistent with previous reports of non-pregnant adult animals suggesting that, whereas spaceflight has virtually no effect on body mass, centrifugation is

  10. The carriers of the A/G-G/G allelic combination of the c.2039 A>G and c.-29 G>A FSH receptor polymorphisms retrieve the highest number of oocytes in IVF/ICSI cycles.

    PubMed

    Allegra, Adolfo; Marino, Angelo; Raimondo, Stefania; Maiorana, Antonio; Gullo, Salvatore; Scaglione, Piero; Volpes, Aldo; Alessandro, Riccardo

    2017-02-01

    The objective of this study was the elucidation of the possible role of the single-nucleotide polymorphisms (SNP) at position -29 and 2039 of the FSH receptor gene (FSHR) as independent predictive markers of ovarian response. Indeed, the tailoring of reproductive treatments is crucial for both maximizing the success of IVF patients and obtaining a reduction in hypo- or hyper-response rates. This prospective, observational study analyzed the association of -29 and 2039 FSHR polymorphisms with the number of retrieved oocytes in 140 patients attending an IVF/ICSI cycle for severe male factors (≤5,000,000 spermatozoa/mL) or tubal factors at the ANDROS Day Surgery Clinic, Palermo, Italy. The results of this study demonstrate that the genetic combination of A/G for polymorphism c.2039 A>G with G/G for polymorphism c.-29 G>A is significantly associated with the highest number of collected oocytes (p = 0.03). This association was significant even after controlling for the effect of other clinical variables. The A/G-G/G allelic variant, identified as an independent variable, if confirmed in a larger number of patients, could be considered as a new genetic biomarker, which could increase the efficacy of prediction models for ovarian stimulation.

  11. G-warm inflation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herrera, Ramón, E-mail: ramon.herrera@pucv.cl

    A warm inflationary universe in the context of Galileon model or G-model is studied. Under a general formalism we study the inflationary dynamics and the cosmological perturbations considering a coupling of the form G (φ, X )= g (φ) X . As a concrete example, we consider an exponential potential together with the cases in which the dissipation and Galilean coefficients are constants. Also, we study the weak regime given by the condition R <1+3 gH φ-dot , and the strong regime in which 1< R +3 gH φ-dot . Additionally, we obtain constraints on the parameters during the evolutionmore » of G-warm inflation, assuming the condition for warm inflation in which the temperature T > H , the conditions or the weak and strong regimes, together with the consistency relation r = r ( n {sub s} ) from Planck data.« less

  12. The H,G_1,G_2 photometric system with scarce observational data

    NASA Astrophysics Data System (ADS)

    Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

    2014-07-01

    The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

  13. 21 CFR 522.1696a - Penicillin G benzathine and penicillin G procaine suspension.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Penicillin G benzathine and penicillin G procaine... FORM NEW ANIMAL DRUGS § 522.1696a Penicillin G benzathine and penicillin G procaine suspension. (a) Specifications. Each milliliter of aqueous suspension contains penicillin G benzathine and penicillin G procaine...

  14. 21 CFR 522.1696a - Penicillin G benzathine and penicillin G procaine suspension.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Penicillin G benzathine and penicillin G procaine... FORM NEW ANIMAL DRUGS § 522.1696a Penicillin G benzathine and penicillin G procaine suspension. (a) Specifications. Each milliliter of aqueous suspension contains penicillin G benzathine and penicillin G procaine...

  15. 21 CFR 522.1696a - Penicillin G benzathine and penicillin G procaine suspension.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin G benzathine and penicillin G procaine... FORM NEW ANIMAL DRUGS § 522.1696a Penicillin G benzathine and penicillin G procaine suspension. (a) Specifications. Each milliliter of aqueous suspension contains penicillin G benzathine and penicillin G procaine...

  16. 21 CFR 522.1696a - Penicillin G benzathine and penicillin G procaine suspension.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Penicillin G benzathine and penicillin G procaine... FORM NEW ANIMAL DRUGS § 522.1696a Penicillin G benzathine and penicillin G procaine suspension. (a) Specifications. Each milliliter of aqueous suspension contains penicillin G benzathine and penicillin G procaine...

  17. 21 CFR 522.1696a - Penicillin G benzathine and penicillin G procaine suspension.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Penicillin G benzathine and penicillin G procaine... FORM NEW ANIMAL DRUGS § 522.1696a Penicillin G benzathine and penicillin G procaine suspension. (a) Specifications. Each milliliter of aqueous suspension contains penicillin G benzathine and penicillin G procaine...

  18. Molecular phylogeny based on six nuclear genes suggests that Echinococcus granulosus sensu lato genotypes G6/G7 and G8/G10 can be regarded as two distinct species.

    PubMed

    Laurimäe, Teivi; Kinkar, Liina; Moks, Epp; Romig, Thomas; Omer, Rihab A; Casulli, Adriano; Umhang, Gérald; Bagrade, Guna; Irshadullah, Malik; Sharbatkhori, Mitra; Mirhendi, Hossein; Ponce-Gordo, Francisco; Soriano, Silvia V; Varcasia, Antonio; Rostami-Nejad, Mohammad; Andresiuk, Vanessa; Saarma, Urmas

    2018-05-21

    Tapeworms of the species complex of Echinococcus granulosus sensu lato (s. l.) are the cause of a severe zoonotic disease - cystic echinococcosis, which is listed among the most severe parasitic diseases in humans and is prioritized by the World Health Organization. A stable taxonomy of E. granulosus s. l. is essential to the medical and veterinary communities for accurate and effective communication of the role of different species in this complex on human and animal health. E. granulosus s. l. displays high genetic diversity and has been divided into different species and genotypes. Despite several decades of research, the taxonomy of E. granulosus s. l. has remained controversial, especially the species status of genotypes G6-G10. Here the Bayesian phylogeny based on six nuclear loci (7387 bp in total) demonstrated, with very high support, the clustering of G6/G7 and G8/G10 into two separate clades. According to the evolutionary species concept, G6/G7 and G8/G10 can be regarded as two distinct species. Species differentiation can be attributed to the association with distinct host species, largely separate geographical distribution and low level of cross-fertilization. These factors have limited the gene flow between genotypic groups G6/G7 and G8/G10, resulting in the formation of distinct species. We discuss ecological and epidemiological differences that support the validity of these species.

  19. Crystal structure of the conserved herpes virus fusion regulator complex gH-gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chowdary, Tirumala K; Cairns, Tina M; Atanasiu, Doina

    2010-09-13

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, wemore » propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.« less

  20. Crystal Structure of the Conserved Herpes Virus Fusion Regulator Complex gH–gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chowdary, T.; Cairns, T; Atanasiu, D

    2010-01-01

    Herpesviruses, which cause many incurable diseases, infect cells by fusing viral and cellular membranes. Whereas most other enveloped viruses use a single viral catalyst called a fusogen, herpesviruses, inexplicably, require two conserved fusion-machinery components, gB and the heterodimer gH-gL, plus other nonconserved components. gB is a class III viral fusogen, but unlike other members of its class, it does not function alone. We determined the crystal structure of the gH ectodomain bound to gL from herpes simplex virus 2. gH-gL is an unusually tight complex with a unique architecture that, unexpectedly, does not resemble any known viral fusogen. Instead, wemore » propose that gH-gL activates gB for fusion, possibly through direct binding. Formation of a gB-gH-gL complex is critical for fusion and is inhibited by a neutralizing antibody, making the gB-gH-gL interface a promising antiviral target.« less

  1. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. [PAL-1 5G/4G polymorphism in patients with systemic lupus erythematosus].

    PubMed

    Savov, A; Andonova, S; Tanev, D; Robeva, R; Marincheva, Ts; Tomova, A; Kumanov, Ph; Rashkov, R; Kolarov, Zl

    2014-01-01

    Systemic lupus erythematosus (SLE) is a connective tissue disease affecting predominantly women that has been widely associated with obstetric complications. Inherited thrombophilias are significant risk factors for pregnancy loss, but their role in patients with SLE, and especially in those without concomitant secondary antiphospholipid syndrome (APS) has not been clarified. The aim of the present study was to study PAI-1 5G/4G polymorphism in women with lupus. A total of 103 SLE patients as well as 69 healthy volunteers were genotyped for PAI-1 5G/4G (rs1799889). No significant differences in the PAI-1 5G/4G genotype prevalence between patients and controls were found. After exclusion of the women with secondary APS, the frequency of pregnancies and spontaneous abortions, as well as the number of live births were similar in the studied patients with different PAI-1 genotype (p> 0.05). PAI-1 5G/4G polymorphism was not significantly related to any of the lupus ACR criteria or disease activity (p > 0.05), but it could influence the platelet number in the studied patients (263.52 ± 91.10 [5G/5G genotype] versus 210.12 ± 71.79 [4G/4G genotype], p = 0.023). In conclusion, our results showed that PAI-1 4G/5G polymorphism did not worsen the reproductive outcome in SLE women without secondary APS.

  3. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

  4. 4G/5G and A-844G Polymorphisms of Plasminogen Activator Inhibitor-1 Associated with Glioblastoma in Iran--a Case-Control Study.

    PubMed

    Pooyan, Honari; Ahmad, Ebrahimi; Azadeh, Rakhshan

    2015-01-01

    Glioblastoma is a highly aggressive and malignant brain tumor. Risk factors are largely unknown however, although several biomarkers have been identified which may support development, angiogenesis and invasion of tumor cells. One of these biomarkers is PAI-1. 4G/5G and A-844G are two common polymorphisms in the gene promotor of PAI 1 that may be related to high transcription and expression of this gene. Studies have shown that the prevalence of the 4G and 844G allele is significantly higher in patients with some cancers and genetic disorders. We here assessed the association of 4G/5G and A-844G polymorphisms with glioblastoma cancer risk in Iranians in a case-control study. All 71 patients with clinically confirmed and 140 volunteers with no history and symptoms of glioblastoma as control group were screened for 4G/5G and A-844G polymorphisms of PAI-1, using ARMS-PCR. Genotype and allele frequencies of case and control groups were analyzed using the DeFinetti program. Our results showed significant associations between 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms of the PAI-1 gene with glioblastoma cancer risk in our Iranian population. The results of this study supporting an association of the PAI-1 4G/5G (p=0.01824) and A-844G (p=0.02012) polymorphisms with increasing glioblastoma cancer risk in Iranian patients.

  5. Plasminogen activator inhibitor I 4G/5G polymorphism in neonatal respiratory distress syndrome.

    PubMed

    Armangil, Didem; Yurdakök, Murat; Okur, Hamza; Gürgey, Aytemiz

    2011-08-01

    Fibrin monomers inhibit surfactant function. 4G/5G insertion/deletion polymorphism plays an important role in the regulation of plasminogen activator inhibitor 1 (PAI-1) gene expression. To examine the genotype distribution of PAI-1 polymorphism in 60 infants with respiratory distress syndrome (RDS) and 53 controls, an allele-specific polymerase chain reaction (PCR) was used. The proportion of 4G/4G, 4G/5G, and 5G/5G genotypes did not differ statistically between the RDS and control groups (P > .05). Having PAI-1 4G/4G genotype polymorphism appears to increase the risk of RDS (odds ratio [OR] =1.5; 95% confidence interval [CI], 0.5-4.3), although it was not statistically significant. No relation was found between the PAI-1 4G/5G polymorphisms and RDS, but there was an increased risk associated with the 4G variant of the PAI-1 gene. We believe that our findings of increased 4G allele of the PAI-1 gene in infants with RDS would also help to clarify the pathogenesis of RDS.

  6. smoothG

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barker, Andrew T.; Gelever, Stephan A.; Lee, Chak S.

    2017-12-12

    smoothG is a collection of parallel C++ classes/functions that algebraically constructs reduced models of different resolutions from a given high-fidelity graph model. In addition, smoothG also provides efficient linear solvers for the reduced models. Other than pure graph problem, the software finds its application in subsurface flow and power grid simulations in which graph Laplacians are found

  7. Reduced carriership of 4G allele of plasminogen activator inhibitor-1 4G/5G polymorphism in very young survivors of myocardial infarction.

    PubMed

    Rallidis, Loukianos S; Gialeraki, Argyri; Merkouri, Efrosyni; Liakos, George; Dagres, Nikolaos; Sionis, Dimitrios; Travlou, Anthi; Lekakis, John; Kremastinos, Dimitrios T

    2010-05-01

    There are limited and controversial data regarding the impact of 4G/5G polymorphism of the plasminogen activator inhibitor-1 (PAI-1) gene in the pathogenesis of premature myocardial infarction (MI). We explored whether 4G/5G polymorphism of the PAI-1 gene is associated with the development of MI G/5G polymorphism of PAI-1 was tested with polymerase chain reaction and reverse hybridization. 4G allele carriers (4G/4G and 4G/5G genotypes) of PAI-1 were less frequent in patients than in controls (69.6 vs. 83.6%, P = 0.007). 4G carriership of the polymorphism of PAI-1 was associated with lower risk for acute MI (odds ratio 0.45, 95% confidence interval 0.23-0.88, P = 0.02) after adjusting for major cardiovascular risk factors. Patients possessing the 4G allele had higher PAI-1 plasma levels (32.2 +/- 25 vs. 22.2 +/- 11.3 ng/ml, P = 0.006) but lower lipoprotein(a) levels (10.1 [2.1-29.9] vs. 15.3 [8.2-57.1] mg/dl, P = 0.03) compared to 5G/5G homozygotes. Our data indicate that the 4G allele of the PAI-1 4G/5G polymorphism is less frequent among survivors of MI at very young age compared with matched controls.

  8. A new hydrostatic anti-G suit vs. a pneumatic anti-G system: preliminary comparison.

    PubMed

    Eiken, O; Kölegård, R; Lindborg, B; Aldman, M; Karlmar, K E; Linder, J; Kölegoård, R

    2002-07-01

    A newly developed hydrostatic anti-G suit is now commercially available. The suit is said to offer a high level of protection against +Gz acceleration. However, past experience shows that it is difficult to produce a hydrostatic suit with effective high-G protection. Careful testing is, therefore, needed to verify its efficacy. The G-protective properties of the hydrostatic anti-G suit (Libelle; L) were compared with those of a pneumatic anti-G ensemble (AGE-39) used in the Swedish JAS 39 Cripen aircraft. Three pilots were studied during vertical (+Gz) acceleration in a centrifuge using the following: 1) the L-suit with varied straining maneuvers; 2) the AGE-39 in combination with full anti-G straining maneuvers (AGSM) throughout each high-G exposure (full maneuver; FM); and 3) the AGE-39 in combination with AGSM during the initial part of each high-G exposure (reduced maneuver; RM). G-intensity tolerance was established during exposures to rapid onset rate (ROR) profiles with G-plateau levels ranging from +6.0 to +9.0 Gz. G-endurance was studied during simulated aerial combat maneuvers (SACM) consisting of 10 cycles of 5.5 to 7.5 G. All three pilots tolerated 9.0 G with the pneumatic system both in the RM and FM conditions; their tolerances averaged 6.3 G (range 6.0 to 7.0 G) for the L suit. Thus, during the ROR exposures only the 6.0 G profile was completed by all subjects in all three conditions. At this G-load both muscle straining (as indicated by electromyographic activity in thigh and abdomen) and heart rate were higher in the L than in the RM condition. Mean arterial pressure at eye level was higher in the FM than in the L and RM conditions. Only one subject was able to complete the SACM profile in the L condition. In the RM condition all subjects completed the SACM profile and in the FM condition two subjects completed the SACM. Whether the AGE-39 was used in combination with maximal AGSM throughout the duration of each high-G exposure or with AGSM only

  9. N -jettiness subtractions for g g →H at subleading power

    NASA Astrophysics Data System (ADS)

    Moult, Ian; Rothen, Lorena; Stewart, Iain W.; Tackmann, Frank J.; Zhu, Hua Xing

    2018-01-01

    N -jettiness subtractions provide a general approach for performing fully-differential next-to-next-to-leading order (NNLO) calculations. Since they are based on the physical resolution variable N -jettiness, TN , subleading power corrections in τ =TN/Q , with Q a hard interaction scale, can also be systematically computed. We study the structure of power corrections for 0-jettiness, T0, for the g g →H process. Using the soft-collinear effective theory we analytically compute the leading power corrections αsτ ln τ and αs2τ ln3τ (finding partial agreement with a previous result in the literature), and perform a detailed numerical study of the power corrections in the g g , g q , and q q ¯ channels. This includes a numerical extraction of the αsτ and αs2τ ln2τ corrections, and a study of the dependence on the T0 definition. Including such power suppressed logarithms significantly reduces the size of missing power corrections, and hence improves the numerical efficiency of the subtraction method. Having a more detailed understanding of the power corrections for both q q ¯ and g g initiated processes also provides insight into their universality, and hence their behavior in more complicated processes where they have not yet been analytically calculated.

  10. IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy.

    PubMed

    Li, Dujuan; Kan, Yunzhen; Fu, Fangfang; Wang, Shuhuan; Shi, Ligang; Liu, Jie; Kong, Lingfei

    2015-01-01

    Immunoglobulin G4-related disease (IgG4-RD) is a recently described inflammatory disease involving multiple organs. Prostate involvement with IgG4-RD is very rare. In this report, we describe a case of IgG4-related prostatitis progressed from localized IgG4-related lymphadenopathy. This patient was present with urine retention symptoms. MRI and CT examination revealed the prostatic enlargement and the multiple lymphadenopathy. Serum IgG4 levels were elevated. Prostatic tissue samples resected both this time and less than 1 year earlier showed the same histological type of prostatitis with histopathologic and immunohistochemical findings characteristic of IgG4-RD. The right submandibular lymph nodes excised 2 years earlier were eventually proven to be follicular hyperplasia-type IgG4-related lymphadenopathy. This is the first case of IgG4-RD that began as localized IgG4-related lymphadenopathy and progressed into a systemic disease involving prostate and multiple lymph nodes. This patient showed a good response to steroid therapy. This leads us to advocate a novel pathogenesis of prostatitis, and a novel therapeutic approach against prostatitis. Pathologists and urologists should consider this disease entity in the patients with elevated serum IgG4 levels and the symptoms of prostatic hyperplasia to avoid ineffective medical or unnecessary surgical treatment.

  11. PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

    PubMed

    Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

  12. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  13. The G72/G30 gene complex and cognitive abnormalities in schizophrenia.

    PubMed

    Goldberg, Terry E; Straub, Richard E; Callicott, Joseph H; Hariri, Ahmad; Mattay, Venkata S; Bigelow, Llewellyn; Coppola, Richard; Egan, Michael F; Weinberger, Daniel R

    2006-09-01

    A recently discovered gene complex, G72/G30 (hereafter G72, but now termed DAOA), was found to be associated with schizophrenia and with bipolar disorder, possibly because of an indirect effect on NMDA neurotransmission. In principle, if G72 increases risk for psychosis by this mechanism, it might impact with greater penetrance those cortically based cognitive and neurophysiological functions associated with NMDA signaling. We performed two independent family-based association studies (one sample contained more than 200 families and the other more than 65) of multiple SNPs in the G72 region and of multiple SNPs in the gene for D-amino acid oxidase (DAAO), which may be modulated by G72. We examined the relationship between select cognitive measures in attention, working memory, and episodic memory and a restricted set of G72 SNPs in over 600 normal controls, schizophrenic patients, and their nonpsychotic siblings using mixed model ANOVAs. We also determined genotype effects on neurophysiology measures in normal controls using the fMRI BOLD response obtained during activation procedures involving either episodic memory or working memory. There were no significant single G72 SNP associations and clinical diagnosis in either sample, though one approached significance (p=0.06). Diagnosis by genotype interaction effects for G72 SNP 10 were significant for cognitive variables assessing working memory and attention (p=0.05), and at the trend level for episodic memory, such that in the schizophrenia group an exaggerated allele load effect in the predicted directions was observed. In the fMRI paradigms, a strong effect of G72 SNP 10 genotype was observed on BOLD activation in the hippocampus during the episodic memory paradigm. Tests of association with DAAO were consistently nonsignificant. We present evidence that SNP variations in the G72 gene region increase risk of cognitive impairment in schizophrenia. SNP variations were not strongly associated with clinical diagnosis

  14. PAI-1 4G/5G Polymorphism Contributes to Cancer Susceptibility: Evidence from Meta-Analysis

    PubMed Central

    Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

    2013-01-01

    Background The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. Methods A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I2 test. Results Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03–1.18, I2 = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06–1.39, I2 = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04–1.18, I2 = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09–1.59, I2 = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04–1.21, I2 = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05–1.21, I2 = 25.3%). Conclusions The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer. PMID:23437240

  15. Expression levels of glycoprotein O (gO) vary between strains of human cytomegalovirus, influencing the assembly of gH/gL complexes and virion infectivity.

    PubMed

    Zhang, Le; Zhou, Momei; Stanton, Richard; Kamil, Jeremy; Ryckman, Brent J

    2018-05-09

    Tropism of human cytomegalovirus (HCMV) is influenced by the envelope glycoprotein complexes gH/gL/gO and gH/gL/UL128-131. During virion assembly, gO and the UL128-131 proteins compete for binding to gH/gL in the ER. This assembly process clearly differs among strains since Merlin (ME) virions contain abundant gH/gL/UL128-131 and little gH/gL/gO, whereas TR contains much higher levels of total gH/gL, mostly in the form of gH/gL/gO, but much less gH/gL/UL128-131 than ME. Remaining questions include 1) what are the mechanisms behind these assembly differences, and 2) do differences reflect in vitro culture adaptations or natural genetic variations? Since the UL74(gO) ORF differs by 25% of amino acids between TR and ME, we analyzed recombinant viruses in which the UL74(gO) ORF was swapped. TR virions were >40-fold more infectious than ME. Transcriptional repression of UL128-131 enhanced infectivity of ME to the level of TR, despite still far lower levels of gH/gL/gO. Swapping the UL74(gO) ORF had no effect on either TR or ME. A quantitative immunoprecipitation approach revealed that gH/gL expression was within 4-fold between TR and ME, but gO expression was 20-fold less by ME, and suggested differences in mRNA transcription, translation or rapid ER-associated degradation of gO. Trans-complementation of gO expression during ME replication gave 6-fold enhancement of infectivity beyond the 40-fold effect of UL128-131 repression alone. Overall, strain variations in assembly of gH/gL complexes result from differences in expression of gO and UL128-131, and selective advantages for reduced UL128-131 expression during fibroblast propagation are much stronger than for higher gO expression. IMPORTANCE Specific genetic differences between independently isolated HCMV strains may result from purifying selection on de novo mutations arising during propagation in culture, or random sampling among the diversity of genotypes present in clinical specimens. Results presented indicate

  16. The binding efficiency of RPA to telomeric G-strands folded into contiguous G-quadruplexes is independent of the number of G4 units.

    PubMed

    Lancrey, Astrid; Safa, Layal; Chatain, Jean; Delagoutte, Emmanuelle; Riou, Jean-François; Alberti, Patrizia; Saintomé, Carole

    2018-03-01

    Replication protein A (RPA) is a single-stranded DNA binding protein involved in replication and in telomere maintenance. During telomere replication, G-quadruplexes (G4) can accumulate on the lagging strand template and need to be resolved. It has been shown that human RPA is able to unfold a single G4. Nevertheless, the G-strand of human telomeres is prone to fold into higher-order structures formed by contiguous G-quadruplexes. To understand how RPA deals with these structures, we studied its interaction with telomeric G-strands folding into an increasing number of contiguous G4s. The aim of this study was to determine whether the efficiency of binding/unfolding of hRPA to telomeric G-strands depends on the number of G4 units. Our data show that the number n of contiguous G4 units (n ≥ 2) does not affect the efficiency of hRPA to coat transiently exposed single-stranded telomeric G-strands. This feature may be essential in preventing instability due to G4 structures during telomere replication. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Expression of the G72/G30 gene in transgenic mice induces behavioral changes

    PubMed Central

    Cheng, Lijun; Hattori, Eiji; Nakajima, Akira; Woehrle, Nancy S.; Opal, Mark D.; Zhang, Chunling; Grennan, Kay; Dulawa, Stephanie C.; Tang, Ya-Ping; Gershon, Elliot S.; Liu, Chunyu

    2012-01-01

    The G72/G30 gene complex is a candidate gene for schizophrenia and bipolar disorder. However, G72 and G30 mRNAs are expressed at very low levels in human brain, with only rare splicing forms observed. We report here G72/G30 expression profiles and behavioral changes in a G72/G30 transgenic mouse model. A human BAC clone containing the G72/G30 genomic region was used to establish the transgenic mouse model, on which gene expression studies, Western blot and behavioral tests were performed. Relative to their minimal expression in humans, G72 and G30 mRNAs were highly expressed in the transgenic mice, and had a more complex splicing pattern. The highest G72 transcript levels were found in testis, followed by cerebral cortex, with very low or undetectable levels in other tissues. No LG72 (the long putative isoform of G72) protein was detected in the transgenic mice. Whole-genome expression profiling identified 361 genes differentially-expressed in transgenic mice compared to wild-type, including genes previously implicated in neurological and psychological disorders. Relative to wild-type mice, the transgenic mice exhibited fewer stereotypic movements in the open field test, higher baseline startle responses in the course of the prepulse inhibition test, and lower hedonic responses in the sucrose preference test. The transcriptome profile changes and multiple mouse behavioral effects suggest that the G72 gene may play a role in modulating behaviors relevant to psychiatric disorders. PMID:23337943

  18. 75 FR 57664 - Airworthiness Directives; G ROB-WERKE Model G120A Airplanes

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-22

    ... Airworthiness Directives; G ROB-WERKE Model G120A Airplanes AGENCY: Federal Aviation Administration (FAA), DOT.... The authority citation for part 39 continues to read as follows: Authority: 49 U.S.C. 106(g), 40113..., PART B, dated May 18, 2010. (g) You may at any time complete GROB Aircraft AG Repair Instruction No. RI...

  19. Benzo[g]indoles

    NASA Astrophysics Data System (ADS)

    Pozharskii, A. F.; Kachalkina, S. G.; Gulevskaya, A. V.; Filatova, E. A.

    2017-07-01

    The data on the synthesis and properties of benzo[g]indoles accumulated mainly over a period of the past 15-20 years are integrated. Various variants of pyrrole ring and naphthalene nucleus closure are considered. It is demonstrated that, in addition to the expected similarity between benzo[g]indoles and indoles, there are noticeable differences between them as well, especially where the synthesis of the benzoindole system is concerned. Practical applications of benzo[g]indoles are discussed. The bibliography includes 199 references.

  20. Comprehensive phenotypic analysis of knockout mice deficient in cyclin G1 and cyclin G2

    PubMed Central

    Ohno, Shouichi; Ikeda, Jun-ichiro; Naito, Yoko; Okuzaki, Daisuke; Sasakura, Towa; Fukushima, Kohshiro; Nishikawa, Yukihiro; Ota, Kaori; Kato, Yorika; Wang, Mian; Torigata, Kosuke; Kasama, Takashi; Uchihashi, Toshihiro; Miura, Daisaku; Yabuta, Norikazu; Morii, Eiichi; Nojima, Hiroshi

    2016-01-01

    Cyclin G1 (CycG1) and Cyclin G2 (CycG2) play similar roles during the DNA damage response (DDR), but their detailed roles remain elusive. To investigate their distinct roles, we generated knockout mice deficient in CycG1 (G1KO) or CycG2 (G2KO), as well as double knockout mice (DKO) deficient in both proteins. All knockouts developed normally and were fertile. Generation of mouse embryonic fibroblasts (MEFs) from these mice revealed that G2KO MEFs, but not G1KO or DKO MEFs, were resistant to DNA damage insults caused by camptothecin and ionizing radiation (IR) and underwent cell cycle arrest. CycG2, but not CycG1, co-localized with γH2AX foci in the nucleus after γ-IR, and γH2AX-mediated DNA repair and dephosphorylation of CHK2 were delayed in G2KO MEFs. H2AX associated with CycG1, CycG2, and protein phosphatase 2A (PP2A), suggesting that γH2AX affects the function of PP2A via direct interaction with its B’γ subunit. Furthermore, expression of CycG2, but not CycG1, was abnormal in various cancer cell lines. Kaplan–Meier curves based on TCGA data disclosed that head and neck cancer patients with reduced CycG2 expression have poorer clinical prognoses. Taken together, our data suggest that reduced CycG2 expression could be useful as a novel prognostic marker of cancer. PMID:27982046

  1. Glycosylation of IgG B cell receptor (IgG BCR) in multiple myeloma: relationship between sialylation and the signal activity of IgG BCR.

    PubMed

    Ilić, Vesna; Milosević-Jovcić, Nadezda; Petrović, Sonja; Marković, Dragana; Stefanović, Gordana; Ristić, Tatjana

    2008-05-01

    Little is known about the glycosylation of the isotype switched B cell receptor (BCR) in multiple myeloma, and the way it might affect receptor function. In this work IgG BCRs isolated from the individual lysates of peripheral blood lymphocytes (PBL) of 32 patients with IgG multiple myeloma and healthy controls were investigated for the expression of sialic acid (SA), galactose (Gal) and N-acetylglucosamine (GlcNAc), the sugars known to specify the glycoforms of human serum IgG. The degree of glycosylation and signaling status of all 32 isolated myeloma IgG BCRs were correlated and compared with the glycosylation of the IgG paraproteins isolated from sera of the same patients. It was shown that BCR IgG in myeloma is more heavily sialylated when compared with normal controls, that the increased sialylation of IgG BCR is associated with higher levels of tyrosine phosphorylation (signaling activity) of the IgG BCR supramolecular complex and that BCR IgG and serum IgG paraprotein from the same patient differed in all cases in the levels of terminal sugar expression. The results suggest that the development of the malignant clone in MM from post-switch B cells expressing IgG BCR at their surfaces to plasma cells secreting IgG paraprotein may be followed by permanent glycosylation changes in the IgG molecules.

  2. 4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

    PubMed Central

    Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

    2007-01-01

    Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

  3. Penicillin G Procaine Injection

    MedlinePlus

    Penicillin G procaine injection is used to treat certain infections caused by bacteria. Penicillin G procaine injection should not be used to ... early in the treatment of certain serious infections. Penicillin G procaine injection is in a class of ...

  4. G protein-coupled receptor (GPCR) signaling via heterotrimeric G proteins from endosomes.

    PubMed

    Tsvetanova, Nikoleta G; Irannejad, Roshanak; von Zastrow, Mark

    2015-03-13

    Some G protein-coupled receptors (GPCRs), in addition to activating heterotrimeric G proteins in the plasma membrane, appear to elicit a "second wave" of G protein activation after ligand-induced internalization. We briefly summarize evidence supporting this view and then discuss what is presently known about the functional significance of GPCR-G protein activation in endosomes. Endosomal activation can shape the cellular response temporally by prolonging its overall duration, and may shape the response spatially by moving the location of intracellular second messenger production relative to effectors. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Are Cognitive "g" and Academic Achievement "g" One and the Same "g"? An Exploration on the Woodcock-Johnson and Kaufman Tests

    ERIC Educational Resources Information Center

    Kaufman, Scott Barry; Reynolds, Matthew R.; Liu, Xin; Kaufman, Alan S.; McGrew, Kevin S.

    2012-01-01

    We examined the degree to which the conventional notion of g associated with IQ tests and general cognitive ability tests ("COG-g") relate to the general ability that underlies tests of reading, math, and writing achievement ("ACH-g"). Two large, nationally representative data sets and two independent individually-administered…

  6. Enzymatic Formation of G-Group Aflatoxins and Biosynthetic Relationship between G- and B-Group Aflatoxins

    PubMed Central

    Yabe, Kimiko; Nakamura, Miki; Hamasaki, Takashi

    1999-01-01

    We detected biosynthetic activity for aflatoxins G1 and G2 in cell extracts of Aspergillus parasiticus NIAH-26. We found that in the presence of NADPH, aflatoxins G1 and G2 were produced from O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin, respectively. No G-group aflatoxins were produced from aflatoxin B1, aflatoxin B2, 5-methoxysterigmatocystin, dimethoxysterigmatocystin, or sterigmatin, confirming that B-group aflatoxins are not the precursors of G-group aflatoxins and that G- and B-group aflatoxins are independently produced from the same substrates (O-methylsterigmatocystin and dihydro-O-methylsterigmatocystin). In competition experiments in which the cell-free system was used, formation of aflatoxin G2 from dihydro-O-methylsterigmatocystin was suppressed when O-methylsterigmatocystin was added to the reaction mixture, whereas aflatoxin G1 was newly formed. This result indicates that the same enzymes can catalyze the formation of aflatoxins G1 and G2. Inhibition of G-group aflatoxin formation by methyrapone, SKF-525A, or imidazole indicated that a cytochrome P-450 monooxygenase may be involved in the formation of G-group aflatoxins. Both the microsome fraction and a cytosol protein with a native mass of 220 kDa were necessary for the formation of G-group aflatoxins. Due to instability of the microsome fraction, G-group aflatoxin formation was less stable than B-group aflatoxin formation. The ordA gene product, which may catalyze the formation of B-group aflatoxins, also may be required for G-group aflatoxin biosynthesis. We concluded that at least three reactions, catalyzed by the ordA gene product, an unstable microsome enzyme, and a 220-kDa cytosol protein, are involved in the enzymatic formation of G-group aflatoxins from either O-methylsterigmatocystin or dihydro-O-methylsterigmatocystin. PMID:10473388

  7. The rust fungus Gymnosporangium in Korea including two new species, G. monticola and G. unicorne

    USDA-ARS?s Scientific Manuscript database

    A survey was conducted of species of the rust fungus Gymnosporangium in Korea. The previously known species were recollected, namely Gymnosporangium asiaticum, G. clavariiforme, G. globosum, G. japonicum, and G. yamadae. Although G. cornutum was reported from Korea, collections similar to that speci...

  8. G4RNA screener web server: User focused interface for RNA G-quadruplex prediction.

    PubMed

    Garant, Jean-Michel; Perreault, Jean-Pierre; Scott, Michelle S

    2018-06-06

    Though RNA G-quadruplexes became a focus of study over a decade ago, the main challenge associated with the identification of new potential G-quadruplexes remains a bottleneck step. It slows the study of these non-canonical structures in nucleic acids, and thus the understanding of their significance. The G4RNA screener is an accurate tool for the prediction of RNA G-quadruplexes but its deployment has brought to light an issue with its accessibility to G-quadruplex experts and biologists. G4RNA screener web server is a platform that provides a much needed interface to manage the input, parameters and result display of the main command-line ready tool. It is accessible at http://scottgroup.med.usherbrooke.ca/G4RNA_screener/. Copyright © 2018. Published by Elsevier B.V.

  9. Lifetime of muscarinic receptor-G-protein complexes determines coupling efficiency and G-protein subtype selectivity.

    PubMed

    Ilyaskina, Olga S; Lemoine, Horst; Bünemann, Moritz

    2018-05-08

    G-protein-coupled receptors (GPCRs) are essential for the detection of extracellular stimuli by cells and transfer the encoded information via the activation of functionally distinct subsets of heterotrimeric G proteins into intracellular signals. Despite enormous achievements toward understanding GPCR structures, major aspects of the GPCR-G-protein selectivity mechanism remain unresolved. As this can be attributed to the lack of suitable and broadly applicable assays, we set out to develop a quantitative FRET-based assay to study kinetics and affinities of G protein binding to activated GPCRs in membranes of permeabilized cells in the absence of nucleotides. We measured the association and dissociation kinetics of agonist-induced binding of G i/o , G q/11 , G s , and G 12/13 proteins to muscarinic M 1 , M 2 , and M 3 receptors in the absence of nucleotides between fluorescently labeled G proteins and receptors expressed in mammalian cells. Our results show a strong quantitative correlation between not the on-rates of G-protein-M 3 -R interactions but rather the affinities of G q and G o proteins to M 3 -Rs, their GPCR-G-protein lifetime and their coupling efficiencies determined in intact cells, suggesting that the G-protein subtype-specific affinity to the activated receptor in the absence of nucleotides is, in fact, a major determinant of the coupling efficiency. Our broadly applicable FRET-based assay represents a fast and reliable method to quantify the intrinsic affinity and relative coupling selectivity of GPCRs toward all G-protein subtypes.

  10. Significance of immunoglobulin G4 (IgG4)-positive cells in extrahepatic cholangiocarcinoma: molecular mechanism of IgG4 reaction in cancer tissue.

    PubMed

    Harada, Kenichi; Shimoda, Shinji; Kimura, Yasushi; Sato, Yasunori; Ikeda, Hiroko; Igarashi, Saya; Ren, Xiang-Shan; Sato, Hirohide; Nakanuma, Yasuni

    2012-07-01

    IgG4 reactions consisting of marked infiltration by immunoglobulin G4 (IgG4)-positive plasma cells in affected organs is found in cancer patients as well as patients with IgG4-related diseases. Notably, extrahepatic cholangiocarcinomas accompanying marked IgG4 reactions clinicopathologically mimic IgG4-related sclerosing cholangitis. The regulatory cytokine interleukin (IL)-10 is thought to induce the differentiation of IgG4-positive cells. In this study, to clarify the mechanism of the IgG4 reaction in extrahepatic cholangiocarcinoma, we investigated nonprofessional antigen-presenting cells (APCs) generating IL-10-producing regulatory T cells (anergy T cells) and Foxp3-positive regulatory cells producing IL-10. Immunohistochemistry targeting IgG4, HLA-DR, CD80, CD86, and Foxp3 was performed using 54 cholangiocarcinoma specimens from 24 patients with gallbladder cancer, 22 patients with common bile duct cancer, and eight patients with cancer of the Papilla of Vater. Moreover, a molecular analysis of Foxp3 and IL-10 was performed using a cultured human cholangiocarcinoma cell line. Consequently, 43% of the cholangiocarcinomas were found to be abundant in IgG4. Those expressing HLA-DR but lacking costimulatory molecules (CD80 and CD86) and those expressing Foxp3 detected by an antibody recognizing the N terminus accounted for 54% and 39% of cases, respectively. Moreover, the number of IgG4-positive cells was larger in these cases than in other groups. In cultured cells, the presence of a splicing variant of Foxp3 messenger RNA and the expression of IL-10 were demonstrated. Extrahepatic cholangiocarcinoma is often accompanied by significant infiltration of IgG4-positive cells. Cholangiocarcinoma cells could play the role of nonprofessional APCs and Foxp3-positive regulatory cells, inducing IgG4 reactions via the production of IL-10 indirectly and directly, respectively. Copyright © 2012 American Association for the Study of Liver Diseases.

  11. Mini G protein probes for active G protein-coupled receptors (GPCRs) in live cells.

    PubMed

    Wan, Qingwen; Okashah, Najeah; Inoue, Asuka; Nehmé, Rony; Carpenter, Byron; Tate, Christopher G; Lambert, Nevin A

    2018-05-11

    G protein-coupled receptors (GPCRs) are key signaling proteins that regulate nearly every aspect of cell function. Studies of GPCRs have benefited greatly from the development of molecular tools to monitor receptor activation and downstream signaling. Here, we show that mini G proteins are robust probes that can be used in a variety of assay formats to report GPCR activity in living cells. Mini G (mG) proteins are engineered GTPase domains of Gα subunits that were developed for structural studies of active-state GPCRs. Confocal imaging revealed that mG proteins fused to fluorescent proteins were located diffusely in the cytoplasm and translocated to sites of receptor activation at the cell surface and at intracellular organelles. Bioluminescence resonance energy transfer (BRET) assays with mG proteins fused to either a fluorescent protein or luciferase reported agonist, superagonist, and inverse agonist activities. Variants of mG proteins (mGs, mGsi, mGsq, and mG12) corresponding to the four families of Gα subunits displayed appropriate coupling to their cognate GPCRs, allowing quantitative profiling of subtype-specific coupling to individual receptors. BRET between luciferase-mG fusion proteins and fluorescent markers indicated the presence of active GPCRs at the plasma membrane, Golgi apparatus, and endosomes. Complementation assays with fragments of NanoLuc luciferase fused to GPCRs and mG proteins reported constitutive receptor activity and agonist-induced activation with up to 20-fold increases in luminescence. We conclude that mG proteins are versatile tools for studying GPCR activation and coupling specificity in cells and should be useful for discovering and characterizing G protein subtype-biased ligands. © 2018 Wan et al.

  12. Relationship between post-SARS osteonecrosis and PAI-1 4G/5G gene polymorphisms.

    PubMed

    Sun, Wei; Li, Zirong; Shi, Zhengcai; Wang, Bailiang; Gao, Fuqiang; Yang, Yurun; Guo, Wanshou

    2014-05-01

    To explore the correlation between post-severe acute respiratory symptom (SARS) patients with osteonecrosis, investigate the etiology of post-SARS osteonecrosis and select the sensitive molecular symbols for early diagnosis and distinguish the high-risk population. The studied subjects were divided into two groups. Sixty-two post-SARS patients with osteonecrosis were one group, and 52 age- and sex-matched healthy people were as normal controlled group. Empty stomach blood samples from cubital veins were collected from both groups. Plasminogen activator inhibitor (PAI) by means of enzyme-linked immunosorbent assay and PAI-1 4G/5G polymorphism was detected by polymerase chain reaction and solid phase oligonucleotide assay. The blood agents of post-SARS patients changed obviously with 15.64 ± 13.85 U/ml while the control group 7.96 ± 4.27 U/ml; 4G/4G genotype for the PAI-1 polymorphism detected in post-SARS group was more than that of the control group, but had no statistical significance. The plasma PAI activity was related to homozygote 4G/4G genotype. This reveals that homozygote 4G/4G genotype may be a susceptible gene mark to Chinese osteonecrosis patients. Plasminogen activator inhibitor-1 is sensitive blood symbol for screening high-risk susceptible population; 4G/4G PAI-1 genotype may be an etiological factor in osteonecrosis.

  13. G protein-membrane interactions II: Effect of G protein-linked lipids on membrane structure and G protein-membrane interactions.

    PubMed

    Casas, Jesús; Ibarguren, Maitane; Álvarez, Rafael; Terés, Silvia; Lladó, Victoria; Piotto, Stefano P; Concilio, Simona; Busquets, Xavier; López, David J; Escribá, Pablo V

    2017-09-01

    G proteins often bear myristoyl, palmitoyl and isoprenyl moieties, which favor their association with the membrane and their accumulation in G Protein Coupled Receptor-rich microdomains. These lipids influence the biophysical properties of membranes and thereby modulate G protein binding to bilayers. In this context, we showed here that geranylgeraniol, but neither myristate nor palmitate, increased the inverted hexagonal (H II ) phase propensity of phosphatidylethanolamine-containing membranes. While myristate and palmitate preferentially associated with phosphatidylcholine membranes, geranylgeraniol favored nonlamellar-prone membranes. In addition, Gαi 1 monomers had a higher affinity for lamellar phases, while Gβγ and Gαβγ showed a marked preference for nonlamellar prone membranes. Moreover, geranylgeraniol enhanced the binding of G protein dimers and trimers to phosphatidylethanolamine-containing membranes, yet it decreased that of monomers. By contrast, both myristate and palmitate increased the Gαi 1 preference for lamellar membranes. Palmitoylation reinforced the binding of the monomer to PC membranes and myristoylation decreased its binding to PE-enriched bilayer. Finally, binding of dimers and trimers to lamellar-prone membranes was decreased by palmitate and myristate, but it was increased in nonlamellar-prone bilayers. These results demonstrate that co/post-translational G protein lipid modifications regulate the membrane lipid structure and that they influence the physico-chemical properties of membranes, which in part explains why G protein subunits sort to different plasma membrane domains. This article is part of a Special Issue entitled: Membrane Lipid Therapy: Drugs Targeting Biomembranes edited by Pablo V. Escribá. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... separate permit for each. (b) Scientific research. You may only conduct G&G scientific research related to... proprietary use or sale. (2) Notice. Any other G&G scientific research that you conduct related to oil, gas.... You must obtain a permit if the research activities you propose to conduct involve: (i) Using solid or...

  15. 30 CFR 251.4 - Types of G&G activities that require permits or Notices.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) Scientific research. You may only conduct G&G scientific research related to oil, gas, and sulphur in the OCS...) Notice. Any other G&G scientific research that you conduct related to oil, gas, and sulphur in the OCS... research activities you propose to conduct involve: (i) Using solid or liquid explosives; (ii) Drilling a...

  16. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and primary open-angle glaucoma

    PubMed Central

    Weger, Martin; Faschinger, Christoph; Schmut, Otto; Renner, Wilfried

    2008-01-01

    Purpose Alterations of the plasmin system have been suggested to participate in the multifactorial pathogenesis of primary open-angle glaucoma (POAG). The main physiological inhibitor of the plasmin system is plasminogen activator inhibitor-1 (PAI-1), which leads to decreased degradation of extracellular material. Interestingly, elevated PAI-1 levels in the aqueous humor of patients with POAG have been reported. A common polymorphism within the promoter region (PAI-1 4G/5G) has previously been shown to reduce the gene transcription rate of PAI-1. The purpose of the present study was to investigate a hypothesized association between PAI-1 4G/5G and the presence of POAG in a Caucasian population. Methods The present case-control study comprised 212 unrelated patients with POAG and 212 healthy control subjects, matched for age and sex. Genotyping of PAI-1 4G/5G polymorphisms was done using polymerase chain reaction. Results Allelic frequencies and genotype distributions of PAI-1 4G/5G did not significantly differ between patients with POAG and control subjects (PAI-1 4G/5G: 29.7% versus 29.7%). Presence of the PAI-1 4G-allele was associated with a nonsignificant odds ratio of 0.98 (95% confidence interval: 0.74–1.30) for POAG. Conclusions Our data suggest that PAI-1 4G/5G itself is unlikely to be a major risk factor among Caucasian patients with POAG. PMID:18615155

  17. OVA-bound nanoparticles induce OVA-specific IgG1, IgG2a, and IgG2b responses with low IgE synthesis.

    PubMed

    Yanase, Noriko; Toyota, Hiroko; Hata, Kikumi; Yagyu, Seina; Seki, Takahiro; Harada, Mitsunori; Kato, Yasuki; Mizuguchi, Junichiro

    2014-10-14

    There is an urgent requirement for a novel vaccine that can stimulate immune responses without unwanted toxicity, including IgE elevation. We examined whether antigen ovalbumin (OVA) conjugated to the surface of nanoparticles (NPs) (OVA-NPs) with average diameter of 110nm would serve as an immune adjuvant. When BALB/c mice were immunized with OVA-NPs, they developed sufficient levels of OVA-specific IgG1 antibody responses with low levels of IgE synthesis, representing helper T (Th)2-mediated humoral immunity. OVA-specific IgG2a and IgG2b responses (i.e., Th1-mediated immunity) were also induced by secondary immunization with OVA-NPs. As expected, immunization with OVA in alum (OVA-alum) stimulated humoral immune responses, including IgG1 and IgE antibodies, with only low levels of IgG2a/IgG2b antibodies. CD4-positive T cells from mice primed with OVA-NPs produced substantial levels of IL-21 and IL-4, comparable to those from OVA-alum group. The irradiated mice receiving OVA-NPs-primed B cells together with OVA-alum-primed T cells exhibited enhanced anti-OVA IgG2b responses relative to OVA-alum-primed B cells and T cells following stimulation with OVA-NPs. Moreover, when OVA-NPs-primed, but not OVA-alum-primed, B cells were cultured in the presence of anti-CD40 monoclonal antibody, IL-4, and IL-21, or LPS plus TGF-β in vitro, OVA-specific IgG1 or IgG2b antibody responses were elicited, suggesting that immunization with OVA-NPs modulates B cells to generate IgG1 and IgG2b responses. Thus, OVA-NPs might exert their adjuvant action on B cells, and they represent a promising potential vaccine for generating both IgG1 and IgG2a/IgG2b antibody responses with low IgE synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Contribution of cysteine residues to the structure and function of herpes simplex virus gH/gL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, Tina M.; Landsburg, Daniel J.; Charles Whitbeck, J.

    2005-02-20

    In HSV types 1 and 2, gH forms a noncovalent heterodimer with gL. Previous studies demonstrated that the first 323 amino acids of gH1 and the first 161 amino acids of gL1 are sufficient for gH/gL binding. For gL1, substitution of any of its four cysteine (C) residues (all located within the gH/gL binding region) destroyed gH binding and function. Although gH1 contains 8 cysteines in its ectodomain, gH 2 contains 7 (C3 of gH1 is replaced by arginine in gH2). We found that mutation of any of the four C-terminal cysteines led to a reduction or loss of gH/gLmore » function. Mutation of C5 or C6 in gH1 or gH2 rendered the proteins non-functional. However, substitution of C7 and/or C8 in gH1 has a definite negative impact on cell-cell fusion, although these mutations had less effect on complementation. Remarkably, all four gH1 N-terminal cysteines could be mutated simultaneously with little effect on fusion or complementation. As gH2 already lacks C3, we constructed a triple mutant (gH2-C1/2/4) which exhibited a similar phenotype. Since gH1 is known to bind gL2 and vice versa, we wondered whether binding of gH2 to the heterologous gL1 would enhance the fusion defect seen with the gH2-C2 mutant. The combination of mutant gH2-C2 with wild-type gL1 was nonfunctional in a cell-cell fusion assay. Interestingly, the reciprocal was not true, as gH1-C2 could utilize both gL1 and gL2. These findings suggest that there is a structural difference in the gH2 N-terminus as compared to gH1. We also present genetic evidence for at least one disulfide bond within gH2, between cysteines 2 and 4.« less

  19. Distinguishing Echinococcus granulosus sensu stricto genotypes G1 and G3 with confidence: A practical guide.

    PubMed

    Kinkar, Liina; Laurimäe, Teivi; Acosta-Jamett, Gerardo; Andresiuk, Vanessa; Balkaya, Ibrahim; Casulli, Adriano; Gasser, Robin B; González, Luis Miguel; Haag, Karen L; Zait, Houria; Irshadullah, Malik; Jabbar, Abdul; Jenkins, David J; Manfredi, Maria Teresa; Mirhendi, Hossein; M'rad, Selim; Rostami-Nejad, Mohammad; Oudni-M'rad, Myriam; Pierangeli, Nora Beatriz; Ponce-Gordo, Francisco; Rehbein, Steffen; Sharbatkhori, Mitra; Kia, Eshrat Beigom; Simsek, Sami; Soriano, Silvia Viviana; Sprong, Hein; Šnábel, Viliam; Umhang, Gérald; Varcasia, Antonio; Saarma, Urmas

    2018-06-21

    Cystic echinococcosis (CE), a zoonotic disease caused by tapeworms of the species complex Echinococcus granulosus sensu lato, represents a substantial global health and economic burden. Within this complex, E. granulosus sensu stricto (genotypes G1 and G3) is the most frequent causative agent of human CE. Currently, there is no fully reliable method for assigning samples to genotypes G1 and G3, as the commonly used mitochondrial cox1 and nad1 genes are not sufficiently consistent for the identification and differentiation of these genotypes. Thus, a new genetic assay is required for the accurate assignment of G1 and G3. Here we use a large dataset of near-complete mtDNA sequences (n = 303) to reveal the extent of genetic variation of G1 and G3 on a broad geographical scale and to identify reliable informative positions for G1 and G3. Based on extensive sampling and sequencing data, we developed a new method, that is simple and cost-effective, to designate samples to genotypes G1 and G3. We found that the nad5 is the best gene in mtDNA to differentiate between G1 and G3, and developed new primers for the analysis. Our results also highlight problems related to the commonly used cox1 and nad1. To guarantee consistent identification of G1 and G3, we suggest using the sequencing of the nad5 gene region (680 bp). This region contains six informative positions within a relatively short fragment of the mtDNA, allowing differentiation of G1 and G3 with confidence. Our method offers clear advantages over the previous ones, providing a significantly more consistent means to distinguish G1 and G3 than the commonly used cox1 and nad1. Copyright © 2018. Published by Elsevier B.V.

  20. Inverting the G-Tetrad Polarity of a G-Quadruplex by Using Xanthine and 8-Oxoguanine.

    PubMed

    Cheong, Vee Vee; Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2016-01-04

    G-quadruplexes are four-stranded nucleic acid structures that are built from consecutively stacked guanine tetrad (G-tetrad) assemblies. The simultaneous incorporation of two guanine base lesions, xanthine (X) and 8-oxoguanine (O), within a single G-tetrad of a G-quadruplex was recently shown to lead to the formation of a stable G⋅G⋅X⋅O tetrad. Herein, a judicious introduction of X and O into a human telomeric G-quadruplex-forming sequence is shown to reverse the hydrogen-bond polarity of the modified G-tetrad while preserving the original folding topology. The control exerted over G-tetrad polarity by joint X⋅O modification will be valuable for the design and programming of G-quadruplex structures and their properties. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. The interaction of ruminant IgG with receptor type II for IgG on human phagocytes.

    PubMed Central

    Jungi, T W; Peterhans, E; Pfister, H; Fey, H

    1989-01-01

    The interaction of ruminant IgG with human phagocytes was assessed using Fc receptor (FcR)-mediated ingestion and the triggering of a respiratory burst as effector functions indicative of receptor-specific interaction. In monomeric form, ruminant IgG was three to five orders of magnitude less potent than homologous IgG in inhibiting FcR-specific phagocytosis by monocytes. However, when attached to tanned sheep erythrocytes (Es-T), ruminant IgG was opsonic, as it promoted enhanced phagocytosis of Es-T, comparable to ingestion of rabbit IgG-coated Es. This phagocytosis was inhibitable by high concentrations of human IgG in the fluid phase. Moreover, Es-T precoated with ferritin could be opsonized to a similar degree by anti-ferritin IgG from rabbit and cow. However, only bovine IgG1, but not IgG2, was opsonic. Bovine and goat IgG of some, but not other, suppliers were inactive. Similar results were obtained by measuring the respiratory burst triggered by heat-aggregated IgG, using a luminol-enhanced chemiluminescence assay. Thus, human IgG and ruminant IgG stimulated monocytes and, to a lesser extent, polymorphonuclear leucocytes (PMN), to generate CL. Depending on the manufacturer, some preparations of bovine and goat IgG were inactive, and bovine IgG2 failed to induce CL. These findings prove that certain ruminant IgG preparations, including bovine IgG1 interacting weakly with homologous PMN and monocytes, do interact with human PMN, monocytes and macrophages in a FcR-specific manner when offered in complexed form. Inhibition studies suggest that bovine IgG1 interacts mainly with human FcR type II. In contrast, bovine IgG2, regarded as cytophilic for homologous PMN, fails to interact with human PMN, monocytes and macrophages. PMID:15493277

  2. HLA-G, -A haplotypes in Amerindians (Ecuador): HLA-G*01:05N World distribution.

    PubMed

    Arnaiz-Villena, Antonio; Palacio-Gruber, Jose; Enriquez de Salamanca, Mercedes; Juárez, Ignacio; Campos, Cristina; Nieto, Jorge; Muñiz, Ester; Martin-Villa, Jose Manuel

    2018-02-01

    HLA-G and HLA-A frequencies have been analysed in Amerindians from Ecuador. HLA-G allele frequencies are found to be closer to those of other Amerindians (Mayas from Guatemala and Uros from Peru) and closer to European ones than to Far East Asians groups, particularly, regarding to HLA-G*01:04 allele. HLA-G/-A haplotypes have been calculated for the first time in Amerindians. It is remarkable that HLA-G*01:05N "null" allele is found in a very low frequency (like in Amerindian Mayas and Uros) and is also found in haplotypes belonging to the HLA-A19 group of alleles (HLA-A*30, -A*31, -A*33). It was previously postulated that HLA-G*01:05N appeared in HLA-A*30/-B*13 haplotypes in Middle East Mediterraneans. It may be hypothesized that in Evolution, HLA-G*01:05N existed primarily in one of the HLA extant or extinct -A19 haplotype, whether this haplotype was placed in Middle East or other World areas, including America. However, the highest present day HLA-G*01:05N frequencies are found in Middle East Mediterraneans. Copyright © 2017. Published by Elsevier Inc.

  3. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  4. Plasminogen activator inhibitor-1 4G/5G polymorphism in infertile women with and without endometriosis.

    PubMed

    Gonçalves-Filho, Rubens P; Brandes, Ariel; Christofolini, Denise M; Lerner, Tatiana G; Bianco, Bianca; Barbosa, Caio P

    2011-05-01

    To evaluate PAI-1 genotypes in a group of infertile women with or without endometriosis and control subjects. Case-control study. Human Reproduction Center of Medicina do ABC Faculty. One hundred and forty infertile women with endometriosis, 64 women with idiopathic infertility and 148 fertile women as control subjects. The PAI-1 4G/5G polymorphism was identified by restriction fragment length polymorphism-polymerase chain reaction. Genotype distribution and allele frequency of the 4G/5G polymorphism of the PAI-1 gene. The frequencies of genotypes 4G/4G, 4G/5G and 5G/5G of the PAI-1 gene in the infertile women with endometriosis were 38.6, 37.1 and 24.3%, respectively, and in the control group 24.3, 33.8 and 41.9%, respectively (p=0.003). When the infertile women with endometriosis were divided according to their endometriosis stage, genotypes 4G/4G, 4G/5G and 5G/5G were identified, respectively, in 36.7, 32.9 and 30.4% of the patients with minimal/mild endometriosis (p=0.102) and in 41.0, 42.6 and 16.4% of the patients with moderate/severe endometriosis (p=0.001); in the women with idiopathic infertility, these genotypes were found at a frequency of 29.7, 34.3 and 36%, respectively (p=0.637). The data suggest that, in Brazilian women, the PAI-1 4G/5G polymorphism may be associated with a risk of endometriosis-associated infertility. © 2011 The Authors Acta Obstetricia et Gynecologica Scandinavica© 2011 Nordic Federation of Societies of Obstetrics and Gynecology.

  5. Glioma CpG island methylator phenotype (G-CIMP): biological and clinical implications.

    PubMed

    Malta, Tathiane M; de Souza, Camila F; Sabedot, Thais S; Silva, Tiago C; Mosella, Maritza S; Kalkanis, Steven N; Snyder, James; Castro, Ana Valeria B; Noushmehr, Houtan

    2018-04-09

    Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.

  6. IgG4 related sclerosing mastitis: expanding the morphological spectrum of IgG4 related diseases.

    PubMed

    Chougule, Abhijit; Bal, Amanjit; Das, Ashim; Singh, Gurpreet

    2015-01-01

    IgG4 related disease (IgG4RD) is a recently recognised condition characterised by mass forming lesions associated with storiform fibrosis, obliterative phlebitis, lymphoplasmacytic infiltrate rich in IgG4 positive plasma cells and elevated serum IgG4 levels. Although rare, mammary involvement has been reported as IgG4 related sclerosing mastitis, the morphological counterpart of a growing family of IgG4 related diseases. A total of 17 cases belonging to mass forming benign inflammatory breast lesions such as plasma cell mastitis, granulomatous lobular mastitis, non-specific mastitis and inflammatory pseudotumour were investigated as a possible member of IgG4 related sclerosing mastitis. Clinical, radiological, histopathological and immunohistochemistry findings were noted in all cases. Cases diagnosed as inflammatory pseudotumour showed all the histopathological features of IgG4RD along with increased number of IgG4 positive plasma cells and IgG4/IgG ratio >40%. However, only a few IgG4 positive cells were seen in plasma cell mastitis, granulomatous lobular mastitis and non-specific mastitis cases. These cases also did not fulfill the morphological criteria for the diagnosis of IgG4 related diseases. IgG4RD should be excluded in plasma cell rich lesions diagnosed on core biopsies by IgG4 immunostaining. This can avoid unnecessary surgery as IgG4 related diseases respond to simple and effective steroid treatment.

  7. Epstein-Barr Virus Glycoprotein gB and gHgL Can Mediate Fusion and Entry in trans, and Heat Can Act as a Partial Surrogate for gHgL and Trigger a Conformational Change in gB

    PubMed Central

    Chesnokova, Liudmila S.; Ahuja, Munish K.

    2014-01-01

    ABSTRACT Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. IMPORTANCE The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. PMID:25142593

  8. Advances to G3

    NASA Astrophysics Data System (ADS)

    Salters, Vincent; Tarduno, John; van Keken, Peter

    2008-12-01

    Geochemistry, Geophysics, Geosystems (G3 ), a joint publication of AGU and the Geochemical Society, publishes research papers that speak to a broad community interested in Earth processes that are best studied with interdisciplinary approaches. G3 publishes conventional papers but is especially interested in novel publication forms that take advantage of electronic formats, such as animations and readily reusable digitized data sets. G3 's large number of submissions and subscriptions attests to how an interdisciplinary approach and electronic format benefit authors and readers. In the past few months, G3 has undergone substantial improvements. These include several changes in the timeliness of publication, revised protocols for the publication of data sets, the appointment of new associate editors, an updated Web site, and improved access to articles. As the editors of G3 , we are confident that these improvements will better serve AGU members.

  9. Downlink power distributions for 2G and 3G mobile communication networks.

    PubMed

    Colombi, Davide; Thors, Björn; Persson, Tomas; Wirén, Niklas; Larsson, Lars-Eric; Jonsson, Mikael; Törnevik, Christer

    2013-12-01

    Knowledge of realistic power levels is key when conducting accurate EMF exposure assessments. In this study, downlink output power distributions for radio base stations in 2G and 3G mobile communication networks have been assessed. The distributions were obtained from network measurement data collected from the Operations Support System, which normally is used for network monitoring and management. Significant amounts of data were gathered simultaneously for large sets of radio base stations covering wide geographical areas and different environments. The method was validated with in situ measurements. For the 3G network, the 90th percentile of the averaged output power during high traffic hours was found to be 43 % of the maximum available power. The corresponding number for 2G, with two or more transceivers installed, was 65 % or below.

  10. Rotating toroids in G10.62-0.38, G19.61-0.23, and G29.96-0.02

    NASA Astrophysics Data System (ADS)

    Beltrán, M. T.; Cesaroni, R.; Neri, R.; Codella, C.

    2011-01-01

    Context. In recent years, we have detected clear evidence of rotation in more than 5 hot molecular cores (HMCs). Their identification is confirmed by the fact that the rotation axes are parallel to the axes of the associated bipolar outflows. We have now pursued our investigation by extending the sample to 3 known massive cores, G10.62-0.38, G19.61-0.23, and G29.96-0.02. Aims: We wish to make a thorough study of the structure and kinematics of HMCs and corresponding molecular outflows to reveal possible velocity gradients indicative of the rotation of the cores. Methods: We carried out PdBI observations at 2.7 and 1.4 mm of gas and dust with angular resolutions of ~2”-3” and ~1”-2”, respectively. To trace both rotation and expansion, we simultaneously observed CH3CN, a typical HMC tracer, and 13CO, a typical outflow tracer. Results: The CH3CN (12-11) observations reveal clear velocity gradients in the three HMCs oriented perpendicular to the direction of the bipolar outflows. For G19 and G29 the molecular outflows have been mapped in 13CO. The gradients are interpreted as rotating toroids. The rotation temperatures, used to derive the mass of the cores, have been obtained by means of the rotational diagram method, and lie in the range of 87-244 K. The diameters and masses of the toroids lie in the range of 4550-12600 AU and 28-415 M_⊙, respectively. Given that the dynamical masses are 2 to 30 times lower than those of the cores (if the inclination of the toroids with respect to the plane of the sky is not much below 45°), we suggest that the toroids could be accreting onto the embedded cluster. For G19 and G29, the collapse is also suggested by the redshifted absorption seen in the 13CO (2-1) line. We infer that infall onto the embedded (proto)stars must proceed with rates of ~10-2 M_⊙ yr-1 and on timescales of ~4 × 103-104 yr. The infall rates derived for G19 and G29 are two orders of magnitude greater than the accretion rates indirectly estimated

  11. Post dural puncture headache after spinal anaesthesia for caesarean section: a comparison of 25 g Quincke, 27 g Quincke and 27 g Whitacre spinal needles.

    PubMed

    Shaikh, Jan Muhammad; Memon, Amna; Memon, Muhammad Ali; Khan, Majida

    2008-01-01

    To compare the frequency and severity of post dural puncture headache in obstetric patients using 25G Quincke, 27G Quincke and 27G Whitacre spinal needles. Comparative, randomized, double-blind, interventional study. Liaquat University Hospital Hyderabad from October 2005 to December 2006. 480 ASA I-II full term pregnant women, 18 to 45 years of age, scheduled for elective Caesarean section, under spinal anaesthesia, were randomized into three groups: Group I (25G Quincke spinal needle: n=168), Group II (27G Quincke spinal needle: n=160) and Group III (27G Whitacre spinal needle: n=152). Spinal anaesthesia was performed with 1.5-2.0 ml 0.75% hyperbaric bupivacaine using 25G Quincke spinal needle (Group I), 27G Quincke spinal needle (Group II) and 27G Whitacre spinal needle (Group III) at L3-4 inter-vertebral space. Each patient was assessed daily for four consecutive days following Caesarean section. Frequency and severity and of postdural puncture headache (PDPH) were recorded. Data were analyzed using SPSS-11. Frequency of PDPH following the use of 25G Quincke (Group I), 27G Quincke (Group II) and 27G Whitacre (Group III) spinal needles was 8.3% (14/168), 3.8% (6/160) and 2.0% (3/152) respectively. In Group I, PDPH was mild in 5 patients, moderate in 7 patients and severe in 2 patients. In Group II, it was mild in 2, moderate in 3 and severe in 1 patient. In group III, it was mild in 2 and moderate in 1 patient. Severe PDPH did not occur in Group III. Most of the patients with PDPH developed it on 1st and 2nd postoperative day. When using a 27G Whitacre spinal needle, the frequency and severity of PDPH was significantly lower than when a 25G Quincke or 27G Quincke needle was used.

  12. The Plasminogen Activator Inhibitor 1 4G/5G Polymorphism and the Risk of Alzheimer's Disease.

    PubMed

    Fekih-Mrissa, Najiba; Mansour, Malek; Sayeh, Aicha; Bedoui, Ines; Mrad, Meriem; Riahi, Anis; Mrissa, Ridha; Nsiri, Brahim

    2017-09-01

    The aim of this study was to determine whether plasminogen activator inhibitor 1 (PAI-1) is associated with the risk of Alzheimer's disease (AD) in Tunisian patients. We analyzed the genotype and allele frequency distribution of the PAI-1 polymorphism in 60 Tunisian patients with AD and 120 healthy controls. The results show a significantly increased risk of AD in carriers of the 4G/4G and 4G/5G genotypes versus the wild-type 5G/5G genotype (4G/4G: 28.33% in patients vs 10.0% in controls; P < 10 -3 ; OR = 8.78; 4G/5G: 55.0% in patients vs 38.33% in controls; OR = 4.45; P < 10 -3 ). The 4G allele was also more frequently found in patients compared with controls; P < 10 -3 ; OR = 3.07. For all participants and by gender, homozygotic carriers (4G/4G) were at an increased risk of AD over heterozygotes and women were at an increased risk over their male genotype counterparts. The odds ratio for AD among 4G/4G carriers for any group was approximately twice that of heterozygotes in the same group. Women homozygotes ranked highest for AD risk (OR = 20.8) and, in fact, women heterozygotes (OR = 9.03) ranked higher for risk than male homozygotes (OR = 6.12). These preliminary exploratory results should be confirmed in a larger study.

  13. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  14. Epstein-Barr virus glycoprotein gB and gHgL can mediate fusion and entry in trans, and heat can act as a partial surrogate for gHgL and trigger a conformational change in gB.

    PubMed

    Chesnokova, Liudmila S; Ahuja, Munish K; Hutt-Fletcher, Lindsey M

    2014-11-01

    Epstein-Barr virus (EBV) fusion with an epithelial cell requires virus glycoproteins gHgL and gB and is triggered by an interaction between gHgL and integrin αvβ5, αvβ6, or αvβ8. Fusion with a B cell requires gHgL, gp42, and gB and is triggered by an interaction between gp42 and human leukocyte antigen class II. We report here that, like alpha- and betaherpesviruses, EBV, a gammaherpesvirus, can mediate cell fusion if gB and gHgL are expressed in trans. Entry of a gH-null virus into an epithelial cell is possible if the epithelial cell expresses gHgL, and entry of the same virus, which phenotypically lacks gHgL and gp42, into a B cell expressing gHgL is possible in the presence of a soluble integrin. Heat is capable of inducing the fusion of cells expressing only gB, and the proteolytic digestion pattern of gB in virions changes in the same way following the exposure of virus to heat or to soluble integrins. It is suggested that the Gibbs free energy released as a result of the high-affinity interaction of gHgL with an integrin contributes to the activation energy required to cause the refolding of gB from a prefusion to a postfusion conformation. The core fusion machinery of herpesviruses consists of glycoproteins gB and gHgL. We demonstrate that as in alpha- and betaherpesvirus, gB and gHgL of the gammaherpesvirus EBV can mediate fusion and entry when expressed in trans in opposing membranes, implicating interactions between the ectodomains of the proteins in the activation of fusion. We further show that heat and exposure to a soluble integrin, both of which activate fusion, result in the same changes in the proteolytic digestion pattern of gB, possibly representing the refolding of gB from its prefusion to its postfusion conformation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  16. Relationship of plasminogen activator inhibitor 1 gene 4G/5G polymorphisms to hypertension in Korean women.

    PubMed

    Kim, Kyu-nam; Kim, Kwang-min; Kim, Bom-taeck; Joo, Nam-seok; Cho, Doo-yeoun; Lee, Duck-joo

    2012-04-01

    Hypertension (HTN) is a major determinant of various cardiovascular events. Plasma levels of plasminogen activator inhibitor 1 (PAI-1) modulate this risk. A deletion/insertion polymorphism within the PAI-1 loci (4G/4G, 4G/5G, 5G/5G) affects the expression of this gene. The present study investigated the association between PAI-1 loci polymorphisms and HTN in Korean women. Korean women (n = 1312) were enrolled in this study to evaluate the association between PAI-1 4G/5G gene polymorphisms and HTN as well as other metabolic risk factors. PAI-1 loci polymorphisms were investigated using polymerase chain reaction amplification and single-strand conformation polymorphism analysis. The three genotype groups differed with respect to systolic blood pressure (P = 0.043), and diastolic blood pressure (P = 0.009) but not with respect to age, body mass index, total cholesterol, low or high density lipoprotein cholesterol, triglycerides, or fasting blood glucose. Carriers of the PAI-1 4G allele had more hypertension significantly (PAI-1 4G/5G vs. PAI-1 5G/5G, P = 0.032; PAI-1 4G/4G vs. PAI-1 5G/5G, P = 0.034). When stratified according to PAI-1 4G/5G polymorphism, there was no significant difference in all metabolic parameters among PAI-1 genotype groups in patients with HTN as well as subjects with normal blood pressure. The estimated odds ratio of the 4G/4G genotype and 4G/5G for HTN was 1.7 (P = 0.005), and 1.6 (P = 0.015), respectively. These findings might indicate that PAI-1 loci polymorphisms independently contribute to HTN and that gene-environmental interaction may be not associated in Korean women.

  17. Differential Decline in Leishmania Membrane Antigen-Specific Immunoglobulin G (IgG), IgM, IgE, and IgG Subclass Antibodies in Indian Kala-Azar Patients after Chemotherapy

    PubMed Central

    Anam, Khairul; Afrin, Farhat; Banerjee, Dwijadas; Pramanik, Netai; Guha, Subhasis K.; Goswami, Rama P.; Saha, Shiben K.; Ali, Nahid

    1999-01-01

    Pathogenesis in kala-azar is associated with depressed cellular immunity and significant elevation of antileishmanial antibodies. Since these antibodies are present even after cure, analysis of the parasite-specific isotypes and immunoglobulin G (IgG) subclasses in kala-azar patients may shed new light on the immune responses during progression and resolution of infection. Using leishmanial membrane antigenic extracts, we investigated the relative levels of specific IgG, IgM, IgA, IgE, and IgG subclasses in Indian kala-azar patient sera during disease, drug resistance, and cure. Acute-phase sera showed strong stimulation of IgG, followed by IgE and IgM and lastly by IgA antibodies. IgG subclass analysis revealed expression of all of the subclasses, with a predominance of IgG1 during disease. Following sodium stibogluconate (SAG) resistance, the levels of IgG, IgM, IgE, and IgG4 remained constant, while there was a decrease in the titers of IgG2 and IgG3. In contrast, a significant (2.2-fold) increase in IgG1 was observed in these individuals. Cure, in both SAG-responsive and unresponsive patients, correlated with a decline in the levels of IgG, IgM, IgE, and all of the IgG subclasses. The stimulation of IgG1 and the persistence, most importantly, of IgE and IgG4 following drug resistance, along with a decline in IgE, IgG4, and IgG1 with cure, demonstrate the potential of these isotypes as possible markers for monitoring effective treatment in kala-azar. PMID:10569788

  18. Computational study of Gleevec and G6G reveals molecular determinants of kinase inhibitor selectivity

    DOE PAGES

    Lin, Yen -Lin; Meng, Yilin; Huang, Lei; ...

    2014-10-22

    Gleevec is a potent inhibitor of Abl tyrosine kinase but not of the highly homologous c-Src kinase. Because the ligand binds to an inactive form of the protein in which an Asp-Phe-Gly structural motif along the activation loop adopts a so-called DFG-out conformation, it was suggested that binding specificity was controlled by a “conformational selection” mechanism. In this context, the binding affinity displayed by the kinase inhibitor G6G poses an intriguing challenge. Although it possesses a chemical core very similar to that of Gleevec, G6G is a potent inhibitor of both Abl and c-Src kinases. Both inhibitors bind to themore » DFG-out conformation of the kinases, which seems to be in contradiction with the conformational selection mechanism. To address this issue and display the hidden thermodynamic contributions affecting the binding selectivity, molecular dynamics free energy simulations with explicit solvent molecules were carried out. Relative to Gleevec, G6G forms highly favorable van der Waals dispersive interactions upon binding to the kinases via its triazine functional group, which is considerably larger than the corresponding pyridine moiety in Gleevec. Upon binding of G6G to c-Src, these interactions offset the unfavorable free energy cost of the DFG-out conformation. When binding to Abl, however, G6G experiences an unfavorable free energy penalty due to steric clashes with the phosphate-binding loop, yielding an overall binding affinity that is similar to that of Gleevec. Such steric clashes are absent when G6G binds to c-Src, due to the extended conformation of the phosphate-binding loop.« less

  19. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients

    PubMed Central

    Taleb, Eman Abo; Nagpal, Manish P.; Mehrotra, Navneet S.; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O.; Noman, Abdulrahman

    2017-01-01

    PURPOSE: To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). MATERIALS AND METHODS: A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. RESULTS: There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state (P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively (P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively (P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively (P > 0.05). CONCLUSION: 25-G vitrectomy is as effective for PDR as 23-G vitrectomy. PMID:29118498

  20. Comparison of clinical outcome between 23-G and 25-G vitrectomy in diabetic patients.

    PubMed

    Taleb, Eman Abo; Nagpal, Manish P; Mehrotra, Navneet S; Bhatt, Kalyani; Goswami, Sangeeta; Babalola, Yewande O; Noman, Abdulrahman

    2017-01-01

    To compare the clinical outcomes and complications between 23-G and 25-G vitrectomy in patients with diabetic vitreous hemorrhage (VH). A retrospective comparative study comprising 69 eyes (36 eyes in 23-G group and 33 eyes in 25-G group) of 65 patients who underwent vitrectomy with air tamponade for diabetic vitreous hemorrhage (VH) with at least 6 months of follow-up was conducted. There were no significant differences between the two groups in age, gender, bilaterality, type of diabetes, presence of hypertension, lens status, and previous argon laser photocoagulation state ( P > 0.05). Best-corrected visual acuity (BCVA) of both groups at postoperative 1 month logarithm of the minimum angle of resolution (logMAR) (1.06 ± 0.99, 0.90 ± 0.96), 3 months logMAR (1.07 ± 0.93, 0.83 ± 0.85), and 6 months logMAR (1.03 ± 0.89, 0.83 ± 0.85) significantly improved from the preoperative BCVA logMAR (2.03 ± 0.83, 2.15 ± 0.99) for 23-G group, 25-G group, respectively ( P < 0.0001). There was no significant difference in BCVA between the two groups preoperatively and at 1, 3, and 6 months postoperatively ( P = 0.566, 0.506, 0.333, and 0.445, respectively), incidence of intraoperative wound suturing (21.4%, 15.2%), postoperative hypotony (0.0%, 0.0%), early postoperative VH (POVH) (11.1%, 15.2%), late POVH (5.6%, 0.0%), retinal detachment (2.8%, 6.1%), neovascular glaucoma (92.8%, 9.1%), and endophthalmitis (0.0%, 0.0%) for 23-G group, 25-G group, respectively ( P > 0.05). 25-G vitrectomy is as effective for PDR as 23-G vitrectomy.

  1. Placental Malaria Induces Variant-Specific Antibodies of the Cytophilic Subtypes Immunoglobulin G1 (IgG1) and IgG3 That Correlate with Adhesion Inhibitory Activity

    PubMed Central

    Elliott, Salenna R.; Brennan, Amy K.; Beeson, James G.; Tadesse, Eyob; Molyneux, Malcolm E.; Brown, Graham V.; Rogerson, Stephen J.

    2005-01-01

    Antibodies targeting variant antigens on the surfaces of chondroitin sulfate A (CSA)-binding malaria-infected erythrocytes have been linked to protection against the complications of malaria in pregnancy. We examined the isotype/subtype profiles of antibodies that bound to variant surface antigens expressed by CSA-adherent Plasmodium falciparum in pregnant Malawian women with and without histologically defined placental malaria. Women in their first pregnancy with placental malaria produced significantly greater amounts of immunoglobulin G1 (IgG1) and IgG3 reactive with surface antigens of malaria-infected erythrocytes than uninfected women of the same gravidity. IgG1 and IgG3 levels in infected and control women in later pregnancies were similar to those in infected women in their first pregnancy. Levels of IgG2 and IgG4 were similarly low in infected and uninfected women of all gravidities. IgM that bound to the surface of CSA-adherent P. falciparum occurred in all groups of women and malaria-naïve controls. There was a significant correlation between IgG1 and IgG3 levels, indicating that women usually produced both subtypes. Levels of IgG1 and IgG3 correlated with the ability of serum or plasma to inhibit parasite adhesion to CSA. Taken together, these data suggest that IgG1 and IgG3 dominate the IgG response to placental-type variant surface antigens. They may function by blocking parasite adhesion to placental CSA, but given their cytophilic nature, they might also opsonize malaria-infected erythrocytes for interaction with Fc receptors on phagocytic cells. PMID:16113309

  2. Association between plasminogen activator inhibitor-1 4G/5G gene polymorphism and immunoglobulin A nephropathy susceptibility.

    PubMed

    Zhou, Tian-Biao; Jiang, Zong-Pei

    2015-02-01

    The association between plasminogen activator inhibitor-1 (PAI-1) 4 G/5 G gene polymorphism and immunoglobulin A nephropathy (IgAN) risk is still controversial. A meta-analysis was performed to evaluate the association between PAI-1 4 G/5 G gene polymorphism and IgAN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Four articles were identified for the analysis of association between PAI-1 4 G/5 G gene polymorphism and IgAN risk. 4 G allele was not associated with IgAN susceptibility in overall populations and in Asians. Furthermore, 4 G/4 G and 5 G/5 G genotype were not associated with IgAN for overall populations, Asians. In conclusion, PAI-1 4 G/5 G gene polymorphism was not associated with IgAN risk in overall populations and in Asians. However, more studies should be performed in the future.

  3. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  4. Oriented immobilized anti-hIgG via F(c) fragment-imprinted PHEMA cryogel for IgG purification.

    PubMed

    Bereli, Nilay; Ertürk, Gizem; Tümer, M Aşkin; Say, Ridvan; Denizli, Adil

    2013-05-01

    Antibodies are used in many applications, especially as diagnostic and therapeutic agents. Among the various techniques used for the purification of antibodies, immunoaffinity chromatography is by far the most common. For this purpose, oriented immobilization of antibodies is an important step for the efficiency of purification step. In this study, F(c) fragment-imprinted poly(hydroxyethyl methacrylate) cryogel (MIP) was prepared for the oriented immobilization of anti-hIgG for IgG purification from human plasma. Non-imprinted poly(hydroxyethyl methacrylate) cryogel (NIP) was also prepared for random immobilization of anti-hIgG to compare the adsorption capacities of oriented (MIP/anti-hIgG) and random (NIP/anti-hIgG) cryogel columns. The amount of immobilized anti-hIgG was 19.8 mg/g for the NIP column and 23.7 mg/g for the MIP column. Although the amount of immobilized anti-hIgG was almost the same for the NIP and MIP columns, IgG adsorption capacity was found to be three times higher than the NIP/anti-hIgG column (29.7 mg/g) for the MIP/anti-hIgG column (86.9 mg/g). Higher IgG adsorption capacity was observed from human plasma (up to 106.4 mg/g) with the MIP/anti-hIgG cryogel column. Adsorbed IgG was eluted using 1.0 M NaCl with a purity of 96.7%. The results obtained here are very encouraging and showed the usability of MIP/anti-hIgG cryogel prepared via imprinting of Fc fragments as an alternative to conventional immunoaffinity techniques for IgG purification. Copyright © 2012 John Wiley & Sons, Ltd.

  5. Diagnostic Performance of Serum IgG4 Levels in Patients With IgG4-Related Disease

    PubMed Central

    Yu, Kuang-Hui; Chan, Tien-Ming; Tsai, Ping-Han; Chen, Ching-Hui; Chang, Pi-Yueh

    2015-01-01

    Abstract The aim of this study is to study the clinical features and diagnostic performance of IgG4 in Chinese populations with IgG4-related diseases (IgG4-RDs). The medical records of 2901 adult subjects who underwent serum IgG4 level tests conducted between December 2007 and May 2014 were reviewed. Serum concentrations of IgG4 were measured in 2901 cases, including 161 (5.6%) patients with IgG4-RD and 2740 (94.4%) patients without IgG4-RD (non-IgG4-RD group). The mean age of the IgG4-RD patients was 58.4 ± 16.1 years (range: 21–87), and 48 (29.8%) were women. The mean serum IgG4 level was significantly much higher in IgG4-RD patients than in non-IgG4-RD (1062.6 vs 104.3 mg/dL, P < 0.001) participants. For IgG4 >135 mg/dL, the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), likelihood ratio (LR)+, and LR− were 86%, 77%, 18%, 99%, 3.70, and 0.19, respectively. When the upper limit of normal was doubled for an IgG4 >270 mg/dL, the corresponding data were 75%, 94%, 43%, 98%, 12.79, and 0.26, respectively. For IgG4 >405 mg/dL (tripling the upper limit of normal), the corresponding data were 62%, 98%, 68%, 98%, 37.00, and 0.39, respectively. When calculated according to the manufacturer's package insert cutoff (>201 mg/dL) for the diagnosis of IgG4-RD, the corresponding sensitivity, specificity, PPV, NPV, LR+, and LR− were 80%, 89%, 29%, 99%, 7.00, and 0.23, respectively. For IgG4 >402 mg/dL (>2× the upper limit of the normal range), the corresponding data were 62%, 98%, 68%, 98%, 36.21, and 0.39, respectively. For IgG4 >603 mg/dL (>3× the upper limit of the normal range), the corresponding data were 50%, 99%, 84%, 97%, 90.77 and 0.51, respectively. The optimal cutoff value of serum IgG4 (measured by nephelometry using a Siemens BN ProSpec instrument and Siemens reagent) for the diagnosis of IgG4-RD was 248 mg/dL, the sensitivity and specificity were 77.6% and 92.8%, respectively. The present

  6. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    PubMed

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  7. Seizures and Encephalitis in Myelin Oligodendrocyte Glycoprotein IgG Disease vs Aquaporin 4 IgG Disease.

    PubMed

    Hamid, Shahd H M; Whittam, Dan; Saviour, Mariyam; Alorainy, Amal; Mutch, Kerry; Linaker, Samantha; Solomon, Tom; Bhojak, Maneesh; Woodhall, Mark; Waters, Patrick; Appleton, Richard; Duddy, Martin; Jacob, Anu

    2018-01-01

    Antibodies to myelin oligodendrocyte glycoprotein IgG (MOG-IgG) are increasingly detected in patients with non-multiple sclerosis-related demyelination, some of whom manifest a neuromyelitis optica (NMO) phenotype. Cortical involvement, encephalopathy, and seizures are rare in aquaporin 4 antibody (AQP4-IgG)-related NMO in the white European population. However, the authors encountered several patients with seizures associated with MOG-IgG disease. To compare incidence of seizures and encephalitis-like presentation, or both between AQP4-IgG-positive and MOG-IgG-positive patients. Retrospective case series of all patients who were seropositive for MOG-IgG (n = 34) and the last 100 patients with AQP4-IgG disease (NMO spectrum disorder) seen in the NMO service between January 2013 and December 2016, and analysis was completed January 4, 2017. All patients were seen in a tertiary neurological center, The Walton Centre NHS Foundation Trust in Liverpool, England. The difference in seizure frequency between the AQP4-IgG-positive and MOG-IgG-positive patient groups was determined. Thirty-four patients with MOG-IgG disease (20 female) with a median age at analysis of 30.5 years (interquartile range [IQR], 15-69 years), and 100 AQP4-IgG-positive patients (86 female) with a median age at analysis of 54 years (IQR, 12-91 years) were studied. Most patients were of white race. Five of the 34 patients with MOG-IgG (14.7%) had seizures compared with 1 patient with AQP4-IgG (2-sided P < .008, Fisher test). On magnetic resonance imaging, all 5 MOG-IgG-positive patients had inflammatory cortical brain lesions associated with the seizures. In 3 of the 5 MOG-IgG-positive patients, seizures occurred as part of the index event. Four of the 5 presented with encephalopathy and seizures, and disease relapsed in all 5 patients. Four of these patients were receiving immunosuppressant medication at last follow-up, and 3 continued to take antiepileptic medication. In contrast, the only

  8. 7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 14 2012-01-01 2012-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

  9. 7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 14 2013-01-01 2013-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

  10. 7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 14 2014-01-01 2014-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

  11. 7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 14 2010-01-01 2009-01-01 true Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

  12. 7 CFR Exhibit G to Subpart E of... - Exhibit G to Subpart E of Part 1980

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 14 2011-01-01 2011-01-01 false Exhibit G to Subpart E of Part 1980 G Exhibit G to Subpart E of Part 1980 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... Program Pt. 1980, Subpt. E, Exh. G Exhibit G to Subpart E of Part 1980 Note: The Exhibit is not published...

  13. Association between plasminogen activator inhibitor-1 -675 4G/5G polymorphism and sepsis: a meta-analysis.

    PubMed

    Li, Li; Nie, Wei; Zhou, Hongfeng; Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08-1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27-2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality.

  14. [HLA-G: fetomaternal tolerance].

    PubMed

    Carosella, E D

    2000-08-01

    HLA-G is a non-classical major histocompatibility complex class I molecule selectively expressed on cytotrophoblasts. We have demonstrated ex vivo (from voluntary pregnancy interruption samples) the protector role of the HLA-G molecule present on the surface of cytotrophoblast cells versus the lysis carried out by the decidual uterine NK cells. This occurs under semi-allogenic conditions (maternal uterine NK cells and their trophoblast counterparts), as well as in allogenic conditions (maternal uterine NK cells and trophoblast cells from different mothers), thus defining the absence of maternal rejection at the moment of the implantation of the fertilized egg during pregnancy. Moreover, the expression of HLA-G on the cytotrophoblasts permits migration in maternal circulation and infiltration of maternal tissue (particularly in the skin), thereby probably creating a general state of tolerance. In the context of heart transplantation, in preliminary studies, we show that the presence of HLA-G in cardiac biopsy tissue prelevated from grafted patients significantly reduces acute rejects and shows an absence of chronic rejects. In the tumour context, the expression of HLA-G protein at the surface of primitive melanoma and metastatic cells confers protection from NK and CTL lytic activity. This suggests that HLA-G expression may impede the elimination of malignant cells by anti-tumour immune effector cells, constituting a newly described mechanism by which tumour cells may evade immunosurveillance. From there on E.D. Carosella introduced the breakthrough concept of 'HLA a tolerance molecule' in the heart of histocompatibility antigens, which had been described up till then as antigenes of defence and rejection, and the dramatic role of HLA-G in immunotolerance.

  15. Penicillin G Benzathine Injection

    MedlinePlus

    ... to treat and prevent certain infections caused by bacteria. Penicillin G benzathine injection is in a class of antibiotics called penicillins. It works by killing bacteria that cause infections.Antibiotics such as penicillin G ...

  16. IgG4 plasma cell myeloma: new insights into the pathogenesis of IgG4-related disease.

    PubMed

    Geyer, Julia T; Niesvizky, Ruben; Jayabalan, David S; Mathew, Susan; Subramaniyam, Shivakumar; Geyer, Alexander I; Orazi, Attilio; Ely, Scott A

    2014-03-01

    IgG4-related disease is a newly described systemic fibroinflammatory process, characterized by increase in IgG4-positive plasma cells. Its pathogenesis, including the role of IgG4, remains poorly understood. Plasma cell myeloma is typically associated with a large monoclonal serum spike, which is frequently of IgG isotype. We sought to identify and characterize a subset of IgG4-secreting myeloma, as it may provide a biological model of disease with high serum levels of IgG4. Six out of 158 bone marrow biopsies (4%) from patients with IgG myeloma expressed IgG4. Four patients were men and two were women, with a mean age of 64 (range 53-87) years. Imaging showed fullness of pancreatic head (1), small non-metabolic lymphadenopathy (1), and bone lytic lesions (6). Two patients developed necrotizing fasciitis. All had elevated serum M-protein (mean 2.4, range 0.5-4.2 g/dl), and none had definite signs or symptoms of IgG4-related disease. Four myelomas had plasmablastic morphology. Four had kappa and two had lambda light chain expression. Three cases expressed CD56. Two patients had a complex karyotype. In conclusion, the frequency of IgG4 myeloma correlates with the normal distribution of IgG4 isoform. The patients with IgG4 myeloma appear to have a high rate of plasmablastic morphology and could be predisposed to necrotizing fasciitis. Despite high serum levels of IgG4, none had evidence of IgG4-related disease. These findings suggest that the increased number of IgG4-positive plasma cells is not the primary etiologic agent in IgG4-related disease. Elevated serum levels of IgG4 is not sufficient to produce the typical disease presentation and should not be considered diagnostic of IgG4-related disease.

  17. Plasminogen Activator Inhibitor-1 (PAI-1) gene 4G/5G alleles frequency distribution in the Lebanese population.

    PubMed

    Shammaa, Dina M R; Sabbagh, Amira S; Taher, Ali T; Zaatari, Ghazi S; Mahfouz, Rami A R

    2008-09-01

    Plasminogen activator inhibitor-1 (PAI-1) is an inhibitor of fibrinolysis. Increased plasma PAI-1 levels play an essential role in the pathogenesis of cardiovascular risk and other diseases associated with thrombosis. The 4G/5G polymorphism of the PAI-1 promoter region has been extensively studied in different populations. We studied 160 healthy unrelated Lebanese individuals using a reverse hybridization PCR assay to detect the 5G/5G, 4G/5G and, 4G/4G genotypes of the PAI-1 gene and the frequencies of the 4G and 5G alleles. We found that 4G/5G genotype was the most prevalent (45.6%) followed by 5G/5G (36.9%) and 4G/4G (17.5%). The frequencies of the 4G and 5G alleles were calculated to be 0.403 and 0.597, respectively. Compared to other ethnic communities, the Lebanese population was found to harbour a relatively high prevalence of the rare 4G allele. This, in turn, may predispose this population to develop cardiovascular diseases and other thrombotic clinical conditions. This study aids to enhance our understanding of the genetic features of the Lebanese population.

  18. 30 CFR 550.244 - What geological and geophysical (G&G) information must accompany the DPP or DOCD?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What geological and geophysical (G&G... Operations Coordination Documents (docd) § 550.244 What geological and geophysical (G&G) information must accompany the DPP or DOCD? The following G&G information must accompany your DPP or DOCD: (a) Geological...

  19. 30 CFR 550.244 - What geological and geophysical (G&G) information must accompany the DPP or DOCD?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What geological and geophysical (G&G... Operations Coordination Documents (docd) § 550.244 What geological and geophysical (G&G) information must accompany the DPP or DOCD? The following G&G information must accompany your DPP or DOCD: (a) Geological...

  20. 30 CFR 550.244 - What geological and geophysical (G&G) information must accompany the DPP or DOCD?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What geological and geophysical (G&G... Operations Coordination Documents (docd) § 550.244 What geological and geophysical (G&G) information must accompany the DPP or DOCD? The following G&G information must accompany your DPP or DOCD: (a) Geological...

  1. ZERO-G - Crippen, Robert L.

    NASA Image and Video Library

    1979-04-03

    Zero-gravity experiments in KC-135 conducted by John Young, Robert L. Crippen, Joseph Kerwin, and Margaret Seddon. 1. Kerwin, Joseph - Zero-G 2. Seddon, Margaret - Zero-G 3. Young, John - Zero-G 4. Aircraft - KC-135

  2. Resolution of G(s)alpha and G(q)alpha/G(11)alpha proteins in membrane domains by two-dimensional electrophoresis: the effect of long-term agonist stimulation.

    PubMed

    Matousek, P; Novotný, J; Svoboda, P

    2004-01-01

    Low-density membrane-domain fractions were prepared from S49 lymphoma cells and clone e2m11 of HEK293 cells expressing a large number of thyrotropin-releasing hormone receptor (TRH-R) and G(11)alpha by flotation on sucrose density gradients. The intact cell structure was broken by detergent-extraction, alkaline-treatment or drastic homogenization. Three types of low-density membranes were resolved by two-dimensional electrophoresis and analyzed for G(s)alpha (S49) or G(q)alpha/G11) (e2m11) content. Four individual immunoblot signals of Gsalpha protein were identified in S49 lymphoma cells indicating complete resolution of the long G(s)alpha L+/-ser and short G(s)alpha S+/-ser variants of G(s)alpha. All these were diminished by prolonged agonist (isoprenaline) stimulation. In e2m11-HEK cells, five different immunoblot signals were detected indicating post-translational modification of G proteins of G(q)alpha/G(11)alpha family. The two major spots corresponding to exogenously (over)expressed G(11)alpha and endogenous G(q)alpha were reduced; the minor spots diminished by hormonal stimulation. Parallel analysis by silver staining of the total protein content indicated that no major changes in protein composition occurred under these conditions. Our data thus indicate that agonist-stimulation of target cells results in down-regulation of all different members of G(s) and G(q)/G(11) families. This agonist-specific effect may be demonstrated in crude membrane as well as domain/raft preparations and it is not accompanied by changes in overall protein composition.

  3. Association between Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism and Sepsis: A Meta-Analysis

    PubMed Central

    Yuan, Weifeng; Li, Weifeng; Huang, Wenjie

    2013-01-01

    Background Several studies have evaluated the association between plasminogen activator inhibitor-1 (PAI-1) -675 4G/5G polymorphism and sepsis in different populations. However, the available results are conflicting. Methods A search of Pubmed and EMBASE databases was performed to identify relevant studies for inclusion in the meta-analysis. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were determined using a random-effects model. Results Twelve case-control studies and three cohort studies were included. Overall, a significant association between 4G/5G polymorphism and sepsis risk was observed for 4G/4G vs. 4G/5G +5G/5G (OR = 1.30, 95% CI 1.08–1.56, P = 0.006). In addition, there was a significant association between PAI-1 4G/5G polymorphism and sepsis-related mortality (OR = 1.72, 95% CI 1.27–2.33, P = 0.0005). In subgroup analyses, increased sepsis risk and mortality risk were found in Caucasians and in patients with sepsis. Conclusions This meta-analysis suggested that the PAI-1 -675 4G/5G polymorphism was a risk factor for sepsis and sepsis mortality. PMID:23382992

  4. Th1/Th2 cytokine profiles in G+/G- bacteremia in pediatric hematology/oncology patients.

    PubMed

    Tang, Yongmin; Liao, Chan; Xu, Xiaojun; Song, Hua; Shi, Shuwen; Yang, Shilong

    2012-01-01

    Early diagnosis of infection and appropriate choice of antibiotics are essential not only to improve the prognosis of the patients but also to prevent from the abuse of the antibiotics in hematology/oncology children at the time of neutropenia after intensive chemotherapy. We evaluated the quantification of Th1/Th2 cytokines with flow cytometry bead assay (CBA) in 145 hospitalized febrile hematology/oncology children with positive blood culture to seek for a rapid diagnostic method to determine the type of infection. IL-4, IL-6, IL-10, TNF-α, and IFN-γ levels from both G- and G+ bacteremia groups were significantly higher than those of controls (P < 0.001). The median levels of IL-6, IL-10, TNF-α of Group G- were 525.4, 96.0, and 6.9 pg/ml, respectively, significantly higher than those of Group G+ (150.0, 22.6, and 4.5 pg/ml, respectively, P < 0.001). According to the different degrees of increased IL-6 and IL-10 levels, we named the G- bacterial infection related cytokine profile G- BIRCP and the G+ BIRCP. The specificity and sensitivity of BIRCP prediction for G- and G+ bacteria cultures were 60.2% and 75.4%, 66.8% and 70.1%, respectively. Similar therapeutic efficacy was achieved between BIRCP-based and broad-spectrum antibiotics groups (86.1% vs. 89.3%, P > 0.05), which was significantly increased as compared with that (65.5%, P < 0.05) of empirical group. These results showed the promising use of the IL-6/IL-10/TNF-α determination with CBA technology for the early and rapid diagnosis, evaluation of G+/G- bacteremia in pediatric hematology/oncology patients. Copyright © 2011 Wiley Periodicals, Inc.

  5. Adaptive Antenna System for Both 4G LTE and 5G Cellular Systems

    NASA Astrophysics Data System (ADS)

    Henderson, Kendrick Q. T.

    Given the steep increase in the use of mobile communication systems, the current 4G/LTE (Long Term Evolution), cellular system will not be able to handle the increase in data. It is estimated that by 2020 the bandwidth requirements will be 10 times greater than what LTE can sustain. A new 5th generation (5G) communication system has been proposed to meet this demand. The physical layer or the antenna is the most critical part of any wireless communication systems as it is the interface between the free space medium and an electrical circuit. It sets the margin for almost all design parameters in the system such as the system noise and bandwidth. Several interactions of antennas have been proposed over the years for cellular services. These antennas are of various geometries, bandwidths, and radiation patterns with almost all having linear polarization. This thesis attempts to solve the multiple LTE antenna problem by creating a simple antenna that covers most of the LTE bands (850-2700 MHz) as well as introducing an antenna system at the 28 GHz 5G band. This allows for a greater educated hypothesis into what 5G can offer at the physical layer. The proposed concept will provide a solution to the co-existence problem of upcoming 5G wireless systems to be interoperable with existing 4G/LTE system.

  6. Hashimoto's thyroiditis with elevated serum IgG4 concentrations is not equivalent to IgG4 Hashimoto's thyroiditis.

    PubMed

    Yu, Yang; Yu, Nan; Lu, Guizhi; Li, Ting; Zhang, Yang; Zhang, Jing; Gao, Ying; Gao, Yanming; Guo, Xiaohui

    2018-06-01

    Hashimoto's thyroiditis (HT) with serum IgG4 concentrations greater than 135 mg/dL can be diagnosed as elevated serum IgG4 HT. HT can also be classified into IgG4 HT and non-IgG4 HT based on an immunohistochemistry analysis of IgG4. The aim of our study was to determine the relationship between elevated serum IgG4 HT and IgG4 HT. Both thyroid tissues and serum samples stored before pathological examination from 93 patients with HT were collected. The serum levels of IgG, IgG4, TgAb IgG, TgAb IgG4, TPOAb IgG and TPOAb IgG4 were measured by ELISAs. The expression levels of IgG4, IgG and TGF-β1 in thyroid tissues were detected by immunohistochemistry. Patients with HT were divided into two groups: elevated serum IgG4 HT (n = 12) and nonelevated serum IgG4 HT (n = 81). Hypothyroidism was found in 5 of 12 cases (41.7%) in the elevated serum IgG4 HT group and 10 of 81 cases (12.3%) in the nonelevated serum IgG4 HT group (P = .023). Serologically, there were no significant differences in the levels of TgAb IgG, TPOAb IgG, TgAb IgG4 and TPOAb IgG4 between the two groups, and the expression of TGF-β1 in thyroid tissues was not significantly different between the groups. Most importantly, the frequency of patients who satisfied the criteria for IgG4 HT diagnosis was comparable (25% vs 20.9%, P = .756). The measurement of serum IgG4 allows the identification of patients with HT closely associated with hypothyroidism. However, our study demonstrated that elevated serum IgG4 HT is not equivalent to IgG4 HT. © 2018 John Wiley & Sons Ltd.

  7. Immunoglobulin class switching to IgG4 in Warthin tumor and analysis of serum IgG4 levels and IgG4-positive plasma cells in the tumor.

    PubMed

    Aga, Mitsuharu; Kondo, Satoru; Yamada, Kazunori; Wakisaka, Naohiro; Yagi-Nakanishi, Sayaka; Tsuji, Akira; Endo, Kazuhira; Murono, Shigeyuki; Ito, Makoto; Muramatsu, Masamichi; Kawano, Mitsuhiro; Yoshizaki, Tomokazu

    2014-04-01

    We previously reported a case of immunoglobulin (Ig)G4-related immune inflammation in Warthin tumor. Increased serum IgG4 levels and tissue infiltration of IgG4-positive plasma cells are characteristics of IgG4-related disease (IgG4-RD), a newly emerging clinicopathological entity. However, the relationship between IgG4-RD and Warthin tumor remains to be elucidated. We aimed to investigate the involvement of systemic and local IgG4 production and class-switch recombination in Warthin tumor. We examined serum IgG4 levels and also analyzed the involvement of IgG4-positive plasma cells in Warthin tumors (18 cases) compared with those of pleomorphic adenomas (19 cases) as controls. Furthermore, in specimens of Warthin tumors (3 cases), pleomorphic adenomas (2 cases), and IgG4-RDs (2 cases), we examined messenger RNA expression of activation-induced cytidine deaminase, IgG4 germline transcripts and productive IgG4 by reverse transcription polymerase chain reaction. Serum IgG4 levels were increased in 5 of 18 Warthin tumors and not in any of the 19 pleomorphic adenomas. Infiltration of IgG4-positive plasma cells was detected in 4 Warthin tumors and none in the pleomorphic adenomas. Moreover, activation-induced cytidine deaminase, IgG4 germline transcripts, and productive IgG4 messenger RNA were found to be expressed in 2 of 3 Warthin tumors as well as IgG4-RDs by reverse transcription polymerase chain reaction, but not in pleomorphic adenomas. In conclusion, immunoglobulin class switching to IgG4 may be involved in the pathogenesis of Warthin tumor, and it is possible that certain inflammatory background with an immune reaction is involved in the pathogenesis of Warthin tumor. © 2013.

  8. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis.

    PubMed

    Xu, Xin; Xie, Yanqi; Lin, Yiwei; Xu, Xianglai; Zhu, Yi; Mao, Yeqing; Hu, Zhenghui; Wu, Jian; Chen, Hong; Zheng, Xiangyi; Qin, Jie; Xie, Liping

    2012-12-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07-1.47, P(heterogeneity)=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03-1.17, P(heterogeneity)=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01-1.35, P(heterogeneity)=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer.

  9. PAI-1 promoter 4G/5G polymorphism (rs1799768) contributes to tumor susceptibility: Evidence from meta-analysis

    PubMed Central

    XU, XIN; XIE, YANQI; LIN, YIWEI; XU, XIANGLAI; ZHU, YI; MAO, YEQING; HU, ZHENGHUI; WU, JIAN; CHEN, HONG; ZHENG, XIANGYI; QIN, JIE; XIE, LIPING

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1), belonging to the urokinase plasminogen activation (uPA) system, is involved in cancer development and progression. The PAI-1 promoter 4G/5G polymorphism was shown to contribute to genetic susceptibility to cancer, although the results were inconsistent. To assess this relationship more precisely, a meta-analysis was performed. The electronic databases PubMed, Scopus, Web of Science and Chinese National Knowledge Infrastructure (CNKI) were searched; data were extracted and analyzed independently by two reviewers. Ultimately, 21 eligible case-control studies with a total of 8,415 cancer cases and 9,208 controls were included. The overall odds ratio (OR) with its 95% confidence interval (CI) showed a statistically significant association between the PAI-1 promoter 4G/5G polymorphism and cancer risk (4G/4G vs. 5G/5G: OR=1.25, 95% CI=1.07–1.47, Pheterogeneity=0.001; 4G/4G vs. 4G/5G+5G/5G: OR=1.10, 95% CI=1.03–1.17, Pheterogeneity=0.194; 4G/4G+4G/5G vs. 5G/5G: OR=1.17, 95% CI=1.01–1.35, Pheterogeneity=0.041). In further subgroup analyses, the increased risk of cancer was observed in a subgroup of Caucasians with regards to endometrial cancer. Our meta-analysis suggests that the PAI-1 4G/5G polymorphism most likely contributes to susceptibility to cancer, particularly in Caucasians. Furthermore, the 4G allele may be associated with an increased risk of endometrial cancer. PMID:23226787

  10. 30 CFR 280.21 - What must I do in conducting G&G prospecting or scientific research?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... scientific research? 280.21 Section 280.21 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... prospecting or scientific research? While conducting G&G prospecting or scientific research activities under a... you are prospecting or conducting scientific research activities. (b) Consult and coordinate your G&G...

  11. The Roles of APOBEC3G Complexes in the Incorporation of APOBEC3G into HIV-1

    PubMed Central

    Zhang, Quan; Liu, Zhenlong; Jia, Pingping; Zhou, Jinming; Guo, Fei; You, Xuefu; Yu, Liyan; Zhao, Lixun; Jiang, Jiandong; Cen, Shan

    2013-01-01

    Background The incorporation of human APOBEC3G (hA3G) into HIV is required for exerting its antiviral activity, therefore the mechanism underlying hA3G virion encapsidation has been investigated extensively. hA3G was shown to form low-molecular-mass (LMM) and high-molecular-mass (HMM) complexes. The function of different forms of hA3G in its viral incorporation remains unclear. Methodology/Principal Findings In this study, we investigated the subcellular distribution and lipid raft association of hA3G using subcellular fractionation, membrane floatation assay and pulse-chase radiolabeling experiments respectively, and studied the correlation between the ability of hA3G to form the different complex and its viral incorporation. Our work herein provides evidence that the majority of newly-synthesized hA3G interacts with membrane lipid raft domains to form Lipid raft-associated hA3G (RA hA3G), which serve as the precursor of mature HMM hA3G complex, while a minority of newly-synthesized hA3G remains in the cytoplasm as a soluble LMM form. The distribution of hA3G among the soluble LMM form, the RA LMM form and the mature forms of HMM is regulated by a mechanism involving the N-terminal part of the linker region and the C-terminus of hA3G. Mutagenesis studies reveal a direct correlation between the ability of hA3G to form the RA LMM complex and its viral incorporation. Conclusions/Significance Together these data suggest that the Lipid raft-associated LMM A3G complex functions as the cellular source of viral hA3G. PMID:24098356

  12. Prognostic value of the PAI-1 4G/5G polymorphism in invasive ductal carcinoma of the breast.

    PubMed

    Yagmurdur, M C; Atac, F B; Tutar, N U; Verdi, H; Isiklar, I; Ozdemir, B H; Ozbek, N; Karakayali, H; Haberal, M

    2008-01-01

    The study group was derived from the archive materials of 55 invasive ductal breast cancer (IDC) patients who had undergone breast-preserving surgery (partial mastectomy/ axillary dissection). All patients included in the study had clinically T(1)-2, N0-M0 invasive ductal carcinoma. Genomic DNA species were extracted from paraffin-embedded blocks, and plasminogen activator inhibitor type-1 (PAI-1) gene 4G/5G genotyping was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). Patient demographics, axillary metastasis status, metastatic lymph nodi/total dissected lymph nodes from axilla, histopathologic characteristics of tumors, local recurrences, and survival ratio were assessed. PAI-1 4G/5G genotype frequencies were 4G/4G (64%), 4G/5G (31%), and 5G/5G (5%) in the patient group. According to the results based on frequencies, the demographics were not different. Five-year local recurrence rate of 4G/5G patients was the lowest (2/17, 12%) (P = 0.02). Also five-year distant metastases ratio of 4G/5G patients was the highest (18%) (P = 0.01). Five- and 10-year disease-free survival rates for the 4G/4G, 4G/5G, and 5G/5G groups were 97% and 94%, 82% and 77%, and 100% and 94%, respectively (P = 0.004). The results of this study indicate that the 4G allele in the PAI 1 gene had a negative impact on local recurrence and disease-free survival of patients with clinical T(1)-2N0M0 IDC.

  13. The association between PAI-1 -675 4G/5G polymorphism and type 2 diabetes mellitus.

    PubMed

    Chen, L; Li, S-Y; Liu, M

    2017-08-15

    In this study, we aimed to analyze the association between plasminogen activator inhibitor 1 (PAI-1) -675 4G/5G polymorphism and type 2 diabetes mellitus (T2DM) risk. We included in 187 T2DM patients and 186 heathy controls between 2014 and 2017 from Tianjin Gong An Hospital, China. All patients and controls were ethnically Chinese Han population. The primers and polymerase chain reaction (PCR) conditions were performed. Results from this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in four genetic models. Additionally, PAI-1 -675 4G/5G polymorphism was not associated with clinical and laboratory characteristics, such as age, gender, body mass index, systolic blood pressure, diastolic blood pressure, total cholesterol, triglycerides, and HbA1c. In conclusion, this case-control study suggested that PAI-1 -675 4G/5G polymorphism was not associated with T2DM risk in this population.

  14. The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

    PubMed

    Bondar, Alexey; Lazar, Josef

    2017-06-09

    The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Association between PAI-1 4G/5G polymorphism and diabetic nephropathy: a meta-analysis in the Chinese population.

    PubMed

    Gao, Wen-Feng; Guo, Ying-Bo; Bai, Yu; Ding, Xin-Yu; Yan, Yong-Ji; Wu, Zhen-Qi

    2016-09-01

    Although a number of studies have been conducted on the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and diabetic nephropathy (DN) in Chinese population, this association remains elusive and controversial. To further assess the effects of PAI-1 4G/5G polymorphism on the risk of DN, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure, and Chinese Biology Medicine through November, 2015. Pooled odds ratios (ORs) and 95 % confidence intervals (CIs) were used to assess the strength of the associations. This meta-analysis identified nine studies, including 777 DN cases, 413 healthy controls, and 523 DM controls. In the total analyses, a significantly elevated risk of DN was associated with variants of PAI-1 4G/5G when compared with the healthy group (4G vs. 5G, OR 2.46, 95 % CI 1.45-4.16; 4G/4G vs. 5G/5G, OR 4.32, 95 % CI 1.79-10.39; 4G/4G vs. 4G/5G +5G/5G, OR 2.96, 95 % CI 1.59-5.53; 4G/4G +4G/5G vs. 5G/5G, OR 2.78, 95 % CI 1.34-5.75) and DM group (4G vs. 5G, OR 1.93, 95 % CI 1.28-2.92; 4G/4G vs. 5G/5G, OR 2.99, 95 % CI 1.44-6.21; 4G/4G vs. 4G/5G +5G/5G, OR 2.84, 95 % CI 1.77-4.54). In the subgroup analyses stratified by ethnicity and geographic areas, it revealed the significant results in Chinese Han, in North and South China. This meta-analysis showed that the PAI-1 4G/4G variant, 4G allele might be risk alleles for DN susceptibility in the Chinese population, and further studies in other ethic groups are required for definite conclusions.

  16. 30 CFR 280.21 - What must I do in conducting G&G prospecting or scientific research?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... scientific research? 280.21 Section 280.21 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION... What must I do in conducting G&G prospecting or scientific research? While conducting G&G prospecting or scientific research activities under a permit or notice, you must: (a) Immediately report to the...

  17. G-quadruplexes as sensing probes.

    PubMed

    Ruttkay-Nedecky, Branislav; Kudr, Jiri; Nejdl, Lukas; Maskova, Darina; Kizek, Rene; Adam, Vojtech

    2013-11-28

    Guanine-rich sequences of DNA are able to create tetrastranded structures known as G-quadruplexes; they are formed by the stacking of planar G-quartets composed of four guanines paired by Hoogsteen hydrogen bonding. G-quadruplexes act as ligands for metal ions and aptamers for various molecules. Interestingly, the G-quadruplexes form a complex with anionic porphyrin hemin and exhibit peroxidase-like activity. This review focuses on overview of sensing techniques based on G-quadruplex complexes with anionic porphyrins for detection of various analytes, including metal ions such as K+, Ca2+, Ag+, Hg2+, Cu2+, Pb2+, Sr2+, organic molecules, nucleic acids, and proteins. Principles of G-quadruplex-based detection methods involve DNA conformational change caused by the presence of analyte which leads to a decrease or an increase in peroxidase activity, fluorescence, or electrochemical signal of the used probe. The advantages of various detection techniques are also discussed.

  18. Plasminogen activator inhibitor-1 5G/5G genotype is a protecting factor preventing posttransplant diabetes mellitus.

    PubMed

    Chang, Horng-Rong; Yang, Shun-Fa; Tsai, Jen-Pi; Hsieh, Ming-Chia; Wu, Sheng-Wen; Tsai, Hui-Ching; Hung, Tung-Wei; Huang, Jun-Huang; Lian, Jong-Da

    2011-01-30

    Plasminogen activator inhibitor 1 (PAI-1) is thought to play a role in the pathogenesis of obesity and insulin resistance. A connection between gestational diabetes mellitus and the functional -675 PAI-1 genotype has been reported. Therefore, we examined the role of the PAI-1 gene polymorphism in kidney transplant recipients. A total of 376 kidney transplant recipients were prospectively screened for posttransplant diabetes mellitus (PTDM). Eighty-one (21.5%) patients were diagnosed with PTDM and the other 295 patients were non-diabetic following kidney transplantation. DNA samples were isolated from the sera and analyzed for the functional -675 4G/5G promoter polymorphisms of the PAI-1 gene. Kidney transplant recipients with PTDM were significantly associated with tacrolimus use (p=0.03), older age (p=0.036), and higher body mass index (p=0.001). The genotype distribution was significantly different between the patients with PTDM (genotype 4G/4G:4G/5G:5G/5G=33.3%:60.5%:6.2%) and those without PTDM (genotype 4G/4G:4G/5G:5G/5G=36.9%:44.1%:19.0%) (p=0.018). Patients with homozygosity for 5G had a significantly lower rate of PTDM (aOR, 0.286, p=0.022) and higher cumulative event-free probability of time to PTDM (log rank test, p=0.0058). Homozygosity for the 5G allele of the PAI-1 gene constitutes a protecting factor for the development of PTDM. Our findings are similar to a previous study on gestational diabetes mellitus, and strongly support a possible genetic role of PAI-1 in the development of PTDM. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Can Stable Isotope combined with Trace Element Analysis distinguish between pure and g.g.A. (protected geographical indication, P.G.I.) certified Pumpkin Seed Oils?

    NASA Astrophysics Data System (ADS)

    Meier-Augenstein, Wolfram; Kemp, Helen; Midwood, Andy

    2013-04-01

    Styrian Pumpkin Seed Oil is a premium single seed vegetable oil that is uniquely linked to the geographic region of Styria where it is grown and produced. In 1996, the strong regional ties of this typical Styrian speciality were recognised by the EU-Commission who declared "Styrian Pumpkin Seed Oil P.G.I." as a Protected Geographical Indication (article 5 VO(EWG) Nr. 2081/92). In 1998, more than 2,000 domestic pumpkin seed producers and 30 oil mills formed an association of Styrian pumpkin seed oil producers, which is now called the "Gemeinschaft Steirisches Kürbiskernöl g.g.A.". This producers' association was formed in order to protect the regionality and the high quality of Styrian Pumpkin Seed Oil P.G.I. Procedures implemented by this producers' association document every step in the process from pumpkin seeds to seed crushing in oil mills and finally bottling of Styrian Pumpkin Seed Oil P.G.I., keeping a contiguous record of all production steps including annual harvest amounts. This permits full traceability of every bottle of Styrian Pumpkin Seed Oil P.G.I from harvest to the finished, bottled products found on the shelf of delis and even supermarkets. Despite these efforts of the producers' association, there have been repeated claims of g.g.A. (P.G.I.) certified bottles of Styrian Pumpkin Seed Oil (PSO) having been analysed independently and shown to contain either mixtures of Styrian and non-Styrian PSO or no Styrian PSO at all. Since keeping records of annual harvest amounts of pumpkin seeds would make it very difficult for an "over-production" by mixing or substitution of alien PSO's to go unnoticed, we formed the hypothesis that the red-flagged bottles could have been counterfeits containing alien PSO with bottles sporting fake g.g.A. seals and fake serial numbers. An alternative hypothesis was that the chosen method of detection of allegedly misrepresented g.g.A. Styrian PSO resulted in a high number of false negatives thus incorrectly rejecting

  20. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  1. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  2. 75 FR 54017 - New Animal Drugs; Change of Sponsor; Penicillin G Benzathine and Penicillin G Procaine Suspension...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-03

    ... [Docket No. FDA-2010-N-0002] New Animal Drugs; Change of Sponsor; Penicillin G Benzathine and Penicillin G Procaine Suspension; Penicillin G Procaine Aqueous Suspension AGENCY: Food and Drug Administration, HHS..., NADA 65-493 for Penicillin G Procaine Aqueous Suspension and NADA 65-500 for Penicillin G Benzathine...

  3. An introduction to g methods.

    PubMed

    Naimi, Ashley I; Cole, Stephen R; Kennedy, Edward H

    2017-04-01

    Robins' generalized methods (g methods) provide consistent estimates of contrasts (e.g. differences, ratios) of potential outcomes under a less restrictive set of identification conditions than do standard regression methods (e.g. linear, logistic, Cox regression). Uptake of g methods by epidemiologists has been hampered by limitations in understanding both conceptual and technical details. We present a simple worked example that illustrates basic concepts, while minimizing technical complications. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association.

  4. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  5. 51g-s-219

    NASA Image and Video Library

    2011-04-25

    51G-S-219 (June 1985) --- Public Affairs Office (PAO) commentator Janet K. Ross is pictured at her console in the Mission Operations Control Room (MOCR) in the Mission Control Center at NASA's Johnson Space Center during the STS-51G mission. Photo credit: NASA

  6. 51g-s-213

    NASA Image and Video Library

    2011-04-25

    51G-S-213 (June 1985) --- Public Affairs Office (PAO) commentator Janet K. Ross is pictured at her console in the Mission Operations Control Room (MOCR) in the Mission Control Center at NASA's Johnson Space Center during the STS-51G mission. Photo credit: NASA

  7. 41g-120-175

    NASA Image and Video Library

    2009-06-25

    41G-120-175 (5-13 Oct. 1984) --- Egypt and the Nile River Delta are easily recognizable in this 250mm frame photographed by one of the seven 41-G crew members aboard the Earth-orbiting space shuttle Challenger. Cairo and the Egyptian pyramids are also visible in the lower left side of this photograph. The 41-G crew consisted of astronauts Robert L. Crippen, commander, Jon A. McBride, pilot; Mission Specialists Kathryn D. Sullivan, Sally K. Ride, and David D. Leestma; along with Canadian astronaut Marc Garneau; and Paul D. Scully-Power, both payload specialists. Photo credit: NASA

  8. g-LIMIT Status Briefing

    NASA Technical Reports Server (NTRS)

    Whorton, Mark; Perkins, Brad T.

    2000-01-01

    For many microgravity science experiments in the International Space Station, the ambient acceleration environment will be exceed desirable levels. To provide a more quiescent acceleration environment to the microgravity payloads, a vibration isolation system named g-LIMIT (GLovebox Integrated Microgravity Isolation Technology) is being designed. g-LIMIT is a sub-rack level isolation system that can be tailored to a variety of applications. Scheduled for launch on the UF-1 mission, the initial implementation of g-LIMIT will be a Characterization Test in the Microgravity Science Glovebox (MSG). g-LIMIT will be available to glovebox investigators immediately after characterization testing. Standard MSG structural and umbilical interfaces will be used so that the isolation mount is transparent to the user with no additional accommodation requirements. g-LIMIT consists of three integrated isolator modules, each of which is comprised of a dual axis actuator, two axes of acceleration sensing, two axes of position sensing, control electronics, and data transmission capabilities in a minimum-volume package. In addition, this system provides the unique capability for measuring absolute acceleration of the experiment independent of accelerometers as a by-product of the control system and will have the capability of generating pristine accelerations to enhance experiment operations.

  9. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis.

    PubMed

    Zhang, Tengyue; Pang, Chong; Li, Ningdong; Zhou, Elaine; Zhao, Kanxing

    2013-01-02

    Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10 years) indicated a gene

  10. Plasminogen activator inhibitor-1 4G/5G polymorphism and retinopathy risk in type 2 diabetes: a meta-analysis

    PubMed Central

    2013-01-01

    Background Mounting evidence has suggested that plasminogen activator inhibitor-1 (PAI-1) is a candidate for increased risk of diabetic retinopathy. Studies have reported that insertion/deletion polymorphism in the PAI-1 gene may influence the risk of this disease. To comprehensively address this issue, we performed a meta-analysis to evaluate the association of PAI-1 4G/5G polymorphism with diabetic retinopathy in type 2 diabetes. Methods Data were retrieved in a systematic manner and analyzed using Review Manager and STATA Statistical Software. Crude odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of associations. Results Nine studies with 1, 217 cases and 1, 459 controls were included. Allelic and genotypic comparisons between cases and controls were evaluated. Overall analysis suggests a marginal association of the 4G/5G polymorphism with diabetic retinopathy (for 4G versus 5G: OR 1.13, 95%CI 1.01 to 1.26; for 4G/4G versus 5G/5G: OR 1.30, 95%CI 1.04 to 1.64; for 4G/4G versus 5G/5G + 4G/5G: OR 1.26, 95%CI 1.05 to 1.52). In subgroup analysis by ethnicity, we found an association among the Caucasian population (for 4G versus 5G: OR 1.14, 95% CI 1.00 to 1.30; for 4G/4G versus 5G/5G: OR 1.33, 95%CI 1.02 to 1.74; for 4G/4G versus 5G/5G + 4G/5G: OR 1.41, 95%CI 1.13 to 1.77). When stratified by the average duration of diabetes, patients with diabetes histories longer than 10 years have an elevated susceptibility to diabetic retinopathy than those with shorter histories (for 4G/4G versus 5G/5G: OR 1.47, 95%CI 1.08 to 2.00). We also detected a higher risk in hospital-based studies (for 4G/4G versus 5G/5G+4G/5G: OR 1.27, 95%CI 1.02 to 1.57). Conclusions The present meta-analysis suggested that 4G/5G polymorphism in the PAI-1 gene potentially increased the risk of diabetic retinopathy in type 2 diabetes and showed a discrepancy in different ethnicities. A higher susceptibility in patients with longer duration of diabetes (more than 10

  11. A quantitative ELISA procedure for the measurement of membrane-bound platelet-associated IgG (PAIgG).

    PubMed

    Lynch, D M; Lynch, J M; Howe, S E

    1985-03-01

    A quantitative ELISA assay for the measurement of in vivo bound platelet-associated IgG (PAIgG) using intact patient platelets is presented. The assay requires quantitation and standardization of the number of platelets bound to microtiter plate wells and an absorbance curve using quantitated IgG standards. Platelet-bound IgG was measured using an F(ab')2 peroxidase labeled anti-human IgG and o-phenylenediamine dihydrochloride (OPD) as the substrate. Using this assay, PAIgG for normal individuals was 2.8 +/- 1.6 fg/platelet (mean +/- 1 SD; n = 30). Increased levels were found in 28 of 30 patients with clinical autoimmune thrombocytopenia (ATP) with a range of 7.0-80 fg/platelet. Normal PAIgG levels were found in 26 of 30 patients with nonimmune thrombocytopenia. In the sample population studied, the PAIgG assay showed a sensitivity of 93%, specificity of 90%, a positive predictive value of 0.90, and a negative predictive value of 0.93. The procedure is highly reproducible (CV = 6.8%) and useful in evaluating patients with suspected immune mediated thrombocytopenia.

  12. Epitope-Specific Suppression of IgG Responses by Passively Administered Specific IgG: Evidence of Epitope Masking.

    PubMed

    Bergström, Joakim J E; Xu, Hui; Heyman, Birgitta

    2017-01-01

    Specific IgG, passively administered together with particulate antigen, can completely prevent induction of antibody responses to this antigen. The ability of IgG to suppress antibody responses to sheep red blood cells (SRBCs) is intact in mice lacking FcγRs, complement factor 1q, C3, or complement receptors 1 and 2, suggesting that Fc-dependent effector functions are not involved. Two of the most widely discussed explanations for the suppressive effect are increased clearance of IgG-antigen complexes and/or that IgG "hides" the antigen from recognition by specific B cells, so-called epitope masking. The majority of data on how IgG induces suppression was obtained through studies of the effects on IgM-secreting single spleen cells during the first week after immunization. Here, we show that IgG also suppresses antigen-specific extrafollicular antibody-secreting cells, germinal center B-cells, long-lived plasma cells, long-term IgG responses, and induction of memory antibody responses. IgG anti-SRBC reduced the amount of SRBC in the spleens of wild-type, but not of FcγR-deficient mice. However, no correlation between suppression and the amount of SRBC in the spleen was observed, suggesting that increased clearance does not explain IgG-mediated suppression. Instead, we found compelling evidence for epitope masking because IgG anti-NP administered with NP-SRBC suppressed the IgG anti-NP, but not the IgG anti-SRBC response. Vice versa, IgG anti-SRBC administered with NP-SRBC, suppressed only the IgG anti-SRBC response. In conclusion, passively transferred IgG suppressed all measured parameters of an antigen-specific antibody/B cell response and an important mechanism of action is likely to be epitope masking.

  13. Restraint hypothermia in cold-exposed rats at 3 G and 1 G

    NASA Technical Reports Server (NTRS)

    Monson, C. B.; Horowitz, J. M.; Horwitz, B. A.

    1982-01-01

    The relationship between heat loss, heat production, and hypothermia was investigated in experiments with rats which determined if hypergravity affects heat production by altering oxygen consumption and if restraint modifies the ability of the rats to activate thermogenic mechanisms after cold exposure in a hypergravic field. Restrained and unrestrained rats were exposed for 1 hr periods to 1 G and 3 G at ambient temperatures of 24 C or 10 C, and the rate of oxygen consumption, the core temperatures, and the tail temperatures were measured. Results show that thermoregulatory mechanisms are impaired when rats are exposed to 3 G fields, and at 24 C as well as at 10 C this impairment leads to an inappropriate increase in heat loss.

  14. Natural convection in low-g environments

    NASA Technical Reports Server (NTRS)

    Grodzka, P. G.; Bannister, T. C.

    1974-01-01

    The present state of knowledge in the area of low-g natural convection is reviewed, taking into account a number of experiments conducted during the Apollo 14, 16, and 17 space flights. Convections due to steady low-g accelerations are considered. Steady g-levels result from spacecraft rotation, gravity gradients, solar wind, and solar pressure. Varying g-levels are produced by engine burns, attitude control maneuvers, and onboard vibrations from machinery or astronaut movement. Thermoacoustic convection in a low-g environment is discussed together with g-jitter convection, surface tension-driven convection, electrohydrodynamics under low-g conditions, phase change convection, and approaches for the control and the utilization of convection in space.

  15. PAI-1 4G/5G polymorphism and plasma levels association in patients with coronary artery disease.

    PubMed

    Lima, Luciana Moreira; Carvalho, Maria das Graças; Fonseca Neto, Cirilo Pereira; Garcia, José Carlos Faria; Sousa, Marinez Oliveira

    2011-12-01

    Type-1 plasminogen activator inhibitor (PAI-1) 4G/5G polymorphism may influence the PAI-1 expression. High plasma levels of PAI-1 are associated with coronary artery disease (CAD). This study investigated the influence of PAI-1 4G/5G polymorphism on plasma PAI-1 levels and its association with CAD assessed by coronary angiography. Blood sample of 35 individuals with angiographically normal coronary arteries, 31 individuals presenting mild/moderate atheromatosis, 57 individuals presenting severe atheromatosis and 38 healthy individuals (controls) were evaluated. In patients and controls, the PAI-1 4G/5G polymorphism was determined by PCR amplification using allele-specific primers. Plasma PAI-1 levels were quantified by ELISA assay (American Diagnostica). No difference was found between groups regarding age, gender and body mass index. Plasma PAI-1 levels and 4G/4G genotype frequency were significantly higher in the severe atheromatosis group compared to the other groups (p<0.001). Furthermore, patients with 4G/4G genotype (r=0.28, p<0.001) had significantly higher plasma PAI-1 levels than those with 5G/5G genotype (r=0.02, p=0.4511). In addition, in a multiple logistic regression model, adjusted for all the other variables, PAI-1 was observed to be independently associated with CAD > 70% (p<0.001). The most important finding of this study was the association between 4G/4G genotype, high plasma PAI-1 levels and coronary stenosis higher than 70% in Brazilian individuals. Whether high plasma PAI-1 levels are a decisive factor for atherosclerosis worsening or it is a consequence remains to be established.

  16. Hemolytic Potential of Tafenoquine in Female Volunteers Heterozygous for Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency (G6PD Mahidol Variant) versus G6PD-Normal Volunteers.

    PubMed

    Rueangweerayut, Ronnatrai; Bancone, Germana; Harrell, Emma J; Beelen, Andrew P; Kongpatanakul, Supornchai; Möhrle, Jörg J; Rousell, Vicki; Mohamed, Khadeeja; Qureshi, Ammar; Narayan, Sushma; Yubon, Nushara; Miller, Ann; Nosten, François H; Luzzatto, Lucio; Duparc, Stephan; Kleim, Jörg-Peter; Green, Justin A

    2017-09-01

    Tafenoquine is an 8-aminoquinoline under investigation for the prevention of relapse in Plasmodium vivax malaria. This open-label, dose-escalation study assessed quantitatively the hemolytic risk with tafenoquine in female healthy volunteers heterozygous for the Mahidol 487A glucose-6-phosphate dehydrogenase (G6PD)-deficient variant versus G6PD-normal females, and with reference to primaquine. Six G6PD-heterozygous subjects (G6PD enzyme activity 40-60% of normal) and six G6PD-normal subjects per treatment group received single-dose tafenoquine (100, 200, or 300 mg) or primaquine (15 mg × 14 days). All participants had pretreatment hemoglobin levels ≥ 12.0 g/dL. Tafenoquine dose escalation stopped when hemoglobin decreased by ≥ 2.5 g/dL (or hematocrit decline ≥ 7.5%) versus pretreatment values in ≥ 3/6 subjects. A dose-response was evident in G6PD-heterozygous subjects ( N = 15) receiving tafenoquine for the maximum decrease in hemoglobin versus pretreatment values. Hemoglobin declines were similar for tafenoquine 300 mg (-2.65 to -2.95 g/dL [ N = 3]) and primaquine (-1.25 to -3.0 g/dL [ N = 5]). Two further cohorts of G6PD-heterozygous subjects with G6PD enzyme levels 61-80% ( N = 2) and > 80% ( N = 5) of the site median normal received tafenoquine 200 mg; hemolysis was less pronounced at higher G6PD enzyme activities. Tafenoquine hemolytic potential was dose dependent, and hemolysis was greater in G6PD-heterozygous females with lower G6PD enzyme activity levels. Single-dose tafenoquine 300 mg did not appear to increase the severity of hemolysis versus primaquine 15 mg × 14 days.

  17. Hemolytic Potential of Tafenoquine in Female Volunteers Heterozygous for Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency (G6PD Mahidol Variant) versus G6PD-Normal Volunteers

    PubMed Central

    Rueangweerayut, Ronnatrai; Bancone, Germana; Harrell, Emma J.; Beelen, Andrew P.; Kongpatanakul, Supornchai; Möhrle, Jörg J.; Rousell, Vicki; Mohamed, Khadeeja; Qureshi, Ammar; Narayan, Sushma; Yubon, Nushara; Miller, Ann; Nosten, François H.; Luzzatto, Lucio; Duparc, Stephan; Kleim, Jörg-Peter; Green, Justin A.

    2017-01-01

    Abstract. Tafenoquine is an 8-aminoquinoline under investigation for the prevention of relapse in Plasmodium vivax malaria. This open-label, dose-escalation study assessed quantitatively the hemolytic risk with tafenoquine in female healthy volunteers heterozygous for the Mahidol487A glucose-6-phosphate dehydrogenase (G6PD)-deficient variant versus G6PD-normal females, and with reference to primaquine. Six G6PD-heterozygous subjects (G6PD enzyme activity 40–60% of normal) and six G6PD-normal subjects per treatment group received single-dose tafenoquine (100, 200, or 300 mg) or primaquine (15 mg × 14 days). All participants had pretreatment hemoglobin levels ≥ 12.0 g/dL. Tafenoquine dose escalation stopped when hemoglobin decreased by ≥ 2.5 g/dL (or hematocrit decline ≥ 7.5%) versus pretreatment values in ≥ 3/6 subjects. A dose–response was evident in G6PD-heterozygous subjects (N = 15) receiving tafenoquine for the maximum decrease in hemoglobin versus pretreatment values. Hemoglobin declines were similar for tafenoquine 300 mg (−2.65 to −2.95 g/dL [N = 3]) and primaquine (−1.25 to −3.0 g/dL [N = 5]). Two further cohorts of G6PD-heterozygous subjects with G6PD enzyme levels 61–80% (N = 2) and > 80% (N = 5) of the site median normal received tafenoquine 200 mg; hemolysis was less pronounced at higher G6PD enzyme activities. Tafenoquine hemolytic potential was dose dependent, and hemolysis was greater in G6PD-heterozygous females with lower G6PD enzyme activity levels. Single-dose tafenoquine 300 mg did not appear to increase the severity of hemolysis versus primaquine 15 mg × 14 days. PMID:28749773

  18. Interview: G. Kip Bollinger

    ERIC Educational Resources Information Center

    Aronin, Miriam; McDuffie, Thomas E., Jr.

    2009-01-01

    This article presents an interview with G. Kip Bollinger. G. Kip Bollinger currently works as a consultant for Intermediate Units, school districts, professional science societies, and science text and kit producers. He performs curriculum alignment, does assessment training, coaches science teachers, trains teachers in the use of specific…

  19. Immunocytochemical localization of the ovine immunoglobulins IgA, IgG1, IgG1A and IgG2: effect of gastro-intestinal parasitism in the sheep

    PubMed Central

    Curtain, C. C.; Anderson, N.

    1971-01-01

    A study has been made of the immunocytochemical localization of IgG1, IgG2, IgG1A and IgA in the alimentary tract and associated lymph nodes of parasitized and parasite-free sheep. No immunoglobulin-containing cells were found in the abomasal mucosa of the parasite-free sheep. On the other hand, large numbers of IgG1 and IgG1A-containing cells were found in the lamina propria and at the base of the villi of the abomasum of the parasitized sheep. IgG1, IgG1A, and IgA-containing cells were found in mucosal sections from the jejunum and ileum of both parasitized and parasite-free sheep, the number of IgG1A-containing cells being sifnificantly greater in the former than in the latter. This increase was considered to be of some importance since the IgG1A subclass appears to be involved in the allergic response of the sheep to intestinal parasites. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6FIG. 7 PMID:4924939

  20. The plasminogen activator inhibitor-1 (PAI-1) gene -844 A/G and -675 4G/5G promoter polymorphism significantly influences plasma PAI-1 levels in women with polycystic ovary syndrome.

    PubMed

    Lin, Sun; Huiya, Zhang; Bo, Liu; Wei, Wei; Yongmei, Guan

    2009-12-01

    Mutations in the plasminogen activator inhibitor-1 (PAI-1) gene, along with increased PAI-1 levels, have been implicated in the pathogenesis of polycystic ovarian syndrome (PCOS). We investigated a possible influence of the promoter polymorphism (-844 A/G and -675 4G/5G) in the PAI-1 gene on plasma PAI-1 levels in 126 PCOS patients and 97 healthy controls. Levels of total testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), fasting plasma glucose (FPG), fasting insulin, and PAI-1 were measured, and body mass index (BMI), waist-to-hip ratio (WHR), LH/FSH ratio, and homeostasis model assessment for insulin resistance (HOMA-IR) were calculated. PAI-1 -675 4G/5G and -844 A/G gene polymorphisms were also performed. Total testosterone, fasting insulin, and PAI-1 levels; BMI, LH/FSH, and HOMA-IR were significantly higher in PCOS patients than controls (P < 0.05). The odds ratio of 4G/4G genotype, 4G allele, and the combination genotype of 4G/4G and -844 A/A were 2.49 (95% confidence interval (CI), 1.4-4.44), 2.1 (95% CI, 1.43-3.08), and 2.9 (95% CI, 1.41-5.98), respectively, (P < 0.001). In the PCOS group, the PAI-1 level of the A/A was significantly higher than that of the A/G or G/G genotype, similarly was 4G/4G genotype compared with 4G/5G or 5G/5G genotype. The plasma PAI-1 levels of the combination of the PAI-1 -844 A/A and -675 4G/4G or 4G/5G genotypes, or the coadunation of 4G/4G and -844 non-G/G (A/A + A/G) genotypes were significantly high in PCOS women compared with controls. A trend to a positive interaction between PAI-1 -675 4G/5G and -844 A/G gene polymorphism may elevate plasma PAI-1 levels and hypofibrinolysis, which is probably an important hereditary risk factor in PCOS.

  1. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Selective cytotoxicity of PAMAM G5 core–PAMAM G2.5 shell tecto-dendrimers on melanoma cells

    PubMed Central

    Schilrreff, Priscila; Mundiña-Weilenmann, Cecilia; Romero, Eder Lilia; Morilla, Maria Jose

    2012-01-01

    Background The controlled introduction of covalent linkages between dendrimer building blocks leads to polymers of higher architectural order known as tecto-dendrimers. Because of the few simple steps involved in their synthesis, tecto-dendrimers could expand the portfolio of structures beyond commercial dendrimers, due to the absence of synthetic drawbacks (large number of reaction steps, excessive monomer loading, and lengthy chromatographic separations) and structural constraints of high-generation dendrimers (reduction of good monodispersity and ideal dendritic construction due to de Gennes dense-packing phenomenon). However, the biomedical uses of tecto-dendrimers remain unexplored. In this work, after synthesizing saturated shell core–shell tecto-dendrimers using amine-terminated polyamidoamine (PAMAM) generation 5 (G5) as core and carboxyl-terminated PAMAM G2.5 as shell (G5G2.5 tecto-dendrimers), we surveyed for the first time the main features of their interaction with epithelial cells. Methods Structural characterization of G5G2.5 was performed by polyacrylamide gel electrophoresis, matrix-assisted laser desorption time-of-flight mass spectrometry, and microscopic techniques; their hydrodynamic size and Z-potential was also determined. Cellular uptake by human epidermal keratinocytes, colon adenocarcinoma, and epidermal melanoma (SK-Mel-28) cells was determined by flow cytometry. Cytotoxicity was determined by mitochondrial activity, lactate dehydrogenase release, glutathione depletion, and apoptosis/necrosis measurement. Results The resultant 60%–67% saturated shell, 87,000-dalton G5G2.5 (mean molecular weight) interacted with cells in a significantly different fashion in comparison to their building blocks and to its closest counterpart, PAMAM G6.5. After being actively taken up by epithelial cells, G5G2.5 caused cytotoxicity only on SK-Mel-28 cells, including depletion of intracellular glutathione and fast necrosis that was manifested above 5 μM G5

  3. Diagnosis of Helicobacter pylori infection by using pyloriset EIA-G and EIA-A for detection of serum immunoglobulin G (IgG) and IgA antibodies.

    PubMed Central

    Granberg, C; Mansikka, A; Lehtonen, O P; Kujari, H; Grönfors, R; Nurmi, H; Räihä, I; Ståhlberg, M R; Leino, R

    1993-01-01

    We evaluated the performance of new enzyme immunoassay (EIA) kits (Pyloriset; Orion Corporation, Orion Diagnostica, Espoo, Finland) for the detection of immunoglobulin G (IgG) and IgA antibodies to Helicobacter pylori in serum. Serum samples from 195 patients with upper abdominal complaints were collected. Biopsy specimens of the gastric mucosae were taken for histological analysis and bacterial culture. The sensitivity, specificity, and positive and negative predictive values, and efficacy of the Pyloriset EIA-G in detecting IgG antibodies to H. pylori were 92, 84, 88, 90, and 89%, respectively, when compared with those of the reference methods used. The corresponding data for detection of IgA antibodies were 80, 89, 89, 79, and 84%, respectively. The overall prevalence of defined H. pylori positivity was 54%. Moreover, the antibody tests showed a very good correlation with the biopsy findings. IgG antibodies were found in 93% of sera from patients with documented gastritis and H. pylori positivity, whereas only 4% of the sera from patients with documented gastritis and H. pylori-negative patients was positive. The results obtained for IgA antibodies were 81 and 6%, respectively. We conclude that the Pyloriset EIA-G, the test for IgG antibodies, is a good and reliable test for the detection of antibodies to H. pylori and as an indication of H. pylori infection. The determination of IgA antibodies may be used as a test that complements the IgG antibody assay. PMID:8314985

  4. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    PubMed

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G 0 /G 1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. G5G2.5 core-shell tecto-dendrimer specifically targets reactive glia in brain ischemia.

    PubMed

    Murta, Veronica; Schilrreff, Priscila; Rosciszewski, Gerardo; Morilla, Maria Jose; Ramos, Alberto Javier

    2018-03-01

    Secondary neuronal death is a serious stroke complication. This process is facilitated by the conversion of glial cells to the reactive pro-inflammatory phenotype that induces neurodegeneration. Therefore, regulation of glial activation is a compelling strategy to reduce brain damage after stroke. However, drugs have difficulties to access the CNS, and to specifically target glial cells. In the present work, we explored the use core-shell polyamidoamine tecto-dendrimer (G5G2.5 PAMAM) and studied its ability to target distinct populations of stroke-activated glial cells. We found that G5G2.5 tecto-dendrimer is actively engulfed by primary glial cells in a time- and dose-dependent manner showing high cellular selectivity and lysosomal localization. In addition, oxygen-glucose deprivation or lipopolysaccharides exposure in vitro and brain ischemia in vivo increase glial G5G2.5 uptake; not being incorporated by neurons or other cell types. We conclude that G5G2.5 tecto-dendrimer is a highly suitable carrier for targeted drug delivery to reactive glial cells in vitro and in vivo after brain ischemia. © 2017 International Society for Neurochemistry.

  6. Association Between Plasminogen Activator Inhibitor-1-675 4G/5G Insertion/Deletion Polymorphism and Chronic Obstructive Pulmonary Disease.

    PubMed

    Essa, Enas S; El Wahsh, Rabab A

    2016-12-01

    Molecular pathology of chronic obstructive pulmonary disease (COPD) is still being investigated to discover relationships with disease pathogenesis. Evidence of plasminogen activator inhibitor-1 (PAI-1) overexpression in the sputum and the blood of COPD patients is growing. We aimed to investigate the potential relation between PAI-1 promoter 4G/5G insertion/deletion polymorphism and COPD development. In a case-control study, we genotyped 117 COPD patients and 160 control subjects for PAI-1 promoter 4G/5G polymorphism by an allele-specific polymerase chain reaction analysis. All subjects were male smokers. In the co-dominant model, there was a significant difference in the distribution of 5G/5G, 4G/5G and 4G/4G genotypes between COPD patients and controls (p = 0.002). In the recessive model, carriers of 4G/4G genotype were significantly higher in COPD patients than controls (p = 0.01). Carriers of 4G/4G genotype were at higher risk to develop COPD than those carrying 5G/5G or 4G/5G genotypes (crude odds ratio (OR) = 2.10, 95% confidence interval (CI) = 1.19-3.73, adjusted OR = 2.5, 95% CI = 1.22-3.99). In conclusion, PAI-1 4G/5G genetic variations are associated with COPD development in males.

  7. Development of a polyclonal anti-dugong immunoglobulin G (IgG) antibody with evaluation of total plasma IgG in a living dugong (Dugong dugon) population.

    PubMed

    Wong, Arthur; Lanyon, Janet M; McKee, Sara J; Linedale, Richard; Woolford, Lucy; Long, Trevor; Leggatt, Graham R

    2018-06-01

    Species-specific antibodies (Ab) for the measurement of immunoglobulins (Ig) are valuable tools for determining the humoral immune status of threatened and endangered wildlife species such as dugongs. However, no studies have reported antibody reagents against dugong immunoglobulin. The object of this study was to develop an Ab with specificity for dugong IgG and apply this tool to survey total IgG levels in plasma samples from a live wild population of dugongs in southern Queensland, Australia. Dugong IgG was isolated from plasma by protein A/G column chromatography and a polyclonal antiserum was successfully raised against the dugong IgG through immunization of mice. The anti-dugong antiserum was reactive with dugong serum but not immunoglobulin from other species such as rats and humans. When tested against a panel of dugong plasma samples, relative IgG levels from dugongs (n = 116) showed biologically relevant relationships with pregnancy status and a principal component of Body Mass Index (BMI)/globulin/fecal glucocorticosteroid (chronic stress) levels combined, which together accounted for 9.2% of the variation in total Ig levels. Together these data suggest that dugongs show variation in total IgG and that this correlates with some physiological parameters of dugong health. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Bicentric evaluation of six anti-toxoplasma immunoglobulin G (IgG) automated immunoassays and comparison to the Toxo II IgG Western blot.

    PubMed

    Maudry, Arnaud; Chene, Gautier; Chatelain, Rémi; Patural, Hugues; Bellete, Bahrie; Tisseur, Bernard; Hafid, Jamal; Raberin, Hélène; Beretta, Sophie; Sung, Roger Tran Manh; Belot, Georges; Flori, Pierre

    2009-09-01

    A comparative study of the Toxoplasma IgG(I) and IgG(II) Access (Access I and II, respectively; Beckman Coulter Inc.), AxSYM Toxo IgG (AxSYM; Abbott Diagnostics), Vidas Toxo IgG (Vidas; bioMerieux, Marcy l'Etoile, France), Immulite Toxo IgG (Immulite; Siemens Healthcare Diagnostics Inc.), and Modular Toxo IgG (Modular; Roche Diagnostics, Basel, Switzerland) tests was done with 406 consecutive serum samples. The Toxo II IgG Western blot (LDBio, Lyon, France) was used as a reference technique in the case of intertechnique discordance. Of the 406 serum samples tested, the results for 35 were discordant by the different techniques. Using the 175 serum samples with positive results, we evaluated the standardization of the titrations obtained (in IU/ml); the medians (second quartiles) obtained were 9.1 IU/ml for the AxSYM test, 21 IU/ml for the Access I test, 25.7 IU/ml for the Access II test, 32 IU/ml for the Vidas test, 34.6 IU/ml for the Immulite test, and 248 IU/ml for the Modular test. For all the immunoassays tested, the following relative sensitivity and specificity values were found: 89.7 to 100% for the Access II test, 89.7 to 99.6% for the Immulite test, 90.2 to 99.6% for the AxSYM test, 91.4 to 99.6% for the Vidas test, 94.8 to 99.6% for the Access I test, and 98.3 to 98.7% for the Modular test. Among the 406 serum samples, we did not find any false-positive values by two different tests for the same serum sample. Except for the Modular test, which prioritized sensitivity, it appears that the positive cutoff values suggested by the pharmaceutical companies are very high (either for economical or for safety reasons). This led to imperfect sensitivity, a large number of unnecessary serological follow-ups of pregnant women, and difficulty in determining the serological status of immunosuppressed individuals.

  9. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  10. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  11. Quantitation of IgG kappa and IgG lambda in the cerebrospinal fluid by sandwich ELISA method.

    PubMed

    Zeman, David; Kušnierová, Pavlína; Bojková, Jana; Všianský, František; Zapletalová, Olga

    2017-01-01

    IgG kappa and IgG lambda concentrations were quantified in 96 paired CSF and sera using Hevylite™ antibodies in an in-house developed sandwich ELISA method. In 56 of these samples, the results were compared with a qualitative isoelectric focusing/affinity-mediated immunoblotting assay for oligoclonal IgG kappa and IgG lambda. Normal IgG kappa/lambda ratio in the CSF was the same as in serum. In 19/33 patients with intrathecal oligoclonal IgG synthesis, skewed IgG kappa/lambda ratio was observed (increased in 16 and decreased in 3 cases). The analysis of light chain composition of intrathecally synthesised immunoglobulins could contribute to our understanding of intrathecal humoral immune response, although its diagnostic utility is limited.

  12. Calibration of mass and conventional mass of weights 2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg

    NASA Astrophysics Data System (ADS)

    Becerra, Luis Omar; Peña, Luis Manuel; Escalante Vargas, Boris; Cori Almonte, Luz; Martín Quiroga Rojas, Aldo; Bermúdez Coronel, Álvaro; Escobar Soto, Jhon J.; Naula, Wilson; Florencio, Arnaldo; Lourdes Valenzuela, María; Ramos Alfaro, Olman; Prenda Peña, Marcela

    2018-01-01

    This report describes the results of a supplementary comparison between SIM NMIs, which was carried out to evaluate the consistency of the measurements of calibration in high accuracy mass standards using the normalized error criteria (2 kg, 1 kg, 200 g, 50 g, 1 g and 200 mg). The supplementary comparison was carried out from April 2012 to July 2013. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  13. Zero-G Workstation Design

    NASA Technical Reports Server (NTRS)

    Gundersen, R. T.; Bond, R. L.

    1976-01-01

    Zero-g workstations were designed throughout manned spaceflight, based on different criteria and requirements for different programs. The history of design of these workstations is presented along with a thorough evaluation of selected Skylab workstations (the best zero-g experience available on the subject). The results were applied to on-going and future programs, with special emphasis on the correlation of neutral body posture in zero-g to workstation design. Where selected samples of shuttle orbiter workstations are shown as currently designed and compared to experience gained during prior programs in terms of man machine interface design, the evaluations were done in a generic sense to show the methods of applying evaluative techniques.

  14. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  15. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regionalmore » inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.« less

  16. [Postspinal headache. A comparison of the 24G Sprotte syringe and a 29G Quincke needle].

    PubMed

    Lim, M; Cross, G D; Sold, M

    1992-09-01

    A randomised study was performed to compare the frequency of postdural puncture headache in 56 patients who underwent spinal anaesthesia for extra-corporeal shockwave lithotripsy using either a Sprotte 24 G (n = 28) or Vygon 29 G or Quincke type needle (n = 28). Frequency of headache was recorded in a similar group of 28 patients who received general anaesthesia. Dural puncture was easier with the Sprotte 24 G cannula than with the less stable Quincke needle, as documented by a significantly shortened time for insertion of the cannula (4.6 +/- 2.6 vs 8.6 +/- 6.3 min, P less than 0.005). The total frequency of post-operative headache was 57% in the Vygon 29 G group and 25% in the Sprotte 24 G group; 21% of patients in the general anaesthesia group complained of headache. Frequency of postdural puncture headache, classified as being posture-related, was 25% in the 29 G Vygon group, compared with 11% in the 24 G Sprotte group (P = 0.148). When only moderate and severe postdural puncture headache was considered, there was a significant difference (25% vs. 4%; P = 0.026) in favour of the Sprotte cannula. Thus, the 24 G Sprotte needle was at least as effective as the 29 G Vygon needle, and there is a suggestion that the former is more effective in minimising the incidence of moderate or severe postdural puncture headache.

  17. Impact of the 4G/5G polymorphism in the plasminogen activator inhibitor-1 gene on primary nephrotic syndrome.

    PubMed

    Luo, Yuezhong; Wang, Chao; Tu, Haitao

    2014-03-01

    The aim of the present study was to investigate whether the four guanosines (4G)/five guanosines (5G) polymorphism in the gene coding for plasminogen activator inhibitor-1 (PAI-1) affects the clinical features of primary nephrotic syndrome (PNS). A cohort of 200 biopsy-diagnosed PNS patients was studied, with 40 healthy subjects as controls. The PAI-1 gene polymorphism was detected by polymerase chain reaction and DNA sequencing. Associations between the PAI-1 4G/5G polymorphism and clinical features and pathological types of PNS were analyzed. The results indicated that the PAI-1 genotype distribution is significantly different between patients with PNS and healthy controls, with significantly higher numbers of the 4G/4G genotype and lower numbers of the 5G5G genotype detected in PNS patients compared to controls (both P<0.05). The frequency of the 4G allele was also significantly higher in PNS patients compared to healthy controls (P<0.01). Among the different pathological types of PNS, IgA nephropathy (IgAN) and membranous nephropathy (MN) were associated with significantly increased frequencies of the 4G/4G and 4G/5G genotypes, as well as of the 4G allele. The increased 4G frequency was also detected in patients with minimal change disease (MCD). Significantly increased international normalized ratio (INR) and prolonged activated partial thromboplastin time (APTT) were observed in 4G/4G compared to 5G/5G PNS subjects. The response to steroids was not significantly different among the three genotypes. In conclusion, the 4G allele of the PAI-1 gene appears to be associated with PNS, especially in MN and IgAN patients. These findings suggest that specific targeting may be required for the treatment of PNS patients with the 4G/4G genotype.

  18. G, Etc.

    ERIC Educational Resources Information Center

    Miller, Phyllis, Ed.

    1999-01-01

    This issue of a research journal on gifted education explores the concept of intelligence and giftedness, talent development, gifted education, and educational research. Specific articles include: (1) "Spearman Revisited: Contemporary Views of g" (Milton Dehn); (2) "Exceptionally High Intelligence and Schooling" (Ellen Winner), which argues for…

  19. Clinicopathological significance of plasminogen activator inhibitor-1 promoter 4G/5G polymorphism in breast cancer: a meta-analysis.

    PubMed

    Lee, Ju-Han; Kim, Younghye; Choi, Jung-Woo; Kim, Young-Sik

    2013-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is associated with poor prognosis in breast cancer. Transcriptional expression of the PAI-1 can be controlled by PAI-1 promoter 4G/5G polymorphism. However, the significance of PAI-1 promoter 4G/5G polymorphism in breast cancer patients is contentious. To address this controversy, we conducted a meta-analysis for the relationships between PAI-1 promoter polymorphism and clinicopathological characteristics of breast cancer. Relevant published studies were identified using a search of PubMed, Embase, and the ISI Web of Science. The effect sizes of PAI-1 promoter 4G/5G polymorphism on breast cancer risk, lymph node metastasis, histologic grade, and overall survival were calculated by odds ratio (OR) or hazard ratio. The effect sizes were combined using a random-effects model. Individuals with 4G/4G genotype had a higher risk of breast cancer than those with the combined 4G/5G and 5G/5G genotypes (OR = 1.388; p = 0.031). Breast cancer patients with the 5G/5G genotype displayed lymph node metastasis more than patients with either the combined other genotypes (OR = 1.495; p = 0.027) or with the 4G/4G genotype (OR = 1.623; p = 0.018). However, the PAI-1 promoter 4G/5G polymorphism was not associated with histological grade or overall survival. PAI-1 promoter 4G/5G polymorphism is associated with a relatively increased risk of breast cancer development and lymph node metastasis. Copyright © 2013 IMSS. Published by Elsevier Inc. All rights reserved.

  20. 12 CFR 563g.3 - Exemptions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Exemptions. 563g.3 Section 563g.3 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.3 Exemptions... non-public offering which satisfies the requirements of § 563g.4 of this part; (e) That are debt...

  1. Detection of G-Induced Loss of Consciousness (G-LOC) prognosis through EMG monitoring on gastrocnemius muscle in flight.

    PubMed

    Booyong Choi; Yongkyun Lee; Taehwan Cho; Hyojin Koo; Dongsoo Kim

    2015-08-01

    G-Induced Loss of Consciousness (G-LOC) is mainly caused by the sudden acceleration in the direction of +Gz axis from the fighter pilots, and is considered as an emergent situation of which fighter pilots are constantly aware. In order to resist against G-LOC, fighter pilots are subject to run Anti-G straining maneuver (AGSM), which includes L-1 respiration maneuvering and muscular contraction of the whole body. The purpose of this study is to create a G-LOC warning alarm prior to G-LOC by monitoring the Electromyogram (EMG) of the gastrocnemius muscle on the calf, which goes under constant muscular contraction during the AGSM process. EMG data was retrieved from pilots and pilot trainees of the Korean Air Force, during when subjects were under high G-trainings on a human centrifugal simulator. Out of the EMG features, integrated absolute value (IAV), reflecting muscle contraction, and waveform length (WL), reflecting muscle contraction and fatigue, have shown a rapid decay during the alarm phase, 3 seconds before G-LOC, compared to that of a normal phase withstanding G-force. Such results showed consistency amongst pilots and pilot trainees who were under G-LOC. Based on these findings, this study developed an algorithm which can detect G-LOC prognosis during flight, and at the same time, generate warning signals. The probability of G-LOC occurrence is detected through monitoring the decay trend and degree of the IVA and WL value of when the pilot initiates AGSM during sudden acceleration above 6G. Conclusively, this G-LOC prognosis detecting and warning system is a customized, real-time countermeasure which enhanced the accuracy of detecting G-LOC.

  2. G6PDdb, an integrated database of glucose-6-phosphate dehydrogenase (G6PD) mutations.

    PubMed

    Kwok, Colin J; Martin, Andrew C R; Au, Shannon W N; Lam, Veronica M S

    2002-03-01

    G6PDdb (http://www.rubic.rdg.ac.uk/g6pd/ or http://www.bioinf.org.uk/g6pd/) is a newly created web-accessible locus-specific mutation database for the human Glucose-6-phosphate dehydrogenase (G6PD) gene. The relational database integrates up-to-date mutational and structural data from various databanks (GenBank, Protein Data Bank, etc.) with biochemically characterized variants and their associated phenotypes obtained from published literature and the Favism website. An automated analysis of the mutations likely to have a significant impact on the structure of the protein has been performed using a recently developed procedure. The database may be queried online and the full results of the analysis of the structural impact of mutations are available. The web page provides a form for submitting additional mutation data and is linked to resources such as the Favism website, OMIM, HGMD, HGVBASE, and the PDB. This database provides insights into the molecular aspects and clinical significance of G6PD deficiency for researchers and clinicians and the web page functions as a knowledge base relevant to the understanding of G6PD deficiency and its management. Copyright 2002 Wiley-Liss, Inc.

  3. G0-G1 Transition and the Restriction Point in Pancreatic β-Cells In Vivo

    PubMed Central

    Hija, Ayat; Salpeter, Seth; Klochendler, Agnes; Grimsby, Joseph; Brandeis, Michael; Glaser, Benjamin; Dor, Yuval

    2014-01-01

    Most of our knowledge on cell kinetics stems from in vitro studies of continuously dividing cells. In this study, we determine in vivo cell-cycle parameters of pancreatic β-cells, a largely quiescent population, using drugs that mimic or prevent glucose-induced replication of β-cells in mice. Quiescent β-cells exposed to a mitogenic glucose stimulation require 8 h to enter the G1 phase of the cell cycle, and this time is prolonged in older age. The duration of G1, S, and G2/M is ∼5, 8, and 6 h, respectively. We further provide the first in vivo demonstration of the restriction point at the G0-G1 transition, discovered by Arthur Pardee 40 years ago. The findings may have pharmacodynamic implications in the design of regenerative therapies aimed at increasing β-cell replication and mass in patients with diabetes. PMID:24130333

  4. [Comparison of efficacy and complications of 27G and 29G Sprottte needles for subarachnoid anesthesia].

    PubMed

    Morros-Viñoles, C; Pérez-Cuenca, M D; Cedó-Lluís, E; Colls, C; Bueno, J; Cedó-Vallobá, F

    2002-11-01

    Post-dural puncture headache and lumbar backache are related to needle gauge and type of point used. We aimed to determine whether the incidence of post-dural puncture headache and lumbar backache could be reduced by using fine gauge pencil-point Sprotte 27G and 29G needles. We also studied increases in technical difficulty with these needles and whether or not reducing needle gauge affected anesthetic quality. Three hundred eighty-nine patients undergoing orthopedic or lower abdominal surgery were randomly assigned to two groups for dural puncture using two Sprotte needles: 27G or 29G. We recorded time to perform puncture, number of re-insertations of the needle, number of times the technique was abandoned and anesthetic efficacy. On the second and seventh days, the patients were interviewed by telephone to check for the presence and severity of post-dural puncture headache or lumbar backache. The technical difficulty was greater with the Sprotte 29G needle, as shown by significant differences in time taken to perform the puncture and the number of re-insertions (p < 0.05). Anesthetic quality was the same in both groups and the percentage of failures was 0.5% for both. Five percent of patients in the 27G group and 3% in the 29G group experienced slight or moderate headache on the second day. No cases of severe cephalea were reported. Lumbar backache was reported on the second day by 26% and 18.5% of the patients in the 27G and 29G groups, respectively, but the rates decreased to 4.5% and 0.5% on the seventh day. The differences were significant, favoring the 29G needle. The use of 29G pencil-point needles can be recommended to reduce the incidence of headache and lumbar backache in the postoperative period, in spite of the greater technical difficulty involved, given that quality of anesthesia is maintained.

  5. New HST/COS FUV Modes G140L/800 and G160M/1533

    NASA Astrophysics Data System (ADS)

    Sankrit, Ravi; De Rosa, Gisella; Fischer, William J.; Fix, Mees B.; Fox, Andrew; Indriolo, Nick; James, Bethan; Magness, Camellia; Oliveira, Cristina M.; Penton, Steven V.; Plesha, Rachel; Rafelski, Marc; Roman-Duval, Julia; Sahnow, David J.; Snyder, Elaine M.; Taylor, Joanna M.; White, James

    2018-06-01

    We present two new observing modes that are being offered for the far-ultraviolet (FUV) channel on the Cosmic Origins Spectrograph (COS), and an initial overview of the science investigations they enable. The FUV channel on COS currently operates in the 900-2150 A wavelength region. It consists of two medium resolution gratings G130M and G160M, and a low resolution grating G140L. The detector consists of two segments (FUVB, shortward and FUVA, longward wavelengths) with a gap between them. Each grating has a number of central wavelength settings (cenwaves) available. The settings place different portions of the spectrum on the detector segments, and the focus at each cenwave is set to optimize spectral resolution in the middle of its wavelength range.The first new mode is G140L/800, which places 800-1950 A on FUVA. The grating rotation and focus for this mode are set to minimize the height of the spectrum on the detector, and thereby the background, in the region below 1100 A. This results in an increased sensitivity at these wavelengths compared to the 1280 cenwave. The second mode, G160M/1533, extends the short-wavelength coverage of the grating by 44 A to overlap with the longest wavelengths covered by the G130M/1222 setting. This allows a broad wavelength range to be covered using just two medium resolution settings without placing the key gain-sag contributor, Ly-alpha, on the detector.

  6. G-protection mechanisms afforded by the anti-G suit abdominal bladder with and without pressure breathing.

    PubMed

    Eiken, Ola; Bergsten, Eddie; Grönkvist, Mikael

    2011-10-01

    G protection afforded by the abdominal bladder of a pneumatic anti-G suit is usually attributed to counteraction of G-induced caudad displacement of the heart and pooling of blood in the abdominal veins. The study examined whether the abdominal bladder might provide G protection also via other mechanisms. Each subject was exposed to +Gz loads while sitting relaxed, wearing a full-coverage anti-G suit modified to permit separate pressurization of the abdominal and leg bladders. In two experimental series (N = 8, N = 14), subjects were breathing at positive airway pressure (PPB); in a third series, five subjects were breathing at atmospheric airway pressure. Intrathoracic pressures were estimated by use of esophageal catheters. During PPB at high G loads, intrathoracic pressure was higher with than without the pressurized abdominal bladder. In 7 of the 14 subjects, basilar intrathoracic pressure exceeded airway pressure during PPB when the abdominal bladder was pressurized. The mean arterial pressure response at high G loads was higher in this subset of subjects (55 +/- 23 mmHg) than in the subjects in whom airway pressure exceeded intrathoracic pressure (41 +/- 27 mmHg). Without PPB at increased G load, the intrathoracic pressure gradient was higher with than without the pressurized abdominal bladder. During PPB, the abdominal bladder acts as an airway counterpressure, thereby facilitating pressure transmission from the airways to the thorax and hence improving G protection. It also appears that in several individuals, pressure may be transmitted from the abdominal bladder to the thorax and heart.

  7. Serologic Tests of IgG and IgM Antibodies and IgG Avidity for Diagnosis of Ocular Toxoplasmosis.

    PubMed

    Rahimi-Esboei, Bahman; Zarei, Mohammad; Mohebali, Mehdi; Valian, Hossein Keshavarz; Shojaee, Saeedeh; Mahmoudzadeh, Raziyeh; Salabati, Mirataollah

    2018-04-01

    This prospective study was aimed to detect acute and chronic ocular toxoplasmosis by comparison of anti- Toxoplasma gondii IgM and IgG antibody levels and IgG avidity test. One hundred and seventeen patients with ocular toxoplasmosis (OT) who referred to the Farabi Eye Hospital, Tehran, Iran were included in this study. Of the patients, 77 cases were positive for anti- T. gondii IgG, and 8 cases were positive for anti- T. gondii IgM. IgG avidity test revealed 11, 4, and 102 cases were low, intermediate, and high, respectively, and 6.8% and 9.4% of cases were positive for IgM and IgG avidity tests, respectively ( P =0.632). Agreement (Kappa value) between paired tests IgG-IgM, IgG-IgG avidity, and IgM-IgG avidity was 0.080, 0.099, and 0.721, respectively ( P <0.05). This study showed that conventional serologic tests (IgM and IgG levels) and IgG avidity correlate well each other and can be used to differentiate recent infections from old OT. It seems that reactivated old infections rather than recently acquired infections are majority of Iranian OT patients.

  8. Immunoglobulin G (IgG) Subclass Distribution and IgG1 Avidity of Antibodies in Human Immunodeficiency Virus-Infected Individuals after Revaccination with Tetanus Toxoid

    PubMed Central

    Kroon, F. P.; van Tol, M. J. D.; Jol-van der Zijde, C. M.; van Furth, R.; van Dissel, J. T.

    1999-01-01

    In human immunodeficiency virus (HIV)-infected individuals the amount of antibodies formed after vaccination with T-cell-dependent recall antigens such as tetanus toxoid is proportional to the peripheral blood CD4+ T-lymphocyte counts. To investigate whether the immunoglobulin G (IgG) subclass distribution and avidity of the antibodies produced after vaccination are affected as well, we gave 13 HIV-infected adults with low CD4+ T-lymphocyte counts (<200 × 106/liter; group I), 11 HIV-infected adults with intermediate CD4+ T-lymphocyte counts (≥200 × 106/liter; group II), and 5 healthy controls booster immunizations with tetanus toxoid. The prevaccination antibody concentrations against tetanus toxoid were similar in the HIV-infected and healthy adults. After vaccination the total IgG and the IgG1 anti-tetanus toxoid antibody concentrations were significantly lower in group I than in group II and the controls. The avidity of the IgG1 anti-tetanus toxoid antibodies formed by HIV-infected adults was within the range for healthy controls, irrespective of their CD4+ T-lymphocyte counts. PMID:10225835

  9. PAI-1 expression and its regulation by promoter 4G/5G polymorphism in clear cell renal cell carcinoma.

    PubMed

    Choi, Jung-Woo; Lee, Ju-Han; Park, Hong Seok; Kim, Young-Sik

    2011-10-01

    To characterise patients with high plasminogen activator inhibitor-1 (PAI-1) expression as oral PAI-1 antagonists are currently in preclinical trials, and to determine whether the PAI-1 promoter 4G/5G polymorphism regulates PAI-1 expression in clear cell renal cell carcinoma (CCRCC). PAI-1 expression was examined by immunohistochemistry in 69 CCRCC specimens. In addition, the promoter 4G/5G polymorphism was investigated by both allele-specific PCR and direct DNA sequencing. PAI-1 was overexpressed in 25/69 (36.2%) patients with CCRCC. PAI-1 staining was intense in tumour cells with a high Fuhrman nuclear grade and in spindle-shaped tumour cells. PAI-1 expression was significantly associated with older age at diagnosis (p=0.027), high nuclear grade (p<0.001), advanced clinical stage (p=0.030) and distant metastasis (p=0.009). In survival analyses, PAI-1 expression was correlated with disease-free survival in Kaplan-Meier curves (p=0.015) but was not significant in the Cox hazards model (p=0.527). The frequencies of the promoter polymorphism were 24.6% (17/69) 4G/4G, 43.5% (30/69) 4G/5G and 31.9% (22/69) 5G/5G. The homozygous 4G/4G or 5G/5G group showed a tendency for a high nuclear grade (p=0.05) but the 4G/5G polymorphism was not related to other prognostic parameters. PAI-1 expression was poorly correlated with its promoter 4G/5G polymorphism (Spearman ρ=0.088). CCRCC with high PAI-1 expression is characterised by older age, high nuclear grade, advanced stage, distant metastasis and/or shortened disease-free survival. PAI-1 expression is not affected by the promoter 4G/5G polymorphism.

  10. Automation methodologies and large-scale validation for G W : Towards high-throughput G W calculations

    NASA Astrophysics Data System (ADS)

    van Setten, M. J.; Giantomassi, M.; Gonze, X.; Rignanese, G.-M.; Hautier, G.

    2017-10-01

    The search for new materials based on computational screening relies on methods that accurately predict, in an automatic manner, total energy, atomic-scale geometries, and other fundamental characteristics of materials. Many technologically important material properties directly stem from the electronic structure of a material, but the usual workhorse for total energies, namely density-functional theory, is plagued by fundamental shortcomings and errors from approximate exchange-correlation functionals in its prediction of the electronic structure. At variance, the G W method is currently the state-of-the-art ab initio approach for accurate electronic structure. It is mostly used to perturbatively correct density-functional theory results, but is, however, computationally demanding and also requires expert knowledge to give accurate results. Accordingly, it is not presently used in high-throughput screening: fully automatized algorithms for setting up the calculations and determining convergence are lacking. In this paper, we develop such a method and, as a first application, use it to validate the accuracy of G0W0 using the PBE starting point and the Godby-Needs plasmon-pole model (G0W0GN @PBE) on a set of about 80 solids. The results of the automatic convergence study utilized provide valuable insights. Indeed, we find correlations between computational parameters that can be used to further improve the automatization of G W calculations. Moreover, we find that G0W0GN @PBE shows a correlation between the PBE and the G0W0GN @PBE gaps that is much stronger than that between G W and experimental gaps. However, the G0W0GN @PBE gaps still describe the experimental gaps more accurately than a linear model based on the PBE gaps. With this paper, we hence show that G W can be made automatic and is more accurate than using an empirical correction of the PBE gap, but that, for accurate predictive results for a broad class of materials, an improved starting point or some

  11. The -675 4G/5G polymorphism in the PAI-1 gene may not contribute to the risk of PCOS.

    PubMed

    Zhang, T-T; Yuan, L; Yang, Y-M; Ren, Y

    2014-08-01

    The association between the -675 4G/5G polymorphism in PAI-1 gene and PCOS has been studied with inconclusive results. We sought to investigate this inconsistency by performing a comprehensive meta-analysis on the polymorphism. Searches were performed in the PubMed, Embase, CNKI and Wanfang databases, covering all papers. Statistical analysis was performed using Revman5.2 and STATA11.0 software. A total of 11 case-control studies were extracted on the polymorphism involving 1861 PCOS cases and 1187 controls. The results showed that, no significant increased/decreased risk were found for the polymorphism for PCOS: OR = 1.03, 95% CI = 0.77-1.66, p = 0.52 for 4G4G + 4G5G vs. 5G5G; OR = 0.99, 95% CI = 0.66-1.49, p = 0.96 for 4G4G vs. 5G5G + 4G5G; OR = 1.08, 95% CI = 0.66-1.79, p = 0.76 for 4G4G vs. 5G5G; OR = 1.11, 95% CI = 0.78-1.58, p = 0.56 for 4G5G vs. 5G5G; OR = 1.00, 95% CI = 0.71-1.41, p = 0.99 for 4G vs. 5G. In the further subgroup analysis by ethnicity, we did not find a significant association between the polymorphism for PCOS risk in either Asians or Europeans. Our findings demonstrated that -675 4G/5G polymorphism in the PAI-1 gene might not be a risk factor for the development of PCOS.

  12. Evidence that the granulocyte colony-stimulating factor (G-CSF) receptor plays a role in the pharmacokinetics of G-CSF and PegG-CSF using a G-CSF-R KO model.

    PubMed

    Kotto-Kome, Anne C; Fox, Samuel E; Lu, Wenge; Yang, Bing-Bing; Christensen, Robert D; Calhoun, Darlene A

    2004-07-01

    The covalent attachment of polyethylene glycol to filgrastim results in a new molecule pegfilgrastim, which has a significantly longer half-life than filgrastim. It is likely that the clearance of both filgrastim and pegfilgrastim involves granulocyte colony simulating factor (G-CSF) receptor binding, but the pharmacokinetics of these drugs have not been compared in mice with and without a functional G-CSF receptor. We sought to clarify the role of receptor-mediated clearance of filgrastim and pegfilgrastim using wild-type (WT) mice or mice with a non-functional G-CSF-R (knockout, KO). We administered single doses of filgrastim or pegfilgrastim (10 or 100 microg kg(-1)) intravenously to WT and KO mice. Plasma levels of protein were measured by enzyme-linked immunosorbent assay (ELISA) at preset time points, and AUC, MRT, CL, V(d), and T(1/2) were calculated. When compared with WT mice, the G-CSF-R KO mice had significantly greater AUC, longer MRT, longer T(1/2), and lower clearance. This was the case whether animals received 10 or 100 microg kg(-1) and whether they received filgrastim or pegfilgrastim. The volume of protein distribution was identical among WT and KO mice. However, the V(d) was larger after pegfilgrastim dosing than after filgrastim dosing. In both WT and KO mice, increasing the dose of figrastim or pegfilgrastim resulted in a proportional increase in the AUC. A functional G-CSF-R is an important mechanism in the plasma clearance of both filgrastim and pegfilgrastim.

  13. 30 CFR 280.20 - What must I not do in conducting Geological and Geophysical (G&G) prospecting or scientific...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Geophysical (G&G) prospecting or scientific research? 280.20 Section 280.20 Mineral Resources MINERALS... What must I not do in conducting Geological and Geophysical (G&G) prospecting or scientific research? While conducting G&G prospecting or scientific research activities under a permit or notice, you must...

  14. A case of non-lacrimal immunoglobulin G4 (IgG4)-related orbital disease with mastitis.

    PubMed

    Farooq, Tahir Ali; Mudhar, Hardeep; Sandramouli, S

    2016-01-01

    IgG4-related orbital disease is a recognised cause for orbital inflammation. As its awareness increases and diagnostic accuracy improves there will be an increased number of cases being identified. This unique case demonstrates for the first time, with histological evidence, a case of a non-lacrimal IgG4-related orbital disease with concurrent IgG4-related mastitis. We describe a 47 year old who presented with a supraorbital swelling and mass. This was initially successfully treated with oral steroids and was later excised on recurrence. Immunohistochemical and blood serum analysis confirmed IgG4-related orbital disease. On systemic enquiry she was found to have a mass of the breast, which was shown to be IgG4-related mastitis. She is currently asymptomatic with no sign of recurrence and is under long-term surveillance. This case highlights the importance of systemic work up in patients presenting with orbital foci of IgG4 disease.

  15. Association of the plasminogen activator inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G promoter polymorphism with risk of keloid in a Chinese Han population.

    PubMed

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-10-28

    A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population.

  16. Frequency of null allele of Human Leukocyte Antigen-G (HLA-G) locus in subjects to recurrent miscarriage.

    PubMed

    Alizadeh, Nazila; Mosaferi, Elnaz; Farzadi, Laya; Majidi, Jafar; Monfaredan, Amir; Yousefi, Bahman; Baradaran, Behzad

    2016-07-01

    Human leukocyte antigen-G (HLA-G) is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM) subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR). Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele.

  17. 41G crew activities

    NASA Image and Video Library

    2009-06-25

    41G-102-003 (5-13 Oct 1984) ---- Astronaut Kathryn D. Sullivan, 41-G mission specialist, floats into a middeck scene to join a more stationary pair of crewmembers---Astronauts Robert L. Crippen, crew commander; and Jon A. McBride, pilot. The protruding article near the stowage lockers is a Krimsky rule, part of the near vision acuity experiment in which recent NASA space travelers have participated.

  18. Two Chimeric Regulators of G-protein Signaling (RGS) Proteins Differentially Modulate Soybean Heterotrimeric G-protein Cycle*

    PubMed Central

    Roy Choudhury, Swarup; Westfall, Corey S.; Laborde, John P.; Bisht, Naveen C.; Jez, Joseph M.; Pandey, Sona

    2012-01-01

    Heterotrimeric G-proteins and the regulator of G-protein signaling (RGS) proteins, which accelerate the inherent GTPase activity of Gα proteins, are common in animals and encoded by large gene families; however, in plants G-protein signaling is thought to be more limited in scope. For example, Arabidopsis thaliana contains one Gα, one Gβ, three Gγ, and one RGS protein. Recent examination of the Glycine max (soybean) genome reveals a larger set of G-protein-related genes and raises the possibility of more intricate G-protein networks than previously observed in plants. Stopped-flow analysis of GTP-binding and GDP/GTP exchange for the four soybean Gα proteins (GmGα1–4) reveals differences in their kinetic properties. The soybean genome encodes two chimeric RGS proteins with an N-terminal seven transmembrane domain and a C-terminal RGS box. Both GmRGS interact with each of the four GmGα and regulate their GTPase activity. The GTPase-accelerating activities of GmRGS1 and -2 differ for each GmGα, suggesting more than one possible rate of the G-protein cycle initiated by each of the Gα proteins. The differential effects of GmRGS1 and GmRGS2 on GmGα1–4 result from a single valine versus alanine difference. The emerging picture suggests complex regulation of the G-protein cycle in soybean and in other plants with expanded G-protein networks. PMID:22474294

  19. Birth of Archaeal Cells: Molecular Phylogenetic Analyses of G1P Dehydrogenase, G3P Dehydrogenases, and Glycerol Kinase Suggest Derived Features of Archaeal Membranes Having G1P Polar Lipids

    PubMed Central

    2016-01-01

    Bacteria and Eukarya have cell membranes with sn-glycerol-3-phosphate (G3P), whereas archaeal membranes contain sn-glycerol-1-phosphate (G1P). Determining the time at which cells with either G3P-lipid membranes or G1P-lipid membranes appeared is important for understanding the early evolution of terrestrial life. To clarify this issue, we reconstructed molecular phylogenetic trees of G1PDH (G1P dehydrogenase; EgsA/AraM) which is responsible for G1P synthesis and G3PDHs (G3P dehydrogenase; GpsA and GlpA/GlpD) and glycerol kinase (GlpK) which is responsible for G3P synthesis. Together with the distribution of these protein-encoding genes among archaeal and bacterial groups, our phylogenetic analyses suggested that GlpA/GlpD in the Commonote (the last universal common ancestor of all extant life with a cellular form, Commonote commonote) acquired EgsA (G1PDH) from the archaeal common ancestor (Commonote archaea) and acquired GpsA and GlpK from a bacterial common ancestor (Commonote bacteria). In our scenario based on this study, the Commonote probably possessed a G3P-lipid membrane synthesized enzymatically, after which the archaeal lineage acquired G1PDH followed by the replacement of a G3P-lipid membrane with a G1P-lipid membrane. PMID:27774041

  20. UreE-UreG Complex Facilitates Nickel Transfer and Preactivates GTPase of UreG in Helicobacter pylori*♦

    PubMed Central

    Yang, Xinming; Li, Hongyan; Lai, Tsz-Pui; Sun, Hongzhe

    2015-01-01

    The pathogenicity of Helicobacter pylori relies heavily on urease, which converts urea to ammonia to neutralize the stomach acid. Incorporation of Ni2+ into the active site of urease requires a battery of chaperones. Both metallochaperones UreE and UreG play important roles in the urease activation. In this study, we demonstrate that, in the presence of GTP and Mg2+, UreG binds Ni2+ with an affinity (Kd) of ∼0.36 μm. The GTPase activity of Ni2+-UreG is stimulated by both K+ (or NH4+) and HCO3− to a biologically relevant level, suggesting that K+/NH4+ and HCO3− might serve as GTPase elements of UreG. We show that complexation of UreE and UreG results in two protein complexes, i.e. 2E-2G and 2E-G, with the former being formed only in the presence of both GTP and Mg2+. Mutagenesis studies reveal that Arg-101 on UreE and Cys-66 on UreG are critical for stabilization of 2E-2G complex. Combined biophysical and bioassay studies show that the formation of 2E-2G complex not only facilitates nickel transfer from UreE to UreG, but also enhances the binding of GTP. This suggests that UreE might also serve as a structural scaffold for recruitment of GTP to UreG. Importantly, we demonstrate for the first time that UreE serves as a bridge to grasp Ni2+ from HypA, subsequently donating it to UreG. The study expands our horizons on the molecular details of nickel translocation among metallochaperones UreE, UreG, and HypA, which further extends our knowledge on the urease maturation process. PMID:25752610

  1. Association of the Plasminogen Activator Inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G Promoter Polymorphism with Risk of Keloid in a Chinese Han Population

    PubMed Central

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-01-01

    Background A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. Material/Methods A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). Results There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Conclusions Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population. PMID:25350781

  2. Nuclease digestion and mass spectrometric characterization of oligodeoxyribonucleotides containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG cisplatin intrastrand cross-links.

    PubMed

    Williams, Renee T; Nalbandian, Jenifer N; Tu, Audrey; Wang, Yinsheng

    2013-05-01

    The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Nuclease Digestion and Mass Spectrometric Characterization of Oligodeoxyribonucleotides Containing 1,2-GpG, 1,2-ApG, and 1,3-GpXpG Cisplatin Intrastrand Cross-links

    PubMed Central

    Williams, Renee T.; Nalbandian, Jenifer; Tu, Audrey; Wang, Yinsheng

    2013-01-01

    Background The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, towards the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines. Methods We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with 15N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase). Results 1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5′ or 3′ terminus revealed that the dinucleotide carries a terminal 5′ phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups. Results The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA. PMID:23266768

  4. A Benzothiazole Derivative (5g) Induces DNA Damage And Potent G2/M Arrest In Cancer Cells.

    PubMed

    Hegde, Mahesh; Vartak, Supriya V; Kavitha, Chandagirikoppal V; Ananda, Hanumappa; Prasanna, Doddakunche S; Gopalakrishnan, Vidya; Choudhary, Bibha; Rangappa, Kanchugarakoppal S; Raghavan, Sathees C

    2017-05-31

    Chemically synthesized small molecules play important role in anticancer therapy. Several chemical compounds have been reported to damage the DNA, either directly or indirectly slowing down the cancer cell progression by causing a cell cycle arrest. Direct or indirect reactive oxygen species formation causes DNA damage leading to cell cycle arrest and subsequent cell death. Therefore, identification of chemically synthesized compounds with anticancer potential is important. Here we investigate the effect of benzothiazole derivative (5g) for its ability to inhibit cell proliferation in different cancer models. Interestingly, 5g interfered with cell proliferation in both, cell lines and tumor cells leading to significant G2/M arrest. 5g treatment resulted in elevated levels of ROS and subsequently, DNA double-strand breaks (DSBs) explaining observed G2/M arrest. Consistently, we observed deregulation of many cell cycle associated proteins such as CDK1, BCL2 and their phosphorylated form, CyclinB1, CDC25c etc. Besides, 5g treatment led to decreased levels of mitochondrial membrane potential and activation of apoptosis. Interestingly, 5g administration inhibited tumor growth in mice without significant side effects. Thus, our study identifies 5g as a potent biochemical inhibitor to induce G2/M phase arrest of the cell cycle, and demonstrates its anticancer properties both ex vivo and in vivo.

  5. G-quadruplex prediction in E. coli genome reveals a conserved putative G-quadruplex-Hairpin-Duplex switch.

    PubMed

    Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman

    2016-11-02

    Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Penicillin G (Potassium, Sodium) Injection

    MedlinePlus

    Penicillin G injection is used to treat and prevent certain infections caused by bacteria. Penicillin G injection is in a class of medications called penicillins. It works by killing bacteria that cause infections. ...

  7. Frequency of null allele of Human Leukocyte Antigen-G (HLA-G) locus in subjects to recurrent miscarriage

    PubMed Central

    Alizadeh, Nazila; Mosaferi, Elnaz; Farzadi, Laya; Majidi, Jafar; Monfaredan, Amir; Yousefi, Bahman; Baradaran, Behzad

    2016-01-01

    Background: Human leukocyte antigen-G (HLA-G) is a non-classical class I molecule highly expressed by extravillous cytotrophoblast cells. Due to a single base pair deletion, its function can be compensated by other isoforms. Investigating the frequency of null allele in Recurrent Miscarriage (RM) subjects could be useful in understanding the relationship between frequency of this allele and RM in a given population. Objective: This study aimed to determine the frequency of HLA-G*0105N null allele and its potential association with down-regulation of HLA-G in subjects with RM. Materials and Methods: Western blotting was used to assess the level of HLA-G protein expression. For investigating the frequency of HLA-G*0105N null allele in RM subjects, PCR-RFLP method was used. Exon 3 of HLA-G gene was amplified by polymerase chain reaction (PCR). Subsequently, PpuM-1 enzyme was employed to digest the PCR products and fragments were analyzed using gel electrophoresis. Results: Digestion using restriction enzyme showed the presence of heterozygous HLA-G*0105N null allele in 10% of the test population. Western blotting results confirmed the decrease in expression of HLA-G in the placental tissue of subjects with RM compared to subjects who could give normal birth. Conclusion: The frequency of heterozygous HLA-G*0105N null allele was high to some extent in subjects with RM. The mutation rate in subjects suggested that there is a significant association between RM and frequency of mutations in this allele. PMID:27525330

  8. G-triplex structure and formation propensity

    PubMed Central

    Cerofolini, Linda; Amato, Jussara; Giachetti, Andrea; Limongelli, Vittorio; Novellino, Ettore; Parrinello, Michele; Fragai, Marco; Randazzo, Antonio; Luchinat, Claudio

    2014-01-01

    The occurrence of a G-triplex folding intermediate of thrombin binding aptamer (TBA) has been recently predicted by metadynamics calculations, and experimentally supported by Nuclear Magnetic Resonance (NMR), Circular Dichroism (CD) and Differential Scanning Calorimetry (DSC) data collected on a 3′ end TBA-truncated 11-mer oligonucleotide (11-mer-3′-t-TBA). Here we present the solution structure of 11-mer-3′-t-TBA in the presence of potassium ions. This structure is the first experimental example of a G-triplex folding, where a network of Hoogsteen-like hydrogen bonds stabilizes six guanines to form two G:G:G triad planes. The G-triplex folding of 11-mer-3′-t-TBA is stabilized by the potassium ion and destabilized by increasing the temperature. The superimposition of the experimental structure with that predicted by metadynamics shows a great similarity, with only significant differences involving two loops. These new structural data show that 11-mer-3′-t-TBA assumes a G-triplex DNA conformation as its stable form, reinforcing the idea that G-triplex folding intermediates may occur in vivo in human guanine-rich sequences. NMR and CD screening of eight different constructs obtained by removing from one to four bases at either the 3′ and the 5′ ends show that only the 11-mer-3′-t-TBA yields a relatively stable G-triplex. PMID:25378342

  9. Small molecules targeting heterotrimeric G proteins.

    PubMed

    Ayoub, Mohammed Akli

    2018-05-05

    G protein-coupled receptors (GPCRs) represent the largest family of cell surface receptors regulating many human and animal physiological functions. Their implication in human pathophysiology is obvious with almost 30-40% medical drugs commercialized today directly targeting GPCRs as molecular entities. However, upon ligand binding GPCRs signal inside the cell through many key signaling, adaptor and regulatory proteins, including various classes of heterotrimeric G proteins. Therefore, G proteins are considered interesting targets for the development of pharmacological tools that are able to modulate their interaction with the receptors, as well as their activation/deactivation processes. In this review, old attempts and recent advances in the development of small molecules that directly target G proteins will be described with an emphasis on their utilization as pharmacological tools to dissect the mechanisms of activation of GPCR-G protein complexes. These molecules constitute a further asset for research in the "hot" areas of GPCR biology, areas such as multiple G protein coupling/signaling, GPCR-G protein preassembly, and GPCR functional selectivity or bias. Moreover, this review gives a particular focus on studies in vitro and in vivo supporting the potential applications of such small molecules in various GPCR/G protein-related diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. ESO089-G018 and ESO089-G019: long-slit spectroscopy of emission-line galaxies

    NASA Astrophysics Data System (ADS)

    da Rocha-Poppe, P. C.; Faúndez-Abans, M.; Fernandes-Martin, V. A.; Fernandes, I. F.; de Oliveira-Abans, M.; Rodrígues-Ardila, A.

    2010-03-01

    We present the first spectroscopic observations for the galaxies ESO089-G018 (hereafter G18, an Sb(?)-type galaxy seen nearly edge-on) and ESO089-G019 (hereafter G19, an SA(s): a peculiar galaxy), extracted from the sample of ring-shaped galaxies compiled in Faúndez-Abans & de Oliveira-Abans. The main goal of this work is to investigate the spectral classification using the three line-ratio diagrams, called diagnostic diagrams, of Veilleux & Osterbrock. However, in order to separate the different types of galaxies [HII galaxies, Seyfert 2 galaxies and low-ionization nuclear emission-line region galaxies (LINERs)] we have to used empirical boundaries between them. Based on the observed spectra, we suggest G18 is a `weak-[OI] LINER' or even a `transition object' or LINER/HII. In the case of G19, we see Hβ in absorption and no [OIII] lines, impeding the [OIII]/Hβ ratio to be estimated. However, other lines ratios have been evaluated for the discussion. We classify the nature of G19 as ambiguous, because of the difficulty in determining its ionizing source (narrow-line active galactic nuclei or HII galaxies) in different diagnostic diagrams. The errors in the fluxes were mostly caused by uncertainties in the placement of the continuum level. We have estimated nuclear redshift of z = 0.034 (G18) and z = 0.039 (G19), corresponding to a heliocentric velocity of 10246 and 11734kms-1, respectively. Some other physical parameters have been derived whenever possible. All spectra were reduced and analysed in a homogeneous way with the standard IRAF procedures. Based on observations carried out at Observatório do Pico dos Dias (OPD), which operated by the LNA/MCT, Brazil-MG. E-mail: paulopoppe@gmail.com

  11. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with type 2 diabetes risk

    PubMed Central

    Zhao, Luqian; Huang, Ping

    2013-01-01

    A number of studies were performed to assess the association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and susceptibility to type 2 diabetes (T2DM). However, the results were inconsistent and inconclusive. In the present study, the possible association was investigated by a meta-analysis. Eligible articles were identified for the period up to June 2013. Pooled odds ratios (OR) with 95% confidence intervals (CI) were appropriately derived from random-effects models or fixed-effects models. Fourteen case-control studies with a total of 2487 cases and 3538 controls were eligible. In recessive model, PAI-1 4G/5G polymorphism was associated with T2DM risk (OR = 1.23; 95% CI 1.07-1.41; P = 0.004). In the subgroup analysis by ethnicity, a significant association was found among Asians (OR = 1.27; 95% CI 1.08-1.51; P = 0.005). This meta-analysis suggested that PAI-1 4G/5G polymorphism may be associated with T2DM development. PMID:24040470

  12. Long-range magnetic order in the Heisenberg pyrochlore antiferromagnets G d2G e2O7 and G d2P t2O7 synthesized under high pressure

    NASA Astrophysics Data System (ADS)

    Li, X.; Cai, Y. Q.; Cui, Q.; Lin, C. J.; Dun, Z. L.; Matsubayashi, K.; Uwatoko, Y.; Sato, Y.; Kawae, T.; Lv, S. J.; Jin, C. Q.; Zhou, J.-S.; Goodenough, J. B.; Zhou, H. D.; Cheng, J.-G.

    2016-12-01

    G d2S n2O7 and G d2T i2O7 have been regarded as good experimental realizations of the classical Heisenberg pyrochlore antiferromagnet with dipolar interaction. The former was found to adopt the Palmer-Chalker state via a single, first-order transition at TN≈1 K , while the latter enters a distinct, partially ordered state through two successive transitions at TN 1≈1 K and TN 2= 0.75 K . To shed more light on their distinct magnetic ground states, we have synthesized two more gadolinium-based pyrochlore oxides, G d2G e2O7 and G d2P t2O7 , under high-pressure conditions and performed detailed characterizations via x-ray powder diffraction, dc and ac magnetic susceptibility, and specific heat measurements down to 100 mK. We found that both compounds enter a long-range antiferromagnetically ordered state through a single, first-order transition at TN= 1.4 K for G d2G e2O7 and TN= 1.56 K for G d2P t2O7 , with the specific heat anomaly similar to that of G d2S n2O7 rather than G d2T i2O7 . Interestingly, the low-temperature magnetic specific heat values of both G d2G e2O7 and G d2P t2O7 were found to follow nicely the T3 dependence as expected for a three-dimensional antiferromagnet with gapless spin-wave excitations. We have rationalized the enhancement of TN in terms of the reduced Gd-Gd distances for the chemically pressurized G d2G e2O7 and the addition of extra superexchange pathways through the empty Pt -eg orbitals for G d2P t2O7 . Our current study has expanded the family of gadolinium-based pyrochlores and permits us to achieve a better understanding of their distinct magnetic properties in a more comprehensive perspective.

  13. 76 FR 30738 - Agency Information Collection Activities: Form G-845 and Form G-845 Supplement, Revision of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-26

    ... Collection Activities: Form G-845 and Form G- 845 Supplement, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form G- 845 and Form G-845 Supplement, Document Verification Request and Document Verification Request Supplement; OMB...

  14. [Correlation between IgG subtypes and hematological diseases].

    PubMed

    Shao, Yuan-Yuan; Shao, Zong-Hong

    2015-02-01

    IgG is the main immunoglobulin, brings the immunolgic effects in body. The human IgG can be divided into four kinds; IgG1, IgG2, IgG3, IgG4, respectively. The structures of IgG1, IgG2, IgG3, IgG4 are different, therefore, their functions are also different. The defects, increase or imbalance of the IgG subtypes in autoimmune diseases, infectious diseases, cancer and other diseases are indicators of the immune response. IgG1, IgG2, IgG3 and IgG4 also play a different important roles in the disease progress. The analysis of IgG subtypes is beneficial to study the etiology, pathogenesis and prognosis of above menthioned deseases. This review briefly summarizes the characteristics of IgG subtypes in thrombotic thrombocytopenic purpura, autoimmune hemolytic anemia, hemophilia, lymphoma and leukemia.

  15. Association of G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms with susceptibility to myocardial infarction in Morocco.

    PubMed

    Hassani Idrissi, Hind; Hmimech, Wiam; Diakite, Brehima; Korchi, Farah; Baghdadi, Dalila; Habbal, Rachida; Nadifi, Sellama

    2016-09-01

    Myocardial infarction (MI) is a common multifactorial disease. Numerous studies have found that genetic plays an essential role in MI occurrence. The main objective of our case-control study is to explore the association of G894T eNOS (rs1799983), 4G/5G PAI (rs1799889) and T1131C APOA5 (rs662799) polymorphisms with MI susceptibility in the Moroccan population. 118 MI patients were recruited vs 184 healthy controls. DNA samples were genotyped by PCR-RFLP method using MboI, BslI and MseI restriction enzymes respectively for the G894T eNOS, 4G/5G PAI and T1131C APOA5 polymorphisms. Our results show that the G894T eNOS was significantly associated with increased risk of MI under the three genetic transmission models (dominant: OR = 1.64, 95% CI = 1.05-2.58, P = 0.003; recessive: OR = 2.15, 95% CI = 0.74-6.16, P = 0.03; additive: OR = 1.54, 95% CI = 1.06-2.23, P = 0.001). The T1131C APOA5 polymorphism was associated to MI risk in recessive and additive models (OR = 1.53, 95% CI = 0.72-3.2, P = 0.04 and OR = 1.78, 95% CI = 1.26-2.51, P = 0.03 respectively). For the 4G/5G PAI variant, even the cases and controls groups were not in Hardy-Weinberg Equilibrium (HWE), the dominant and additive models show a statistically significant association with MI risk (OR = 7.96, 95%CI = 3.83-16.36, P = 0.01 and OR = 1.96, 95% CI = 1.4-2.72, P = 0.03 respectively). Our results suggest that G894T eNOS and T1131C APOA5 polymorphisms may be considered as genetic markers of MI among the Moroccan population. Further studies including larger sample sizes and exploring more genetic associations are needed to confirm our results and to better understand the susceptibility to MI.

  16. Reduced G tolerance associated with supplement use.

    PubMed

    Barker, Patrick D

    2011-02-01

    High G forces encountered in tactical military aviation and aerobatic flight produce a host of physiologic responses aimed at preserving cerebral perfusion. The military has instituted measures to augment the physiologic response in order to avoid G-induced loss of consciousness (G-LOC) because of its potential to cause a catastrophic mishap. The case presented here details a Naval Aviator who experienced reduced G tolerance over two successive flights with a temporal relationship of starting a new supplement. Two components of the supplement, coenzyme Q10 and niacin, are highlighted here for their hemodynamic effects. After stopping the supplement the aviator regained his normal G tolerance and had no further issues in flight. There are several factors that can reduce G tolerance and supplement use has to be considered here because of the potential for altering the normal physiological response to increased G force. Our discussion reviews the physiological effects of increased G force, the spectrum of signs of decompensation under the stress of G force, and the potential effects this supplement had on the normal physiological response to increased G force, thus reducing the aviator's G tolerance.

  17. High resolution spectral analysis of oxygen. I. Isotopically invariant Dunham fit for the X(3)Σ(g)(-), a(1)Δ(g), b(1)Σ(g)(+) states.

    PubMed

    Yu, Shanshan; Miller, Charles E; Drouin, Brian J; Müller, Holger S P

    2012-07-14

    We have developed a simultaneous global fit to the MW, THz, infrared, visible, and UV transitions of all six oxygen isotopologues, (16)O(16)O, (16)O(17)O, (16)O(18)O, (17)O(17)O, (17)O(18)O, (18)O(18)O, with the objective of predicting all transitions below the O((3)P) + O((3)P) dissociation threshold as well as the B(3)Σ(u) (-) state from O((3)P)+O((1)D) within state-of-the-art experimental uncertainty. Here, we report an isotopically invariant Dunham fit for the lowest three electronic states, X(3)Σ(g)(-), a(1)Δ(g), and b(1)Σ(g)(+). Experimental transition frequencies involving these three states of all six O(2) isotopologues were critically reviewed and incorporated into the analysis. For the (16)O(16)O isotopologue, experimental data sample vibrational states v = 0-31 for X(3)Σ(g)(-), v = 0-10 for a(1)Δ(g), and v = 0-12 for b(1)Σ(g)(+). To the best of our knowledge, this is the first analysis that simultaneously fits spectra from all six O(2) isotopologues.

  18. IgG Glycome in Colorectal Cancer.

    PubMed

    Vučković, Frano; Theodoratou, Evropi; Thaçi, Kujtim; Timofeeva, Maria; Vojta, Aleksandar; Štambuk, Jerko; Pučić-Baković, Maja; Rudd, Pauline M; Đerek, Lovorka; Servis, Dražen; Wennerström, Annika; Farrington, Susan M; Perola, Markus; Aulchenko, Yurii; Dunlop, Malcolm G; Campbell, Harry; Lauc, Gordan

    2016-06-15

    Alternative glycosylation has significant structural and functional consequences on IgG and consequently also on cancer immunosurveillance. Because of technological limitations, the effects of highly heritable individual variations and the differences in the dynamics of changes in IgG glycosylation on colorectal cancer were never investigated before. Using recently developed high-throughput UPLC technology for IgG glycosylation analysis, we analyzed IgG glycome composition in 760 patients with colorectal cancer and 538 matching controls. Effects of surgery were evaluated in 28 patients sampled before and three times after surgery. A predictive model was built using regularized logistic regression and evaluated using a 10-cross validation procedure. Furthermore, IgG glycome composition was analyzed in 39 plasma samples collected before initial diagnosis of colorectal cancer. We have found that colorectal cancer associates with decrease in IgG galactosylation, IgG sialylation and increase in core-fucosylation of neutral glycans with concurrent decrease of core-fucosylation of sialylated glycans. Although a model based on age and sex did not show discriminative power (AUC = 0.499), the addition of glycan variables into the model considerably increased the discriminative power of the model (AUC = 0.755). However, none of these differences were significant in the small set of samples collected before the initial diagnosis. Considering the functional relevance of IgG glycosylation for both tumor immunosurveillance and clinical efficacy of therapy with mAbs, individual variation in IgG glycosylation may turn out to be important for prediction of disease course or the choice of therapy, thus warranting further, more detailed studies of IgG glycosylation in colorectal cancer. Clin Cancer Res; 22(12); 3078-86. ©2016 AACR. ©2016 American Association for Cancer Research.

  19. Echinococcus ortleppi (G5) and Echinococcus granulosus sensu stricto (G1) loads in cattle from Southern Brazil.

    PubMed

    Balbinotti, Helier; Santos, Guilherme B; Badaraco, Jeferson; Arend, Ana C; Graichen, Daniel Ângelo S; Haag, Karen L; Zaha, Arnaldo

    2012-09-10

    Echinococcus granulosus sensu stricto (G1) and Echinococcus ortleppi (G5) are haplotypes of the parasite formerly known as Echinococcus granulosus sensu lato, which in its larval stage causes cystic hydatid disease, endemic in Southern Brazil. Epidemiological and molecular knowledge about the haplotypes occurring in a region is essential to control the spread of the disease. The aim of this work was to analyze the haplotype frequency and fertility of hydatid cysts in cattle from the state of Rio Grande do Sul. Cysts were collected and classified according to their fertility status. DNA was extracted from protoscoleces and germinal layers and then used as template for the amplification of the cytochrome c oxidase subunit 1 gene by PCR. Amplicons were purified and sequenced, and the sequences were analyzed for haplotype identification. A total of 638 fertile cysts collected in the last ten years were genotyped. On average, G1 (56.6%) was more frequent than G5 (43.4%). In lungs, the G5 haplotype exhibited a higher parasite load (52.8%), whereas in the liver, G1 was more frequent (90.4%). The analysis revealed an increase in the frequency of G5 haplotype cysts during the period of sampling, and an increase in the abundance of fertile cysts has also been observed in the last several years. Most infertile cysts were genotyped as G1. The possible factors involved in the increase in the proportion of E. ortleppi (G5) and the consequences of this increase are discussed. This study suggests that the proportion of E. ortleppi (G5) loads in cattle may be increasing overtime. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Study on camel IgG purification

    PubMed Central

    Khamehchian, Sedigheh; Zolfagharian, Hossein; Dounighi, Naser Mohammadpour; Tebianian, Majid; Madani, Rasool

    2014-01-01

    A combined process of ammonium sulfate precipitation (salting out) and ion-exchange chromatography on DEAE-Sepharose CL-6B was used to prepare camel antivenom (IgG) against Naja Naja Oxiana for therapy. In the ammonium sulfate precipitation, the best condition for fractionation of IgG from the other proteins in camel serum was 55% precipitate. The camel IgG presented as 2 bands with molecular masses of 250 and 100 kDa, the latter corresponding to heavy chain IgG, on 10% gel electrophoresis. A trace amount of non-IgG proteins was not isolated and remained in this precipitate. Therefore in order to effectively separate albumin and the other nonspecific proteins from the IgG, the 25% precipitate of ammonium sulfate precipitation of serum was subjected to DEAE-Sepharose CL-6B column chromatography. A peak of antibody (IgG) could be obtained by elution with sodium phosphate buffer. In this stage, 2 bands of molecular masses of 150 and 75 kDa were observed on 7% gel electrophoresis. A comparative study was performed between camel IgG and conventional horse F(ab)2 antivenoms in term of potency (serum neutralization test and ELISA). Our results showed that the potency of camel antivenom was 4-fold higher than that of horse. It is suggested the combined ammonium sulfate precipitation and ion-exchange chromatography process effectively removed residual proteins in the final camel IgG preparation and can be a suitable method for large-scale refinement of therapeutic camel antivenoms. PMID:24642472

  1. Mass: 100 mg, 10 g, 100 g, 1 kg, 10 kg and 50 kg

    NASA Astrophysics Data System (ADS)

    Kaçmaz, Sevda; Davidson, Stuart

    2017-01-01

    Bilateral mass comparison of mass standards of 100 mg, 2 g, 20 g, 500 g and 10 kg was carried out in 2011 to 2012 between UME and NPL. UME was the pilot laboratory. For all mass standards, the results show adequate agreement between the laboratories. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  2. Determination of soluble immunoglobulin G in bovine colostrum products by Protein G affinity chromatography-turbidity correction and method validation.

    PubMed

    Holland, Patrick T; Cargill, Anne; Selwood, Andrew I; Arnold, Kate; Krammer, Jacqueline L; Pearce, Kevin N

    2011-05-25

    Immunoglobulin-containing food products and nutraceuticals such as bovine colostrum are of interest to consumers as they may provide health benefits. Commercial scale colostrum products are valued for their immunoglobulin G (IgG) content and therefore require accurate analysis. One of the most commonly used methods for determining total soluble IgG in colostrum products is based on affinity chromatography using a Protein G column and UV detection. This paper documents improvements to the accuracy of the Protein G analysis of IgG in colostrum products, especially those containing aggregated forms of IgG. Capillary electrophoresis-sodium dodecyl sulfate (CE-SDS) analysis confirmed that aggregated IgG measured by Protein G does not contain significant amounts of casein or other milk proteins. Size exclusion chromatography identified the content of soluble IgG as mainly monomeric IgG and aggregated material MW > 450 kDa with small amounts of dimer and trimer. The turbidity of the eluting IgG, mainly associated with aggregated IgG, had a significant effect on the quantitative results. Practical techniques were developed to correct affinity LC data for turbidity on an accurate, consistent, and efficient basis. The method was validated in two laboratories using a variety of colostrum powders. Precision for IgG was 2-3% (RSD(r)) and 3-12% (RSD(R)). Recovery was 100.2 ± 2.4% (mean ± RSD, n = 10). Greater amounts of aggregated IgG were solubilized by a higher solution:sample ratio and extended times of mixing or sonication, especially for freeze-dried material. It is concluded that the method without acid precipitation and with turbidity correction provides accurate, precise, and robust data for total soluble IgG and is suitable for product specification and quality control of colostrum products.

  3. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction.

    PubMed

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009-2.718, p = 0.046). Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes.

  4. The Effect of PAI-1 4G/5G Polymorphism and Clinical Factors on Coronary Artery Occlusion in Myocardial Infarction

    PubMed Central

    Parpugga, Tajinder Kumar; Tatarunas, Vacis; Skipskis, Vilius; Kupstyte, Nora; Zaliaduonyte-Peksiene, Diana; Lesauskaite, Vaiva

    2015-01-01

    Objective. Data on the impact of PAI-1-675 4G/5G genotype for fibrinolysis during myocardial infarction are inconsistent. The aim of our study was to evaluate the association of clinical and genetic (PAI-1-675 4G/5G polymorphism) factors with coronary artery occlusion in patients with myocardial infarction. Materials and Methods. PAI-1-675 4G/5G detection was achieved by using Sanger sequencing in a sample of patients hospitalized for stent implantation due to myocardial infarction. We categorized the patients into two groups: patients with coronary artery occlusion and patients without coronary artery occlusion according to angiographic evaluation. Results. We identified n = 122 (32.4%) 4G/4G, n = 186 (49.5%) 4G/5G, and n = 68 (18.1%) 5G/5G PAI-1 genotype carriers. Univariate and multivariate analysis showed that only the 4G/5G genotype was associated with coronary artery occlusion (OR: 1.656 and 95% CI: 1.009–2.718, p = 0.046). Conclusions. Our results showed that carriers of PAI-1 4G/5G genotype with myocardial infarction have increased odds of coronary artery occlusion more than 1.6 times in comparison to the carriers of homozygous genotypes. PMID:26273123

  5. Soluble HLA-G: Are They Clinically Relevant?

    PubMed Central

    Pistoia, Vito; Morandi, Fabio; Wang, Xinhui; Ferrone, Soldano

    2007-01-01

    HLA-G is a non-classical HLA-class Ib molecule with multiple immunoregulatory properties. Its main function in physiological conditions is to abrogate maternal NK cell activity against foetal tissue and to establish immune tolerance at maternal-foetal interface. HLA-G is expressed not only as a membrane bound molecule on the surface of cells, but also as a soluble moiety in body fluids. The major isoforms of HLA-G present in serum are soluble HLA-G1 and HLA-G5 which are generated by shedding or proteolytic cleavage of the membrane bound isoform and by secretion of a soluble isoform, respectively. Here we review the data about soluble HLA-G (sHLA-G) serum levels in different pathological conditions, including immune-mediated disorders, transplantation, and malignancies. In particular, we focus on sHLA-G expression and function in human neuroblastoma, a pediatric tumor, with special emphasis on a novel potential immuno escape mechanism utilized by NB to instruct monocytes to produce and release sHLA-G. Finally, the potential clinical relevance of sHLA-G serum levels is discussed. PMID:17825579

  6. A spatial focusing model for G protein signals. Regulator of G protein signaling (RGS) protien-mediated kinetic scaffolding.

    PubMed

    Zhong, Huailing; Wade, Susan M; Woolf, Peter J; Linderman, Jennifer J; Traynor, John R; Neubig, Richard R

    2003-02-28

    Regulators of G protein signaling (RGS) are GTPase-accelerating proteins (GAPs), which can inhibit heterotrimeric G protein pathways. In this study, we provide experimental and theoretical evidence that high concentrations of receptors (as at a synapse) can lead to saturation of GDP-GTP exchange making GTP hydrolysis rate-limiting. This results in local depletion of inactive heterotrimeric G-GDP, which is reversed by RGS GAP activity. Thus, RGS enhances receptor-mediated G protein activation even as it deactivates the G protein. Evidence supporting this model includes a GTP-dependent enhancement of guanosine 5'-3-O-(thio)triphosphate (GTPgammaS) binding to G(i) by RGS. The RGS domain of RGS4 is sufficient for this, not requiring the NH(2)- or COOH-terminal extensions. Furthermore, a kinetic model including only the GAP activity of RGS replicates the GTP-dependent enhancement of GTPgammaS binding observed experimentally. Finally in a Monte Carlo model, this mechanism results in a dramatic "spatial focusing" of active G protein. Near the receptor, G protein activity is maintained even with RGS due to the ability of RGS to reduce depletion of local Galpha-GDP levels permitting rapid recoupling to receptor and maintained G protein activation near the receptor. In contrast, distant signals are suppressed by the RGS, since Galpha-GDP is not depleted there. Thus, a novel RGS-mediated "kinetic scaffolding" mechanism is proposed which narrows the spatial range of active G protein around a cluster of receptors limiting the spill-over of G protein signals to more distant effector molecules, thus enhancing the specificity of G(i) protein signals.

  7. STS-41G earth observations

    NASA Image and Video Library

    1984-10-08

    41G-38-060 (5-13 Oct 1984) --- A large ship wake in the central Mediterranean Sea is highlighted by sunglint in this handheld camera's view from STS-41G. According to NASA and U.S. Navy scientists studying the STS-41G film, the depicted reflectance is similar to oil slicks seen in the various oceans of the world. They note that it is apparent that a ship is pumping a mixture of bilge water and oil overboard. The crew consisted of astronauts Robert L. Crippen, commander; Jon A. McBride, pilot; mission specialist's Kathryn D. Sullivan, Sally K. Ride, and David D. Leestma; Canadian astronaut Marc Garneau; and Paul D. Scully-Power, payload specialist. EDITOR'S NOTE: The STS-41G mission had the first American female EVA (Sullivan); first seven-person crew; first orbital fuel transfer; and the first Canadian (Garneau).

  8. 4G/5G plasminogen activator inhibitor-1 and -308 A/G tumor necrosis factor-α promoter gene polymorphisms in Argentinean lupus patients: focus on lupus nephritis.

    PubMed

    Muñoz, Sebastián Andrés; Aranda, Federico; Allievi, Alberto; Orden, Alberto Omar; Perés Wingeyer, Silvia; Trobo, Rosana; Alvarez, Analía; Eimon, Alicia; Barreira, Juan Carlos; Schneeberger, Emilce; Dal Pra, Fernando; Sarano, Judith; Hofman, Julio; Chamorro, Julián; de Larrañaga, Gabriela

    2014-02-01

    We investigated the relationship between the 4G/5G plasminogen activator inhibitor (PAI-1) and -308 A/G tumor necrosis factor-α (TNF-α) polymorphisms and the clinical and biochemical features of systemic lupus erythematosus (SLE) in an Argentinean patient cohort. A total of 402 patients were studied, including 179 SLE patients and 223 healthy individuals. PCR-RLFP was used to determine the genotypes of the 4G/5G PAI-1 and -308 A/G TNF-α polymorphisms. SLE patients with lupus nephritis (LN) (n = 86) were compared with patients without LN (n = 93). Additionally, LN patients were divided into proliferative LN and non-proliferative LN groups according to the results of the renal biopsies. No significant differences were noted in the genotype distributions or allele frequencies of these TNF-α and PAI-1 polymorphisms between SLE patients and controls. There were higher numbers of criteria for SLE, more lupus flares and higher damage scores in LN patients, but there were similar frequencies of anti-phospholipid antibody (APA) positivity and anti-phospholipid syndrome. No significant difference was noted for any studied variable between the proliferative LN and non-proliferative LN groups except for the presence of APA. We found no significant differences in the TNF-α and PAI-1 genotype distributions or allele frequencies between groups. We found that the -308 A/G TNF-α and 4G/5G PAI-1 polymorphisms are not associated with susceptibility to SLE in an Argentinean population. We also did not find any association between the presence of any specific allele or genotype and the development of LN in SLE patients. Finally, no association was noted between either of the two polymorphisms and the severity of renal disease.

  9. The g-modes of white dwarfs

    NASA Technical Reports Server (NTRS)

    Sobouti, Y.; Khajehpour, M. R. H.; Dixit, V. V.

    1980-01-01

    The neutral g-modes of a degenerate fluid at zero temperature are analyzed. The g-modes of a degenerate fluid at finite but small temperatures are then expanded in terms of those of the zero temperature fluid. For nonrelativistic degenerate fluids it is found that (1) the g-eigenvalues are proportional to T mu(6)sub e mu(-1)sub i, where T is the internal temperature of the fluid, mu sub e and mu sub i are the mean molecular weights of electrons and ions, respectively; (2) the ion pressure is solely responsible for driving the g-modes. For white dwarfs of about a solar mass, the periods of the g-oscillations are in the range of a few hundredths of seconds.

  10. [IgG4 immunohistochemistry in Riedle thyroiditis].

    PubMed

    Wang, S; Luo, Y F; Cao, J L; Zhang, H; Shi, X H; Liang, Z Y; Feng, R E

    2017-03-08

    Objective: To observe the histopathological changes and immunohistochemical expression of IgG4 in Riedle thyroiditis (RT) and to study the relationship between RT and IgG4-related diseases (IgG4-RD). Methods: A total of 5 RT patients were collected from the Department of Pathology, Peking Union Medical College Hospital during April 2012 to August 2014. The clinical and immunohistochemical features were analyzed in the 5 patients. Histopathologic analysis was performed on hematoxylin and eosin-stained sections. Results: There were one male and four female patients, aged 52 to 78 years (median 59 years). Five cases were characterized by multiple nodules of thyroid, which increased year by year. All patients were found to have surrounding tissue compression symptoms and signs. Two female patients were found to have hypothyroidism. The serum concentration of IgG was elevated in 2 cases, and the serum concentration of IgG was not tested before operation in the remaining patients. By ultrasound, all presented as low echo or medium low echo. Strong echo occasionally appeared in hypoechoic nodules. Microscopically, fibrous tissue hyperplasia was infiltrated with varying numbers of lymphocytes and plasma cells. The occlusion of phlebitis was found in 4 cases and eosinophils were found in 3 cases. IgG4 counts and IgG4/IgG ratios in 5 cases were 20/HPF, 16%; 60/HPF, 82%; 22/HPF, 28%; 400/HPF, 266% and 33/HPF, 71%, respectively. Conclusions: With the similar pathological manifestations between RT and IgG4-RD, immunohistochemical staining shows that the number of IgG4 positive plasma cells and IgG4/IgG ratio of RT are increased in varying degrees. Some cases meet the diagnostic criteria of IgG4-RD, and speculate that some cases of RT belong to IgG4-RD.

  11. Tandem application of ligand-based virtual screening and G4-OAS assay to identify novel G-quadruplex-targeting chemotypes.

    PubMed

    Musumeci, Domenica; Amato, Jussara; Zizza, Pasquale; Platella, Chiara; Cosconati, Sandro; Cingolani, Chiara; Biroccio, Annamaria; Novellino, Ettore; Randazzo, Antonio; Giancola, Concetta; Pagano, Bruno; Montesarchio, Daniela

    2017-05-01

    G-quadruplex (G4) structures are key elements in the regulation of cancer cell proliferation and their targeting is deemed to be a promising strategy in anticancer therapy. A tandem application of ligand-based virtual screening (VS) calculations together with the experimental G-quadruplex on Oligo Affinity Support (G4-OAS) assay was employed to discover novel G4-targeting compounds. The interaction of the selected compounds with the investigated G4 in solution was analysed through a series of biophysical techniques and their biological activity investigated by immunofluorescence and MTT assays. A focused library of 60 small molecules, designed as putative G4 groove binders, was identified through the VS. The G4-OAS experimental screening led to the selection of 7 ligands effectively interacting with the G4-forming human telomeric DNA. Evaluation of the biological activity of the selected compounds showed that 3 ligands of this sub-library induced a marked telomere-localized DNA damage response in human tumour cells. The combined application of virtual and experimental screening tools proved to be a successful strategy to identify new bioactive chemotypes able to target the telomeric G4 DNA. These compounds may represent useful leads for the development of more potent and selective G4 ligands. Expanding the repertoire of the available G4-targeting chemotypes with improved physico-chemical features, in particular aiming at the discovery of novel, selective G4 telomeric ligands, can help in developing effective anti-cancer drugs with fewer side effects. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. G2 Flywheel Module Design

    NASA Technical Reports Server (NTRS)

    Jensen, Ralph H.; Dever, Timothy P.

    2006-01-01

    Design of a flywheel module, designated the G2 module, is described. The G2 flywheel is a 60,000 RPM, 525 W-hr, 1 kW system designed for a laboratory environment; it will be used for component testing and system demonstrations, with the goal of applying flywheels to aerospace energy storage and integrated power and attitude control (IPACS) applications. G2 has a modular design, which allows for new motors, magnetic bearings, touchdown bearings, and rotors to be installed without a complete redesign of the system. This design process involves several engineering disciplines, and requirements are developed for the speed, energy storage, power level, and operating environment. The G2 rotor system consists of a multilayer carbon fiber rim with a titanium hub on which the other components mount, and rotordynamics analysis is conducted to ensure rigid and flexible rotor modes are controllable or outside of the operating speed range. Magnetic bearings are sized using 1-D magnetic circuit analysis and refined using 3-D finite element analysis. The G2 magnetic bearing system was designed by Texas A&M and has redundancy which allows derated operation after the loss of some components, and an existing liquid cooled two pole permanent magnet motor/generator is used. The touchdown bearing system is designed with a squeeze film damper system allowing spin down from full operating speed in case of a magnetic bearing failure. The G2 flywheel will enable module level demonstrations of component technology, and will be a key building block in system level attitude control and IPACS demonstrations.

  13. G-Protein-Coupled Estrogen Receptor Antagonist G15 Decreases Estrogen-Induced Development of Non-Small Cell Lung Cancer.

    PubMed

    Liu, Changyu; Liao, Yongde; Fan, Sheng; Fu, Xiangning; Xiong, Jing; Zhou, Sheng; Zou, Man; Wang, Jianmiao

    2017-08-25

    G-protein-coupled estrogen receptor (GPER) was found to promote Non-small cell lung cancer (NSCLC) by estrogen, indicating the potential necessity of inhibiting GPER by selective antagonist. This study was performed to elucidate the function of GPER selective inhibitor G15 in NSCLC development. Cytoplasmic GPER (cGPER) and nuclear GPER (nGPER) were detected by immunohistochemical analysis in NSCLC samples. The relation of GPER and estrogen receptor β (ERβ) expression and correlation between GPER, ERβ and clinical factors were analyzed. The effects of activating GPER and function of G15 were analyzed in proliferation of A549, H1793 cell lines and development of urethane-induced adenocarcinoma. Overexpression of cGPER and nGPER was detected in 80.49% (120/150) and 52.00% (78/150) of the NSCLC samples. High expression of GPER related with higher stages, poorer differentiation and high expression of ERβ. Protein level of GPER in A549 and H1793 cell lines increased by treatment of E2, G1 (GPER agonist) or Ful (fulvestrant, ERβ antagonist), and decreased by G15. Administration with G15 reversed the E2- or G1-induced cell growth by inhibiting GPER. In urethane-induced adenocarcinoma mice, number of tumor nodules and tumor index increased in E2 or G1 group and decreased by treatment of G15. These findings deomonstrate that using of G15 to block GPER signaling may be considered as a new therapeutic target in NSCLC.

  14. PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

    PubMed

    Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

    2012-12-01

    Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.

  15. G-spot anatomy: a new discovery.

    PubMed

    Ostrzenski, Adam

    2012-05-01

    The anatomic existence of the G-spot has not been documented yet. To identify the anatomic structure of the G-spot.   A stratum-by-stratum vaginal wall dissection on a fresh cadaver. Primary outcome is the identification of the G-spot and the secondary outcome is its measurements and anatomic description of the G-spot. The G-spot has a distinguishable anatomic structure that is located on the dorsal perineal membrane, 16.5 mm from the upper part of the urethral meatus, and creates a 35° angle with the lateral border of the urethra. The lower pole (tail) and the upper pole (head) were located 3 and 15 mm next to the lateral border of the urethra, respectively. Grossly, the G-spot appeared as a well-delineated sac with walls that resembled fibroconnective tissues and resembled erectile tissues. The superior surface of the sac had bluish irregularities visible through the coat. Upon opening the sac's upper coat, blue grape-like anatomic compositions of the G-spot emerged with dimensions of length (L) of 8.1 mm × width (W) of 3.6-1.5 mm × height (H) of 0.4 mm. The G-spot structure had three distinct areas: the proximal part (the head) L 3.4 mm × W 3.6 mm, the middle part L 3.1 mm × W 3.3 mm, and the distal part (tail) L 3.3 mm × W 3.0 mm. From the distal tail, a rope-like structure emerged, which was seen for approximately 1.6 mm and then disappeared into the surrounding tissue. The anatomic existence of the G-spot was documented with potential impact on the practice and clinical research in the field of female sexual function. © 2012 International Society for Sexual Medicine.

  16. Plasminogen Activator Inhibitor-1 4G/5G Polymorphism is Associated with Reproductive Failure: Metabolic, Hormonal, and Immune Profiles.

    PubMed

    Salazar Garcia, Maria D; Sung, Nayoung; Mullenix, Thomas M; Dambaeva, Svetlana; Beaman, Kenneth; Gilman-Sachs, Alice; Kwak-Kim, Joanne

    2016-07-01

    Association between PAI-1 4G/5G polymorphism and reproductive failures has been postulated. We aimed to investigate its impact on metabolic, hormonal, and immune profiles of women with reproductive failures. A retrospective study was carried out in 208 women with a history of reproductive failure. Study patients were divided into three groups: women with repeated implantation failure (RIF, n = 40), recurrent pregnancy loss (RPL, n = 113), and both RIF and RPL (n = 55). Fertile controls were 92. PAI-1 4G/4G was prevalent in RPL, RIF, and RIF/RPL groups when compared with controls (P = 0.003) and associated with increased risks of RIF, RPL, and RIF with RPL (OR = 4.5, 2.2 and 2.7). Women with PAI-1 4G/4G have significantly higher BMI, glucose, and PAI-1 levels and lower NK cytotoxicity when compared with women without PAI-1 4G/4G. PAI-1 4G/5G polymorphism plays a major role in the pathogenesis of RPL and RIF by altering metabolic and immunological profiles. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Meta-analysis of the association between plasminogen activator inhibitor-1 4G/5G polymorphism and recurrent pregnancy loss.

    PubMed

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-04-11

    The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34-2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44-3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84-2.59; P=0.18). In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians.

  18. g-Factors in the (sdg) boson model

    NASA Astrophysics Data System (ADS)

    Morrison, I.

    1986-07-01

    The role of the g-boson in producing first-order variations in the g-factors of states in rotational nuclei is investigated. It is shown that the g-boson is unlikely to contribute directly to any observed g-factor variations in the ground-state band.

  19. Experimental and theoretical investigation of homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → products (n = 1, 2).

    PubMed

    Li, Zhuangjie; Zhang, Baoquan

    2012-09-13

    Decreasing CO2 emissions into the atmosphere is key for reducing global warming. To facilitate the CO2 emission reduction efforts, our laboratory conducted experimental and theoretical investigations of the homogeneous gaseous reaction of CO2(g) + nH2O(g) + nNH3(g) → (NH4)HCO3(s)/(NH4)2CO3(s) (n = 1 and 2) using Fourier transform infrared attenuated total reflectance (FTIR-ATR) spectroscopy and ab initio molecular orbital theory. Our FTIR-ATR experimental results indicate that (NH4)2CO3(s) and (NH4)HCO3(s) are formed as aerosol particulate matter when carbon dioxide reacts with ammonia and water in the gaseous phase at room temperature. Ab initio study of this chemical system suggested that the reaction may proceed through formation of NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes. Subsequent complexes, NH3·H2O·CO2 and (NH3)2·H2O·CO2, can be formed by adding gaseous reactants to the NH3·H2O(g), NH3·CO2(g), and CO2·H2O(g) complexes, respectively. The NH3·H2O·CO2 and (NH3)2·H2O·CO2 complexes can then be rearranged to produce (NH4)HCO3 and (NH4)2CO3 as final products via a transition state, and the NH3 molecule acts as a medium accepting and donating hydrogen atoms in the rearrangement process. Our computational results also reveal that the presence of an additional water molecule can reduce the activation energy of the rearrangement process. The high activation energy predicted in the present work suggests that the reaction is kinetically not favored, and our experimental observation of (NH4)HCO3(s) and (NH4)2CO3(s) may be attributed to the high concentrations of reactants increasing the reaction rate of the title reactions in the reactor.

  20. The role of TPA I/D and PAI-1 4G/5G polymorphisms in multiple sclerosis.

    PubMed

    Zivković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Lavtar, Polona; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Jazbec, Saša Sega; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut; Ristić, Smiljana

    2014-01-01

    Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63-0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01-1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06-1.82, P = 0.017). We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS.

  1. The Role of TPA I/D and PAI-1 4G/5G Polymorphisms in Multiple Sclerosis

    PubMed Central

    Živković, Maja; Starčević Čizmarević, Nada; Lovrečić, Luca; Klupka-Sarić, Inge; Stanković, Aleksandra; Gašparović, Iva; Dinčić, Evica; Stojković, Ljiljana; Rudolf, Gorazd; Šega Jazbec, Saša; Perković, Olivio; Sinanović, Osman; Sepčić, Juraj; Kapović, Miljenko; Peterlin, Borut

    2014-01-01

    Background. Previous studies have shown impaired fibrinolysis in multiple sclerosis (MS) and implicated extracellular proteolytic enzymes as important factors in demyelinating neuroinflammatory disorders. Tissue-type plasminogen activator (t-PA) and its inhibitor (PAI-1) are key molecules in both fibrinolysis and extracellular proteolysis. In the present study, an association of the TPA Alu I/D and PAI-1 4G/5G polymorphisms with MS was analyzed within the Genomic Network for Multiple Sclerosis (GENoMS). Methods. The GENoMS includes four populations (Croatian, Slovenian, Serbian, and Bosnian and Herzegovinian) sharing the same geographic location and a similar ethnic background. A total of 885 patients and 656 ethnically matched healthy blood donors with no history of MS in their families were genotyped using PCR-RFLP. Results. TPA DD homozygosity was protective (OR = 0.79, 95% CI 0.63–0.99, P = 0.037) and PAI 5G5G was a risk factor for MS (OR = 1.30, 95% CI 1.01–1.66, P = 0.038). A significant effect of the genotype/carrier combination was detected in 5G5G/I carriers (OR = 1.39 95% CI 1.06–1.82, P = 0.017). Conclusions. We found a significantly harmful effect of the combination of the PAI-1 5G/5G genotype and TPA I allele on MS susceptibility, which indicates the importance of gene-gene interactions in complex diseases such as MS. PMID:24825926

  2. Limitations of a hemolytic plaque assay for IgG-anti-IgG rheumatoid factor-producing cells.

    PubMed

    Venn, A J; Dresser, D W

    1987-09-24

    An attempt has been made to develop a hemolytic plaque assay capable of detecting homophile IgG rheumatoid factor (RF)-producing cells. Anti-immunoglobulin allotype-developing reagents were used to distinguish between target and effector IgG. The hemolytic assay has been used to demonstrate an apparently high level of homophile IgM and IgG RF-producing cells in the spleens and lymph nodes of mice stimulated by LPS. However, it appears that a large proportion of the plaques obtained in these assays are due to an artefact resulting from cross-linking of target and effector molecules by the developing reagents. In the case of IgM RF the artefact depends on the presence of a small contamination of the target IgG by IgM, allowing cross-linking of target and effector IgM by the anti-mu-specific developing reagent. With the IgG RF, cross-reactivity of the rabbit anti-Ighb allotype-developing serum for the 'wrong' (Igha) allotype, normally undetectable, becomes sufficient to be biologically relevant when the developing antibody is complexed by being bound to its target (Ighb) allotype. Nevertheless anti-allotype reagents may afford an accurate means of detecting homophile IgG RF producing cells using other assay systems.

  3. A soluble form of Epstein-Barr virus gH/gL inhibits EBV-induced membrane fusion and does not function in fusion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rowe, Cynthia L.; Connolly, Sarah A.; Chen, Jia

    We investigated whether soluble EBV gH/gL (sgH/gL) functions in fusion and made a series of truncations of gH/gL domains based on the gH/gL crystal structure. We found sgH/gL failed to mediate cell-cell fusion both when co-expressed with the other entry glycoproteins and when added exogenously to fusion assays. Interestingly, sgH/gL inhibited cell-cell fusion in a dose dependent manner when co-expressed. sgH/gL from HSV was unable to inhibit EBV fusion, suggesting the inhibition was specific to EBV gH/gL. sgH/gL stably binds gp42, but not gB nor gH/gL. The domain mutants, DI/gL, DI-II/gL and DI-II-III/gL were unable to bind gp42. Instead, DI-II/gL,more » DI-II-III/gL and sgH/gL but not DI/gL decreased the expression of gp42, resulting in decreased overall fusion. Overall, our results suggest that domain IV may be required for proper folding and the transmembrane domain and cytoplasmic tail of EBV gH/gL are required for the most efficient fusion.« less

  4. 12 CFR 563g.14 - Waiver.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Waiver. 563g.14 Section 563g.14 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.14 Waiver. (a) The Office may waive any requirement of this part, or any required information: (1) Determined to be...

  5. [Pseudolaric acid B induces G2/M arrest and inhibits invasion and migration in HepG2 hepatoma cells].

    PubMed

    Li, Shuai; Guo, Lianyi

    2018-01-01

    Objective To investigate the mechanisms of pseudolaric acid B (PAB) blocks cell cycle and inhibits invasion and migration in human hepatoma HepG2 cells. Methods The proliferation effect of PAB on HepG2 cells was evaluated by MTT assay. The effect of PAB on the cell cycle of HepG2 cells was analyzed by flow cytometry. Immunofluorescence cytochemical staining was applied to observe the effect of PAB on the α-tubulin polymerization and expression in HepG2 cells. Transwell TM chamber invasion assay and wound healing assay were performed to detect the influence of PAB on the migration and invasion ability of HepG2 cells. Western blotting was used to determine the expressions of α-tubulin, E-cadherin and MMP-9 in HepG2 cells after treated with PAB. Results PAB inhibited the proliferation of HepG2 cells in a dose-dependent manner and blocked the cell cycle in G2/M phase. PAB significantly changed the polymerization and decreased the expression of α-tubulin. The capacities of invasion and migration of HepG2 cells treated by PAB were significantly depressed. The protein levels of α-tubulin and MMP-9 decreased while the E-cadherin protein level increased. Conclusion PAB can inhibits the proliferation of HepG2 cells by down-regulating the expression of α-tubulin and influencing its polymerization, arresting HepG2 cells in G2/M phase. Meanwhile, PAB also can inhibit the invasion and migration of HepG2 cells by lowering cytoskeleton α-tubulin and MMP-9, and increasing E-cadherin.

  6. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  7. Construction of brewing-wine Aspergillus oryzae pyrG- mutant by pyrG gene deletion and its application in homology transformation.

    PubMed

    Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen

    2014-06-01

    pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  8. [G-CSF administration following autologous peripheral blood stem cell transplantation--the effect of G-CSF level on neutrophil recovery].

    PubMed

    Saigo, K; Sugimoto, T; Matsuo, M; Narita, H; Ryo, R; Kumagai, S

    2000-03-01

    We studied the usefulness of rhG-CSF (filgrastim) administration in patients who received autologous peripheral blood stem cell transplantation (PBSCT) combined with super-high dose chemotherapy. Twenty patients received 0-8.3 micrograms/kg/day filgrastim after PBSCT. There was a significant relationship between G-CSF dose and the neutrophil recovery rate, and the highest levels of serum G-CSF tended to correlate with neutrophil recovery rate. The highest G-CSF level after 75 micrograms injection in normal volunteers is reported to be 1,500 pg/ml. On the other hand, as one patient in our series exhibited extremely high endogenous G-CSF of 11,500 pg/ml, measurements of G-CSF might reduce the over-administration of rhG-CSF.

  9. IgG abnormality in narcolepsy and idiopathic hypersomnia.

    PubMed

    Tanaka, Susumu; Honda, Makoto

    2010-03-05

    A close association between narcolepsy and the Human Leukocyte Antigen (HLA)-DQB1*0602 allele suggests the involvement of the immune system, or possibly an autoimmune process. We investigated serum IgG levels in narcolepsy. We measured the serum total IgG levels in 159 Japanese narcolepsy-cataplexy patients positive for the HLA-DQB1*0602 allele, 28 idiopathic hypersomnia patients with long sleep time, and 123 healthy controls (the HLA-DQB1*0602 allele present in 45 subjects). The serum levels of each IgG subclass were subsequently measured. The distribution of serum IgG was significantly different among healthy controls negative for the HLA-DQB1*0602 allele (11.66+/-3.55 mg/ml), healthy controls positive for the HLA-DQB1*0602 allele (11.45+/-3.43), narcolepsy patients (9.67+/-3.38), and idiopathic hypersomnia patients (13.81+/-3.80). None of the following clinical variables, age, disease duration, Epworth Sleepiness Scale, smoking habit and BMI at the time of blood sampling, were associated with IgG levels in narcolepsy or idiopathic hypersomnia. Furthermore we found the decrease in IgG1 and IgG2 levels, stable expression of IgG3, and the increase in the proportion of IgG4 in narcolepsy patients with abnormally low IgG levels. The increase in the proportion of IgG4 levels was also found in narcolepsy patients with normal serum total IgG levels. Idiopathic hypersomnia patients showed a different pattern of IgG subclass distribution with high IgG3 and IgG4 level, low IgG2 level, and IgG1/IgG2 imbalance. Our study is the first to determine IgG abnormalities in narcolepsy and idiopathic hypersomnia by measuring the serum IgG levels in a large number of hypersomnia patients. The observed IgG abnormalities indicate humoral immune alterations in narcolepsy and idiopathic hypersomnia. Different IgG profiles suggest immunological differences between narcolepsy and idiopathic hypersomnia.

  10. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic

  11. Meta-Analysis of the Association between Plasminogen Activator Inhibitor-1 4G/5G Polymorphism and Recurrent Pregnancy Loss

    PubMed Central

    Li, Xuejiao; Liu, Yukun; Zhang, Rui; Tan, Jianping; Chen, Libin; Liu, Yinglin

    2015-01-01

    Background The association between plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism and recurrent pregnancy loss (RPL) risk is still contradictory. We thus performed a meta-analysis. Material/Methods Relevant studies were searched for in PubMed, Web of Science, Embase, and Cochrane Library. An odds ratio (OR) with a 95% confidence interval (CI) was used to assess the association between PAI-1 4G/5G polymorphism and RPL risk. Results A total of 22 studies with 4306 cases and 3076 controls were included in this meta-analysis. We found that PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk (OR=1.89; 95% CI 1.34–2.67; P=0.0003). In the subgroup analysis by race, PAI-1 4G/5G polymorphism was significantly associated with an increased RPL risk in Caucasians (OR=2.23; 95% CI 1.44–3.46; P=0.0003). However, no significant association was observed in Asians (OR=1.47; 95% CI 0.84–2.59; P=0.18). Conclusions In conclusion, this meta-analysis suggests that PAI-1 4G/5G polymorphism might be associated with RPL development in Caucasians. PMID:25862335

  12. 20 g PPV with indocyanine green-assisted ILM peeling versus 23 g PPV with brilliant blue G-assisted ILM peeling for epiretinal membrane.

    PubMed

    Manousaridis, Kleanthis; Peter, Silvia; Mennel, Stefan

    2016-06-01

    To compare the anatomical and visual outcomes of 20 gauge (g) pars plana vitrectomy (PPV) with indocyanine green (ICG)-assisted internal limiting membrane (ILM) peeling and 23 g PPV with brilliant blue G (BBG)-assisted ILM peeling for idiopathic epiretinal membrane (ERM). 38 eyes of 38 patients with idiopathic ERM were included. They were divided in two groups: group 1 (18 eyes) underwent 20 g PPV with ICG-assisted ILM peeling and group 2 (20 eyes) 23 g PPV with BBG-assisted ILM peeling. Postoperative best-corrected visual acuity (BCVA) and central macular thickness (CMT) were compared. Average BCVA in group 1 improved significantly from 0.60 logarithm of the minimal angle of resolution (log MAR) at baseline to 0.3 log MAR postoperatively. Average BCVA in group 2 improved significantly from 0.60 log MAR at baseline to 0.3 log MAR postoperatively. Mean CMT reduced significantly from 473 to 375 μm in group 1 and from 486 to 396 μm in group 2. There were no significant differences in the BCVA and CMT between the groups. Both surgical methods appeared to be safe and provided similar anatomical and visual outcomes.

  13. Role of immunoglobulin G subclasses in Q fever.

    PubMed

    Camacho, M T; Outschoorn, I; Tellez, A

    1995-12-01

    The progression of Q fever to either acute or chronic disease has been attributed both to biological characteristics of the bacteria and to the host immune response. In order to determine whether a specific immunoglobulin G (IgG) subclass distribution could play a diagnostic or prognostic role in Q fever, IgG subclass levels were measured in patients with acute or chronic disease. It was observed that (i) IgG1 and IgG3 levels were elevated in patients with chronic Q fever compared to patients with acute disease or normal controls; (ii) variations over time reflected inverse complementary relationships of subclass levels, such as between IgG1 and IgG3 compared with IgG2 and IgG4, or an inverse relationship between IgG1 and IgG2; (iii) variations in IgG2 and IgG3 total subclass levels during follow-up of patients with chronic Q fever showed a decrease in IgG2 with a concomitant increase in IgG3 two years from disease onset. These findings indicate that measurements of IgG subclasses may be a simple, additional tool useful in the diagnosis of Q fever. This data raises the question of an unusual immunoregulatory mechanism in Q fever that is implicated in the presentation of the clinical disease.

  14. The -675 4G/5G polymorphism in plasminogen activator inhibitor-1 gene is associated with risk of asthma: a meta-analysis.

    PubMed

    Nie, Wei; Li, Bing; Xiu, Qing-Yu

    2012-01-01

    A number of studies assessed the association of -675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12-2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06-1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17-2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07-1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08-1.68, P = 0.008). This meta-analysis suggested that the -675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma.

  15. Relative stabilities of IgG1 and IgG4 Fab domains: Influence of the light–heavy interchain disulfide bond architecture

    PubMed Central

    Heads, James T; Adams, Ralph; D'Hooghe, Lena E; Page, Matt J T; Humphreys, David P; Popplewell, Andrew G; Lawson, Alastair D; Henry, Alistair J

    2012-01-01

    The stability of therapeutic antibodies is a prime pharmaceutical concern. In this work we examined thermal stability differences between human IgG1 and IgG4 Fab domains containing the same variable regions using the thermofluor assay. It was found that the IgG1 Fab domain is up to 11°C more stable than the IgG4 Fab domain containing the same variable region. We investigated the cause of this difference with the aim of developing a molecule with the enhanced stability of the IgG1 Fab and the biological properties of an IgG4 Fc. We found that replacing the seven residues, which differ between IgG1 CH1 and IgG4 CH1 domains, while retaining the native IgG1 light-heavy interchain disulfide (L–H) bond, did not affect thermal stability. Introducing the IgG1 type L–H interchain disulfide bond (DSB) into the IgG4 Fab resulted in an increase in thermal stability to levels observed in the IgG1 Fab with the same variable region. Conversely, replacement of the IgG1 L–H interchain DSB with the IgG4 type L–H interchain DSB reduced the thermal stability. We utilized the increased stability of the IgG1 Fab and designed a hybrid antibody with an IgG1 CH1 linked to an IgG4 Fc via an IgG1 hinge. This construct has the expected biophysical properties of both the IgG4 Fc and IgG1 Fab domains and may therefore be a pharmaceutically relevant format. PMID:22761163

  16. A novel inactivated gE/gI deleted pseudorabies virus (PRV) vaccine completely protects pigs from an emerged variant PRV challenge.

    PubMed

    Gu, Zhenqing; Dong, Jing; Wang, Jichun; Hou, Chengcai; Sun, Haifeng; Yang, Wenping; Bai, Juan; Jiang, Ping

    2015-01-02

    A highly virulent and antigenic variant of pseudorabies virus (PRV) broke out in China at the end of 2011 and caused great economic loss in the pig industry. In this study, an infectious bacterial artificial chromosome (BAC) clone containing the full-length genome of the emerged variant PRV ZJ01 strain was generated. The BAC-derived viruses, vZJ01-GFPΔgE/gI (gE/gI deleted strain, and exhibiting green autofluorescence), vZJ01ΔgE/gI (gE/gI deleted strain), and vZJ01gE/gI-R (gE/gI revertant strain), showed similar in vitro growth to their parent strain. In pigs, inactivated vZJ01ΔgE/gI vaccine generated significantly high levels of neutralizing antibodies against ZJ01 compared with Bartha-K61 live vaccine (p<0.05). After fatal ZJ01 challenge, all five animals in the inactivated vZJ01ΔgE/gI vaccine group survived without exhibiting any clinical sings, but two of five animals exhibited central nervous signs in the Bartha-K61 group. Meanwhile, all the non-vaccinated control animals died at 7 days post-challenge. This indicates that the inactivated vZJ01ΔgE/gI vaccine is a promising vaccine candidate for controlling the variant strains of PRV now circulating in China. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. A live, attenuated pseudorabies virus strain JS-2012 deleted for gE/gI protects against both classical and emerging strains.

    PubMed

    Tong, Wu; Li, Guoxin; Liang, Chao; Liu, Fei; Tian, Qing; Cao, Yanyun; Li, Lin; Zheng, Xuchen; Zheng, Hao; Tong, Guangzhi

    2016-06-01

    Emerging pseudorabies virus (PRV) variant have led to pseudorabies outbreaks in Chinese pig farms. The commercially available PRV vaccine provides poor protection against the PRV variant. In this study, a gE/gI deleted PRV strain JS-2012-△gE/gI was generated from a PRV variant strain using homologous DNA recombination. Compared to the parental strain JS-2012, JS-2012-△gE/gI grew slowly and showed small plaque morphology on Vero cells. The safety and immunological efficacy of JS-2012-△gE/gI was evaluated as a vaccine candidate. JS-2012-△gE/gI was avirulent to suckling piglets, but was able to provide full protection for young piglets against challenge with both the classical virulent PRV and the emerging PRV variant. After sows were vaccinated with the gE/gI-deleted strain, their suckling offspring were resistant to an otherwise lethal challenge with the classical and the variant PRVs. Piglets inoculated with JS-2012-△gE/gI did not develop PRV-specific gE-ELISA antibodies. Thus, JS-2012-△gE/gI appears to be a promising marker vaccine candidate to control PRV variant circulating in pig farms in China. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Loss of G2 subunit of vacuolar-type proton transporting ATPase leads to G1 subunit upregulation in the brain

    PubMed Central

    Kawamura, Nobuyuki; Sun-Wada, Ge-Hong; Wada, Yoh

    2015-01-01

    Vacuolar-type ATPase (V-ATPase) is a primary proton pump with versatile functions in various tissues. In nerve cells, V-ATPase is required for accumulation of neurotransmitters into secretory vesicles and subsequent release at the synapse. Neurons express a specific isoform (G2) of the G subunit of V-ATPase constituting the catalytic sector of the enzyme complex. Using gene targeting, we generated a mouse lacking functional G2 (G2 null), which showed no apparent disorders in architecture and behavior. In the G2-null mouse brain, a G1 subunit isoform, which is ubiquitously expressed in neuronal and non-neuronal tissues, accumulated more abundantly than in wild-type animals. This G1 upregulation was not accompanied by an increase in mRNA. These results indicate that loss of function of neuron-specific G2 isoform was compensated by an increase in levels of the G1 isoform without apparent upregulation of the G1 mRNA. PMID:26353914

  19. G1 arrest induction represents a critical determinant for cisplatin cytotoxicity in G1 checkpoint-retaining human cancers.

    PubMed

    Un, Frank

    2007-04-01

    Cisplatin has been used effectively to treat various human cancer types; yet, the precise mechanism underlying its cytotoxicity remains unknown. In eukaryotes, progression through G1 is monitored by a checkpoint, which executes G1 arrest in the event of DNA damage to allow time for repair before initiating DNA replication. The retinoblastoma tumor suppressor gene is an integral component of the mammalian G1 checkpoint. The utility of the retinoblastoma gene as a therapeutic for human cancers has been investigated. Intriguingly, the cytotoxicity profile of the retinoblastoma gene therapy closely parallels the clinical targets of cisplatin. It prompted an investigation into the potential role of the checkpoint-induced G1 arrest in cisplatin cytotoxicity. Here, the evidence that G1 arrest induction represents a critical step in cisplatin-induced lytic path is presented. First, cisplatin-treated human cancer cells undergo a prolonged G1 arrest before dying. Second, triggering G1 arrest via infection with a recombinant adenovirus expressing the human retinoblastoma gene is sufficient to potentiate lethality in the absence of cisplatin. Third, the extent of the lethality induced correlates with the G1-arresting potential of the ectopically expressed human retinoblastoma polypeptide. Fourth, human cancer cells resistant to cisplatin do not undergo G1 arrest despite cisplatin treatment. The above mechanism may be exploited to develop therapeutics that preserve the efficacy of cisplatin yet bypass its mutagenicity associated with the formation of secondary tumors.

  20. Confined space facilitates G-quadruplex formation

    NASA Astrophysics Data System (ADS)

    Shrestha, Prakash; Jonchhe, Sagun; Emura, Tomoko; Hidaka, Kumi; Endo, Masayuki; Sugiyama, Hiroshi; Mao, Hanbin

    2017-07-01

    Molecular simulations suggest that the stability of a folded macromolecule increases in a confined space due to entropic effects. However, due to the interactions between the confined molecular structure and the walls of the container, clear-cut experimental evidence for this prediction is lacking. Here, using DNA origami nanocages, we show the pure effect of confined space on the property of individual human telomeric DNA G-quadruplexes. We induce targeted mechanical unfolding of the G-quadruplex while leaving the nanocage unperturbed. We find that the mechanical and thermodynamic stabilities of the G-quadruplex inside the nanocage increase with decreasing cage size. Compared to the case of diluted or molecularly crowded buffer solutions, the G-quadruplex inside the nanocage is significantly more stable, showing a 100 times faster folding rate. Our findings suggest the possibility of co-replicational or co-transcriptional folding of G-quadruplex inside the polymerase machinery in cells.

  1. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  2. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  3. 30 CFR 250.214 - What geological and geophysical (G&G) information must accompany the EP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What geological and geophysical (G&G) information must accompany the EP? 250.214 Section 250.214 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... OUTER CONTINENTAL SHELF Plans and Information Contents of Exploration Plans (ep) § 250.214 What...

  4. G-Quadruplexes influence pri-microRNA processing.

    PubMed

    Rouleau, Samuel G; Garant, Jean-Michel; Bolduc, François; Bisaillon, Martin; Perreault, Jean-Pierre

    2018-02-01

    RNA G-Quadruplexes (G4) have been shown to possess many biological functions, including the regulation of microRNA (miRNA) biogenesis and function. However, their impact on pri-miRNA processing remains unknown. We identified G4 located near the Drosha cleavage site in three distinct pri-miRNAs: pri-mir200c, pri-mir451a, and pri-mir497. The folding of the potential G4 motifs was determined in solution. Subsequently, mutations disrupting G4 folding led to important changes in the mature miRNAs levels in cells. Moreover, using small antisense oligonucleotides binding to the pri-miRNA, it was possible to modulate, either positively or negatively, the mature miRNA levels. Together, these data demonstrate that G4 motifs could contribute to the regulation of pri-mRNA processing, a novel role for G4. Considering that bio-informatics screening indicates that between 9% and 50% of all pri-miRNAs contain a putative G4, these structures possess interesting potential as future therapeutic targets.

  5. When Heterotrimeric G Proteins Are Not Activated by G Protein-Coupled Receptors: Structural Insights and Evolutionary Conservation.

    PubMed

    DiGiacomo, Vincent; Marivin, Arthur; Garcia-Marcos, Mikel

    2018-01-23

    Heterotrimeric G proteins are signal-transducing switches conserved across eukaryotes. In humans, they work as critical mediators of intercellular communication in the context of virtually any physiological process. While G protein regulation by G protein-coupled receptors (GPCRs) is well-established and has received much attention, it has become recently evident that heterotrimeric G proteins can also be activated by cytoplasmic proteins. However, this alternative mechanism of G protein regulation remains far less studied than GPCR-mediated signaling. This Viewpoint focuses on recent advances in the characterization of a group of nonreceptor proteins that contain a sequence dubbed the "Gα-binding and -activating (GBA) motif". So far, four proteins present in mammals [GIV (also known as Girdin), DAPLE, CALNUC, and NUCB2] and one protein in Caenorhabditis elegans (GBAS-1) have been described as possessing a functional GBA motif. The GBA motif confers guanine nucleotide exchange factor activity on Gαi subunits in vitro and activates G protein signaling in cells. The importance of this mechanism of signal transduction is highlighted by the fact that its dysregulation underlies human diseases, such as cancer, which has made the proteins attractive new candidates for therapeutic intervention. Here we discuss recent discoveries on the structural basis of GBA-mediated activation of G proteins and its evolutionary conservation and compare them with the better-studied mechanism mediated by GPCRs.

  6. Epstein-Barr virus glycoprotein gH/gL antibodies complement IgA-viral capsid antigen for diagnosis of nasopharyngeal carcinoma

    PubMed Central

    Tang, Lin-Quan; Zhang, Hua; Li, Yan; Liu, Wan-Li; Zhong, Qian; Zeng, Mu-Sheng; Huang, Xiao-Ming

    2016-01-01

    To determine whether measuring antibodies against Epstein-Barr virus (EBV) glycoprotein gH/gL in serum could improve diagnostic accuracy in nasopharyngeal carcinoma (NPC) cases, gH/gL expressed in a recombinant baculovirus system was used in an enzyme-linked immunosorbent assay (ELISA) to detect antibodies in two independent cohorts. Binary logistic regression analyses were performed using results from a training cohort (n = 406) to establish diagnostic mathematical models, which were validated in a second independent cohort (n = 279). Levels of serum gH/gL antibodies were higher in NPC patients than in healthy controls (p < 0.001). In the training cohort, the IgA-gH/gL ELISA had a sensitivity of 83.7%, specificity of 82.3% and area under the curve (AUC) of 0.893 (95% CI, 0.862-0.924) for NPC diagnosis. Furthermore, gH/gL maintained diagnostic capacity in IgA-VCA negative NPC patients (sensitivity = 78.1%, specificity = 82.3%, AUC = 0.879 [95% CI, 0.820 - 0.937]). Combining gH/gL and viral capsid antigen (VCA) detection improved diagnostic capacity as compared to individual tests alone in both the training cohort (sensitivity = 88.5%, specificity = 97%, AUC = 0.98 [95% CI, 0.97 - 0.991]), and validation cohort (sensitivity = 91.2%, specificity = 96.5%, AUC = 0.97 [95% CI, 0.951-0.988]). These findings suggest that EBV gH/gL detection complements VCA detection in the diagnosis of NPC and aids in the identification of patients with VCA-negative NPC. PMID:27093005

  7. G3 Program

    EPA Pesticide Factsheets

    The G3 initiative was designed to build a collaborative network for small to mid-sized towns and communities that are interested in adopting Green Streets to address urban stormwater, improve community health and livability, and encourage economic growth.

  8. RNA G-quadruplexes: emerging mechanisms in disease

    PubMed Central

    Cammas, Anne

    2017-01-01

    Abstract RNA G-quadruplexes (G4s) are formed by G-rich RNA sequences in protein-coding (mRNA) and non-coding (ncRNA) transcripts that fold into a four-stranded conformation. Experimental studies and bioinformatic predictions support the view that these structures are involved in different cellular functions associated to both DNA processes (telomere elongation, recombination and transcription) and RNA post-transcriptional mechanisms (including pre-mRNA processing, mRNA turnover, targeting and translation). An increasing number of different diseases have been associated with the inappropriate regulation of RNA G4s exemplifying the potential importance of these structures on human health. Here, we review the different molecular mechanisms underlying the link between RNA G4s and human diseases by proposing several overlapping models of deregulation emerging from recent research, including (i) sequestration of RNA-binding proteins, (ii) aberrant expression or localization of RNA G4-binding proteins, (iii) repeat associated non-AUG (RAN) translation, (iv) mRNA translational blockade and (v) disabling of protein–RNA G4 complexes. This review also provides a comprehensive survey of the functional RNA G4 and their mechanisms of action. Finally, we highlight future directions for research aimed at improving our understanding on RNA G4-mediated regulatory mechanisms linked to diseases. PMID:28013268

  9. Granulocyte-associated IgG in neutropenic disorders

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cines, D.B.; Passero, F.; Guerry, D. IV

    We applied a radiolabeled antiglobulin test to a study of patients with a variety of neutropenic disorders. After defining the nature of the interaction of radiolabeled anti-IgG with the neutrophil, we studied 16 patients with neutropenia of uncertain etiology and adequate bone marrow granulocyte precursors. Twelve of these 16 patients had increased neutrophil-associated IgG (PMN-IgG). Patients with the highest levels of PMN-IgG had the lowest neutrophil counts. The majority of patients with neutropenia and increased PMN-IgG had an underlying immunologic disorder that included immune thrombocytopenic purpura in 5 patients and autoimmune hemolytic anemia in 1 patient. In some patients, elevatedmore » PMN-IgG preceded other evidence for immunologic disease. The direct antiglobulin test helped to distinguish neutropenic patients with increased PMN-IgG both from patients with neutropenia due to a known nonimmune disorder and from noneutropenic patients with rheumatoid arthritis or systemic lupus erythematosis. Each of four patients with increased neutrophil-associated IgG treated with systemic corticosteroids responded clinically with an associated fall in neutrophil IgG and a rise in the circulating neutrophil count. The radiolabeled antiglobulin test appears useful in defining a subpopulation of patients with neutropenia due to an underlying immunologic disorder.« less

  10. Granulocyte-associated IgG in neutropenic disorders

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cines, D.B.; Passero, F.; Guerry, D.

    We applied a radiolabeled antiglobulin test to a study of patients with a variety of neutropenic disorders. After defining the nature of the interaction of radiolabeled anti-IgG with the neutrophil, we studied 16 patients with neutropenia of uncertain etiology and adequate bone marrow granulocyte precursors. Twelve of these 16 patients had increased neutrophil-associated IgG (PMN-IgG). Patients with the highest levels of PMN-IgG had the lowest neutrophil counts. The majority of patients with neutropenia and increased PMN-IgG had an underlying immunologic disorder that included immune thrombocytopenic purpura in 5 patients and autoimmune hemolytic anemia in 1 patient. In some patients, elevatedmore » PMN-IgG preceded other evidence for immunologic disease. The direct antiglobulin test helped to distinguish neutropenic patients with increased PMN-IgG both from patients with neutropenia due to a known nonimmune disorder and from nonneutropenic patients with rheumatoid arthritis or systemic lupus erythematosis. Each of four patients with increased neutrophil-associated IgG treated with systemic corticosteroids responded clinically with an associated fall in neutrophil IgG and a rise in the circulating neutrophil count. The radiolabeled antiglobulin test appears useful in defining a subpopulation of patients with neutropenia due to an underlying immunologic disorder.« less

  11. Role of -675 4G/5G in the plasminogen activator inhibitor-1 gene and -308G/A tumor necrosis factor-α gene polymorphisms in obese Argentinean patients.

    PubMed

    Wingeyer, Silvia D Perés; Graffigna, Mabel N; Belli, Susana H; Benetucci, Jorge; de Larrañaga, Gabriela F

    2012-05-01

    Plasminogen activator inhibitor-1 (PAI-1) and tumor necrosis factor-α (TNF-α) are increased in the circulation of obese persons. Because a direct link between PAI-1 and TNF-α in obesity has been observed, they are candidate genes for the development of obesity. We sought to evaluate the relation between the genotypic and allelic frequencies of the -675 4G/5G PAI-1 and -308 G/A TNF-α polymorphisms and their association with the risk for obesity in an Argentinean population. A group of 110 consecutive obese persons and a group of 111 lean controls were recruited. Polymerase chain reaction was used to determine the frequency of PAI-1 and TNF-α polymorphisms; serum fasting glucose, insulin, and lipid levels were measured by standard methods. Insulin sensitivity was evaluated by using homeostasis model assessment. The -308 TNF-α and -675 4G/5G PAI-1 genotype distribution did not significantly differ between the groups (p=0.544 and p=0.327, respectively). Homeostasis model assessment was the only positive independent determinant of body mass index (R(2)=0.493; p<0.001). The -675 4G/5G PAI-1 and the -308 TNF-α polymorphism variants tested in this study, individually or combined, were not associated with obesity in an Argentinean population.

  12. On s*g-continuous Functions on Topological Spaces

    NASA Astrophysics Data System (ADS)

    Khan, M.; Hussain, Murad

    2010-11-01

    The aim of this paper is to introduce and study the concept of s*g-continuous and s*g-closed functions. We investigate their relation with already existing notions. We also introduce s*g-irresolute function and investigate its relation with s*g-continuous function. When the s*g-closed sets are preserved, is also studied. In the end, we define and study the notions of s*g-compactness and s*g-connectedness.

  13. 30 CFR 280.20 - What must I not do in conducting Geological and Geophysical (G&G) prospecting or scientific...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I not do in conducting Geological and Geophysical (G&G) prospecting or scientific research? 280.20 Section 280.20 Mineral Resources BUREAU OF OCEAN...) prospecting or scientific research? While conducting G&G prospecting or scientific research activities under a...

  14. 75 FR 16492 - Agency Information Collection Activities: Form G-28, and Form G-28I, Revision of an Existing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-01

    ... Collection Activities: Form G-28, and Form G- 28I, Revision of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection under Review: Form G- 28, Notice of Entry of Appearance as Attorney or Accredited Representative, and Form G-28I, Notice of Entry of Appearance of Foreign...

  15. Global fibrinolytic activity, PAI-1 level, and 4G/5G polymorphism in Thai children with arterial ischemic stroke.

    PubMed

    Natesirinilkul, Rungrote; Sasanakul, Werasak; Chuansumrit, Ampaiwan; Kadegasem, Praguywan; Visudtibhan, Anannit; Wongwerawattanakoon, Pakawan; Sirachainan, Nongnuch

    2014-01-01

    Prolonged euglobulin clot lysis time (ECLT) and increased level of plasminogen activator inhibitor-1 (PAI-1) were reported to be risk factors of arterial ischemic stroke (AIS) by some studies; however, these findings were not supported by other studies. The objective of this study was to determine the association of ECLT, PAI-1 level, and polymorphisms of 4G and 5G of PAI-1 gene to the development of AIS in Thai children. This study included patients aged 1-18 years old. Diagnosis of AIS was confirmed by imaging study. The control group was age- and sex-matched healthy subjects. Demographic data were recorded, and blood was tested for ECLT, PAI-1 level, lipid profiles, fasting blood sugar (FBS), and 4G and 5G polymorphisms of PAI-1 gene. There were 70 subjects participating in this study, consisting of 30 patients and 40 controls. Demographic data, lipid profiles, and FBS were similar between the 2 groups. Furthermore, ECLT and PAI-1 level did not differ between patient and control groups; however, both showed significant correlation (r = .352, P = .006). The 4G/5G polymorphism was the most common genotype in both patient and control groups (69.0% vs. 80.0%). However, 4G and 5G polymorphisms of PAI-1 gene did not correlate with PAI-1 level in this study (P = .797). The PAI-1 level and 4G/5G polymorphism may not be a risk factor of AIS in this population. It was also found that the 4G/5G polymorphism was the most common PAI-1 genotype in this study. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  16. 78 FR 8191 - Certain Wireless Devices With 3G and/or 4G Capabilities and Components Thereof; Institution of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-05

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 337-TA-868] Certain Wireless Devices With 3G and... importation, and the sale within the United States after importation of certain wireless devices with 3G and... devices with 3G and/or 4G capabilities and components thereof by reason of infringement of one or more of...

  17. Relation between osteonecrosis of the femoral head and PAI-1 4G/5G gene polymorphism: a meta-analysis.

    PubMed

    Zeng, Zheng; Wang, Bing; Pan, Haitao

    2015-01-01

    The aim of this study was to investigate the association of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene polymorphism and osteonecrosis of the femoral head (ONFH). The pooled relative risk ratio (RR) and 95% confidence intervals (95% CI) were calculated using the the RevMan 5.0 software. The present study included 969 patients with ONFH and 419 healthy controls. The Meta analysis results showed: There is association between PAI-1 gene 4G/5G polymorphism and the increasing risk of ONFH (allele model: RR = 1.24, 95% CI = 1.16 ~ 1.33; dominant genetic model: RR = 1.12, 95% CI = 1.05 ~ 1.18). It was found that the association between PAI-1 gene 4 G/5 G polymorphism and the susceptibility of ONFH (P < 0.05) through the comparison of Caucasian population and Asian people according to the analysis of different races. There is association between PAI-1 gene 4 G/5 G polymorphism and the increasing of the susceptibility of ONFH.

  18. Traveling wave solutions of the Boussinesq equation via the new approach of generalized (G'/G)-expansion method.

    PubMed

    Alam, Md Nur; Akbar, M Ali; Roshid, Harun-Or-

    2014-01-01

    Exact solutions of nonlinear evolution equations (NLEEs) play a vital role to reveal the internal mechanism of complex physical phenomena. In this work, the exact traveling wave solutions of the Boussinesq equation is studied by using the new generalized (G'/G)-expansion method. Abundant traveling wave solutions with arbitrary parameters are successfully obtained by this method and the wave solutions are expressed in terms of the hyperbolic, trigonometric, and rational functions. It is shown that the new approach of generalized (G'/G)-expansion method is a powerful and concise mathematical tool for solving nonlinear partial differential equations in mathematical physics and engineering. 05.45.Yv, 02.30.Jr, 02.30.Ik.

  19. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  20. Sodium in weak G-band giants

    NASA Technical Reports Server (NTRS)

    Drake, Jeremy J.; Lambert, David L.

    1994-01-01

    Sodium abundances have been determined for eight weak G-band giants whose atmospheres are greatly enriched with products of the CN-cycling H-burning reactions. Systematic errors are minimized by comparing the weak G-band giants to a sample of similar but normal giants. If, further, Ca is selected as a reference element, model atmosphere-related errors should largely be removed. For the weak-G-band stars (Na/Ca) = 0.16 +/- 0.01, which is just possibly greater than the result (Na/Ca) = 0.10 /- 0.03 from the normal giants. This result demonstrates that the atmospheres of the weak G-band giants are not seriously contaminated with products of ON cycling.

  1. Immunological studies on bee-keepers: specific IgG and subclass typing IgG against bee venom and bee venom components.

    PubMed

    Urbanek, R; Forster, J; Ziupa, J; Karitzky, D

    1980-11-17

    Specific IgE antibodies against bee venom and its components were studied in 23 bee-keepers. The highest IgG serum levels were observed for whole bee venom followed by phospholipase A. The serum levels of specific IgG antibodies against melittin and MCD-peptide were lower, the lowest serum levels being observed for apamin. After a 5 month absence from bee-keeping a fall in the serum levels of IgG antibodies was observed in all the bee-keepers studied. The investigation of the IgG subclass antibodies 1-4 against bee venom and phospholipase A demonstrated the highest serum levels for IgG 4 and IgG 2, the lowest levels were observed for IgG 1. The lowest IgG serum levels were associated with the least effective protection to bee stings. These findings support the concept that specific IgG antibodies prevent the development of allergic symptoms after bee sting.

  2. Solar g-modes? Comparison of detected asymptotic g-mode frequencies with solar model predictions

    NASA Astrophysics Data System (ADS)

    Wood, Suzannah Rebecca; Guzik, Joyce Ann; Mussack, Katie; Bradley, Paul A.

    2018-06-01

    After many years of searching for solar gravity modes, Fossat et al. (2017) reported detection of the nearly equally spaced high-order g-modes periods using a 15-year time series of GOLF data from the SOHO spacecraft. Here we report progress towards and challenges associated with calculating and comparing g-mode period predictions for several previously published standard solar models using various abundance mixtures and opacities, as well as the predictions for some non-standard models incorporating early mass loss, and compare with the periods reported by Fossat et al (2017). Additionally, we have a side-by-side comparison of results of different stellar pulsation codes for calculating g-mode predictions. These comparisons will allow for testing of nonstandard physics input that affect the core, including an early more massive Sun and dynamic electron screening.

  3. Randomized controlled trial comparing 200μg and 400μg sublingual misoprostol for prevention of primary postpartum hemorrhage.

    PubMed

    Ugwu, Innocent A; Oluwasola, Timothy A; Enabor, Obehi O; Anayochukwu-Ugwu, Ngozi N; Adeyemi, Abolaji B; Olayemi, Oladapo O

    2016-05-01

    To compare efficacy and adverse effects of 200μg and 400μg misoprostol for prevention of postpartum hemorrhage (PPH). In a randomized control trial, women with term singleton pregnancies in active labor attending University College Hospital, Ibadan, Nigeria, were enrolled between July 2011 and February 2012. Participants were randomly assigned using random numbers (block size four) to receive 200μg or 400μg sublingual misoprostol after delivery of the anterior shoulder, alongside intravenous oxytocin. Investigators were masked to group assignment, but participants were not. The primary outcomes were blood loss up to 1h after delivery, PPH (blood loss ≥500mL), and adverse effects. Overall, 62 patients were assigned to each group. No significant differences between the 200-μg and 400-μg groups were recorded in mean peripartum blood loss (307±145mL vs 296±151mL; P=0.679) and PPH occurrence (5 [8.1%] vs 6 [9.7%] women; P=0.752). Noticeable adverse effects were reported by 16 (25.8%) women in the 200-μg group and 42 (67.7%) in the 400-μg group (P<0.001). Risk of shivering was significantly lower with 200μg than 400μg (relative risk 0.33, 95% confidence interval 0.19-0.58). Blood loss and PPH occurrence did not differ by misoprostol dose, but a 200-μg dose was associated with a reduction in adverse effects. Pan Africa Clinical Trials Registry: PACTR201505001107182. Copyright © 2016 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

  4. FANCJ promotes DNA synthesis through G-quadruplex structures

    PubMed Central

    Castillo Bosch, Pau; Segura-Bayona, Sandra; Koole, Wouter; van Heteren, Jane T; Dewar, James M; Tijsterman, Marcel; Knipscheer, Puck

    2014-01-01

    Our genome contains many G-rich sequences, which have the propensity to fold into stable secondary DNA structures called G4 or G-quadruplex structures. These structures have been implicated in cellular processes such as gene regulation and telomere maintenance. However, G4 sequences are prone to mutations particularly upon replication stress or in the absence of specific helicases. To investigate how G-quadruplex structures are resolved during DNA replication, we developed a model system using ssDNA templates and Xenopus egg extracts that recapitulates eukaryotic G4 replication. Here, we show that G-quadruplex structures form a barrier for DNA replication. Nascent strand synthesis is blocked at one or two nucleotides from the G4. After transient stalling, G-quadruplexes are efficiently unwound and replicated. In contrast, depletion of the FANCJ/BRIP1 helicase causes persistent replication stalling at G-quadruplex structures, demonstrating a vital role for this helicase in resolving these structures. FANCJ performs this function independently of the classical Fanconi anemia pathway. These data provide evidence that the G4 sequence instability in FANCJ−/− cells and Fancj/dog1 deficient C. elegans is caused by replication stalling at G-quadruplexes. PMID:25193968

  5. Epstein-Barr virus-infected cells in IgG4-related lymphadenopathy with comparison with extranodal IgG4-related disease.

    PubMed

    Takeuchi, Mai; Sato, Yasuharu; Yasui, Hiroshi; Ozawa, Hiroaki; Ohno, Kyotaro; Takata, Katsuyoshi; Gion, Yuka; Orita, Yorihisa; Tachibana, Tomoyasu; Itoh, Tomoo; Asano, Naoko; Nakamura, Shigeo; Swerdlow, Steven H; Yoshino, Tadashi

    2014-07-01

    IgG4-related lymphadenopathy with increased numbers of Epstein-Barr virus (EBV)-infected cells has been reported but not fully described. We analyzed 31 cases of IgG4-related lymphadenopathy and 24 cases of extranodal IgG4-related diseases for their possible relationship with EBV. Other types of reactive lymph nodes (22) and angioimmunoblastic T-cell lymphoma (AITL) (10) were also studied for comparison. EBV-encoded RNA (EBER) in situ hybridization revealed EBER(+) cells in 18 of 31 cases (58%) of IgG4-related lymphadenopathy. Increased EBER(+) cells were found in only 4 of 22 (18.1%) non-IgG4-related reactive lymphoid hyperplasia in patients of a similar age (P=0.002) and in only 5 of 24 (21%) extranodal IgG4-related biopsies (P=0.006). Interestingly, all patients with EBER(+) progressively transformed germinal center-type IgG4-related lymphadenopathy had systemic lymphadenopathy and/or extranodal involvement. AITL also is associated with EBV, and IgG4-related lymphadenopathy sometimes mimics the morphology of AITL; however, the number of IgG4(+) cells in AITL was significantly less than that in IgG4-related lymphadenopathy (P<0.001). Increased numbers of regulatory T cells are seen in IgG4-related disease; however, there was not a significant difference between the EBER(+) and EBER(-) cases. In conclusion, the presence of increased numbers of EBV-infected cells in IgG4-related lymphadenopathy, compared with other reactive lymphadenopathy or extranodal IgG4-related disease, suggests that there may be a relationship at least between nodal IgG4-related disease and EBV. It is important to avoid overdiagnosing these cases as malignant lymphomas or EBV-related lymphoproliferative disorders.

  6. Surface Plasmon Resonance kinetic analysis of the interaction between G-quadruplex nucleic acids and an anti-G-quadruplex monoclonal antibody.

    PubMed

    Lago, Sara; Nadai, Matteo; Rossetto, Monica; Richter, Sara N

    2018-06-01

    G-quadruplexes (G4s) are nucleic acids secondary structures formed in guanine-rich sequences. Anti-G4 antibodies represent a tool for the direct investigation of G4s in cells. Surface Plasmon Resonance (SPR) is a highly sensitive technology, suitable for assessing the affinity between biomolecules. We here aimed at improving the orientation of an anti-G4 antibody on the SPR sensor chip to optimize detection of binding antigens. SPR was employed to characterize the anti-G4 antibody interaction with G4 and non-G4 oligonucleotides. Dextran-functionalized sensor chips were used both in covalent coupling and capturing procedures. The use of two leading molecule for orienting the antibody of interest allowed to improve its activity from completely non-functional to 65% active. The specificity of the anti-G4 antobody for G4 structures could thus be assessed with high sensitivity and reliability. Optimization of the immobilization protocol for SPR biosensing, allowed us to determine the anti-G4 antibody affinity and specificity for G4 antigens with higher sensitivity with respect to other in vitro assays such as ELISA. Anti-G4 antibody specificity is a fundamental assumption for the future utilization of this kind of antibodies for monitoring G4s directly in cells. The heterogeneous orientation of amine-coupling immobilized ligands is a general problem that often leads to partial or complete inactivation of the molecules. Here we describe a new strategy for improving ligand orientation: driving it from two sides. This principle can be virtually applied to every molecule that loses its activity or is poorly immobilized after standard coupling to the SPR chip surface. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Association of MMP-1 -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population.

    PubMed

    Lepetsos, Panagiotis; Pampanos, Andreas; Kanavakis, Emmanouil; Tzetis, Maria; Korres, Dimitrios; Papavassiliou, Athanasios G; Efstathopoulos, Nicolaos

    2014-09-01

    Osteoarthritis is the most common form of arthritis with still unknown pathogenic etiology and considerable contribution of genetic factors. One of the mechanisms of cartilage degradation in osteoarthritis is enzymatic proteolysis of the extracellular matrix by metalloproteinases. MMP-1, produced by chondrocytes and synovial cells, is a major proteinase of the MMPs family. The present study aims at evaluating the association of MMP1 gene -1607 1G/2G (rs1799750) polymorphism with primary knee osteoarthritis in the Greek population. One hundred fifty five patients with primary symptomatic knee osteoarthritis participated in the study along with 139 controls. Genotypes were determined using PCR-RLFP technique. Allelic and genotypic frequencies were compared between both study groups. There was no significant association between MMP1 -1607 1G/2G polymorphism and knee osteoarthritis, in crude analysis; however, after multiple logistic regression analysis, 1G/2G was associated with reduced odds of knee osteoarthritis by 75% in males, compared to genotypes 1G/1G + 2G/2G, adjusting for age and BMI (adjusted OR: 0.25, 95% CI: 0.069, 0.910, p = 0.035). The present study shows that MMP1 -1607 1G/2G (rs1799750) polymorphism might be a risk factor for knee osteoarthritis susceptibility in the Greek population. Further investigations are needed to confirm this association in the pathogenesis of osteoarthritis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  8. [Drug assessment: IQWiG, G-BA, and an international comparison].

    PubMed

    Glaeske, G

    2016-01-01

    Since the Pharmaceutical Market Restructuring Act (Arzneimittelmarktneuordnungsgesetz-AMNOG) went into effect on 1 January 2011, new medicinal products provided under statutory health insurance have to undergo an early benefit assessment, prepared on the basis of scientific dossiers drawn up by the German Institute for Quality and Cost Effectiveness in the Health Care Sector (Institut für Qualität und Wirtschaftlichkeit im Gesundheitswesen-IQWiG) and adopted by the Federal Joint Committee (Gemeinsamer Bundesausschuss-G-BA). These assessments, in which the additional benefit of a product is compared with existing standard therapy and ultimately has a bearing on price negotiations with the pharmaceutical companies, are carried out on the basis of clinical trial data presented by the latter. Results so far, however, show that the IQWIG's and the G-BA's assessments often vary, although both bodies have the same documentation. Such differences can also be observed on an international level. Using selected examples, the differences in the assessments of new pharmaceuticals are presented and reasons for national and international deviations are discussed. As yet, no systematic comparative analysis has been made of assessments of medicinal products by the respective institutions. For this reason, it was not possible to make a systematic selection of pharmaceuticals, and the cases were instead selected according to available information. An overview of the results shows that the diverging assessments-both national and international-are not always scientifically justifiable, but rather appear to be influenced by the-not always transparent-framework parameters of the respective health system. Assessments are always shaped by certain perspectives on the data and results under scrutiny. It would undoubtedly be worthwhile to evaluate these influences to gain a better understanding of the reasons for national and international discrepancies in the assessment of additional

  9. Association of IL-10-1082 G/G genotype with lower mortality of acute respiratory distress syndrome in a Chinese population.

    PubMed

    Jin, Xiaodong; Hu, Zhi; Kang, Yan; Liu, Chang; Zhou, Yongfang; Wu, Xiaodong; Liu, Jin; Zhong, Mingxing; Luo, Chuanxing; Deng, Lijing; Deng, Yiyun; Xie, Xiaoqi; Zhang, Zhongwei; Zhou, Yan; Liao, Xuelian

    2012-01-01

    We aimed to investigate whether interleukin-10 (IL-10) -1082 G/G genotype is associated with lower mortality of acute respiratory distress syndrome (ARDS) in a Chinese population. A hospital-based case-control study was conducted in 314 cases of ARDS and 210 controls who were admitted to an intensive care unit with sepsis, trauma, aspiration or massive transfusions. Cases were followed for 30-day mortality. The -1082G/G genotype was associated with lower development of ARDS (OR=0.51; 95% CI 0.34-0.76; P=0.001). Among patients with ARDS, the -1082G/G genotype was associated with lower 30-day mortality (OR=0.44; 95% CI 0.25-0.76; P=0.003). In conclusion, IL-10-1082 G/G genotype is associated with lower development and mortality of ARDS in a Chinese population.

  10. Fund honors Jule G. Charney

    NASA Astrophysics Data System (ADS)

    The Department of Meteorology and Physical Oceanography at the Massachusetts Institute of Technology has established a fund in honor of the late Jule G. Charney. Charney died in Boston last month (Eos, July 7). Income from the fund will be awarded to meritorious students for graduate study in the department. The awards will be known as the Jule G. Charney Awards.

  11. Low-g measurements by NASA

    NASA Technical Reports Server (NTRS)

    Chassay, Roger P.; Schwaniger, Arthur

    1990-01-01

    NASA has utilized low-g accelerometers on a variety of flights for over ten years. These flights have included aircraft parabolas, suborbital trajectories, and orbital missions. This large quantity of data has undergone only limited in-depth analyses. Highlights of this low-g data are presented along with brief discussion of the instruments used and the circumstances of the data collection.

  12. Distances to supernova remnants G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 and new molecular cloud associations

    NASA Astrophysics Data System (ADS)

    Ranasinghe, S.; Leahy, D. A.

    2018-06-01

    Accurate distances to supernova remnants (SNRs) are crucial in determining their size, age, luminosity, and evolutionary state. To determine distances, we chose three SNRs from the VLA (Very Large Array) Galactic Plane Survey for extraction of H I absorption spectra. Analysing H I absorption spectra, 13CO emission spectra, and H I and 13CO channel maps, kinematic velocities (or their limits) to the three SNRs were calculated. The three SNRs are probably associated with molecular clouds and the new distance to G20.4 + 0.1, G24.7 - 0.6, and G28.6 - 0.1 are 7.8 ± 0.5 kpc, 3.8 ± 0.2 kpc, and 9.6 ± 0.3 kpc, respectively.

  13. The Vaporization of B2O3(l) to B2O3(g) and B2O2(g)

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan S.; Myers, Dwight L.

    2011-01-01

    The vaporization of B2O3 in a reducing environment leads to formation of both B2O3(g) and B2O2(g). While formation of B2O3(g) is well understood, many questions about the formation of B2O2(g) remain. Previous studies using B(s) + B2O3(l) have led to inconsistent thermodynamic data. In this study, it was found that after heating, B(s) and B2O3(l) appear to separate and variations in contact area likely led to the inconsistent vapor pressures of B2O2(g). To circumvent this problem, an activity of boron is fixed with a two-phase mixture of FeB and Fe2B. Both second and third law enthalpies of formation were measured for B2O2(g) and B2O3(g). From these the enthalpies of formation at 298.15 K are calculated to be -479.9 +/- 41.5 kJ/mol for B2O2(g) and -833.4 +/- 13.1 kJ/mol for B2O3(g). Ab initio calculations to determine the enthalpies of formation of B2O2(g) and B2O3(g) were conducted using the W1BD composite method and show good agreement with the experimental values.

  14. ANTIDOG IgG SECONDARY ANTIBODY SUCCESSFULLY DETECTS IgG IN A VARIETY OF AQUATIC MAMMALS.

    PubMed

    Roehl, Katherine; Jankowski, Mark; Hofmeister, Erik

    2016-12-01

    Serological tests play an important role in the detection of wildlife diseases. However, while there are many commercial assays and reagents available for domestic species, there is a need to develop efficient serological assays for wildlife. In recent years, marine mammals have represented a wildlife group with emerging infectious diseases, such as influenza, brucellosis, and leptospirosis. However, with the exception of disease-agent-specific assays or functional assays, few reports describe the use of antibody detection assays in marine mammals. In an indirect enzyme-linked immunoassay (EIA) or an immunofluorescence assay, antibody is detected using an antitarget species secondary conjugated antibody. The sensitivity of the assay depends on the avidity of the binding reaction between the bound antibody and the detection antibody. A commercial polyclonal antidog IgG conjugated antibody was tested in an EIA for its ability to sensitively detect the IgG of seven marine mammals including sea otter ( Enhydra lutris ), polar bear ( Ursus maritimus ), grey seal ( Halichoerus grypus ), harbor seal ( Phoca vitulina ), northern elephant seal ( Mirounga angustirostris ), California sea lion ( Zalophus californianus ), Pacific walrus ( Odobenus rosmarus ) and one freshwater mammal: Asian small-clawed otter ( Aonyx cinerea ). With the exception of Asian small-clawed sea otters, the detection of IgG in these marine mammals either exceeded or was nearly equal to detection of dog IgG. The use of the tested commercial antidog IgG antibody may be a valid approach to the detection of antibody response to disease in sea mammals.

  15. Detailed functional analysis of two clinical glucose-6-phosphate dehydrogenase (G6PD) variants, G6PDViangchan and G6PDViangchan+Mahidol: Decreased stability and catalytic efficiency contribute to the clinical phenotype.

    PubMed

    Boonyuen, Usa; Chamchoy, Kamonwan; Swangsri, Thitiluck; Saralamba, Naowarat; Day, Nicholas P J; Imwong, Mallika

    2016-06-01

    Deficiency of glucose-6-phosphate dehydrogenase (G6PD) is an X-linked hereditary genetic defect that is the most common polymorphism and enzymopathy in humans. To investigate functional properties of two clinical variants, G6PDViangchan and G6PDViangchan+Mahidol, these two mutants were created by overlap-extension PCR, expressed in Escherichia coli and purified to homogeneity. We describe an overexpression and purification method to obtain substantial amounts of functionally active protein. The KM for G6P of the two variants was comparable to the KM of the native enzyme, whereas the KM for NADP(+) was increased 5-fold for G6PDViangchan and 8-fold for G6PDViangchan+Mahidol when compared with the native enzyme. Additionally, kcat of the mutant enzymes was markedly reduced, resulting in a 10- and 18-fold reduction in catalytic efficiency for NADP(+) catalysis for G6PDViangchan and G6PDViangchan+Mahidol, respectively. Furthermore, the two variants demonstrated significant reduction in thermostability, but similar susceptibility to trypsin digestion, when compared with the wild-type enzyme. The presence of NADP(+) is shown to improve the stability of G6PD enzymes. This is the first report indicating that protein instability and reduced catalytic efficiency are responsible for the reduced catalytic activity of G6PDViangchan and G6PDViangchan+Mahidol and, as a consequence, contribute to the clinical phenotypes of these two clinical variants. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Triosephosphate isomerase gene promoter variation: -5G/A and -8G/A polymorphisms in clinical malaria groups in two African populations.

    PubMed

    Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula

    2015-06-01

    TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Hepatic radiofrequency ablation: in vivo and ex vivo comparisons of 15-gauge (G) and 17-G internally cooled electrodes

    PubMed Central

    Song, K D; Park, H J; Cha, D I; Kang, T W; Lee, J; Moon, J Y; Rhim, H

    2015-01-01

    Objective: To compare the performance of the 15-G internally cooled electrode with that of the conventional 17-G internally cooled electrode. Methods: A total of 40 (20 for each electrode) and 20 ablation zones (10 for each electrode) were made in extracted bovine livers and in in vivo porcine livers, respectively. Technical parameters, three dimensions [long-axis diameter (Dl), vertical-axis diameter (Dv) and short-axis diameter (Ds)], volume and the circularity (Ds/Dl) of the ablation zone were compared. Results: The total delivered energy was higher in the 15-G group than in the 17-G group in both ex vivo and in vivo studies (8.78 ± 1.06 vs 7.70 ± 0.98 kcal, p = 0.033; 11.20 ± 1.13 vs 8.49 ± 0.35 kcal, p = 0.001, respectively). The three dimensions of the ablation zone had a tendency to be larger in the 15-G group than in the 17-G group in both studies. The ablation volume was larger in the 15-G group than in the 17-G group in both ex vivo and in vivo studies (29.61 ± 7.10 vs 23.86 ± 3.82 cm3, p = 0.015; 10.26 ± 2.28 vs 7.79 ± 1.68 cm3, p = 0.028, respectively). The circularity of ablation zone was not significantly different in both the studies. Conclusion: The size of ablation zone was larger in the 15-G internally cooled electrode than in the 17-G electrode in both ex vivo and in vivo studies. Advances in knowledge: Radiofrequency ablation of hepatic tumours using 15-G electrode is useful to create larger ablation zones. PMID:25882688

  18. 5G: rethink mobile communications for 2020+.

    PubMed

    Chih-Lin, I; Han, Shuangfeng; Xu, Zhikun; Sun, Qi; Pan, Zhengang

    2016-03-06

    The 5G network is anticipated to meet the challenging requirements of mobile traffic in the 2020s, which are characterized by super high data rate, low latency, high mobility, high energy efficiency and high traffic density. This paper provides an overview of China Mobile's 5G vision and potential solutions. Three key characteristics of 5G are analysed, i.e. super fast, soft and green. The main 5G R&D themes are further elaborated, which include five fundamental rethinkings of the traditional design methodologies. The 5G network design considerations are also discussed, with cloud radio access network, ultra-dense network, software defined network and network function virtualization examined as key potential solutions towards a green and soft 5G network. The paradigm shift to user-centric network operation from the traditional cell-centric operation is also investigated, where the decoupled downlink and uplink, control and data, and adaptive multiple connections provide sufficient means to achieve a user-centric 5G network with 'no more cells'. The software defined air interface is investigated under a uniform framework and can adaptively adapt the parameters to well satisfy various requirements in different 5G scenarios. © 2016 The Author(s).

  19. Simulation of Shuttle launch G forces and acoustic loads using the NASA Ames Research Center 20G centrifuge

    NASA Technical Reports Server (NTRS)

    Shaw, T. L.; Corliss, J. M.; Gundo, D. P.; Mulenburg, G. M.; Breit, G. A.; Griffith, J. B.

    1994-01-01

    The high cost and long times required to develop research packages for space flight can often be offset by using ground test techniques. This paper describes a space shuttle launch and reentry simulating using the NASA Ames Research Center's 20G centrifuge facility. The combined G-forces and acoustic environment during shuttle launch and landing were simulated to evaluate the effect on a payload of laboratory rates. The launch G force and acoustic profiles are matched to actual shuttle launch data to produce the required G-forces and acoustic spectrum in the centrifuge test cab where the rats were caged on a free-swinging platform. For reentry, only G force is simulated as the aero-acoustic noise is insignificant compared to that during launch. The shuttle G-force profiles of launch and landing are achieved by programming the centrifuge drive computer to continuously adjust centrifuge rotational speed to obtain the correct launch and landing G forces. The shuttle launch acoustic environment is simulated using a high-power, low-frequency audio system. Accelerometer data from STS-56 and microphone data from STS-1 through STS-5 are used as baselines for the simulations. This paper provides a description of the test setup and the results of the simulation with recommendations for follow-on simulations.

  20. Hypogammaglobulinemia associated with accelerated catabolism of IgG secondary to its interaction with an IgG-reactive monoclonal IgM

    PubMed Central

    Waldmann, Thomas A.; Johnson, John S.; Talal, Norman

    1971-01-01

    Hypogammaglobulinemia due to a new pathophysiological mechanism was studied in a patient with Sjögren's syndrome, a monoclonal IgM and a mixed (IgM-IgG) cryoglobulinemia. The IgM (IgMdk) component of the cryogel possessed light chains of λ-type with highly restricted electrophoretic mobility analagous to those of a Waldenström's macroglobulin. IgMdk reacted specifically with native IgG, with IgG subclasses 1, 2, and 4, and with the Fc piece of IgG to form a cryogel. Serum concentrations of IgG 1, 2, and 4 were 10% of normal, whereas the IgG3 level was slightly increased and the IgM level was markedly increased. Viscosity and analytical ultracentrifugation studies with the purified mixed cryogel (IgM-LgG) indicated soluble complex formation over a temperature range (36-38°C) attainable in vivo. Immunoglobulin turnover studies revealed a markedly elevated rate of IgM synthesis with a normal survival of IgM, IgA, and IgE. IgG3, which failed to form complexes with IgMdk at body temperature, had a normal synthetic rate and survival. In contrast, the other IgG subclasses showed reduced synthesis and shortened survival. These studies are the first indicating a short survival of some IgG subclasses with a normal survival of another. The hypogammaglobulinemia appears to be due in part to a new mechanism of accelerated protein catabolism: The rapid elimination of IgG due to its interaction with an IgG-reactive monoclonal IgM. PMID:4993860

  1. Parabolic flight experiment `Convection in a Cylinder' -Interaction of 1g, 1.8g, micro-g and electro-hydrodynamic g periods

    NASA Astrophysics Data System (ADS)

    Dahley, M. Sc. Norman; Futterer, Birgit; Smieszek, Marlene; Egbers, Christoph; Crumeyrolle, Olivier; Mutabazi, Innocent

    In micro pumps, dosing systems, heat exchanger and transfer devices the flow control is realized by means of external impressed force fields. Here we focus on the enhancement of heat transfer in an annular cavity, if an electrohydrodynamic force field is set up. This synthetic force field is established with a high voltage potential between differentially heated inner and outer cylinders, filled with a dielectric insulating fluid. It acts comparable to thermal buoyancy forces induced by gravity. Sitte et al. (2001) performed quantitative parabolic flight experiments without determining critical values and finally reported a broken azimuthally symmetry due to the instability in a recent parabolic flight experiment (Sitte et al., 2003). With the experiment accomplishment in the 14th parabolic flight, first scenarios are realized in order to weigh the different influences of natural buoyancy coming from g and electro-hydrodynamic buoyancy coming from synthetic force fields, which were studied with numerical simulations by Smieszek et al. (2008). Specific experiment objective was the convection in an annular cavity with differentially heated inner and outer cylinders under the influence of the both buoyancy driven forces. By scaling the annulus width to approximate 5mm the initial outer cell radius for a first parabolic flight campaign was set to 10mm. The inner cylinder is made of aluminum and is heated with heating cartridges. The outer cylinder is made of glass. The gap in between is the experimental volume, which is filled with silicone oil and particles. With this a Laser light sheet illumination was set up. The inner cylinder, made of aluminum, is connected to a high-tension up to 10kV. The glass cylinder is coated with Indium-Tin-Oxide (ITO) inside, to make the glass conductive and is connected to ground. The central force field is introduced by applying a high voltage difference between the two cylinders. Convection was observed during the whole parabolic

  2. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  3. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  4. 40 CFR Appendix G to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes Listed in the March 3, 1999...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Restrictions and Unacceptable Substitutes Listed in the March 3, 1999, Final rule, Effective April 2, 1999. G Appendix G to Subpart G of Part 82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Pt. 82, Subpt. G, App. G Appendix G to Subpart G of Part 82—Substitutes Subject to Use Restrictions...

  5. Expansion of blood IgG4+ B, TH2, and regulatory T cells in patients with IgG4-related disease.

    PubMed

    Heeringa, Jorn J; Karim, A Faiz; van Laar, Jan A M; Verdijk, Robert M; Paridaens, Dion; van Hagen, P Martin; van Zelm, Menno C

    2018-05-01

    IgG 4 -related disease (IgG 4 -RD) is a systemic fibroinflammatory condition affecting various organs and has a diverse clinical presentation. Fibrosis and accumulation of IgG 4 + plasma cells in tissue are hallmarks of the disease, and IgG 4 -RD is associated with increased IgG 4 serum levels. However, disease pathogenesis is still unclear, and these cellular and molecular parameters are neither sensitive nor specific for the diagnosis of IgG 4 -RD. Here we sought to develop a flow cytometric gating strategy to reliably identify blood IgG 4 + B cells to study their cellular and molecular characteristics and investigate their contribution in disease pathogenesis. Sixteen patients with histologically confirmed IgG 4 -RD, 11 patients with sarcoidosis, and 30 healthy subjects were included for 11-color flow cytometric analysis of peripheral blood for IgG 4 -expressing B cells and T H subsets. In addition, detailed analysis of activation markers and chemokine receptors was performed on IgG 4 -expressing B cells, and IgG 4 transcripts were analyzed for somatic hypermutations. Cellular and molecular analyses revealed increased numbers of blood IgG 4 + memory B cells in patients with IgG 4 -RD. These cells showed reduced expression of CD27 and CXCR5 and increased signs of antibody maturation. Furthermore, patients with IgG 4 -RD, but not patients with sarcoidosis, had increased numbers of circulating plasmablasts and CD21 low B cells, as well as T H 2 and regulatory T cells, indicating a common disease pathogenesis in patients with IgG 4 -RD. These results provide new insights into the dysregulated IgG 4 response in patients with IgG 4 -RD. A specific "peripheral lymphocyte signature" observed in patients with IgG 4 -RD, could support diagnosis and treatment monitoring. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  6. Influence of PAI-1 gene promoter-675 (4G/5G) polymorphism on fibrinolytic activity after cardiac surgery employing cardiopulmonary bypass.

    PubMed

    Ozolina, Agnese; Strike, Eva; Jaunalksne, Inta; Serova, Jelena; Romanova, Tatjana; Zake, Liene Nikitina; Sabelnikovs, Olegs; Vanags, Indulis

    2012-01-01

    The plasminogen activator inhibitor type-1 (PAI-1) gene promoter contains 675 (4G/5G) polymorphism. The aim of this study was evaluate the effect of the PAI-1 promoter-675 (4G/5G) polymorphism on the concentrations of PAI-1 and tissue plasminogen activator/PAI-1 (t-PA/PAI-1) complex and bleeding volume after on-pump cardiac surgery. A total of 90 patients were included in the study at Pauls Stradins Clinical University Hospital. Seven patients were excluded due to surgical bleeding. Eighty-three patients were classified according to the PAI-1 genotype: 21 patients had the 4G/4G genotype; 42, the 4G/5G genotype; and 20, the 5G/5G genotype. The following fibrinolysis parameters were recorded: the PAI-1 level preoperatively, D-dimer level at 0, 6, and 24 hours after surgery, and t-PA/PAI-1 complex level 24 hours postoperatively. A postoperative bleeding volume was registered in mL 24 hours after surgery. The patients with the 5G/5G genotype had significantly lower preoperative PAI-1 levels (17 [SD, 10.8] vs. 24 ng/mL [SD, 9.6], P=0.04), higher D-dimer levels at 6 hours (371 [SD, 226] vs. 232 ng/mL [SD, 185], P=0.03) and 24 hours (326 [SD, 207] vs. 209 ng/mL [SD, 160], P=0.04), and greater postoperative blood loss (568 [SD, 192] vs. 432 mL [168], P=0.02) compared with the 4G/4G carriers. There were no significant differences in the levels of the t-PA/PAI-1 complex comparing different genotype groups. The carriers of the 5G/5G genotype showed the lower preoperative PAI-1 levels, greater chest tube blood loss, and higher D-dimer levels indicating that the 5G/5G carriers may have enhanced fibrinolysis.

  7. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy.

    PubMed

    Han, Su-Ryun; Kim, Cheon-Jong; Lee, Byung-Cheol

    2012-04-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34-20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN.

  8. Occurrence of IgG4-related hypophysitis lacking IgG4-bearing plasma cell infiltration during steroid therapy.

    PubMed

    Ohkubo, Yohsuke; Sekido, Takashi; Takeshige, Keiko; Ishi, Hiroaki; Takei, Masahiro; Nishio, Shin-ichi; Yamazaki, Masanori; Komatsu, Mitsuhisa; Kawa, Shigeyuki; Suzuki, Satoru

    2014-01-01

    Eight years after an episode of multiple IgG4-related disease, a pituitary mass with panhypopituitarism and a visual disturbance developed in a 70-year-old man under low-dose steroid therapy. A pituitary biopsy revealed findings of lymphocytic hypophysitis with the absence of IgG4-positive plasma cell infiltration. The serum IgG4 level was unremarkable. Although performing a pituitary biopsy and measuring the serum IgG4 level is crucial for making a diagnosis of IgG4-related hypophysitis, it is occasionally difficult to diagnose the disease in patients treated with steroid therapy, as observed in the present case. Based on a review of the diagnosis, conducting a careful assessment is required, especially in men and elderly patients thought to have solitary hypophysitis.

  9. Influence of hearing of 22 G Whitacre and 22 G Quincke needles.

    PubMed

    Sundberg, A; Wang, L P; Fog, J

    1992-11-01

    Audiograms were performed pre-operatively and 2 days postoperatively in 48 patients given spinal anaesthesia for transurethral resection of the prostate. Hearing levels were examined at 1000 Hz and below. Either 22 G standard design (Quincke) needles (n = 25) or 22 G pencil-point design (Whitacre) needles (n = 23) were used. Hearing loss of 10 dB or more at two or more frequencies were observed in six of 25 patients in the Quincke group and in two of 23 patients in the Whitacre group. The mean hearing level was more reduced in the Quincke group. The shape of the tip of the spinal needle seems to be of some importance to the effects on hearing level that may occur after spinal anaesthesia.

  10. Dark-energy cosmological models in f(G) gravity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shamir, M. F., E-mail: farasat.shamir@nu.edu.pk

    We discuss dark-energy cosmological models in f(G) gravity. For this purpose, a locally rotationally symmetric Bianchi type I cosmological model is considered. First, exact solutions with a well-known form of the f(G) model are explored. One general solution is discussed using a power-law f(G) gravity model and physical quantities are calculated. In particular, Kasner’s universe is recovered and the corresponding f(G) gravity models are reported. Second, the energy conditions for the model under consideration are discussed using graphical analysis. It is concluded that solutions with f(G) = G{sup 5/6} support expansion of universe while those with f(G) = G{sup 1/2}more » do not favor the current expansion.« less

  11. Endonuclease G promotes mitochondrial genome cleavage and replication

    PubMed Central

    Wiehe, Rahel Stefanie; Gole, Boris; Chatre, Laurent; Walther, Paul; Calzia, Enrico; Ricchetti, Miria; Wiesmüller, Lisa

    2018-01-01

    Endonuclease G (EndoG) is a nuclear-encoded endonuclease, mostly localised in mitochondria. In the nucleus EndoG participates in site-specific cleavage during replication stress and genome-wide DNA degradation during apoptosis. However, the impact of EndoG on mitochondrial DNA (mtDNA) metabolism is poorly understood. Here, we investigated whether EndoG is involved in the regulation of mtDNA replication and removal of aberrant copies. We applied the single-cell mitochondrial Transcription and Replication Imaging Protocol (mTRIP) and PCR-based strategies on human cells after knockdown/knockout and re-expression of EndoG. Our analysis revealed that EndoG stimulates both mtDNA replication initiation and mtDNA depletion, the two events being interlinked and dependent on EndoG's nuclease activity. Stimulation of mtDNA replication by EndoG was independent of 7S DNA processing at the replication origin. Importantly, both mtDNA-directed activities of EndoG were promoted by oxidative stress. Inhibition of base excision repair (BER) that repairs oxidative stress-induced DNA damage unveiled a pronounced effect of EndoG on mtDNA removal, reminiscent of recently discovered links between EndoG and BER in the nucleus. Altogether with the downstream effects on mitochondrial transcription, protein expression, redox status and morphology, this study demonstrates that removal of damaged mtDNA by EndoG and compensatory replication play a critical role in mitochondria homeostasis. PMID:29719607

  12. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân

    2013-01-01

    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  13. The 26gAl(p,g)27Si reaction in Novae

    NASA Astrophysics Data System (ADS)

    Ruiz, Chris; Parikh, A.; José, J.; Buchmann, L.; Caggiano, J. A.; Chen, A. A.; Clark, J. A.; Crawford, H.; Davids, B.; D'Auria, J. M.; Davis, C.; Deibel, C.; Erikson, L.; Fogarty, L.; Frekers, D.; Greife, U.; Hussein, A.; Hutcheon, D. A.; Huyse, M.; Jewett, C.; Laird, A. M.; Lewis, R.; Mumby-Croft, P.; Olin, A.; Ottewell, D. F.; Ouellet, C. V.; Parker, P.; Pearson, J.; Ruprecht, G.; Trinczek, M.; Vockenhuber, C.; Wrede, C.

    The 26gAl(p,γ)27Si Reaction in Novae PoS(NIC-IX)004 1 TRIUMF, 4004 Wesbrook Mall, Vancouver, BC V6T 2A3, Canada 2 Wright Nuclear Structure Laboratory, Yale University, New Haven, Conneticut 06520-8124, USA 3 Dept. de Física í Enginyeria Nuclear, Universitat Politécnica de Catalunya, Barcelona, Spain 4 Institut d'Estudis Espacials de Catalunya (IEEC), Barcelona, Spain 5 McMaster University, Hamilton, ON L8S 481, Canada 6 Simon Fraser University, Burnaby, BC V5A 1S6, Canada 7 Department of Physics, Colorado School of Mines, Golden, Colorado 80401, USA 8 National University of Ireland, Maynooth, Co. Kildare, Ireland 9 Institut für Kernphysik, Westfälische Willhelms-Universität Münster, 48149 Münster, Germany 10 University of Northern British Columbia, Prince George, BC V2N 4Z9, Canada 11 Katholieke Universiteit Leuven, 3000 Leuven, Belgium 12 Department of Physics, University of York, York YO10 5DD, United Kingdom The 184 keV resonance strength in the 26gAl(p,γ)27Si reaction was measured in inverse kinematics using the DRAGON facility at TRIUMF-ISAC. We obtain a value of ωγ=35±7 μeV for the strength and ER=184±1 keV for the resonance energy. These values are consistent with p-wave capture into the 7652(3) keV state in 27Si. We discuss the implications of these results for 26gAl nucleosynthesis in a typical O-Ne white dwarf nova.

  14. The −675 4G/5G Polymorphism in Plasminogen Activator Inhibitor-1 Gene Is Associated with Risk of Asthma: A Meta-Analysis

    PubMed Central

    Xiu, Qing-yu

    2012-01-01

    Background A number of studies assessed the association of −675 4G/5G polymorphism in the promoter region of plasminogen activator inhibitor (PAI)-1 gene with asthma in different populations. However, most studies reported inconclusive results. A meta-analysis was conducted to investigate the association between polymorphism in the PAI-1 gene and asthma susceptibility. Methods Databases including Pubmed, EMBASE, HuGE Literature Finder, Wanfang Database, China National Knowledge Infrastructure (CNKI) and Weipu Database were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association in the dominant model, recessive model, codominant model, and additive model. Results Eight studies involving 1817 cases and 2327 controls were included. Overall, significant association between 4G/5G polymorphism and asthma susceptibility was observed for 4G4G+4G5G vs. 5G5G (OR = 1.56, 95% CI 1.12–2.18, P = 0.008), 4G/4G vs. 4G/5G+5G/5G (OR = 1.38, 95% CI 1.06–1.80, P = 0.02), 4G/4G vs. 5G/5G (OR = 1.80, 95% CI 1.17–2.76, P = 0.007), 4G/5G vs. 5G/5G (OR = 1.40, 95% CI 1.07–1.84, P = 0.02), and 4G vs. 5G (OR = 1.35, 95% CI 1.08–1.68, P = 0.008). Conclusions This meta-analysis suggested that the −675 4G/5G polymorphism of PAI-1 gene was a risk factor of asthma. PMID:22479620

  15. Effect of Urea on G-Quadruplex Stability.

    PubMed

    Aslanyan, Lusine; Ko, Jordan; Kim, Byul G; Vardanyan, Ishkhan; Dalyan, Yeva B; Chalikian, Tigran V

    2017-07-13

    G-quadruplexes represent a class of noncanonical nucleic acid structures implicated in transcriptional regulation, cellular function, and disease. An understanding of the forces involved in stabilization and destabilization of the G-quadruplex conformation relative to the duplex or single-stranded conformation is a key to elucidating the biological role of G-quadruplex-based genomic switches and the quest for therapeutic means for controlled induction or suppression of a G-quadruplex at selected genomic loci. Solute-solvent interactions provide a ubiquitous and, in many cases, the determining thermodynamic force in maintaining and modulating the stability of nucleic acids. These interactions involve water as well as water-soluble cosolvents that may be present in the solution or in the crowded environment in the cell. We present here the first quantitative investigation of the effect of urea, a destabilizing cosolvent, on the conformational preferences of a G-quadruplex formed by the telomeric d[A(G 3 T 2 A) 3 G 3 ] sequence (Tel22). At 20 mM NaCl and room temperature, Tel22 undergoes a two-state urea-induced unfolding transition. An increase in salt mitigates the deleterious effect of urea on Tel22. The urea m-value of Tel22 normalized per change in solvent-accessible surface area, ΔS A , is similar to those for other DNA and RNA structures while being several-fold larger than that of proteins. Our results suggest that urea can be employed as an analytical tool in thermodynamic characterizations of G-quadruplexes in a manner similar to the use of urea in protein studies. We emphasize the need for further studies involving a larger selection of G-quadruplexes varying in sequence, topology (parallel, antiparallel, hybrid), and molecularity (monomolecular, bimolecular, tetramolecular) to outline the advantages and the limits of the use of urea in G-quadruplex studies. A deeper understanding of the effect of solvent and cosolvents on the differential stability of the

  16. Regulation, Signaling, and Physiological Functions of G-Proteins.

    PubMed

    Syrovatkina, Viktoriya; Alegre, Kamela O; Dey, Raja; Huang, Xin-Yun

    2016-09-25

    Heterotrimeric guanine-nucleotide-binding regulatory proteins (G-proteins) mainly relay the information from G-protein-coupled receptors (GPCRs) on the plasma membrane to the inside of cells to regulate various biochemical functions. Depending on the targeted cell types, tissues, and organs, these signals modulate diverse physiological functions. The basic schemes of heterotrimeric G-proteins have been outlined. In this review, we briefly summarize what is known about the regulation, signaling, and physiological functions of G-proteins. We then focus on a few less explored areas such as the regulation of G-proteins by non-GPCRs and the physiological functions of G-proteins that cannot be easily explained by the known G-protein signaling pathways. There are new signaling pathways and physiological functions for G-proteins to be discovered and further interrogated. With the advancements in structural and computational biological techniques, we are closer to having a better understanding of how G-proteins are regulated and of the specificity of G-protein interactions with their regulators. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. G6PD deficiency assessment in Freetown, Sierra Leone, reveals further insight into the molecular heterogeneity of G6PD A-.

    PubMed

    Jalloh, Amadu; Jalloh, Muctarr; Gamanga, Idrissa; Baion, David; Sahr, Foday; Gbakima, Aiah; Willoughby, Victor R; Matsuoka, Hiroyuki

    2008-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency in Africa is of high prevalence, although precise data are lacking in many individual nations. We investigated 129 unrelated subjects (71 male subjects, 58 female subjects) visiting a teaching hospital in Freetown, Sierra Leone, to collect baseline data on the distribution of G6PD deficiency among respective ethnic groups in the country. We confirmed eight G6PD-deficient male subjects by two formazan-based blood tests (11.3% of the male subjects examined), and also detected the common 376A > G mutation in 11 male subjects and eight female subjects by sequencing exons 3-5 of the G6PD gene. Selected samples were further sequenced for exons 2-13 and introns 5, 7, 8, and 11. Among the deficient male subjects, six were G6PD A- carrying the double mutations (202G > A and 376A > G), all of whom were in the Temne and Mende ethnic groups. Others included A- Betica, and a novel variant having double mutations in exon 5 (311G > A and 376A > G forming 104 Arg > His and 126 Asn > Asp, respectively), which we designate as G6PD Sierra Leone. Subsequent haplotype analysis linked this novel variant to the G6PD A- "family".

  18. Gender-specific association of the plasminogen activator inhibitor-1 4G/5G polymorphism with central arterial blood pressure.

    PubMed

    Björck, Hanna M; Eriksson, Per; Alehagen, Urban; De Basso, Rachel; Ljungberg, Liza U; Persson, Karin; Dahlström, Ulf; Länne, Toste

    2011-07-01

    The functional plasminogen activator inhibitor-1 (PAI-1) 4G/5G polymorphism has previously been associated with hypertension. In recent years, central blood pressure, rather than brachial has been argued a better measure of cardiovascular damage and clinical outcome. The aim of this study was to investigate the possible influence of the 4G/5G polymorphism on central arterial blood pressure in a cohort of elderly individuals. We studied 410 individuals, 216 men and 194 women, aged 70-88. Central pressures and pulse waveforms were calculated from the radial artery pressure waveform by the use of the SphygmoCor system and a generalized transfer function. Brachial pressure was recorded using oscillometric technique (Dinamap, Critikon, Tampa, FL). PAI-1 antigen was determined in plasma. The results showed that central pressures were higher in women carrying the PAI-1 4G/4G genotype compared to female carriers of the 5G/5G genotype, (P = 0.025, P = 0.002, and P = 0.002 for central systolic-, diastolic-, and mean arterial pressure, respectively). The association remained after adjustment for potentially confounding factors related to hypertension. No association of the PAI-1 genotype with blood pressure was found in men. Multiple regression analysis revealed an association between PAI-1 genotype and plasma PAI-1 levels (P = 0.048). Our findings show a gender-specific association of the PAI-1 4G/5G polymorphism with central arterial blood pressure. The genotype effect was independent of other risk factors related to hypertension, suggesting that impaired fibrinolytic potential may play an important role in the development of central hypertension in women.

  19. GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.

    PubMed

    Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma

    2015-09-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.

  20. 4G/5G Polymorphism of the plasminogen activator inhibitor-1 gene is associated with multiple organ dysfunction in critically ill patients.

    PubMed

    Huq, Muhammad Aminul; Takeyama, Naoshi; Harada, Makoto; Miki, Yasuo; Takeuchi, Akinori; Inoue, Sousuke; Nakagawa, Takashi; Kanou, Hideki; Hirakawa, Akihiko; Noguchi, Hiroshi

    2012-01-01

    Impaired fibrinolysis is associated with a higher incidence of both multiple organ dysfunction and mortality in the intensive care unit (ICU). Plasminogen activator inhibitor (PAI)-1 is the chief inhibitor of fibrinolysis. We investigated the influence of the 4G/5G polymorphism (rs1799768) of the PAI-1 gene on the plasma PAI-1 level and the outcome of critically ill patients. In 41 consecutive patients admitted to the ICU, PAI-1 gene polymorphism was assessed, plasma PAI-1 and arterial lactate concentrations were measured and clinical severity scores were recorded. Homozygotes for the 4G allele had higher plasma levels of PAI-1 antigen. The mean ± SD PAI-1 antigen level was 193.31 ± 167.93 ng/ml for the 4G/4G genotype, 100.67 ± 114.16 ng/ml for the 4G/5G genotype and 0.43 ± 0.53 ng/ml for the 5G/5G genotype. There was a significant correlation between plasma PAI-1 and arterial lactate concentrations, as well as between PAI-1 and severity scores. The mortality rate was 63, 33 and 0% for patients with the 4G/4G, 4G/5G and 5G/5G genotypes, respectively. These results demonstrate that the 4G/5G polymorphism of the PAI-1 gene affects the plasma PAI-1 concentration, which could impair fibrinolysis and cause organ failure, and thus the presence of the 4G allele increases the risk of death. Copyright © 2011 S. Karger AG, Basel.

  1. Upfront plerixafor plus G-CSF versus cyclophosphamide plus G-CSF for stem cell mobilization in multiple myeloma: efficacy and cost analysis study.

    PubMed

    Afifi, S; Adel, N G; Devlin, S; Duck, E; Vanak, J; Landau, H; Chung, D J; Lendvai, N; Lesokhin, A; Korde, N; Reich, L; Landgren, O; Giralt, S; Hassoun, H

    2016-04-01

    Cyclophosphamide plus G-CSF (C+G-CSF) is one of the most widely used stem cell (SC) mobilization regimens for patients with multiple myeloma (MM). Plerixafor plus G-CSF (P+G-CSF) has demonstrated superior SC mobilization efficacy when compared with G-CSF alone and has been shown to rescue patients who fail mobilization with G-CSF or C+G-CSF. Despite the proven efficacy of P+G-CSF in upfront SC mobilization, its use has been limited, mostly due to concerns of high price of the drug. However, a comprehensive comparison of the efficacy and cost effectiveness of SC mobilization using C+G-CSF versus P+G-CSF is not available. In this study, we compared 111 patients receiving C+G-CSF to 112 patients receiving P+G-CSF. The use of P+G-CSF was associated with a higher success rate of SC collection defined as ⩾5 × 10(6) CD34+ cells/kg (94 versus 83%, P=0.013) and less toxicities. Thirteen patients in the C+G-CSF arm were hospitalized owing to complications while none in the P+G-CSF group. C+G-CSF was associated with higher financial burden as assessed using institutional-specific costs and charges (P<0.001) as well as using Medicare reimbursement rates (P=0.27). Higher rate of hospitalization, increased need for salvage mobilization, and increased G-CSF use account for these differences.

  2. Impact of the -675 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene on childhood IgA nephropathy

    PubMed Central

    HAN, SU-RYUN; KIM, CHEON-JONG; LEE, BYUNG-CHEOL

    2012-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is an important regulator of the fibrinolytic pathway and extracellular matrix (ECM) turnover. The -675 4G/5G polymorphism in the PAI-1 promoter is associated with altered PAI-1 transcription, suggesting that this polymorphism may be a candidate risk factor for diseases characterized by ECM accumulation, such as immunoglobulin A nephropathy (IgAN) and mesangial proliferative glomerulonephritis (MesPGN). We genotyped childhood patients with biopsy-confirmed IgAN (n=111) and MesPGN (n=47), and healthy control subjects (n=230) for the -675 4G/5G PAI-1 polymorphism by polymerase chain reaction-restriction fragment length polymorphism methods. The distribution of the 4G/4G (27.9%), 4G/5G (45.1%) and 5G/5G (27.0%) genotypes in IgAN patients was significantly different from the healthy controls (32.2, 54.3 and 13.5%, respectively) (p=0.0092). There was no significant difference in the genotype distributions of the 4G/5G polymorphism between MesPGN patients and the healthy controls. Regarding the impact of the polymorphism on IgAN, the 4G/4G genotype was markedly increased in patients with proteinuria (≥1,000 mg/day) and/or hypertension when compared to patients without proteinuria and hypertension (OR=5.23, 95% CI 1.34–20.38, P=0.0183). These findings indicate that the PAI-1 gene polymorphism may affect the susceptibility of childhood IgAN. PMID:22969955

  3. IgG subclass alterations in adult asthma.

    PubMed

    Outschoorn, I M; Natta, C L

    1992-01-01

    Immunoglobulin levels were measured in serum samples of 12 black adult non-smoking asthmatic patients, 11 females and 1 male, and compared with 15 age-, sex-matched normal controls. Their total IgG, IgA and IgM levels were within the normal range. However, on quantitation of subclasses, IgG1 levels were significantly above normal, while IgG2 and IgG3 levels were significantly lower than those of controls. No significant differences were found between the two groups when IgG4 levels were compared. These studies as well as those of others suggest that immunoglobulin administration, particularly of individual subclasses, might prove to be a beneficial addition in the management of this condition.

  4. The influence of monovalent cations on trimeric G protein G(i)1α activity in HEK293 cells stably expressing DOR-G(i)1α (Cys(351)-Ile(351)) fusion protein.

    PubMed

    Vošahlíková, M; Svoboda, P

    2011-01-01

    The effect of monovalent cations on trimeric G protein G(i)1α was measured at equimolar concentration of chloride anion in pertussis-toxin (PTX)-treated HEK293 cells stably expressing PTX-insensitive DOR- G(i)1α (Cys(351)-Ile(351)) fusion protein by high-affinity [(35)S]GTPgammaS binding assay. The high basal level of binding was detected in absence of DOR agonist and monovalent ions and this high level was inhibited with the order of: Na(+) > K(+) > Li(+). The first significant inhibition was detected at 1 mM NaCl. The inhibition by monovalent ions was reversed by increasing concentrations of DOR agonist DADLE. The maximum DADLE response was also highest for sodium and decreased in the order of: Na(+) > K(+) ~ Li(+). Our data indicate i) an inherently high activity of trimeric G protein G(i)1α when expressed within DOR- G(i)1α fusion protein and determined in the absence of monovalent cations, ii) preferential sensitivity of DOR- G(i)1alpha to sodium as far as maximum of agonist response is involved.

  5. The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

    PubMed Central

    Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

    2013-01-01

    DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

  6. Functional Fluorescent Protein Insertions in Herpes Simplex Virus gB Report on gB Conformation before and after Execution of Membrane Fusion

    PubMed Central

    Gallagher, John R.; Atanasiu, Doina; Saw, Wan Ting; Paradisgarten, Matthew J.; Whitbeck, J. Charles; Eisenberg, Roselyn J.; Cohen, Gary H.

    2014-01-01

    Entry of herpes simplex virus (HSV) into a target cell requires complex interactions and conformational changes by viral glycoproteins gD, gH/gL, and gB. During viral entry, gB transitions from a prefusion to a postfusion conformation, driving fusion of the viral envelope with the host cell membrane. While the structure of postfusion gB is known, the prefusion conformation of gB remains elusive. As the prefusion conformation of gB is a critical target for neutralizing antibodies, we set out to describe its structure by making genetic insertions of fluorescent proteins (FP) throughout the gB ectodomain. We created gB constructs with FP insertions in each of the three globular domains of gB. Among 21 FP insertion constructs, we found 8 that allowed gB to remain membrane fusion competent. Due to the size of an FP, regions in gB that tolerate FP insertion must be solvent exposed. Two FP insertion mutants were cell-surface expressed but non-functional, while FP insertions located in the crown were not surface expressed. This is the first report of placing a fluorescent protein insertion within a structural domain of a functional viral fusion protein, and our results are consistent with a model of prefusion HSV gB constructed from the prefusion VSV G crystal structure. Additionally, we found that functional FP insertions from two different structural domains could be combined to create a functional form of gB labeled with both CFP and YFP. FRET was measured with this construct, and we found that when co-expressed with gH/gL, the FRET signal from gB was significantly different from the construct containing CFP alone, as well as gB found in syncytia, indicating that this construct and others of similar design are likely to be powerful tools to monitor the conformation of gB in any model system accessible to light microscopy. PMID:25233449

  7. Toward improving mucosal barrier defenses: rhG-CSF plus IgG antibody.

    PubMed

    Simmonds, Aryeh; LaGamma, Edmund F

    2006-11-01

    Epithelial cell functions ultimately define the ability of the extremely low birth weight human fetus to survive outside of the uterus. These specialized epithelial cell capacities manage all human interactions with the ex utero world including: (i) lung mechanics, surface chemistry and gas exchange, (ii) renal tubular balance of fluid and electrolytes, (iii) barrier functions of the intestine and skin for keeping bacteria out and water in, plus enabling intestinal digestion, as well as (iv) maintaining an intact neuroepithelium lining of the ventricles of the brain and retina. In Part I of this two part review, the authors describe why the gut barrier is a clinically relevant model system for studying the complex interplay between innate and adaptive immunity, dendritic &epithelial cell interactions, intraepithelial lymphocytes, M-cells, as well as the gut associated lymphoid tissues where colonization after birth, clinician feeding practices, use of antibiotics as well as exposure to prebiotics, probiotics and maternal vaginal flora all program the neonate for a life-time of immune competence distinguishing "self" from foreign antigens. These barrier defense capacities become destructive during disease processes like necrotizing enterocolitis (NEC) when an otherwise maturationally normal, yet dysregulated and immature, immune defense system is associated with high levels of certain inflammatory mediators like TNFa. In Part II the authors discuss the rationale for why rhG-CSF has theoretical advantages in managing NEC or sepsis by augmenting neonatal neutrophil number, neutrophil expression of Fcg and complement receptors, as well as phagocytic function and oxidative burst. rhG-CSF also has potent anti-TNFa functions that may serve to limit extension of tissue destruction while not impairing bacterial killing capacity. Healthy, non-infected neutropenic and septic neonates differ in their ability to respond to rhG-CSF; however, no neonatal clinical trials to date

  8. Total and free cortisol levels during 1 μg, 25 μg, and 250 μg cosyntropin stimulation tests compared to insulin tolerance test: results of a randomized, prospective, pilot study.

    PubMed

    Peechakara, Seenia; Bena, James; Clarke, Nigel J; McPhaul, Michael J; Reitz, Richard E; Weil, Robert J; Recinos, Pablo; Kennedy, Laurence; Hamrahian, Amir H

    2017-09-01

    The appropriate cosyntropin dose during cosyntropin stimulation tests remains uncertain. We conducted a prospective, randomized pilot study to compare 1 μg IV low dose cosyntropin test, 25 μg IM medium dose cosyntropin test, and 250 μg IM standard dose cosyntropin test to evaluate secondary adrenal insufficiency. Insulin tolerance test was used as the gold standard. The study included patients with hypothalamic/pituitary disease (n  = 10) with at least one pituitary axis deficiency other than ACTH deficiency and controls (n  = 12). All tests were done in random order. Sensitivity and specificity were calculated for total cortisol and serum free cortisol cut-off levels during cosyntropin stimulation tests. The median (range) age and F/M sex ratios for patients and controls were 54 years (23-62), 2/8, and 33 years (21-51), 6/6, respectively. The best total cortisol cut-off during low dose cosyntropin test, medium dose cosyntropin test, 30 min and 60 min standard dose cosyntropin test were 14.6 μg/dL (100% sensitivity & specificity), 18.7 μg/dL (100% sensitivity, 88% specificity), 16.1 (100% sensitivity & specificity), and 19.5 μg/dL (100% sensitivity & specificity), respectively. There was no difference in the ROC curve for cortisol values between the cosyntropin stimulation tests (p  > 0.41). Using a cortisol cut-off of 18 μg/dL during cosyntropin stimulation tests, only cortisol level at 30 min during standard dose cosyntropin test provided discrimination similar to insulin tolerance test. The best peak free cortisol cut-off levels were 1 μg/dL for insulin tolerance test, 0.9 μg/dL for low dose cosyntropin test, 0.9 μg/dL for medium dose cosyntropin test, and 0.9 μg/dL and 1.3 μg/dL for 30 min and 60 min standard dose cosyntropin test, respectively. All cosyntropin stimulation tests had excellent correlations with insulin tolerance test, when appropriate cut-offs were used. This pilot study does not

  9. Adjustable Membrane Mirrors Incorporating G-Elastomers

    NASA Technical Reports Server (NTRS)

    Chang, Zensheu; Morgan, Rhonda M.; Xu, Tian-Bing; Su, Ji; Hishinuma, Yoshikazu; Yang, Eui-Hyeok

    2008-01-01

    Lightweight, flexible, large-aperture mirrors of a type being developed for use in outer space have unimorph structures that enable precise adjustment of their surface figures. A mirror of this type includes a reflective membrane layer bonded with an electrostrictive grafted elastomer (G-elastomer) layer, plus electrodes suitably positioned with respect to these layers. By virtue of the electrostrictive effect, an electric field applied to the G-elastomer membrane induces a strain along the membrane and thus causes a deflection of the mirror surface. Utilizing this effect, the mirror surface figure can be adjusted locally by individually addressing pairs of electrodes. G-elastomers, which were developed at NASA Langley Research Center, were chosen for this development in preference to other electroactive polymers partly because they offer superior electromechanical performance. Whereas other electroactive polymers offer, variously, large strains with low moduli of elasticity or small strains with high moduli of elasticity, G-elastomers offer both large strains (as large as 4 percent) and high moduli of elasticity (about 580 MPa). In addition, G-elastomer layers can be made by standard melt pressing or room-temperature solution casting.

  10. 75 FR 23194 - Airworthiness Directives; GROB-WERKE GMBH & CO KG Models G102 ASTIR CS and G102 STANDARD ASTIR...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-03

    ... & CO KG Models G102 ASTIR CS and G102 STANDARD ASTIR III Gliders AGENCY: Federal Aviation.... Affected ADs (b) None. Applicability (c) This AD applies to Models G102 ASTIR CS and G102 STANDARD ASTIR..., Standards Office, FAA, has the authority to approve AMOCs for this AD, if requested using the procedures...

  11. Δg: The new aromaticity index based on g-factor calculation applied for polycyclic benzene rings

    NASA Astrophysics Data System (ADS)

    Ucun, Fatih; Tokatlı, Ahmet

    2015-02-01

    In this work, the aromaticity of polycyclic benzene rings was evaluated by the calculation of g-factor for a hydrogen placed perpendicularly at geometrical center of related ring plane at a distance of 1.2 Å. The results have compared with the other commonly used aromatic indices, such as HOMA, NICSs, PDI, FLU, MCI, CTED and, generally been found to be in agreement with them. So, it was proposed that the calculation of the average g-factor as Δg could be applied to study the aromaticity of polycyclic benzene rings without any restriction in the number of benzene rings as a new magnetic-based aromaticity index.

  12. FURTHER STUDIES ON THE γG-HEAVY CHAIN GENE COMPLEXES, WITH PARTICULAR REFERENCE TO THE GENETIC MARKERS Gm(g) AND Gm(n)

    PubMed Central

    Natvig, J. B.; Kunkel, H. G.; Yount, W. J.; Nielsen, J. C.

    1968-01-01

    The recently described Gm (g) and Gm (n) genetic markers of the γG3- and γG2-subgroups of γ-globulin were characterized in detail primarily through studies of myeloma proteins, their polypeptide chains and fragments. Antisera derived from rabbits, non-human primates and rheumatoid arthritis patients gave identical results. This contrasted with the Gm (b) system where the rabbit antisera react with a different genetic determinant (b0) than the sera from rheumatoid arthritis patients (b). The Gm (g) and Gm (n) antigens were detected both by precipitin analysis and by hemagglutination inhibition. The Gm (g) antigen was not associated with any of the other genetic antigens of the γG3-proteins which all belonged in the Gm (b) class. The genes for the latter were always allelic to the gene coding for Gm (g), with that for Gm (b0) constantly present when that for Gm (g) was absent. The Gm (g) and Gm (n) markers were of particular value in tracing the various gene complexes made up of the closely linked subgroup genes. Further support was gained for the concept that the different gene complexes of various population groups arose primarily through crossing-over. The Gm g and Gm b genes for the γG3-subgroup were extremely closely linked to those for the γG1-subgroup. However the Gm (n) marker indicated that the γG2-subgroup genes were probably further separated on the chromosome. Additional evidence was obtained for the γG2-γG3-γG1-order of the subgroup cistrons. Among the wide range of gene complexes a new type (γG2,—,γ/G1) was described. This complex appeared to have a deletion of the γG3-cistron. Lower levels of γG3-globulin were found in the sera of the individuals with this gene in the heterozygous state. The possibility that this unusual complex arose through an unequal nonhomologous crossing-over is discussed. PMID:19867305

  13. Clinical anatomy of the G-spot.

    PubMed

    Pan, Shu; Leung, Cynthia; Shah, Jaimin; Kilchevsky, Amichai

    2015-04-01

    The existence of the G-Spot has never been unequivocally confirmed. With increased public exposure and a trend towards sexual gratification, however, the impetus to elucidate this structure is greater than ever. This review will focus on research that has been conducted on the clinical anatomy of the G-Spot. Ultimately this review will show that while the distal area of the anterior vaginal wall appears to be the most sensitive region of the vagina, the existence of an anatomical "G-spot" remains to be demonstrated. © 2015 Wiley Periodicals, Inc.

  14. Bergman spaces of natural G-manifolds☆

    PubMed Central

    Della Sala, Giuseppe; Perez, Joe J.

    2013-01-01

    Let G be a unimodular Lie group, X a compact manifold with boundary, and M the total space of a principal bundle G→M→X so that M is also a strongly pseudoconvex complex manifold. In this work, we show that if there exists a point p∈bM such that TpG is contained in the complex tangent space TpcbM of bM at p, then the Bergman space of M is large. Natural examples include the gauged G-complexifications of Heinzner, Huckleberry, and Kutzschebauch. PMID:24222924

  15. The empirical Gaia G-band extinction coefficient

    NASA Astrophysics Data System (ADS)

    Danielski, C.; Babusiaux, C.; Ruiz-Dern, L.; Sartoretti, P.; Arenou, F.

    2018-06-01

    Context. The first Gaia data release unlocked the access to photometric information for 1.1 billion sources in the G-band. Yet, given the high level of degeneracy between extinction and spectral energy distribution for large passbands such as the Gaia G-band, a correction for the interstellar reddening is needed in order to exploit Gaia data. Aims: The purpose of this manuscript is to provide the empirical estimation of the Gaia G-band extinction coefficient kG for both the red giants and main sequence stars in order to be able to exploit the first data release DR1. Methods: We selected two samples of single stars: one for the red giants and one for the main sequence. Both samples are the result of a cross-match between Gaia DR1 and 2MASS catalogues; they consist of high-quality photometry in the G-, J- and KS-bands. These samples were complemented by temperature and metallicity information retrieved from APOGEE DR13 and LAMOST DR2 surveys, respectively. We implemented a Markov chain Monte Carlo method where we used (G - KS)0 versus Teff and (J - KS)0 versus (G - KS)0, calibration relations to estimate the extinction coefficient kG and we quantify its corresponding confidence interval via bootstrap resampling. We tested our method on samples of red giants and main sequence stars, finding consistent solutions. Results: We present here the determination of the Gaia extinction coefficient through a completely empirical method. Furthermore we provide the scientific community with a formula for measuring the extinction coefficient as a function of stellar effective temperature, the intrinsic colour (G - KS)0, and absorption.

  16. Women’s G Tolerance

    DTIC Science & Technology

    1986-08-01

    for the groups matched by age (70 pairs), weight sickness, uncomfortable feelings of distension in arms (26 pairs), and act~vity status (84 pairs...mass-spring-damper) s ,stem Straining G tolerance, being dpendent on skeletal having a resonant frequency above about I Hz. As muscular strength and...of the women’s G tolerance stud\\ scclic variations in muscular strength and endurance. was below 0.1 Hz (11), the production of any significant

  17. Effects of 2G and 3G mobile phones on performance and electrophysiology in adolescents, young adults and older adults.

    PubMed

    Leung, S; Croft, R J; McKenzie, R J; Iskra, S; Silber, B; Cooper, N R; O'Neill, B; Cropley, V; Diaz-Trujillo, A; Hamblin, D; Simpson, D

    2011-11-01

    This study examined sensory and cognitive processing in adolescents, young adults and older adults, when exposed to 2nd (2G) and 3rd (3G) generation mobile phone signals. Tests employed were the auditory 3-stimulus oddball and the N-back. Forty-one 13-15 year olds, forty-two 19-40 year olds and twenty 55-70 year olds were tested using a double-blind cross-over design, where each participant received Sham, 2G and 3G exposures, separated by at least 4 days. 3-Stimulus oddball task: Behavioural: accuracy and reaction time of responses to targets were not affected by exposure. Electrophysiological: augmented N1 was found in the 2G condition (independent of age group). N-back task: Behavioural: the combined groups performed less accurately during the 3G exposure (compared to Sham), with post hoc tests finding this effect separately in the adolescents only. Electrophysiological: delayed ERD/ERS responses of the alpha power were found in both 3G and 2G conditions (compared to Sham; independent of age group). Employing tasks tailored to each individual's ability level, this study provides support for an effect of acute 2G and 3G exposure on human cognitive function. The subtlety of mobile phone effect on cognition in our study suggests that it is important to account for individual differences in future mobile phone research. Copyright © 2011 International Federation of Clinical Neurophysiology. All rights reserved.

  18. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice.

    PubMed

    Perez, Elizabeth M; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-03-21

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year.

  19. 4G/5G Polymorphism of Plasminogen Activator Inhibitor -1 Gene Is Associated with Mortality in Intensive Care Unit Patients with Severe Pneumonia

    PubMed Central

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A.; Wiener-Kronish, Jeanine

    2011-01-01

    Background Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. Methods The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. Results A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. Conclusions The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia. PMID:19387177

  20. 4G/5G polymorphism of plasminogen activator inhibitor-1 gene is associated with mortality in intensive care unit patients with severe pneumonia.

    PubMed

    Sapru, Anil; Hansen, Helen; Ajayi, Temitayo; Brown, Ron; Garcia, Oscar; Zhuo, HanJing; Wiemels, Joseph; Matthay, Michael A; Wiener-Kronish, Jeanine

    2009-05-01

    Higher plasma and pulmonary edema fluid levels of plasminogen activator inhibitor-1 (PAI-1) are associated with increased mortality in patients with pneumonia and acute lung injury. The 4G allele of the 4G/5G polymorphism of the PAI-1 gene is associated with higher PAI-1 levels and an increased incidence of hospitalizations for pneumonia. The authors hypothesized that the 4G allele would be associated with worse clinical outcomes (mortality and ventilator-free days) in patients with severe pneumonia. The authors enrolled patients admitted with severe pneumonia in a prospective cohort. Patients were followed until hospital discharge. DNA was isolated from blood samples, and genotyping detection for the PAI-1 4G/5G polymorphism was carried out using Taqman-based allelic discrimination. A total of 111 patients were available for analysis. Distribution of genotypes was 4G/4G 26 of 111 (23%), 4G/5G 59 of 111 (53%), and 5G/5G 26 of 111 (23%). Of 111 patients, 32 (29%) died before hospital discharge and 105 patients (94%) received mechanical ventilation. Patients with the 4G/4G and the 4G/5G genotypes had higher mortality (35% vs. 8%, P = 0.007) and fewer ventilator-free days (median 4 vs. 13, P = 0.04) compared to patients with the 5G/5G genotype. The 4G allele of the 4G/5G polymorphism in the PAI-1 gene is associated with fewer ventilator-free days and increased mortality in hospitalized patients with severe pneumonia. These findings suggest that PAI-1 may have a role in pathogenesis and that the 4G/5G polymorphism may be an important biomarker of risk in patients with severe pneumonia.

  1. Heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(s)

    NASA Technical Reports Server (NTRS)

    Leu, Ming-Taun; Timonen, Raimo S.; Keyser, Leon F.; Yung, Yuk L.

    1995-01-01

    The heterogeneous reactions of HNO3(g) + NaCl(s) yields HCl(g) + NaNO3(s) (eq 1) and N2O5(g) + NaCl(s) yields ClNO2(g) + NaNO3(S) (eq 2) were investigated over the temperature range 223-296 K in a flow-tube reactor coupled to a quadrupole mass spectrometer. Either a chemical ionization mass spectrometer (CIMS) or an electron-impact ionization mass spectrometer (EIMS) was used to provide suitable detection sensitivity and selectivity. In order to mimic atmospheric conditions, partial pressures of HNO3 and N2O5 in the range 6 x 10(exp -8) - 2 x 10(exp -6) Torr were used. Granule sizes and surface roughness of the solid NaCl substrates were determined by using a scanning electron microscope. For dry NaCl substrates, decay rates of HNO3 were used to obtain gamma(1) = 0.013 +/- 0.004 (1sigma) at 296 K and > 0.008 at 223 K, respectively. The error quoted is the statistical error. After all corrections were made, the overall error, including systematic error, was estimated to be about a factor of 2. HCl was found to be the sole gas-phase product of reaction 1. The mechanism changed from heterogeneous reaction to predominantly physical adsorption when the reactor was cooled from 296 to 223 K. For reaction 2 using dry salts, gamma(2) was found to be less than 1.0 x 10(exp -4) at both 223 and 296 K. The gas-phase reaction product was identified as ClNO2 in previous studies using an infrared spectrometer. An enhancement in reaction probability was observed if water was not completely removed from salt surfaces, probably due to the reaction of N2O5(g) + H2O(s) yields 2HNO3(g). Our results are compared with previous literature values obtained using different experimental techniques and conditions. The implications of the present results for the enhancement of the hydrogen chloride column density in the lower stratosphere after the El Chichon volcanic eruption and for the chemistry of HCl and HNO3 in the marine troposphere are discussed.

  2. Whole Genomic Analysis of Human G12P[6] and G12P[8] Rotavirus Strains that Have Emerged in Myanmar

    PubMed Central

    Ide, Tomihiko; Komoto, Satoshi; Higo-Moriguchi, Kyoko; Htun, Khaing Win; Myint, Yi Yi; Myat, Theingi Win; Thant, Kyaw Zin; Thu, Hlaing Myat; Win, Mo Mo; Oo, Htun Naing; Htut, Than; Wakuda, Mitsutaka; Dennis, Francis Ekow; Haga, Kei; Fujii, Yoshiki; Katayama, Kazuhiko; Rahman, Shofiqur; Nguyen, Sa Van; Umeda, Kouji; Oguma, Keiji; Tsuji, Takao; Taniguchi, Koki

    2015-01-01

    G12 rotaviruses are emerging rotavirus strains causing severe diarrhea in infants and young children worldwide. However, the whole genomes of only a few G12 strains have been fully sequenced and analyzed. In this study, we sequenced and characterized the complete genomes of six G12 strains (RVA/Human-tc/MMR/A14/2011/G12P[8], RVA/Human-tc/MMR/A23/2011/G12P[6], RVA/Human-tc/MMR/A25/2011/G12P[8], RVA/Human-tc/MMR/P02/2011/G12P[8], RVA/Human-tc/MMR/P39/2011/G12P[8], and RVA/Human-tc/MMR/P43/2011/G12P[8]) detected in six stool samples from children with acute gastroenteritis in Myanmar. On whole genomic analysis, all six Myanmarese G12 strains were found to have a Wa-like genetic backbone: G12-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strains A14, A25, P02, P39, and P43, and G12-P[6]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strain A23. Phylogenetic analysis showed that most genes of the six strains examined in this study were genetically related to globally circulating human G1, G3, G9, and G12 strains. Of note is that the NSP4 gene of strain A23 exhibited the closest relationship with the cognate genes of human-like bovine strains as well as human strains, suggesting the occurrence of reassortment between human and bovine strains. Furthermore, strains A14, A25, P02, P39, and P43 were very closely related to one another in all the 11 gene segments, indicating derivation of the five strains from a common origin. On the other hand, strain A23 consistently formed distinct clusters as to all the 11 gene segments, indicating a distinct origin of strain A23 from that of strains A14, A25, P02, P39, and P43. To our knowledge, this is the first report on whole genome-based characterization of G12 strains that have emerged in Myanmar. Our observations will provide important insights into the evolutionary dynamics of spreading G12 rotaviruses in Asia. PMID:25938434

  3. UPSS and G2

    NASA Technical Reports Server (NTRS)

    Dito, Scott J.

    2014-01-01

    The Universal Propellant Servicing System (UPSS) is a dedicated mobile launcher propellant delivery method that will minimize danger and complexity in order to allow vehicles to be serviced and ultimately launched from a variety of locations previously not seen fit for space launch. The UPPS/G2 project is the development of a model, simulation, and ultimately a working application that will control and monitor the cryogenic fluid delivery to the rocket for testing purposes. To accomplish this, the project is using the programming language/environment Gensym G2. The environment is an all-inclusive application that allows development, testing, modeling, and finally operation of the unique application through graphical and programmatic methods. We have learned G2 through classes and trial-and-error, and are now in the process of building the application that will soon be able to be tested on apparatuses here at Kennedy Space Center, and eventually on the actual unit. The UPSS will bring near-autonomous control of launches to those that need it, as well it will be a great addition to NASA and KSC's operational viability and the opportunity to bring space launches to parts of the world, and in time constraints, once not thought possible.

  4. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  5. 25G compared with 20G vitrectomy under Resight non-contact wide-angle lenses for Terson syndrome.

    PubMed

    Mao, Xinbang; You, Zhipeng

    2017-08-01

    The aim of the present study was to compare the effectiveness of 25G vitrectomy to standard 20G vitrectomy for treatment of Terson syndrome under Resight non-contact wide-angle lenses. This was a case-control study of 20 patients with Terson syndrome (study group) that underwent 25G vitrectomy under Resight non-contact wide-angle lenses, with those of 20 matched patients that underwent 20G vitrectomy (control group). Medical records were reviewed from between July 2011 and October 2013. Data included results of the Early Treatment Diabetic Retinopathy Study examination, ophthalmology B-scan ultrasonography and fundus photography. The mean age, follow-up time, the preoperative visual acuity of LogMAR and the preoperative intraocular pressure (IOP) were all comparable in the two groups (all P>0.05). There were statistically significant differences in postoperative visual acuity of LogMAR compared with preoperative visual acuity (P<0.001) in both groups, but no difference between the groups (P=0.845). However, the operative times (13.5 min in study group vs. 42 min in control group) and post-operative IOP at day 1 (13.5 vs. 20 mmHg) were significantly reduced in the study group compared to the control group (P<0.001). Therefore, the present findings suggest that 25G Vitrectomy for Terson syndrome under Resight non-contact wide-angle lenses can achieve a significantly shorter operative time and lower post-operative IOP compared with 20G Vitrectomy.

  6. Determination of aflatoxins B1, B2, G1 and G2 in spices using a multifunctional column clean-up.

    PubMed

    Akiyama, H; Goda, Y; Tanaka, T; Toyoda, M

    2001-10-12

    A rapid and simple method using a multifunctional column, which contains lipophilic and charged active sites, was developed to analyse aflatoxins B1, B2, G1 and G2 in various spices, such as red pepper and nutmeg. After extraction by acetonitrile:water (9:1) and clean-up using MultiSep #228 column, the aflatoxins and aflatoxin-TFA derivatives are determined using LC with fluorescence detection. Recoveries of each aflatoxin B1, B2, G1 and G2 spiked to red pepper, white pepper, black pepper, nutmeg and tear grass at the level of 10 ng/g were over 80-85% in all instances. The minimum detectable concentration for aflatoxins in red pepper was 0.5 ng/g.

  7. Microgravity Investigation of Crew Reactions in 0-G (MICR0-G): Ground-Based Development Effort

    NASA Technical Reports Server (NTRS)

    Newman, Dava J.

    2002-01-01

    This report describes the technology development of an advanced load sensor ground-based prototype and details the preliminary tests in microgravity during parabolic flights. The research effort is entitled, the Microgravity Investigation and Crew Reactions in 0-G (MICR0-G), a ground-based research effort funded by the National Aeronautics and Space Administration (NASA). The MICR0-G project was a follow-on to the Enhanced Dynamic Load Sensors (EDLS) spaceflight experiment flown on the Russian Space Station Mir. The technology development of the advanced load sensor prototype has been carried out by the Massachusetts Institute of Technology (MIT), with collaboration from Politecnico di Milano University and the Italian Space Agency (ASI). The key hardware of the advanced sensor prototype is a set of two types of load sensors - a hand-hold and foot restraints - similar in appearance to the mobility aids found in the Space Shuttle orbiter to assist the crew in moving inside the spacecraft, but able to measure the applied forces and moments about the x-, y-, and z- axes. The aim of Chapter 1 is to give a brief overview of the report contents. The first section summarizes the previous research efforts on astronaut-induced loads in microgravity. The second section provides information on the MICR0-G research project and the technology development work conducted at MIT. Section 1.3 details the motivation for designing a new generation of load sensors and describes the main enhancements and contributions of the MICR0-G advanced load sensors system compared to the EDLS system. Finally, the last section presents the outline of the report.

  8. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements.

    PubMed

    Silva, Cleuton de Souza; Pereira, Douglas Henrique; Custodio, Rogério

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol(-1), while the original method presents a deviation corresponding to 0.83 kcal mol(-1). The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol(-1)) is compared to 1.29 kcal mol(-1) from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol(-1), the G4CEP deviation is ±2.72 kcal mol(-1). Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.

  9. The wiring diagram for plant G signaling

    DOE PAGES

    Colaneri, Alejandro C.; Jones, Alan M.

    2014-10-01

    Like electronic circuits, the modular arrangement of cell-signaling networks decides how inputs produce outputs. Animal heterotrimeric guanine nucleotide binding proteins (G-proteins) operate as switches in the circuits that signal between extracellular agonists and intracellular effectors. There still is no biochemical evidence for a receptor or its agonist in the plant G-protein pathways. Plant G-proteins deviate in many important ways from the animal paradigm. This paper covers important discoveries from the last two years that enlighten these differences and ends describing alternative wiring diagrams for the plant signaling circuits regulated by G-proteins. Finally, we propose that plant G-proteins are integrated inmore » the signaling circuits as variable resistor rather than switches, controlling the flux of information in response to the cell's metabolic state.« less

  10. Increase in serum concentrations of IgG2 and IgG4 by selenium supplementation in children with Down's syndrome.

    PubMed Central

    Annerén, G; Magnusson, C G; Nordvall, S L

    1990-01-01

    In a previous study on children with Down's syndrome a reduced rate of infections was reported by their parents after the children had received six months' treatment with selenium supplements. In the present study the concentrations of the four IgG subclasses were measured in 29 of these children in samples of serum obtained before and immediately after the period of supplementation and one year after it had finished. Selenium had a significant augmentative effect on the serum concentrations of IgG2 and IgG4, but not of IgG1 and IgG3. This effect was not related to age, as among children over the age of 6 years the serum concentrations of IgG2 and IgG4 had decreased significantly one year after the treatment had been stopped. This study suggests that selenium has an immunoregulatory effect, which might be of importance in both basic research and clinical practice. PMID:2148668

  11. Crew Training - STS-30/61B (Zero-G)

    NASA Image and Video Library

    1985-08-21

    KC-135 inflight training of the STS-30/61B Crew for suit donning doffing and Zero-G orientation for Rudolfo Neri, Astronaut Mary Cleave, and Ricardo Peralta, Backup Neri. 1. Astronaut Cleave, Mary - Zero-G 2. Neri, Rodolfo - Zero-G 3. Peralta, Ricard - Zero-G

  12. Computational Analysis of KRAS Mutations: Implications for Different Effects on the KRAS p.G12D and p.G13D Mutations

    PubMed Central

    Liu, Yen-Yi; Hwang, Jenn-Kang; Barrio, Maria Jesus; Rodrigo, Maximiliano; Garcia-Toro, Enrique; Herreros-Villanueva, Marta

    2013-01-01

    Background The issue of whether patients diagnosed with metastatic colorectal cancer who harbor KRAS codon 13 mutations could benefit from the addition of anti-epidermal growth factor receptor therapy remains under debate. The aim of the current study was to perform computational analysis to investigate the structural implications of the underlying mutations caused by c.38G>A (p.G13D) on protein conformation. Methods Molecular dynamics (MD) simulations were performed to understand the plausible structural and dynamical implications caused by c.35G>A (p.G12D) and c.38G>A (p.G13D). The potential of mean force (PMF) simulations were carried out to determine the free energy profiles of the binding processes of GTP interacting with wild-type (WT) KRAS and its mutants (MT). Results Using MD simulations, we observed that the root mean square deviation (RMSD) increased as a function of time for the MT c.35G>A (p.G12D) and MT c.38G>A (p.G13D) when compared with the WT. We also observed that the GTP-binding pocket in the c.35G>A (p.G12D) mutant is more open than that of the WT and the c.38G>A (p.G13D) proteins. Intriguingly, the analysis of atomic fluctuations and free energy profiles revealed that the mutation of c.35G>A (p.G12D) may induce additional fluctuations in the sensitive sites (P-loop, switch I and II regions). Such fluctuations may promote instability in these protein regions and hamper GTP binding. Conclusions Taken together with the results obtained from MD and PMF simulations, the present findings implicate fluctuations at the sensitive sites (P-loop, switch I and II regions). Our findings revealed that KRAS mutations in codon 13 have similar behavior as KRAS WT. To gain a better insight into why patients with metastatic colorectal cancer (mCRC) and the KRAS c.38G>A (p.G13D) mutation appear to benefit from anti-EGFR therapy, the role of the KRAS c.38G>A (p.G13D) mutation in mCRC needs to be further investigated. PMID:23437064

  13. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells.

    PubMed

    Chao, Xu; Zhou, Xiaojun; Zheng, Gang; Dong, Changhu; Zhang, Wei; Song, Xiaomei; Jin, Tianbo

    2014-05-01

    Osthole [7-methoxy-8-(3-methyl-2-butenyl) coumarin] isolated from the fruit of Cnidium monnieri (L.) Cuss, one of the commonly used Chinese medicines listed in the Shennong's Classic of Materia Medica in the Han Dynasty, had remarkable antiproliferative activity against human hepatocellular carcinoma HepG2 cells in culture. This study evaluated the effects of osthole on cell growth, nuclear morphology, cell cycle distribution, and expression of apoptosis-related proteins in HepG2 cells. Cytotoxic activity of osthole was determined by the MTT assay at various concentrations ranging from 0.004 to 1.0 µmol/ml in HepG2 cells. Cell morphology was assessed by Hoechst staining and fluorescence microscopy. Apoptosis and cell-cycle distribution was determined by annexin V staining and flow cytometry. Apoptotic protein levels were assessed by Western blot. Osthole exhibited significant inhibition of the survival of HepG2 cells and the half inhibitory concentration (IC₅₀) values were 0.186, 0.158 and 0.123 µmol/ml at 24, 48 and 72 h, respectively. Cells treated with osthole at concentrations of 0, 0.004, 0.02, 0.1 and 0.5 μmol/ml showed a statistically significant increase in the G2/M fraction accompanied by a decrease in the G0/G1 fraction. The increase of apoptosis induced by osthole was correlated with down-regulation expression of anti-apoptotic Bcl-2 protein and up-regulation expression of pro-apoptotic Bax and p53 proteins. Osthole had significant growth inhibitory activity and the pro-apoptotic effect of osthole is mediated through the activation of caspases and mitochondria in HepG2 cells. Results suggest that osthole has promising therapeutic potential against hepatocellular carcinoma.

  14. Signaling through G protein coupled receptors.

    PubMed

    Tuteja, Narendra

    2009-10-01

    Heterotrimeric G proteins (Galpha, Gbeta/Ggamma subunits) constitute one of the most important components of cell signaling cascade. G Protein Coupled Receptors (GPCRs) perceive many extracellular signals and transduce them to heterotrimeric G proteins, which further transduce these signals intracellular to appropriate downstream effectors and thereby play an important role in various signaling pathways. GPCRs exist as a superfamily of integral membrane protein receptors that contain seven transmembrane alpha-helical regions, which bind to a wide range of ligands. Upon activation by a ligand, the GPCR undergoes a conformational change and then activate the G proteins by promoting the exchange of GDP/GTP associated with the Galpha subunit. This leads to the dissociation of Gbeta/Ggamma dimer from Galpha. Both these moieties then become free to act upon their downstream effectors and thereby initiate unique intracellular signaling responses. After the signal propagation, the GTP of Galpha-GTP is hydrolyzed to GDP and Galpha becomes inactive (Galpha-GDP), which leads to its re-association with the Gbeta/Ggamma dimer to form the inactive heterotrimeric complex. The GPCR can also transduce the signal through G protein independent pathway. GPCRs also regulate cell cycle progression. Till to date thousands of GPCRs are known from animal kingdom with little homology among them, but only single GPCR has been identified in plant system. The Arabidopsis GPCR was reported to be cell cycle regulated and also involved in ABA and in stress signaling. Here I have described a general mechanism of signal transduction through GPCR/G proteins, structure of GPCRs, family of GPCRs and plant GPCR and its role.

  15. Who's afraid of the G-spot?

    PubMed

    Jannini, Emmanuele A; Whipple, Beverly; Kingsberg, Sheryl A; Buisson, Odile; Foldès, Pierre; Vardi, Yoram

    2010-01-01

    No controversy can be more controversial than that regarding the existence of the G-spot, an anatomical and physiological entity for women and many scientists, yet a gynecological UFO for others. The pros and cons data have been carefully reviewed by six scientists with different opinions on the G-spot. This controversy roughly follows the Journal of Sexual Medicine Debate held during the International Society for the Study of Women's Sexual Health Congress in Florence in the February of 2009. To give to The Journal of Sexual Medicine's reader enough data to form her/his own opinion on an important topic of female sexuality. Expert #1, who is JSM's Controversy section editor, reviewed histological data from the literature demonstrating the existence of discrete anatomical structures within the vaginal wall composing the G-spot. He also found that this region is not a constant, but can be highly variable from woman to woman. These data are supported by the findings discussed by Expert #2, dealing with the history of the G-spot and by the fascinating experimental evidences presented by Experts #4 and #5, showing the dynamic changes in the G-spot during digital and penile stimulation. Experts #3 and #6 argue critically against the G-spot discussing the contrasting findings so far produced on the topic. Although a huge amount of data (not always of good quality) have been accumulated in the last 60 years, we still need more research on one of the most challenging aspects of female sexuality.

  16. The role of HLA-G in parasitic diseases.

    PubMed

    Sabbagh, A; Sonon, P; Sadissou, I; Mendes-Junior, C T; Garcia, A; Donadi, E A; Courtin, D

    2018-04-01

    Little attention has been devoted to the role of HLA-G gene and molecule on parasitic disorders, and the available studies have focused on malaria, African and American trypanosomiasis, leishmaniosis, toxoplasmosis and echinococcosis. After reporting a brief description regarding the role of the cells of innate and adaptive immune system against parasites, we reviewed the major features of the HLA-G gene and molecule and the role of HLA-G on the major cells of immune system. Increased levels of soluble HLA-G (sHLA-G) have been observed in patients presenting toxoplasmosis and in the active phase of echinococcosis. In addition, increased sHLA-G has also been associated with increased susceptibility to malaria and increased susceptibility to develop human African trypanosomiasis (HAT). In contrast, decreased membrane-bound HLA-G has been reported in placenta of patients infected with Plasmodium falciparum and in heart and colon of patients presenting Chagas disease. The 3' untranslated region of the HLA-G gene has been the main focus of studies on malaria, HAT and Chagas disease, exhibiting distinct patterns of associations. Considering that HLA-G is an immune checkpoint molecule, inhibiting the activity of several cells of the immune system, the excessive neoexpression and the increased sHLA-G levels together with the decreased constitutive tissue expression of membrane-bound HLA-G may be detrimental to the host infected with parasite agents. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant

  18. Assessment of the further improved (G'/G)-expansion method and the extended tanh-method in probing exact solutions of nonlinear PDEs.

    PubMed

    Akbar, M Ali; Ali, Norhashidah Hj Mohd; Mohyud-Din, Syed Tauseef

    2013-01-01

    The (G'/G)-expansion method is one of the most direct and effective method for obtaining exact solutions of nonlinear partial differential equations (PDEs). In the present article, we construct the exact traveling wave solutions of nonlinear evolution equations in mathematical physics via the (2 + 1)-dimensional breaking soliton equation by using two methods: namely, a further improved (G'/G)-expansion method, where G(ξ) satisfies the auxiliary ordinary differential equation (ODE) [G'(ξ)](2) = p G (2)(ξ) + q G (4)(ξ) + r G (6)(ξ); p, q and r are constants and the well known extended tanh-function method. We demonstrate, nevertheless some of the exact solutions bring out by these two methods are analogous, but they are not one and the same. It is worth mentioning that the first method has not been exercised anybody previously which gives further exact solutions than the second one. PACS numbers 02.30.Jr, 05.45.Yv, 02.30.Ik.

  19. G-Strands on symmetric spaces

    PubMed Central

    2017-01-01

    We study the G-strand equations that are extensions of the classical chiral model of particle physics in the particular setting of broken symmetries described by symmetric spaces. These equations are simple field theory models whose configuration space is a Lie group, or in this case a symmetric space. In this class of systems, we derive several models that are completely integrable on finite dimensional Lie group G, and we treat in more detail examples with symmetric space SU(2)/S1 and SO(4)/SO(3). The latter model simplifies to an apparently new integrable nine-dimensional system. We also study the G-strands on the infinite dimensional group of diffeomorphisms, which gives, together with the Sobolev norm, systems of 1+2 Camassa–Holm equations. The solutions of these equations on the complementary space related to the Witt algebra decomposition are the odd function solutions. PMID:28413343

  20. CREW TRAINING (ZERO-G) - STS-41G - OUTER SPACE

    NASA Image and Video Library

    1984-07-16

    S84-37514 (18 July 1984) --- Marc Garneau, representing Canada's National Research Council as one of two 41-G payload specialists, gets the "feel" of zero gravity aboard a special NASA aircraft designed to create brief periods of weightlessness. Five astronauts and an oceanographer from the U.S. Dept. of the Navy will join Canada's first representative in space for the trip aboard Challenger later this year. This KC-135 aircraft is used extensively for evaluation of equipment and experiments scheduled for future missions.

  1. Plasminogen activator inhibitor-1 4G/5G polymorphism and ischemic stroke risk: a meta-analysis in Chinese population.

    PubMed

    Cao, Yuezhou; Chen, Weixian; Qian, Yun; Zeng, Yanying; Liu, Wenhua

    2014-12-01

    The guanosine insertion/deletion polymorphism (4G/5G) of plasminogen activator inhibitor-1 (PAI-1) gene has been suggested as a risk factor for ischemic stroke (IS), but direct evidence from genetic association studies remains inconclusive even in Chinese population. Therefore, we performed a meta-analysis to evaluate this association. All of the relevant studies were identified from PubMed, Embase, Chinese National Knowledge Infrastructure database and Chinese Wanfang database up to September 2013. Statistical analyses were conducted with Revman 5.2 and STATA 12.0 software. Odds ratio (OR) with 95% confidence interval (CI) values were applied to evaluate the strength of the association. Heterogeneity was evaluated by Q-test and the I² statistic. The Begg's test and Egger's test were used to assess the publication bias. A significant association and a borderline association between the PAI-1 4G/5G polymorphism and IS were found under the recessive model (OR = 1.639, 95% CI = 1.136-2.364) and allelic model (OR = 1.256, 95% CI = 1.000-1.578), respectively. However, no significant association was observed under homogeneous comparison model (OR = 1.428, 95% CI = 0.914-2.233), heterogeneous comparison model (OR = 0.856, 95% CI = 0.689-1.063) and dominant model (OR = 1.036, 95% CI = 0.846-1.270). This meta-analysis suggested that 4G4G genotype of PAI-1 4G/5G polymorphism might be a risk factor for IS in the Chinese population.

  2. Novel Epstein-Barr virus-like particles incorporating gH/gL-EBNA1 or gB-LMP2 induce high neutralizing antibody titers and EBV-specific T-cell responses in immunized mice

    PubMed Central

    Perez, Elizabeth M.; Foley, Joslyn; Tison, Timelia; Silva, Rute; Ogembo, Javier Gordon

    2017-01-01

    Previous Epstein-Barr virus (EBV) prophylactic vaccines based on the major surface glycoprotein gp350/220 as an immunogen have failed to block viral infection in humans, suggesting a need to target other viral envelope glycoproteins. In this study, we reasoned that incorporating gH/gL or gB, critical glycoproteins for viral fusion and entry, on the surface of a virus-like particle (VLP) would be more immunogenic than gp350/220 for generating effective neutralizing antibodies to prevent viral infection of both epithelial and B cell lines. To boost the humoral response and trigger cell-mediated immunity, EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2 (LMP2), intracellular latency proteins expressed in all EBV-infected cells, were also included as critical components of the polyvalent EBV VLP. gH/gL-EBNA1 and gB-LMP2 VLPs were efficiently produced in Chinese hamster ovary cells, an FDA-approved vehicle for mass-production of biologics. Immunization with gH/gL-EBNA1 and gB-LMP2 VLPs without adjuvant generated both high neutralizing antibody titers in vitro and EBV-specific T-cell responses in BALB/c mice. These data demonstrate that EBV glycoprotein(s)-based VLPs have excellent immunogenicity, and represent a potentially safe vaccine that will be invaluable not only in preventing EBV infection, but importantly, in preventing and treating the 200,000 cases of EBV-associated cancers that occur globally every year. PMID:27926486

  3. Grob aircraft construction: The G 110 flies

    NASA Technical Reports Server (NTRS)

    Malzbender, B.

    1982-01-01

    Description, specifications and test flight performance of the G 110 are provided. The G 110 completely incorporates modern GfK construction techniques which heretofore have been developed and perfected for the construction of sailplanes. The G 110 is a prototype of a GfK constructed motorized aircraft and shows much promise for the future of German aviation.

  4. 12 CFR 563g.9 - Escrow requirement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Escrow requirement. 563g.9 Section 563g.9 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.9 Escrow requirement. (a) Any funds received in an offering which is offered and sold on a best efforts all...

  5. 12 CFR 563g.6 - Effective date.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Effective date. 563g.6 Section 563g.6 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY SECURITIES OFFERINGS § 563g.6 Effective date. (a) Except as provided for in paragraph (d) of this section, an offering circular filed by a...

  6. Muon g-2

    Science.gov Websites

    Related Links A Key Contribution from Brookhaven Laboratory The Big Move Muon Department Facebook g-2 on is filled with an invisible sea of virtual particles that -in accordance with the laws of quantum presence and nature of these virtual particles with particle beams traveling in a magnetic field. The Muon

  7. G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silva, Cleuton de Souza; Instituto de Ciências Exatas e Tecnologia, Universidade Federal do Amazonas, Campus de Itacoatiara, 69100-021 Itacoatiara, Amazonas; Pereira, Douglas Henrique

    2016-05-28

    The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol{sup −1}, while the original method presents a deviation corresponding to 0.83more » kcal mol{sup −1}. The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol{sup −1}) is compared to 1.29 kcal mol{sup −1} from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol{sup −1}, the G4CEP deviation is ±2.72 kcal mol{sup −1}. Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.« less

  8. Anti-dog IgG secondary antibody successfully detects IgG in a variety of aquatic mammals

    USGS Publications Warehouse

    Roehl, Katherine; Jankowski, Mark D.; Hofmeister, Erik K.

    2016-01-01

    Serological tests play an important role in the detection of wildlife diseases. However, while there are many commercial assays and reagents available for domestic species, there is a need to develop efficient serological assays for wildlife. In recent years, marine mammals have represented a wildlife group with emerging infectious diseases, such as influenza, brucellosis, and leptospirosis. However, with the exception of disease-agent-specific assays or functional assays, few reports describe the use of antibody detection assays in marine mammals. In an indirect enzyme-linked immunoassay (EIA) or an immunofluorescence assay, antibody is detected using an antitarget species secondary conjugated antibody. The sensitivity of the assay depends on the avidity of the binding reaction between the bound antibody and the detection antibody. A commercial polyclonal antidog IgG conjugated antibody was tested in an EIA for its ability to sensitively detect the IgG of seven marine mammals including sea otter (Enhydra lutris), polar bear (Ursus maritimus), grey seal (Halichoerus grypus), harbor seal (Phoca vitulina), northern elephant seal (Mirounga angustirostris), California sea lion (Zalophus californianus), Pacific walrus (Odobenus rosmarus) and one freshwater mammal: Asian small-clawed otter (Aonyx cinerea). With the exception of Asian small-clawed sea otters, the detection of IgG in these marine mammals either exceeded or was nearly equal to detection of dog IgG. The use of the tested commercial antidog IgG antibody may be a valid approach to the detection of antibody response to disease in sea mammals.

  9. SHUTTLE - PAYLOADS (STS-41G) - KSC

    NASA Image and Video Library

    1984-10-05

    Payload canister transporter in Vertical Processing Facility Clean Room loaded with Earth Radiation Budget Experiment (ERBS), Large Format Camera (LFC), and Orbital Reservicing System (ORS) for STS-41G Mission. 1. STS-41G - EXPERIMENTS 2. CAMERAS - LFC KSC, FL Also available in 4x5 CN

  10. sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoebee, B.; Loman, H.; Brouwer, J.

    Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

  11. Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

    PubMed

    Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

    2013-06-01

    The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. In vitro synthesis and processing of herpes simplex virus type 2 gG-2, using cell-free transcription and translation systems.

    PubMed Central

    Weldon, S K; Su, H K; Fetherston, J D; Courtney, R J

    1990-01-01

    Translation of in vitro-synthesized herpes simplex virus type 2 (HSV-2) gG-2 mRNA in a reticulocyte lysate system was used to study the processing of HSV-2 gG-2. In the presence of canine pancreatic microsomal membranes, a single species that is protected from trypsin digestion was detected. This product comigrates with the 104,000-Mr (104K) high mannose intermediate seen in HSV-2-infected-cell lysates. Endo-beta-N-acetylglucosaminidase H treatment of the in vitro-synthesized 104K protein yielded a single product migrating at 100 K. The 72K and 31K cleavage products of gG-2 were not observed in the in vitro system. These data show that the molecular weight of the nonglycosylated form of the gG-2 protein is 100,000 and that the cotranslational processing of this protein in the endoplasmic reticulum yields the 104K high-mannose intermediate. Images PMID:2154614

  13. Plasmonic biosensor for label-free G-quadruplexes detection

    NASA Astrophysics Data System (ADS)

    Qiu, Suyan; Zhao, Fusheng; Santos, Greggy M.; Shih, Wei-Chuan

    2016-03-01

    G-quadruplex, readily formed by the G-rich sequence, potentially distributes in over 40 % of all human genes, such as the telomeric DNA with the G-rich sequence found at the end of the chromosome. The G-quadruplex structure is supposed to possess a diverse set of critical functions in the mammalian genome for transcriptional regulation, DNA replication and genome stability. However, most of the currently available methods for G-quadruplex identification are restricted to fluorescence techniques susceptible to poor sensitivity. It is essential to propose methods with higher sensitivity to specifically recognize the G-quadruplexes. In this study, we demonstrate a label-free plasmonic biosensor for G-quadruplex detection by relying on the advantages of nanoporous gold (NPG) disks that provide high-density plasmonic hot spots, suitable for molecular recognition capability without the requirement for labeling processes.

  14. APOBEC3G: a Double Agent in Defense

    PubMed Central

    Smith, Harold C.

    2011-01-01

    APOBEC3G (A3G) is an effective cellular host defense factor under experimental conditions in which a functional form of the HIV-encoded protein Vif cannot be expressed. Wild type Vif targets A3G for proteasomal degradation and along with it, any host defense advantage A3G might provide is severely diminished or lost. Recent evidence cast doubt on the potency of A3G in host defense and suggested that it could, under some circumstances, promote the emergence of more virulent HIV strains. In this article, I argue that it is time to recognize that A3G has the potential to act as a double agent. The path forward relies on understanding how cellular and viral regulatory mechanisms enable A3G antiviral function and on developing novel research reagents to explore these pathways. PMID:21239176

  15. G-sequentially connectedness for topological groups with operations

    NASA Astrophysics Data System (ADS)

    Mucuk, Osman; Cakalli, Huseyin

    2016-08-01

    It is a well-known fact that for a Hausdorff topological group X, the limits of convergent sequences in X define a function denoted by lim from the set of all convergent sequences in X to X. This notion has been modified by Connor and Grosse-Erdmann for real functions by replacing lim with an arbitrary linear functional G defined on a linear subspace of the vector space of all real sequences. Recently some authors have extended the concept to the topological group setting and introduced the concepts of G-sequential continuity, G-sequential compactness and G-sequential connectedness. In this work, we present some results about G-sequentially closures, G-sequentially connectedness and fundamental system of G-sequentially open neighbourhoods for topological group with operations which include topological groups, topological rings without identity, R-modules, Lie algebras, Jordan algebras, and many others.

  16. Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

    Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

  17. Comparative In Vitro and In Vivo Studies of Porcine Rotavirus G9P[13] and Human Rotavirus Wa G1P[8

    PubMed Central

    Shao, Lulu; Fischer, David D.; Kandasamy, Sukumar; Rauf, Abdul; Langel, Stephanie N.; Wentworth, David E.; Stucker, Karla M.; Halpin, Rebecca A.; Lam, Ham Ching; Marthaler, Douglas

    2015-01-01

    ABSTRACT The changing epidemiology of group A rotavirus (RV) strains in humans and swine, including emerging G9 strains, poses new challenges to current vaccines. In this study, we comparatively assessed the pathogenesis of porcine RV (PRV) G9P[13] and evaluated the short-term cross-protection between this strain and human RV (HRV) Wa G1P[8] in gnotobiotic pigs. Complete genome sequencing demonstrated that PRV G9P[13] possessed a human-like G9 VP7 genotype but shared higher overall nucleotide identity with historic PRV strains. PRV G9P[13] induced longer rectal virus shedding and RV RNAemia in pigs than HRV Wa G1P[8] and generated complete short-term cross-protection in pigs challenged with HRV or PRV, whereas HRV Wa G1P[8] induced only partial protection against PRV challenge. Moreover, PRV G9P[13] replicated more extensively in porcine monocyte-derived dendritic cells (MoDCs) than did HRV Wa G1P[8]. Cross-protection was likely not dependent on serum virus-neutralizing (VN) antibodies, as the heterologous VN antibody titers in the sera of G9P[13]-inoculated pigs were low. Thus, our results suggest that heterologous protection by the current monovalent G1P[8] HRV vaccine against emerging G9 strains should be evaluated in clinical and experimental studies to prevent further dissemination of G9 strains. Differences in the pathogenesis of these two strains may be partially attributable to their variable abilities to replicate and persist in porcine immune cells, including dendritic cells (DCs). Additional studies are needed to evaluate the emerging G9 strains as potential vaccine candidates and to test the susceptibility of various immune cells to infection by G9 and other common HRV/PRV genotypes. IMPORTANCE The changing epidemiology of porcine and human group A rotaviruses (RVs), including emerging G9 strains, may compromise the efficacy of current vaccines. An understanding of the pathogenesis and genetic, immunological, and biological features of the new emerging

  18. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  19. 7 CFR 29.3522 - Green (G).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Green (G). 29.3522 Section 29.3522 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 95) § 29.3522 Green (G). A term applied to green-colored, immature, or crude tobacco. Any leaf...

  20. 7 CFR 29.3029 - Green (G).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Green (G). 29.3029 Section 29.3029 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Green (G). A color term applied to immature or crude tobacco. Any leaf which has a green color affecting...

  1. 7 CFR 29.3522 - Green (G).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Green (G). 29.3522 Section 29.3522 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 95) § 29.3522 Green (G). A term applied to green-colored, immature, or crude tobacco. Any leaf...

  2. 7 CFR 29.3029 - Green (G).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Green (G). 29.3029 Section 29.3029 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Green (G). A color term applied to immature or crude tobacco. Any leaf which has a green color affecting...

  3. Transposable elements and G-quadruplexes.

    PubMed

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes.

  4. Revisiting the Roco G-protein cycle.

    PubMed

    Terheyden, Susanne; Ho, Franz Y; Gilsbach, Bernd K; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is strictly controlled by guanine-nucleotide-exchange factors (GEFs) and GTPase-activating proteins (GAPs). Because of contradictory structural and biochemical data, the regulatory mechanism of the LRRK2 Roc G-domain and the RocCOR tandem is still under debate. In the present study, we solved the first nucleotide-bound Roc structure and used LRRK2 and bacterial Roco proteins to characterize the RocCOR function in more detail. Nucleotide binding induces a drastic structural change in the Roc/COR domain interface, a region strongly implicated in patients with an LRRK2 mutation. Our data confirm previous assumptions that the C-terminal subdomain of COR functions as a dimerization device. We show that the dimer formation is independent of nucleotide. The affinity for GDP/GTP is in the micromolar range, the result of which is high dissociation rates in the s-1 range. Thus Roco proteins are unlikely to need GEFs to achieve activation. Monomeric LRRK2 and Roco G-domains have a similar low GTPase activity to small G-proteins. We show that GTPase activity in bacterial Roco is stimulated by the nucleotide-dependent dimerization of the G-domain within the complex. We thus propose that the Roco proteins do not require GAPs to stimulate GTP hydrolysis but stimulate each other by one monomer completing the catalytic machinery of the other.

  5. Increased plasmatic soluble HLA-G levels in endometrial cancer.

    PubMed

    Ben Yahia, Hamza; Babay, Wafa; Bortolotti, Daria; Boujelbene, Nadia; Laaribi, Ahmed Baligh; Zidi, Nour; Kehila, Mehdi; Chelbi, Hanène; Boudabous, Abdellatif; Mrad, Karima; Mezlini, Amel; Di Luca, Dario; Ouzari, Hadda-Imene; Rizzo, Roberta; Zidi, Inès

    2018-05-03

    Human Leukocyte Antigen-G (HLA-G) is known as an immune suppressive molecule; it interacts with several immune cells and inhibits their functions. HLA-G molecule is highly represented in pathological conditions including malignant transformation. To the best of our knowledge this is the first study that focuses on the expression of soluble HLA-G (sHLA-G) in endometrial cancer (EC). We aimed at exploring sHLA-G plasma levels and its prognostic value in EC. We examined total sHLA-G expression as well as the sHLA-G1 and HLA-G5 isoforms expression in plasma samples from 40 patients with EC and 45 healthy controls by a specific sandwich ELISA. Immunoprecipitation and Coomassie blue staining were performed to explore the presence of plasmatic sHLA-G monomers and dimers. sHLA-G plasma level was significantly enhanced in patients with EC compared to healthy controls (p = 0.028). Additionally, HLA-G5 molecules were highly represented than sHLA-G1 molecules in EC, at the borderline of significance (p = 0.061). Interestingly, sHLA-G has been shown to be increased in early stages (Stages I and II) as well as in high grade EC (Grade 3) that is associated with rapid spread of the disease (p = 0.057). sHLA-G positive EC plasma were majorly in monomeric form (75%). Clinically, all the HLA-G dimers were detected in early stages and in high grade of EC. Our data strengthen the implication of HLA-G molecules in EC etiology and especially in progression. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 2 2012-04-01 2012-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  7. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 2 2014-04-01 2014-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  8. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 2 2011-04-01 2011-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  9. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 2 2013-04-01 2013-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  10. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 8 2014-04-01 2014-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  11. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 8 2013-04-01 2013-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  12. 26 CFR 1.149(g)-1 - Hedge bonds.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Hedge bonds. 1.149(g)-1 Section 1.149(g)-1...) INCOME TAXES (CONTINUED) Tax Exemption Requirements for State and Local Bonds § 1.149(g)-1 Hedge bonds... for purposes of section 149(g) and this section. In addition, the following terms have the following...

  13. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 8 2011-04-01 2011-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  14. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 8 2012-04-01 2012-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES (CONTINUED) Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It...(g) is applicable be treated in the same way. One deduction or portion of a deduction may be allowed...

  15. 26 CFR 1.642(g)-2 - Deductions included.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Deductions included. 1.642(g)-2 Section 1.642(g... (CONTINUED) INCOME TAXES Estates, Trusts, and Beneficiaries § 1.642(g)-2 Deductions included. It is not required that the total deductions, or the total amount of any deduction, to which section 642(g) is...

  16. Investigation of Plasminogen Activator Inhibitor-1 (PAI-1) 4G/5G promoter polymorphism in Indian venous thrombosis patients: A case-control study.

    PubMed

    Prabhudesai, Aniket; Shetty, Shrimati; Ghosh, Kanjaksha; Kulkarni, Bipin

    2017-09-01

    The role of PAI-1 4G/5G polymorphism in venous thrombosis has been contradictory. PAI-1 4G/4G genotype is associated with elevated levels of PAI-1 resulting in a hypofibrinolytic state and a higher thrombotic risk. In this study, the distribution of genotypes and frequency of alleles of the 4G/5G polymorphism of PAI-1 gene in Indian patients with different types of venous thrombosis was investigated for its role in development of thrombosis. A total of 87 portal vein thrombosis (PVT), 71 Budd-Chiari syndrome (BCS), 156 cerebral vein thrombosis (CVT), and 163 deep vein thrombosis (DVT) patients were studied alongside 251 healthy controls for the PAI-1 4G/5G polymorphism by allele-specific PCR. Frequency of 4G/4G genotype was higher in all groups in comparison with controls. 4G/4G was associated with PVT risk (OR=2.51, 95% CI=1.29-4.96, P=.0075), BCS risk (OR=5.98, 95% CI=2.68-13.42, P<.0001), and DVT risk (OR=1.75, 95% CI=0.98-3.02, P=.0225). This is the first case-control study from India establishing PAI-1 4G/4G as a strong risk factor for abdominal thrombosis (PVT and BCS). Statistically significant association was not found between 4G/4G genotype and CVT risk. PAI-1 4G/4G is a strong risk factor for venous thrombosis in Indian patients and should be included in laboratory testing panel of thrombophilia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. IgG2 deficiency in sickle cell anaemia.

    PubMed

    Natta, C L; Outschoorn, I M

    1984-08-01

    8 patients with known sickle cell anaemia were studied immunologically. The concentrations of the main immunoglobulin classes, IgG and IgA, were significantly higher than the levels in 11 normal age- and sex-matched black subjects (P less than 0.01). IgM levels were not significantly different in the two groups. There was a heterogeneity in the interaction of the IgG subclasses with Protein A, with low levels of IgG2. The IgG2:IgG1 ratios varied from 1:3.8 to 1:6 (normals 1:3). In 4 patients the absolute levels of IgG2 as measured by radial immunodiffusion were lower than normal, thus confirming the chromatographic ratios. Since specific antibody is often restricted to a single subclass, the levels of IgG subclasses may be related to recurrent bacterial infections in these patients.

  18. Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

    PubMed

    Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

    2016-12-01

    Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

  19. Comparisons of Serum Total IgE, IgG, and IgG1 Levels in Patients with and without Echinococcosis-Induced Anaphylactic Shock

    PubMed Central

    Li, Yimei; Zheng, Hong; Gu, Meilin; Cao, Xinghua; Wen, Hao; Liu, Zaoling; Liu, Tao

    2012-01-01

    We investigated serum total immunoglobulin E (IgE), IgG, and IgG1 levels in patients with and without echinococcosis-induced anaphylactic shock. This was a case-control study of 11 patients with echinococcosis-induced anaphylactic shock and 22 echinococcosis patients with cyst rupture but without anaphylactic shock. Blood was collected before surgery (T0), at the time of cyst rupture (T1), and shock (Tx), 1 h (T2), 1 day (T3), and 1 week (T4) after cyst rupture. Serum IgE, IgG, and IgG1 were determined by enzyme-linked immunosorbent assay. Serum IgE, IgG, and IgG1 levels were significantly higher in patients who developed anaphylactic shock at all time points. Increased pre-surgical IgG and IgG1 levels were identified to be a significant risk factors for developing anaphylactic shock. The results showed that a serum IgG concentration of 312.25 μg/mL could be used as a cut-off point to predict whether an echinococcosis patient would develop anaphylactic shock. PMID:22764299

  20. NF-κB and JNK mediated apoptosis and G0/G1 arrest of HeLa cells induced by rubiarbonol G, an arborinane-type triterpenoid from Rubia yunnanensis.

    PubMed

    Zeng, Guang-Zhi; Wang, Zhe; Zhao, Li-Mei; Fan, Jun-Ting; Tan, Ning-Hua

    2018-06-28

    Rubia yunnanensis is a medicinal plant mainly grown in Yunnan province in Southwest China, and its root named "Xiaohongshen" has been used as a herb in Yunnan for the treatment of cancers. Three major types of chemical components, Rubiaceae-type cyclopeptides, quinones, and triterpenoids, were identified from R. yunnanensis, in which some of compounds including rubiarbonol G (RG), a unique arboriane-type triterpenoid, showed cytotoxicity on cancer cells. But the cytotoxic mechanism of RG has not been reported. To investigate the cytotoxic mechanism of RG on cancer cells. RG was evaluated its cytotoxicity on 7 cancer cell lines by the SRB assay, and detected the effect on apoptosis and cell cycle arrest by Annexin V-FITC/PI apoptosis assay and DNA contents analysis. The expression and activity of apoptosis and cell cycle related proteins were also investigated by western blot and caspase activity assay. Furthermore, the effect of RG on NF-κB signaling was also tested by luciferase assay, western blot, and immunofluorescence staining. RG showed potent cytotoxicity on 7 human cancer cell lines, whose activity was attributed to apoptosis induction and G 0 /G 1 arrest in HeLa cells. Results from the mechanism study showed that RG promoted the activation of ERK1/2 and JNK pathway in MAPK family, which in turn increased the expression of p53, thereby triggering the G 0 /G 1 arrest through p53/p21/cyclin D1 signaling. Moreover, RG-mediated JNK activation down-regulated the expression of the anti-apoptotic protein Bcl-2, which caused the release of cytochrome c to the cytosol and activated the cleavage of caspase cascade and poly(ADP-ribose) polymerase, thereby inducing apoptosis in HeLa cells. In addition, RG was also found to inhibit the activation of NF-κB signaling by down-regulating the expression and attenuating the translocation to nucleus of NF-κB p65, by which the down-stream p53, cyclin D1, Bcl-2, and caspases were regulated, thereby triggering apoptosis and G

  1. 7 CFR 29.1024 - Green (G).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Green (G). 29.1024 Section 29.1024 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1024 Green (G). A color term applied to immature or crude tobacco. Any leaf which has a...

  2. 7 CFR 29.2524 - Green (G).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Green (G). 29.2524 Section 29.2524 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing...-Cured Tobacco (u.s. Types 22, 23, and Foreign Type 96) § 29.2524 Green (G). A term applied to green...

  3. 7 CFR 29.2524 - Green (G).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Green (G). 29.2524 Section 29.2524 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing...-Cured Tobacco (u.s. Types 22, 23, and Foreign Type 96) § 29.2524 Green (G). A term applied to green...

  4. 7 CFR 29.1024 - Green (G).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Green (G). 29.1024 Section 29.1024 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1024 Green (G). A color term applied to immature or crude tobacco. Any leaf which has a...

  5. Aflatoxin (B1 , B2 , G1 , and G2 ) contamination in rice of Mexico and Spain, from local sources or imported.

    PubMed

    Suárez-Bonnet, Elena; Carvajal, Magda; Méndez-Ramírez, Ignacio; Castillo-Urueta, Pável; Cortés-Eslava, Josefina; Gómez-Arroyo, Sandra; Melero-Vara, José María

    2013-11-01

    Rice is an important cereal but it is often contaminated with aflatoxins (AFs). The purpose of this study was to identify and quantify AF (B1 , B2 , G1 , and G2 ) in 67 rice samples cultivated in Mexico and Spain, and from imported crops collected in 2008 and 2009. The methodology was validated, the rice samples were concentrated and purified with immunoaffinity columns and were quantified by high-pressure liquid chromatography (HPLC). The average total AF (AFt) in the Spanish rice was 37.3 μg/kg, the range was from 1.6 to 1383 μg/kg, the most contaminated samples being from San Juan de Aznalfarache, Sevilla (AFt = 138.6 μg/kg), from Tortosa, Tarragona (AFt = 104.6 μg/kg), and Calasparra, Murcia (AFt = 103.9 μg/kg). The rice imported from France to Spain had AFt of 26.6 μg/kg and from Pakistan AFt of 18.4 μg/kg, showing less AF contamination than the local one. The rice which originated from Mexico contained (AFt = 16.9 μg/kg), and those imported from the United States (AFt = 14.4 μg/kg) and Uruguay (AFt = 15.6 μg/kg). The imported rice had better quality in terms of the presence of AFs. © 2013 Institute of Food Technologists®

  6. [Correlation between genetic polymorphisms of -855 G/C and -1140 G/A in GRIN1 gene and paranoid schizophrenia].

    PubMed

    Li, Zhong-Jie; Ding, Mei; Pang, Hao; Sun, Xue-Fei; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

    2013-04-01

    To investigate the single nucleotide polymorphisms (SNP) of -855 G/C and -1140 G/A in promoter regions of GRIN1 gene and find their genetic correlation to paranoid schizophrenia as well as their applicable values in forensic medicine. The genetic polymorphisms of -855 G/C and -1140 G/A at the 5' end of GRIN1 gene were detected by PCR restriction fragment length polymorphism and PAGE in 183 healthy unrelated individuals of northern Chinese Han population and 172 patients of paranoid schizophrenia, respectively. The chi2 test was used to identify Hardy-Weinberg equilibrium of the genotype distribution. The differences of genotypes and allelic frequency distributions were compared between the two groups. Distributions of the genotypic frequencies satisfied Hardy-Weinberg equilibrium in both groups. The difference of genotypes was statistically significant between female patient group and female control group in -855 G/C distribution (P < 0.05). The differences of genotypes and allelic frequencies were statistically significant not only between the patient group and the control group but also between female patient group and female control group in -1140 G/A distribution (P < 0.05). The SNP of -1140 G/A in promoter regions of GRIN1 gene might positively correlate to paranoid schizophrenia. The genetic factor of schizophrenia is involved in gender tendency. And it could be useful in forensic identification of schizophrenia.

  7. Age related IgG subclass concentrations in asthma.

    PubMed

    Hoeger, P H; Niggemann, B; Haeuser, G

    1994-03-01

    The prevalence of IgG subclass deficiency in asthma is still controversial. Earlier studies often included patients receiving treatment with systemic steroids which can induce hypogammaglobulinaemia. Concentrations of IgG subclasses were studies in 200 children (aged 2-17 years) with asthma (mean asthma severity score (ASS) 2, range 1-4) who had not received systemic steroids for at least six weeks before investigation, and in 226 healthy age matched controls. The mean concentrations of IgG subclasses in children with asthma were within the 1SD range of those of the control group. In the group with asthma there was a trend towards higher levels of IgG1 and IgG4, whereas the number of children with low concentrations of IgG2 (< 2 SD of control serum samples; absolute concentrations 0.08-1.25 g/l) was slightly greater than in the group who did not have asthma (4.5 v 2.2%). Patients with subnormal concentrations of IgG2 could not be distinguished clinically or on the basis of case history and additional immunological studies did not show further abnormalities. Patients with severe asthma (ASS 3-4) had significantly higher concentrations of IgG4 (mean (SE) 0.53 (0.09) v 0.26 (0.04) g/l) than patients with mild asthma (ASS 1). No significant difference in subclass concentration was found between patients with atopic and those with non-atopic asthma. It is concluded that in an unselected group of children with asthma the mean IgG subclass concentrations do not differ significantly from a group of healthy age matched controls.

  8. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2

    PubMed Central

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E.; Chen, Shuang; Bodie, Wesley W.; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A.; Kramer, Lora B.; Dent, Paul

    2011-01-01

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138+ cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138+ primary samples, but spared normal CD138− and CD34+ cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G0/G1 arrest and increased apoptosis in all cell-cycle phases, including G0/G1. To determine whether this regimen is active against quiescent G0/G1 MM cells, cells were cultured in low-serum medium to enrich the G0/G1 population. G0/G1–enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G0/G1–enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G0) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst+), low pyronin Y (PY)–staining (2N Hst+/PY−) G0 population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition. PMID:21911831

  9. Cytokinetically quiescent (G0/G1) human multiple myeloma cells are susceptible to simultaneous inhibition of Chk1 and MEK1/2.

    PubMed

    Pei, Xin-Yan; Dai, Yun; Youssefian, Leena E; Chen, Shuang; Bodie, Wesley W; Takabatake, Yukie; Felthousen, Jessica; Almenara, Jorge A; Kramer, Lora B; Dent, Paul; Grant, Steven

    2011-11-10

    Effects of Chk1 and MEK1/2 inhibition were investigated in cytokinetically quiescent multiple myeloma (MM) and primary CD138(+) cells. Coexposure to the Chk1 and MEK1/2 inhibitors AZD7762 and selumetinib (AZD6244) robustly induced apoptosis in various MM cells and CD138(+) primary samples, but spared normal CD138(-) and CD34(+) cells. Furthermore, Chk1/MEK1/2 inhibitor treatment of asynchronized cells induced G(0)/G(1) arrest and increased apoptosis in all cell-cycle phases, including G(0)/G(1). To determine whether this regimen is active against quiescent G(0)/G(1) MM cells, cells were cultured in low-serum medium to enrich the G(0)/G(1) population. G(0)/G(1)-enriched cells exhibited diminished sensitivity to conventional agents (eg, Taxol and VP-16) but significantly increased susceptibility to Chk1 ± MEK1/2 inhibitors or Chk1 shRNA knock-down. These events were associated with increased γH2A.X expression/foci formation and Bim up-regulation, whereas Bim shRNA knock-down markedly attenuated lethality. Immunofluorescent analysis of G(0)/G(1)-enriched or primary MM cells demonstrated colocalization of activated caspase-3 and the quiescent (G(0)) marker statin, a nuclear envelope protein. Finally, Chk1/MEK1/2 inhibition increased cell death in the Hoechst-positive (Hst(+)), low pyronin Y (PY)-staining (2N Hst(+)/PY(-)) G(0) population and in sorted small side-population (SSP) MM cells. These findings provide evidence that cytokinetically quiescent MM cells are highly susceptible to simultaneous Chk1 and MEK1/2 inhibition.

  10. Glycoprotein G is a virulence factor in infectious laryngotracheitis virus.

    PubMed

    Devlin, J M; Browning, G F; Hartley, C A; Kirkpatrick, N C; Mahmoudian, A; Noormohammadi, A H; Gilkerson, J R

    2006-10-01

    Infectious laryngotracheitis virus (ILTV; Gallid herpesvirus 1) is an alphaherpesvirus that causes acute respiratory disease in chickens. The role of glycoprotein G (gG) in vitro has been investigated in a number of alphaherpesviruses, but the relevance of gG in vivo in the pathogenicity of ILTV or in other alphaherpesviruses is unknown. In this study, gG-deficient mutants of ILTV were generated and inoculated into specific-pathogen-free chickens to assess the role of gG in pathogenicity. In chickens, gG-deficient ILTV reached a similar titre to wild-type (wt) ILTV but was significantly attenuated with respect to induction of clinical signs, effect on weight gain and bird mortality. In addition, an increased tracheal mucosal thickness, reflecting increased inflammatory cell infiltration at the site of infection, was detected in birds inoculated with gG-deficient ILTV compared with birds inoculated with wt ILTV. The reinsertion of gG into gG-deficient ILTV restored the in vivo phenotype of the mutant to that of wt ILTV. Quantitative PCR analysis of the expression of the genes adjacent to gG demonstrated that they were not affected by the deletion of gG and investigations in vitro confirmed that the phenotype of gG-deficient ILTV was consistent with unaltered expression of these adjacent genes. This is the first reported study to demonstrate definitively that gG is a virulence factor in ILTV and that deletion of gG from this alphaherpesvirus genome causes marked attenuation of the virus in its natural host.

  11. Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines.

    PubMed

    Lingnau, Karen; Egyed, Alena; Schellack, Carola; Mattner, Frank; Buschle, Michael; Schmidt, Walter

    2002-10-04

    This study describes an entirely synthetic vaccine composed of antigenic peptides (T cell epitopes), oligodeoxynucleotides containing CpG-motifs (CpG-ODN) and poly-L-arginine (pR). CpG-ODN are known to be potent inducers of predominantly type 1-like immune responses, while polycationic amino acids, like pR, facilitate the uptake of antigens into antigen presenting cells (APCs). We demonstrate that the application of peptides and pR/CpG-ODN results in strongly enhanced peptide-specific immune responses as compared to the application of peptides with either of the immunomodulators alone. High numbers of antigen-specific T cells can be observed even after only one injection of the vaccine for a remarkably long period of time (at least 372 days). Furthermore, the potentially harmful systemic release of pro-inflammatory cytokines induced upon injection of CpG-ODN is inhibited. Thus, the combined application of CpG-ODN and pR may represent a novel vaccine strategy in humans.

  12. Recipient HLA-G +3142 CC Genotype and Concentrations of Soluble HLA-G Impact on Occurrence of CMV Infection after Living-Donor Kidney Transplantation

    PubMed Central

    Guberina, Hana; Tomoya Michita, Rafael; Dolff, Sebastian; Bienholz, Anja; Trilling, Mirko; Heinemann, Falko M.; Horn, Peter A.; Kribben, Andreas; Witzke, Oliver; Rebmann, Vera

    2017-01-01

    The expression modulation of the immunosuppressive non-classical Human leukocyte antigen-G (HLA-G) molecule and its soluble isoforms is an immune evasion strategy being deployed by cytomegalovirus (CMV). The +3142 C>G single nucleotide polymorphism (SNP) located within the 3′ untranslated region (3′UTR) is of crucial importance for the regulation of HLA-G expression. Therefore, we analyzed the influence of the +3142 C>G HLA-G SNP on the occurrence of CMV infection in a cohort of 178 living-donor kidney recipients and their 178 corresponding donors. In addition, soluble HLA-G (sHLA-G) levels were quantified before and after transplantation. The presence of the HLA-G +3142 CC genotype in recipients, but not donors of our cohort as along with elevated sHLA-G levels (≥6.1 ng/mL) were associated with higher susceptibility to CMV infection after transplantation. Our results provided evidence that (i) HLA-G is implicated in the establishment of CMV after living-donor kidney transplantation and (ii) recipient HLA-G +3142 CC genotype and sHLA-G concentration levels could represent important predictive risk markers for CMV infection. PMID:29113092

  13. Recipient HLA-G +3142 CC Genotype and Concentrations of Soluble HLA-G Impact on Occurrence of CMV Infection after Living-Donor Kidney Transplantation.

    PubMed

    Guberina, Hana; Tomoya Michita, Rafael; Dolff, Sebastian; Bienholz, Anja; Trilling, Mirko; Heinemann, Falko M; Horn, Peter A; Kribben, Andreas; Witzke, Oliver; Rebmann, Vera

    2017-11-05

    The expression modulation of the immunosuppressive non-classical Human leukocyte antigen-G (HLA-G) molecule and its soluble isoforms is an immune evasion strategy being deployed by cytomegalovirus (CMV). The +3142 C>G single nucleotide polymorphism (SNP) located within the 3' untranslated region (3'UTR) is of crucial importance for the regulation of HLA-G expression. Therefore, we analyzed the influence of the +3142 C>G HLA-G SNP on the occurrence of CMV infection in a cohort of 178 living-donor kidney recipients and their 178 corresponding donors. In addition, soluble HLA-G (sHLA-G) levels were quantified before and after transplantation. The presence of the HLA-G +3142 CC genotype in recipients, but not donors of our cohort as along with elevated sHLA-G levels (≥ 6.1 ng/mL) were associated with higher susceptibility to CMV infection after transplantation. Our results provided evidence that i) HLA-G is implicated in the establishment of CMV after living-donor kidney transplantation and ii) recipient HLA-G +3142 CC genotype and sHLA-G concentration levels could represent important predictive risk markers for CMV infection.

  14. Human rotavirus strains circulating in Venezuela after vaccine introduction: predominance of G2P[4] and reemergence of G1P[8].

    PubMed

    Vizzi, Esmeralda; Piñeros, Oscar A; Oropeza, M Daniela; Naranjo, Laura; Suárez, José A; Fernández, Rixio; Zambrano, José L; Celis, Argelia; Liprandi, Ferdinando

    2017-03-21

    Rotavirus (RV) is the most common cause of severe childhood diarrhea worldwide. Despite Venezuela was among the first developing countries to introduce RV vaccines into their national immunization schedules, RV is still contributing to the burden of diarrhea. Concerns exist about the selective pressure that RV vaccines could exert on the predominant types and/or emergence of new strains. To assess the impact of RV vaccines on the genotype distribution 1 year after the vaccination was implemented, a total of 912 fecal specimens, collected from children with acute gastroenteritis in Caracas from February 2007 to April 2008, were screened, of which 169 (18.5%) were confirmed to be RV positive by PAGE. Rotavirus-associated diarrhea occurred all year-round, although prevailed during the coolest and driest months among unvaccinated children under 24 months old. Of 165 RV strains genotyped for G (VP7) and P (VP4) by seminested multiplex RT-PCR, 77 (46.7%) were G2P[4] and 63 (38.2%) G1P[8]. G9P[8], G3P[8] and G2P[6] were found in a lower proportion (7.3%). Remarkable was also the detection of <5% of uncommon combinations (G8P[14], G8P[4], G1P[4] and G4P[4]) and 3.6% of mixed infections. A changing pattern of G/P-type distribution was observed during the season studied, with complete predominance of G2P[4] from February to June 2007 followed by its gradual decline and the reemergence of G1P[8], predominant since January 2008. Phylogenetic analysis of VP7 and VP4 genes revealed a high similarity among G2P[4] and global strains belonging to G2-II and P[4]-V lineages. The amino acid substitution 96D → N, related with reemergence of the G2 genotype elsewhere, was observed. The G1P[8] strains from Caracas were grouped into the lineages G1-I and P[8]-III, along with geographically remote G1P[8] rotaviruses, but they were rather distant from Rotarix ® vaccine and pre-vaccine strains. Unique amino acid substitutions observed on neutralization domains of the VP7 sequence from

  15. Influence of decreased fibrinolytic activity and plasminogen activator inhibitor-1 4G/5G polymorphism on the risk of venous thrombosis.

    PubMed

    Vuckovic, Biljana A; Djeric, Mirjana J; Tomic, Branko V; Djordjevic, Valentina J; Bajkin, Branislav V; Mitic, Gorana P

    2018-01-01

    : Objective of our study is to determine whether decreased fibrinolytic activity or plasminogen activator inhibitor (PAI)-1 4G/5G polymorphism influence the risk of venous thrombosis.Our case-control study included 100 patients with venous thrombosis, and 100 random controls. When patients were compared with random controls, unconditional logistic regression was used to calculate odds ratios (ORs) with 95% confidence intervals (CIs).Decreased fibrinolytic activity yielded a 2.7-fold increase in risk for venous thrombosis than physiological fibrinolytic activity (OR 2.70; 95% CI 1.22-5.98), when comparing patients with random controls. Adjustment for several putative confounders did not change the estimate (OR 3.02; 95% CI 1.26-7.22). Analysis of venous thrombotic risk influenced by PAI-1 genotype, showed no influence of PAI-1 4G/5G gene variant in comparison with 5G/5G genotype (OR 0.57 95% CI; 0.27-1.20).Decreased fibrinolytic activity increased, whereas PAI-1 4G/5G polymorphism did not influence venous thrombosis risk in this study.

  16. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  17. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 6 2014-04-01 2014-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  18. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  19. 26 CFR 1.475(g)-1 - Effective dates.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES (CONTINUED) Inventories § 1.475(g)-1 Effective dates. (a)-(b) [Reserved] (c) Section 1.475(a...) applies on and after August 13, 1996 (the effective date of § 1.1275-6). (g) [Reserved] (h) Section 1.475...

  20. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    PubMed

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  1. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    PubMed Central

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  2. PAI-1 -675 4G/5G Polymorphism in Association with Diabetes and Diabetic Complications Susceptibility: a Meta-Analysis Study

    PubMed Central

    Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg’s and Egger’s test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies. PMID:24223897

  3. PAI-1 -675 4G/5G polymorphism in association with diabetes and diabetic complications susceptibility: a meta-analysis study.

    PubMed

    Xu, Kuanfeng; Liu, Xiaoyun; Yang, Fan; Cui, Dai; Shi, Yun; Shen, Chong; Tang, Wei; Yang, Tao

    2013-01-01

    A meta-analysis was performed to assess the association between the PAI-1 -675 4G/5G polymorphism and susceptibility to diabetes mellitus (DM), diabetic nephropathy (DN), diabetic retinopathy (DR) and diabetic coronary artery disease (CAD). A literature-based search was conducted to identify all relevant studies. The fixed or random effect pooled measure was calculated mainly at the allele level to determine heterogeneity bias among studies. Further stratified analyses and sensitivity analyses were also performed. Publication bias was examined by the modified Begg's and Egger's test. Twenty published articles with twenty-seven outcomes were included in the meta-analysis: 6 studies with a total of 1,333 cases and 3,011 controls were analyzed for the PAI-1 -675 4G/5G polymorphism with diabetes risk, 7 studies with 1,060 cases and 1,139 controls for DN risk, 10 studies with 1,327 cases and 1,557 controls for DR and 4 studies with 610 cases and 1,042 controls for diabetic CAD risk respectively. Using allelic comparison (4G vs. 5G), the PAI-1 -675 4G/5G polymorphism was observed to have no significant association with diabetes (REM OR 1.07, 95% CI 0.96, 1.20), DN (REM OR 1.10, 95% CI 0.98, 1.25), DR (REM OR 1.09, 95% CI 0.97, 1.22) or diabetic CAD risk (REM OR 1.07, 95% CI 0.81, 1.42), and similar results were obtained in the dominant, recessive and co-dominant models. Our meta-analyses suggest that the PAI-1 -675 4G/5G polymorphism might not be a risk factor for DM, DN, DR or diabetic CAD risk in the populations investigated. This conclusion warrants confirmation by further studies.

  4. Association between HLA-G 14bp Gene Polymorphism and Serum sHLA-G Protein Concentrations in Preeclamptic Patients and Normal Pregnant Women.

    PubMed

    Rokhafrooz, Saber; Ghadiri, Ata; Ghandil, Pegah; Ghafourian, Mehri; Hossaini, Seyed Hojjat; Daraei, Nahid; Najafian, Mahin; Rouhizadeh, Ahmad

    2018-06-28

    Preeclampsia (PE) is a multisystem syndrome that is a primary source of fetal-maternal morbidity and mortality. Human leukocyte antigen-G (HLA-G) is a nonclassical Major histocompatibility complex (MHC) class-Ib molecule expressed on the extravillous trophoblast and seems to have immunomodulatory functions during pregnancy. The purpose of our study was to investigate whether HLA-G may be a vital marker in the modulation of the pregnancy. In this case-control study, a number of 150 healthy pregnant women and 150 patients with PE had been genotyped for the 14 base-pair (bp) insertion/deletion polymorphism in exon 8 of the HLA-G gene, and the serum level of soluble HLA-G (sHLA-G) protein was measured using the enzyme-linked immunosorbent assay. Data showed that the PE syndrome was not related to the HLA-G 14 bp genotype. But, the serum level of sHLA-G in PE patients was significantly lower than that in healthy pregnant women in the third trimester (11.74 and 24.48 U/ml, respectively, p < 0.001). However, no significant association was observed between the HLA-G 14 bp genotype and serum sHLA-G level. Our results demonstrate that measurement of sHLA-G protein level may be helpful as a primary diagnosis for the pathogenesis of PE. Overall, this study suggests that the association between HLA-G 14 bp polymorphism and serum sHLA-G level in different ethnic populations of PE should be taken into consideration.

  5. NIa-Pro of Papaya ringspot virus interacts with Carica papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G).

    PubMed

    Gao, Le; Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-02-01

    The interaction of papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G) with Papaya ringspot virus (PRSV) NIa-Pro was validated using a bimolecular fluorescence complementation assay in papaya protoplasts based on the previous yeast two-hybrid assay results. The C-terminal (residues 133-239) fragment of PRSV NIa-Pro and the central domain (residues 59-167) of CpeIF3G were required for effective interaction between NIa-Pro and CpeIF3G as shown by a Sos recruitment yeast two-hybrid system with several deletion mutants of NIa-Pro and CpeIF3G. The central domain of CpeIF3G, which contains a C2HC-type zinc finger motif, is required to bind to other eIFs of the translational machinery. In addition, quantitative real-time reverse transcription PCR assay confirmed that PRSV infection leads to a 2- to 4.5-fold up-regulation of CpeIF3G mRNA in papaya. Plant eIF3G is involved in various stress response by enhancing the translation of resistance-related proteins. It is proposed that the NIa-Pro-CpeIF3G interaction may impair translation preinitiation complex assembly of defense proteins and interfere with host defense.

  6. First report of Porcine teschovirus (PTV), Porcine sapelovirus (PSV) and Enterovirus G (EV-G) in pig herds of Brazil.

    PubMed

    Donin, Daiane Güllich; de Arruda Leme, Raquel; Alfieri, Alice Fernandes; Alberton, Geraldo Camilo; Alfieri, Amauri Alcindo

    2014-03-01

    Porcine teschovirus (PTV), Porcine sapelovirus (PSV) and Enterovirus G (EV-G) have been associated with enteric, respiratory, reproductive and neurological disorders. Although Brazil is the world's fourth largest producer and exporter of pork, no information on the occurrence of PTV, PSV and EV-G infections is available for Brazilian pig herds. This study aimed to investigate the occurrence of Porcine enteric picornavirus infections in pig farms located in three distinct geographical regions of Brazil. Forty randomly selected diarrhoeic and normal consistency faeces of suckling (n = 22) and nursery (n = 18) pigs from farms located in 21 distinct cities of the Southern, Southeast, and Midwest regions of Brazil were evaluated by nested-RT-PCR assays. Suckling piglets presented the expected amplicon size for PTV (158 bp) and EV-G (313 bp) in single and mixed infections in 40.9 % (9/22) of the faecal samples. PSV amplicon (212 bp) was not detected in this age group. For nursery pigs, Porcine enteric picornaviruses amplicons were present in 77.8 % (14/18) of the faecal samples. PTV and EV-G were detected in single and mixed infections, while PSV was detected only in two samples in co-infection with PTV and EV-G in this age group. The Brazilian regions evaluated presented at least two of the tested viruses. Sequencing analysis revealed high similarities to the related viruses (95.3 to 99.2 % for PTV, 94.2 to 98.5 % for PSV and 86 to 100 % for EV-G). For the first time PTV, PSV and EV-G have been molecularly detected and characterised in pig faecal samples in Brazil.

  7. G-quadruplex dynamics.

    PubMed

    Harkness, Robert W; Mittermaier, Anthony K

    2017-11-01

    G-quadruplexes (GQs) are four-stranded nucleic acid secondary structures formed by guanosine (G)-rich DNA and RNA sequences. It is becoming increasingly clear that cellular processes including gene expression and mRNA translation are regulated by GQs. GQ structures have been extensively characterized, however little attention to date has been paid to their conformational dynamics, despite the fact that many biological GQ sequences populate multiple structures of similar free energies, leading to an ensemble of exchanging conformations. The impact of these dynamics on biological function is currently not well understood. Recently, structural dynamics have been demonstrated to entropically stabilize GQ ensembles, potentially modulating gene expression. Transient, low-populated states in GQ ensembles may additionally regulate nucleic acid interactions and function. This review will underscore the interplay of GQ dynamics and biological function, focusing on several dynamic processes for biological GQs and the characterization of GQ dynamics by nuclear magnetic resonance (NMR) spectroscopy in conjunction with other biophysical techniques. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. B-52G crew noise exposure study

    NASA Astrophysics Data System (ADS)

    Decker, W. H.; Nixon, C. W.

    1985-08-01

    The B-52G aircraft produces acoustic environments that are potentially hazardous, interfere with voice communications and may degrade task performance. Numerous reports from aircrew of high noise levels at crew location have been documented for those B-52G aircraft that have been modified with the Offensive Avionics System. To alleviate and minimize the excessive noise exposures of aircrews, a study of the noise problem in the b-52G was deemed necessary. First, in-flight noise measurements were obtained at key personnel locations on a B-52G during a typical training mission. Then, extensive laboratory analyses were conducted on these in-flight noise data. The resulting noise exposure data were evaluated in terms of the various segments of and the total flight profile relative to allowable noise exposures. Finally, recommendations were developed for short term and long term approaches toward potential improvement in the B-52G noise exposure problem.

  9. [Gastroenterology in the G-DRG-System 2004].

    PubMed

    Bunzemeier, H; Frühmorgen, P; Caspary, W F; Roeder, N

    2003-11-01

    After a year of preliminary voluntarily introduction of casemix funding in hospitals in 2003 nearly every German hospital will be confronted with lump sump payments on the basis of the G-DRG system for their inpatient care starting from January 2004. To analyse weaknesses referring to gastroenterology services within the G-DRG version 1.0 the German Association for Disorders of the Digestive System and Metabolism (DGVS) and the DRG-Research-Group from the University of Muenster conducted a DRG evaluation project. In the analysis patient data from 16 hospitals were included. As a result of the project recommendations for G-DRG adjustments were generated. Those recommendations were implemented in the advancement to G-DRG version 2004. Also the International Classification of Diseases (ICD-10) was modified to ICD-10 German Modification. The classification of procedures OPS-301 was revised. The main adjustments to the G-DRG system and both classifications will be presented in this paper.

  10. A New Classification System for IgG4 Autoantibodies

    PubMed Central

    Koneczny, Inga

    2018-01-01

    IgG4 autoimmune diseases are characterized by the presence of antigen-specific autoantibodies of the IgG4 subclass and contain well-characterized diseases such as muscle-specific kinase myasthenia gravis, pemphigus, and thrombotic thrombocytopenic purpura. In recent years, several new diseases were identified, and by now 14 antigens targeted by IgG4 autoantibodies have been described. The IgG4 subclass is considered immunologically inert and functionally monovalent due to structural differences compared to other IgG subclasses. IgG4 usually arises after chronic exposure to antigen and competes with other antibody species, thus “blocking” their pathogenic effector mechanisms. Accordingly, in the context of IgG4 autoimmunity, the pathogenicity of IgG4 is associated with blocking of enzymatic activity or protein–protein interactions of the target antigen. Pathogenicity of IgG4 autoantibodies has not yet been systematically analyzed in IgG4 autoimmune diseases. Here, we establish a modified classification system based on Witebsky’s postulates to determine IgG4 pathogenicity in IgG4 autoimmune diseases, review characteristics and pathogenic mechanisms of IgG4 in these disorders, and also investigate the contribution of other antibody entities to pathophysiology by additional mechanisms. As a result, three classes of IgG4 autoimmune diseases emerge: class I where IgG4 pathogenicity is validated by the use of subclass-specific autoantibodies in animal models and/or in vitro models of pathogenicity; class II where IgG4 pathogenicity is highly suspected but lack validation by the use of subclass specific antibodies in in vitro models of pathogenicity or animal models; and class III with insufficient data or a pathogenic mechanism associated with multivalent antigen binding. Five out of the 14 IgG4 antigens were validated as class I, five as class II, and four as class III. Antibodies of other IgG subclasses or immunoglobulin classes were present in several diseases

  11. Recombinant human G6PD for quality control and quality assurance of novel point-of-care diagnostics for G6PD deficiency.

    PubMed

    Kahn, Maria; LaRue, Nicole; Zhu, Changcheng; Pal, Sampa; Mo, Jack S; Barrett, Lynn K; Hewitt, Steve N; Dumais, Mitchell; Hemmington, Sandra; Walker, Adrian; Joynson, Jeff; Leader, Brandon T; Van Voorhis, Wesley C; Domingo, Gonzalo J

    2017-01-01

    A large gap for the support of point-of-care testing is the availability of reagents to support quality control (QC) of diagnostic assays along the supply chain from the manufacturer to the end user. While reagents and systems exist to support QC of laboratory screening tests for glucose-6-phosphate dehydrogenase (G6PD) deficiency, they are not configured appropriately to support point-of-care testing. The feasibility of using lyophilized recombinant human G6PD as a QC reagent in novel point-of-care tests for G6PD deficiency is demonstrated. Human recombinant G6PD (r-G6PD) was expressed in Escherichia coli and purified. Aliquots were stored at -80°C. Prior to lyophilization, aliquots were thawed, and three concentrations of r-G6PD (representing normal, intermediate, and deficient clinical G6PD levels) were prepared and mixed with a protective formulation, which protects the enzyme activity against degradation from denaturation during the lyophilization process. Following lyophilization, individual single-use tubes of lyophilized r-G6PD were placed in individual packs with desiccants and stored at five temperatures for one year. An enzyme assay for G6PD activity was used to ascertain the stability of r-G6PD activity while stored at different temperatures. Lyophilized r-G6PD is stable and can be used as a control indicator. Results presented here show that G6PD activity is stable for at least 365 days when stored at -80°C, 4°C, 30°C, and 45°C. When stored at 55°C, enzyme activity was found to be stable only through day 28. Lyophilized r-G6PD enzyme is stable and can be used as a control for point-of-care tests for G6PD deficiency.

  12. Genetic characterization of human hydatid cysts shows coinfection by Echinococcus canadensis G7 and Echinococcus granulosus sensu stricto G1 in Argentina.

    PubMed

    Debiaggi, María Florencia; Soriano, Silvia Viviana; Pierangeli, Nora Beatriz; Lazzarini, Lorena Evelina; Pianciola, Luis Alfredo; Mazzeo, Melina Leonor; Moguillansky, Sergio; Farjat, Juan Angel Basualdo

    2017-09-01

    Human cystic echinococcosis caused by the larval stage of Echinococcus granulosus sensu lato (s.l.) is a highly endemic disease in the province of Neuquén, Patagonia, Argentina. Human infections with E. granulosus sensu stricto (s.s.) G1 and Echinococcus canadensis G6 were reported in Neuquén in previous studies, whereas four genotypes were identified in livestock: G1, G3, G6, and G7. The aim of this study was to identify the genotypes of E. granulosus s.l. isolates from humans of Neuquén province, Patagonia, Argentina, through the 2005-2014 period. Twenty six hydatid cysts were obtained from 21 patients. The most frequent locations were the liver and lungs. Single cysts were observed in 81.0% of patients, and combined infection of liver and lungs was detected in 9.5% of cases. Partial sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) and NADH dehydrogenase subunit 1 (nad1) genes identified the presence of E. granulosus s.s. G1 (n = 11; 42.3%) including three different partial sequences; E. canadensis G6 (n = 14; 53.8%) and E. canadensis G7 (n = 1; 3.9%). Coinfection with G1 and G7 genotypes was detected in one patient who harbored three liver cysts. Most of the liver cysts corresponded to G1 and G6 genotypes. This study presents the first report in the Americas of a human infection with E. canadensis G7 and the second worldwide report of a coinfection with two different species and genotypes of E. granulosus s.l in humans. The molecular diversity of this parasite should be considered to redesign or improve the control program strategies in endemic regions.

  13. [IgG4-related disease].

    PubMed

    González-Moreno, Juan; Losada López, Inés; Ortego Centeno, Norberto

    2015-12-21

    IgG4-related disease is a recently described clinicopathological entity showing a wide spectrum of clinical manifestations that share a common pathology. Its most characteristic feature is the formation of inflammatory tumors in different organs, which makes differentiation mainly with neoplastic diseases fundamental. The inflammatory process is typically comprised of IgG4 lymphoplasmacytic cells. The pathophysiological role of the immunoglobulin is not clear. The treatment of choice is corticosteroids. This article aims to summarize the main features of the disease. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  14. Confirmation of Echinococcus canadensis G8 and G10 in Idaho Gray Wolves ( Canis lupus) and Cervids.

    PubMed

    Cerda, Jacey Roche; Ballweber, Lora Rickard

    2018-04-01

    We confirm the presence of Echinococcus canadensis genotypes G8 and G10 in gray wolves ( Canis lupus) and cervids in Idaho, US. Our results demonstrated that cystic echinococcosis remains a potential public health issue, indicating the need for regular deworming of domestic dogs, who often act as potential bridge hosts.

  15. Metal Ion Interactions with Immunoglobulin G (IgG). 1. Preliminary Studies with Electron Paramagnetic Resonance (EPR) Spectroscopy and Ultrafiltration

    DTIC Science & Technology

    1978-12-12

    EPR and ultrafiltration studies are recommceided to conduct luture metal ion- IgG binding research. Using Scatchard plots, bind.ng levels can be...of the binding sites can be best pursued by EPR and ultrafiltration using the fragments of IgG . This report noted some difference in the binding...immunoelectrophoresis, ultrafiltration, UV spectroscopy, atomic absorption spectroscopy, and electron paramagnetic resonance (EPR). IgG used ,- ,is non

  16. Visualizing Vpr-Induced G2 Arrest and Apoptosis

    PubMed Central

    Murakami, Tomoyuki; Aida, Yoko

    2014-01-01

    Vpr is an accessory protein of human immunodeficiency virus type 1 (HIV-1) with multiple functions. The induction of G2 arrest by Vpr plays a particularly important role in efficient viral replication because the transcriptional activity of the HIV-1 long terminal repeat is most active in G2 phase. The regulation of apoptosis by Vpr is also important for immune suppression and pathogenesis during HIV infection. However, it is not known whether Vpr-induced apoptosis depends on the ability of Vpr to induce G2 arrest, and the dynamics of Vpr-induced G2 arrest and apoptosis have not been visualized. We performed time-lapse imaging to examine the temporal relationship between Vpr-induced G2 arrest and apoptosis using HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator2 (Fucci2). The dynamics of G2 arrest and subsequent long-term mitotic cell rounding in cells transfected with the Vpr-expression vector were visualized. These cells underwent nuclear mis-segregation after prolonged mitotic processes and then entered G1 phase. Some cells subsequently displayed evidence of apoptosis after prolonged mitotic processes and nuclear mis-segregation. Interestingly, Vpr-induced apoptosis was seldom observed in S or G2 phase. Likewise, visualization of synchronized HeLa/Fucci2 cells infected with an adenoviral vector expressing Vpr clearly showed that Vpr arrests the cell cycle at G2 phase, but does not induce apoptosis at S or G2 phase. Furthermore, time-lapse imaging of HeLa/Fucci2 cells expressing SCAT3.1, a caspase-3-sensitive fusion protein, clearly demonstrated that Vpr induces caspase-3-dependent apoptosis. Finally, to examine whether the effects of Vpr on G2 arrest and apoptosis were reversible, we performed live-cell imaging of a destabilizing domain fusion Vpr, which enabled rapid stabilization and destabilization by Shield1. The effects of Vpr on G2 arrest and subsequent apoptosis were reversible. This study is the first to characterize the

  17. Association of interleukin-10-1082 G/G genotype with lower mortality of acute respiratory distress syndrome in a Chinese population.

    PubMed

    Jin, Xiaodong; Hu, Zhi; Kang, Yan; Liu, Chang; Zhou, Yongfang; Wu, Xiaodong; Liu, Jin; Zhong, Mingxing; Luo, Chuanxing; Deng, Lijing; Deng, Yiyun; Xie, Xiaoqi; Zhang, Zhongwei; Zhou, Yan; Liao, Xuelian

    2011-04-01

    We investigate whether interleukin-10 (IL-10)-1082 G/G genotype is associated with the mortality rate of acute respiratory distress syndrome (ARDS) in a hospital-based case-control study in China conducted on 314 patients with ARDS and 210 controls admitted to an intensive care unit for sepsis, trauma, aspiration, or massive transfusions. IL-10-1082 promoter polymorphisms were analyzed with polymerase chain reaction amplification followed by restriction fragment length polymorphism. Mortality was recorded if it occurred within 30 days from admission. The -1082G/G genotype was associated with lower frequency of ARDS (odds ratios=0.51; 95% confidence intervals: 0.34-0.76; p=0.001), and in patients with ARDS, it was associated with lower mortality within 30 days (odds ratios=0.44; 95% confidence intervals: 0.25-0.76; p=0.003) than in controls. We conclude that IL-10-1082 G/G genotype is associated with a decreased rate development of ARDS and mortality in this Chinese population.

  18. Geological studies of the COST nos. G-1 and G-2 wells, United States North Atlantic outer continental shelf

    USGS Publications Warehouse

    Scholle, Peter A.; Wenkam, Chiye R.

    1982-01-01

    The COST Nos. G-1 and G-2 wells (fig. 1) are the second and third deep stratigraphic test wells drilled in the North Atlantic Outer Continental Shelf of the United States. COST No. G-1 was drilled in the Georges Bank basin to a total depth of 16,071 ft (4,898 m). G-1 bottomed in phyllite, slate, and metaquartzite overlain by weakly metamorphosed dolomite, all of Cambrian age. From approximately 15,600 to 12,400 ft (4,755 to 3,780 m) the strata are Upper Triassic(?), Lower Jurassic(?), and Middle Jurassic, predominantly red shales, sandstones, and conglomerates. Thin, gray Middle Jurassic beds of shale, sandstone, limestone, and dolomite occur from 12,400 to 9,900 ft (3,780 to 3,018 m). From 9,900 to 1,030 ft (3,018 to 314 m) are coarse-grained unconsolidated sands and loosely cemented sandstones, with beds of gray shale, lignite, and coal. The microfossils indicate the rocks are Upper Jurassic from 10,100 ft (3,078 m) up to 5,400 ft (1,646 m) and Cretaceous from that depth to 1,030 ft (314 m). No younger or shallower rocks were recovered in the drilling at the COST No. G-1 site, but an Eocene limestone is inferred to be disconformable over Santonian strata. The Jurassic strata of the COST No. G-1 well were deposited in shallow marine, marginal marine, and nonmarine environments, which changed to a dominantly shallow marine but still nearshore environment in the Cretaceous. The COST No. G-2 well was drilled 42 statute miles {68 km) east of the G-1 site, still within the Georges Bank basin, to a depth of 21,874 ft (6,667 m). The bottom 40 ft (12 m) of salt and anhydrite is overlain by approximately 7,000 ft {2,134 m) of Upper Triassic{?), Lower Jurassic{?) and Middle Jurassic dolomite, limestone, and interbedded anhydrite from 21,830 to 13,615 ft (6,654 to 4,153 m). From 13,500 to 9,700 ft (4,115 to 2,957 m) are Middle Jurassic limestones with interbedded sandstone. From 9,700 to 4,000 ft (2,957 to 1,219 m) are Upper Jurassic and Cretaceous interbedded sandstones and

  19. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis.

    PubMed

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD.

  20. Plasminogen activator inhibitor-1 4G/5G polymorphism is associated with coronary artery disease risk: a meta-analysis

    PubMed Central

    Zhang, Huifeng; Dong, Pingshuan; Yang, Xuming; Liu, Zhenghao

    2014-01-01

    Background: The aim of the current study was to evaluate the association of PAI-1 4G/5G polymorphism with coronary artery disease (CAD) risk using a meta-analysis. Methods: All eligible studies were identified through a search of PubMed, EMBASE, China National Knowledge Infrastructure (CNKI), Database of Chinese Scientific and Technical Periodicals, and China Biology Medical literature database (CBM) before June 2014. The association between the PAI-1 4G/5G polymorphism and CAD risk was estimated by odds ratio (OR) and 95% confidence interval (CI). Results: A total of 72 studies including 23557 cases and 21526 controls were eventually collected. The PAI-1 4G/5G polymorphism was significant associated with CAD risk in overall population (OR=1.19, 95% CI 1.10-1.28, P < 0.00001). The combination of adjusted ORs for CAD was 1.20 (95% CI 1.03-1.40, P=0.02). This polymorphism was associated with CAD risk in Caucasians (OR=1.10, 95% CI 1.02-1.19, P=0.01) and Asians (OR=1.46, 95% CI 1.21-1.75, P < 0.0001). This polymorphism significantly increased MI risk (OR=1.15, 95% CI 1.06-1.25, P=0.001). In the subgroup analysis by age, this polymorphism was significantly associated with early-onset CAD risk (OR=1.21, 95% CI 1.02-1.43, P=0.03). In the gender subgroup analyses, a statistically significant association was found in male CAD patients (OR=1.10, 95% CI 1.01-1.20, P=0.04). Both T2DM patients and non-T2DM patients carrying 4G allele showed increased CAD risks (OR=2.23, 95% CI 1.27-3.92, P=0.005 and OR=1.64, 95% CI 1.19-2.25, P=0.002, respectively). Conclusions: This meta-analysis suggested that PAI-1 4G/5G polymorphism was a risk factor for CAD. PMID:25419432

  1. Carbazole ligands as c-myc G-quadruplex binders.

    PubMed

    Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

    2018-07-15

    The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Key technologies and concepts for beyond-3G networks

    NASA Astrophysics Data System (ADS)

    Pehkonen, Kari; Uskela, Sami; Kalliojarvi, Kari; Oksanen, Lauri; Rikkinen, Kari

    2001-10-01

    Standardization of 3rd Generation (3G) mobile communication systems has produced the first specification releases and the commercial deployment of the 3G systems has started. Whereas 1G and 2G focused on efficiently providing voice services, in 3G a lot of attention has been devoted to solutions that support both Circuit Switched (CS) and Packet Switched (PS) communication. That has called for very flexible air interface and network solutions. 3G will continue to evolve and there are already on-going standardization activities that will, for example, boost the peak data rates up to 5-10 Mbps and improve spectral efficiency by 2-4 times. In the future, 3G evolution will be going towards 10/100 Mbps peak data rates in wide/local are coverage, respectively. This will take place partly because of technical improvements of 3G radio interface solutions, but also due to network evolution which will allow the integration other radio access methods like radio LANs into the 3G system. In longer term the 3G network evolution will be going towards ALL-IP networks. As 3G evolution seems to be going towards 10 Mbps/100 Mbps peak data rates and ALL-IP networks any beyond 3G air interface or network solution should be clearly better in order to justify its technical and commercial feasibility. Given the long evolution time of 3G and integration of other radio access schemes with 3G radio we may not even see a new, complete beyond 3G system being developed. Maybe we will just witness the emergence of a new, more advanced radio access solution which will then be connected to the evolving 3G network. As 3G evolution will continue for several years to come the research targets for any beyond 3G solutions must be set very high. When it comes to air interface, we should aim at 100 Mbps peak data rates for wide area access with high mobility, and at 1 Gbps for local area access with low mobility. Regarding possible commercial launches of any beyond 3G systems or solutions they could then

  3. More about solar g modes

    NASA Astrophysics Data System (ADS)

    Fossat, E.; Schmider, F. X.

    2018-04-01

    Context. The detection of asymptotic solar g-mode parameters was the main goal of the GOLF instrument onboard the SOHO space observatory. This detection has recently been reported and has identified a rapid mean rotation of the solar core, with a one-week period, nearly four times faster than all the rest of the solar body, from the surface to the bottom of the radiative zone. Aim. We present here the detection of more g modes of higher degree, and a more precise estimation of all their parameters, which will have to be exploited as additional constraints in modeling the solar core. Methods: Having identified the period equidistance and the splitting of a large number of asymptotic g modes of degrees 1 and 2, we test a model of frequencies of these modes by a cross-correlation with the power spectrum from which they have been detected. It shows a high correlation peak at lag zero, showing that the model is hidden but present in the real spectrum. The model parameters can then be adjusted to optimize the position (at exactly zero lag) and the height of this correlation peak. The same method is then extended to the search for modes of degrees 3 and 4, which were not detected in the previous analysis. Results: g-mode parameters are optimally measured in similar-frequency bandwidths, ranging from 7 to 8 μHz at one end and all close to 30 μHz at the other end, for the degrees 1 to 4. They include the four asymptotic period equidistances, the slight departure from equidistance of the detected periods for l = 1 and l = 2, the measured amplitudes, functions of the degree and the tesseral order, and the splittings that will possibly constrain the estimated sharpness of the transition between the one-week mean rotation of the core and the almost four-week rotation of the radiative envelope. The g-mode periods themselves are crucial inputs in the solar core structure helioseismic investigation.

  4. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and coronary artery disease in the Chinese Han population: a meta-analysis.

    PubMed

    Li, Yan-yan

    2012-01-01

    The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD.

  5. Plasminogen Activator Inhibitor-1 4G/5G Gene Polymorphism and Coronary Artery Disease in the Chinese Han Population: A Meta-Analysis

    PubMed Central

    Li, Yan-yan

    2012-01-01

    Background The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. Objective and Methods The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. Results The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P<0.0001). Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017), study region (P = 0.014), control group sample size (P = 0.011), total sample size (P = 0.011), and ratio of the case to the control group sample size (RR) (P = 0.019). In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02). Conclusions In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD. PMID:22496752

  6. 5G: The Convergence of Wireless Communications.

    PubMed

    Chávez-Santiago, Raúl; Szydełko, Michał; Kliks, Adrian; Foukalas, Fotis; Haddad, Yoram; Nolan, Keith E; Kelly, Mark Y; Masonta, Moshe T; Balasingham, Ilangko

    As the rollout of 4G mobile communication networks takes place, representatives of industry and academia have started to look into the technological developments toward the next generation (5G). Several research projects involving key international mobile network operators, infrastructure manufacturers, and academic institutions, have been launched recently to set the technological foundations of 5G. However, the architecture of future 5G systems, their performance, and mobile services to be provided have not been clearly defined. In this paper, we put forth the vision for 5G as the convergence of evolved versions of current cellular networks with other complementary radio access technologies. Therefore, 5G may not be a single radio access interface but rather a "network of networks". Evidently, the seamless integration of a variety of air interfaces, protocols, and frequency bands, requires paradigm shifts in the way networks cooperate and complement each other to deliver data rates of several Gigabits per second with end-to-end latency of a few milliseconds. We provide an overview of the key radio technologies that will play a key role in the realization of this vision for the next generation of mobile communication networks. We also introduce some of the research challenges that need to be addressed.

  7. Quadruplexes in 'Dicty': crystal structure of a four-quartet G-quadruplex formed by G-rich motif found in the Dictyostelium discoideum genome.

    PubMed

    Guédin, Aurore; Lin, Linda Yingqi; Armane, Samir; Lacroix, Laurent; Mergny, Jean-Louis; Thore, Stéphane; Yatsunyk, Liliya A

    2018-06-01

    Guanine-rich DNA has the potential to fold into non-canonical G-quadruplex (G4) structures. Analysis of the genome of the social amoeba Dictyostelium discoideum indicates a low number of sequences with G4-forming potential (249-1055). Therefore, D. discoideum is a perfect model organism to investigate the relationship between the presence of G4s and their biological functions. As a first step in this investigation, we crystallized the dGGGGGAGGGGTACAGGGGTACAGGGG sequence from the putative promoter region of two divergent genes in D. discoideum. According to the crystal structure, this sequence folds into a four-quartet intramolecular antiparallel G4 with two lateral and one diagonal loops. The G-quadruplex core is further stabilized by a G-C Watson-Crick base pair and a A-T-A triad and displays high thermal stability (Tm > 90°C at 100 mM KCl). Biophysical characterization of the native sequence and loop mutants suggests that the DNA adopts the same structure in solution and in crystalline form, and that loop interactions are important for the G4 stability but not for its folding. Four-tetrad G4 structures are sparse. Thus, our work advances understanding of the structural diversity of G-quadruplexes and yields coordinates for in silico drug screening programs and G4 predictive tools.

  8. 7 CFR 29.1038 - No-G.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false No-G. 29.1038 Section 29.1038 Agriculture Regulations... Type 92) § 29.1038 No-G. A designation applied to a lot of tobacco which is offtype, semicured, fire-killed, smoked, oxidized over 10 percent, or has an odor foreign to the type. (See Rule 23.) [47 FR 51721...

  9. Sequence Factorial of "g"-Gonal Numbers

    ERIC Educational Resources Information Center

    Asiru, Muniru A.

    2013-01-01

    The gamma function, which has the property to interpolate the factorial whenever the argument is an integer, is a special case (the case "g"?=?2) of the general term of the sequence factorial of "g"-gonal numbers. In relation to this special case, a formula for calculating the general term of the sequence factorial of any…

  10. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  11. G6PD testing in support of treatment and elimination of malaria: recommendations for evaluation of G6PD tests.

    PubMed

    Domingo, Gonzalo J; Satyagraha, Ari Winasti; Anvikar, Anup; Baird, Kevin; Bancone, Germana; Bansil, Pooja; Carter, Nick; Cheng, Qin; Culpepper, Janice; Eziefula, Chi; Fukuda, Mark; Green, Justin; Hwang, Jimee; Lacerda, Marcus; McGray, Sarah; Menard, Didier; Nosten, Francois; Nuchprayoon, Issarang; Oo, Nwe Nwe; Bualombai, Pongwit; Pumpradit, Wadchara; Qian, Kun; Recht, Judith; Roca, Arantxa; Satimai, Wichai; Sovannaroth, Siv; Vestergaard, Lasse S; Von Seidlein, Lorenz

    2013-11-04

    Malaria elimination will be possible only with serious attempts to address asymptomatic infection and chronic infection by both Plasmodium falciparum and Plasmodium vivax. Currently available drugs that can completely clear a human of P. vivax (known as "radical cure"), and that can reduce transmission of malaria parasites, are those in the 8-aminoquinoline drug family, such as primaquine. Unfortunately, people with glucose-6-phosphate dehydrogenase (G6PD) deficiency risk having severe adverse reactions if exposed to these drugs at certain doses. G6PD deficiency is the most common human enzyme defect, affecting approximately 400 million people worldwide.Scaling up radical cure regimens will require testing for G6PD deficiency, at two levels: 1) the individual level to ensure safe case management, and 2) the population level to understand the risk in the local population to guide Plasmodium vivax treatment policy. Several technical and operational knowledge gaps must be addressed to expand access to G6PD deficiency testing and to ensure that a patient's G6PD status is known before deciding to administer an 8-aminoquinoline-based drug.In this report from a stakeholder meeting held in Thailand on October 4 and 5, 2012, G6PD testing in support of radical cure is discussed in detail. The focus is on challenges to the development and evaluation of G6PD diagnostic tests, and on challenges related to the operational aspects of implementing G6PD testing in support of radical cure. The report also describes recommendations for evaluation of diagnostic tests for G6PD deficiency in support of radical cure.

  12. Herpes simplex virus glycoproteins gB and gH function in fusion between the virion envelope and the outer nuclear membrane.

    PubMed

    Farnsworth, Aaron; Wisner, Todd W; Webb, Michael; Roller, Richard; Cohen, Gary; Eisenberg, Roselyn; Johnson, David C

    2007-06-12

    Herpesviruses must traverse the nuclear envelope to gain access to the cytoplasm and, ultimately, to exit cells. It is believed that herpesvirus nucleocapsids enter the perinuclear space by budding through the inner nuclear membrane (NM). To reach the cytoplasm these enveloped particles must fuse with the outer NM and the unenveloped capsids then acquire a second envelope in the trans-Golgi network. Little is known about the process by which herpesviruses virions fuse with the outer NM. Here we show that a herpes simplex virus (HSV) mutant lacking both the two putative fusion glycoproteins gB and gH failed to cross the nuclear envelope. Enveloped virions accumulated in the perinuclear space or in membrane vesicles that bulged into the nucleoplasm (herniations). By contrast, mutants lacking just gB or gH showed only minor or no defects in nuclear egress. We concluded that either HSV gB or gH can promote fusion between the virion envelope and the outer NM. It is noteworthy that fusion associated with HSV entry requires the cooperative action of both gB and gH, suggesting that the two types of fusion (egress versus entry) are dissimilar processes.

  13. Analysis of Radiation-natural Convection Interactions in 1-g and low-g Environments using the Discrete Exchange Factor Method

    NASA Technical Reports Server (NTRS)

    Kassemi, M.; Naraghi, M. H. N.

    1993-01-01

    A new numerical method is presented for the analysis of combined natural convection and radiation heat transfer with applications in many engineering situations such as materials processing, combustion and fire research. Because of the recent interest in the low gravity environment of space, attention is devoted to both 1-g and low-g applications. The two-dimensional mathematical model is represented by a set of coupled nonlinear integro-partial differential equations. Radiative exchange is formulated using the Discrete Exchange Factor method (DEF). This method considers point to point exchange and provides accurate results over a wide range of radiation parameters. Numerical results show that radiation significantly influences the flow and heat transfer in both low-g and 1-g applications. In the low-g environment, convection is weak, and radiation can easily become the dominant heat transfer mode. It is also shown that volumetric heating by radiation gives rise to an intricate cell pattern in the top heated enclosure.

  14. Cold-sensitive mutants G680V and G691C of Dictyostelium myosin II confer dramatically different biochemical defects.

    PubMed

    Patterson, B; Ruppel, K M; Wu, Y; Spudich, J A

    1997-10-31

    Cold-sensitive myosin mutants represent powerful tools for dissecting discrete deficiencies in myosin function. Biochemical characterization of two such mutants, G680V and G691C, has allowed us to identify separate facets of myosin motor function perturbed by each alteration. Compared with wild type, the G680V myosin exhibits a substantially enhanced affinity for several nucleotides, decreased ATPase activity, and overoccupancy or creation of a novel strongly actin-binding state. The properties of the novel strong binding state are consistent with a partial arrest or pausing at the onset of the mechanical stroke. The G691C mutant, on the other hand, exhibits an elevated basal ATPase indicative of premature phosphate release. By releasing phosphate without a requirement for actin binding, the G691C can bypass the part of the cycle involving the mechanical stroke. The two mutants, despite having alterations in glycine residues separated by only 11 residues, have dramatically different consequences on the mechanochemical cycle.

  15. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  16. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  17. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  18. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  19. 48 CFR Appendix G to Chapter 2 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false [Reserved] G Appendix G to Chapter 2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE Appendix G to Chapter 2 [Reserved] ...

  20. Comparison of two contraceptive pills containing drospirenone and 20 μg or 30 μg ethinyl estradiol for polycystic ovary syndrome.

    PubMed

    Bhattacharya, Sudhindra M; Jha, Ayan; DasMukhopadhyay, Lipika

    2016-02-01

    To compare the effects of 30 μg and 20 μg ethinyl estradiol (EE) among women with polycystic ovary syndrome (PCOS). In a randomized study, patients with PCOS, a history of six or fewer menstrual cycles in the previous 12 months, and abnormal body hair growth were enrolled at a center in Kolkata, India, between May 1, 2012, and January 31, 2014. Participants were randomly assigned (1:1) using a computer-generated randomization table to receive an oral contraceptive pill containing 3mg drospirenone and either 30 μg EE or 20 μg EE. Patients were followed up after 6 and 12 months. The primary outcome was the absolute change in the free androgen index. Participants were masked to group assignment but investigators were not. Analyses were by intention to treat. Overall, 112 patients were enrolled. At 6 months, the free androgen index had decreased by 4.96±6.01 among patients receiving 30 μg (n=55) and by 4.81±6.03 among those receiving 20 μg (n=57; P=0.89). At 12 months, the decrease from baseline was 5.23±5.79 with 30 μg and 4.99±5.86 with 20 μg (P=0.82). Among patients with PCOS, an oral contraceptive pill containing 20 μg EE has similar effects on androgen levels to those of a pill containing 30 μg. CTRI/2012/04/002571. Copyright © 2015 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Gene expression changes in spinal motoneurons of the SOD1(G93A) transgenic model for ALS after treatment with G-CSF.

    PubMed

    Henriques, Alexandre; Kastner, Stefan; Chatzikonstantinou, Eva; Pitzer, Claudia; Plaas, Christian; Kirsch, Friederike; Wafzig, Oliver; Krüger, Carola; Spoelgen, Robert; Gonzalez De Aguilar, Jose-Luis; Gretz, Norbert; Schneider, Armin

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is an incurable fatal motoneuron disease with a lifetime risk of approximately 1:400. It is characterized by progressive weakness, muscle wasting, and death ensuing 3-5 years after diagnosis. Granulocyte-colony stimulating factor (G-CSF) is a drug candidate for ALS, with evidence for efficacy from animal studies and interesting data from pilot clinical trials. To gain insight into the disease mechanisms and mode of action of G-CSF, we performed gene expression profiling on isolated lumbar motoneurons from SOD1(G93A) mice, the most frequently studied animal model for ALS, with and without G-CSF treatment. Motoneurons from SOD1(G93A) mice present a distinct gene expression profile in comparison to controls already at an early disease stage (11 weeks of age), when treatment was initiated. The degree of deregulation increases at a time where motor symptoms are obvious (15 weeks of age). Upon G-CSF treatment, transcriptomic deregulations of SOD1(G93A) motoneurons were notably restored. Discriminant analysis revealed that SOD1 mice treated with G-CSF has a transcriptom close to presymptomatic SOD1 mice or wild type mice. Some interesting genes modulated by G-CSF treatment relate to neuromuscular function such as CCR4-NOT or Prss12. Our data suggest that G-CSF is able to re-adjust gene expression in symptomatic SOD1(G93A) motoneurons. This provides further arguments for G-CSF as a promising drug candidate for ALS.

  2. Gene expression changes in spinal motoneurons of the SOD1G93A transgenic model for ALS after treatment with G-CSF

    PubMed Central

    Henriques, Alexandre; Kastner, Stefan; Chatzikonstantinou, Eva; Pitzer, Claudia; Plaas, Christian; Kirsch, Friederike; Wafzig, Oliver; Krüger, Carola; Spoelgen, Robert; Gonzalez De Aguilar, Jose-Luis; Gretz, Norbert; Schneider, Armin

    2015-01-01

    Background: Amyotrophic lateral sclerosis (ALS) is an incurable fatal motoneuron disease with a lifetime risk of approximately 1:400. It is characterized by progressive weakness, muscle wasting, and death ensuing 3–5 years after diagnosis. Granulocyte-colony stimulating factor (G-CSF) is a drug candidate for ALS, with evidence for efficacy from animal studies and interesting data from pilot clinical trials. To gain insight into the disease mechanisms and mode of action of G-CSF, we performed gene expression profiling on isolated lumbar motoneurons from SOD1G93A mice, the most frequently studied animal model for ALS, with and without G-CSF treatment. Results: Motoneurons from SOD1G93A mice present a distinct gene expression profile in comparison to controls already at an early disease stage (11 weeks of age), when treatment was initiated. The degree of deregulation increases at a time where motor symptoms are obvious (15 weeks of age). Upon G-CSF treatment, transcriptomic deregulations of SOD1G93A motoneurons were notably restored. Discriminant analysis revealed that SOD1 mice treated with G-CSF has a transcriptom close to presymptomatic SOD1 mice or wild type mice. Some interesting genes modulated by G-CSF treatment relate to neuromuscular function such as CCR4-NOT or Prss12. Conclusions: Our data suggest that G-CSF is able to re-adjust gene expression in symptomatic SOD1G93A motoneurons. This provides further arguments for G-CSF as a promising drug candidate for ALS. PMID:25653590

  3. G2 phase-specific proteins of HeLa cells.

    PubMed Central

    Al-Bader, A A; Orengo, A; Rao, P N

    1978-01-01

    The objective of this study was to determine if HeLa cells irreversibly arrested in G2 phase of the cell cycle by a brief exposure to a nitrosourea compound were deficient in certain proteins when compared with G2-synchronized cells. Total cellular proteins of G2-synchronized, G2-arrested, and S phase-synchronized cells were compared by two-dimensional polyacrylamide gel electrophoresis. The S phase cells differed from the G2-synchronized and G2-arrested cells by the absence of about 35 and 25 protein spots, respectively, of a total of nearly 150. At least nine protein spots in the molecular weight range of 4--5 X 10(4) that were present in the G2-synchronized cells were absent in both the G2-arrested and the S phase cells. Thus, these studies suggest that the missing proteins are probably necessary for the transition of cells from G2 phase to mitosis. Supplying the missing proteins to the G2-arrested cells by fusion with G2-synchronized cells facilitated the entry of the former into mitosis. Images PMID:282623

  4. Cerebral infarction and femoral venous thrombosis detected in a patient with diabetic ketoacidosis and heterozygous factor V Leiden G1691A and PAI-1 4G/5G mutations.

    PubMed

    Yaroglu Kazanci, Selcen; Yesilbas, Osman; Ersoy, Melike; Kihtir, Hasan Serdar; Yildirim, Hamdi Murat; Sevketoglu, Esra

    2015-09-01

    Cerebral infarction is one of the serious neurological complications of diabetic ketoacidosis (DKA). Especially in patients who are genetically prone to thrombosis, cerebral infarction may develop due to inflammation, dehydration, and hyperviscocity secondary to DKA. A 6-year-old child with DKA is diagnosed with cerebral infarction after respiratory insufficiency, convulsion, and altered level of consciousness. Femoral and external iliac venous thrombosis also developed in a few hours after central femoral catheter had been inserted. Heterozygous type of factor V Leiden and PAI-14G/5G mutation were detected. In patients with DKA, cerebral infarction may be suspected other than cerebral edema when altered level of consciousness, convulsion, and respiratory insufficiency develop and once cerebral infarction occurs the patients should also be evaluated for factor V Leiden and PAI-14G/5G mutation analysis in addition to the other prothrombotic risk factors.

  5. G-DYN Multibody Dynamics Engine

    NASA Technical Reports Server (NTRS)

    Acikmese, Behcet; Blackmore, James C.; Broderick, Daniel

    2011-01-01

    G-DYN is a multi-body dynamic simulation software engine that automatically assembles and integrates equations of motion for arbitrarily connected multibody dynamic systems. The algorithm behind G-DYN is based on a primal-dual formulation of the dynamics that captures the position and velocity vectors (primal variables) of each body and the interaction forces (dual variables) between bodies, which are particularly useful for control and estimation analysis and synthesis. It also takes full advantage of the spare matrix structure resulting from the system dynamics to numerically integrate the equations of motion efficiently. Furthermore, the dynamic model for each body can easily be replaced without re-deriving the overall equations of motion, and the assembly of the equations of motion is done automatically. G-DYN proved an essential software tool in the simulation of spacecraft systems used for small celestial body surface sampling, specifically in simulating touch-and-go (TAG) maneuvers of a robotic sampling system from a comet and asteroid. It is used extensively in validating mission concepts for small body sample return, such as Comet Odyssey and Galahad New Frontiers proposals.

  6. 41G crew activities

    NASA Image and Video Library

    2009-06-25

    41G-101-039 (5-13 Oct 1984) --- Two members of a record seven-person crew are pictured during Intravehicular Activity (IVA) aboard the Earth-orbiting Space Shuttle Challenger. Hold picture with open hand at right center edge. Astronaut David C. Leestma, mission specialist, is at right observing a test by payload specialist Marc Garneau, representing the National Research Council (NRC) of Canada. Garneau spent much of his on-duty time conducting a series of experiments for the NRC. The crew consisted of astronauts Robert L. Crippen, commander; Jon A. McBride, pilot; mission specialist's Kathryn D. Sullivan, Sally K. Ride, and David D. Leestma; Canadian astronaut Marc Garneau, and Paul D. Scully-Power, payload specialist's. EDITOR'S NOTE: The STS-41G mission had the first American female EVA (Sullivan); first seven-person crew; first orbital fuel transfer; and the first Canadian (Garneau).

  7. IgG4-related disease of the rectum

    PubMed Central

    Choi, Sung-Bong; Lim, Chul-Hyun; Cha, Myung-Guen

    2016-01-01

    IgG4-related disease is a relatively new disease entity characterized by elevated serum IgG4 levels and marked infiltration of IgG4-positive plasma cells in lesions. Organ enlargement or nodular lesions consisting of abundant infiltration of lymphocytes and IgG4-positive plasma cells and fibrosis are seen in various organs throughout. We encountered a patient with an inflammatory pseudotumor of the rectum, which was histopathologically confirmed to be an IgG4-related disease. The patient was a 28-year-old woman who had constipation for 3 months. The endoluminal ultrasonography showed a lesion that was heterogeneous and low echogenic in lower rectum. The result of colonoscopic biopsy findings was of chronic proctitis with lymphoid aggregates. For a confirmative diagnosis, excision was performed. Histopathological examination represented plasma cell infiltration and fibrosis. Immunohistochemistry revealed prominence of IgG4-positive plasma cells and confirmed the diagnosis of IgG4-related disease. The patient is currently under observation on low-dose oral prednisolone without relapse. PMID:27186575

  8. The extraction of the spin structure function, g2 (and g1) at low Bjorken x

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ndukum, Luwani Z.

    2015-08-01

    The Spin Asymmetries of the Nucleon Experiment (SANE) used the Continuous Electron Beam Accelerator Facility at Jefferson Laboratory in Newport News, VA to investigate the spin structure of the proton. The experiment measured inclusive double polarization electron asymmetries using a polarized electron beam, scattered off a solid polarized ammonia target with target polarization aligned longitudinal and near transverse to the electron beam, allowing the extraction of the spin asymmetries A1 and A2, and spin structure functions g1 and g2. Polarized electrons of energies of 4.7 and 5.9 GeV were used. The scattered electrons were detected by a novel, non-magnetic arraymore » of detectors observing a four-momentum transfer range of 2.5 to 6.5 GeV*V. This document addresses the extraction of the spin asymmetries and spin structure functions, with a focus on spin structure function, g2 (and g1) at low Bjorken x. The spin structure functions were measured as a function of x and W in four Q square bins. A full understanding of the low x region is necessary to get clean results for SANE and extend our understanding of the kinematic region at low x.« less

  9. Liposomal gD Ectodomain (gD1-306) Vaccine Protects Against HSV2 Genital or Rectal Infection of Female and Male Mice

    PubMed Central

    Olson, K.; Macias, P.; Hutton, S.; Ernst, W. A.; Fujii, G.; Adler-Moore, J. P.

    2009-01-01

    Herpes simplex virus type 2 (HSV2) is the most common causative agent of genital herpes, with infection rates as high as 1 in 6 adults. The present studies were done to evaluate the efficacy of a liposomal HSV2 gD1-306 vaccine (L-gD1-306-HD) in an acute murine HSV2 infection model of intravaginal (female) or intrarectal (male or female) challenge. Two doses of L-gD1-306-HD containing 60μg gD1-306-HD and 15μg monophosphoryl lipid A (MPL) per dose provided protection against HSV2 intravaginal challenge (86-100% survival, P≤0.0003 vs control liposomes; P=0.06 vs L-gD1-306-HD without MPL). Both male and female mice (BALB/c and C57BL/6) immunized with L-gD1-306-HD/MPL were significantly protected against HSV2 intrarectal challenge, with higher survival rates compared to controls (71-100%, P≤0.007). L-gD1-306-HD/MPL also provided increased survival when compared to a liposomal peptide vaccine, L-gD264-285-HD/MPL (male BALB/c, P≤0.001; female BALB/c and male C57BL/6, P=0.06). Mice given L-gD1-306-HD/MPL also had minimal disease signs, reduced viral burden in their spinal cords and elevated neutralizing antibody titers in the females. The vaccine also stimulated gD1-306-HD specific splenocytes of both male and female mice with significantly elevated levels of IFN-γ compared to IL-4 (P≤0.01) indicating that there was an enhanced Th1 response. These results provide the first evidence that the L-gD1-306–HD vaccine can protect both male and female mice against intrarectal HSV2 challenge. PMID:19835825

  10. Effective boson g factors in the mass 80 region

    NASA Astrophysics Data System (ADS)

    Mertzimekis, T. J.; Taylor, M. J.; Kumbartzki, G.; Benczer-Koller, N.; Stuchbery, A. E.

    2002-10-01

    Recent precision g factors have been obtained by using the transient field technique combined with Coulomb excitation in inverse kinematics in several, near spherical, nuclei around A ˜ 80. The g factors were analyzed in terms of an IBA-II formulation which treats the n and p boson effective g factors as mass-independent free parameters (A.Wolf et al.), Phys. Lett. B190, 19 (1987).. The data yielded more accurate effective boson g factors than obtained in the previous systematics for this region, g_π=0.50(3), g_ν=0.24(5) and g_π=0.45(3), g_ν=0.35(3) for the regions 28 <= N <= 50 and 38 <= N <= 50 respectively, with comparable i^2's. Evidence of shell closure for N=38 (K.-H. Speidel et al.), Phys. Rev. C57, 2181 (1998). prompted the need to examine these two regions separately. The deviations of g_π from unity and g_ν from zero indicate the importance of the underlying fermion structure.

  11. The combination of ezetimibe and ursodiol promotes fecal sterol excretion and reveals a G5G8-independent pathway for cholesterol elimination[S

    PubMed Central

    Wang, Yuhuan; Liu, Xiaoxi; Pijut, Sonja S.; Li, Jianing; Horn, Jamie; Bradford, Emily M.; Leggas, Markos; Barrett, Terrence A.; Graf, Gregory A.

    2015-01-01

    Previous studies suggest an interdependent relationship between liver and intestine for cholesterol elimination from the body. We hypothesized that a combination of ursodiol (Urso) and ezetimibe (EZ) could increase biliary secretion and reduce cholesterol reabsorption, respectively, to promote cholesterol excretion. Treatment with Urso increased hepatic ABCG5 ABCG8 (G5G8) protein and both biliary and fecal sterols in a dose-dependent manner. To determine whether the drug combination (Urso-EZ) further increased cholesterol excretion, mice were treated with Urso alone or in combination with two doses of EZ. EZ produced an additive and dose-dependent increase in fecal neutral sterol (FNS) elimination in the presence of Urso. Finally, we sequentially treated wide-type and G5G8-deficient mice with Urso and Urso-EZ to determine the extent to which these effects were G5G8 dependent. Although biliary and FNS were invariably lower in G5G8 KO mice, the relative increase in FNS following treatment with Urso alone or the Urso-EZ combination was not affected by genotype. In conclusion, Urso increases G5G8, biliary cholesterol secretion, and FNS and acts additively with EZ to promote fecal sterol excretion. However, the stimulatory effect of these agents was not G5G8 dependent. PMID:25635125

  12. 49 CFR Appendix G to Part 229 - [Reserved

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 4 2012-10-01 2012-10-01 false [Reserved] G Appendix G to Part 229 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Appendix G to Part 229 [Reserved] ...

  13. 49 CFR Appendix G to Part 229 - [Reserved

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 4 2014-10-01 2014-10-01 false [Reserved] G Appendix G to Part 229 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Appendix G to Part 229 [Reserved] ...

  14. 49 CFR Appendix G to Part 229 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 4 2013-10-01 2013-10-01 false [Reserved] G Appendix G to Part 229 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Appendix G to Part 229 [Reserved] ...

  15. Ground/Air Task Oriented Radar (G/ATOR)

    DTIC Science & Technology

    2015-12-01

    Selected Acquisition Report ( SAR ) RCS: DD-A&T(Q&A)823-386 Ground/Air Task Oriented Radar (G/ATOR) As of FY 2017 President’s Budget Defense...Acquisition Management Information Retrieval (DAMIR) March 18, 2016 06:47:59 UNCLASSIFIED G/ATOR December 2015 SAR March 18, 2016 06:47:59 UNCLASSIFIED 2...Document OSD - Office of the Secretary of Defense O&S - Operating and Support PAUC - Program Acquisition Unit Cost G/ATOR December 2015 SAR March 18

  16. Utility of serum IgG, IgG4 and carbonic anhydrase II antibodies in distinguishing autoimmune pancreatitis from pancreatic cancer and chronic pancreatitis.

    PubMed

    Talar-Wojnarowska, Renata; Gąsiorowska, Anita; Olakowski, Marek; Dranka-Bojarowska, Daria; Lampe, Paweł; Śmigielski, Jacek; Kujawiak, Magdalena; Grzegorczyk, Janina; Małecka-Panas, Ewa

    2014-09-01

    Autoimmune pancreatitis (AIP) can mimic pancreatic cancer in its clinical presentation, imaging features and laboratory parameters. The aim of our study was to compare IgG, IgG4 and anti-CAIIAb serum levels in patients with AIP, pancreatic adenocarcinoma (PA) and chronic pancreatitis (CP) and to assess their clinical significance and utility in differential diagnosis of pancreatic diseases. The study included 124 patients: 45 with PA, 24 with AIP and 55 with CP. Peripheral venous blood samples were obtained from all analyzed patients at the time of hospital admission and total IgG, IgG4 and anti-CAIIAB serum levels were measured using ELISA tests. Serum levels of IgG, IgG4 and anti-CAIIAb were significantly higher in patients with AIP compared to PA and CP patients (p<0.001). In AIP patients the median IgG levels were 19.7 g/l, IgG4 levels - 301.9 mg/dl and anti-CAIIAb - 81.82 ng/ml, compared to 10.61 g/l, 123.2mg/dl and 28.6 ng/ml, respectively, in PA patients. IgG4 for the cut-off 210 mg/dl showed the best sensitivity and specificity (83.8% and 89.5%) in AIP diagnosis compared to IgG (69.3% and 87.3%, respectively) and anti-CAIIAb (45.3% and 74.3%). However, 16 (35.5%) patients with PA and 14 (25.4%) patients with CP had IgG4 levels greater than 140 mg/dl. Moreover, in 3 (6.67%) patients with pancreatic cancer those values were greater than 280 mg/dl. No patients with CP had IgG4 more than 280 mg/dl. IgG4 at cut-off 210 mg/dl showed the best sensitivity and specificity in AIP diagnosis compared to IgG and anti-CAIIAb, however elevations of serum IgG4 may be seen in subjects without AIP, including pancreatic cancer. Copyright © 2014 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  17. Value of serum IgG4 in the diagnosis of IgG4-related disease and in differentiation from rheumatic diseases and other diseases.

    PubMed

    Yamamoto, Motohisa; Tabeya, Tetsuya; Naishiro, Yasuyoshi; Yajima, Hidetaka; Ishigami, Keisuke; Shimizu, Yui; Obara, Mikiko; Suzuki, Chisako; Yamashita, Kentaro; Yamamoto, Hiroyuki; Hayashi, Toshiaki; Sasaki, Shigeru; Sugaya, Toshiaki; Ishida, Tadao; Takano, Ken-Ichi; Himi, Tetsuo; Suzuki, Yasuo; Nishimoto, Norihiro; Honda, Saho; Takahashi, Hiroki; Imai, Kohzoh; Shinomura, Yasuhisa

    2012-06-01

    IgG4-related disease (IgG4-RD) is a novel disease entity that includes Mikulicz's disease, autoimmune pancreatitis (AIP), and many other conditions. It is characterized by elevated serum IgG4 levels and abundant IgG4-bearing plasmacyte infiltration of involved organs. We postulated that high levels of serum IgG4 would comprise a useful diagnostic tool, but little information is available about IgG4 in conditions other than IgG4-RD, including rheumatic diseases. Several reports have described cutoff values for serum IgG4 when diagnosing IgG4-RD, but these studies mostly used 135 mg/dL in AIP to differentiate from pancreatic cancer instead of rheumatic and other common diseases. There is no evidence for a cutoff serum IgG4 level of 135 mg/dL for rheumatic diseases and common diseases that are often complicated with rheumatic diseases. The aim of this work was to re-evaluate the usual cutoff serum IgG4 value in AIP (135 mg/dL) that is used to diagnose whole IgG4-RD in the setting of a rheumatic clinic by measuring serum IgG4 levels in IgG4-RD and various disorders. We therefore constructed ROC curves of serum IgG4 levels in 418 patients who attended Sapporo Medical University Hospital due to IgG4-RD and various rheumatic and common disorders. The optimal cut-off value of serum IgG4 for a diagnosis of IgG4-RD was 144 mg/dL, and the sensitivity and specificity were 95.10 and 90.76%, respectively. Levels of serum IgG4 were elevated in IgG4-RD, Churg-Strauss syndrome, multicentric Castleman's disease, eosinophilic disorders, and in some patients with rheumatoid arthritis, systemic sclerosis, chronic hepatitis, and liver cirrhosis. The usual cut-off value of 135 mg/dL in AIP is useful for diagnosing whole IgG4-RD, but high levels of serum IgG4 are sometimes observed in not only IgG4-RD but also other rheumatic and common diseases.

  18. Standard solar model. II - g-modes

    NASA Technical Reports Server (NTRS)

    Guenther, D. B.; Demarque, P.; Pinsonneault, M. H.; Kim, Y.-C.

    1992-01-01

    The paper presents the g-mode oscillation for a set of modern solar models. Each solar model is based on a single modification or improvement to the physics of a reference solar model. Improvements were made to the nuclear reaction rates, the equation of state, the opacities, and the treatment of the atmosphere. The error in the predicted g-mode periods associated with the uncertainties in the model physics is predicted and the specific sensitivities of the g-mode periods and their period spacings to the different model structures are described. In addition, these models are compared to a sample of published observations. A remarkably good agreement is found between the 'best' solar model and the observations of Hill and Gu (1990).

  19. The Earth System CoG Collaboration Environment

    NASA Astrophysics Data System (ADS)

    DeLuca, C.; Murphy, S.; Cinquini, L.; Treshansky, A.; Wallis, J. C.; Rood, R. B.; Overeem, I.

    2013-12-01

    The Earth System CoG supports collaborative Earth science research and product development in virtual organizations that span multiple projects and communities. It provides access to data, metadata, and visualization services along with tools that support open project governance, and it can be used to host individual projects or to profile projects hosted elsewhere. All projects on CoG are described using a project ontology - an organized common vocabulary - that exposes information needed for collaboration and decision-making. Projects can be linked into a network, and the underlying ontology enables consolidated views of information across the network. This access to information promotes the creation of active and knowledgeable project governance, at both individual and aggregate project levels. CoG is being used to support software development projects, model intercomparison projects, training classes, and scientific programs. Its services and ontology are customizable by project. This presentation will provide an overview of CoG, review examples of current use, and discuss how CoG can be used as knowledge and coordination hub for networks of projects in the Earth Sciences.

  20. Polymorphisms affecting the gE and gI proteins partly contribute to the virulence of a newly-emergent highly virulent Chinese pseudorabies virus.

    PubMed

    Dong, Jing; Gu, Zhenqing; Jin, Ling; Lv, Lin; Wang, Jichun; Sun, Tao; Bai, Juan; Sun, Haifeng; Wang, Xianwei; Jiang, Ping

    2018-06-01

    An outbreak of a highly virulent pseudorabies virus strain, ZJ01, occurred in PRV-vaccinated pigs in China in 2011. In this study, ZJ01 caused fatal diseases, while the Chinese prototypic PRV strain LA caused mild respiratory disorders. Full-genome sequencing results indicate the two viruses can be classified into two sub-clusters that distinct from traditional European and US strains. To examine the potential role of the gE and gI proteins in ZJ01 virulence, we generated several recombinant viruses. In two chimeric viruses (rZJ01-LA/gEI and rLA-ZJ01/gEI), the gE and gI genes were swapped using corresponding genes from ZJ01 and LA. rZJ01-LA/gEI and the parental virus rZJ01 retained high virulence in piglets, although the survival time for rZJ01-LA/gEI infected piglets was obviously prolonged. In contrast, rLA-ZJ01/gEI exhibited higher virulence than its parental virus rLA. We conclude that changes in gE and gI proteins partly contribute to the enhanced virulence of ZJ01 strain. Copyright © 2018 Elsevier Inc. All rights reserved.