Hydration mechanisms of two polymorphs of synthetic ye'elimite
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuesta, A.; Álvarez-Pinazo, G.; Sanfélix, S.G.
2014-09-15
Ye'elimite is the main phase in calcium sulfoaluminate cements and also a key phase in sulfobelite cements. However, its hydration mechanism is not well understood. Here we reported new data on the hydration behavior of ye'elimite using synchrotron and laboratory powder diffraction coupled to the Rietveld methodology. Both internal and external standard methodologies have been used to determine the overall amorphous contents. We have addressed the standard variables: water-to-ye'elimite ratio and additional sulfate sources of different solubilities. Moreover, we report a deep study of the role of the polymorphism of pure ye'elimites. The hydration behavior of orthorhombic stoichiometric and pseudo-cubicmore » solid-solution ye'elimites is discussed. In the absence of additional sulfate sources, stoichiometric-ye'elimite reacts slower than solid-solution-ye'elimite, and AFm-type phases are the main hydrated crystalline phases, as expected. Moreover, solid-solution-ye'elimite produces higher amounts of ettringite than stoichiometric-ye'elimite. However, in the presence of additional sulfates, stoichiometric-ye'elimite reacts faster than solid-solution-ye'elimite.« less
Alite-ye'elimite cement: Synthesis and mineralogical analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Suhua; Snellings, Ruben; Li, Xuerun
2013-03-15
Alite-ye'elimite cement is an alternative cement that combines desirable characteristics of calcium sulfoaluminate cements and Portland cement in that it shows improved strength development at early age while retaining high portlandite contents. The key problem in the clinkering process is to produce the alite-ye'elimite phase assemblage so that both phases can co-exist. In this study, a new synthesis method is proposed to achieve the coexistence of alite and ye'elimite consisting of a secondary heat treatment step at 1250 °C after regular Portland clinker firing at 1450 °C. Quantitative X-ray powder diffraction and electron microscopy were used to analyze the phasemore » composition of clinker before and after the secondary heat treatment. The results show that ye'elimite develops during secondary heat treatment of calcium sulphate enriched clinker by reaction of C{sub 3}A and sulphate phases. Additional ferrite is formed as result of rejection of Fe originally in solid solution with C{sub 3}A during ye'elimite formation.« less
Quantum Quench of the Sachdev-Ye-Kitaev Model
NASA Astrophysics Data System (ADS)
Steinberg, Julia; Eberlein, Andreas; Sachdev, Subir
The Sachdev-Ye-Kitaev model is a single site model containing N flavors of fermions with random infinite range interactions. It is exactly solvable in the large N limit and has an emergent reparameterization symmetry in time at low temperatures and strong coupling. This leads to many interesting properties such as locally critical behavior in correlation functions and the saturation of the chaos bound proposed .We start with the generalized Sachdev-Ye-Kitaev with quadratic and quartic interactions. This Hamiltonian has the form of a 0+1d Fermi liquid and contains long-lived quasiparticles at all values of the quadratic coupling. We quench the system into a locally critical state without quasiparticles by turning off the quadratic coupling at some initial time. We numerically study the spectral function at intermediate and long times and determine the timescale in which the system loses memory of the quasiparticles. J.S. is supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE1144152.
From climate to global change: Following the footprint of Prof. Duzheng YE's research
NASA Astrophysics Data System (ADS)
Fu, Congbin
2017-10-01
To commemorate 100 years since the birth of Professor Duzheng YE, this paper reviews the contribution of Ye and his research team to the development from climate to global change science in the past 30 or so years, including: (1) the role of climate change in global change; (2) the critical time scales and predictability of global change; (3) the sensitive regions of global change—transitional zones of climate and ecosystems; and (4) orderly human activities and adaptation to global change, with a focus on the development of a proactive strategy for adaptation to such change.
Innovative /ye/ and /we/ sequences in recent loans in Japanese
NASA Astrophysics Data System (ADS)
Vance, Timothy; Matsugu, Yuka
2005-04-01
The GV sequences /ye/ and /we/ do not occur in Japanese except perhaps in recent loans. Katakana spellings of the relevant loans in authoritative dictionaries are inconsistent, and it is not clear whether native speakers treat them as containing the GV sequences /ye/ and /we/ or as containing the VV sequences /ie/ and /ue/. Native speakers of Japanese with minimal exposure to spoken English were recorded producing some relevant loans in response to picture prompts. The same speakers were also recorded producing some native words containing uncontroversial /ie/ and /ue/ sequences. All the productions are being analyzed acoustically to determine whether they show the expected contrast between GV and VV sequences. A VV sequence is disyllabic (and bimoraic) and should therefore have greater duration and more gradual formant movements than a monosyllabic (and monomoraic) GV sequence. Utterance-initially, a VV sequence should have a LH pitch pattern and should be preceded by a nondistinctive glottal stop, whereas a GV sequence should have a H pitch pattern and should have smooth onset.
Topological Sachdev-Ye-Kitaev model
NASA Astrophysics Data System (ADS)
Zhang, Pengfei; Zhai, Hui
2018-05-01
In this Rapid Communication, we construct a large-N exactly solvable model to study the interplay between interaction and topology, by connecting the Sachdev-Ye-Kitaev (SYK) model with constant hopping. The hopping forms a band structure that can exhibit both topologically trivial and nontrivial phases. Starting from a topologically trivial insulator with zero Hall conductance, we show that the interaction can drive a phase transition to a topologically nontrivial insulator with quantized nonzero Hall conductance, and a single gapless Dirac fermion emerges when the interaction is fine tuned to the critical point. The finite temperature effect is also considered, and we show that the topological phase with a stronger interaction is less stable against temperature. Our model provides a concrete example to illustrate the interacting topological phases and phase transitions, and can shed light on similar problems in physical systems.
Liao, Wen-Jun; Chen, Wan-Wen; Wen, Zhang; Wu, Yue-Heng; Li, Dong-Feng; Zhou, Jia-Hui; Zheng, Jian-Yi; Lin, Zhan-Yi
2016-06-20
To improve Luo-Ye pump-based stress-forming system and optimize the stimulating effect on smooth muscle cells during cultivation of tissue-engineered blood vessels (TEBV). A new Luo-Ye pump-based TEBV 3D culture system was developed by adding an air pump to the output of the bioreactor. A pressure guide wire was used to measure the stress at different points of the silicone tube inside the TEBV bio-reactor, and fitting curves of the stress changes over time was created using Origin 8.0 software. The TEBVs were constructed by seeding vascular smooth muscle cells (VSMCs) isolated from human umbilical artery on polyglycolic acid (PGA) and cultured under dynamic conditions with 40 mmHg resistance (improved group), dynamic conditions without resistance (control group) or static condition (static group) for 4 weeks. The harvested TEBVs were then examined with HE staining, masson staining, α-SMA immunohistochemical staining, and scanning and transmission electron microscopy with semi-quantitative analysis of collagen content and α-SMA expression. The measured stress values and the fitting curves showed that the stress stimuli from the Luo-Ye pump were enhanced by adding an air pump to the output of the bioreactor. Histological analysis revealed improved VSMC density, collagen content and α-SMA expression in the TEBVs constructed with the improved method as compared with those in the control and static groups. Adding an air pump to the Luo-Ye pump significantly enhances the stress stimulation in the TEBV 3-D culture system to promote the secretion function of VSMCs.
Y&E Lessons in Learning: Youth and Education Program News, Summer 2003
ERIC Educational Resources Information Center
Cournoyer, David, Ed.
2003-01-01
This Summer 2003 issue of "Y&E Lessons in Learning" contains the following articles: (1) Playgrounds Where All Kids Are Able to Play; (2) Kellogg Foundation Promotes Youth Voices in Special Comic Book; (3) Families for Kids: A Powerful Approach to System Reform; (4) New Program Focuses Community Leaders on Educational Change; (5)…
Supersymmetric Sachdev-Ye-Kitaev models
Fu, Wenbo; Gaiotto, Davide; Maldacena, Juan; ...
2017-01-13
We discuss a supersymmetric generalization of the Sachdev-Ye-Kitaev (SYK) model. These are quantum mechanical models involving N Majorana fermions. The supercharge is given by a polynomial expression in terms of the Majorana fermions with random coefficients. The Hamiltonian is the square of the supercharge. The N = 1 model with a single supercharge has unbroken supersymmetry at large N , but nonperturbatively spontaneously broken supersymmetry in the exact theory. We analyze the model by looking at the large N equation, and also by performing numerical computations for small values of N . We also compute the large N spectrum ofmore » “singlet” operators, where we find a structure qualitatively similar to the ordinary SYK model. We also discuss an N = 2 version. In this case, the model preserves supersymmetry in the exact theory and we can compute a suitably weighted Witten index to count the number of ground states, which agrees with the large N computation of the entropy. In both cases, we discuss the supersymmetric generalizations of the Schwarzian action which give the dominant effects at low energies.« less
Zhou, Fujun; Walker, Sarah E.; Mitchell, Sarah F.; Lorsch, Jon R.; Hinnebusch, Alan G.
2014-01-01
eIF4B has been implicated in attachment of the 43 S preinitiation complex (PIC) to mRNAs and scanning to the start codon. We recently determined that the internal seven repeats (of ∼26 amino acids each) of Saccharomyces cerevisiae eIF4B (yeIF4B) compose the region most critically required to enhance mRNA recruitment by 43 S PICs in vitro and stimulate general translation initiation in yeast. Moreover, although the N-terminal domain (NTD) of yeIF4B contributes to these activities, the RNA recognition motif is dispensable. We have now determined that only two of the seven internal repeats are sufficient for wild-type (WT) yeIF4B function in vivo when all other domains are intact. However, three or more repeats are needed in the absence of the NTD or when the functions of eIF4F components are compromised. We corroborated these observations in the reconstituted system by demonstrating that yeIF4B variants with only one or two repeats display substantial activity in promoting mRNA recruitment by the PIC, whereas additional repeats are required at lower levels of eIF4A or when the NTD is missing. These findings indicate functional overlap among the 7-repeats and NTD domains of yeIF4B and eIF4A in mRNA recruitment. Interestingly, only three highly conserved positions in the 26-amino acid repeat are essential for function in vitro and in vivo. Finally, we identified conserved motifs in the NTD and demonstrate functional overlap of two such motifs. These results provide a comprehensive description of the critical sequence elements in yeIF4B that support eIF4F function in mRNA recruitment by the PIC. PMID:24285537
Son, J R; Liu, Y; Ma, Q N; Ju, B Z; Sun, K F; Wu, J D; Zhang, L D; Yang, G L
2017-09-28
In the Huang di nei jing ( Huangdi ' s Internal Classic ), jin ye (fluid and humor) is described in two senses, broad and narrow, though not so strictly.Sometimes, jin ye is explained ambiguously as "sweat" and "urine" , as in the phrase "the bladder, being a house of jin ye " , here " jin ye " refers to the urine. In the Qi jue lun pian of Su wen ( Chapter on Qi - Syncope of Plain Questions ) , the " bao " in the sentence "heat of bao moved to bladder" refersto the uterus. In the Shi cong rong lun pian ( Chapter of Readily Inspecting ) of Plain Questions , the "bladder" in the phrase "gallbladder, stomach, large intestine, small intestine, spleen, bao and bladder" , which, being an annotation of " bao " originally, is mistakenly incorporated into the text of the Classic . In the Wu wei lun of Ling shu ( On Five Tastes in Miraculous Pivot ) , the " bao " in " bao of bladder" refers to the external hou (external manifestation) of the bladder, that is the scrotum. In the Bei ji qian jin yao fang ( Essential Prescriptions Worth a Thousand Gold for Emergencies ) , the short sentence " pang guang zou bao " is an error in itself. In the sentence of "settled in the bao and zhi causing to dream of defecation and urination" in the Yin xie fa meng (Dreams due to Evils) of Miraculous Pivot , " bao " refers to uterus, and " zhi " to anus. In Bi lun pian ( Chapter on Impediment ) of Plain Questions , "the man suffered bao bimight feel internal pain when the lesser abdomen and bladder are pressed" , here, " bao " refers to the bladder. In the Wu yin wu wei ( Chapter on Five Sound and Five Tastes ) of Miraculous Pivot , the " bao " in the sentence "thoroughfare vessel and conception vessel all starts from bao " , again, " bao " here refers to the bladder, rather than to the uterus. From the above descriptions of "bladder" and " bao " in the Huangdi ' s Internal Classic , the "bladder" in ancient medical books refers to the substantial bladder, an anatomical organ, and " bao
Strongly Correlated Metal Built from Sachdev-Ye-Kitaev Models
NASA Astrophysics Data System (ADS)
Song, Xue-Yang; Jian, Chao-Ming; Balents, Leon
2017-11-01
Prominent systems like the high-Tc cuprates and heavy fermions display intriguing features going beyond the quasiparticle description. The Sachdev-Ye-Kitaev (SYK) model describes a (0 +1 )D quantum cluster with random all-to-all four-fermion interactions among N fermion modes which becomes exactly solvable as N →∞ , exhibiting a zero-dimensional non-Fermi-liquid with emergent conformal symmetry and complete absence of quasiparticles. Here we study a lattice of complex-fermion SYK dots with random intersite quadratic hopping. Combining the imaginary time path integral with real time path integral formulation, we obtain a heavy Fermi liquid to incoherent metal crossover in full detail, including thermodynamics, low temperature Landau quasiparticle interactions, and both electrical and thermal conductivity at all scales. We find linear in temperature resistivity in the incoherent regime, and a Lorentz ratio L ≡(κ ρ /T ) varies between two universal values as a function of temperature. Our work exemplifies an analytically controlled study of a strongly correlated metal.
Phase Diagram of Planar Matrix Quantum Mechanics, Tensor, and Sachdev-Ye-Kitaev Models.
Azeyanagi, Tatsuo; Ferrari, Frank; Massolo, Fidel I Schaposnik
2018-02-09
We study the Schwinger-Dyson equations of a fermionic planar matrix quantum mechanics [or tensor and Sachdev-Ye-Kitaev (SYK) models] at leading melonic order. We find two solutions describing a high entropy, SYK black-hole-like phase and a low entropy one with trivial IR behavior. There is a line of first order phase transitions that terminates at a new critical point. Critical exponents are nonmean field and differ on the two sides of the transition. Interesting phenomena are also found in unstable and stable bosonic models, including Kazakov critical points and inconsistency of SYK-like solutions of the IR limit.
Approximating the Sachdev-Ye-Kitaev model with Majorana wires
NASA Astrophysics Data System (ADS)
Chew, Aaron; Essin, Andrew; Alicea, Jason
The Sachdev-Ye-Kitaev (SYK) model describes a large collection of Majorana fermions coupled via random, `all-to-all' four-fermion interactions. This model enjoys broad interdisciplinary interest because it provides a solvable realization of holography in 0+1 dimensions, exhibits unusual spectral and thermodynamic properties, and shares deep connections to chaos and black holes. We propose a solid-state implementation of the SYK Hamiltonian that employs quantum dots coupled to arrays of topological superconductors hosting Majorana end-states. All-to-all four-Majorana couplings are mediated by interactions in the dot, while the randomness originates from disorder in the hoppings between the Majorana modes and dot levels. Using perturbation theory and explicit numerics, we study the properties of the dot-wire array system under various experimental conditions. Interestingly, our setup not only allows exploration of SYK physics, but also provides a controlled testbed for interaction effects on the topological classification of fermionic phases. Supported by the National Science Foundation (DMR-1341822), Institute for Quantum Information and Matter, and Walter Burke Institute at Caltech. AC gratefully acknowledges support from the Dominic Orr Fellowship.
Dispersive Sachdev-Ye-Kitaev model: Band structure and quantum chaos
NASA Astrophysics Data System (ADS)
Zhang, Pengfei
2017-11-01
The Sachdev-Ye-Kitaev (SYK) model is a concrete model for a non-Fermi liquid with maximally chaotic behavior in (0 +1 ) dimensions. In order to gain some insights into real materials in higher dimensions where fermions could hop between different sites, here we consider coupling a SYK lattice by constant hopping. We call this the dispersive SYK model. Focusing on (1 +1 ) -dimensional homogeneous hopping, by either tuning the temperature or the relative strength of the random interaction (hopping) and constant hopping, we find a crossover between a dispersive metal to an incoherent metal, where the dynamic exponent z changes from 1 to ∞ . We study the crossover by calculating the spectral function, charge density correlator, and the Lyapunov exponent. We further find the Lyapunov exponent becomes larger when the chemical potential is tuned to approach a van Hove singularity because of the large density of states near the Fermi surface. The effect of the topological nontrivial bands is also discussed.
Chen, Qi; Lei, Lei; Li, Yan; Wang, Ji-Guang
2017-10-01
The present study aimed to evaluate the accuracy of the automated oscillometric upper-arm blood pressure monitor YuWell YE690A for blood pressure measurement according to the International Protocol of the European Society of Hypertension revision 2010. Systolic and diastolic blood pressures were measured sequentially in 33 adult Chinese (12 women, 44.2 years of mean age) using a mercury sphygmomanometer (two observers) and the YE690A device (one supervisor). A total of 99 pairs of comparisons were obtained from 33 participants for judgments in two parts with three grading phases. All the blood pressure requirements were fulfilled. The YuWell YE690A device achieved the targets in part 1 of the validation study. The number of absolute differences between device and observers within 5, 10, and 15 mmHg was 79/99, 96/99, and 97/99, respectively, for systolic blood pressure and 72/99, 95/99, and 98/99, respectively, for diastolic blood pressure. The device also fulfilled the criteria in part 2 of the validation study. Thirty-one and 25 participants for systolic and diastolic blood pressure, respectively, had at least two of the three device-observer differences within 5 mmHg (required ≥24). No participant for systolic and two participants for diastolic blood pressure had all the three device-observer comparisons greater than 5 mmHg. The YuWell blood pressure monitor YE690A has passed the requirements of the International Protocol revision 2010 and hence can be recommended for blood pressure measurement in adults.
Xu, Gui-li; Li, Hong-liang; He, Jian-chang; Feng, En-fu; Shi, Pan-pan; Liu, Yue-qiong; Liu, Chang-xiao
2013-08-26
Qing Ye Dan is a well-known herbal drug that is widely used to treat viral hepatitis in the Yi and Hani minority regions in the Yunnan province of China. An LC-MS/MS method was developed to determine the levels of swertiamarin in rat plasma. Swertiamarin and naringin (internal standard, IS) were extracted from rat plasma using solid-phase extraction (SPE) to purify the samples. The pharmacokinetics of the following different administration methods of swertiamarin in rats were studied: oral administration of swertiamarin alone, a Qing Ye Dan tablet (QYDT) and co-administration of swertiamarin and oleanolic acid, with each method delivering approximately 20mg/kg of swertiamarin. Non-compartmental pharmacokinetic profiles were constructed by using the software DAS (version 2.1.1), and the pharmacokinetic parameters were compared using an unpaired Student's t-test. The results showed that the pharmacokinetic parameters Cmax, AUC0-∞, Vz/F and CLz/F were significantly different (P<0.05) among the three types of swertiamarin administration. The data indicate that oleanolic acid and the other ingredients present in QYDT could affect the pharmacokinetic behaviour of swertiamarin in rats. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Chen, Xin; Fan, Ruihua; Chen, Yiming; Zhai, Hui; Zhang, Pengfei
2017-11-17
The Sachdev-Ye-Kitaev (SYK) model is a concrete solvable model to study non-Fermi liquid properties, holographic duality, and maximally chaotic behavior. In this work, we consider a generalization of the SYK model that contains two SYK models with a different number of Majorana modes coupled by quadratic terms. This model is also solvable, and the solution shows a zero-temperature quantum phase transition between two non-Fermi liquid chaotic phases. This phase transition is driven by tuning the ratio of two mode numbers, and a nonchaotic Fermi liquid sits at the critical point with an equal number of modes. At a finite temperature, the Fermi liquid phase expands to a finite regime. More intriguingly, a different non-Fermi liquid phase emerges at a finite temperature. We characterize the phase diagram in terms of the spectral function, the Lyapunov exponent, and the entropy. Our results illustrate a concrete example of the quantum phase transition and critical behavior between two non-Fermi liquid phases.
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Tang, Yingzhan; Ling, Junhong; Zhang, Peng; Zhang, Xiangrong; Zhang, Na; Wang, Wenli; Li, Jiayuan; Li, Ning
2015-08-15
Because of platelets as critical factor in the formation of pathogenic thrombi, anti-platelet activities have been selected as therapeutic target for various circulatory diseases. In order to find potential therapeutic agents, bioassay-directed separation of Bauhinia glauca Benth.subsp. pernervosa. (called Da Ye Guan Men as a traditional Chinese medicine) was performed to get 29 main components (compounds 1-29) from the bioactive part of this herbal. It was the first time to focus on the composition with anti-platelet aggregation activities for this traditional Chinese medicine. The constituents, characterized from the effective extract, were established on the basis of extensive spectral data analysis. Then their anti-platelet aggregation effects were evaluated systematically. On the basis of the chemical profile and biological assay, it was suggested that the flavonoid composition (5 and 18) should be responsible for the anti-platelet aggregation of the herbal because of their significant activities. The primary structure and activity relationship was also discussed briefly. Copyright © 2015. Published by Elsevier Ltd.
NASA Technical Reports Server (NTRS)
Zolotukhin, V. G.; Kolosov, B. I.; Usikov, D. A.; Borisenko, V. I.; Mosin, S. T.; Gorokhov, V. N.
1980-01-01
A description of a batch of programs for the YeS-1040 computer combined into an automated system for processing photo (and video) images of the Earth's surface, taken from spacecraft, is presented. Individual programs with the detailed discussion of the algorithmic and programmatic facilities needed by the user are presented. The basic principles for assembling the system, and the control programs are included. The exchange format within whose framework the cataloging of any programs recommended for the system of processing will be activated in the future is displayed.
Universality and Thouless energy in the supersymmetric Sachdev-Ye-Kitaev model
NASA Astrophysics Data System (ADS)
García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.
2018-05-01
We investigate the supersymmetric Sachdev-Ye-Kitaev (SYK) model, N Majorana fermions with infinite range interactions in 0 +1 dimensions. We have found that, close to the ground state E ≈0 , discrete symmetries alter qualitatively the spectral properties with respect to the non-supersymmetric SYK model. The average spectral density at finite N , which we compute analytically and numerically, grows exponentially with N for E ≈0 . However the chiral condensate, which is normalized with respect the total number of eigenvalues, vanishes in the thermodynamic limit. Slightly above E ≈0 , the spectral density grows exponentially with the energy. Deep in the quantum regime, corresponding to the first O (N ) eigenvalues, the average spectral density is universal and well described by random matrix ensembles with chiral and superconducting discrete symmetries. The dynamics for E ≈0 is investigated by level fluctuations. Also in this case we find excellent agreement with the prediction of chiral and superconducting random matrix ensembles for eigenvalue separations smaller than the Thouless energy, which seems to scale linearly with N . Deviations beyond the Thouless energy, which describes how ergodicity is approached, are universally characterized by a quadratic growth of the number variance. In the time domain, we have found analytically that the spectral form factor g (t ), obtained from the connected two-level correlation function of the unfolded spectrum, decays as 1 /t2 for times shorter but comparable to the Thouless time with g (0 ) related to the coefficient of the quadratic growth of the number variance. Our results provide further support that quantum black holes are ergodic and therefore can be classified by random matrix theory.
Exact moments of the Sachdev-Ye-Kitaev model up to order 1 /N 2
NASA Astrophysics Data System (ADS)
García-García, Antonio M.; Jia, Yiyang; Verbaarschot, Jacobus J. M.
2018-04-01
We analytically evaluate the moments of the spectral density of the q-body Sachdev-Ye-Kitaev (SYK) model, and obtain order 1 /N 2 corrections for all moments, where N is the total number of Majorana fermions. To order 1 /N, moments are given by those of the weight function of the Q-Hermite polynomials. Representing Wick contractions by rooted chord diagrams, we show that the 1 /N 2 correction for each chord diagram is proportional to the number of triangular loops of the corresponding intersection graph, with an extra grading factor when q is odd. Therefore the problem of finding 1 /N 2 corrections is mapped to a triangle counting problem. Since the total number of triangles is a purely graph-theoretic property, we can compute them for the q = 1 and q = 2 SYK models, where the exact moments can be obtained analytically using other methods, and therefore we have solved the moment problem for any q to 1 /N 2 accuracy. The moments are then used to obtain the spectral density of the SYK model to order 1 /N 2. We also obtain an exact analytical result for all contraction diagrams contributing to the moments, which can be evaluated up to eighth order. This shows that the Q-Hermite approximation is accurate even for small values of N.
NASA Astrophysics Data System (ADS)
Chlachula, Jiri; Krupyanko, Alexander A.
2016-06-01
The paper presents the results of Quaternary palaeoecology and geoarchaeology studies in the Zerkal'naya Basin, with new insights about sequenced natural shifts during the prehistoric occupation of this marginally explored NE Asian maritime territory. The Basin is part of the continental drainage system and the main physiographic and biotic corridor for peopling of the transitive coastal interior SE Primor'ye Region. The Final Pleistocene and Holocene environmental (biotic and abiotic) proxy records from the Upper/Final Palaeolithic to early historical sites document a dynamic climate change with vegetation cover transformations within riverine and mountain valley ecosystems of the Russian Far East. Most of the archaeological sites located on the low terraces and bedrock promontories along the main river channel and its tributary streams suggest traditional hunter gathered lifestyles based on seasonal salmon-fishing supplemented by pastoral economy. Tundra-forests with larch trees, dwarf birch thickets and polypod ferns from the basal stratigraphic units of the late Last Glacial occupation sites associated with the Upper Palaeolithic micro-blade and bifacial stone tool traditions (14C-dated to 19,000-12,000 cal yrs BP) indicate rather pronounced conditions and much lower MAT comparing today. Following a final Pleistocene cooling event, a major climate warming marked the onset of Holocene accompanied by a regional humidity increase promoting the formation of a mixed broadleaved-coniferous oak-dominant taiga, and culminating in the mid-Holocene Climatic Optimum. The appearance of mosaic parklands ca. 5,000-4,000 cal yrs BP. may be partly attributed to the expansion of the Far Eastern Neolithic cultures practicing forest clearance for pastures and dwellings. A progressing landscape opening indicated by the spread of light-demanding thickets and birch-dominated riverine biotopes with Artemisia suggests a further vegetation cover transformation during the late Neolithic
Huang, Rong; Jiang, Bo-Guang; Li, Xiao-Nian; Wang, Ya-Ting; Liu, Si-Si; Zheng, Kai-Xuan; He, Jian; Wu, Shao-Hua
2018-02-07
Seven new polyoxygenated cyclohexenoids, namely, phomopoxides A-G (1-7), were isolated from the fermentation broth extract of an endophytic fungal strain Phomopsis sp. YE3250 from the medicinal plant Paeonia delavayi Franch. The structures of these compounds were established by spectroscopic interpretation. The absolute configurations of compounds 1 and 4 were confirmed by X-ray crystallographic analysis and chemical derivative approach. All isolated compounds showed weak cytotoxic activities toward three human tumor cell lines (Hela, MCF-7, and NCI-H460) and weak antifungal activities against five pathogenic fungi (Candida albicans, Aspergillus niger, Pyricularia oryzae, Fusarium avenaceum, and Hormodendrum compactum). In addition, compounds 1-7 showed a promising α-glycosidase inhibitory activity with IC 50 values of 1.47, 1.55, 1.83, 2.76, 2.88, 3.16, and 2.94 mM, respectively, as compared with a positive control of acarbose (IC 50 = 1.22 mM).
Geometry, Representation Theory, and the Langlands Program
2013-04-01
or the middle range of dimensions (in the non-Shimura variety case), the systems of Hecke eigenvalues that appear are all Eisenstein ...characteristic p coecients of GLn(Q) is Eisenstein . (The characteristic zero analogue follows directly from Borel’s proof of stability of cohomology with
The category MF in the semistable case
NASA Astrophysics Data System (ADS)
Faltings, G.
2016-10-01
The categories MF over discrete valuation rings were introduced by J. M. Fontaine as crystalline objects one might hope to associate with Galois representations. The definition was later extended to smooth base-schemes. Here we give a further extension to semistable schemes. As an application we show that certain Shimura varieties have semistable models.
The Shock and Vibration Digest, Volume 17, Number 9
1985-09-01
Hannover, Fed. Rep. Germany , pendent vehicle- bridge interaction forces Vol. II, pp 379-398, 6 figs, 17 refs (In has been developed in the present The...79 STRUCTURAL SYSTEMS............. 44 Ducts......................... 80 Bridges ........................ 44 Building Components........... 81...Werkzeugmaschinen, Stuttgart T. Shimura, K. Kamijo Univ., Fed. Rep. Germany National Aerospace Lab., Tokyo, Japan Rept. No. BMFT-FB-HA-183-21, 100 pp Rept. No
Bibliography of Soviet Laser Developments, Number 55. September-October 1981.
1983-01-01
Boldeskul , I.Ye., and A.Ye. Boldeskul (0). Fluorescence and resonant R-amanspctra1 probes in studies on the dynamics of biological and micellar...AKAYEV A 45 BOLDESKUL I YE 72 AKHMANOV S A 87 PAPADZHAN YE 1 79 BOLGAROV L N 11 AKHMEDZHANOV I M 24 BABARSKOV YE V 84 BOL’SHOV L A 84 AKHSAKHALYAN A D
NASA Astrophysics Data System (ADS)
Pikulin, D. I.; Franz, M.
2017-07-01
A system of Majorana zero modes with random infinite-range interactions—the Sachdev-Ye-Kitaev (SYK) model—is thought to exhibit an intriguing relation to the horizons of extremal black holes in two-dimensional anti-de Sitter space. This connection provides a rare example of holographic duality between a solvable quantum-mechanical model and dilaton gravity. Here, we propose a physical realization of the SYK model in a solid-state system. The proposed setup employs the Fu-Kane superconductor realized at the interface between a three-dimensional topological insulator and an ordinary superconductor. The requisite N Majorana zero modes are bound to a nanoscale hole fabricated in the superconductor that is threaded by N quanta of magnetic flux. We show that when the system is tuned to the surface neutrality point (i.e., chemical potential coincident with the Dirac point of the topological insulator surface state) and the hole has sufficiently irregular shape, the Majorana zero modes are described by the SYK Hamiltonian. We perform extensive numerical simulations to demonstrate that the system indeed exhibits physical properties expected of the SYK model, including thermodynamic quantities and two-point as well as four-point correlators, and discuss ways in which these can be observed experimentally.
Hear ye? Hear ye! Successful auditory aging.
Gates, G A; Rees, T S
1997-01-01
Age-related hearing loss (presbycusis) is a multifactorial process that affects nearly all people in their senior years. Most cases are due to a loss of cochlear hair cell function and are well mediated by communication courtesy and modern amplification technology. Severe hearing loss is generally due to cochlear problems or age-related diseases and may require speech reading, assistive listening devices, and cochlear implants, depending on the degree of loss. Presbycusis may seriously impair communication and contribute to isolation, depression, and possibly dementia. Accurate diagnosis and prompt remediation are widely available but are frequently underused. Geriatric health care and well-being is enhanced by the detection and remediation of communication disorders. PMID:9348755
Wu, Xinying; Gu, Ye; Li, Lun
2017-01-04
Qing Ye Dan (QYD) is the whole plant of Swertia mileensis and used in Chinese folk medicine for the treatment of prostatitis, benign prostatic hyperplasia (BPH) and so on. This study was to investigate the effects of QYD and its main component swertiamarin on BPH induced by testosterone in rats. The prostatic expressions of vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), basic fibroblast growth factor (βFGF) and proliferating cell nuclear antigen (PCNA) were detected by immunohistochemistry assay. Prostatic levels of oxidative stress and inflammatory-related factors were also analyzed. Additionally, the prostatic expressions of androgen receptor (AR), estrogen receptor (ER)-α, ER-β, hypoxia-inducible factor (HIF)-1α, B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot. The epithelial-mesenchymal transition (EMT) associated factors were evaluated by quantitative RT-PCR. It showed that QYD and swertiamarin ameliorated the testosterone-induced prostatic hyperplasia and collagen deposition, attenuated the over-expressions of HIF-1α, VEGF, EGF, βFGF, PCNA, AR and ER-α, reduced the ratio of Bcl-2/Bax, enhanced the expression of ER-β, inhibited the oxidative stress and local inflammation, as well as relieved prostatic EMT. It suggested that QYD and swertiamarin had prostatic protective potential against BPH. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment. No. 24
1976-10-18
of ribbed cylindrical envelopes with rectangular apertures. 2/2 N USSR UDC 629.78.023.015.4 IVCHENKO, YE. V., MAKEYEV , YE. M. THE STRENGTH OF A...cylindrical envelope is a semizero-moment 1/2 . 203 USSR IVCHENKO, YE. V., MAKEYEV , YE. M., VSES KONF AVTOMATIZ ISSLED NESUSHCHEY SPOSOBIOSTI I...USSR UDC 629.78.002.3.015.4 MAKEYEV , A. I., FOMICHEV, P. A., TRISHINA, L. A., KORUNA, G. S. THE PROBLEM OF NONLINEAR ADDITION OF FATIGUE DAMAGE VSES
Fate of Yersinia enterocolitica during manufacture, ripening and storage of Lighvan cheese.
Hanifian, Shahram; Khani, Sajjad
2012-05-15
This study aimed to evaluate the behavior of virulent Yersinia enterocolitica (YE) during the manufacture, ripening and storage of Lighvan cheese with particular reference to strains of YE, initial inoculation level, and storage time. Three strains of YE with low (1 log cfu/ml) and high (3 log cfu/ml) inoculation levels were inoculated to raw whole ewe's milk which was then used for manufacturing of Lighvan cheese. Throughout the manufacturing, ripening and storage periods the number of YE was counted on selective media. Enumerated colonies were then confirmed by duplex PCR using ail and virF genes. Moreover, some microbial and physiochemical characteristics of the cheese samples were examined. According to the results, initial inoculation level and storage time had statistically significant (P<0.01) effects on persistency of YE, while strain type exhibited no statistically significant (P>0.01) impact on survival of the pathogen. Results showed a rapid increase in the number of YE during manufacturing, however, in the ripening and storage periods the number of YE was decreased and eventually it was eliminated in all cheese batches after 4 months of storage. Copyright © 2012 Elsevier B.V. All rights reserved.
Mosser, Mathilde; Kapel, Romain; Chevalot, Isabelle; Olmos, Eric; Marc, Ivan; Marc, Annie; Oriol, Eric
2015-01-01
Yeast extract (YE) is known to greatly enhance mammalian cell culture performances, but its undefined composition decreases process reliability. Accordingly, in the present study, the nature of YE compounds involved in the improvement of recombinant CHO cell growth and IgG production was investigated. First, the benefits of YE were verified, revealing that it increased maximal concentrations of viable cells and IgG up to 73 and 60%, respectively compared to a reference culture. Then, the analyses of YE composition highlighted the presence of molecules such as amino acids, vitamins, salts, nucleobase, and glucose that were contained in reference medium, while others including peptides, trehalose, polysaccharides, and nucleic acids were not. Consequently, YE was fractionated by a nanofiltration process to deeper evaluate its effects on CHO cell cultures. The YE molecules already contained in reference medium were mainly isolated in the permeate fraction together with trehalose and short peptides, while other molecules were concentrated in the retentate. Permeate, which was free of macromolecules, exhibited a similar positive effect than raw YE on maximal concentrations. Additional studies on cell energetic metabolism underlined that dipeptides and tripeptides in permeate were used as an efficient source of nitrogenous substrates. © 2015 American Institute of Chemical Engineers.
Thermophilic biofiltration of benzene and toluene.
Cho, Kyung-Suk; Yoo, Sun-Kyung; Ryu, Hee Wook
2007-12-01
In the current studies, we characterized the degradation of a hot mixture of benzene and toluene (BT) gases by a thermophilic biofilter using polyurethane as packing material and high-temperature compost as a microbial source. We also examined the effect of supplementing the biofilter with yeast extract (YE). We found that YE substantially enhanced microbial activity in the thermophilic biofilter. The degrading activity of the biofilter supplied with YE was stable during long-term operation (approximately 100 d) without accumulating excess biomass. The maximum elimination capacity (1,650 g x m(-3) h(-1)) in the biofilter supplemented with YE was 3.5 times higher than that in the biofilter without YE (470 g g x m(-3) h(-1)). At similar retention times, the capacity to eliminate BT for the YE-supplemented biofilter was higher than for previously reported mesophilic biofilters. Thus, thermophilic biofiltration can be used to degrade hydrophobic compounds such as a BT mixture. Finally, 16S rDNA polymerase chain reaction-DGGE (PCR-DGGE) fingerprinting revealed that the thermophilic bacteria in the biofilter included Rubrobacter sp. and Mycobacterium sp.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew
Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less
Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; ...
2017-01-05
Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had onlymore » 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO 2).« less
Barnhart, Elliott P.; Davis, Katherine J.; Varonka, Matthew; Orem, William H.; Cunningham, Alfred B.; Ramsay, Bradley D.; Fields, Matthew W.
2017-01-01
Many coal beds contain microbial communities that can convert coal to natural gas (coalbed methane). Native microorganisms were obtained from Powder River Basin (PRB) coal seams with a diffusive microbial sampler placed downhole and used as an inoculum for enrichments with different nutrients to investigate microbially-enhanced coalbed methane production (MECoM). Coal-dependent methanogenesis more than doubled when yeast extract (YE) and several less complex components (proteins and amino acids) were added to the laboratory microcosms. Stimulated coal-dependent methanogenesis with peptone was 86% of that with YE while glutamate-stimulated activity was 65% of that with YE, and a vitamin mix had only 33% of the YE stimulated activity. For field application of MECoM, there is interest in identifying cost-effective alternatives to YE and other expensive nutrients. In laboratory studies, adding algal extract (AE) with lipids removed stimulated coal-dependent methanogenesis and the activity was 60% of that with YE at 27 d and almost 90% of YE activity at 1406 d. Analysis of British Thermal Unit (BTU) content of coal (a measure of potential energy yield) from long-term incubations indicated > 99.5% of BTU content remained after coalbed methane (CBM) stimulation with either AE or YE. Thus, the coal resource remains largely unchanged following stimulated microbial methane production. Algal CBM stimulation could lead to technologies that utilize coupled biological systems (photosynthesis and methane production) that sustainably enhance CBM production and generate algal biofuels while also sequestering carbon dioxide (CO2).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hargis, Craig W.; Kirchheim, Ana Paula; Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu
Suspensions of synthetic ye'elimite (C{sub 4}A{sub 3}S{sup ¯}) in a saturated gypsum (CS{sup ¯}H{sub 2}) and calcium hydroxide (CH) solution were examined in-situ in a wet cell by soft X-ray transmission microscopy and ex-situ by scanning electron microscopy. The most voluminous hydration product observed was ettringite. Ettringite commonly displayed acicular, filiform, reticulated, and stellate crystal habits. Additionally, pastes with C{sub 4}A{sub 3}S{sup ¯}, 15% CS{sup ¯}H{sub 2}, and varying amounts of CH were prepared and examined with X-ray diffraction (XRD) and isothermal calorimetry. The XRD experiments showed that increasing CH content caused more solid solution (SO{sub 4}{sup 2−}/OH{sup −}) AFmmore » phases to form at early ages (< 1 d) and more monosulfate to form at later ages (> 1 d). Calorimetry indicated that the increased production of solid solution AFm was accompanied with an increase in the initial (< 30 min) rate of heat evolution, and increasing CH generally reduced the time till the second maximum rate of heat evolution due to the formation of ettringite and monosulfate.« less
A de novo designed 11 kDa polypeptide: model for amyloidogenic intrinsically disordered proteins.
Topilina, Natalya I; Ermolenkov, Vladimir V; Sikirzhytski, Vitali; Higashiya, Seiichiro; Lednev, Igor K; Welch, John T
2010-07-01
A de novo polypeptide GH(6)[(GA)(3)GY(GA)(3)GE](8)GAH(6) (YE8) has a significant number of identical weakly interacting beta-strands with the turns and termini functionalized by charged amino acids to control polypeptide folding and aggregation. YE8 exists in a soluble, disordered form at neutral pH but is responsive to changes in pH and ionic strength. The evolution of YE8 secondary structure has been successfully quantified during all stages of polypeptide fibrillation by deep UV resonance Raman (DUVRR) spectroscopy combined with other morphological, structural, spectral, and tinctorial characterization. The YE8 folding kinetics at pH 3.5 are strongly dependent on polypeptide concentration with a lag phase that can be eliminated by seeding with a solution of folded fibrillar YE8. The lag phase of polypeptide folding is concentration dependent leading to the conclusion that beta-sheet folding of the 11-kDa amyloidogenic polypeptide is completely aggregation driven.
Mixed-Integer Nonconvex Quadratic Optimization Relaxations and Performance Analysis
2016-10-11
Analysis of Interior Point Algorithms for Non-Lipschitz and Nonconvex Minimization,” (W. Bian, X. Chen, and Ye), Math Programming, 149 (2015) 301-327...Chen, Ge, Wang, Ye), Math Programming, 143 (1-2) (2014) 371-383. This paper resolved an important open question in cardinality constrained...Statistical Performance, and Algorithmic Theory for Local Solutions,” (H. Liu, T. Yao, R. Li, Y. Ye) manuscript, 2nd revision in Math Programming
The Impact of Modernization on the Military Capabilities of the People’s Republic of China.
1982-04-19
pair of allies on the Standing Committee were Ye Jianying and Li Xiannian, who represented both the veteran cadres who had survived the Cultural...in October with the arrest of the four leading radical figures ("Gang of Four") in a coup lead by the Defense Minister, Marshall Ye Jianying who...Dengkui, and Wu De, from the Politburo. A new Standing Committee was constituted on which Hua Guofeng now sat in lonely isolation; Marshal Ye Jianying and
Frequency Comb Spectroscopy - From IR to XUV
2015-06-09
time resolution of 25 s. Publications: [1] A. Cingöz, Yost, D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J...J. , Eikema, K. S. E. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Full phase stabilization of a Yb:fiber femtosecond frequency comb via high...D. C. , Allison, T. K. , Ruehl, A. , Fermann, M. E. , Hartl , I. , and Ye, J. , “Direct frequency comb spectroscopy in the extreme ultraviolet”, Nature
A case-control study of Yersinia enterocolitica infections in Auckland.
Satterthwaite, P; Pritchard, K; Floyd, D; Law, B
1999-10-01
To identify major risk factors for Yersinia enterocolitica (YE) and identify measures to reduce YE infections. A prospective case control study, group age matched, using 186 cases of YE identified by community pathology laboratories and 379 randomly selected controls. Conducted between April 1995 and June 1996 in Auckland, New Zealand. Face-to-face interviews used a standardised questionnaire examining exposures to factors potentially associated with YE infections including untreated water, unreticulated sewerage, consumption of selected foods, selected food handling practices and socio-demographic factors. Multivariate logistic regression was used to calculate adjusted odds ratios for the potential risk factors. Population attributable risk (PAR) was calculated for significant exposures. Having more than two people living in the home was more common among cases than controls (OR = 2.2). Town supply water (OR = 0.2), reticulated sewerage (OR = 0.34) and looking after a young child (OR = 0.51) were significantly less common. Of the meats, only pork (OR = 1.34) had a higher consumption rate, while bacon (OR = 0.75) and smallgoods (OR = 0.73) were consumed less frequently by cases than controls. Eating food from a sandwich bar was more frequent among cases (OR = 1.18). Fruit and vegetable consumption was marginally less (OR = 0.98). The population attributable risk of these factors was 0.89, implying that 89% of YE would be eliminated if adverse exposures were removed. The risk of YE illness is increased by contact with untreated water, unreticulated sewerage and consumption of pork. Investigation of non-town water supply, informal sewerage systems and methods of preparation and consumption of pork are recommended to determine how YE enters the human food chain.
Du, Lifen; Lei, Yongfang; Chen, Jinglou; Song, Hongping; Wu, Xinying
2017-01-01
Cadmium (Cd) is an environmental pollutant with reproductive toxicity. Swertia mileensis is used in Chinese medicine for the treatment of prostatic deficits and named as Qing Ye Dan (QYD). This study was undertaken to investigate the potential protective effects of QYD against Cd-induced prostatic deficits. Rat model of prostatic deficits was induced by 0.2 mg/kg/d CdCl2 subcutaneous injection for 15 days. The prostatic oxidative stress was evaluated by detecting the levels of malondialdehyde, nitric oxide, reduced/ oxidized glutathione, total sulfhydryl groups and enzymatic antioxidant status. The prostatic inflammation was estimated by testing the levels of pro-inflammatory cytokines. The levels of epithelial-mesenchymal transition (EMT) markers E-cadherin, fibronectin, vimentin and α-smooth muscle actin were measured by qPCR analysis. Additionally, the prostatic expressions of transforming growth factor-β1 (TGF-β1), type I TGF-β receptor (TGF-βRI), Smad2, phosphorylation-Smad2 (p-Smad2), Smad3, p-Smad3, Smad7, nuclear related factor-2 (Nrf-2), heme oxygenase-1 (HO-1), B-cell CLL/lymphoma (Bcl)-2 and Bcl-2-associated X protein (Bax) were measured by western blot assay. It was found that QYD ameliorated the Cd-induced prostatic oxidative stress and inflammation, attenuated prostatic EMT, inhibited the TGF-β1/Smad pathway, increased Bcl-2/Bax ratio and enhanced the activity of Nrf-2/HO-1 pathway. These results showed that QYD could ameliorate Cd-induced prostatic deficits via modulating Nrf-2/HO-1 and TGF-β1/Smad pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.
Inhibitory Effects of Yuzu and Its Components on Human Platelet Aggregation
Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook
2015-01-01
Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion. PMID:25767683
Inhibitory effects of yuzu and its components on human platelet aggregation.
Kim, Tae-Ho; Kim, Hye-Min; Park, Se Won; Jung, Yi-Sook
2015-03-01
Our previous study demonstrated that yuzu has an anti-platelet effect in rat blood. In the present study, we examined whether the anti-platelet effect of yuzu can be extended to human blood by investigating its ability to inhibit aggregations induced by various agonists in human platelet rich plasma (PRP). This study also investigated the underlying mechanism of yuzu focusing on ADP granule secretion, TXB2 formations, and PLCγ/Akt signaling. The results from this study showed that ethanolic yuzu extract (YE), and its components, hesperidin and naringin, inhibited human platelet aggregation in a concentration-dependent manner. YE, hesperidin and naringin also inhibited TXB2 formation and ADP release. The phosphorylation of PLCγ and Akt was significantly inhibited by YE, heperidin and naringin. Furthermore, we demonstrated that YE, heperidin and naringin has anti-platelet effects in rat ex vivo studies, and lower side effects in mice tail bleeding time studies. The results from this study suggest that YE, hesperidin and naringin can inhibit human platelet aggregation, at least partly through the inhibition of PLCγ and Akt, leading to a decrease in TXB2 formation and granule secretion.
JILA BEC/Ultracold Atoms Homepage
JILA BEC & Ultracold Atoms Bose Einstein Condensate Eric Cornell Cornell Group Debbie Jin Jin Group Jun Ye Ye Group Dana Anderson Anderson Group What is BEC? Easy BEC Machine Nobel BEC BibTek Papers
Polat, Fatih; Akın, Şenol; Yıldırım, Alper; Dal, Tarık
2016-08-01
In this study, the association between heavy metals in water and cyprinids sampled from the Yeşilırmak River stretch, which is frequently exposed to pollutant sources (a sugar production factory (Turhal) and solid wastes dump area (Taşlıçiftlik) was explored, and the oxidative effects of heavy metals on cyprinids were evaluated through analyzing some liver enzymes, namely, superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA), and cortisol. The heavy metal concentrations of both fish and water, collected from three different locations along the river during the summer of 2011 and winter of 2010 (Turhal, Taşlıçiftlik, and Gümenek), were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AES). The water and fish liver heavy metal concentrations exhibited increasing trends from upstream (Gümenek) to downstream (Turhal). The water and liver samples collected during the summer had higher heavy metal concentrations than those obtained during the winter. The mean heavy metal concentrations increased from Gümenek to Turhal. The liver heavy metal concentrations were higher than those in the water and exhibited almost the same increasing trend from Gümenek to Turhal. Positive relationships between liver and water heavy metal concentrations, especially for cadmium (R 2 = 0.91) and lead (R 2 = 0.98), were obtained. Among the liver enzymes, only MDA followed the same increasing trend from Gümenek to Turhal as was obtained for heavy metals. On the other hand, CAT and SOD had a contrary spatial pattern of change to those of heavy metals and MDA. Although the values of heavy metals and MDA in Taşlıçiftlik were between the two other locations, fish inhabiting this locality had significantly higher values of cortisol, which is an indication of the other stress-causing factors for fish. © The Author(s) 2015.
Nalakath Abubackar, Haris; Veiga, María C.; Kennes, Christian
2015-01-01
The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54. PMID:25608591
Abubackar, Haris Nalakath; Veiga, María C; Kennes, Christian
2015-01-20
The effect of different sources of nitrogen as well as their concentrations on the bioconversion of carbon monoxide to metabolic products such as acetic acid and ethanol by Clostridium autoethanogenum was studied. In a first set of assays, under batch conditions, either NH4Cl, trypticase soy broth or yeast extract (YE) were used as sources of nitrogen. The use of YE was found statistically significant (p < 0.05) on the product spectrum in such batch assays. In another set of experiments, three bioreactors were operated with continuous CO supply, in order to estimate the effect of running conditions on products and biomass formation. The bioreactors were operated under different conditions, i.e., EXP1 (pH = 5.75, YE 1g/L), EXP2 (pH = 4.75, YE 1 g/L) and EXP3 (pH = 5.75, YE 0.2 g/L). When compared to EXP2 and EXP3, it was found that EXP1 yielded the maximum biomass accumulation (302.4 mg/L) and products concentrations, i.e., acetic acid (2147.1 mg/L) and ethanol (352.6 mg/L). This can be attributed to the fact that the higher pH and higher YE concentration used in EXP1 stimulated cell growth and did, consequently, also enhance metabolite production. However, when ethanol is the desired end-product, as a biofuel, the lower pH used in EXP2 was more favourable for solventogenesis and yielded the highest ethanol/acetic acid ratio, reaching a value of 0.54.
NASA Astrophysics Data System (ADS)
Laksono, A. T., Jr.; Tsai, L. L. Y., Sr.
2017-12-01
Major earthquakes had occurred in eastern Taiwan for many times. According to an Amis folklore originated in Chengkong City, there was a big sea wave struck their settlement in 1850 AD. Several studies had been conducted, however, the evidence which indicates the tsunami was very weak. There is also a possibility that big sea waves had occurred due to typhoons which take place 3-4 times a year in Taiwan. The purpose of this study is to prove the possibility of tsunami events on the eastern coast of Taiwan based on sedimentological features. The methods in this study are facies analysis including observation of the marine terrace along Lu-Ye, Changping, and Tulan, identification of lithology, sedimentary structure, and fossil content. Lithology analysis is conducted by using point counting of 12 sandstone samples from marine terrace outcrops. Based on the field observation, we found a thin sand marine deposit included in the beach gravel at a height of 10 meters at the Changping marine terrace. It contains coral and some Mollusca shells and does not display any particular sedimentary structure. Sediments that have similar characteristics were also found in the Tulan marine terrace with a height of 5 m. In addition, fossil analysis of marine sand in Tulan exhibits the presence of several planktonic foraminifera fossils such as Orbulina bilobata and Globigerinoides ruber. Temporary interpretation indicates that there is a "super" event which transports shallow marine and beach materials subsequently deposit them on top of an alluvial fan. A 10 cm thin layer of sediment serves as an early tsunami indicator. In addition, the absence of deposits with the same characteristics further indicates that the event occurred only once. Since the eastern coast of Taiwan is an uplift zone with an uplift rate between 5-8 mm/year, the estimated wave height of tsunami should take into account both the tsunami age and the uplift rate. Furthermore, based on the distance from the
O'Grady, Don; Kenny, Kevin; Power, Seamus; Egan, John; Ryan, Fergus
2016-10-01
Intestinal infection by Yersinia enterocolitica serotype O:9 (YeO9) in cattle has been linked to false positive serological reactivity (FPSR) in diagnostic tests for brucellosis. Although eradicated in Ireland, brucellosis monitoring still identifies seropositive animals, usually one or two (termed singletons) per herd, which are classed as FPSR. To investigate a link between FPSR and YeO9, faeces and blood were collected from singleton FPSR cattle, and from companion animals, in eight selected herds with more than one FPSR animal, for YeO9 culture and Brucella serology. YeO9 was isolated from 76/474 (16%) FPSR singletons in 309 herds, but not from any of 621 animals in 122 control non-FPSR herds. In the FPSR herds 52/187 (27.8%) animals were culture positive, and 17% of the isolates were from seronegative animals. Seropositive animals were more likely to have a rising antibody titre when culture positive. Copyright © 2016 Elsevier Ltd. All rights reserved.
Shen, N; Qin, Y; Wang, Q; Liao, S; Zhu, J; Zhu, Q; Mi, H; Adhikari, B; Wei, Y; Huang, R
2015-06-01
The potential of using corn steep liquor powder (CSLP), peanut meal (PM), soybean meal (SM), cotton meal (CM) and urea as the substitute of yeast extract (YE) as the nitrogen source was investigated for producing succinic acid (SA). Actinobacillus succinogenes GXAS137 was used as the fermenting bacterium and sugarcane molasses was used as the main substrate. None of these materials were able to produce SA as high as YE did. The CSLP could still be considered as a feasible and inexpensive alternate for YE as the yield of SA produced using CSLP was second only to the yield of SA obtained by YE. The use of CSLP-PM mixed formulation (CSLP to PM ratio = 2·6) as nitrogen source produced SA up to 59·2 g l(-1) with a productivity of 1·2 g l(-1) h(-1). A batch fermentation using a stirred bioreactor produced up to 60·7 g l(-1) of SA at the same formulation. Fed-batch fermentation that minimized the substrate inhibition produced 64·7 g l(-1) SA. These results suggest that sugarcane molasses supplemented with a mixture of CSLP and PM as the nitrogen source could be used to produce SA more economically using A. succinogenes. Significance and impact of the study: Succinic acid (SA) is commonly used as a platform chemical to produce a number of high value derivatives. Yeast extract (YE) is used as a nitrogen source to produce SA. The high cost of YE is currently the limiting factor for industrial production of SA. This study reports the use of a mixture of corn steep liquor powder (CSLP) and peanut meal (PM) as an inexpensive nitrogen source to substitute YE. The results showed that this CSLP-PM mixed formulation can be used as an effective and economic nitrogen source for the production of SA. © 2015 The Society for Applied Microbiology.
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.
2013-01-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192
Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E
2007-10-01
Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.
BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track
2014-11-01
BUPT_PRIS at TREC 2014 Knowledge Base Acceleration Track Yuanyuan Qi, Ye Xu, Dongxu Zhang, Weiran Xu qiyuanyuan@bupt.edu.cn,bob.ye.xu@gmail.com...Filtering for Entity Profile Updates for TREC 2013 [2]Yan Li, Zhaozhao Wang , Baojin Yu, Yong Zhang, Ruiyang Luo,Weiran Xu, Guang Chen, Jun Guo. PRIS
Ledbetter, Rhesa N; Connon, Stephanie A; Neal, Andrew L; Dohnalkova, Alice; Magnuson, Timothy S
2007-09-01
The Alvord Basin in southeast Oregon contains a variety of hydrothermal features which have never been microbiologically characterized. A sampling of Murky Pot (61 degrees C; pH 7.1) led to the isolation of a novel arsenic-metabolizing organism (YeAs) which produces an arsenic sulfide mineral known as beta-realgar, a mineral that has not previously been observed as a product of bacterial arsenic metabolism. YeAs was grown on a freshwater medium and utilized a variety of organic substrates, particularly carbohydrates and organic acids. The temperature range for growth was 37 to 75 degrees C (optimum, 55 degrees C), and the pH range for growth was 6.0 to 8.0 (optimum, pH 7.0 to 7.5). No growth was observed when YeAs was grown under aerobic conditions. The doubling time when the organism was grown with yeast extract and As(V) was 0.71 h. Microscopic examination revealed Gram stain-indeterminate, non-spore-forming, nonmotile, rod-shaped cells, with dimensions ranging from 0.1 to 0.2 microm wide by 3 to 10 microm long. Arsenic sulfide mineralization of cell walls and extracellular arsenic sulfide particulate deposition were observed with electron microscopy and elemental analysis. 16S rRNA gene analysis placed YeAs in the family Clostridiaceae and indicated that the organism is most closely related to the Caloramator and Thermobrachium species. The G+C content was 35%. YeAs showed no detectable respiratory arsenate reductase but did display significant detoxification arsenate reductase activity. The phylogenetic, physiological, and morphological characteristics of YeAs demonstrate that it is an anaerobic, moderately thermophilic, arsenic-reducing bacterium. This organism and its associated metabolism could have major implications in the search for innovative methods for arsenic waste management and in the search for novel biogenic mineral signatures.
Complexes of yeast adenylate kinase and nucleotides investigated by sup 1 H NMR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vetter, I.R.; Konrad, M.; Rosch, P.
1991-04-30
The role of one of the histidine residues present in many adenylate kinases (H36 in the porcine cytosolic enzyme) is highly disputed. The authors studied the yeast enzyme (AK{sub ye}) containing this His residue. AK{sub ye} is highly homologous to the Escherichia coli enzyme (AK{sub ec}), a protein that is already well characterized by NMR and does not contain the His residue in question. In addition, discrepancies between solution structural and X-ray crystallographic studies on the location of the nucleotide binding sites of adenylate kinases are clarified. One- and two-dimensional nuclear magnetic resonance (NMR) spectroscopy was used to investigate AK{submore » ye} and its complex with the bisubstrate analogue P{sup 1},P{sup 5}-bis(5{prime}-adenosyl)pentaphosphate (AP{sub 5}A). From these studies, all aromatic residues of AK{sub ec} involved in the binding of ATP{center dot}Mg{sup 2+} have functional analogues in AK{sub ye}. The AMP site seems to make no contacts to aromatic side chains, neither in the AK{sub ye}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} nor in the AK{sub ec}{center dot}AP{sub 5}A{center dot}Mg{sup 2+} complexes, so that it is presently not possible to localize this binding site by NMR. In combination with the recent X-ray results on the AP{sub 5}A complexes AK{sub ye} and AK{sub ec} and the GMP complex of guanylate kinase the latter one leading to the definition of the monophosphate site, the problem of the location of the nucleotide sites can be considered to be solved in a way contradicting earlier work and denying the His residue homologous to H36 in porcine adenylate kinase a direct role in substrate binding.« less
USDA-ARS?s Scientific Manuscript database
The effects of a yeast extract (YE) feed supplement and/or vitamin D3 (VD) on the bone properties of 16 wk-old turkeys, transiently subjected to a simulated stress using dexamethasone (Dex), were determined. The turkeys were fed diets with or without YE and/or VD during 6, 11, and 15 wk post hatch, ...
ERIC Educational Resources Information Center
Berty, Ernest
This publication is primarily designed for educational practitioners who possess little or no training in conducting mail surveys or have not kept current on the present state of the art of survey methods and techniques. It is also intended to be a checking and comparing aid to ensure that important research considerations are taken into account.…
JPRS Report: Proliferation Issues
1993-03-08
Mo’allem Khani -ye, approximately 150 km north of Rafsanjani’s brother-in-law and among the leaders of the Tehran. This is a base-most of it underground...the manner national Atomic Energy Agency visited Iran, its mem- in which Saddam Husayn was defeated. bers asked to visit the site at Mo’allem Khani -ye
USDA-ARS?s Scientific Manuscript database
We evaluated yeast extract (YE) and vitamin D (VD) in turkeys treated with dexamethasone (Dex) at intervals designed to simulate transport stress during a 3 stage growout. YE but not VD decreased early mortality (P = 0.001) and mortality at wk 7 (P= 0.02) and wk 12 (P = 0.002) but not wk 16. Celluli...
Miao, L; Fraefel, C; Sia, K C; Newman, J P; Mohamed-Bashir, S A; Ng, W H; Lam, P Y P
2014-01-01
Background: Emerging studies have shown the potential benefit of arming oncolytic viruses with therapeutic genes. However, most of these therapeutic genes are placed under the regulation of ubiquitous viral promoters. Our goal is to generate a safer yet potent oncolytic herpes simplex virus type-1 (HSV-1) for cancer therapy. Methods: Using bacterial artificial chromosome (BAC) recombineering, a cell cycle-regulatable luciferase transgene cassette was replaced with the infected cell protein 6 (ICP6) coding region (encoded for UL39 or large subunit of ribonucleotide reductase) of the HSV-1 genome. These recombinant viruses, YE-PC8, were further tested for its proliferation-dependent luciferase gene expression. Results: The ability of YE-PC8 to confer proliferation-dependent transgene expression was demonstrated by injecting similar amount of viruses into the tumour-bearing region of the brain and the contralateral normal brain parenchyma of the same mouse. The results showed enhanced levels of luciferase activities in the tumour region but not in the normal brain parenchyma. Similar findings were observed in YE-PC8-infected short-term human brain patient-derived glioma cells compared with normal human astrocytes. intratumoural injection of YE-PC8 viruses resulted in 77% and 80% of tumour regression in human glioma and human hepatocellular carcinoma xenografts, respectively. Conclusion: YE-PC8 viruses confer tumour selectivity in proliferating cells and may be developed further as a feasible approach to treat human cancers. PMID:24196790
Bibliography of Soviet Laser Developments, Number 79, September - October 1985.
1987-01-01
Prakticheskiye primeneniya. NSPGAN. Leningrad, Nauka, 1985, 107-116. " 470. Ashcheulov, Yu.V.; Petnikov, A.Ye.; Sukhanov , V.I. (). Stability of...YU V 64 SHTANCHAYEV M 1 21 SNEGIREV YE P 75 SUKHANOV V 1 52 SHTERN F K 77 SNITKO 0 V 4 SUKHAREV S A 35 SHTERNI3ERG A R 92 SNOPKO V N 57 SUKHAREVA L K
Smith, Esti-Andrine; Myburgh, Jacobus; Osthoff, Gernot; de Wit, Maryna
2014-11-01
Water soluble autolysate of yeast, usually utilised for microbial growth support, was used as additive in yoghurt fermentation. The yeast extract (YE) resulted in a decrease of fermentation time by 21% to reach a pH of 4·6. However, the YE resulted in unacceptable flavour and taste. By size exclusion chromatography, a fraction of the YE was obtained that could account for the observed 21% decrease in fermentation time. The fraction contained molecules of low molecular weight, consisting of minerals, free amino acids and peptides. The acceleration of the yoghurt fermentation was ascribed to the short peptides in the fraction. It is proposed that the application of this extract in industrial yoghurt manufacture would result in savings for both the industry and the consumer.
Suzuki, Hideyuki; Reddy, M S Srinivasa; Naoumkina, Marina; Aziz, Naveed; May, Gregory D; Huhman, David V; Sumner, Lloyd W; Blount, Jack W; Mendes, Pedro; Dixon, Richard A
2005-03-01
Exposure of cell suspension cultures of Medicago truncatula Gaerth. to methyl jasmonate (MeJA) resulted in up to 50-fold induction of transcripts encoding the key triterpene biosynthetic enzyme beta-amyrin synthase (betaAS; EC 5.4.99.-). Transcripts reached maximum levels at 24 h post-elicitation with 0.5 mM MeJA. The entry point enzymes into the phenylpropanoid and flavonoid pathways, L: -phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) and chalcone synthase (CHS; EC 2.3.1.74), respectively, were not induced by MeJA. In contrast, exposure of cells to yeast elicitor (YE) resulted in up to 45- and 14-fold induction of PAL and CHS transcripts, respectively, at only 2 h post-elicitation. betaAS transcripts were weakly induced at 12 h after exposure to YE. Over 30 different triterpene saponins were identified in the cultures, many of which were strongly induced by MeJA, but not by YE. In contrast, cinnamic acids, benzoic acids and isoflavone-derived compounds accumulated following exposure of cultures to YE, but few changes in phenylpropanoid levels were observed in response to MeJA. DNA microarray analysis confirmed the strong differential transcriptional re-programming of the cell cultures for multiple genes in the phenylpropanoid and triterpene pathways in response to MeJA and YE, and indicated different responses of individual members of gene families. This work establishes Medicago cell cultures as an excellent model for future genomics approaches to understand the regulation of legume secondary metabolism.
JPRS Report Science & Technology USSR: Life Sciences.
1988-07-18
SOTSIALISTICHESKAYA INDUSTRIYA, 31 Jan 87, 1 Feb 87) 79 PSYCHOLOGY Psychoprevention and Psychotherapy of Alcoholism (V.Ye. Rozhnov, M.Ye. Burno...IMMOBILIZOVANNYYE FERMENTY V MEDITSINE INOVOYE V ZHIZNI, NAUKE, TEKHNIKE: SERIYA "KRTMIYA"] , No 9, Sep 86) 3 Isolation of Cholesterol Oxidase ...No 5, Sep-Oct 86) 17 Alkylation of Benzo- and Dibenzocrown Esters With Various Alcohols (A. K. Tashmukhamedova, I. A. Stempnevskaya, et al
USSR Report, Life Sciences, Biomedical and Behavioral Sciences
1985-02-05
of the toxicity and anticholinesterase activity , of a number of organophosphorus compounds and carbamates, for females of the genus hybomitra and...house flies. Anticholinesterase activity and toxicity did not vary identically. 1842-6508] UDC: 619*616.981.42:612.017.1 ANTIGENTREACTIVE CELLS IN...Rukhlyada, M. Ye. Pillpenko; VETERINARIYA, No 8, Aug 84) 2 Toxicity and Anticholinesterase Action of Insecticides (Ye. K. Balashova, V. I
VizieR Online Data Catalog: Supernova matter EOS (Buyukcizmeci+, 2014)
NASA Astrophysics Data System (ADS)
Buyukcizmeci, N.; Botvina, A. S.; Mishustin, I. N.
2017-03-01
The Statistical Model for Supernova Matter (SMSM) was developed in Botvina & Mishustin (2004, PhLB, 584, 233 ; 2010, NuPhA, 843, 98) as a direct generalization of the Statistical Multifragmentation Model (SMM; Bondorf et al. 1995, PhR, 257, 133). We treat supernova matter as a mixture of nuclear species, electrons, and photons in statistical equilibrium. The SMSM EOS tables cover the following ranges of control parameters: 1. Temperature: T = 0.2-25 MeV; for 35 T values. 2. Electron fraction Ye: 0.02-0.56; linear mesh of Ye = 0.02, giving 28 Ye values. It is equal to the total proton fraction Xp, due to charge neutrality. 3. Baryon number density fraction {rho}/{rho}0 = (10-8-0.32), giving 31 {rho}/{rho}0 values. (2 data files).
1977-01-26
Sisteme Matematicheskogo Obespecheniya YeS EVM [ Applied Programs in the Software System for the Unified System of Computers], by A. Ye. Fateyev, A. I...computerized systems are most effective in large production complexes , in which the level of utilization of computers can be as high as 500,000...performance of these tasks could be furthered by the complex introduction of electronic computers in automated control systems. The creation of ASU
Detecting and Jamming Dynamic Communication Networks in Anti-Access Environments
2011-03-01
P.M. Pardalos, Y. Ye. and C.W. Commander (eds) V. Boginski. Sensors: Theory , Algorithms, and Applications. Springer, to appear in 2009. [21] Joseph C...Sumeetpal S. Singh. Nikolaos Kantas , Ba-Ngu Vo, Arnaud Doucet, and Robin J. Evans. Simulation-based optimal sensor scheduling with application to...observer trajectory planning. Aotomatica, 43(5):817-830, 2007. [27] Anthony Man-Cho So and Yinyu Ye. Theory of semidefinite programming for sensor network
Hear Ye, Hear Ye: A Dozen Messages from the New York Common Core Crier
ERIC Educational Resources Information Center
Jaeger, Paige
2014-01-01
In 2010, Jean Stevens from the New York State Education Department addressed a group of NY state administrators and shared, "It is no mistake that inquiry-based learning is throughout the Common Core." That was a cornerstone cry for which only school librarians knew the significance. After years of fighting for turf as a poor fief, it…
NASA Astrophysics Data System (ADS)
Pllumbi, Else; Tamborra, Irene; Wanajo, Shinya; Janka, Hans-Thomas; Hüdepohl, Lorenz
2015-08-01
Neutrino oscillations, especially to light sterile states, can affect nucleosynthesis yields because of their possible feedback effect on the electron fraction (Ye). For the first time, we perform nucleosynthesis calculations for neutrino-driven wind trajectories from the neutrino-cooling phase of an 8.8 {M}⊙ electron-capture supernova (SN), whose hydrodynamic evolution was computed in spherical symmetry with sophisticated neutrino transport and whose Ye evolution was post-processed by including neutrino oscillations between both active and active-sterile flavors. We also take into account the α-effect as well as weak magnetism and recoil corrections in the neutrino absorption and emission processes. We observe effects on the Ye evolution that depend in a subtle way on the relative radial positions of the sterile Mikheyev-Smirnov-Wolfenstein resonances, on collective flavor transformations, and on the formation of α particles. For the adopted SN progenitor, we find that neutrino oscillations, also to a sterile state with eV mass, do not significantly affect the element formation and in particular cannot make the post-explosion wind outflow neutron-rich enough to activate a strong r-process. Our conclusions become even more robust when, in order to mimic equation-of-state-dependent corrections due to nucleon potential effects in the dense-medium neutrino opacities, six cases with reduced Ye in the wind are considered. In these cases, despite the conversion of active neutrinos to sterile neutrinos, Ye increases or is not significantly lowered compared to the values obtained without oscillations and active flavor transformations. This is a consequence of a complicated interplay between sterile-neutrino production, neutrino-neutrino interactions, and α-effect.
Effects on grape amino acid concentration through foliar application of three different elicitors.
Gutiérrez-Gamboa, G; Portu, J; Santamaría, P; López, R; Garde-Cerdán, T
2017-09-01
Elicitors play an important role in the defense against pathogens as an alternative to chemical pesticides by increasing secondary metabolites. Their effect on grape amino acid has been little investigated. Thus, the aim of this research was to study the influence of methyl jasmonate (MeJ), chitosan (CHT), and a yeast extract (YE) on grape amino acid composition, through foliar applications to grapevines. The must amino acid concentration was analyzed by HPLC. The results showed that CHT and YE treatments decreased the must concentration of several amino acids, affecting total amino acid content (from 2364 to 1961, and 1818mg/L, respectively). However, MeJ treatment had a slight effect on grape amino acid content, increasing the concentration of Met (from 8.95 to 12.13mg/L) and Phe (from 7.96 to 9.29mg/L). It seems to be that, the resistance induction through CHT and YE treatments results in physiological costs to grapevines associated with a decrease on grape amino acid concentration. Consequently, MeJ applications, as a viticultural practice, could be a better tool than CHT and YE treatments, because did not affect grape amino acid concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.
The Role of the Chinese Military in National Security of Policymaking.
1996-01-01
California Press, 1992, pp. 95-124; Wei Li , The Chinese Staff System: A Mechanism for Bureaucratic Control and Integration, Berkeley: Institute of East...representatives, etc. They reportedly continue to perform these roles today. For details, see Wei Li and Lucian W. Pye, "The Ubiquitous Role of the Mishu in...strategic objectives. These included Ye Jianying , Xu Xiangqian, Nie Rongzhen, Yang Shangkun, Zhang Aiping, Yang Dezhi, Yu Qiuli, and Hong Xuezhi. Ye, Xu
Biodegradation of Polychlorinated Methanes in Methanogenic Systems
1991-01-01
occurring toxicant and C-1 growth substrate. J. General Microbiol. 132:1139-1142. 18. Hoover, S. R. and N. Porges. 1952. Assimilation of dairy wastes by...carbon and electron donor source; (3) to examine the level of micronutrients - provided as yeast extract (YE) - needed in the system feed; (4) to...provided the electron donor needed to consume oxygen and lower the redox potential in the precolumn; YE provided micronutrients . No reductant (Na2S
2007-06-29
than others. It was found that TZ-3Y-E, which is a partially stabilised zirconia powder , was particularly suitable. The percentage of ceramic powder...layered coatings The current ceramic powder that was being used was a fully stabilised zirconia powder TZ-0Y. However a readily available powder...TZ-3Y-E, partially stabilised zirconia powder , was available and utilised. These tests consisted of a combination of 3, 4 and 5 layers. In the
Nishida, Yuichiro; Adati, Naoki; Ozawa, Ritsuko; Maeda, Aasami; Sakaki, Yoshiyuki; Takeda, Tadayuki
2008-10-28
SH-SY5Y cells exhibit a neuronal phenotype when treated with all-trans retinoic acid (RA), but the molecular mechanism of activation in the signalling pathway mediated by phosphatidylinositol 3-kinase (PI3K) is unclear. To investigate this mechanism, we compared the gene expression profiles in SK-N-SH cells and two subtypes of SH-SY5Y cells (SH-SY5Y-A and SH-SY5Y-E), each of which show a different phenotype during RA-mediated differentiation. SH-SY5Y-A cells differentiated in the presence of RA, whereas RA-treated SH-SY5Y-E cells required additional treatment with brain-derived neurotrophic factor (BDNF) for full differentiation. After exposing cells to a PI3K inhibitor, LY294002, we identified 386 genes and categorised these genes into two clusters dependent on the PI3K signalling pathway during RA-mediated differentiation in SH-SY5Y-A cells. Transcriptional regulation of the gene cluster, including 158 neural genes, was greatly reduced in SK-N-SH cells and partially impaired in SH-SY5Y-E cells, which is consistent with a defect in the neuronal phenotype of these cells. Additional stimulation with BDNF induced a set of neural genes that were down-regulated in RA-treated SH-SY5Y-E cells but were abundant in differentiated SH-SY5Y-A cells. We identified gene clusters controlled by PI3K- and TRKB-mediated signalling pathways during the differentiation of two subtypes of SH-SY5Y cells. The TRKB-mediated bypass pathway compensates for impaired neural function generated by defects in several signalling pathways, including PI3K in SH-SY5Y-E cells. Our expression profiling data will be useful for further elucidation of the signal transduction-transcriptional network involving PI3K or TRKB.
Qin, Y M; Marttila, M S; Haapalainen, A M; Siivari, K M; Glumoff, T; Hiltunen, J K
1999-10-01
The yeast peroxisomal (3R)-hydroxyacyl-CoA dehydrogenase/2-enoyl-CoA hydratase 2 (multifunctional enzyme type 2; MFE-2) has two N-terminal domains belonging to the short chain alcohol dehydrogenase/reductase superfamily. To investigate the physiological roles of these domains, here called A and B, Saccharomyces cerevisiae fox-2 cells (devoid of Sc MFE-2) were taken as a model system. Gly(16) and Gly(329) of the S. cerevisiae A and B domains, corresponding to Gly(16), which is mutated in the human MFE-2 deficiency, were mutated to serine and cloned into the yeast expression plasmid pYE352. In oleic acid medium, fox-2 cells transformed with pYE352:: ScMFE-2(aDelta) and pYE352::ScMFE-2(bDelta) grew slower than cells transformed with pYE352::ScMFE-2, whereas cells transformed with pYE352::ScMFE-2(aDeltabDelta) failed to grow. Candida tropicalis MFE-2 with a deleted hydratase 2 domain (Ct MFE- 2(h2Delta)) and mutational variants of the A and B domains (Ct MFE- 2(h2DeltaaDelta), Ct MFE- 2(h2DeltabDelta), and Ct MFE- 2(h2DeltaaDeltabDelta)) were overexpressed and characterized. All proteins were dimers with similar secondary structure elements. Both wild type domains were enzymatically active, with the B domain showing the highest activity with short chain and the A domain with medium and long chain (3R)-hydroxyacyl-CoA substrates. The data show that the dehydrogenase domains of yeast MFE-2 have different substrate specificities required to allow the yeast to propagate optimally on fatty acids as the carbon source.
Effect of a six month yoga exercise intervention on fitness outcomes for breast cancer survivors
Hughes, Daniel C.; Darby, Nydia; Gonzalez, Krystle; Boggess, Terri; Morris, Ruth M.; Ramirez, Amelie G.
2016-01-01
Yoga-based exercise has proven to be beneficial for practitioners, including cancer survivors. This study reports on the improvements in physical fitness for 20 breast cancer survivors who participated in a six-month yoga-based (YE) exercise program. Results are compared to a comprehensive exercise (CE) program group and a comparison (C) exercise group who chose their own exercises. “Pre” and “post” fitness assessments included measures of anthropometrics, cardiorespiratory capacity, strength and flexibility. Descriptive statistics, effect size (d), dependent sample ‘t’ tests for all outcome measures were calculated for the YE group. Significant improvements included: decreased % body fat (−3.00%, d = −0.44, p < 0.001); increased sit to stand leg strength repetitions (2.05, d = 0.48, p = 0.003); forward reach (3.59 cm, d = 0.61, p = 0.01); and right arm sagittal range of motion (6.50°, d = 0.92, p= 0.05). To compare YE outcomes with the other two groups, a one-way analysis of variance (ANOVA) was used. YE participants significantly outperformed C participants on “forward reach” (3.59 cm gained versus −2.44 cm lost), (p = 0.009) and outperformed CE participants (3.59 cm gained versus 1.35 cm gained), but not statistically significant. Our results support yoga-based exercise modified for breast cancer survivors as safe and effective. PMID:26395825
Bibliography of Soviet Laser Developments, Number 41, May - June 1979.
1980-01-10
Andreyeva, O.V., and V.I. Sukhanov (0). Method for calculating the diffraction efficiency of holograms, allowing for the granularity of the photolayer. Sb...thick-layer holograms. Sb 14, 128-133. 315. Sukhanov , V.I., G.I. Lashkov, A.Ye. Petnikov, Yu.V. Ashcheulov, I.I. Reznikova, and A.S. Cherkasov (0... Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Recording and readout of holograms in LiNbO :Fe crystals. Sb 14, 64-72. 317. Tanin, L.V. (0
Bibliography of Soviet Laser Developments Number 53, May-June 1981.
1982-07-20
Mukhametniyazova, V.M. Sarkisova, and S. Sukhanov (55). Recrystallization of indium antimonide films. IAN Turk, no. 1, 1981, 121-124. 309. Portnova, E.G., K.K...radioholograms. Sb 15, 104-114. (RZhRadiot, 6/81, 6Ye4l0) 506. Andreyeva, O.V., and V.I. Sukhanov (0). Effect of amplitude modulation on the...5Ye356) 714. Sukhanov , I.I., and Yu.V. Troitskiy (0). Phase characteristics of multibeam interferometers. OiS, v. 50, no. 5, 1981, 952-959. 715
On multi-level thinking and scientific understanding
NASA Astrophysics Data System (ADS)
McIntyre, Michael Edgeworth
2017-10-01
Professor Duzheng YE's name has been familiar to me ever since my postdoctoral years at MIT with Professors Jule CHARNEY and Norman PHILLIPS, back in the late 1960s. I had the enormous pleasure of meeting Professor YE personally in 1992 in Beijing. His concern to promote the very best science and to use it well, and his thinking on multi-level orderly human activities, reminds me not only of the communication skills we need as scientists but also of the multi-level nature of science itself. Here I want to say something (a) about what science is; (b) about why multi-level thinking—and taking more than one viewpoint—is so important for scientific as well as for other forms of understanding; and (c) about what is meant, at a deep level, by "scientific understanding" and trying to communicate it, not only with lay persons but also across professional disciplines. I hope that Professor YE would approve.
[Preliminary study on the time of first appearance of "lanhousha" (scarlet fever)].
Yu, X
2001-04-01
There are controversies about the problem of the source of "lanhousha" (scarlet fever) in the field of modern medical history, whether it is an epidemic appeared from the ancient time in our country or imported from other countries. Now, almost all researches were carried out around the classic medical books, especially "Medical Records of Ye Tianshi", and hardly dealing it in a historical context at that time. Through contrastive analysis between the records in medical books and historical facts, it is concluded that Ye Tianshi's records of scarlet fever have nothing to do with Ye Tianshi himself, and is by author of allonym. It perhaps was exogenous cold diseases spread when a severe epidemic diseases happened at Southern Jiangsu in the 11th year of Yongzheng reign. Even though there was some scarlet fever, it was not the first spread of scarlet fever in fact. Actually, in late Kangxi reign, scarlet fever was regarded as an epidemic disease seldom seen at Southern Jiangsu.
Sikirzhytski, Vitali; Topilina, Natalya I; Takor, Gaius A; Higashiya, Seiichiro; Welch, John T; Uversky, Vladimir N; Lednev, Igor K
2012-05-14
Understanding of numerous biological functions of intrinsically disordered proteins (IDPs) is of significant interest to modern life science research. A large variety of serious debilitating diseases are associated with the malfunction of IDPs including neurodegenerative disorders and systemic amyloidosis. Here we report on the molecular mechanism of amyloid fibrillation of a model IDP (YE8) using 2D correlation deep UV resonance Raman spectroscopy. YE8 is a genetically engineered polypeptide, which is completely unordered at neutral pH yet exhibits all properties of a fibrillogenic protein at low pH. The very first step of the fibrillation process involves structural rearrangements of YE8 at the global structure level without the detectable appearance of secondary structural elements. The formation of β-sheet species follows the global structural changes and proceeds via the simultaneous formation of turns and β-strands. The kinetic mechanism revealed is an important new contribution to understanding of the general fibrillation mechanism proposed for IDP.
Bibliography of Soviet Laser Developments, Number 64, March - April 1983.
1984-03-06
140. Mirza, S.Yu. * A.N. Soldatov, and V.B. Sukhanov (0). Efficient conversion of radiation in metal vapor to tunable lasing in dyes. Sb 8, 81-107...Device for reconstructing images. Otkr izobr, no. 16, 1983, 1015508. 521. Sander, Ye.A., V.I. Sukhanov , and S.A. Shoydin (0). Study on holographic...Deposit at VINITI, no. 6231-82, 17 Dec 1982, 27 p. (RZhF, 3/83, 3D975) 556. Sukhanov , V.I., A.Ye. Petnikov, and Yu.V. Ashcheulov (0). Hologram
Barriers to Breast Cancer Screening among Latinas in the U.S.-Mexico Border Region
2011-05-01
la Salud : A breast and cervical... en in g E ve r ha d a m am m og ra m H ad a M am m og ra m w ith in th e la st 2 ye ar s H ad a m am m og ra m w ith in th e la st ye ar U na dj us...Cancer Society, Atlanta, GA 22. Fernandez ME, Gonzales A, Tortolero-Luna G et al (2009) Effectiveness of Cultivando la Salud : a breast and cervical
Kuntz, Alexander B; Chopp-Hurley, Jaclyn N; Brenneman, Elora C; Karampatos, Sarah; Wiebenga, Emily G; Adachi, Jonathan D; Noseworthy, Michael D; Maly, Monica R
2018-01-01
Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Single-blind, three-arm randomized controlled trial. Community in Southwestern Ontario, Canada. A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality of life score for YE and knee flexor strength for TE, while both also
Parameter study of r-process lanthanide production and heating rates in kilonovae
NASA Astrophysics Data System (ADS)
Lippuner, Jonas; Roberts, Luke F.
2015-04-01
Explosive r-process nucleosynthesis in material ejected during compact object mergers may lead to radioactively powered transients called kilonovae. The timescale and peak luminosity of these transients are sensitive to the composition of the material after nuclear burning ceases, as the composition determines the local heating rate from nuclear decays and the opacity. The presence of lanthanides in the ejecta can drastically increase the opacity. We use the new general-purpose nuclear reaction network SkyNet to run a parameter study of r-process nucleosynthesis for a range of initial electron fractions Ye, initial entropies s, and density decay timescales τ. We find that the ejecta is lanthanide-free for Ye >~ 0 . 22 - 0 . 3 , depending on s and τ. The heating rate is insensitive to s and τ, but certain, larger values of Ye lead to reduced heating rates, because single nuclides dominate the heating. With a simple model we estimate the luminosity, time, and effective temperature at the peak of the light curve. Since the opacity is much lower in the lanthanide-free case, we find the luminosity peaks much earlier at ~ 1 day vs. ~ 15 days in the lanthanide-rich cases. Although there is significant variation in the heating rate with Ye, changes in the heating rate do not mitigate the effect of the lanthanides. This research is partially supported by NSF under Award Numbers AST-1333520 and AST-1205732.
1988-12-01
equations, x(k+l) = A*x(k) + B*u(k) + Ko *[y(k)-C*x(k)] in which y(k) is the previous time sensor output signals. In this case, two outputs were...available to the observer, the pitch rate, and the water depth. The observer gains, Ko , may be selected by using the dual of the controller pole placement...becomes, 15 y(k) = [l;l]*ye(k) so that the gains for the two-input system become Ko = [l;l]*ke where Ke are found via pole placement using ye(k). The
Ma, Kedong; Maeda, Toshinari; You, Huiyan; Shirai, Yoshihito
2014-01-01
The development of a low-cost polymer-grade L-lactic acid production process was achieved in this study. Excess sludge hydrolyzate (ESH) was chosen as nutrient source for the objective of reducing nutrient cost in lactic acid production. 1% of ESH had high performance in lactic acid production relative to 2g/l yeast extract (YE) while the production cost of ESH was much lower than that of YE, indicating ESH was a promising substitute of YE. By employing a thermophilic strain of Bacillus coagulans (NBRC 12583), non-sterilized batch and repeated batch L-lactic acid fermentation was successfully performed, and the optical purity of L-lactic acid accumulated was more than 99%. Moreover, the factors associated with cell growth and lactic acid fermentation was investigated through a two-stage lactic acid production strategy. Oxygen played an important role in cell growth, and the optimal condition for cell growth and fermentation was pH 7.0 and 50°C. Copyright © 2013 Elsevier Ltd. All rights reserved.
Li, Xiangyu; Yu, Chao; Yao, Jianming; Wang, Zhiming; Lu, Shuhuan
2018-01-01
Mortierella alpina (M. alpina) is well known for arachidonic acid (ARA) production. However, low efficiency and unstableness are long existed problems for industrial production of ARA by M. alpina due to the lack of online regulations. The aim of the present work is to develop an online-regulation strategy for efficient and stable ARA production in industry. The strategy was developed in 50 L fermenters and then applied in a 200 m3 fermenter. Results indicated that yeast extract (YE) highly increased cell growth in shake flask, it was then used in bioreactor fermentation by various feeding strategies. Feeding YE to control respiratory quotient (RQ) at 1.1 during 0–48 h and at 1.5 during 48–160 h, dry cell weight, and ARA titer reached 53.1 and 11.49 g/L in 50 L fermenter, which were increased by 79.4 and 36.9% as compared to that without YE feeding, respectively. Then, the online RQ-feedback strategy was applied in 200 m3 bioreactor fermentation and an average ARA titer of 16.82 g/L was obtained from 12 batches, which was 41.0% higher than the control batches. This is the first report on successful application of online RQ-feedback control of YE in ARA production, especially in an industrial scale of 200 m3 fermentation. It could be applied to other industrial production of microbial oil by oleaginous microorganisms. PMID:29404320
Biophysical Characterization of Copolymer-Protected Gene Vectors (COPROGs)
Hönig, Daniel; DeRouchey, Jason; Jungmann, Ralf; Koch, Christian; Plank, Christian; Rädler, Joachim O.
2010-01-01
A copolymer-protected gene vector (COPROG) is a three component gene delivery system consisting of a preformed DNA and branched polyethylenimine (bPEI) complex subsequently modified by the addition of a copolymer (P6YE5C) incorporating both poly(ethylene glycol) (PEG) and anionic peptides. Using fluorescence correlation spectroscopy (FCS) and atomic force microscopy (AFM), we characterized and compared the self-assembly of bPEI/DNA particles and COPROG complexes. In low salt buffer, both bPEI/DNA and COPROG formulations form stable nanoparticles with hydrodynamic radii between 60–120 nm. COPROG particles, as compared to bPEI/DNA, show greatly improved particle stability to both physiological salt as well as low pH conditions. Binding stoichiometry of the three-component COPROG system was investigated by dual-color fluorescence cross-correlation spectroscopy (FCCS). It was found that a significant fraction of P6YE5C copolymer aggregates with excess bPEI forming bPEI/P6YE5C “ghost complexes” with no DNA inside. The ratio of ghost particles to COPROG complexes is about 4:1. In addition we find a large fraction of excess P6YE5C copolymer, which remains unbound in solution. We observe a 2–4 fold enhanced reporter gene expression with COPROG formulations at various equivalents as compared to bPEI-DNA alone. We believe that both complex stabilization as well as the capture of excess bPEI into ghost particles induced by the copolymer is responsible for the improvement in gene expression. PMID:20672861
Kuntz, Alexander B.; Chopp-Hurley, Jaclyn N.; Brenneman, Elora C.; Karampatos, Sarah; Wiebenga, Emily G.; Adachi, Jonathan D.; Noseworthy, Michael D.
2018-01-01
Objective Certain exercises could overload the osteoarthritic knee. We developed an exercise program from yoga postures with a minimal knee adduction moment for knee osteoarthritis. The purpose was to compare the effectiveness of this biomechanically-based yoga exercise (YE), with traditional exercise (TE), and a no-exercise attention-equivalent control (NE) for improving pain, self-reported physical function and mobility performance in women with knee osteoarthritis. Design Single-blind, three-arm randomized controlled trial. Setting Community in Southwestern Ontario, Canada. Participants A convenience sample of 31 women with symptomatic knee osteoarthritis was recruited through rheumatology, orthopaedic and physiotherapy clinics, newspapers and word-of-mouth. Interventions Participants were stratified by disease severity and randomly allocated to one of three 12-week, supervised interventions. YE included biomechanically-based yoga exercises; TE included traditional leg strengthening on machines; and NE included meditation with no exercise. Participants were asked to attend three 1-hour group classes/sessions each week. Measurements Primary outcomes were pain, self-reported physical function and mobility performance. Secondary outcomes were knee strength, depression, and health-related quality of life. All were assessed by a blinded assessor at baseline and immediately following the intervention. Results The YE group demonstrated greater improvements in KOOS pain (mean difference of 22.9 [95% CI, 6.9 to 38.8; p = 0.003]), intermittent pain (mean difference of -19.6 [95% CI, -34.8 to -4.4; p = 0.009]) and self-reported physical function (mean difference of 17.2 [95% CI, 5.2 to 29.2; p = 0.003]) compared to NE. Improvements in these outcomes were similar between YE and TE. However, TE demonstrated a greater improvement in knee flexor strength compared to YE (mean difference of 0.1 [95% CI, 0.1 to 0.2]. Improvements from baseline to follow-up were present in quality
Liu, Gao-Qiang; Wang, Xiao-Ling
2007-02-01
Response surface methodology (RSM) was applied to optimize the critical medium ingredients of Agaricus blazei. A three-level Box-Behnken factorial design was employed to determine the maximum biomass and extracellular polysaccharide (EPS) yields at optimum levels for glucose, yeast extract (YE), and peptone. A mathematical model was then developed to show the effect of each medium composition and its interactions on the production of mycelial biomass and EPS. The model predicted the maximum biomass yield of 10.86 g/l that appeared at glucose, YE, peptone of 26.3, 6.84, and 6.62 g/l, respectively, while a maximum EPS yield of 348.4 mg/l appeared at glucose, YE, peptone of 28.4, 4.96, 5.60 g/l, respectively. These predicted values were also verified by validation experiments. The excellent correlation between predicted and measured values of each model justifies the validity of both the response models. The results of bioreactor fermentation also show that the optimized culture medium enhanced both biomass (13.91 +/- 0.71 g/l) and EPS (363 +/- 4.1 mg/l) production by Agaricus blazei in a large-scale fermentation process.
Radio-Astronomical Instruments Observations (Selected Articles),
1982-08-02
NL SIIDAUG 82 L I MATVEYENKO, G S MISEZHNIKOV UNCLASSIFIED FTO_ ID(RS) -0564-82 N FTD-ID(RS) T -0564-82 FOREIGN TECHNOLOGY DIVISION RADIO-ASTRONOMICAL...INSTR1ThMNTS OBSERVATIONS (Selected Articles) 3 71982 Approved for public release; LAJ distribuion~ urJA’nited. • I . FTD- ID(RS) T -0564-82 UNEDITED... T , t * r a yy y y 7, u F, f E # Ye, ye; E, e* X x X x Kh, kh X C Zh, zn .4 u L q Ts, ts - -. Z ,. 4 f 14 Ch ,ch U 7 H u I , i w Sh, sh 2 R ia Y, y
Applications of Cavity-Enhanced Direct Frequency Comb Spectroscopy
NASA Astrophysics Data System (ADS)
Cossel, Kevin C.; Adler, Florian; Maslowski, Piotr; Ye, Jun
2010-06-01
Cavity-enhanced direct frequency comb spectroscopy (CE-DFCS) is a unique technique that provides broad bandwidth, high resolution, and ultra-high detection sensitivities. This is accomplished by combining a femtosecond laser based optical frequency comb with an enhancement cavity and a broadband, multichannel imaging system. These systems are capable of simultaneously recording many terahertz of spectral bandwidth with sub-gigahertz resolution and absorption sensitivities of 1×10-7 cm-1 Hz-1/2. In addition, the ultrashort pulses enable efficient nonlinear processes, which makes it possible to reach spectral regions that are difficult to access with conventional laser sources. We will present an application of CE-DFCS for trace impurity detection in the semiconductor processing gas arsine near 1.8 μm and the development of a high-power, mid-infrared frequency comb for breath analysis in the 2.8-4.8 μm region. M. J. Thorpe, K. D. Moll, R. J. Jones, B. Safdi, and J. Ye. Science 311, 1595-1599 (2006) F. Adler, M. J. Thorpe, K. C. Cossel, and J. Ye. Annu. Rev. Anal. Chem. 3, 175-205 (2010) F. Adler, K. C. Cossel, M. J. Thorpe, I. Hartl, M. E. Fermann, and J. Ye. Opt. Lett. 34, 1330-1332 (2009)
Identifying asteroid families >2 Gyrs-old
NASA Astrophysics Data System (ADS)
Bolin, Bryce T.; Morbidelli, Alessandro; Delbo, Marco; Walsh, Kevin J.
2017-10-01
There are only a few known Main Belt (MB) asteroid families with ages >2 Gyr. The lack of ancient families may be due to a bias in current techniques used to identify families. Ancient asteroid family fragments disperse in their orbital elements (a,e,i), due to secular resonances and the Yarkovsky effect (YE) making them difficult to identify. We have developed a new technique that is insensitive to the resonant spreading of fragments in e and i by searching for V-shaped correlations between family members in a vs 1/Diameter space. Our V-shape technique is demonstrated on known families and used to discover a 4 Gyr-old family linking most dark asteroids in the inner MB previously not included in any known family. In addition, the 4 Gyr-old family reveals asteroids with D >35 km that are do not belong to any asteroid family implying that they originally accreted from the protoplanetary disk.The V-shape detection tool is also a powerful analysis tool by finding the boundary of an asteroid family and fitting for its shape. Following the proposed relationship between thermal inertia (TI) with D, we find that asteroids YE drift rate might have a more complex size dependence than previous thought, leading to a curved family boundary in a vs 1/D space. The V-shape tool is capable of detecting this on synthetic families and was deployed on >30 families located throughout the MB to find this effect and quantify the YE size-dependent drift rate. We find that there is no correlation between family age and V-shape curvature. In addition, the V-shape curvature decreases for asteroid families with larger a suggesting that the relationship between TI and D is weaker in the outer MB.By examining families <20 Myrs-old, we can use this tool to separate family shape that is due to the initial ejection velocity and that which is due to the YE drift rate. V-shapes which do not contain any spreading due to YE preserve their initial ejection velocity. We constrain the initial initial
"Thou" and "Ye" in Chaucer's "Clerk's Tale."
ERIC Educational Resources Information Center
Wilcockson, Colin
1980-01-01
Examines the use of the second person pronoun in Chaucer's "Clerk's Tale" to demonstrate that students of medieval texts may well miss important areas of meaning if they fail to give adequate attention to the historical study of language. (GT)
Operation Allied Force: The View from Beijing
2000-01-01
should “learn and master” anti-air-raid, anti-electronic-war- fare, and anti-information-control operations.19 Information Warfare Reporter Ye Lu ...also wanted to see whether a strong stimu lus could provoke internal chaos within China that would cause a change in China’s orientation.31...Ye Lu , “Strategic Thought on Weapons Development,” Keji Ribao (Beijing), 20 May 1999, in FBIS-CHI-1999-0621; on-line, Internet, 3 July 1999
Thermal Design of Boiler Unit (Standard Method).
1980-04-29
T-0411-80" h EhlllllEI mhEhhhhh m~lEElhElllllE Elhllllllhllll llllllllmllllu llllllllhllllu "’FTD-ID(RS)T-0411-80 FOREIGN TECHNOLOGY DIVISION THERMAL...Block italic Transliter. - - A a A, a P p p p R, r S B, b C C S B V, v T m , t r g Y y SD, d SE a Ye, ye; E, e* x X x Kh, , W Zc h , z h L 4 Ti , L...sh sn arc_4n 6 ch cosh arc or -. tar. th tanh arc t- Scot zth cct arc c’- h sec Sch sech arc sc- . - o-ec csc cscn cs ch aronc sc Russian Er.I n h rot
NASA Astrophysics Data System (ADS)
Sekiguchi, Yuichiro; Kiuchi, Kenta; Kyutoku, Koutarou; Shibata, Masaru; Taniguchi, Keisuke
2016-06-01
We perform neutrino radiation-hydrodynamics simulations for the merger of asymmetric binary neutron stars in numerical relativity. Neutron stars are modeled by soft and moderately stiff finite-temperature equations of state (EOS). We find that the properties of the dynamical ejecta such as the total mass, neutron richness profile, and specific entropy profile depend on the mass ratio of the binary systems for a given EOS in a unique manner. For a soft EOS (SFHo), the total ejecta mass depends weakly on the mass ratio, but the average of electron number per baryon (Ye ) and specific entropy (s ) of the ejecta decreases significantly with the increase of the degree of mass asymmetry. For a stiff EOS (DD2), with the increase of the mass asymmetry degree, the total ejecta mass significantly increases while the average of Ye and s moderately decreases. We find again that only for the SFHo, the total ejecta mass exceeds 0.01 M⊙ irrespective of the mass ratio chosen in this paper. The ejecta have a variety of electron number per baryon with an average approximately between Ye˜0.2 and ˜0.3 irrespective of the EOS employed, which is well suited for the production of the rapid neutron capture process heavy elements (second and third peaks), although its averaged value decreases with the increase of the degree of mass asymmetry.
Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan
2016-06-23
The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.
NASA Astrophysics Data System (ADS)
Ge, Zhen-Ming; Wang, Heng; Cao, Hao-Bin; Zhao, Bin; Zhou, Xiao; Peltola, Heli; Cui, Li-Fang; Li, Xiu-Zhen; Zhang, Li-Quan
2016-06-01
The impacts of sea-level rise (SLR) on coastal ecosystems have attracted worldwide attention in relation to global change. In this study, the salt marsh model for the Yangtze Estuary (SMM-YE, developed in China) and the Sea Level Affecting Marshes Model (SLAMM, developed in the U.S.) were used to simulate the effects of SLR on the coastal salt marshes in eastern China. The changes in the dominant species in the plant community were also considered. Predictions based on the SLAMM indicated a trend of habitat degradation up to 2100; total salt marsh habitat area continued to decline (4-16%) based on the low-level scenario, with greater losses (6-25%) predicted under the high-level scenario. The SMM-YE showed that the salt marshes could be resilient to threats of SLR through the processes of accretion of mudflats, vegetation expansion and sediment trapping by plants. This model predicted that salt marsh areas increased (3-6%) under the low-level scenario. The decrease in the total habitat area with the SMM-YE under the high-level scenario was much lower than the SLAMM prediction. Nevertheless, SLR might negatively affect the salt marsh species that are not adapted to prolonged inundation. An adaptive strategy for responding to changes in sediment resources is necessary in the Yangtze Estuary.
Ma, Chunquan; Zhou, Dong; Wang, Haitao; Han, Dongming; Wang, Yang; Yan, Xiufeng
2017-01-01
Plant cell suspension cultures have emerged as a potential source of secondary metabolites for food additives and pharmaceuticals. In this study inulin accumulation and its degree of polymerisation (DP) in the treated cells in the same medium were investigated after treatment with six types of elicitors. An in vitro cell suspension culture of Jerusalem artichoke (Helianthus tuberosus L.) was optimised by adding an extra nitrogen source. According to the growth kinetics, a maximum biomass of 5.48 g L -1 was obtained from the optimal cell suspension medium consisted of Murashige and Skoog basic medium (MS) + 1.0 mg L -1 α-naphthalene acetic acid (NAA) + 1.0 mg L -1 6-benzylaminopurine (6-BA) + 0.5 mg L -1 proline + 1.0 mg L -1 glutamine. Methyl jasmonate (MeJA, 250 µmol L -1 ) treatment for 15 days led to the highest levels of inulin (2955.27 ± 9.81 mg L -1 compared to control of 1217.46 ± 0.26 mg L -1 ). The elicited effect of five elicitors to the suspension cells of Jerusalem artichoke is as follows: AgNO 3 (Ag, 10 µmol L -1 ), salicylic acid (SA, 75 µmol L -1 ), chitosan (KJT, 40 mg L -1 ), Trichoderma viride (Tv, 90 mg L -1 ), yeast extract (YE, 0.25 mg L -1 ), and the corresponding content of inulin is increased by 2.05-, 1.93-, 1.76-, 1.44- and 1.18-fold compared to control, respectively. The obvious effect on the percentage of lower DP in inulin was observed in cells treated with 40 mg L -1 KJT, 0.25 mg L -1 YE and 10 µmol L -1 Ag. Among the six types of elicitors, the descending order of inulin content is MeJA > Ag > SA > KJT > Tv > YE. For the purpose inulin with lower DP and its application to prebiotic food, three elicitors, including KJT, YE and Ag, can be used for the elicitation. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Genetics Home Reference: microphthalmia
... CR, Ye M, Garcha K, Bigot K, Perera AG, Staehling-Hampton K, Mema SC, Chanda B, Mushegian ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...
RDM Lifetime measurements in ^191Hg using the Gammasphere Plunger
NASA Astrophysics Data System (ADS)
Jin, H.; Kharraja, B.; Garg, U.; Ghugre, S. S.; Carpenter, M. P.; Fischer, S.; Janssens, R. V. F.; Khoo, T. L.; Lauritsen, T.; Nisius, D.; Kaczarowski, R.; Govil, I. M.; Kruecken, R.; Machiavelli, A.; MacLeod, R.
1998-10-01
Recoil Distance Lifetime Measurements have been performed for the nucleus ^191Hg at Gammasphere with a view to further investigate the prolate non-collective structure (ɛ2 = 0.1 - 0.15, γ ~= - 120^circ) reported several years ago by D. Ye et al. (D. Ye et al.,) Phys. Lett. B236, 7 (1990) The ^174Yb(^22Ne, 5n) reaction was employed at a beam energy of 120 MeV. In this experiment the new Gammasphere Plunger was used for the first time. Data were collected at 7 distances ranging from 50 μm to 1070 μm. The extracted lifetimes for the level sequence of interest are in the range of ~ 7 ps to 120 ps, leading to transition probabilities that indeed correspond to a non-collective nature.
Structure of a pectin methylesterase from Yersinia enterocolitica.
Boraston, Alisdair B; Abbott, D Wade
2012-02-01
Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species.
Unified planning work program federal fiscal year 2008
DOT National Transportation Integrated Search
2008-01-01
This Unified Planning Work Program (UPWP) contains information about surface-transportation planning projects that will be conducted in the Boston metropolitan region during the period of October 1, 2007, through September 30, 2008 (federal fiscal ye...
Mars Target Encyclopedia: Information Extraction for Planetary Science
NASA Astrophysics Data System (ADS)
Wagstaff, K. L.; Francis, R.; Gowda, T.; Lu, Y.; Riloff, E.; Singh, K.
2017-06-01
Mars surface targets / and published compositions / Seek and ye will find. We used text mining methods to extract information from LPSC abstracts about the composition of Mars surface targets. Users can search by element, mineral, or target.
Financial management : Federal Aviation Administration lacked accountability for major assets
DOT National Transportation Integrated Search
1998-02-18
This short report is in response to a request by the Congress that the General : Accounting Office (GAO) analyze the Department of Transportation (DOT) Inspector : General's (IG) audit report on the Federal Aviation Administration's (FAA) : fiscal ye...
In-situ early-age hydration study of sulfobelite cements by synchrotron powder diffraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Álvarez-Pinazo, G.; Cuesta, A.; García-Maté, M.
Eco-friendly belite calcium sulfoaluminate (BCSA) cement hydration behavior is not yet well understood. Here, we report an in-situ synchrotron X-ray powder diffraction study for the first hours of hydration of BCSA cements. Rietveld quantitative phase analysis has been used to establish the degree of reaction (α). The hydration of a mixture of ye'elimite and gypsum revealed that ettringite formation (α ∼ 70% at 50 h) is limited by ye'elimite dissolution. Two laboratory-prepared BCSA cements were also studied: non-active-BCSA and active-BCSA cements, with β- and α′{sub H}-belite as main phases, respectively. Ye'elimite, in the non-active-BCSA system, dissolves at higher pace (αmore » ∼ 25% at 1 h) than in the active-BCSA one (α ∼ 10% at 1 h), with differences in the crystallization of ettringite (α ∼ 30% and α ∼ 5%, respectively). This behavior has strongly affected subsequent belite and ferrite reactivities, yielding stratlingite and other layered phases in non-active-BCSA. The dissolution and crystallization processes are reported and discussed in detail. -- Highlights: •Belite calcium sulfoaluminate cements early hydration mechanism has been determined. •Belite hydration strongly depends on availability of aluminum hydroxide. •Orthorhombic ye’elimite dissolved at a higher pace than cubic one. •Ye’elimite larger reaction degree yields stratlingite formation by belite reaction. •Rietveld method quantified gypsum, anhydrite and bassanite dissolution rates.« less
Structure of a pectin methylesterase from Yersinia enterocolitica
Boraston, Alisdair B.; Abbott, D. Wade
2012-01-01
Pectin methylesterases (PMEs) are family 8 carbohydrate esterases (CE8s) which remove the methyl group from methylesterified galacturonic acid (GalA) residues within pectin. Although the role of pectinases such as PMEs within dedicated phytopathogens has been well established, the significance of homologous enzymes found within the genomes of human enteropathogens remains to be determined. Presented here is the low-resolution (3.5 Å) structure of the CE8 from Yersinia enterocolitica (YeCE8). The high degree of structural conservation in the topology of the active-site cleft and catalytic apparatus that is shared with a characterized PME from a bacterial phytopathogen (i) indicates that YeCE8 is active on methylated pectin and (ii) highlights a more prominent role for pectin utilization in Yersinia than in other enteropathogenic species. PMID:22297983
FY 72 Computer Utilization at the Transportation Systems Center
DOT National Transportation Integrated Search
1972-08-01
The Transportation Systems Center currently employs a medley of on-site and off-site computer systems to obtain the computational support it requires. Examination of the monthly User Accountability Reports for FY72 indicated that during the fiscal ye...
Climate change, land use and socioeconomic developments are principal variables that define the need and scope of adaptive engineering and management to sustain water resource and infrastructure development. As described in IPCC (2007), hydroclimatic changes in the next 30-50 ye...
DOT National Transportation Integrated Search
2013-12-01
Accommodating left turns at signalized intersections has been a challenge for traffic engineers as they : seek balance between two conflicting goals; capacity and safety. The use of a four-section head for the left-turn : lane only with a flashing ye...
ERIC Educational Resources Information Center
Rothenberg, Julia Johnson
This paper reports on the author's 4-week consultation with faculty of the Lesotho National Teachers College as part of the Primary Education Project which provided technical assistance with issues of primary age schooling in the Kingdom of Lesotho. The consultant worked with 12 faculty members of the National Teachers College in a process that…
NASA Astrophysics Data System (ADS)
Winteler, Christian
2014-02-01
In this dissertation we present the main features of a new nuclear reaction network evolution code. This new code allows nucleosynthesis calculations for large numbers of nuclides. The main results in this dissertation are all obtained using this new code. The strength of standard big bang nucleosynthesis is, that all primordial abundances are determined by only one free parameter, the baryon-to-photon ratio η. We perform self consistent nucleosynthesis calculations for the latest WMAP value η = (6.16±0.15)×10^-10 . We predict primordial light element abundances: D/H = (2.84 ± 0.23)×10^-5, 3He/H = (1.07 ± 0.09)×10^-5, Yp = 0.2490±0.0005 and 7Li/H = (4.57 ± 0.55)×10^-10, in agreement with current observations and other predictions. We investigate the influence of the main production rate on the 6 Li abundance, but find no significant increase of the predicted value, which is known to be orders of magnitude lower than the observed. The r-process is responsible for the formation of about half of the elements heavier than iron in our solar system. This neutron capture process requires explosive environments with large neutron densities. The exact astrophysical site where the r-process occurs has not yet been identified. We explore jets from magnetorotational core collapse supernovae (MHD jets) as possible r-process site. In a parametric study, assuming adiabatic expansion, we find good agreement with solar system abundances for a superposition of components with different electron fraction (Ye ), ranging from Ye = 0.1 to Ye = 0.3. Fission is found to be important only for Ye ≤ 0.17. The first postprocessing calculations with data from 3D MHD core collapse supernova simulations are performed for two different simulations. Calculations are based on two different methods to extract data from the simulation: tracer particles and a two dimensional, mass weighted histogram. Both results yield almost identical results. We find that both simulations can
Pedestrian accidents : a state-of-the-art 1970-1980
DOT National Transportation Integrated Search
1981-09-01
In 1979 in the United States, 8,090 pedestrians were killed in motor vehicle accidents out of a total of 51,093 total traffic fatalities. An estimated total of 150,000 police reported pedestrian accidents of all severities occurred during the same ye...
Summary of nighttime belt use studies
DOT National Transportation Integrated Search
2007-05-01
Despite gains in the daytime national seat belt rate over the past few years, reaching 81 percent in 2006 (Glassbrenner and Ye, 2007), the number of fatalities has remained basically unchanged. One reason for this may be that many fatalities occur at...
Targeting Environmental Quality to Improve Population Health and Lower Healthcare Costs
Key goals of health care reform are to stimulate innovative approaches to improve healthcare quality and clinical outcomes while holding down costs. To achieve these goals value-based payment places the needs of the patient first and encourages multi-stakeholder cooperation. Ye...
Karhukorpi, Jari; Päivänurmi, Marjut
2014-01-01
Aesculin hydrolysis (ESC) is one of the key reactions in differentiating pathogenic Yersinia enterocolitica biotypes 1B, 2, 3, 4 and 5 from the less-pathogenic biotype 1A. Because the ESC reaction is caused by β-glucosidase (βGLU) activity of the bacteria, we studied whether two commonly used methods (BBL CHROMagar Orientation and Vitek2 Gram-negative identification card) could be used in assessing βGLU activity of 74 Yersinia strains. Both methods were sensitive (100 % and 97 %) and specific (100 % and 100 %) in differentiating βGLU-positive YE BT1A from βGLU-negative Y. enterocolitica biotypes. For a subset of strains (n = 69), a new selective CHROMagar Yersinia showed excellent agreement with the strains' βGLU activity. Thus all the methods evaluated in this study may be used to differentiate between YE BT1A and other Y. enterocolitica biotypes.
Gürsel, B; Gürakan, G C
1997-12-01
Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d.
Fibre fortification of wheat bread: impact on mineral composition and bioaccessibility.
Martins, Zita E; Pinto, Edgar; Almeida, Agostinho A; Pinho, Olívia; Ferreira, Isabel M P L V O
2017-05-24
In this work, wheat bread was fortified with fibre enriched extracts recovered from agroindustry by-products, namely, elderberry skin, pulp and seeds (EE); orange peel (OE); pomegranate peel and interior membranes (PE); and spent yeast (YE). The impact of this fortification on the total and bioaccessible mineral composition of wheat breads, estimated mineral daily intake, and the relationship between bioaccessibility and dietary fibre was evaluated. Fortification with OE, EE, and PE improved the content of essential minerals in bread when compared to control bread. The exception was bread fortified with YE, which presented a mineral content similar to control bread, but its mineral bioaccessibility was significantly higher than in all the other bread formulations. The opposite was observed for PE bread, which presented a significant reduction of bioaccessible minerals. We concluded that the origin of the fibre rich extract must be carefully selected, to avoid potential negative impact on mineral bioaccessibility.
Identification of odor volatile compounds and deodorization of Paphia undulata enzymatic hydrolysate
NASA Astrophysics Data System (ADS)
Chen, Deke; Chen, Xin; Chen, Hua; Cai, Bingna; Wan, Peng; Zhu, Xiaolian; Sun, Han; Sun, Huili; Pan, Jianyu
2016-12-01
Unfavorable fishy odour is an inevitable problem in aquatic products. In the present study, headspace solid-phase microextraction gas chromatography mass spectrometry (HS-SPME-GC-MS) analysis of volatiles from untreated samples and three deodorized samples (under the optimal conditions) of Paphia undulata enzymatic hydrolysate revealed that the compounds contributing to the distinctive odor were 1-octen-3-ol, n-hexanal, n-heptanal, 2,4-heptadienal, and 2,4-decadienal, whereas n-pentanal, n-octanal, n-octanol, benzaldehyde, 2-ethylfuran and 2-pentylfuran were the main contributors to the aromatic flavor. The deodorizing effects of activated carbon (AC) adsorption, yeast extract (YE) masking and tea polyphenol (TP) treatment on a P. undulata enzymatic hydrolysate were investigated using orthogonal experiments with sensory evaluation as the index. The following optimized deodorization conditions were obtained: AC adsorption (35 mg mL-1, 80°C, 40 min), YE masking (7 mg mL-1, 45°C, 30 min) and TP treatment (0.4 mg mL-1, 40°C, 50 min). AC adsorption effectively removed off-flavor volatile aldehydes and ketones. YE masking modified the odor profile by increasing the relative contents of aromatic compounds and decreasing the relative contents of aldehydes and ketones. The TP treatment was not effective in reducing the odor score, but it significantly reduced the relative content of aldehydes while increasing that of alkanes. It is also notable that TP effectively suppressed trimethylamine (TMA) formation in a P. undulate hydrolysate solution for a period of 72 h.
STUDIES ON ADSORPTION OF 2-CHLORO BIPHENYL ON SEDIMENTS AND SEDIMENT COMPONENTS
Polychlorinated biphenyls, or PCBs, are a family of 209 structurally related chemical compounds (congeners), consisting of two benzene rings and 1 to 10 chlorine atoms. They range from light, oily fluids to heavier, greasy or waxy substances. PCBs were discovered more than 100 ye...
DOT National Transportation Integrated Search
2000-04-01
Approximately 500 million tons of hot mix asphalt (HMA) are placed in the United States each year. With this large quantity of HMA, it is expected that some construction problems will occur from time to time. One problem that has been observed for ye...
USDA-ARS?s Scientific Manuscript database
Heat stress (HS) in feedlot cattle can be detrimental to performance, health and profitability; however, utilization of feed additives has the potential to mitigate some of these negative effects. Therefore, this study was designed to determine if supplementation of a combination live yeast and ye...
2003 traffic crash facts annual report
DOT National Transportation Integrated Search
2003-01-01
In 2003, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 : to 2003 is represented in Figure 1 (Page 2). Even though the death rate : fluctuates from year to ye...
Yeasts as distinct life forms of fungi
USDA-ARS?s Scientific Manuscript database
This review describes all presently recognized genera of the Ascomycete yeasts (Saccharomycotina, budding yeasts, and the Taphrinomycotina, fission yeasts and related) as well as all currently recognized genera of the Basidiomycete yeasts. This update will be the lead chapter for a book entitled “Ye...
2001 traffic crash facts annual report
DOT National Transportation Integrated Search
2001-01-01
In 2001, the death rate on Nebraska roadways was 1.6 persons killed per : 100 million vehicle miles traveled. The death rate in Nebraska, from 1961 to : 2001 is represented in Figure 1 (Page 2). Even though the death rate fluctuates : from year to ye...
USDA-ARS?s Scientific Manuscript database
The Formosan subterranean termite, Coptotermes formosanus Shiraki (FST) was first introduced to the continental US after WWII. New Orleans’ French Quarter (FQ) in particular has been severely impacted experiencing reoccurring cycles of damages and repairs since FST was introduced to the region 65 ye...
Plant maintenance and advanced reactors issue, 2008
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agnihotri, Newal
The focus of the September-October issue is on plant maintenance and advanced reactors. Major articles/reports in this issue include: Technologies of national importance, by Tsutomu Ohkubo, Japan Atomic Energy Agency, Japan; Modeling and simulation advances brighten future nuclear power, by Hussein Khalil, Argonne National Laboratory, Energy and desalination projects, by Ratan Kumar Sinha, Bhabha Atomic Research Centre, India; A plant with simplified design, by John Higgins, GE Hitachi Nuclear Energy; A forward thinking design, by Ray Ganthner, AREVA; A passively safe design, by Ed Cummins, Westinghouse Electric Company; A market-ready design, by Ken Petrunik, Atomic Energy of Canada Limited, Canada;more » Generation IV Advanced Nuclear Energy Systems, by Jacques Bouchard, French Commissariat a l'Energie Atomique, France, and Ralph Bennett, Idaho National Laboratory; Innovative reactor designs, a report by IAEA, Vienna, Austria; Guidance for new vendors, by John Nakoski, U.S. Nuclear Regulatory Commission; Road map for future energy, by John Cleveland, International Atomic Energy Agency, Vienna, Austria; and, Vermont's largest source of electricity, by Tyler Lamberts, Entergy Nuclear Operations, Inc. The Industry Innovation article is titled Intelligent monitoring technology, by Chris Demars, Exelon Nuclear.« less
ERIC Educational Resources Information Center
McVeigh, Francis
2014-01-01
Purpose - This research project has investigated the "Company Programme" of the charity YE and how effective it is at increasing Life Skills in young people. Data has been obtained using student questionnaires and teacher interviews. Previous studies have been completed on "Life Skills" and "Enterprise Programmes",…
1984-09-01
time ;oent ikontcorvng, enforcing. and rs,) lving *Lfitculties ind discrepancies inouLd ilso ye Lncluded. time 131 5. 9required to houdjet or:74rias...OH: Grid Publishers, 1979. 21. McNichols, Charles W. An Introduction to Applied Mltivariate Data Analysis, Unpublished Notes. Air Force Institute of
1998-09-01
lymphogranuloma venereum (LGV). .?.■ Methods: One hundred and ninety seven consecutive men with a clinical presentation coasUtent with IJGV were...REACTION FOR THE DIAGNOSIS OF \\J 1 / Z> LYMPIIOGRANULOMA VENEREUM IN SOUTHERN AFRICA. Radebc F. Fehler HG, Ye Hrun. Tshabalala V, Ballard RC j V
Mustard seed meal for management of root-knot nematode and weeds in tomato production
USDA-ARS?s Scientific Manuscript database
Mustard seed meals of indian mustard [InM (Brassica juncea)] and yellow mustard [YeM (Sinapis alba)], alone and combined, were tested for effects on tomato (Solanum lycopersicum) plants and for suppression of southern root-knot nematode [RKN (Meloidogyne incognita)] and weed populations. In the gree...
ERIC Educational Resources Information Center
McElravy, L. J.; Matkin, Gina; Hastings, Lindsay J.
2018-01-01
Although service-learning increases several important development and learning outcomes in college students (Yorio & Ye, 2012), it is not clear whether service-learning is better preparing these students for their future careers (Gray, Ondaatje, Fricker, & Geschwind, 2000). To better understand the influence of service-learning on student…
Genetic diversity and paternal origin of domestic donkeys.
Han, H; Chen, N; Jordana, J; Li, C; Sun, T; Xia, X; Zhao, X; Ji, C; Shen, S; Yu, J; Ainhoa, F; Chen, H; Lei, C; Dang, R
2017-12-01
Numerous studies have been conducted to investigate genetic diversity, origins and domestication of donkey using autosomal microsatellites and the mitochondrial genome, whereas the male-specific region of the Y chromosome of modern donkeys is largely uncharacterized. In the current study, 14 published equine Y chromosome-specific microsatellites (Y-STR) were investigated in 395 male donkey samples from China, Egypt, Spain and Peru using fluorescent labeled microsatellite markers. The results showed that seven Y-STRs-EcaYP9, EcaYM2, EcaYE2, EcaYE3, EcaYNO1, EcaYNO2 and EcaYNO4-were male specific and polymorphic, showing two to eight alleles in the donkeys studied. A total of 21 haplotypes corresponding to three haplogroups were identified, indicating three independent patrilines in domestic donkey. These markers are useful for the study the Y-chromosome diversity and population genetics of donkeys in Africa, Europe, South America and China. © 2017 Stichting International Foundation for Animal Genetics.
Effect of Sediment Gas Voids and Ebullition on Benthic Solute Exchange.
Flury, Sabine; Glud, Ronnie N; Premke, Katrin; McGinnis, Daniel F
2015-09-01
The presence of free gas in sediments and ebullition events can enhance the pore water transport and solute exchange across the sediment-water interface. However, we experimentally and theoretically document that the presence of free gas in sediments can counteract this enhancement effect. The apparent diffusivities (Da) of Rhodamine WT and bromide in sediments containing 8-18% gas (Da,YE) were suppressed by 7-39% compared to the control (no gas) sediments (Da,C). The measured ratios of Da,YE:Da,C were well within the range of ratios predicted by a theoretical soil model for gas-bearing soils. Whereas gas voids in sediments reduce the Da for soluble species, they represent a shortcut for low-soluble species such as methane and oxygen. Therefore, the presence of even minor amounts of gas can increase the fluxes of low-soluble species (i.e., gases) by several factors, while simultaneously suppressing fluxes of dissolved species.
2008-10-31
Navigation Services Working Group Jan de Regt FAA Tony Richardson JPDO Technical Support James Roberts DoD AFFSA Eric Rolfe JPDO Air Navigation...Kirsch DHS Drew Kuepper DoD eragency Architecture and Engineering Division Jay Merkle JPDO Int Paul Polski DHS ing GroupElizabeth Lynn ye JPDO Air
USDA-ARS?s Scientific Manuscript database
A laboratory colony of Coleomegilla maculata (DeGeer), ye, selected for a pigmentation deficiency, was restored to near wild type cuticle coloration by adding crushed heads and wings of the red colored parental strain to the diet. While the wings and other colored portions of the cuticle regained th...
Intensifying drought eliminates the expected benefits of elevated [CO2] for soybean
USDA-ARS?s Scientific Manuscript database
Stimulation of C3 crop yield by rising [CO2] is widely expected to counteract crop losses to greater drought this century. But these expectations come from sparse field trials that have been biased towards mesic growth conditions. This eight-year study used precipitation manipulations and year-to-ye...
USSR Report Engineering and Equipment.
1987-05-04
Korenev , et al. ; ENERGETICHESKOYE STROITELSTVO, No 7, Jul 86) 33 Improving Fire Protection of Cables in Electric Power Plants (S.Ye. Korshunov...Russian No 7, Jul 86 pp 32-33 {Article by V.D. Likhachev, candidate of technical sciences, K.I. Korenev , candidate of technical sciences, K.I. Chikvaidze
Carbon dynamics and sequestration in urban turfgrass ecosystems
USDA-ARS?s Scientific Manuscript database
Urbanization is a global trend. Turfgrass covers 1.9% of land in the continental US. Here we review existing literature associated with carbon (C) pools, sequestration, and nitrous oxide emission of urban turfgrass ecosystems. Turfgrasses exhibit significant carbon sequestration (0.34–1.4 Mg ha-1 ye...
MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin
2016-01-01
In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case–control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85–123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. PMID:27588690
MacDonald, Emily; Einöder-Moreno, Margot; Borgen, Katrine; Thorstensen Brandal, Lin; Diab, Lore; Fossli, Øivind; Guzman Herrador, Bernardo; Hassan, Ammar Ali; Johannessen, Gro S; Johansen, Eva Jeanette; Jørgensen Kimo, Roger; Lier, Tore; Paulsen, Bjørn Leif; Popescu, Rodica; Tokle Schytte, Charlotte; Sæbø Pettersen, Kristin; Vold, Line; Ørmen, Øyvind; Wester, Astrid Louise; Wiklund, Marit; Nygård, Karin
2016-08-25
In May 2014, a cluster of Yersinia enterocolitica (YE) O9 infections was reported from a military base in northern Norway. Concurrently, an increase in YE infections in civilians was observed in the Norwegian Surveillance System for Communicable Diseases. We investigated to ascertain the extent of the outbreak and identify the source in order to implement control measures. A case was defined as a person with laboratory-confirmed YE O9 infection with the outbreak multilocus variable-number tandem repeat analysis (MLVA)-profile (5-6-9-8-9-9). We conducted a case-control study in the military setting and calculated odds ratios (OR) using logistic regression. Traceback investigations were conducted to identify common suppliers and products in commercial kitchens frequented by cases. By 28 May, we identified 133 cases, of which 117 were linked to four military bases and 16 were civilians from geographically dispersed counties. Among foods consumed by cases, multivariable analysis pointed to mixed salad as a potential source of illness (OR 10.26; 95% confidence interval (CI): 0.85-123.57). The four military bases and cafeterias visited by 14/16 civilian cases received iceberg lettuce or radicchio rosso from the same supplier. Secondary transmission cannot be eliminated as a source of infection in the military camps. The most likely source of the outbreak was salad mix containing imported radicchio rosso, due to its long shelf life. This outbreak is a reminder that fresh produce should not be discounted as a vehicle in prolonged outbreaks and that improvements are still required in the production and processing of fresh salad products. This article is copyright of The Authors, 2016.
A study of in-situ sediment flocculation in the turbidity maxima of the Yangtze Estuary
NASA Astrophysics Data System (ADS)
Guo, Chao; He, Qing; Guo, Leicheng; Winterwerp, Johan C.
2017-05-01
In order to improve our understandings of temporal and vertical variations of sediment flocculation dynamics within the turbidity maxima (TM) of the highly turbid Yangtze Estuary (YE), we deployed LISST-100C, a laser instrument for in-situ monitor of the sizes and concentrations of flocculated particles in a wet season. Field data in terms of vertical profiles of flow velocity, suspended sediment concentration (SSC), salinity, flocculated particle size distribution and volume concentration were obtained, based on field works conducted at consecutive spring, moderate, and neap tides. Data analyses show that the mean floc diameters (DM) were in the range of 14-95 μm, and flocculation exhibited strong temporal and vertical variations within a tidal cycle and between spring-neap cycles. Larger DM were observed during high and low slack waters, and the averaged floc size at neap tide was found 57% larger than at spring tide. Effective density of flocs decreased with the increase of floc size, and fractal dimension of flocs in the YE was mainly between 1.5 and 2.1. We also estimated the settling velocity of flocs by 0.04-0.6 mm s-1 and the largest settling velocity occurred also at slack waters. Moreover, it is found that turbulence plays a dominant role in the flocculation process. Floc size decreases significantly when the shear rate parameter G is > 2-3 s-1, suggesting the turbulence breaking force. Combined effects of fine sediment flocculation, enhanced settling process, and high sediment concentration resulted in a large settling flux around high water, which can in part explain the severe siltation in the TM of the YE, thus shedding lights on the navigation channel management.
Post-merger evolution of a neutron star-black hole binary with neutrino transport
NASA Astrophysics Data System (ADS)
Foucart, Francois; O'Connor, Evan; Roberts, Luke; Duez, Matthew D.; Haas, Roland; Kidder, Lawrence E.; Ott, Christian D.; Pfeiffer, Harald P.; Scheel, Mark A.; Szilagyi, Bela
2015-06-01
We present a first simulation of the post-merger evolution of a black hole-neutron star binary in full general relativity using an energy-integrated general-relativistic truncated moment formalism for neutrino transport. We describe our implementation of the moment formalism and important tests of our code, before studying the formation phase of an accretion disk after a black hole-neutron star merger. We use as initial data an existing general-relativistic simulation of the merger of a neutron star of mass 1.4 M⊙ with a black hole of mass 7 M⊙ and dimensionless spin χBH=0.8 . Comparing with a simpler leakage scheme for the treatment of the neutrinos, we find noticeable differences in the neutron-to-proton ratio in and around the disk, and in the neutrino luminosity. We find that the electron neutrino luminosity is much lower in the transport simulations, and that both the disk and the disk outflows are less neutron rich. The spatial distribution of the neutrinos is significantly affected by relativistic effects, due to large velocities and curvature in the regions of strongest emission. Over the short time scale evolved, we do not observe purely neutrino-driven outflows. However, a small amount of material (3 ×10-4M⊙ ) is ejected in the polar region during the circularization of the disk. Most of that material is ejected early in the formation of the disk, and is fairly neutron rich (electron fraction Ye˜0.15 - 0.25 ). Through r-process nucleosynthesis, that material should produce high-opacity lanthanides in the polar region, and could thus affect the light curve of radioactively powered electromagnetic transients. We also show that by the end of the simulation, while the bulk of the disk remains neutron rich (Ye˜0.15 - 0.2 and decreasing), its outer layers have a higher electron fraction: 10% of the remaining mass has Ye>0.3 . As that material would be the first to be unbound by disk outflows on longer time scales, and as composition evolution is
Q'epethet ye Mestiyexw, A Gathering of the People.
ERIC Educational Resources Information Center
Kenny, Carolyn; Archibald, Jo-ann
2000-01-01
A 4-week program in Vancouver (British Columbia) used traditional and academic formats to connect Aboriginal communities throughout British Columbia with each other and with Maori participants from New Zealand. A conference, a symposium and graduate courses covered the role of Aboriginal art, politics of transforming education, revitalization of…
Say YeSSSSS to Collaboration: Transforming Collaborative Mentoring Relationships
ERIC Educational Resources Information Center
Lamb, Dennis; Ludy, Robbie
2008-01-01
School administrators frequently find themselves working with personnel unprepared for the dynamics of the schools today. Thus, approaches to meeting the needs of newly hired (in-service or novice) teachers have manifested itself since the 1980s. As many researchers have indicated, formal evaluation of performance is essential to one's growth…
ERIC Educational Resources Information Center
Leung, S. Alvin; Hou, Zhi-Jin; Gati, Itamar; Li, Xixi
2011-01-01
This study examined the effects of cultural-values conflict and parental expectations on the career decision-making difficulties of university students in three cities in China (Beijing, Wuhan, and Hong Kong, N = 1342). The Multidimensional Scales of Individual Traditionality and Modernity (Yang, Yu, & Ye, 1989) were used as a measure of…
USDA-ARS?s Scientific Manuscript database
Knowledge of the microbial quality of irrigation waters is extremely limited. For this reason, the US FDA has promulgated the Produce Rule, mandating the testing of irrigation water sources for many farms. The rule requires the collection and analysis of at least 20 water samples over two to four ye...
2013-01-28
In this new view of the Andromeda, also known as M31, galaxy from the Herschel space observatory, cool lanes of forming stars are revealed in the finest detail yet. M31 is the nearest major galaxy to our own Milky Way at a distance of 2.5 million light-ye
Potential Partners in the Pacific? Soft Power and the SINO-NATO Relationship
2011-01-01
non-threatening manner. While both NATO and China have interests in Afghanistan, the most fertile ground for a future relationship lies in mutual...Soviet Card’ in the U.S. Opening to China, 1971-1974” Diplomatic History, Vol. 29, No. 3 (June 2005): 487. 22 Zhou-Ye Jianying -Kissinger memcon, 20/6
Study of Electromagnetic Wave Absorption Properties of Carbon Nanotubes-Based Composites
2012-11-29
Publications: [1]. G. L. Zhao, Z. Ye, Z. Li, J. A. Roberts, "New carbon nanotube-epoxy composite for dampening microwave cavity resonance", IEEE Xplore ...Nanotechnology ( IEEE - NANO), 2012 12th IEEE Conference on 20-23 Aug. 2012. [2]. Z. Li, G. L. Zhao, P. Zhang, S. Guo, J. Tang, " Thermoelectric
14 CFR 399.34 - Intra-Hawaii and Intra-Puerto Rico/Virgin Islands fare flexibility.
Code of Federal Regulations, 2010 CFR
2010-01-01
... Kodiak ($24.40). 10 July 1977 fare increased by cumulative adjustment factor of 1.5558% per Order 80-4... at 12.35 Percent Return Regulatory actual Y.E. March 1977 Aloha Hawaiian Total Cost inflation... fourth quarter of 1976. 2 Passenger revenue divided by RPM's. 3 Passenger yield at 12.35 percent return...
2014-06-13
bicycle. If it slows down, it could fall off, and the earth might quake ” (Behar 2008c). In order to maintain this momentum, China aggressively...ANALYSIS Rise like Lions after slumber In unvanquishable number — Shake your chains to earth like dew Which in your sleep had fallen on you— Ye are
Equation-free modeling unravels the behavior of complex ecological systems
DeAngelis, Donald L.; Yurek, Simeon
2015-01-01
Ye et al. (1) address a critical problem confronting the management of natural ecosystems: How can we make forecasts of possible future changes in populations to help guide management actions? This problem is especially acute for marine and anadromous fisheries, where the large interannual fluctuations of populations, arising from complex nonlinear interactions among species and with varying environmental factors, have defied prediction over even short time scales. The empirical dynamic modeling (EDM) described in Ye et al.’s report, the latest in a series of papers by Sugihara and his colleagues, offers a promising quantitative approach to building models using time series to successfully project dynamics into the future. With the term “equation-free” in the article title, Ye et al. (1) are suggesting broader implications of their approach, considering the centrality of equations in modern science. From the 1700s on, nature has been increasingly described by mathematical equations, with differential or difference equations forming the basic framework for describing dynamics. The use of mathematical equations for ecological systems came much later, pioneered by Lotka and Volterra, who showed that population cycles might be described in terms of simple coupled nonlinear differential equations. It took decades for Lotka–Volterra-type models to become established, but the development of appropriate differential equations is now routine in modeling ecological dynamics. There is no question that the injection of mathematical equations, by forcing “clarity and precision into conjecture” (2), has led to increased understanding of population and community dynamics. As in science in general, in ecology equations are a key method of communication and of framing hypotheses. These equations serve as compact representations of an enormous amount of empirical data and can be analyzed by the powerful methods of mathematics.
Risk assessment of debris flow in Yushu seismic area in China: a perspective for the reconstruction
NASA Astrophysics Data System (ADS)
Lan, H. X.; Li, L. P.; Zhang, Y. S.; Gao, X.; Liu, H. J.
2013-11-01
The 14 April 2010 Ms = 7.1 Yushu Earthquake (YE) had caused severe damage in the Jiegu township, the residential centre of Yushu Tibetan Autonomous Prefecture, Qinghai Province, China. In view of the fragile geological conditions after YE, risk assessment of secondary geohazards becomes an important concern for the reconstruction. A quantitative methodology was developed to assess the risk of debris flow by taking into account important intensity information. Debris flow scenarios were simulated with respect to rainfall events with 10, 50 and 100 yr returning period, respectively. The possible economic loss and fatalities caused by damage to buildings were assessed both in the settlement area and in the low hazard settlement area regarding the simulated debris flow events. Three modelled building types were adopted, i.e. hollow brick wood (HBW), hollow brick concrete (HBC) and reinforced concrete (RC) buildings. The results suggest that HBC structure achieves a good balance for the cost-benefit relationship compared with HBW and RC structures and thus could be an optimal choice for most of the new residential buildings in the Jiegu township. The low hazard boundary presents significant risk reduction efficiency in the 100 yr returning debris flow event. In addition, the societal risk for the settlement area is unacceptable when the 100 yr returning event occurs but reduces to ALARP (as low as reasonably practicable) level as the low hazard area is considered. Therefore, the low hazard area was highly recommended to be taken into account in the reconstruction. Yet, the societal risk might indeed approach an unacceptable level if one considers that YE has inevitably increased the occurrence frequency of debris flow. The quantitative results should be treated as a perspective for the reconstruction rather than precise numbers of future losses, owing to the complexity of the problem and the deficiency of data.
Bibliography of Soviet Laser Developments, Number 90, July-August 1987
1988-06-27
8, 1987, 1250-1255. 51. Cernai, K.; Novakov , M. 0. Concentration dependence of stimulated emission in 4-methylumbelliferone-fluorescein laser dye...118 PANCHENKO I P 129 NADENENKO A V 29 NOVAK A 9 PANCHENKO V YA 18 NADEZHDINSKIY A 1 115 NOVAKOV 14 7 PANKOV F N 88 NAGORNYKH S N 121 NOVICHENKOV V YE
Vol. 96(1): 57-65 Mycologia
2004-01-01
The concentrations and relative abundances of aquatic hyphomycete conidia in water were followed during a three-year study in two headwater streams at Coweeta Hydrologic Laboratory, North Carolina, using the membrane-filtration technique. After a one-ye& pretreatment period, one of the streams was enriched continuously with inorganic nutrients (N+P) for two years...
USDA-ARS?s Scientific Manuscript database
Cattle are the primary reservoir of Escherichia coli O157:H7, the most frequently isolated serotype of enterohemorrhagic E. coli infections among humans in North America. To evaluate the diversity of E. coli O157:H7 isolates within a single dairy herd the genomes of 30 isolates collected over a 7-ye...
Weak scale from the maximum entropy principle
NASA Astrophysics Data System (ADS)
Hamada, Yuta; Kawai, Hikaru; Kawana, Kiyoharu
2015-03-01
The theory of the multiverse and wormholes suggests that the parameters of the Standard Model (SM) are fixed in such a way that the radiation of the S3 universe at the final stage S_rad becomes maximum, which we call the maximum entropy principle. Although it is difficult to confirm this principle generally, for a few parameters of the SM, we can check whether S_rad actually becomes maximum at the observed values. In this paper, we regard S_rad at the final stage as a function of the weak scale (the Higgs expectation value) vh, and show that it becomes maximum around vh = {{O}} (300 GeV) when the dimensionless couplings in the SM, i.e., the Higgs self-coupling, the gauge couplings, and the Yukawa couplings are fixed. Roughly speaking, we find that the weak scale is given by vh ˜ T_{BBN}2 / (M_{pl}ye5), where ye is the Yukawa coupling of electron, T_BBN is the temperature at which the Big Bang nucleosynthesis starts, and M_pl is the Planck mass.
Kim, Sung-Han; Lee, Jae Seong; Hyun, Jung-Ho
2017-07-15
We investigated environmental impact of large-scale dyke on the sediment geochemistry, sulfate reduction rates (SRRs), sediment oxygen demand (SOD) and potential contribution of benthic nutrient flux (BNF) to primary production in the Yeongsan River estuary, Yellow Sea. The sediment near the dyke (YE1) with high organic carbon (C org ) content (>4%, dry wt.) was characterized by extremely high SOD (327mmolm -2 d -1 ) and SRRs (91-140mmolm -2 d -1 ). The sulfate reduction accounted for 73% of C org oxidation, and was responsible for strikingly high concentrations of NH 4 + (7.7mM), PO 4 3- (67μM) and HS - (487μM) in pore water. The BNF at YE1 accounted for approximately 200% of N and P required for primary production in the water column. The results present one of the most extreme cases that the construction of an artificial dyke may have profound impacts on the biogeochemical and ecological processes in coastal ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.
1987-05-01
AUDIOGRAM DAY Of WEEK MJIL-TIME-DAY HOURS SINCE ENT PROBLEM AT TIME OF TESI do,~iiII. r___1 ISON WEDHURSA LAST~ N II-o 2YE LIii. I2 MON T-URS I E...POS ’REI...such as CHEMISTRY, HEMATOLOGY, MICROBIOLOGY , RADIOLOGY, and MISCELLANEOUS. The date is displayed in the same format as previously described. The
Bi-local holography in the SYK model: Perturbations
Jevicki, Antal; Suzuki, Kenta
2016-11-08
We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.
Tomicus piniperda (Scolytidae): a serious pest of yunnan pine in southwestern China
Hui Ye; Robert A. Haack; Jun Lu
2003-01-01
The pine shoot beetle, Tomicus piniperda (L.), is native to the pine growing regions of Europe, Asia, and northern Africa (Bakke 1968; L?ngstrom 1983; Ye 1991). Established populations of T. piniperda were first found in North America in 1992 (Haack and Kucera 1993), and as of January 2002, it now occurs in 318 counties in the...
The Impact of Enterprise Education on Attitudes to Enterprise in Young People: An Evaluation Study
ERIC Educational Resources Information Center
Athayde, Rosemary
2012-01-01
Purpose: The purpose of the paper is to present evidence on the impact of enterprise education on young people still at school in London, UK. The study was designed to measure the effect of participation in a Young Enterprise (YE) Company Program on young people's attitudes toward starting a business, and on their enterprise potential.…
1977-02-09
RANGE NAVIGATION. RSBN-2 By: Ye. M. Yakovlev, A. N. Kleplkov, et al. English pages: 706 source: Radlotekhnlcheskaya Sistema Bllzhney Navigatsli...L4 and the grid of tube L5 (6N8S) limits grid m^^mammm^m^^^f.^^ rn .„ | -.,, ..S^JTv i tOC = 77050017 PAGE ^ I current©. |: *■ «a—m
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jevicki, Antal; Suzuki, Kenta
We continue the study of the Sachdev-Ye-Kitaev model in the Large N limit. Following our formulation in terms of bi-local collective fields with dynamical reparametrization symmetry, we perform perturbative calculations around the conformal IR point. As a result, these are based on an ε expansion which allows for analytical evaluation of correlators and finite temperature quantities.
Studies in the Phonology of Asian Languages VI: Complex Syllable Nuclei in Vietnamese.
ERIC Educational Resources Information Center
Han, Mieko S.
This study is the sixth in the series "Studies in the Phonology of Asian Languages." A phonetic and phonemic analysis of the three complex nuclei of Vietnames (Hanoi dialect), spelled (1) ye-, -ie-, -ia, (2) -u'o'-, -u'a, and (3) -uo-, -ua, was carried out using the sound spectrograph. The relative domains of the target qualities of the…
Kim, SoJung; Bemben, Michael G.; Knehans, Allen W.; Bemben, Debra A.
2015-01-01
Although Yoga has the potential to be an alternative physical activity to enhance bone health, there is a lack of high quality evidence for this type of intervention. The purpose of this randomized controlled trial was to examine the effects of a progressive 8-month Ashtanga-based Yoga program on bone turnover markers (BTM), areal bone mineral density (aBMD) and volumetric bone characteristics in premenopausal women. Thirty-four premenopausal women (35-50 years) were randomly assigned either to a Yoga group (YE, n = 16) or a control group (CON, n = 18). Participants in YE group performed 60 minutes of an Ashtanga-based Yoga series 2 times/week with one day between sessions for 8 months, and the session intensity was progressively increased by adding the number of sun salutations (SS). Participants in CON were encouraged to maintain their normal daily lifestyles monitored by the bone specific physical activity questionnaire (BPAQ) at 2 month intervals for 8 months. Body composition was measured by dual energy x-ray absorptiometry (DXA). Bone formation (bone alkaline phosphatase, Bone ALP) and bone resorption (Tartrate-Resistant Acid Phosphatase-5b, TRAP5b) markers were assessed at baseline and after 8 months. aBMD of total body, lumbar spine and dual proximal femur and tibia bone characteristics were measured using DXA and peripheral Quantitative Computed Tomography (pQCT), respectively. We found that the serum Bone ALP concentrations were maintained in YE, but significantly (p = 0.005) decreased in CON after the 8 month intervention, and there were significant (p = 0.002) group differences in Bone ALP percent changes (YE 9.1 ± 4.0% vs. CON -7.1 ± 2.3%). No changes in TRAP5b were found in either group. The 8-month Yoga program did not increase aBMD or tibia bone strength variables. Body composition results showed no changes in weight, fat mass, or % fat, but small significant increases in bone free lean body mass occurred in both groups. The findings of this study
Mo, SangJoon; Lee, Sung-Kwon; Jin, Ying-Yu; Oh, Chung-Hun; Suh, Joo-Won
2013-04-01
FK506 production by a mutant strain (Streptomyces sp. RM7011) induced by N-methyl-N'-nitro-N-nitrosoguanidine and ultraviolet mutagenesis was improved by 11.63-fold (94.24 mg/l) compared to that of the wild-type strain. Among three different metabolic pathways involved in the biosynthesis of methylmalonyl-CoA, only expression of propionyl-CoA carboxylase (PCC) pathway led to a 1.75-fold and 2.5-fold increase in FK506 production and the methylmalonyl-CoA pool, respectively, compared to those of the RM7011 strain. Lipase activity of the high FK506 producer mutant increased in direct proportion to the increase in FK506 yield, from low detection level up to 43.1 U/ml (12.6-fold). The level of specific FK506 production and lipase activity was improved by enhancing the supply of lipase inducers. This improvement was approximately 1.88-fold (71.5 mg/g) with the supplementation of 5 mM Tween 80, which is the probable effective stimulator in lipase production, to the R2YE medium. When 5 mM vinyl propionate was added as a precursor for PCC pathway to R2YE medium, the specific production of FK506 increased approximately 1.9-fold (71.61 mg/g) compared to that under the non-supplemented condition. Moreover, in the presence of 5 mM Tween 80, the specific FK506 production was approximately 2.2-fold (157.44 mg/g) higher than that when only vinyl propionate was added to the R2YE medium. In particular, PCC expression in Streptomyces sp. RM7011 (RM7011/pSJ1003) together with vinyl propionate feeding resulted in an increase in the FK506 titer to as much as 1.6-fold (251.9 mg/g) compared with that in RM7011/pSE34 in R2YE medium with 5 mM Tween 80 supplementation, indicating that the vinyl propionate is more catabolized to propionate by stimulated lipase activity on Tween 80, that propionyl-CoA yielded from propionate generates methylmalonyl-CoA, and that the PCC pathway plays a key role in increasing the methylmalonyl-CoA pool for FK506 biosynthesis in RM7011 strain. Overall
PREFACE: 3rd International Workshop on Materials Analysis and Processing in Magnetic Fields (MAP3)
NASA Astrophysics Data System (ADS)
Sakka, Yoshio; Hirota, Noriyuki; Horii, Shigeru; Ando, Tsutomu
2009-07-01
the journal Science and Technology of Advanced Materials. All articles have been refereed by experts in the field. Both of these journals are fully accessible electronically and can be cited and referenced in the usual way. It is our hope that the reader will enjoy and profit from the MAP3 Proceedings. Hitoshi Wada (Kashiwa, Japan) Chair Eric Beaugon (Grenoble, France) Hans J Schneider-Muntau (Tallahassee, USA) Co-chair Advisory Board Shigeo Asai (Nagoya, Japan) Koichi Kitazawa (Tokyo, Japan) Mitsuhiro Motokawa (Sendai, Japan) Shoogo Ueno (Fukuoka, Japan) Robert Tournier (Grenoble, France) Justin Schwartz (Tallahassee, USA) J C Maan (Nijmegen, Netherland) Scientific Committee Yoshifumi Tanimoto (Hiroshima, Japan) Masuhiro Yamaguchi (Yokohama, Japan) Tsunehisa Kimura (Kyoto, Japan) Yoshio Sakka (Tsukuba Japan) Ryoichi Aogaki (Tokyo, Japan) Jyunji Miyakoshi (Hirosaki, Japan) Kazuo Watanabe (Sendai, Japan) James M Valles Jr. (Providence, USA) Joon Pyo Park (Pohang, Korea) Qiang Wang (Shenyang, China) Nicole Pamme (Hull, UK) Sophie Rivoirard (Grenoble, France) P C M Christianen (Nijmegen, Netherland) Local Organizing Committee Isao Yamamoto Masafumi Yamato Shigeru Horii Norihito Sogoshi Masateru Ikehata Noriyuki Hirota Tsutomu Ando Proceedings Editorial Board Yoshio Sakka Noriyuki Hirota Shigeru Horii Tsutomu Ando Conference photograph
2006-09-07
Statements During Clinton Administration . . . . . . . . . . . . . . . . . . . . . . . . . 48 PRC Premier Li Peng Warns Taiwan...Soviet Union/Russia and built up its theater missile force.48 In December 1992 and March 1993, PRC President Jiang Zemin and Premier Li Peng began to...Ye Jianying Explains Policy Concerning Return of Taiwan to Motherland and Peaceful Unification,” Xinhua [New China News Agency], September 30, 1981
U.S. EPA, Pesticide Product Label, , 11/13/1987
2011-04-14
... r'r~-::)pir'ati()ll by !J'o(.rll.th-·-I:o···mrouth (H" othl~r mC'·)frS:· \\1t \\·r ... 'f·qhqI.3ti~ nr::~1n r::au~ji:.~ tl.l.ng et:ir:.'rna
Atomic Layer Deposition of Al2O3 on GaSb Using In Situ Hydrogen Plasma Exposure
2012-12-03
Krishna, and A. Javey, Nano Lett. 12, 3592 (2012). 7A. Ali, H. Madan , A. Agrawal, I. Ramirez, R. Misra, J. B. Boos, B. R. Bennett, J. Lindemuth, and S...Trans. Electron Devices 58, 3407 (2011). 9M. Xu, R. S. Wang, and P. D. Ye, IEEE Electron Device Lett. 32, 883 (2011). 10A. Ali, H. S. Madan , A. P. Kirk
1985-04-19
Specifics of Geology of Saryshagan Molybdenum- Copper - Porphyry Deposit (Northwestern Balkash Area) (Yu. K. Kudryavtsev, V. V. Izotov, et al...SPECIFICS’OF GEOLOGY OF SARYSHAGAN MOLYBDENUM- COPPER - PORPHYRY DEPOSIT (NORTHWESTERN BALKASH AREA) Moscow IZVESTIYA VYSSHIKH UCHEBNYKH ZAVEDENIY... Copper , Lead and Cadmium in Ooze Water of Central Pacific (A. Ye. Kosov, T. P. Demidova; GEOKHIMIYA, No 10, Oct 84) 37 Nickel Minerals in
Bibliography of Soviet Laser Developments, Number 37, September - October 1978
1979-07-01
RZhF, 10/78, lbD1210) 333. Sukhanov , V.I., Yu.V. Ashcheulov, and A.Ye. Petnikov (0). Hologram recording in lithium niobate crystals. Sb 15, 86-88...SUCIU P SUKHANOV V I SUKHOVERKHOVA L G SUKOV A I SUSHENKO A N SUSHKEVICH T N SUSHKIN V N SUSLENNIKOV L A SUSLIKOV L M SUSLOV A M SVERDLOV B N
Fiscal Year 2013 Comprehensive Oversight Plan for Southwest Asia
2012-09-26
Republic JO Jordan TJ Tajikistan KZ Kazakhstan TM Turkmenistan KW Kuwait AE United Arab Emirates KG Kyrgyzstan UZ Uzbekistan LB Lebanon YE Yemen...effective, responsive, democratic, transparent, accountable, and gender sensitive municipal governance in select municipalities in Afghanistan? (Project...CAII-Creative Associates International, Inc., Ambassador’s Small Grants Program to Support Gender Equality in Afghanistan – ASGP Objective: 306-A-00
JPRS Report, Science & Technology, USSR: Computers
1987-07-15
Algebras and Multilevel Program Planning (G. Ye.. Tseytlin; PROGRAMMIROVANIYE, No 3, May-Jun 86) 36 Linguistic Facilities for Programming...scientific production associations which, jointly with the USSR Academy of Sciences, will solve basic and applied problems in the informatics industry...especially the establishment of complex , interdisciplinary problems and directions), the change in the style of the scientific thought of the epoch, and
Thermo-Mechanical and Thermal Behavior of High-Temperature Structural Materials.
1981-12-31
8217 wtich should r’o = - :a . mere ilret ap. l I it;on to , ision reactor mat.er als. The "roaa ot)l c i: ye oi tie work has 5,!iere : iS tte .:k i,.’nt...Center Materials Department Office of Naval Research Annapolis, Maryland 21402 (1) San Francisco Area Office One Hallidie Plaza, Suite 601 Naval Undersea
Directory of Soviet Officials: Science and Education: A Reference Aid
1989-05-01
Sergey Yevstratovich id 1971 Organic Semifinished Products and Dyes SRI imeni K. Ye. Voroshllov, Moscow (Nil organicheskikh poluproduktov i... products and also produces dyes for use in the textile industry.) Director Physical Chemistry SRI imeni L Ya, Karppv, Moscow (Nauchno...103 Organic Semifinished Products and Dyes SRI imeni K.Yc. Voroshilov. Moscow 197 Organic Synthesis Institute. Riga 157 Oriental Studies Institute
Cleaving the Halqeh-ye-nur diamonds: a dynamic fracture analysis.
Atkinson, Colin; Martineau, Philip M; Khan, Rizwan U A; Field, John E; Fisher, David; Davies, Nick M; Samartseva, Julia V; Putterman, Seth J; Hird, Jonathan R
2015-03-28
The degree of surface roughness and clarity with which a surface in a brittle material can be formed via fracture is known to be related to the speed of the propagating crack. Cracks traversing a brittle material at low speed produce very smooth surfaces, while those propagating faster create less reflective and rough surfaces (Buehler MJ, Gao H. 2006 Nature 439, 307-310 (doi:10.1038/nature04408)). The elastic wave speeds (c(l)≈18 000 m s(-1), c(s)≈11 750 m s(-1)) in diamond are fast (Willmott GR, Field JE. 2006 Phil. Mag. 86, 4305-4318 (doi:10.1080/14786430500482336)) and present a particular problem in creating smooth surfaces during the cleaving of diamond-a routine operation in the fashioning of diamonds for gemstone purposes--as the waves are reflected from the boundaries of the material and can add a tensile component to the propagating crack tip causing the well-known cleavage steps observed on diamond surfaces (Field JE. 1971 Contemp. Phys. 12, 1-31 (doi:10.1080/00107517108205103); Field JE. 1979 Properties of diamond, 1st edn, Academic Press; Wilks EM. 1958 Phil. Mag. 3, 1074-1080 (doi:10.1080/14786435808237036)). Here we report an analysis of two diamonds, having large dimensions and high aspect ratio, which from a gemological analysis are shown to have been cleaved from the same 200 carat specimen. A methodology for their manufacture is calculated by an analysis of a model problem. This takes into account the effect of multiple reflections from the sample boundaries. It is suggested that the lapidary had an intuitive guide to how to apply the cleavage force in order to control the crack speed. In particular, it is shown that it is likely that this technique caused the fracture to propagate at a lower speed. The sacrifice of a large diamond with the intention of creating thin plates, rather than a faceted gemstone, demonstrates how symbolism and beliefs associated with gemstones have changed over the centuries (Harlow GE. 1998 The nature of diamonds, Cambridge University Press). The scientific insights gained by studying these gemstones suggest a method of producing macroscale atomically flat and stress-free surfaces on other brittle materials.
Cleaving the Halqeh-ye-nur diamonds: a dynamic fracture analysis
Atkinson, Colin; Martineau, Philip M.; Khan, Rizwan U. A.; Field, John E.; Fisher, David; Davies, Nick M.; Samartseva, Julia V.; Putterman, Seth J.; Hird, Jonathan R.
2015-01-01
The degree of surface roughness and clarity with which a surface in a brittle material can be formed via fracture is known to be related to the speed of the propagating crack. Cracks traversing a brittle material at low speed produce very smooth surfaces, while those propagating faster create less reflective and rough surfaces (Buehler MJ, Gao H. 2006 Nature 439, 307–310 (doi:10.1038/nature04408)). The elastic wave speeds (cl≈18 000 m s−1, cs≈11 750 m s−1) in diamond are fast (Willmott GR, Field JE. 2006 Phil. Mag. 86, 4305–4318 (doi:10.1080/14786430500482336)) and present a particular problem in creating smooth surfaces during the cleaving of diamond—a routine operation in the fashioning of diamonds for gemstone purposes—as the waves are reflected from the boundaries of the material and can add a tensile component to the propagating crack tip causing the well-known cleavage steps observed on diamond surfaces (Field JE. 1971 Contemp. Phys. 12, 1–31 (doi:10.1080/00107517108205103); Field JE. 1979 Properties of diamond, 1st edn, Academic Press; Wilks EM. 1958 Phil. Mag. 3, 1074–1080 (doi:10.1080/14786435808237036)). Here we report an analysis of two diamonds, having large dimensions and high aspect ratio, which from a gemological analysis are shown to have been cleaved from the same 200 carat specimen. A methodology for their manufacture is calculated by an analysis of a model problem. This takes into account the effect of multiple reflections from the sample boundaries. It is suggested that the lapidary had an intuitive guide to how to apply the cleavage force in order to control the crack speed. In particular, it is shown that it is likely that this technique caused the fracture to propagate at a lower speed. The sacrifice of a large diamond with the intention of creating thin plates, rather than a faceted gemstone, demonstrates how symbolism and beliefs associated with gemstones have changed over the centuries (Harlow GE. 1998 The nature of diamonds, Cambridge University Press). The scientific insights gained by studying these gemstones suggest a method of producing macroscale atomically flat and stress-free surfaces on other brittle materials. PMID:25713458
Kilonova from post-merger ejecta as an optical and near-Infrared counterpart of GW170817
NASA Astrophysics Data System (ADS)
Tanaka, Masaomi; Utsumi, Yousuke; Mazzali, Paolo A.; Tominaga, Nozomu; Yoshida, Michitoshi; Sekiguchi, Yuichiro; Morokuma, Tomoki; Motohara, Kentaro; Ohta, Kouji; Kawabata, Koji S.; Abe, Fumio; Aoki, Kentaro; Asakura, Yuichiro; Baar, Stefan; Barway, Sudhanshu; Bond, Ian A.; Doi, Mamoru; Fujiyoshi, Takuya; Furusawa, Hisanori; Honda, Satoshi; Itoh, Yoichi; Kawabata, Miho; Kawai, Nobuyuki; Kim, Ji Hoon; Lee, Chien-Hsiu; Miyazaki, Shota; Morihana, Kumiko; Nagashima, Hiroki; Nagayama, Takahiro; Nakaoka, Tatsuya; Nakata, Fumiaki; Ohsawa, Ryou; Ohshima, Tomohito; Okita, Hirofumi; Saito, Tomoki; Sumi, Takahiro; Tajitsu, Akito; Takahashi, Jun; Takayama, Masaki; Tamura, Yoichi; Tanaka, Ichi; Terai, Tsuyoshi; Tristram, Paul J.; Yasuda, Naoki; Zenko, Tetsuya
2017-12-01
Recent detection of gravitational waves from a neutron star (NS) merger event GW170817 and identification of an electromagnetic counterpart provide a unique opportunity to study the physical processes in NS mergers. To derive properties of ejected material from the NS merger, we perform radiative transfer simulations of kilonova, optical and near-infrared emissions powered by radioactive decays of r-process nuclei synthesized in the merger. We find that the observed near-infrared emission lasting for >10 d is explained by 0.03 M⊙ of ejecta containing lanthanide elements. However, the blue optical component observed at the initial phases requires an ejecta component with a relatively high electron fraction (Ye). We show that both optical and near-infrared emissions are simultaneously reproduced by the ejecta with a medium Ye of ˜0.25. We suggest that a dominant component powering the emission is post-merger ejecta, which exhibits that the mass ejection after the first dynamical ejection is quite efficient. Our results indicate that NS mergers synthesize a wide range of r-process elements and strengthen the hypothesis that NS mergers are the origin of r-process elements in the Universe.
The advertisement calls of Quasipaa shini (Ahl, 1930) (Anura: Dicroglossidae).
Kong, Shen Shen; Zheng, Rong Quan; Zhang, Qi Peng
2016-12-04
The genus Quasipaa (Family Dicroglossidae) is currently composed of 11 species distributed in China and Southeast Asia: Quasipaa acanthophora (Dubois & Ohler 2009), Q. boulengeri (Günther 1889), Q. courtoisi (Angel 1922), Q. delacouri (Angel 1928), Q. exilispinosa (Liu & Hu, 1975), Q. fasciculispina (Inger 1970), Q. jiulongensis (Huang & Liu, 1985), Q. shini (Ahl 1930), Q. spinosa (David 1875), Q. verrucospinosa (Bourret 1937), Q. yei (Chen, Qu & Jiang 2002) (Frost 2016). These species are morphologically similar, and their taxonomy is subject to controversy (Che et al. 2009). Analyses of nuclear and mitochondrial genes suggest the genus likely encompass additional cryptic species (Ye et al. 2013). Bioacoustics has contributed to studies on the taxonomy of the genus (Ye et al. 2013; Shen et al. 2015), however, to date, only the advertisement calls of Q. spinosa are known (Yu & Zheng 2009; Chen et al. 2012; Shen et al. 2015). Here, we describe the advertisement calls of Q. shini, which inhabits streams in the southern part of central China(Guizhou, Hunan, Guangxi and Jiangxi) and is characterized by the presence of keratinized skin spines on the lateral surfaces of the body.
Calculated and Observed Speeds of Cavitation About Two- and Three- Dimensional Bodies in Water
1942-11-01
yE1l0.044po ellipse of - 36 (1 - Y) 6 0 .l.Olxx 0(y) L . 6.54 Porabolo Elipe em - Cicl Y ,11p f. 2 1 - fal: Figure 1 ScinofCylinders and Bodies of...Propellers,* by E.Z. Stowell and A.F. Deming , BACA Report 526, 1935. (2) "Flow about a Pair of Adjacent, Parallel Cylinders Normal to a Stream, Theoretical
An Ada/SQL (Structured Query Language) Application Scanner.
1988-03-01
Digital ...8217 (" DIGITS "), 46 new STRING’ ("DO"), new STRING’ ("ELSE"), new STRING’ ("ELSIF"), new STRING’ ("END"), new STRING’ ("ENTRY"), new STRING’ ("EXCEPTION...INTEGERPRINT; generic type NUM is digits <>; package FLOATPRINT is package txtprts.ada 18 prcdr PR (FL inFL %YE LINE n LINTYPE UNCLASSIFIED procedure
SOVRaD - A Digest of Recent Soviet R and D Articles. Volume 2, Number 1, 1976
1976-01-01
sensors and for making pyroelectric pow^r generators. [ Chechkin , V . V . , A , I. Leychenko, O. S. Didkovskaya, G. Ye. Savenkova, V . V ...ALlenov, M. I. , A . V . Afomn, M. F. Akhmetzyanov, et al. High-speed apparatus for recording and processing measurements of fluctuations...is included. [Medvedev, G. A . , M. A . Markovich, and V . I. Shlyakhov. Optical light flux demodulation device for optical probes. Author’s
USSR Report, Life Sciences Biomedical and Behavioral Sciences
1984-02-02
Plant Protection 1 Predicting Effectiveness of Mineral Fertilizers on Rice Plantings (Ye. P. Aleshin. et al.; DOKLADY VASKhNIL, No 5, May 83... Protection Cited (Yu. Zaytsev; PRAVDA UKRAINY, 5 Oct 83) 88 - f - AGROTECHNOLOGY BRIEFS BIOLOGICAL PLANT PROTECTION —The criticism contained in the...the biological means of plant protection manufactured by Glavmikrobioprom enterprises are still inferior in quality to better samples. Measures
1984-12-12
extracted - Unfamiliar names rendered phonetically or transliterated are enclosed in parentheses. Words or names preceded by a question mark and...warrant officers, and six NCO’s and soldiers raised their scores. Moreover, St Lieutenants Ye. Shavrov, S. Boldin , and V. Radionov became specialists...absence—a scientific essay on the selected specialty; notarized copies of the VUZ graduation diploma and an extract from the academic record; service
2016 Quantum Science Gordon Research Conference
2018-01-10
PERSON 19b. TELEPHONE NUMBER Jun Ye 611102 c. THIS PAGE The public reporting burden for this collection of information is estimated to average 1 hour...completing and reviewing the collection of information . Send comments regarding this burden estimate or any other aspect of this collection of information ...including suggesstions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215
Laser Instrumentation for Attosecond Experimentation
2009-06-15
Spectroscopy Principal Investigator: Jun Ye, JILA, NIST and University of Colorado, Boulder With revolutionary impact on precision metrology and...geometry, one of the focusing cavity mirrors had a 100-mm hole drilled in the middle. The coupling efficiency and cavity loss associated with such...carried out by the Leone and Neumark groups. These studies provided a gauge of the plasmon-field ponderomotive forces. Attosecond experiments were prepared
2013-02-01
DTRA-TR-12-65 Manipulation of Molecular Quantum Wavepackets with Ultrashort Laser Pulses for Non-destructive Detection of Volatile Explosives ...Manipulation of Molecular Quantum Wavepackets with Ultrashort Laser Pulses for Non-destructive Detection of Volatile Explosives HDTRA1-09-1-0021 Valery...destructive detection of volatile explosives . Moshe Shapiro1, Valery Milner1 and Jun Ye2 1University of British Columbia, Vancouver, Canada 2JILA
JPRS Report, Science & Technology, USSR: Science & Technology Policy
1990-05-31
SERVICE SPRINGFIELD, VA. 22161 DTTC QUALITY INSPECTED t Science & Technology USSR: Science & Technology Policy JPRS-UST-90-006 CONTENTS 31 May...64 Uzbek Central Committee Examines S& T Cadre Problem [PRAVDA VOSTOKA, 27Feb 90] 65 Miscellaneous Scientists Comment on Compensation, Contract...Expositions POISK Commentary on February S& T Conference [V. Oshchenko, Ye. Ponarina; POISK, 22-28 Feb 90] 77 Conference Sets Policy for Future S& T
FEASIL Implementation under VAX VMS with Design Information.
1986-11-01
desirable to eventually port FEASIL to the HP 9000, the IBM PC, and several other com- puters. However, the flowcharting and VAX conversion efforts have...v W l EU l l~rl EDIIkEL (pg 12) DEL El’F TJ-’LE C rr~PACE 13 HPvrwrH IIUpdate the I Itpe DescrL c ðere tau,1es remaining nthe relatioil ? ye
Ute Unit: Study Guide and Follow Up Activities.
ERIC Educational Resources Information Center
North Conejos School District, Capulin, CO.
The study guide and follow-up activities were designed primarily to give students a feeling of Ute life in the San Luis Valley in Colorado. The unit begins with six Southern Ute stories about the wolf and coyote, the race between the skunk and the coyote, the frog and the eagle, why the frog croaks, the bear (Que Ye Qat), and the two Indian…
Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici
Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta; ...
2017-08-17
The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of
Gnepe, J R; Tyagi, R D; Brar, S K; Valero, J R
2011-01-01
A rheological study of diets using the agro-industrial wastes (brewery wastewater and pomace waste) was carried out in order to obtain a diet most adapted to supply nutrients for growth of codling moth (CM) larvae. Nutritive capacity (g/L) of brewery wastewater (BWW) (25.5 ± 5.5 carbohydrates; 16.9 ± 2.1 proteins; 6 ± 1.6 lipids) and pomace waste (POM) (22.0 ± 0.03 carbohydrates; 11.3 ± 1.3 proteins; 2 ± 0.2 lipids) were essential and important as replacement or in association with other ingredients [soya flour (SF), wheat germ (WG), yeast extract (YE)] of the standard diet for the breeding of codling moth larvae. These diet additives also contributed to the preservation of texture and nutritive content of larvae diet. The eggs and CM larvae were grown on alternate diets under industrial conditions (16:8 h photoperiod; 25 ± 1 °C and 50 ± 0.5 % of humidity). The higher assimilation of nutrients of the diets in BWW and control diet was observed by calculating the rate of hatching of eggs (0.48 to 0.71); larvae growth (0.23 to 0.4) and fertility (1.33 to 3 for control diet). The excellent growth and fertility rates of codling moth larvae were attributed to variations in viscosity (varying from 50 to 266 mPa.s⁻¹), particle size (varying 24.3 μm in 88.05 μm with regard to 110 μm the control diet) and total solids (145.88 g/L POM + YE; 162.08 g/L BWW + YE; 162.2 g/L POM + WG; 173 g/L control; 174.3 g/L BWW + WG) diets. Lower viscosity favored improved diet due to ease of assimilation of nutrients. Thus, rheology is an important parameter during preparation of diets for growth of codling moth larvae as it will dictate the nutrient assimilation which is an important parameter of larvae growth.
Propionic acid production from corn stover hydrolysate by Propionibacterium acidipropionici
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Xiaoqing; Salvachua, Davinia; Sanchez i Nogue, Violeta
The production of value-added chemicals alongside biofuels from lignocellulosic hydrolysates is critical for developing economically viable biorefineries. Here, the production of propionic acid (PA), a potential building block for C3-based chemicals, from corn stover hydrolysate is investigated using the native PA-producing bacterium Propionibacterium acidipropionici. A wide range of culture conditions and process parameters were examined and experimentally optimized to maximize titer, rate, and yield of PA. The effect of gas sparging during fermentation was first examined, and N 2 was found to exhibit improved performance over CO 2. Subsequently, the effects of different hydrolysate concentrations, nitrogen sources, and neutralization agentsmore » were investigated. One of the best combinations found during batch experiments used yeast extract (YE) as the primary nitrogen source and NH 4OH for pH control. This combination enabled PA titers of 30.8 g/L with a productivity of 0.40 g/L h from 76.8 g/L biomass sugars, while successfully minimizing lactic acid production. Due to the economic significance of downstream separations, increasing titers using fed-batch fermentation was examined by changing both feeding media and strategy. Continuous feeding of hydrolysate was found to be superior to pulsed feeding and combined with high YE concentrations increased PA titers to 62.7 g/L and improved the simultaneous utilization of different biomass sugars. Additionally, applying high YE supplementation maintains the lactic acid concentration below 4 g/L for the duration of the fermentation. Finally, with the aim of increasing productivity, high cell density fed-batch fermentations were conducted. PA titers increased to 64.7 g/L with a productivity of 2.35 g/L h for the batch stage and 0.77 g/L h for the overall process. These results highlight the importance of media and fermentation strategy to improve PA production. Altogether, this work demonstrates the feasibility of
NASA Astrophysics Data System (ADS)
Ogretmen, Nazik; Cosentino, Domenico; Gliozzi, Elsa; Cipollari, Paola; Radeff, Giuditta; Yıldırım, Cengiz
2016-04-01
In regions that are located in steep, orogenic plateau margins, such as the coastal area of the Central Anatolian Plateau (CAP) southern margin, natural hazard studies related to active tectonics and events that are triggered by active tectonics (e.g., earthquakes, landslides, tsunamis) are very essential in the context of preventing possible damages. This work herein, represents some evidence of the tsunami hazard along the coast between Aydıncık and Narlıkuyu, in southern Turkey. The work is based on a study on out-of-place beachrock-slab boulder acummulation in Aydıncık district, which were transported onshore by sliding process, and on out-of-place more rounded boulders that were transported by saltation process in Narlıkuyu and Yeşilovacık districts. The presence of intertidal organisms (e.g., lithophaga boring, balanids, oysters, etc.) encrusting the boulders of both localities shows that those boulders were carried onland from a marine environment. According to their dimensions and weight, in agreement with out-of-place boulders from areas surely affected by tsunamis, those out-of-place boulders here are interpreted as due to tsunami waves. The tsunamites in the Aydıncık area are located on beachrock slabs. They are platty and some of those blocks are embricated and oriented perpendicular to the shoreline (NE-SW direction). Those boulders have been interpreted as transported by sliding process, in relation with the coastal morphology and the boulder geometry, which means that to move those boulders the energy of the tsunami not necessarily should have been as high as in saltation or rolling transport processes. On the contrary, in Narlıkuyu and Yeşilovacık localities, the boulders are well-rounded and ellipsoidal shaped, suggesting that they were transported by rolling and/or saltation mode rather than by sliding. To carry onland the tsunami boulders observed in the Narlıkuyu and Yeşilovacık districts, which in the Yeşilovacık area they are
Molecular Studies of Alphavirus Immunogenicity
1992-12-03
RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian
2007-07-09
48 PRC Premier Li Peng Warns Taiwan . . . . . . . . . . . . . . . . . . . . . . . . . 48 Mainland-Taiwan “Koo-Wang...and March 1993, PRC President Jiang Zemin and Premier Li Peng began to warn of having to use “drastic” or “resolute” measures to prevent Taiwan...commitment in its referral to Quemoy and Matsu.” (Wolff and Simon, p. 282-283.) 95 “Ye Jianying Explains Policy Concerning Return of Taiwan to Motherland and
Professionalization of the Senior Chinese Officer Corps Trends and Implications
1997-01-01
81The officers who retired were Ye Jianying , Nie Rongzhen, Xu Xiangqian, Wang Zhen, Song Renqiong, and Li Desheng. Of course, the political impact of...increased education level, functional spe- cialization, and adherence to retirement norms.4 Li Cheng and Lynn White, in their 1993 Asian Survey article...making rigorous comparative analysis untenable. Second, Li and White do not place their results or analysis in any theoretical context. In
Dynamics of Photoexcitation and Photocatalysis at Nanostructured Carbon Interfaces
2015-07-14
nanotubes with a sacrificial polymer and eliminating the polymer using a critical point drying process. This process creates aerogel structures that...Bindl DJ, Jacobberger RM, Wu M-Y, Singha Roy S, Arnold MS, Semiconducting Carbon Nanotube Aerogel Bulk Heterojunction Solar Cells, Small 10 (16), pp...ACS Nano 2015, 9 (1), 564-572. Ye Y, Bindl DJ, Jacobberger RM, Wu M-Y, Singha Roy S, Arnold MS, Semiconducting Carbon Nanotube Aerogel Bulk
1985-07-24
ZAVEDENIY: KHBIIYA I KHIMICHESKAYA TEKHNOLOGIYA, No 3, Mar 85) ................ 2 ANALYTICAL CHEMISTRY Spectroscopic Method of Studying...Ye. Gutman, I. A. Myasnikov, et al.; ZHURNAL FIZICHESKOY KHE-1II, No 3, Mar 85) 4 -a - [III - USSR - 21B S&T] Detailed Method for...Containing Rare Earth and Transitional Elements (S. E. Mamedov, B. A. Dadashev: KINETIKA I KATALIZ, No 1, Jan-Feb 85) 11 Isotope Exchange Method in
USSR Report. Life Sciences: Biomedical and Behavioral Sciences
1987-05-29
Ioffe, M.G. Bezrukov; BIOTEKHNOLOGIYA, No 5, Sep-Oct 86) • 29 Influence of Hydrodynamic Structure of Flows on Processes in Bubbler Reactor (A.A...Ye.F. Andreyev and M.A. Kazaryan, Ali-Union Scientific Research Biosynthetic Institute, Moscow] [Abstract] Flow -through microbiocalorimeters widely...references 13: 2 Russian, 11 Western. 6508/13046 CSO: 1840/356 UDC 663.033.063.86 INFLUENCE OF HYDRODYNAMIC STRUCTURE OF FLOWS ON PROCESSES IN
Eighth Mendeleyev Congress on General and Applied Chemistry - USSR -
1960-07-18
A. Nazarova and V. S. Orlova (Moscow) succeeded in forming sulfates , nitrates and carbonates of platinum iodopentamine by ammonia substitution of...of ruthenium; S. I. Ginsburg, N. K. Pshenitsyn and L. G. Sal’skaya (moscow) studied the nature of colored iridum compounds formed in sulfuric ...phosphoric and perchloric acids ; Ye. V. Shenderet- skaya and I. I. Chernyayev (Moscow) studied formates of mono- valent rhodium; E. P. Deichman (Moscow
JPRS Report, Science & Technology, USSR: Science & Technology Policy.
1987-07-15
called for by the specifications. We pointed this out, tut the suppliers were in no hurry to correct the situation," shop foreman S . Korenev ... S &T Progress ( S . Leznov; TEKHNIKA I NAUKA,No 9, Sep 86) 10 Work of ESSR S &T Societies on Intensifying Social Production (Vladimir...Moscow Automated Control System ( S . Ye. Serdyuk; TEKHNIKA I NAUKA, No 9, Sep 86) 41 INDUSTRIAL, COMMERCIAL APPLICATION Development of Methods
JPRS Report, Science & Technology, USSR: Physics & Mathematics
1987-06-17
Manishin, G. A. Pasmanik; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) Determination of Weak Optical Absorption of Optoacoustic Method ( S . A. Vinokurov...Gorbunov, A. S . Kaminskiy; ZHURNAL EKSPERIMENTALNOY I TEORETICHESKOY FIZIKI, No 3(9),- -’"’ Sep 86) , ’.. ■ ■ \\ - b - Dependence of...Kokurin, N. Ye. Kuzmenko, et al.; KVANTOVAYA ELEKTRONIKA, No 12, Dec 86) 17 Kinematic Mode Locking in Continuous-Wave YAG:Nd3 Ring Laser (L. S
JPRS Report, Science & Technology USSR: Chemistry
1991-05-02
91] 11 Using Ftorlon Fabric for the Diaphragms of Hydrochloric Acid Electrolyzers [Ye.M. Levinskiy, V.l. Barmashenko, et ai; KHIMICHESKAYA...that boron trifluoride was used in an adsorbed state over a neutral carrier and not complexed with strong inorganic acids . Because of this carrier...the Diaphragms of Hydrochloric Acid Electrolyzers 917M0069I Kiev KHIMICHESKAYA TEKHNOLOGIYA in Russian No 1, Jan-Fcb 91 (manuscript received 13 Nov
Clinical Investigation Program.
1981-10-01
Tomographic (CT) Appearance of the ryc- cardium After Neversible and Irreversible Ischemic Injury . 29th Annual Meeting of the Association of University...Orthopedic Surgeons, San Antonio, TX, Nov 1980. (C) Greenfield, G. Q., Jr.: Injuries Related to Rollerskating. Annual Mleeting, Society of Military...volume reduction odiumw balance A c-umuatie-.EDLASE I E st Ac cumul a ti ye Perio -di-c ............ Lost: LOA Cost: $1LO0. Review Results: Continue
1987-07-17
Yuhua Guan, Gillian C. Lynch and Donald L. Thompson Department of Chemistry, Oklahoma State University, Stillwater, OK 74078 Classical trajectories...P20 PHOTOFRAGMrTATION OF ALKYL IODIDES -- Photofragmentation Channels and Energy Partitioning of the Fragments Qihe Zhu, Shouling Huang, J.R. Cao , Ye...Chemistry (314) 553-5344 Upton, NY 11973 (516) 282-4348 Dr. William L. Hase Wayne State University Dr. Yuhua Guan 435 Chemistry Department of Chemistry
1985-08-16
of the thermal interaction of polonium - 210 with palladium and iridium. The vacuum-thermal method of direct synthesis was used, a study of the...ZHURNAL -PRIKLADNOY KHIMII, No k, Apr 85) Ik CATALYSIS Effect of Intermetallic Compounds Zr-Co Composition on Their Catalytic Properties in...KHIMICHESKAYA, No U, Apr 85) IT Effect of Stabilization on Adsorption and Catalytic Properties of Electrodeposited Platinum Catalysts (T. M. Grishina, Ye. V
JPRS Report, Soviet Union, Political Affairs
1989-05-18
crops and grapes which go from production plan was less than half fulfilled, said Viktor here to the city market . This brings the farm a good deal...hurriedly describing the advan- that go back to the days of communal existence- tages of the market from the point of view of effective - traditions of...Ye. Dodolev; MOSKOVSKA YA PRA VDA, 31 Dec 88; 3, 4 Jan 89] ......................................................... 59 Evaluating Effectiveness of
Sensing Biological, Chemical, and Radiation Hazards in Harsh Environment
2013-07-05
has supported research to develop multimodal microcantilever gas sensing, to investiate the mechanical properties of Zn and Sn oxide nanobelts for...properties of Zn and Sn oxide nanobelts for mechanical detection, nanoscale assembly of magnetic nanomaterials into user defined shapes, noise properties of...2013 1.00 L. Ye, B. Terry, O. T. Mefford, C. Rinaldi, T. M. Crawford. All- nanoparticle concave diffraction grating fabricated by self-assembly onto
2014-08-11
methods for determining potential human health hazards , especially in field environment set- tings. We described the development of sensitive and specific...Smith, Department of Microbiology , Immunology and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort...2012. Adapted Tembusu-like virus in chickens and geese in China. J Clin Microbiol 50: 2807–2809. 7. Yun T, Ye W, Ni Z, Zhang D, Zhang C, 2012
Martins, Z E; Pinho, O; Ferreira, I M P L V O
2017-09-01
The use of agroindustry by-products (BP) for fortification of wheat bread can be an alternative to waste disposal because BP are appealing sources of dietary fiber. Moreover, it may also contribute to indirect income generation. In this study, sensory, color, and crumb structure properties of breads fortified with fiber rich fraction recovered from four types of agroindustry BP were tested, namely orange (OE), pomegranate (PE), elderberry (EE), and spent yeast (YE). Statistical models for sensory preference evaluation and correlation with color and crumb structure were developed. External preference mapping indicated consumer preferences and enabled selection of the concentrations of BP fibre-rich fraction with best acceptance, namely 7.0% EE, 2.5% OE, 5.0% PE, and 2.5% YE. Data collected from image analysis complemented sensory profile information, whereas multivariate PLS regression provided information on the relationship between "crust color" and "crumb color" and instrumental data. Regression models developed for both sensory attributes presented good fitting (R 2 Y > 0.700) and predictive ability (Q 2 > 0.500), with low RMSE. Crust and crumb a* parameters had a positive influence on "crust color" and "crumb color" models, while crust L* and b* had a negative influence. © 2017 Institute of Food Technologists®.
Self-Consistent Frequency Sweeping of TAE mode
NASA Astrophysics Data System (ADS)
Wang, Ge
2012-03-01
We have extended our intuitive Toroidal Alfven Wave (TAE) model [1] for describing spontaneous frequency sweeping by a destabilizing component of energetic particles. Now a fully developed self-consistent description for frequency sweeping of an isolated TAE mode has been developed. As in [1], we use the Rosenbluth, Berk,Van Dam tip theory [2], valid for low beta, large aspect ratio, circular tokamaks, to describe the evolution of the TAE wave equation. The wave is coupled to the particle dynamics that uses the Berk, Breizman, Ye map model [3] to construct the particle/wave Lagrangian associated with a phase space dependent mode structure. Then together with the appropriate Vlasov equation for describing the particle dynamics, a set of equations determining the dynamics of the system has been formulated. Adiabatic solutions have been obtained and work is underway in simulating the exact nonlinear dynamics. A status report of our results will be given at the meeting. [4pt] [1] G. Wang and H. L. Berk, Communication in Nonlinear Science and Numerical Simulation 17, 2179 (2012) [0pt] [2] M. N. Rosenbluth,; H. L. Berk, J. Van Dam and D. M. Lingberg, Phys. Rev. Lett. 68, 596 (1992). [0pt] [3] Berk, H.L.; Breizman, B.N.; Ye, H. In: Physics of Fluids B 51993, 1506 (1993)
Naoumkina, Marina A; He, XianZhi; Dixon, Richard A
2008-01-01
Background Exposure of Medicago truncatula cell suspension cultures to pathogen or wound signals leads to accumulation of various classes of flavonoid and/or triterpene defense molecules, orchestrated via a complex signalling network in which transcription factors (TFs) are essential components. Results In this study, we analyzed TFs responding to yeast elicitor (YE) or methyl jasmonate (MJ). From 502 differentially expressed TFs, WRKY and AP2/EREBP gene families were over-represented among YE-induced genes whereas Basic Helix-Loop-Helix (bHLH) family members were more over-represented among the MJ-induced genes. Jasmonate ZIM-domain (JAZ) transcriptional regulators were highly induced by MJ treatment. To investigate potential involvement of WRKY TFs in signalling, we expressed four Medicago WRKY genes in tobacco. Levels of soluble and wall bound phenolic compounds and lignin were increased in all cases. WRKY W109669 also induced tobacco endo-1,3-β-glucanase (NtPR2) and enhanced the systemic defense response to tobacco mosaic virus in transgenic tobacco plants. Conclusion These results confirm that Medicago WRKY TFs have broad roles in orchestrating metabolic responses to biotic stress, and that they also represent potentially valuable reagents for engineering metabolic changes that impact pathogen resistance. PMID:19102779
Niu, Canfang; Yang, Peilong; Luo, Huiying; Huang, Huoqing; Wang, Yaru; Yao, Bin
2017-08-30
Susceptibility to proteases usually limits the application of phytase. We sought to improve the pepsin and trypsin resistance of YeAPPA from Yersinia enterocolitica and YkAPPA from Y. kristensenii by optimizing amino acid polarity and charge. The predicted pepsin/trypsin cleavage sites F89/K226 in pepsin/trypsin-sensitive YeAPPA and the corresponding sites (F89/E226) in pepsin-sensitive but trypsin-resistant YkAPPA were substituted with S and H, respectively. Six variants were produced in Pichia pastoris for catalytic and biochemical characterization. F89S, E226H, and F89S/E226H elevated pepsin resistance and thermostability and K226H and F89S/K226H improved pepsin and trypsin resistance and stability at 60 °C and low pH. All the variants increased the ability of the proteins to hydrolyze phytate in corn meal by 2.6-14.9-fold in the presence of pepsin at 37 °C and low pH. This study developed a genetic manipulation strategy specific for pepsin/trypsin-sensitive phytases that can improve enzyme tolerance against proteases and heat and benefit the food and feed industry in a cost-effective way.
Comfort Ye My People: Chaplains, Spiritual Care, and Operational Stress Injury
2011-04-30
differently, offering "both ·a degree of predictability and an element of surprise.ඉ In the Hebrew Scriptures we read of Jacob who wrestles through...by the use of spiritual practices such as: prayer, meditation, Yoga, Bible reading, reading of other sacred Scripture, a twelve-step program
1974-11-01
obvioun that they were’ dkep]y corncented a d halrd at work in &,tvrloping meaw to masure their rmT effectiveness . This proposed eval- tiatiot plIn wilt be...AD/A-002 532 MEASURES OF EFFECTIVENESS -CONUS REORCAN- IZATION 1973 (AS PERTAINS TO FORSCOM. TRADOC, HSC, OTEA AND CAA). VOLUME I.EXECUTIVE SUMMARY M...resulting Interaction organizational objective goal effectiveness imovati ye chanuge vrasurement are a The study provider, an evaluatinn plan, "ased
Development of Technologies for Early Detection and Stratification of Breast Cancer
2016-12-01
heterogeneous nature of these cells. Figure 17 shows a yellow emitting Pdot (semiconducting polymer dot), which is a new family of ultra-bright fluorescent...Yu, J., Zhang, X., Sun, W., Ye, F., Wu, I., Zhang, Y., Hayden, S., Zhang, Y., Wu, C., Chiu, D.T. "New yellow fluorescent semiconducting polymer dots...fluorescent fluorinated semiconducting polymer dots for cellular imaging and analysis" Chemical Communication, 2013, 49, 8256-8258. • Zhao, M., Wei, B
Current Chinese Leadership: Background, Associations, and Issues for Selected Key Military Leaders
1985-09-01
58 years old). Key leaders classified as conservative, such as Ye Jianying and Xu Xiangqian, lost their influential positions in September 1985...Cmte, CCP-CC (since Oct 83); VC, Central Greening Cmte (since Feb 82) Name;Jiang Xianchen Position; Deputy Chief, PLA GSD (since Mar 85) Name; Li ...Guang Position; Dir, Weapons & Equipment Dept, PLA GSD (since Nov 82) Name; Li Jing Position; Dep Cdr, PLA Navy (since Jul 83) Name; Li Jiulong
JPRS Report, Science & Technology, USSR: Life Sciences
1988-04-05
Order Boundary Conditions [A.N. Zaikin; BIOFIZIKA, Nov-Dec 87] 4 Biotechnology Optimization of Batch Cultivation of Biomass [Ye.G. Kosman, I.P...Vol 297, No 4 , Dec 87 (manuscript received 17 Jul 87) pp 1018-1021 [Article by I.B. Kaplan, S.I. Malyshenko, A.B. Fedina, M.E. Talyanskiy, M.Ya...Crosslinking and Effects on Combination of Retinal With Bacterioopsin 18400193 Moscow BIOLOGICHESKIYE MEMBRANY in Russian Vol 4 , No 11, Nov 87
Multifunctional Poly(2,5-benzimidazole)/Carbon Nanotube Composite Films
2010-01-01
Multifunctional Poly(2,5- benzimidazole )/Carbon Nanotube Composite Films JI-YE KANG,1 SOO-MI EO,1 IN-YUP JEON,1 YEONG SUK CHOI,2 LOON-SENG TAN,3 JONG...molecular-weight poly(2,5- benzimidazole ) (ABPBI). ABPBI/carbon nanotube (CNT) compo- sites were prepared via in situ polymerization of the AB-monomer in the...polymerization; multiwalled carbon nanotube (MWCNT); nano- composites; poly(2,5- benzimidazole ); (ABPBI); polycondensa- tion; poly(phosphoric acid); single-walled
Bibliography of Soviet Laser Developments, Number 52, March - April 1981.
1982-05-17
KNbOj crystal and pumped by the second harmonic of a YAG laser. KE, no. 4, 1981, 715-721. 187. Soldatov, A.N., V.B. Sukhanov , Yu.P. Polunin, and A.I...27.63SLOBODYANYUC A V 36 SUENDER D 96 TOLSTOY M N 7SNIRNOY A N 88 SUKHANOV V B 30 TOMCHUK YE YA 59SMIRNOY D F 37 SUI(HANOVA G3 B 15 TOHILINA V 1 60S?4IRNOV S
Precision Atomic Beam Laser Spectroscopy
1999-02-20
optical efficiency with a new coupled- cavity scheme. We have locked a MISER Nd:YAG laser to a finesse 50,000 cavity with a...sensitivity of optical heterodyne detection is preserved with ZERO sensitivity to small laser / cavity frequency noises. The new method is called Noise-Immune...1996), P. Dube, L.- S. Ma, J. Ye, and J.L.Hall. 9 . "Free-induction decay in molecular iodine measured with an extended - cavity diode laser ,"
2012-08-01
pp. 4–9. 46. Ye, Liang; Tong, Ming Wei; Zeng, Xin Design and Analysis of Multiple Parallel-pass Condensers. International Journal of Refrigeration...we mean energy that has low availability to do work (low exergy ). The closer a system is to the condition of its surroundings in terms of...vehicle with a gasoline internal combustion engine loses 40% of its fuel energy through the exhaust gas, which is still at a relatively high
JPRS Report, Science & Technology, USSR: Life Sciences
1987-07-09
87) 59 Prophylactic Effectiveness of Epsilon- Aminocaproic Acid (EACA) on Influenza in Mice (L.Ye. Puzis, V.P. Lozitskiy, et al.; ACTA VIROLOGICA...EFFECTIVENESS OF EPSILON- AMINOCAPROIC ACID (EACA) ON INFLUENZA IN MICE Bratislava ACTA VIROLOGICA in Russian Vol 30, No 1, Jan 86 (manuscript received 17...MEDITSINSKOY KHIMII, No 4, Jul-Aug 86) 59 Effects of Novel Antineoplastic Blastozole on Nucleic Acid Levels and DNA Synthesis in Cancer Cells (S.N
Bibliography of Soviet Laser Developments, March-April 1988
1988-08-01
f. Iodine g. Hydrogen h. Ammonia --- i. Carbon Tetrafluoride --- j. Nitrous Oxide k. Water Vapor I. Heavy-Water Vapor --- m. Submillimeter --- n...1988, 25-26. 36. Porskiy, Yu.Ye.; Sitenkov, Yu.L.; Khokhlov, Yu.M. (-0-). Influence of the discharge circuit inductance on the value of specific...Hydrogen h. Ammonia i. Carbon Tetrafluoride j. Nitrous Oxide k. Water Vapor 1. Heavy-Water Vapor m. Submillimeter 9 n. Metal Vapor 59. Astadzhov, D.N
1993-10-17
34, "in criteria, and scoring each applicable high resolution mode’, "within 10 minutes of element as I (satisfactory) or 0 power -on...everone ese, humanity. We humans are kowledg limited and we The specificatio concept development design, and ye the problem caused by that limitation...human task that is component, we would have 53=125 integration spaces. within the power of a normal, single, specialized As you can imagine this could
Bibliography of Soviet Laser Developments, No. 17, July - September 1974
1975-01-29
A . N. Tokare and V . M. Usova (0). Effect of structural differ va. ences in flashlamps on the efficiency of solid state lasers...USATYUK, V.V. USHAKOV. A . Yt». USMANOV, A . G. USMANOV, R.G. USOVA , V . M. UZKIY. A . E. VALYASHKO, YE.G. VAREOLOMEYEV. A.A...ot’ power oulpul In a ruby laser with self-Q- switching. ZhPS, v . 20, no. 6, 1974, 987-989. 2, Kopvillem, U. Kh. , V .
Bibliography of Soviet Laser Developments
1975-09-22
Nagibarov, V. R. , I. A. Nagibarova, and A. M. Shegeda (0). Nonresonant supermigration [of energy ] in concentrated specimens of ruby. ZhETF P...Korniyenko (1). Relationship of luminescence energies of various transitions with the metastable level of the Nd ion in glass. KE, no. 2, 1975...12Ye8) 98. 99. 100. Anan’kin, A. I. (0). Calculating the energy characteriitJcs of a thermally excited CG-, laser. KE, no. 1, 1975
USA: Economics, Politics, Ideology No. 7, Jul 1978
1978-09-22
121 United States and Canadian Underwater Vehicles ( I . B . Ikonnikov, G . P. Lisov) 122 Book Reviews Washington’s Budget Policy, "by Ye. P...Federal Program Information Bill (A.A. Voronkov, G . B . Kochetkov) 105 Focus on Western Europe (T. V. Oberemko) 112 - a - [III - USSR - 39...well, and the exam will, hopefully, corroborate this. Each student can select a particular topic in advance for in-depth study; during the exam, I
USSR Report, Life Sciences Biomedical and Behavioral Sciences.
1987-05-13
Activities of Selected Organoboron Compounds (A.N. Lukashik, A.A. Malama, et al.; MIKOLOGIYA I FTTOPATOLOGIYA, No 5, Sep-Oct 86) .35 - e - Mycotic Flora... Compounds (G.B. Pliss, N.N. Antashkova, et al.; VOPROSY ONKOLOGII, No 7, Jul 86). • • 94 Review of Book on Protection of Machinery From Biodegradation...Jul 85) pp 746-751 [Article by K.Ye. Dorokhov and G.L. Grigoryan, Scientific Research Institute for Biological Testing of Chemical Compounds
JPRS Report, Soviet Union, Political Affairs.
1989-10-03
18000602 Moscow PRA VDA in Russian 2 Aug 88 p 3 [Article by I . Zarakhovich and T . Trukhacheva, journal- ists, and Ye. Sokolova, member, Central Council...QTJAUn INSP1CH3B t Soviet Union Political Affairs JPRS-UPA-88-044 CONTENTS 03 OCTOBER 1989 PARTY, STATE AFFAIRS History of Formation of Nagorno...Advocated //. Zarakhovich, T . Trukhacheva; PRAVDA, 2 Aug 88] 86 REGIONAL ISSUES Biologist on Costs of Pollution Control Measures [A. Valentey
JPRS Report, Science & Technology, USSR: Science & Technology Policy
1990-09-18
Ye. Ponarina; POISK, 22-28 Jun 90] .. ■ ■ 7 People’s Deputies Propose Scientific- Industrial Union [SOVETSKAYA ROSSIYA, 18 May 90] 10...achievements of science and tech- nology in industry and other spheres of life, and for material and technical and financial support for the planned work, and...low: even in machine building it does not exceed 40 percent. Due to the slow penetration in industry of new techno- logical processes and systems
Immunological Study of the O-Antigens of Streptomycin-Dependent Mutants of Salmonella
1974-10-23
AD/A-O00 361 IMMUNOLOGICAL STUDY OF THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA L. S. Edvabnaya, et al Foreign Technology Division...U. S. Air Force SREPORT TITLE IMMUNOLOGICAL STUDY OF THE 0-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA 4 DCESCRIPTIVIE NOTES (?T’pe of...THE O-ANTIGENS OF STREPTOMYCIN-DEPENDENT MUTANTS OF SALMONELLA By: L. S. Yedvabnaya, Ye. S. Stanislavskiy, and V. V. Sergeyev Englihs pages: 10 Source
JPRS Report, Science & Technology USSR: Lift Sciences
1987-07-17
Viral Diseases and Productivity (A.D. Bobyr, A.A. Barkalova; MIKROBIOLOGICHESKIY ZHURNAL, No 5, Sep-Oct 86) 3 Culture Age as Factor in...Proteinase Production by Bacillus Subtilis (V.V. Artemov, Ye.L. Barskiy, et al.; BIOKHIMIYA, No 5, May 86).. 14 Inhibition of Glutamate Synthetase...I KLETKA, No 4, Jul-Aug 86) 27 Production of Recipient Yeasts for Stable Reproduction of Vectors Involving 2 Micron DNA (O.V. Nevzglyadova, A.G
Ceramics for High Power Lasers
2011-12-01
Y3Al5O12”, Applied Physics Letters, 93, 191902 (2008) [2] I. Sakaguchi et al., J . Am. Ceram. Soc. 79 (1996), 1627 [3] http://www.vloc.com/PDFs...of growth defects in synthetic quartz crystals by light-scattering tomography “ J . Crystal Growth, Volume 44, Issue 1, August 1978, Pages 53-60...Investigator Romain Gaume - Research Scientist Roger Route - Senior Research Associate Ye He - Graduate Student Research Assistant V. Publications
2016-06-03
Ultracold Atoms 5:10 Zelevinsky Ye Inouye High-precision spectroscopy with two-body quantum systems Low entropy quantum gas of polar molecules New limit...12th US-Japan Seminar: Many Body Quantum Systems from Quantum Gases to Metrology and Information Processing Support was provided for The 12th US...Japan Seminar on many body quantum systems which was held in Madison, Wisconsin from September 20 to 24, 2015 at the Monona Terrace Convention Center
Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A
2016-01-01
Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga - based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga- na
Braun, Tosca D; Park, Crystal L; Gorin, Amy A; Garivaltis, Hilary; Noggle, Jessica J; Conboy, Lisa A
2016-09-01
Overweight/obesity is a pressing international health concern and conventional treatments demonstrate poor long-term efficacy. Preliminary evidence suggests yoga and Ayurveda may be promising approaches, although recent NHIS estimates indicate rare utilization of Ayurveda in the US. Group-based curricula that integrate yoga and Ayurveda-inspired principles to attenuate overweight and obesity across individuals may prove a feasible, disseminable clinical adjunct to facilitate psychosocial health and weight loss and/or maintenance. Determine feasibility and preliminary effectiveness of a ten-week yoga-based, Ayurveda-inspired weight management curriculum (YWL) piloted in female yoga practitioners (Study 1) then refined and tailored for yoga naïves (Study 2), on self-reported psychosocial process variables and % of self-reported total body weight loss (%TBWL). Study 1 enrolled 22 yoga-experienced women (48.2 ± 14.3 years, BMI 30.8 ± 4.2 kg/m2) in a 10-week yoga-based program (YWL-YE). Study 2 enrolled 21 yoga- naïve women (49.4 ± 10.7 years, BMI 35.5 ± 6.8 kg/m2) in a revised 10-week program (YWL-YN). Self-reported weight and self-ratings of mindful eating behavior, body image disturbance, weight loss self-efficacy, body awareness, and self-compassion were collected at baseline, post-treatment (T2), and 3-month follow- up (T3). YWL curricula was feasible in both studies. While attrition rates for both studies favorably compared to other weight management studies, attrition was higher for YWL-YN (28.6%) than YWL-YE (18.2%). In both studies, self-reported process variables and self-reported % TBWL changed in hypothesized directions at T2 and evidenced greater improvement at T3; effect sizes across all process variables were medium (-0.4) to large (-1.8). % TBWL reached clinical significance (>5%) only at T3 for the YWL-YE group. The YWL curricula employed here appear to improve psychosocial health among both overweight/obese yoga-experienced and yoga-naïve women
1987-05-01
a ;-A.act! ye Cune led mcl.t. a Iong I l’ nlortheasternf p i- tcr of ; e s~ e e uA n it w,’a 0 .;Taq"eI t1bf td o tie re:’ p. *, a. ~: t I..c() rvf ...just starting so they maue extra money selling milk to the Lniners. Thv-y kept eight or ten dairy cows and a small hierd of cattle. Th-e famrilly herded
Instructional Videos for Unsupervised Harvesting and Learning of Action Examples
2014-11-03
collection of image or video anno - tations has been tackled in different ways, but most existing methods still require a human in the loop. The...the views of ARO and NSF. 7. REFERENCES [1] C.-C. Chang and C.- J . Lin. LIBSVM: A library for support vector machines. In ACM Transactions on...feature encoding methods. In BMVC, 2011. [3] J . Chen, Y. Cui, G. Ye, D. Liu, and S.-F. Chang. Event-driven semantic concept discovery by exploiting
1982-10-06
Under %he peculiar conditions of Second World War this Leninist prediction/forecast completely justified. The process of the nonuniform development of...and resourcefulness were required heroines Ye. G. Mazanik, N. V. Troyan and M. B. Osipovoy in order to select into the very lair of deputy Hitler in...the front, in the rear, in the lair of enemy - to give entire their energy to the work of victory were that decisive force which gave rise to the mass
Modeling, Analysis, and Control of Swarming Agents in a Probabilistic Framework
2012-11-01
configurations, which can ultimately lead the swarm towards configurations close to the global minimum of the total potential of interactions. The drawback ...165–171, 1992. [6] H. Ye, H. Wang, and H. Wang, “Stabilization of a PVTOL aircraft and an inertia wheel pendulum using saturation technique,” IEEE...estimate its parameters. The drawback of this approach is that the assumed form of the field can be unrealistic. In the approach that we are presenting here
Translations on Narcotics and Dangerous Drugs, Number 278
1976-12-30
present. Cabinet’s decision was announced yesterday by the Minister for business and consumer affairs, Mr Howard, who said the new penalties would be im...BEHIND OPIUM TRAFFICKING Rangoon BOTATAUNG in Burmese 13 Dec 76 p 5 BK /Article by Ye Mya Win: "The Communist Party of Burma Is Doing Good Business ...Lashio, Kunlong and Muse have then sent out their men to buy these goods for redistribution. There is also another business : brandishing their arms
2015-04-24
xs , ys , xe , ye ) double EndPo in t s [L...Distribution Statement A. Approved for public release. #26161 350 400 450 100 150 200 250 300 350 400 450 500 550 600 x (m) y (m ) Start Target U0 = 10...longitudinal speed 350 400 450 100 150 200 250 300 350 400 450 500 550 600 x (m) y (m ) Start Target (a) Trajectory 0 5 10 15 0 1 t (s) f ( U0 = 30
Bibliography of Soviet Laser Developments, Number 76, March - April 1985.
1986-06-01
515. Andreyeva, O.V.; Sukhanov , V.I.; Khazova, M.V. 0 * Experimental study on the optical characteristics of * developed layers for three-dimensional...holograms. ZNPFA, no. 6, 1985, 435-438. (RZFZA, 85/3L814). 516. Andreyeva, O.V.; Sukhanov , V.I.; Rhazova, M.V. 0 Relationship of the refractive index... Sukhanov , V.I.; Ashcheulov, Yu.V.; Petnikov, A.Ye. (GOI). Method of measuring values of the diffraction * efficiency of 3D phase holograms. OPMPA, no. 4
ONRASIA Scientific Information Bulletin. Volume 17, Number 4, October - December 1992
1992-12-01
department tero-technology, and technology location is less congested and much Optical devices chair assessment), and eight endowed greener than that of the...chemi- Tel: +81 3-3481-4411 had been a very good advertisement cal compound design. Some details for Al, and in fact had moved stu- and references are...Point ment for online system. Automatesvolume, of Sale data. setting of parameters when new ter- Daa ye m c t o f Facg (ra ne minal is introduced
Bi-local holography in the SYK model
Jevicki, Antal; Suzuki, Kenta; Yoon, Junggi
2016-07-01
We discuss large N rules of the Sachdev-Ye-Kitaev model and the bi-local representation of holography of this theory. This is done by establishing 1/N Feynman rules in terms of bi-local propagators and vertices, which can be evaluated following the recent procedure of Polchinski and Rosenhaus. Lastly, these rules can be interpreted as Witten type diagrams of the dual AdS theory, which we are able to define at IR fixed point and off.
The Legality of al-Qaeda’s Jihad
2011-05-19
directly from the Koran in such verses as, “Allah promiseth you much booty that ye will capture, and hath given you this in advance, and hath withheld...jihad and how it is to be divided. According to al- Misri, Muslim men waging jihad are entitled to personal booty and a share of the collective spoils...provided they participated in the battle to the end of it. Eligibility for the personal booty requires that the jihadist overcome enemy resistance
Inversion of Ionospheric Backscatter Radar Data in Order to Map and Model the Ionosphere
2006-08-17
M., Wild, J . A., Lester, M., Yeoman, T . K., Milan, S. E., Ye, H., Devlin, J . C., Frey, H. U., and Kikuchi, T ., Interhemispheric asymmetries in the...Devlin, J . and Salim, T ., Evaluation of Digital Generation and Phasing Techniques for Transmitter Signals of the TIGER N.Z. Radar. WARS02 (Workshop on...17. Conde, M. and Dyson, P. L., Thermospheric Vertical Winds Above Mawson , Antarctica, J . Atmos. Terr. Phys., Vol. 57, 589-596, 1995. 18. Conde, M
1960-07-29
changes. A broad application of ascorbic acid in the therapy of inflammatory and degenerative ailments of the cornea was proposed. Ye. M. Orlova...accumulation of cholesterol and phosphatides occurs, leading to an opacity of the fibers. In X-ray cataract the opacity of the fibers apparently occurs...corneal spots and the indices he had developed for repeated transplant of the cornea . The reports of Cand. of Med. Sei. N. I. Pil’man (Kiev; and Cand
Installation Restoration Program. Phase 1. Records Search Andrews AFB. Maryland
1985-06-01
red to silvery-qrey, functions ma a conf ining bed. Formation. ~Va plastics thin lonses of pole gray silt. Ann"a Formation. ye (0-210 sand, qrsenieh...the Nanjemoy Formation (a clayey glauconi- tic sand, two to thirty feet thick) and the Marlboro Clay (a plastic clay with silt partings, two to... plastics , empty 55-gallon drums, waste lumber, tires, pipes, and hospital wastes such as unused needles and chemical reagents. In the past, Site D-4 was
Excitatory Amino Acids as Transmitters in the Brain
1989-04-30
Amino Acids as Transmitters in the Brain 12 PERSONAL AUTHOR(S) Cotman, C.W. 13a TYPE OF REPORT 1i3b TIME OYERED 14. DATE OF REPORT (Ye, Month, Day) 5s...necenearia i dentf by block number) FIEL.D GROUP SBGOP Excitatory receptors, excitatory amino acids , excitotoxicit N-methyl-D-aspartate, kainate...mediated by excitatory amino acids and their receptors. These receptors participate in both standard synaptic transmission as well as higher order
Transplantation analysis of developmental mechanisms in Hydra.
Shimizu, Hiroshi
2012-01-01
Since the pioneering work of Ethel Browne (1909) who demonstrated for the first time the concept of organizer activity, i.e. the potency of an apical Hydra tissue to induce a secondary axis when transplanted onto a host, Hydra flourished as a fruitful model system for developmental studies. Over the next 60 years this efficient transplantation approach identified graded biological activities along the body column of Hydra named Head Acti-vation and Head Inhibition. These properties inspired theoretical modelers including Lewis Wolpert, Alfred Gierer and Hans Meinhardt to propose models for morphogenesis, respectively the positional information (1969) and reaction-diffusion (1972) models. In 1973, Tsutomu Sugiyama and Toshitaka Fujisawa initiated in Mishima a unique project to analyze the properties of Hydra strains with distinct morphological and developmental characters. To this end, they collected in several areas of Japan multiple Hydra strains that they subsequently characterized and crossed. They also established a lateral transplantation strategy that was much more powerful than the previous ones, as it combined quantitative measurements with cellular analyses thanks to the chimera procedures developed by Campbell and colleagues. In-deed this approach provided a paradigm to quantify in any morphological phenotype the Head Activation and Head Inhibition levels along the body column. In this article, I review the various strains identified by Sugiyama and colleagues, the principles and the main results deduced from the quantitative lateral transplantation strategy. In addition, I briefly discuss the relevance of this approach in the era of molecular biology.
Observations of the new Camelopardalids meteor shower using a 38.9 MHz radar at Mohe, China
NASA Astrophysics Data System (ADS)
Younger, J. P.; Reid, I. M.; Li, G.; Ning, B.; Hu, L.
2015-06-01
The Camelopardalids meteor shower was predicted to occur for the first time on 24 May 2014, based on optical observations of the comet 209P/LINEAR. Using a 38.9 MHz meteor radar located at Mohe, China, we were able to detect approximately 590 shower meteors originating from an average pre-infall radiant of R.A. = 129.1° ± 9.8°, declination = 79.4° ± 1.6° (J2000) with a geocentric velocity of 16.0 ± 1.6 km s-1. Measurements of the shower duration, direction, velocity, and individual meteor detection heights facilitated a detailed analysis of the parent debris stream. Orbital parameters were calculated including a semi-major axis of 2.86 AU, eccentricity of 0.659, and inclination of 21.1°. Combining orbital parameters with the shower activity duration FWHM of 5.09 h, it was found that the stream has a FWHM of at least 211,000 km at 1 AU, as measured perpendicular to the direction of orbital motion. A comparison of shower meteor detection heights and diffusion coefficient estimates with the sporadic background is consistent the prediction of Ye and Wiegert (Ye, Q., Wiegert, P. [2014]. Mon. Not. R. Astron. Soc. 437, 3283-3287) that Camelopardalid meteoroids are biased towards larger sizes or that Cameloppardalid meteoroids are less fragile than sporadic background meteoroids.
Rubio-Moraga, Angela; Candel-Perez, David; Lucas-Borja, Manuel E; Tiscar, Pedro A; Viñegla, Benjamin; Linares, Juan C; Gómez-Gómez, Lourdes; Ahrazem, Oussama
2012-01-01
Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA) and Nei's genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst) was 0.233. Cuenca showed the highest Nei's genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups-Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco-while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR) method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra.
Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio
2015-01-01
This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164
Silva-Angulo, Angela B; Zanini, Surama F; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio
2015-01-01
This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 10(2) and 10(6) cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral.
Initiator system in holographic photopolymer materials
NASA Astrophysics Data System (ADS)
Ortuño, M.; Fernández, E.; Fuentes, R.; Gallego, S.; Márquez, A.
2010-05-01
The photopolymers with a hydrophilic matrix as poly(vinyl alcohol), PVA, are versatile holographic recording materials in hologram recording experiments. They use water as solvent and they can be made in layers with several thickness. One of the photopolymers more used is composed of acrylamide as polymerizable monomer, PVA and water as binder. The pair: triethanolamine, TEA, and the dye yellowish eosin, YE, is widely used as initiator system due to its high sensitivity and efficiency. TEA is the radical initiator more used with dyes derived from fluorescein as YE because they can generate a radical by redox reaction under dye excitation by light. The dye is bleached in this process because is decomposed in the photoinitiation reaction. The ethylenediaminetetraacetic acid EDTA has a molecular structure very similar to TEA and therefore could replace it in this kind of photopolymers. The 4,4' azo-bis-(4-cyanopentanoic acid), ACPA, is a radical initiator that is soluble in water and usually used in polymerizations in solution with thermal initiation. In this work, we use EDTA and ACPA in order to check their properties as radical initiator in the photochemical reaction that takes place inside the photopolymer while a hologram is being recorded. We will compare the results obtained with those derived from TEA and will evaluate the possibilities for these substances.
Van Damme, Inge; Berkvens, Dirk; De Zutter, Lieven
2012-07-01
The objective of this study was to determine the effect of sampling (swab samples compared to destructive samples) on isolation rates of human pathogenic Yersinia enterocolitica from pig tonsils. Moreover, the relative efficiency of different rapid, routinely applicable isolation methods was evaluated. Therefore, swab and destructive samples from tonsils of 120 pigs at slaughter were analyzed in parallel using direct plating and different enrichment methods. Salmonella-Shigella-desoxycholate-calcium chloride (SSDC) agar, cefsulodin-irgasan-novobiocin (CIN) agar, and Yersinia enterocolitica chromogenic medium (YeCM) were used as selective agar media. For enrichment, irgasan-ticarcillin-potassium chlorate (ITC) broth and peptone-sorbitol-bile (PSB) broth were incubated at 25°C for 48 h. Overall, 55 tonsils (45.8%) were positive for Y. enterocolitica bioserotype 4/O:3. Recovery was significantly higher using the destructive method compared to the swabbing method. Direct plating resulted in 47 and 28 Y. enterocolitica-positive destructive and swab samples, respectively. Alkali treatment of PSB and ITC enrichment broths significantly increased recovery of pathogenic Y. enterocolitica from destructive tonsil samples. The performance of YeCM for qualitative and quantitative isolation of pathogenic Y. enterocolitica from pig tonsils was equal to SSDC and CIN. In conclusion, direct plating and ISO 10273: 2003 with minor modifications are suitable and rapid methods for isolation of pathogenic Y. enterocolitica from destructive tonsil samples.
Tian, Fei; Yang, Yonghui; Han, Shumin
2009-01-01
Water resources in North China have declined sharply in recent years. Low runoff (especially in the mountain areas) has been identified as the main factor. Hutuo River Basin (HRB), a typical up-stream basin in North China with two subcatchments (Ye and Hutuo River Catchments), was investigated in this study. Mann-Kendall test was used to determine the general trend of precipitation and runoff for 1960-1999. Then Sequential Mann-Kendall test was used to establish runoff slope-break from which the beginning point of sharp decline in runoff was determined. Finally, regression analysis was done to illustrate runoff decline via comparison of precipitation-runoff correlation for the period prior to and after sharp runoff decline. This was further verified by analysis of rainy season peak runoff flows. The results are as follows: (1) annual runoff decline in the basin is significant while that of precipitation is insignificant at alpha=0.05 confidence level; (2) sharp decline in runoff in Ye River Catchment (YRC) occurred in 1968 while that in Hutuo River Catchment (HRC) occurred in 1978; (3) based on the regression analysis, human activity has the highest impact on runoff decline in the basin. As runoff slope-breaks in both Catchments strongly coincided with increase in agricultural activity, agricultural water use is considered the dominate factor of runoff decline in the study area.
Wu, Xueyun; Yang, Dong; Zhu, Xiangcheng; Feng, Zhiyang; Lv, Zhengbin; Zhang, Yaozhou; Shen, Ben; Xu, Zhinan
2011-01-01
The heterologous production of iso-migrastatin (iso-MGS) was successfully demonstrated in an engineered S. lividans SB11002 strain, which was derived from S. lividans K4–114, following introduction of pBS11001, which harbored the entire mgs biosynthetic gene cluster. However, under similar fermentation conditions, the iso-MGS titer in the engineered strain was significantly lower than that in the native producer - Streptomyces platensis NRRL 18993. To circumvent the problem of low iso-MGS titers and to expand the utility of this heterologous system for iso-MGS biosynthesis and engineering, systematic optimization of the fermentation medium was carried out. The effects of major components in the cultivation medium, including carbon, organic and inorganic nitrogen sources, were investigated using a single factor optimization method. As a result, sucrose and yeast extract were determined to be the best carbon and organic nitrogen sources, resulting in optimized iso-MGS production. Conversely, all other inorganic nitrogen sources evaluated produced various levels of inhibition of iso-MGS production. The final optimized R2YE production medium produced iso-MGS with a titer of 86.5 mg/L, about 3.6-fold higher than that in the original R2YE medium, and 1.5 fold higher than that found within the native S. platensis NRRL 18993 producer. PMID:21625393
China Report RED FLAG No 13, 1 JULY 1986
1986-08-21
who were in Yanan to discuss the draft "Resolution." The group leaders, such as Li Fuchun, Ye Jianying , Nie Rongzhen, Liu Bocheng, and Chen Yi also...its nature is ’leftist’ opportunism. Compared with the two erroneous lines of Chen Duxiu and Li Lisan, this line is more perfect in form, of longer...comrades who had been attacked, including He Mengxiong, Lin Yunan, and Li Qiushi; and pointing out the important significance of the Zunyi meeting in
1986-10-10
Cooperation, by Liu Jienyang, Zhao Rueishan, Ze Fu .......... 35 > A Visit to the Institute of Guided Missile Technology, by Zhang Juzheng, Li Weiliang...4,. *1 .4 9- -I. .p *. .4 I-.- a. S.... .4 11 l.a. 9-.4 *49.4*~*9*~. ° - S’: Key: (1) Analyst Li Xien studies techniques hard in the field in...leader Chairman Hua, Vice Chairmen Ye Jianying , Deng Xiao- ping, Wang Dongxing and other leaders of the party, state and militaryarrived at the
USSR and Eastern Europe Scientific Abstracts, Materials Science and Metallurgy, Number 54
1978-06-28
DEFEKTOSKOPIYA in Russian No 2, Feb 78 pp 49-52 manuscript received 28 Feb 77 DEVYATCHENKO, L. D., YESIPOV, I. V. , BATURINA, S. K., KIRILLOVA, G . K...received 10 Apr 77 KARPINOS, D. M., MAKSIMOVICH, G . G ., LYUTYY, YE. M., FILIPOVSKIY, A. V., and KADYROV, V. KH., Physico-Mechanical Institute and the...OBRABOTKI MATERIALOV in Russian No 1, Jan/Feb 78 pp 149-151 manuscript received 20 Jun 77 KARPINOS, D. M. and ZIL’BERBERG, V. G ., Kiev [Abstract] The
Bibliography of Soviet Laser Developments: January - February 1988
1989-02-21
Organic Dyes a. Miscellaneous 64. Alekseyeva,V.I.; Butakov,A.L.; Konin,V.N.; Lazareva,T.V.; Mirza,S.Yu.; Savvina,L.P.; Sukhanov ,V.B. 0. Study on the...laser with a longitudinal discharge. IVTAN. Preprint, no. 5-220, 1987, 1-40. (RZFZA, 88/1G508). 122. Yelayev,V.F.; Mirza,S.Yu.; Sukhanov ,V.B.; Troitskiy...Klyachkin,L.Ye.; Sukhanov ,V. L. 0. Technological possibilities for electric decoupling of photodetector mosaic elements used for optical image processing
Combustion Characteristics of Sprays
1989-08-01
Lin. T. H.. and Sohrab. S. H. (1987). On the transition oi’diffusion to premixed I’lames in consers.ed ssstem Cornhusio. Flume 68. 73. Mlizutani. Y ...and Nakauima. A. (1973a). Combustion of fuel vapor-drop-air systems: Part 1-Open burner flames. Combust. F/ante 21.14. Mizutani. Y .. and Nakajima. A...AFOSR LES Final Report. AFRPL. Sohrab. S. H.. Ye. Z. Y .. and Law~k C. K. (1984). An experimenial investication on ilame interaction ano the
1979-09-01
Suburban Rural,Farm___ ’.iod & and 20% Slope: s;teep 20 tied. 2Q% Slight 60%... ______ Fa.rks Nitial P-onlirg xea. 30 Acres; Ave. Depth 6’ lt priuzqt...dam failure? Yes I No .. Character Downstream Valley: Narrow x Wide _ Developed _ _ Rural 70Z Urban 30 , ’ Park Highway WW Railroad .3 k to life and...Location and Type:. Controls___, ’ype;_________________________ Aut~~c *.~n..l . Gperative Yes-___, No___ : W presen~t ’Ye X ,No . Operative Yes-, No___
USSR and Eastern Europe Scientific Abstracts, Engineering and Equipment, Number 39
1978-01-30
34 ’\\ v i \\ • . .1 DISTRIBUTION STATEMENT A Approved for Public Release Distribution Unlimited •’••*^.:- v ;;;.-’.i^ 20000405 198 U. S...1034 manuscript received 22 Feb 77 GOLUBINSKIY, A . I., and GOLYBKIN, V . N., Central Aerohydrodynamic Institute imeni N. Ye. Zhukovskiy [Abstract] A ...Russian Vol 232 No 3, 1977 pp 538-541 manuscript received 23 Apr 76 ZHEVNIN, A . A ., and T0L0KN0V, V . I., Moscow Higher Technical School imeni N. E
Bibliography of Soviet Laser Developments, Number 63, January-February 1983.
1984-02-01
properties of oxide crystals free of iron ions. Crystal Research and Technology [GDR), no. 7, 1982, 885-889. (RZhF, 1/83, 1D941) 5. Lebedev, V.I., V.A...and Yu.F. Suslov (0). Tellurium films as coatings for output mirrors in CO 2 laser resonators. Sb 1, 36-37. (RZhR, 2/83, 2Ye228) 7. Detectors 185...T.V. Timofeyeva, T.M. Vember, and A.F. Kavtrev (0). Sensitized photorefraction in block polymethylmethacrylate .containing lightly oxidizing anthracene
Unsolved Problems in Evolutionary Theory
1967-01-01
finding the probability of survival of a single new mutant). Most natural populations probably satisfy these conditions , as is illustrated by the...Ykl) of small quantities adding to zero. Then under suitable conditions on the function f(x), (3) xi + Yi,t+i = fi(x) + YE yjfi(tf) + O(y yt...It is clear that a sufficient condition for the point x to be locally stable is that all the roots of the matrix, (4) (a j) = ____ should have moduli
2005-04-01
enter S-phase but does not rescue endogenous histone expression (Ye et al. 2003). It is well known that HPV E7 inactivates Rb, the critical regulator...transcription during S-phase (McKnight 2003; Zheng et al. 2003), and with HiNF-P, a transcription factor critical for transactivation of histone H4 genes...CBP/p300 histone acetyltransferase to promote S-phase entry (Wang et al. 2004). Taken together, our work has allowed to demonstrate the critical role of
Analysis of Helicopter Mishaps at Heliports, Airports and Unimproved Sites
1991-01-01
Distance ___________ NM A Bearno a_________ ,.~ 400’n 4 Airport Category 5 Airport Certificatton (FAR M39 6 Emergency Plan Tested 7 Months Since...Emergency Plan Tested 1 0 Commerciai service ,0C Ful certrt,catio, 0 ye- 2 0 Reliever 2 [C Limireo certificatior I C 3 0 Ge’e-rai aviation None, Go to block...Aeriai application 8 1Public use 3, instructional (Incluaing air carrer training) 6 -IAerial observation 9 1Ferry A Soecit First PMot Information 87
1988-02-24
after that, it was Defense Minister Sokolov and 2 weeks later Lev Saikov, a mem - ber of the Politburo and a central committee secretary, visited...POL1TICHESKOYE OBRAZOVAN1YE in Russian No 12 Dec 87 signed to press 16 Nov 87 pp 114-120 [Article by MSZMP Central Committee Politburo Mem - ber and Central...work" which should above all find its expres- sion in: —the growth of political requirements on party mem - bers; —consolidation of a creative
Frank, We Hardly Knew Ye: The Very Personal Side of Frank Parsons
ERIC Educational Resources Information Center
Pope, Mark; Sveinsdottir, Maria
2005-01-01
This article is a detailing of the limited information available regarding the personal life of Frank Parsons, who is credited with founding the career counseling specialization of modern day professional counseling as well as all professional counseling and the related fields of vocational psychology and counseling psychology in the early 1900s.…
By their genes ye shall know them: genomic signatures of predatory bacteria
Pasternak, Zohar; Pietrokovski, Shmuel; Rotem, Or; Gophna, Uri; Lurie-Weinberger, Mor N; Jurkevitch, Edouard
2013-01-01
Predatory bacteria are taxonomically disparate, exhibit diverse predatory strategies and are widely distributed in varied environments. To date, their predatory phenotypes cannot be discerned in genome sequence data thereby limiting our understanding of bacterial predation, and of its impact in nature. Here, we define the ‘predatome,' that is, sets of protein families that reflect the phenotypes of predatory bacteria. The proteomes of all sequenced 11 predatory bacteria, including two de novo sequenced genomes, and 19 non-predatory bacteria from across the phylogenetic and ecological landscapes were compared. Protein families discriminating between the two groups were identified and quantified, demonstrating that differences in the proteomes of predatory and non-predatory bacteria are large and significant. This analysis allows predictions to be made, as we show by confirming from genome data an over-looked bacterial predator. The predatome exhibits deficiencies in riboflavin and amino acids biosynthesis, suggesting that predators obtain them from their prey. In contrast, these genomes are highly enriched in adhesins, proteases and particular metabolic proteins, used for binding to, processing and consuming prey, respectively. Strikingly, predators and non-predators differ in isoprenoid biosynthesis: predators use the mevalonate pathway, whereas non-predators, like almost all bacteria, use the DOXP pathway. By defining predatory signatures in bacterial genomes, the predatory potential they encode can be uncovered, filling an essential gap for measuring bacterial predation in nature. Moreover, we suggest that full-genome proteomic comparisons are applicable to other ecological interactions between microbes, and provide a convenient and rational tool for the functional classification of bacteria. PMID:23190728
Ensuring the relocatability of programs in the operational system DOS YeS
NASA Technical Reports Server (NTRS)
Novoseltsev, S. K.; Orlov, I. G.; Chesalin, A. S.
1979-01-01
Specific modifications in the Disk Operational System Unified Series to insure the relocatability of programs stored permanently in the core image library is described. A self-relocating method for loading programs into the working memory with re-editing all the programs recorded in the core image library is presented. The modified linkage editor can be included in a relocation dictionary containing data about each address constant at the assembly stage at the request of the programmer. The relocation dictionary increases the dimension of the RL-phase in comparison with the dimension of this same phase when edited by the standard method, making possible the creation of multiphase program complexes. Generation and use of the modified system using Assembly language is described. An example of the use of the system is given, and limitations of the use of the relocatable programs in the modified system are outlined.
Imaging of intracellular fatty acids by scanning X-ray fluorescence microscopy
Shimura, Mari; Shindou, Hideo; Szyrwiel, Lukasz; Tokuoka, Suzumi M.; Hamano, Fumie; Matsuyama, Satoshi; Okamoto, Mayumi; Matsunaga, Akihiro; Kita, Yoshihiro; Ishizaka, Yukihito; Yamauchi, Kazuto; Kohmura, Yoshiki; Lobinski, Ryszard; Shimizu, Isao; Shimizu, Takao
2016-01-01
Fatty acids are taken up by cells and incorporated into complex lipids such as neutral lipids and glycerophospholipids. Glycerophospholipids are major constituents of cellular membranes. More than 1000 molecular species of glycerophospholipids differ in their polar head groups and fatty acid compositions. They are related to cellular functions and diseases and have been well analyzed by mass spectrometry. However, intracellular imaging of fatty acids and glycerophospholipids has not been successful due to insufficient resolution using conventional methods. Here, we developed a method for labeling fatty acids with bromine (Br) and applied scanning X-ray fluorescence microscopy (SXFM) to obtain intracellular Br mapping data with submicrometer resolution. Mass spectrometry showed that cells took up Br-labeled fatty acids and metabolized them mainly into glycerophospholipids in CHO cells. Most Br signals observed by SXFM were in the perinuclear region. Higher resolution revealed a spot-like distribution of Br in the cytoplasm. The current method enabled successful visualization of intracellular Br-labeled fatty acids. Single-element labeling combined with SXFM technology facilitates the intracellular imaging of fatty acids, which provides a new tool to determine dynamic changes in fatty acids and their derivatives at the single-cell level.—Shimura, M., Shindou, H., Szyrwiel, L., Tokuoka, S. M., Hamano, F., Matsuyama, S., Okamoto, M., Matsunaga, A., Kita, Y., Ishizaka, Y., Yamauchi, K., Kohmura, Y., Lobinski, R., Shimizu, I., Shimizu, T. Imaging of intracellular fatty acids by scanning X-ray fluorescence microscopy. PMID:27601443
Ionospheric Irregularities: Source, Structure, Plasma Processes and Effects on Sensor Systems
1989-10-31
modified by using y - ye + w sin 0 sin 0 (20h) some of M orf et al.’s ideas. Fougere [1981] added a set of subroutines which find for each channel, the...correlation analysis has employed the modified Fedor algo- rithm (Fedor. 1967. CFB, this issue]. 3. ALGORITHM FOR THE SPECTRAL ANALYSIS The elements of the...knowledge, this paper presents with the every 240 m along the orbital track [Ifeelis et al., 1981]. Thus above data set the most detailed analysis of
Bibliography of Soviet Laser Developments, Number 22, October-December 1975
1976-05-17
medium by a resonant monoc.iromatic field. KE, no. 9, 1975, 1985- 1991 . 33 ^^ W ftHUUUI.ipiU i U.iHJilll»ll«llil*i»Hiiiil..»w I 245...V. Pankratov , A. N. Skachkov, and G. V. Shmerling (0). Kinetics of threshold luminescence and bleaching in SF, and BC1., gases...PANASYUK, YE.L 2,45 PANCHENKO, M.V. 35 PANCHENKO, V. YA. 23 PANCHENKO, YU. M. 90 PANFILOV, V. N. 64 PANIN, V.V. 52,80 PANKRATOV , A.V
1984-01-01
S : L : K -W+ ~ ~ : PP: R: ~FAC NAT:BL LANG:Bs IC: 1: T A 4 CQMIT< E INTERNATIONAL DE M<EDECINE ET DE PHARMACIE...PSYCHOLOGIQUES DE STRESS DANS LE VOL SPATIAL CONCEPTS ACTUELS S ,X ADAPTATON UMAINE AU VOL SPATIAL 5 1 8 EVUE INTERNATIONALE DES SERVICES DE _SANT< E ...Teea . l ,ale ol-ti 1te o sta ) aid pagty letIn* Ito lv te ttit 1.- e b26 l s oul, - t I o ottetlil tttd ye -eile .o o -
Bibliography of Soviet Laser Developments, Number 39, January - February 1979.
1979-11-01
with quantum size effects in the active layers , produced by a continuous (300 K) gas-transport epi- taxy method from metalloorganic compounds. ZhTF P...Chirikov (0). Efficient waveguide CO2 laser. ZhTF P, no. 1, 1979, 25-28. 62. Gordiyets, B.F., A.I. Gudzenko, and V.Ya. Panchenko (1,2). Solar -pumped...p. (RZhF, 2/79, 2D1412) 266. Belanov, A.S., Ye.M. Dianov, and A.M. Prokhorov (1). Data tcansmission over quasi-single-mode three- layer optical
1983-12-01
ISEF;,, YE 5) SET NXT ENTRYIN PLANTO EF RESE LATH DEFENSETOhION ET REET E CNTRON L TO E. FIND EST PS TO THIS DEFENSE ’DEF’UPDATE PS OF THIS LOCATION... cNc 8p & iin Ik - -4 C- coj C4 GoC "p c C4 tnS ’Io V4~ en *1-4C .44 0800 * .. ; J knccC C4>4- 1Sc C4 C4A xll 00 % .... ***~***M******B13 6 . -0 4 )V
Hurricane Impact on Gulf Coast Barriers.
1982-01-01
advaince and huge late-ral extent, Frederic de- ye Ii ped a large ,.toriin so rge. After en is~.in g Dauphin [,land, Alabama, Fredi’ric made landfill near...stratification Each set is some 10 to 20 cr0 These fans are characterized byv wide con tinhi-its upper-flow thick . Tahular cross-stratif aioofviblthcnsisa...Note lth ndward mingration swash bars along the fan crest . (See fig 1:3 P’,intFtlicati)n of thi, oblique aerial photo). Photo taken March 12. 19N
Asynchronous Distributed Flow Control Algorithms.
1984-10-01
all yeX, y <x. We may think of X as a "feasible" set. The fair allocation vector solves the following set of nested problems. The first problem is to...interval parameters that can be adjusted: the time between a succesful update and the next update attempt, and the time between an unsuccessful attempt...For years she took great delight in being able to tell people , quite truthfully, that she was from Mars. In 1970, she graduated from the University of
Chemical Reactions at the Au/InP Interface.
1986-10-15
Chye , et al., 6 using various forms of photoemission spectroscopy and ion-depth profiling techniques, found that extremely thin Au films 3 interacted...Appl. Phys. 50, 1445 (1979). 6) P.W. ChYe , I. Lindau, P. Pianetta, Ci’!. Garner, C.Y. Su and W.E. Spicer, Physical Review B, 19, 5545 (1978). 7) R.F.C...Brilison, C.F. Brucker, A.D. Katnani, N.G. Stoffel, and G. Margaritondo, J.Vac.Soi Technol., 19, 661 (1981). 13) 1. Caznlibel, A.K. Chin , F. Eruanis
1984-08-01
various wheel loads and gecoetries an an aid to vehicle design PO04 299 Flotation tires anc subsurface compaction POMl 300 Tractor power selection...soil copatiml steering computer modelling, vehicle -component design , measuremnt of soil and anow properties and soil bin facilitiesi and vehicle... design . 74 ~ Al i~~s W3 *1oe 9e e1 SALilsasifiLed seCUffiY cLataric*Ye ATWop ’ VA .-I rumo. .. nemraa~sociy m v smuAN vnaaz Yswros 1BR.NM 72 Lym AmI
JPRS Report, Soviet Union, Military Affairs.
1988-12-29
have a duty to him. [Letter from Nadezhda Nikolayevna Kuzmina , Lenin- gradskaya Oblast] I am raising three sons and the oldest will enter the army...JPRS-UMA-88-023 29 SEPTEMBER 1988 343036 JPRS 010 Soviet Union Military Affairs Wi& i DTK) QUALITY INSPECTED 1 ■v-yx&fJ’&yiCM 5#1fi^wiv«*’* i ?f...Domestic Service, 11 Sep 88] 21 Mobile Quadrant Antennas [Ye. Klinshov, G. Titov.TEKHNIKA I VOORUZHENIYE, Jun 88] 23 AIR FORCE, AIR DEFENSE FORCES
Medical Surveillance Monthly Report (MSMR). Volume 18, Number 08, August 2011
2011-08-01
continue, and STI preven- tion eff orts should be reinforced. R E F E R E N C E S 1. Kuper H, Ye W, Broome U, et al. The risk of liver and bile duct ...hepatitis A virus (HAV) causes infl ammatory liver disease (hepatitis) in aff ected individu- als. Th e virus is spread through fecal-oral...ammatory liver disease (hepatitis B) in aff ected individ- uals. Th e virus is spread by percutaneous or mucous membrane exposure to infected blood or
Thickener/Fluid Interaction in Lubricating Greases
1984-05-01
I) p V * .’ .. 21 ___ to & - -9 01 o0 lw0 ca 4 C., trn u ’ ri" cU, 23z "iFQ Ig. C14i~~ z NAii W -W_; 24 C49 c - C-, cn4 II 1- .0, co 4 fa1 41 t 1-4...STRNA-YE (DR KAPLAN ) 1 AITN: STECR-TA STRNA-U I APO SEATTLE 98733 NATICK MA 01760 CDR CDR US ARMY RSCH & STDZN GROUP US ARMY RESEARCH OFFICE (EUROPE
Xie, Xuehui; Liu, Na; Ping, Jing; Zhang, Qingyun; Zheng, Xiulin; Liu, Jianshe
2018-06-01
In present study, a hydrolysis acidification (HA) reactor was used for simulated dyeing wastewater treatment. Co-substrates included starch, glucose, sucrose, yeast extract (YE) and peptone were fed sequentially into the HA reactor to enhance the HA process effects. The performance of the HA reactor and the microbial community structure in HA process were investigated under different co-substrates conditions. Results showed that different co-substrates had different influences on the performance of HA reactor. The highest decolorization (50.64%) and COD removal rate (60.73%) of the HA reactor were obtained when sucrose was as the co-substrate. And it found that carbon co-substrates starch, glucose and sucrose exhibited better decolorization and higher COD removal efficiency of the HA reactor than the nitrogen co-substrates YE and peptone. Microbial community structure in the HA process was analyzed by Illumina MiSeq sequencing. Results revealed different co-substrates had different influences on the community structure and microbial diversity in HA process. It was considered that sucrose could enrich the species such as Raoultella, Desulfovibrio, Tolumonas, Clostridium, which might be capable of degrading the dyes. Sucrose was considered to be the best co-substrate of enhancing the HA reactor's performance in this study. This work would provide deep insight into the influence of many different co-substrates on HA reactor performance and microbial communities in HA process. Copyright © 2018 Elsevier Ltd. All rights reserved.
Rubio-Moraga, Angela; Candel-Perez, David; Lucas-Borja, Manuel E.; Tiscar, Pedro A.; Viñegla, Benjamin; Linares, Juan C.; Gómez-Gómez, Lourdes; Ahrazem, Oussama
2012-01-01
Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA) and Nei’s genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst) was 0.233. Cuenca showed the highest Nei’s genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups—Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco—while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR) method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra. PMID:22754321
Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Domínguez, José Manuel
2009-11-11
Yeast extract (YE) is the most common nitrogen source in a variety of bioprocesses in spite of the high cost. Therefore, the use of YE in culture media is one of the major technical hurdles to be overcome for the development of low-cost fermentation routes, making the search for alternative-cheaper nitrogen sources particularly desired. The aim of the current study is to develop cost-effective media based on corn steep liquor (CSL) and locally available vinasses in order to increase the economic potential for larger-scale bioproduction. Three microorganisms were evaluated: Lactobacillus rhamnosus , Debaryomyces hansenii , and Aspergillus niger . The amino acid profile and protein concentration was relevant for the xylitol and citric acid production by D. hansenii and A. niger , respectively. Metals also played an important role for citric acid production, meanwhile, D. hansenii showed a strong dependence with the initial amount of Mg(2+). Under the best conditions, 28.8 g lactic acid/L (Q(LA) = 0.800 g/L.h, Y(LA/S) = 0.95 g/g), 35.3 g xylitol/L (Q(xylitol) = 0.380 g/L.h, Y(xylitol/S) = 0.69 g/g), and 13.9 g citric acid/L (Q(CA) = 0.146 g/L.h, Y(CA/S) = 0.63 g/g) were obtained. The economic efficiency (E(p/euro)) parameter identify vinasses as a lower cost and more effective nutrient source in comparison to CSL.
A Social Network Analysis of the Chinese Communist Party’s Politburo
2013-12-01
Centrality Deng Xiaoping 0.583 0.665 Ye Jianying 0.333 0.454 Li Xiannian 0.333 0.454 Chen Yun 0.313 0.475 Xu Xiangqian 0.292 0.412 Hu Yaobang... Li Keqiang, and the right that China has to great power status in the writings of Liu Yunshan. These moralistic themes are viewed as a reaction by...0.229 0.345 Nie Rongzhen 0.229 0.374 Wan Li 0.208 0.218 Deng Yingchao 0.208 0.374 Zhao Ziyang 0.208 0.345 Table 2. Ideological Model 1–Nodal
Circulation of the Elite in the Chinese Communist Party
2014-09-02
the 11th Party Congress. Li Disheng (rank 6) made it to the 11th Congress, but as a Politburo member, and not as a PSC member. Only Ye Jianying (rank 5...2003; Holbig 2009; Holbig and Gilley 2010; Hsu 2001; Lee 2010: Li 2013b; Schubert 2007; Zheng 2003. 4Dittmer 2001, 58; Yue 2008, 82-83. 5Bo 2007; Cho...2008; Dittmer 2001; Fewsmith 2003; Kou and Zang 2014; Li 1994; Li 2012; Lin 2004; Nathan 1973; Shih 2008; Shih et al. 2010; Shih et al. 2012; Tsou and
A Vectorized ’Nearest-Neighbors’ Algorithm of Order N Using a Monotonic Logical Grid
1985-05-29
Computational Phy’sics 0 4 May 29 , 1985 This work was supported by the Office of Naval Research. . ~ Q~JUN 1719851- * NAVAL RESEARCH LABORATORY * lit...YE ’.ARK:NGS UNCLASSIFIED_______________ _____ K -. A R, ~ CA7,ON 4, 71CO1, 3 :)-S7R,9U-ON AdA,.A3:L ’Y OF REPOR7Io - EC..ASi.’ CA27 ON., DOWNGAZING...Year. Month. Day) 5 PAGE COUNT Interim FROM -____ Toi__ 1985 May 29 50 SuPPILSMENTARY NOTATION This work was supported by the Office of Naval
1960-08-03
copies. 5 PILKOV, Ye. V., Cand Tech Sei — "Study of distortions in the reproduction of color television images in a tube with striated screen...copies0 D0VGÖP0LYY, G. I., Cand Agr Sci — "Peculiarities of the raising of tomato seedlings in food pots in the Ukraine." Khar’kov, 1959, 20 pp (Min of...Order bf Lenin Inst of Engineers of Railroad Transport im Academician V4N. Obraztsov), l50 copies» BARANOVA, K.V., Cand Agr Sei -* » Effectof the
Bibliography of Soviet Laser Developments, Number 87, January-February 1987
1987-12-29
laser. OPMPA, no. 1, 1987, 58-59. 84. Sukhanov , 1.1.; Troitskiy, Yu.V.; Yakushkin, S.V. 0 Investigation of a He-Ne laser, generating a beam with a...2Ye498). * 519. Shelekhov, N.S.; Sukhanov , V.I.; Solomatin, Yu.V.;Ashcheulov, Yu.V. (GOI). Investigation of the possibility of obtaining specimens of...G 46,49 SOBOLEV V B 57 SUETIN N V 26 TIMASHOV A V 11 SOCHIVKIN G M 87 SUKHANOV I 1 11 TIMASHOVA L N 60 SOKOLOV A V 107 SUKHANOV V 1 61 TIMERKAYEV B A
The Coast Artillery Journal. Volume 63, Number 6, December 1925
1925-12-01
know many of its limitations. ’Vc know that it takcs many rounds from any gun to score a hit upon an airplanc . ’Ye know also that tons and tons of...suspicions, and to try to create an attitude of toleration in the public mind of the peoples of the earth, that is, we submit, a long job, and in the...feared that the partial vacuum thus created wou1d tend to suck in enough gas to be harmfu1 to the observer. Actual trial does not show this to be the case
Strategic Implications of Japan Amending Its Constitution
2008-12-09
and Déjà Vu . Before discussing the four scenarios, it is important to make some valid assumptions to further keep the variables at a minimum for the...si a Passive China Reaction Aggressive China Reaction U S Fo rce s R e -D e p lo ye d b a ck to C O N U S IMPERIAL DRAGON POWDER KEG DEJA VUHIDDEN...well as posture itself to participate in collective security arrangements. Déjà Vu . While the previous scenario titles are self-explanatory, the Déjà
Non-Line of Sight-Combined Arms (NLOS-CA) Manpower, Personnel and Logistics Impact Analysis (LIA)
1993-11-15
total weight and volume to explosive weight have been used. These measure the size of the round relative to the killing power in the round. On this basis...the weapon system is powered up. (3) Alert Time is that time during which radios are operating, but the system is not powered up. For this analysis...TELEPHONE MANUA: SB-22/PT 1S U99185 UTILITY RECEPTACLE I V31211 TELEPHONE SET TA312 26 V•1788 POWER SUPPLY YE8 HYP-571TSEC 2I N32593 SHOP EQUIP AUTO
Application of Quasi-Lagrangian Diagnostics and FGGE Data in a Study of East-Coast Cyclogenesis.
1981-09-01
QUASI-LAGRANGIAN UDIAGNOSTICS AND FGGE DATA IN A STUDY OF EAST-COAST CYCLOGENESIS by Donald A. Roman September 1981 Thesis Advisor: Dr. Carlyle H. Wash...REPORT DOCUMENTATION PAGE DEVFOR COMPLETING FORM I.M9PR UM19 2. GOV? AccaS "@ "mO L.VIPICUTS CA? ALOG MUUNW S TyP =F NOo’BP io OE4. TITLC (nd Sisle . ye i...n.J000 Application of Quasi-Lagrangian Master’s Thesis Diagnostics and FGGE Data in a Study 0#4 September 1981 East-Coast Cyclogenesis C PlaPranIWG
The Influence of Ballistic Damage on the Aeroelastic Characteristics of Lifting Surfaces.
1979-07-01
the pressure distribution. The finite-element method, often referred to as a vortex- lattice or doublet- lattice method, divides the lifting surface into...finite-element modeling, such as doublet- lattice , would provide a better understanding of the near-field effects of a damage hole and allow a data base...0.17 0.33 0.50 6.67 0.833 1.00 Figure 42 125 CASE 5 and CASE 5D 0 Ye=.57 = UNDAMAGED M = DAMAGED 0 C3/ C22 CD QCD 6.330,4 0/ Fiue4 02 CASE 5 and CASE
Bibliography of Soviet Laser Developments. Number 70, March - April 1984.
1985-06-12
Nagayev, A.l.; Pika-In, V . P Frt1 ze, A.V. (). Spatial light m,-dul-0, , wtb ii- e’rctrostatically controlled e -beam. "lit’. Moskva, 29 Nov - 2 Dec...in a turbulent atmosphere. OPSPA, v . 57, no. 4, 1984, 732-734. 49 e ’Ile 450. Anikeyenko, G.N.; Pavlichenko, 1.0. (VPI). Study on the polarization...B.N.; Shil’nikov, Ye.V. (IPM). Mathematical modeling of e -beam [compared with laser] vaporization of metal. DANKA, v . 272, no. 4, 1983, 835-838. 871
Digital Quantum Simulation of Minimal AdS/CFT.
García-Álvarez, L; Egusquiza, I L; Lamata, L; Del Campo, A; Sonner, J; Solano, E
2017-07-28
We propose the digital quantum simulation of a minimal AdS/CFT model in controllable quantum platforms. We consider the Sachdev-Ye-Kitaev model describing interacting Majorana fermions with randomly distributed all-to-all couplings, encoding nonlocal fermionic operators onto qubits to efficiently implement their dynamics via digital techniques. Moreover, we also give a method for probing nonequilibrium dynamics and the scrambling of information. Finally, our approach serves as a protocol for reproducing a simplified low-dimensional model of quantum gravity in advanced quantum platforms as trapped ions and superconducting circuits.
Digital Quantum Simulation of Minimal AdS /CFT
NASA Astrophysics Data System (ADS)
García-Álvarez, L.; Egusquiza, I. L.; Lamata, L.; del Campo, A.; Sonner, J.; Solano, E.
2017-07-01
We propose the digital quantum simulation of a minimal AdS /CFT model in controllable quantum platforms. We consider the Sachdev-Ye-Kitaev model describing interacting Majorana fermions with randomly distributed all-to-all couplings, encoding nonlocal fermionic operators onto qubits to efficiently implement their dynamics via digital techniques. Moreover, we also give a method for probing nonequilibrium dynamics and the scrambling of information. Finally, our approach serves as a protocol for reproducing a simplified low-dimensional model of quantum gravity in advanced quantum platforms as trapped ions and superconducting circuits.
Molecular Approach to Hypothalamic Rhythms
1998-06-24
PAGE • PuDiic reoorttnc DUTCH p gather.r.q ar.c n-untai ; COHeCtJO-■ -:r ;-v-rrr.^! ; Davis hiopwa.-, ioiie 1 ■ 1. AGENCY USE AFRL-SR-BL-TR...the same neurons? eharacter"ed „™ „eer ye3f1V 6d ,y the sl" P -^ueing lipid oleamide. He have precursor exeinslvelv H = ’", "^ "W"«1...mapped the anatomical distribution of the degradative enzyme for oleamide within the brain. To identify neuronal populations activated in vivo by 3
1986-12-01
PREDICTION VIA FIBER BUNDLE TESTING-EVALUATION OF TESTING EQUIPMENT JD DATA ACQUISITION SYSTEM PERSONAL AUTHOR(S) Petridis Dimitrios M. i *y?e o j report...experiencing a known number of filament failures per bundle. The results of this investigation are relevant to man-safe applications as in composite pressure...single filament r’iber testing and can become more 29 3> C o - Pwo PwS ?w4 Pw3 Pw2 Pwl PSD Ps5 PS4 Ps3 Ps2 PS! homoiogous correspondence t ~ to Life ( Laqt
Quantum criticality and duality in the Sachdev-Ye-Kitaev/AdS2 chain
NASA Astrophysics Data System (ADS)
Jian, Shao-Kai; Xian, Zhuo-Yu; Yao, Hong
2018-05-01
We show that the quantum critical point (QCP) between a diffusive metal and ferromagnetic (or antiferromagnetic) phases in the SYK chain has a gravitational description corresponding to the double-trace deformation in an AdS2 chain. Specifically, by studying a double-trace deformation of a Z2 scalar in an AdS2 chain where the Z2 scalar is dual to the order parameter in the SYK chain, we find that the susceptibility and renormalization group equation describing the QCP in the SYK chain can be exactly reproduced in the holographic model. Our results suggest that the infrared geometry in the gravity theory dual to the diffusive metal of the SYK chain is also an AdS2 chain. We further show that the transition in SYK model captures universal information about double-trace deformation in generic black holes with near horizon AdS2 space-time.
Calcium sulfoaluminate (Ye'elimite) hydration in the presence of gypsum, calcite, and vaterite
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hargis, Craig W.; Telesca, Antonio; Monteiro, Paulo J.M., E-mail: monteiro@ce.berkeley.edu
Six calcium sulfoaluminate-based cementitious systems composed of calcium sulfoaluminate, calcite, vaterite, and gypsum were cured as pastes and mortars for 1, 7, 28 and 84 days. Pastes were analyzed with X-ray diffraction, thermogravimetric and differential thermal analyses. Mortars were tested for compressive strength, dimensional stability and setting time. Furthermore, pastes with a water/cementitious material mass ratio of 0.80 were tested for heat evolution during the first 48 h by means of isothermal conduction calorimetry. It has been found that: (1) both calcite and vaterite reacted with monosulfoaluminate to give monocarboaluminate and ettringite, with vaterite being more reactive; (2) gypsum loweredmore » the reactivity of both carbonates; (3) expansion was reduced by calcite and vaterite, irrespective of the presence of gypsum; and (4) both carbonates increased compressive strength in the absence of gypsum and decreased compressive strength less in the presence of gypsum, with vaterite's action more effective than that of calcite.« less
Liang, Jibei; Cheng, Tao; Huang, Yi; Liu, Jianhua
2018-05-28
Enhanced bioremediation is a favorable approach for petroleum pollutant cleanup, which depends on the growth of oil-eating microorganisms. In this study, we show that, by using the modified T-RFLP (mT-RFLP) methodology, one of the four major microbial populations derived from oil sludge has failed to propagate in MS medium supplemented with 2% yeast extract (YE). rDNA sequence-based analysis indicated that the four populations were Donghicola sp. CT5, Bacillus sp. CT6, Alcaligenes sp. CT10, and Pseudomonas sp. ZS1. Four purified strains grow well individually in MS medium supplemented with 2% YE, suggesting that ZS1 growth is antagonized by other strains. Co-growth analysis using mT-RFLP methodology and plate inhibitory assay indicated that ZS1 exhibited antagonistic effect against CT5 and CT6. On the other hand, co-growth analysis and plate inhibition assay showed that CT10 antagonized against ZS1. To investigate the potential compounds responsible for the antagonism, supernatant of CT10 culture was subjected to GC-MS analysis. Analysis indicated that CT10 produced a number of antimicrobial compounds including cyclodipeptide c-(L-Pro-L-Phe), which was known to inhibit the growth of Pseudomonas sp. Growth test using the purified c-(L-Pro-L-Phe) from CT10 confirmed its inhibitory activity. We further showed that, using both gravimetric and GC analysis, CT10 antagonism against the oil-eating ZS1 led to the diminishing of crude oil degradation. Together, our results indicate that bioremediation can be affected by environmental antagonists.
Niu, Canfang; Luo, Huiying; Shi, Pengjun; Huang, Huoqing; Wang, Yaru; Yang, Peilong
2015-01-01
N-Glycosylation can modulate enzyme structure and function. In this study, we identified two pepsin-resistant histidine acid phosphatase (HAP) phytases from Yersinia kristensenii (YkAPPA) and Yersinia rohdei (YrAPPA), each having an N-glycosylation motif, and one pepsin-sensitive HAP phytase from Yersinia enterocolitica (YeAPPA) that lacked an N-glycosylation site. Site-directed mutagenesis was employed to construct mutants by altering the N-glycosylation status of each enzyme, and the mutant and wild-type enzymes were expressed in Pichia pastoris for biochemical characterization. Compared with those of the N-glycosylation site deletion mutants and N-deglycosylated enzymes, all N-glycosylated counterparts exhibited enhanced pepsin resistance. Introduction of the N-glycosylation site into YeAPPA as YkAPPA and YrAPPA conferred pepsin resistance, shifted the pH optimum (0.5 and 1.5 pH units downward, respectively) and improved stability at acidic pH (83.2 and 98.8% residual activities at pH 2.0 for 1 h). Replacing the pepsin cleavage sites L197 and L396 in the immediate vicinity of the N-glycosylation motifs of YkAPPA and YrAPPA with V promoted their resistance to pepsin digestion when produced in Escherichia coli but had no effect on the pepsin resistance of N-glycosylated enzymes produced in P. pastoris. Thus, N-glycosylation may improve pepsin resistance by enhancing the stability at acidic pH and reducing pepsin's accessibility to peptic cleavage sites. This study provides a strategy, namely, the manipulation of N-glycosylation, for improvement of phytase properties for use in animal feed. PMID:26637601
The Sale of FX Aircraft to Taiwan,
1982-02-01
A« ii 4J -r-i cr. u CO U O H oi 4-1 4-1 JS k4 cr. CO 3 1 E C li iH u -H CM CO 01 UH 1...31, 1981, pp. U1-U2 (Xinhua, "Ye Jianying Explains Policy Concerning Return of Taiwan to Mother- land and Peaceful Reunification"). FBIS, People’s...Industrial Potential" (Fei-ohan knai-t’ing tzu- li she-ohi ahien-tsu hsien-shih wo kuo ahun-shih kung-yeh ch’ien- li ), October 9, 1980. , "The U.S. Defense
Chinese-English Rocketry Dictionary. Volume 3
1979-03-01
xiezhen diania 14] Q i. plate tank 1’? yangil yanghuara $, anodic oxidation process 18 yangji yinji dianya I3 A.j - I t anode -cathode voltage...talo Gu Yin yin aao ou Ylng Yin ta’u Ou YU You taluan cuan Yuing Yawg talui cul 341 tau tm yuan ruan toa ’Wg Cown Yft ye. tfu tu Yfln t’tian tuant...tanhuang Jiahe mopian 94f X laE f(4 ’m’. #j spring-loaded membrane 14 tanhuang Jiaju A1 A -)t spring clawp 15 tanhuang Jianshendian A1 &c A V -’P spring
1982-06-01
3oijsteii 14.) v ilson f3 1vj Ar inj~on, VA Ž222JY L. or p AtLnZ: -,iii~iarn Ouriey I d.LU ýu ndoldt i~d txlJlýjLuqucqe, 14,, f. /A i’ Atun : ý...34ivision iY) LiOX d /M ye I v - iv i S i 01-1 I ,/L i r ic u .L Lbr~ J o-r y At~rlt -lex earker 1.i nj .on, A½iI r -I efnLi.) DL-4 NAS’A Aines Atun
1972-06-01
JUN 72 L C FITZPATRICK , R L ABSHI RE. L G KNOX D AC W 3-72-C-X052 4 mhhho hhEEE I lffllffllfNOlf NElf mohEEEEEshhhEE EhmhhEEEmhEEEE mhEmhEEEEEmhhI...C-0052, on 30 June 1972. I f’v IabnC Wer’Ye td so; itsj 81 3 3 063 - I _rj_,CLASSIFICATION OF THIS PAGE (When Dole Kntored) REPORT DOCUMENTATION PAGE...Engineers June 1972 Engineering Division, Plng Br, SWFED-P I . NUMBER OFPAGES P. 0. Box 17300, Fort Worth, Texas 76102 339 14. MONITORING AGENCY NAME
Open quantum random walk in terms of quantum Bernoulli noise
NASA Astrophysics Data System (ADS)
Wang, Caishi; Wang, Ce; Ren, Suling; Tang, Yuling
2018-03-01
In this paper, we introduce an open quantum random walk, which we call the QBN-based open walk, by means of quantum Bernoulli noise, and study its properties from a random walk point of view. We prove that, with the localized ground state as its initial state, the QBN-based open walk has the same limit probability distribution as the classical random walk. We also show that the probability distributions of the QBN-based open walk include those of the unitary quantum walk recently introduced by Wang and Ye (Quantum Inf Process 15:1897-1908, 2016) as a special case.
Transaction Design Specification Medical Exam Databases System (MED) update Transaction
1986-12-01
8217RECOFD IN 51) 73. CORONARY SFAS1 SITE ;CHAR X(6) IN 7:) 74* CORONARY FLAQUES (RECO D IN 51) 75. CCFONARY PLAOUE 3ITE ,CHAR K(60 IN 74) 76* FCT DIAMETER...KETOSTEROIDS YE HYDROXYCARTICOSTEROIDS YO 24 HR URINE TOTAL VOLUME MA URINE OSMOLALITY MB SERUM OSMOLALITY MC 24HR URINE TOTAL VOLUME ZE SERUM COPPER FBS TO...RHEUMATOID FACTOR PA N P -2 2 ANTINUCLEAR ANTIBODY PB N P -2 2 0 FREE FATTY ACIDS QA 5 9 57 200 MG% SERUM COPPER RA 30 70 130 300 JG% URINE COPPER RBM 10 30 90
Normal Modes of a Lagrangian System Constrained in a Potential Well.
1983-12-01
A’ -137 948 NORMAL MODES OF A LFHbRANGIAN SYSTEM CONSTRAINED INvi P0TENTIAL WELL(U WISCONSNN UNIV-MADISON MATHEMATICS RESEARCH CENTER V EN DEC F1...Carolina 27709 DT FLE OP Y UNIVERSITY OF WISCONSIN-MADISON MATHEMATICS RESEARCH CENTER NORMAL MODES OF A LAGRANGIAN SYSTEM CONSTRAINED IN A POTENTIAL WELL...respect to the norm lYE [f i + 2 yi )dtl/ 0 Since H I(S’ 1 n’) C CO(S, fle ), then the set A 1 0 is an open set in H1 (lf’) The periodic solution of
Flavor Oscillations in the Supernova Hot Bubble Region: Nonlinear Effects of Neutrino Background
NASA Astrophysics Data System (ADS)
Pastor, Sergio; Raffelt, Georg
2002-10-01
The neutrino flux close to a supernova core contributes substantially to neutrino refraction so that flavor oscillations become a nonlinear phenomenon. One unexpected consequence is efficient flavor transformation for antineutrinos in a region where only neutrinos encounter a Mikheyev-Smirnov-Wolfenstein resonance or vice versa. Contrary to previous studies we find that in the neutrino-driven wind the electron fraction Ye always stays below 0.5, corresponding to a neutron-rich environment as required by r-process nucleosynthesis. The relevant range of masses and mixing angles includes the region indicated by LSND, but not the atmospheric or solar oscillation parameters.
Flavor oscillations in the supernova hot bubble region: nonlinear effects of neutrino background.
Pastor, Sergio; Raffelt, Georg
2002-11-04
The neutrino flux close to a supernova core contributes substantially to neutrino refraction so that flavor oscillations become a nonlinear phenomenon. One unexpected consequence is efficient flavor transformation for antineutrinos in a region where only neutrinos encounter a Mikheyev-Smirnov-Wolfenstein resonance or vice versa. Contrary to previous studies we find that in the neutrino-driven wind the electron fraction Y(e) always stays below 0.5, corresponding to a neutron-rich environment as required by r-process nucleosynthesis. The relevant range of masses and mixing angles includes the region indicated by LSND, but not the atmospheric or solar oscillation parameters.
The Poor Ye Need Not Have with You; Lessons from the War on Poverty.
ERIC Educational Resources Information Center
Levine, Robert A.
The book provides a dichotomy of the general technique of problem handling in the United States; i.e., getting even or punishing the adversary, and the reverse of this, problem solving; and discusses the two aspects in the context of the war on poverty. The second and third chapters discuss various definitions of the Poor, and provide objectives…
1980-06-30
284 1.090 LEASE RENTAL OF EQ’BRUSHTS-PAI NTS - SEA ,ER NA HA H4A 162 1.06I LEASE -REtITAL OF EQ’CDNTAINERS-PACKA I NO MA HA MA 29 1.083 LEAS’E RENTAL OF...DOLAARSI IFIS C AL YE9ARII PROC URCHIN T PROSRAM ------------------------------- 1976 1977 1676 1979 AIRFRAME& AND RELATED ASSEMBLIES AND SPARES...39 I 5 - ", M V PAT(r :If AMA:TRDA LFIRE ER42 0441 230 26 * 3920 FIAT II R P EQIIFICPT1O’L-R O.ED:.6NT1 2, sea 1.4 2533 31.30 WRE. HOAE REAC TOP5RCO
The Aluminum Ship Evaluation Model (ASEM) Static Test Results
1983-12-01
8217- -- fC1 (-10,o 1 3 7-1 -69 6 12 960.00 9869 30 0 t SAME 22 R2A:CM7 9-E1 2 23 9 11 -69 822 - 41 fta 2S87 98- 3 35 19 I 30 SOME 12 244 9 ES0 0 0 1 SAME...YE 0D . 0 0 -40 -:0 0 246 344412; FMD 4-A-AS YES 0 1 0. 01 00 _ 0 A 0 204 848117I8 047 YSI .- 0 0 1 -60-A7 1 24 ;41:0 4-A44 YES 0 I 0. 0100 ’-0 -FC 249
The Renewal Equation for Markov Renewal Processes with Applications to Storage Models.
1986-05-01
2.21) = pt(Bf(jO,A))v(EO, tD )+I(6=O)[:P(YnkB,T nkTnkk~t’Ynk-kiY) -2pO(Bn(j0 ,A))v([O,tJ3 if ye (j09A), with p, v as in corollary 2.2, and y and 6 are...S.) max ( max (S n-S )+(S n-S n 0~. l 5j:n no 0 14_XM nk -n: j!nk 0kI n n Thus, for all w 4EA, Z (wlmax( max (S -S.),x +S 1=0. (3.4) l,n 0 1j n 0
NASA Astrophysics Data System (ADS)
Kalyuzhnyi, Yurij V.; Cummings, Peter T.
2006-03-01
The Blum-Høye [J. Stat. Phys. 19 317 (1978)] solution of the mean spherical approximation for a multicomponent multi-Yukawa hard-sphere fluid is extended to a polydisperse multi-Yukawa hard-sphere fluid. Our extension is based on the application of the orthogonal polynomial expansion method of Lado [Phys. Rev. E 54, 4411 (1996)]. Closed form analytical expressions for the structural and thermodynamic properties of the model are presented. They are given in terms of the parameters that follow directly from the solution. By way of illustration the method of solution is applied to describe the thermodynamic properties of the one- and two-Yukawa versions of the model.
An NQR Study of TNT Characteristics.
1977-09-01
RDX , HMX , a r d some of t he heavy me t al 3~~: id~.s h~~’n for rn.nn ye.~rs been use d as rn~~lit~~ry nii p lns i n’t-~~~~, Thr p h y s i c a l...ambient temperatures of more than one coexisting crystal phase. This polymorphism is known to occur in TNT , HMX and PbN3, and is responsible for a...specific problems of TNT polymorphism and phase transitions were researched . This is one of the problems which is relevant to present day concerns . The
Wood Joist Floors: Probabilistic Analysis of Joist Stiffness Measured at Retail Lumberyards.
1982-10-01
me.er maltsmctiued. Rad then a o minrama onotboo, Other species.) A 2 by 8 stamped S-ORN denotes that It was we choe to thsude m xcept for de variabls tha...t4- * 70 2.00 6o 0." 0,t50 -nO.16" 50 ~60 la -. 03 A .0.6 40 .: s 3.62 30040 2.70 20 - 30 10 20 0 . I * I Ip I * p . a10 .50 .60 .70 .80 .90 1.00...34kthstavrageft ye protely ere t. A discussion of the procedures for "idealizing," which considers variability in the histograms on thickness, width
JPRS Report, Science & Technology, USSR: Computers
1987-09-10
O H V 01 Ü C Q) ö H n) in u At A2 Af A2 SC-S5SI A3 A4...At A2 20 Af A2 At 42 -55" A4 ) A3 A4 -555e i Ü .■•; sj <, .^ ^ u o ca to <u u o u CM cfl u u C dJ u u to O i-l 4J tii... O C Q) ß l-l tfl !Z> O Key: A. Multiplex channel. The input of subchannel A of the YeS-5568 disk controller is connected to the first
Corrosion Modeling and Testing of Riveted Aluminum Alloy Panel
2012-08-28
Curve Measurement • V-I measurement using rotating disk electrode ( RDE ) captures mass transport contribution • Mass transport can be important for...curve measurement needed Rotating Disk Electrode ( RDE ) y = 0.0353x + 0.1796 0 10 20 30 40 50 60 70 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 5 10 15 B ou nd...ar y la ye r t hi ck ne ss , um D iff us io n Li m ite d C ur re nt ( m A /c m 2 ) Rotation Rate, w1/2 (radian s-1)1/2 Cu RDE Tests IL, mA
Experiment to measure vacuum birefringence: Conceptual design
NASA Astrophysics Data System (ADS)
Mueller, Guido; Tanner, David; Doebrich, Babette; Poeld, Jan; Lindner, Axel; Willke, Benno
2016-03-01
Vacuum birefringence is another lingering challenge which will soon become accessible to experimental verification. The effect was first calculated by Euler and Heisenberg in 1936 and is these days described as a one-loop correction to the differential index of refraction between light which is polarized parallel and perpendicular to an external magnetic field. Our plan is to realize (and slightly modify) an idea which was originally published by Hall, Ye, and Ma using advanced LIGO and LISA technology and the infrastructure of the ALPS light-shining-through-walls experiment following the ALPS IIc science run. This work is supported by the Deutsche Forschungsgemeinschaft and the Heising-Simons Foundation.
Bibliography of Soviet Laser Developments, Number 62, November-December 1982.
1983-10-30
A V ill UBOV V S 26 VODOVATOV I A 76 TITOV YE A 34,96 USOVA N A 1 VOZOT B 16 TRAL’ V A 113 USTINOY N D 12,59 VOLCHENOK V 1 17 TODUA...of single pulse lasing. ZhPS, v . 37, no. 5, 1982, 741-748. 3. Zaskal’ko, O.P., and l.G. Rudoy (1). Giant pulse lasing without a resonator. ZhETF P, v ...2534. b. Er 3+ 8. Kaminskiy, A.A. (13).- Staged lasing from Er3 ions in YAlO 3crytal a4 4 1 IV 4 4a 3/2--:--3/2 ’~ A +111/2-1-
Joint Logistics Commanders Precision Optics Study
1987-06-19
DOCUMENTATION PAGE 11IFORE couri- EIING FORM YI T I (-’a 1.61100~) TYEor arFPO. a PERIOD t’V.Fi.(( JoI-rT PRECISION OPTICS TECHINIC.AL GROUP FINHAL I PRVOr kG...34*m rtlds ortw d ta.4 i r’f. Wu Uuuai mkidu*~s @9 o pndct praade by Ow MfsKM 9W fidsder ~Ye bevwil Af cnot ei ’ for ,tWta &.Vtionitt it ts" diviate wi...Canada Austria Belgium i):E ( upec If, Price Quald ’ILy Input coz:b: capital other (specify) DelIvery (lead-time) Foo1 uc rv Ice Resea: ’, capatiliity Csto
Fluorescein sodium-guided surgery of a brain abscess: A case report
Höhne, Julius; Brawanski, Alexander; Schebesch, Karl-Michael
2016-01-01
Background: Up to now, the feasibility and benefit of using fluorescein sodium under a dedicated surgical microscope filter (YE560, YELLOW 560 nm filter, Carl Zeiss Meditec, Germany) has never been clinically evaluated in infectious disorders of the brain. Case Description: Here, we report the case of a male patient with a brain abscess in the right parietal lobe that was removed under fluorescence-guidance (intravenous administration of fluorescein sodium 10%, 5 mg/kg bodyweight). The abscess capsule showed intensive yellow fluorescent staining, while − under white light − the cortex appeared normal. Conclusion: This technique may improve the identification and surgical removal of brain abscesses. PMID:28031990
Perfection and Entry: An Example,
1983-07-01
p(t),a(t)) 0 I t=fi I (2) - t-1 H ([p,a]) = (I - C) I h (p(t),a(t)) E t-1 E The stationary equilibrium outcomes of such a game are those strategy...aSO41 SuOwe seP! JO ague4:pxO a4) aMP)! 03 s! asodind Ja4aIL ye~s leuossajoid sll ol asias e se uoiejodioj) puell a4. Aq partssi ate siaded saiuaS...does not 1). reduce the set of equilibrium outcomes in the discounted gamelJ. The essential features of the market situation required to produce the phe
Towards a bulk description of higher spin SYK
NASA Astrophysics Data System (ADS)
González, Hernán A.; Grumiller, Daniel; Salzer, Jakob
2018-05-01
We consider on the bulk side extensions of the Sachdev-Ye-Kitaev (SYK) model to Yang-Mills and higher spins. To this end we study generalizations of the Jackiw-Teitelboim (JT) model in the BF formulation. Our main goal is to obtain generalizations of the Schwarzian action, which we achieve in two ways: by considering the on-shell action supplemented by suitable boundary terms compatible with all symmetries, and by applying the Lee-Wald-Zoupas formalism to analyze the symplectic structure of dilaton gravity. We conclude with a discussion of the entropy (including log-corrections from higher spins) and a holographic dictionary for the generalized SYK/JT correspondence.
NASA Technical Reports Server (NTRS)
Zhukov, G. P.
1980-01-01
The Soviet Union's participation in the solution of international legal problems as space flights became possible is reviewed with emphasis on the efforts of the most prominent Soviet international lawyer. Some of the professor's 230 writings are highlighted.
Ait Ouali, Fatma; Al Kassaa, Imad; Cudennec, Benoit; Abdallah, Marwan; Bendali, Farida; Sadoun, Djamila; Chihib, Nour-Eddine; Drider, Djamel
2014-11-17
Two hundred and thirty individual clones of microorganisms were recovered from milk tanks and milking machine surfaces at two distinct farms (Bejaja City, Algeria). Of these clones, 130 were identified as lactic acid bacteria (LAB). In addition Escherichia coli, Salmonella, Staphylococcus aureus and Pseudomonas aeruginosa species were identified in the remaining 100 isolates-spoilage isolate. These isolates were assayed for ability to form biofilms. S. aureus, Lactobacillus brevis strains LB1F2, LB14F1 and LB15F1, and Lactobacillus pentosus strains LB2F2 and LB3F2 were identified as the best biofilm formers. Besides, these LAB isolates were able to produce proteinaceous substances with antagonism against the aforementioned spoilage isolates, when grown in MRS or TSB-YE media. During the screening, L. pentosus LB3F2 exhibited the highest antibacterial activity when grown in TSB-YE medium at 30 °C. Additionally, L. pentosus LB3F2 was able to strongly hamper the adhesion of S. aureus SA3 on abiotic surfaces as polystyrene and stainless steel slides. LAB isolates did not show any hemolytic activity and all of them were sensitive to different families of antibiotic tested. It should be pointed out that LB3F2 isolate was not cytotoxic on the intestinal cells but could stimulate their metabolic activity. This report unveiled the potential of LB1F2, LB14F1, LB15F1, LB2F2, and LB3F2 isolates to be used as natural barrier or competitive exclusion organism in the food processing sector as well as a positive biofilm forming bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Fuzik, M M; Prysyazhnyuk, A Y; Shibata, Y; Romanenko, A Y; Fedorenko, Z P; Gudzenko, N A; Gulak, L O; Trotsyuk, N K; Goroh, Y L; Khukhrianska, O M; Sumkina, O V; Saenko, V A; Yamashita, S
2013-01-01
The objective of this study was to investigate the thyroid cancer incidence in a whole territory of Ukraine and to clear up its age and gender patterns depending on average regional (oblast) thyroid doses from radioactive iodine due to the Chornobyl accident. MATERIALS AND METHODS. On the basis of average accumulated thyroid doses from radioactive iodine the geographical regions of Ukraine with low and high average thyroid doses were identified for a comparative analysis performance. Methods of descriptive epidemiology were used. The level and dynamics of thyroid cancer incidence were analyzed in different gender and age groups (both for attained age and age at the moment of the Chornobyl accident). Results of this study confirmed the radiation excess of thyroid cancer in individuals who were children and adolescents in 1986. Some excess was observed in elder age groups too. Especial situation was observed in female age group 40-49 at the moment of the Chornobyl accident i.e. the age-specific thyroid cancer incidence rates were significantly higher in "high exposure" regions comparing with "low exposure" ones during all years of observation within 1989-2009. A probable radiation excess of thyroid cancer was suggested not only in children and adolescents but also in adult age groups. In elder age groups this excess was less expressed and manifested after a longer period of time. The origin of the phenomenon in female age group of 40-49 is unclear now. Hypothesis of combined effect of radiation and natural changing of hormonal status in this age should be checked in the future studies. Fuzik M. M, Prysyazhnyuk A. Ye, Shibata Y., Romanenko A. Yu., Fedorenko Z. P., Gudzenko N. A., Gulak L. O., Trotsyuk N. K., Goroh Ye. L., Khukhrianska O. M., Sumkina O. V., Saenko V. A., Yamashita Sh., 2013.
NASA Astrophysics Data System (ADS)
Ando, Shin'ichiro; Sato, Katsuhiko
2003-07-01
We study the resonant spin-flavor (RSF) conversion of supernova neutrinos, which is induced by the interaction between the nonzero neutrino magnetic moment and the supernova magnetic fields, and its dependence on presupernova models. As the presupernova models, we adopt the latest ones by Woosley, Heger, and Weaver, and, further, models with both solar and zero metallicity are investigated. Since the (1-2Ye) profile of the new presupernova models, which is responsible for the RSF conversion, suddenly drops at the resonance region, the completely adiabatic RSF conversion is not realized, even if μνB0=(10-12μB)(1010 G), where B0 is the strength of the magnetic field at the surface of the iron core. In particular for the model with zero metallicity, the conversion is highly nonadiabatic in the high energy region, reflecting the (1-2Ye) profile of the model. In calculating the flavor conversion, we find that the shock wave propagation, which changes density profiles drastically, is a much more severe problem than it is for the pure Mikheyev-Smirnov-Wolfenstein (MSW) conversion case. This is because the RSF effect occurs at a far deeper region than the MSW effect. To avoid the uncertainty concerning the shock propagation, we restrict our discussion to 0.5 s after the core bounce (and for more conservative discussion, 0.25 s), during which the shock wave is not expected to affect the RSF region. We also evaluate the energy spectrum at the Super-Kamiokande detector for various models using the calculated conversion probabilities, and find that it is very difficult to obtain useful information on the supernova metallicities and magnetic fields or on the neutrino magnetic moment from the supernova neutrino observation. Future prospects are also discussed.
Cole, Kathryn E; Gattis, Samuel G; Angell, Heather D; Fierke, Carol A; Christianson, David W
2011-01-18
The first committed step of lipid A biosynthesis is catalyzed by UDP-(3-O-((R)-3-hydroxymyristoyl))-N-acetylglucosamine deacetylase, a metal-dependent deacetylase also known as LpxC. Because lipid A is essential for bacterial viability, the inhibition of LpxC is an appealing therapeutic strategy for the treatment of Gram-negative bacterial infections. Here we report the 1.79 Å resolution X-ray crystal structure of LpxC from Yersinia enterocolitica (YeLpxC) complexed with the potent hydroxamate inhibitor CHIR-090. This enzyme is a nearly identical orthologue of LpxC from Yersinia pestis (99.7% sequence identity), the pathogen that causes bubonic plague. Similar to the inhibition of LpxC from Escherichia coli, CHIR-090 inhibits YeLpxC via a two-step slow, tight-binding mechanism with an apparent K(i) of 0.54 ± 0.14 nM followed by conversion of the E·I to E·I* species with a rate constant of 0.11 ± 0.01 min(-1). The structure of the LpxC complex with CHIR-090 shows that the inhibitor hydroxamate group chelates the active site zinc ion, and the "tail" of the inhibitor binds in the hydrophobic tunnel in the active site. This hydrophobic tunnel is framed by a βαβ subdomain that exhibits significant conformational flexibility as it accommodates inhibitor binding. CHIR-090 displays a 27 mm zone of inhibition against Y. enterocolitica in a Kirby-Bauer antibiotic assay, which is comparable to its reported activity against other Gram-negative species including E. coli and Pseudomonas aeruginosa. This study demonstrates that the inhibition of LpxC should be explored as a potential therapeutic and/or prophylatic response to infection by weaponized Yersinia species.
Magnetoassociation of KRb Feshbach molecules
NASA Astrophysics Data System (ADS)
Cumby, Tyler; Perreault, John; Shewmon, Ruth; Jin, Deborah
2010-03-01
I will discuss experiments in which we study the creation of ^40K^87Rb Feshbach molecules via magnetoassociation. We measure the molecule number as a function of the magnetic-field sweep rate through the interspecies Feshbach resonance and explore the dependence of association on the initial atom gas conditions. This study of the Feshbach molecule creation process may be relevant to the production of ultracold polar molecules, where magnetoassociated Feshbach molecules can be a crucial first step [1].[4pt] [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231- 235.
Magnetoassociation of KRb Feshbach molecules
NASA Astrophysics Data System (ADS)
Cumby, Tyler; Perreault, John; Shewmon, Ruth; Jin, Deborah
2010-03-01
I will discuss experiments in which we study the creation of ^40K^87Rb Feshbach molecules via magnetoassociation. We measure the molecule number as a function of the magnetic-field sweep rate through the interspecies Feshbach resonance and explore the dependence of association on the initial atom gas conditions. This study of the Feshbach molecule creation process may be relevant to the production of ultracold polar molecules, where magnetoassociated Feshbach molecules can be a crucial first step [1].[4pt] [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231-235.
An Examination of Target Tracking in the Antisubmarine Warfare Systems Evaluation Tool (ASSET)
1991-09-01
fnCorC- Ingi Ing?)))) WX CY) Calt) (dlat2 Ccosl.±sp lat2 C) (if 0- C. diet dIng? 0.0001) (proqa (if (- flag 0) (proqa (if f- ding 0) (proqa (if (c latl...x Y)) (if (or C brg 90) Cbzg 2101) fsetq rnq C- cat? dIng)) Csetq tag (abs C/ diet Cco&Lisp brgC C C Csetq rng tC 60.1077 rng)) (list rag brgC C;let...Xdus i .X KetO : 0 yea 0 0 vi : .- (-2ln(md(I ))) cod 2rad(l ( i +Xd ye n .- (-2.n(rd(I)))n 2- rnd(I ) +Ydis n ,Vet V .xp -aA 4A,- - .k .H- it .- vx
NASA Astrophysics Data System (ADS)
Liu, Zhi-Hao; Chen, Han-Wu
2018-02-01
As we know, the information leakage problem should be avoided in a secure quantum communication protocol. Unfortunately, it is found that this problem does exist in the large payload bidirectional quantum secure direct communication (BQSDC) protocol (Ye Int. J. Quantum. Inf. 11(5), 1350051 2013) which is based on entanglement swapping between any two Greenberger-Horne-Zeilinger (GHZ) states. To be specific, one half of the information interchanged in this protocol is leaked out unconsciously without any active attack from an eavesdropper. Afterward, this BQSDC protocol is revised to the one without information leakage. It is shown that the improved BQSDC protocol is secure against the general individual attack and has some obvious features compared with the original one.
Water Quality Management Studies, Lake Seminole, February-December 1979. Phase II.
1982-12-01
Carbon, Dissolved Organtc X X X X X X X Carbon. Total Organic I I X I X X" X Carbon Dioxide I X X X X X X I trogen. Total Amonia I X I X X X I Nitrogen...were less than 1 mg S04/1. During Phase I and Phase II there were no distinctive trends in measured carbon dioxide levels. However, there was a tendency...6. so 0 To CARSON DIOXIDE (MG C02.01. 0 1.3 Re 1. Re 0. 2* 0 NITROGEN. TOTAL AMMONIA IMG N/’LI 0.02 < 0.02 < 0.02 CO (002 ’ NITROG01. NITPATE.NITT2lYE
Oliver E. Buckley Condensed Matter Prize: Emergent gravity from interacting Majorana modes
NASA Astrophysics Data System (ADS)
Kitaev, Alexei
I will describe a concrete many-body Hamiltonian that exhibits some features of a quantum black hole. The Sachdev-Ye-Kitaev model is a system of N >> 1 Majorana modes that are all coupled by random 4-th order terms. The problem admits an approximate dynamic mean field solution. At low temperatures, there is a fluctuating collective mode that corresponds to reparametrization of time. The effective action for this mode is equivalent to dilaton gravity in two space-time dimensions. Some important questions are how to quantize the reparametrization mode in Lorentzian time, include dissipative effects, and understand this system from the quantum information perspective. Supported by the Simons Foundation, Award Number 376205.
1979-11-01
inspection, Union Meadows Dam is in good 3-1 condition. Trees growing on thc - e-ast bar-,k of tne discharge channel between the damn and State Route 16T...Vernon A. Know ttOn On the mornin, 01 Novem-,ber 14, 1 9t8, 1 - isitedl L:nion eaw to check a leak oni the lef-t abutmentL ol: thc spillw;oy Thke...8217t 1 .Ce ev-:-r: f ive ye -rs. c)ai.,i3tanft ri1th -. ,m pt~qnt ijlt&vi.-i~ 1-s-’ctor is na ex-oert an ’-i-t~~i~~r~.iK"., cbd sinflt you wiII be
Medical Physics Panel Discussion
NASA Astrophysics Data System (ADS)
Guèye, Paul; Avery, Steven; Baird, Richard; Soares, Christopher; Amols, Howard; Tripuraneni, Prabhakar; Majewski, Stan; Weisenberger, Drew
2006-03-01
The panel discussion will explore opportunities and vistas in medical physics research and practice, medical imaging, teaching medical physics to undergraduates, and medical physics curricula as a recruiting tool for physics departments. Panel members consist of representatives from NSBP (Paul Guèye and Steven Avery), NIH/NIBIB (Richard Baird), NIST (Christopher Soares), AAPM (Howard Amols), ASTRO (Prabhakar Tripuraneni), and Jefferson Lab (Stan Majewski and Drew Weisenberger). Medical Physicists are part of Departments of Radiation Oncology at hospitals and medical centers. The field of medical physics includes radiation therapy physics, medical diagnostic and imaging physics, nuclear medicine physics, and medical radiation safety. It also ranges from basic researcher (at college institutions, industries, and laboratories) to applications in clinical environments.
[Briefly analysis on academic origins of traditional Chinese medicine dispensing].
Zhao, Xue-Min; Zhang, Xiao-Juan; Zhai, Hua-Qiang; Jin, Shi-Yuan
2014-04-01
Through collecting and collating the development process of traditional Chinese medicine dispensing, the development of modern Chinese medicine dispensing on the basis of experience could be promoted. "Heyaofenji", "Hehe", " Heji" in ancient Chinese medicine, herbal medicine literature and law were collected, and then things were sorted out according to traditional Chinese medicine dispensing theory, skills and legal norms. Firstly, "Tang Ye Jing Fa" is the earliest book which marks the rudiment of traditional Chinese medicine dispensing. Secondly, traditional Chinese medicine dispensing theory formed in "Shen Nong's herbal classic". Thirdly, Zhang Zhongjing's "Treatise on Febrile Diseases" marked the formation of Chinese medicine dispensing skills. Lastly, Provisions in Tang Dynasty law marks the development of traditional Chinese medicine dispensing.
Quantum critical scaling in beta-YbAlB4 and theoretical implications
NASA Astrophysics Data System (ADS)
Nevidomskyy, Andriy
2012-02-01
Emergent phenomena in quantum materials are subject of intense experimental and theoretical research at present. A wonderful example thereof are the sister phases of YbAlB4 - a newly discovered heavy fermion material [1]. While one phase (α-YbAlB4) is a heavy Fermi liquid, its sibling β-YbAlB4 is quantum critical, supporting an unconventional superconductivity with a tiny transition temperature of ˜80 mK. Latest experiments [2] uncover the quantum critical T/B-scaling in β-YbAlB4 and prove that superconductivity emerges from a strange metal governed by an extremely fragile quantum criticality, which apparently occurs at zero field, without any external tuning. Here, we will present a theoretical perspective on the quantum critical scaling in β-YbAlB4 and will show that the critical exponents can be derived from the nodal structure of the hybridization matrix between Yb f-band and the conduction electrons. It follows that the free energy at low temperatures can be written in a scaling form F[(kBT)^2 + (gμBB)^2]^3/4, which predicts the divergent Sommerfeld coefficient γ and quasi-particle effective mass as B->0: γ˜m^*/m B-1/2. This is indeed observed in the experiment [1,2], which places a tiny upper bound on the critical magnetic field Bc<0.2 mT. We will discuss theoritical implications of this fragile intrinsic quantum criticality in β-YbAlB4 and discuss the possibility of a quantum critical phase, rather than a quantum critical point, in this material. [1] S. Nakatsuji et al., Nature Physics 4, 603 (2008). [2] Y. Matsumoto, S. Nakatsuji, K. Kuga, Y. Karaki, Y. Shimura, T. Sakakibara, A. H. Nevidomskyy, and P. Coleman, Science 331, 316 (2011).
Molecular Genetics of Root Thigmoresponsiveness in Arabidopsis thaliana
NASA Technical Reports Server (NTRS)
Masson, Patrick H.
2002-01-01
The molecular mechanisms that allow plant roots to use gravity and touch as growth guides are investigated. We are using a molecular genetic strategy in Arabidopsis thaliana to study these processes. When Arabidopsis thaliana seedlings grow on tilted hard-agar surfaces, their roots develop a wavy pattern of growth which appears to derive from a succession of left-handed and right-handed circumnutation-like processes triggered by gravity and touch stimulation (Okada and Shimura, 1990; Rutherford et al., 1998; Rutherford and Masson, 1996). Interestingly, mutations that affect root waving on tilted hard-agar surfaces can be identified and characterized. Some of these mutations affect root gravitropism, while others appear to be responsible for the production of abnormal waves (no waves, compressed or square waves, coils) without affecting gravitropism. The specific objectives of this project were to functionally characterize two genes (WVD2 and WVD6) which are required for root waving on tilted agar surfaces, but not for root gravitropism. Specific objectives included a physiological and cytological analysis of the mutants, and molecular cloning and characterization of the corresponding genes. As summarized in this paper, we have reached these objectives. We have also identified and partially characterized other mutations that affect root skewing on hard-agar surfaces (sku5-1 and ago1), and have completed our work on the root-wave phenotype associated with mutations in genes of the tryptophan biosynthesis pathway (Lynn et al., 1999; Rutherford et al., 1998; Sedbrook et al., 2000, 2002). We briefly describe our progress on the cloning and characterization of WVD6, WVD2 and SKU5, and provide a list of papers (published, or in preparation) that derived from this grant. We also discuss the biological implications of our findings, with special emphasis on the analysis of WVD2.
NASA Astrophysics Data System (ADS)
Qattan, I. A.
2017-05-01
Background: The inconsistency in the results obtained from the Rosenbluth separation method and the high-Q2 recoil polarization results on the ratio μpGEp/GMp implies a systematic difference between the two techniques. Several studies suggest that missing higher-order radiative corrections to elastic electron-proton scattering cross section σR(ɛ ,Q2) and in particular hard two-photon-exchange (TPE) contributions could account for the discrepancy. Purpose: In this work, I improve on and extend to low and high Q2 values the extractions of the ɛ dependence of the real parts of the TPE amplitudes relative to the magnetic form factor, as well as the ratio Pl/PlBorn(ɛ ,Q2) by using world data on σR(ɛ ,Q2) with an emphasis on precise new data covering the low-momentum region which is sensitive to the large-scale structure of the nucleon. Method: I combine cross section and polarization measurements of elastic electron-proton scattering to extract the TPE amplitudes. Because the recoil polarization data were confirmed "experimentally" to be essentially independent of ɛ , I constrain the ratio Pt/Pl(ɛ ,Q2) to its ɛ -independent term (Born value) by setting the TPE contributions to zero. This allows for the amplitude YM(ɛ ,Q2) and σR(ɛ ,Q2) to be expressed in terms of the remaining two amplitudes YE(ɛ ,Q2) and Y3(ɛ ,Q2) which in turn are parametrized as second-order polynomials in ɛ and Q2 to reserve as possible the linearity of σR(ɛ ,Q2) as well as to account for possible nonlinearities in the TPE amplitudes. Furthermore, I impose the Regge limit which ensures the vanishing of the TPE contributions to σR(ɛ ,Q2) and the TPE amplitudes in the limit ɛ →1 . Results: I provide simple parametrizations of the TPE amplitudes, along with an estimate of the fit uncertainties. The extracted TPE amplitudes are compared with previous phenomenological extractions and TPE calculations. The Pl/PlBorn ratio is extracted by using the new parametrizations of the TPE
Seed Placement into Veggie Pods
2018-02-27
Dr. Ye Zhang, a project scientists, places seeds in Veggie Passive Orbital Nutrient Delivery System (PONDS) units inside a laboratory at the Space Station Processing Facility at NASA's Kennedy Space Center in Florida. Veggie PONDS is a direct follow-on to the Veg-01 and Veg-03 hardware and plant growth validation tests. The primary goal of this newly developed plant growing system, Veggie PONDS, is to demonstrate uniform plant growth. PONDS units have features that are designed to mitigate microgravity effects on water distribution, increase oxygen exchange and provide sufficient room for root zone growth. PONDS is planned for use during Veg-04 and Veg-05 on the International Space Station after the Veggie PONDS Validation flights on SpaceX-14 and OA-9.
Sun, Bai-Ye; Kan, Shi-Hong; Zhang, Yan-Zong; Wu, Jun; Deng, Shi-Huai; Liu, Chun-Sheng; Yang, Gang
2010-01-15
The following article from Environmental Toxicology, 'Long-term Copper Toxicity in Apple Trees (Malus pumila Mill) and Bioaccumulation in Fruits' by Bai-Ye Sun, Shi- Hong Kan, Yan-Zong Zhang, Jun Wu, Shi-Huai Deng, Chun-Sheng Liu and Gang Yang, published online on January 15, 2010 in Wiley InterScience (www.interscience.wiley.com; DOI: 10.1002/tox.20565), has been retracted by agreement between the authors, the journal Editor in Chief, Dr. Paul Tchounwou, and Wiley Periodicals, Inc. The retraction has been agreed at the request of the authors due to overlap with 'Copper Toxicity and Bioaccumulation in Chinese Cabbage (Brassica pekinensis Rupr.)' by Zhi-Ting Xiong and Hai Wang, published in Environmental Toxicology, Volume 20, pages 188-194, 2005.
Aftershocks to Philippine quake found within nearby megathrust fault
NASA Astrophysics Data System (ADS)
Schultz, Colin
2013-02-01
On 31 August 2012 a magnitude 7.6 earthquake ruptured deep beneath the sea floor of the Philippine Trench, a powerful intraplate earthquake centered seaward of the plate boundary. In the wake of the main shock, sensors detected a flurry of aftershocks, counting 110 in total. Drawing on seismic wave observations and rupture mechanisms calculated for the aftershocks, Ye et al. found that many were located near the epicenter of the main intraplate quake but at shallower depth; all involved normal faulting. Some shallow thrusting aftershocks were located farther to the west, centered within the potentially dangerous megathrust fault formed by the subduction of the Philippine Sea plate beneath the Philippine microplate, the piece of crust housing the Philippine Islands.
The Schwarzian theory — origins
NASA Astrophysics Data System (ADS)
Mertens, Thomas G.
2018-05-01
In this paper we further study the 1d Schwarzian theory, the universal low-energy limit of Sachdev-Ye-Kitaev models, using the link with 2d Liouville theory. We provide a path-integral derivation of the structural link between both theories, and study the relation between 3d gravity, 2d Jackiw-Teitelboim gravity, 2d Liouville and the 1d Schwarzian. We then generalize the Schwarzian double-scaling limit to rational models, relevant for SYK-type models with internal symmetries. We identify the holographic gauge theory as a 2d BF theory and compute correlators of the holographically dual 1d particle-on-a-group action, decomposing these into diagrammatic building blocks, in a manner very similar to the Schwarzian theory.
Cumulative Author Index for Soviet Laser Bibliographies Nos. 67-93, September 1983-February 1989
1990-02-01
91:62 ABRAHOV A YU 82:30 91:26 92:30 ABAKUOV V N 68:66 73:84 78:82 ABRAMOV 0 I 67:57 72:79 77:46 82:55 86: 15 88:70 ADALIYEV A E 75:9 ABRAHOV 0 V 90...75;68 93:77 ABRAMYAN ’T 0 70:52,72 ABDULLAYEV D A 74:36 ABRAHYAN YE A 70:99 ABDULIAYEV E A 91:25 ABRASIIIN V N 76:54 79:34 81:39 ABDULLAYEV F KH 86...LOYI,; V N S 67:71 91:53 ABSALYAHOVA E KI 87:84 ABDU[JHAIOV I G 90:108 ABSATAROVA N G 93:44 A8DUJL’tANIV R R 71:59 75:82 ABIJBAKIRUV A S 74:30 76:32 90
"This Is London, How D'ye Like It?": Teaching the Streets in Eighteenth-Century London
ERIC Educational Resources Information Center
McGraw, Ken
2017-01-01
As a professor of eighteenth-century British Literature I am often tasked (like my colleagues in other areas) with constructing a period based syllabus that "represents" this portion of literary history. Every semester, without fail, I am befuddled by the word "represents." How, exactly, do I want to "represent" the…
VizieR Online Data Catalog: IRX-β relation of HII regions in NGC628 (Ye+, 2016)
NASA Astrophysics Data System (ADS)
Ye, C.; Zou, H.; Lin, L.; Lian, J.; Hu, N.; Kong, X.
2016-10-01
NGC 628 has been observed by the PPAK IFS Nearby Galaxies Survey (PINGS) performed by the 3.5m telescope of the Calar Alto Observatory. The IFU provides a sampling of 2.7", an optical wavelength range of 3700-7000Å with a spectral resolution of ~8Å. The final data set comprises 11094 individual spectra, and the typical spatial resolution is about 3.5"-4". The slice image at the Hα wavelength is used to determine HII regions. FUV and near-UV (NUV) images of NGC 628 were taken by the Galaxy Evolution Explorer (GALEX), which are centered at wavelengths of 1516 and 2267Å. IR images were taken by Spitzer IRAC (3.6um, 8.0um) and MIPS (24um). The spatial resolutions of UV and IR images are 4.3", 5.3", 1.9", 2.8", and 6.4", respectively. We obtain these images from the data release website of Local Volume Legacy (LVL) survey DR5 (Dale+, 2009, J/ApJ/703/517; http://irsa.ipac.caltech.edu/data/SPITZER/LVL/). (2 data files).
NASA Astrophysics Data System (ADS)
Nguyen, Trung; Kokkin, Damian L.; Steimle, Timothy; Kozyryev, Ivan; Doyle, John M.
2015-06-01
Motivated by a diverse range of applications in physics and chemistry, currently there is great interest in the cooling of molecules to very low temperatures (≤1 mK). Direct laser cooling has been previously demonstrated for the diatomic radicals SrF, YO, and CaF, and most recently a three-dimensional magneto-optical trap (MOT) of SrF molecules was achieved. To determine the possibility of laser cooling for polyatomic molecules containing three or more atoms, detailed information is required about their Franck-Condon factors (FCFs) for emission from the excited states of interest. Here we report on the high-resolution laser excitation spectra, recorded field-free and in the presence of a static magnetic field, and on the dispersed fluorescence (DF) spectra for the A^2Π1/2 ← X^2σ^+ and B^2σ^+ ← X ^2σ^+ electronic transitions of SrOH. The DF spectra were analyzed to precisely determine FCFs and compared with values predicted using a normal coordinate GF matrix approach. The recorded Zeeman spectra were analyzed to determine the magnetic moments. Implication for proposed laser cooling and trapping experiments for SrOH will be presented. E.S. Shuman, J.F. Barry and D. DeMille, Nature 467, 820 (2010) J.F. Barry, E.S. Shuman, E.B. Norrgard and D. DeMille, Phys. Rev. Lett. 108, 103002 (2012) M.T. Hummon, M. Yeo, B.K. Stuhl, A.L. Collopy, Y. Xia, and J. Ye, Phys. Rev. Lett. 110, 143001 (2013) M. Yeo, M.T. Hummon, A.L. Collopy, B. Yan, B. Hemmerling, E. Chae, J.M. Doyle, and J. Ye, arXiv:1501.04683 (2015) V. Zhelyazkova, A. Cournol, T.E. Wall, A. Matsushima, J.J. Hudson, E.A. Hinds, M.R. Tarbutt, and B.E. Sauer, Phys. Rev. A 89, 053416 (2014) J.F. Barry, D.J. McCarron, E.B. Norrgard, M.H. Steinecker and D. DeMille, Nature 512, 286 (2014) D.J. McCarron, E.B. Norrgard, M.H. Steinecker and D. DeMille, arXiv:1412.8220 (2014)
Improving culture media for the isolation of Clostridium difficile from compost.
Dharmasena, Muthu; Jiang, Xiuping
2018-06-01
This study was to optimize the detection methods for Clostridium difficile from the animal manure-based composts. Both autoclaved and unautoclaved dairy composts were inoculated with a 12-h old suspension of a non-toxigenic C. difficile strain (ATCC 43593) and then plated on selected agar for vegetative cells and endospores. Six types of enrichment broths supplemented with taurocholate and l-cysteine were assessed for detecting a low level of artificially inoculated C. difficile (ca. 5 spores/g) from dairy composts. The efficacy of selected enrichment broths was further evaluated by isolating C. difficile from 29 commercial compost samples. Our results revealed that using heat-shock was more effective than using ethanol-shock for inducing endospore germination, and the highest endospore count (p < 0.05) was yielded at 60 °C for 25 min. C. difficile agar base, supplemented with 0.1% l-cysteine, 7% defibrinated horse blood, and cycloserine-cefoxitin (CDA-CYS-H-CC agar) was the best medium (p < 0.05) for recovering vegetative cells from compost. C. difficile endospore populations from both types of composts enumerated on both CDA-CYS-H-CC agar supplemented with 0.1% sodium taurocholate (CDA-CYS-H-CC-T agar) and brain heart infusion agar supplemented with 0.5% yeast extract, 0.1% l-cysteine, cycloserine-cefoxitin, and 0.1% sodium taurocholate (BHIA-YE-CYS-CC-T agar) media were not significantly different from each other (p > 0.05). Overall, enrichment of inoculated compost samples in broths containing moxalactam-norfloxacin (MN) produced significantly higher (p < 0.05) spore counts than in non-selective broths or broths supplemented with CC. Enrichment in BHIB-YE-CYS-MN-T broth followed by culturing on an agar containing 7% horse blood and 0.1% taurocholate provided a more sensitive and selective combination of media for detecting a low population of C. difficile from environmental samples with high background microflora. Copyright © 2018
Seed Placement into Veggie Pods
2018-02-27
From left, Matthew Romeyn and Dr. Ye Zhang, project scientists, place seeds in Veggie Passive Orbital Nutrient Delivery System (PONDS) units inside a laboratory at the Space Station Processing Facility at NASA’s Kennedy Space Center in Florida. Veggie PONDS is a direct follow-on to the Veg-01 and Veg-03 hardware and plant growth validation tests. The primary goal of this newly developed plant growing system, Veggie PONDS, is to demonstrate uniform plant growth. PONDS units have features that are designed to mitigate microgravity effects on water distribution, increase oxygen exchange and provide sufficient room for root zone growth. PONDS is planned for use during Veg-04 and Veg-05 on the International Space Station after the Veggie PONDS Validation flights on SpaceX-14 and OA-9.
Infrared-thermography imaging system multiapplications for manufacturing
NASA Astrophysics Data System (ADS)
Stern, Sharon A.
1990-03-01
Imaging systems technology has been utilized traditionally for diagnosing structural envelope or insulation problems in the general thermographic comunity. Industrially, new applications for utilizing thermal imaging technology have been developed i n pred i cti ve/preventi ye mai ntenance and prod uct moni tori ng prociures at Eastman Kodak Company, the largest photographic manufacturering producer in the world. In the manufacturing processes used at Eastman Kodak Company, new applications for thermal imaging include: (1) Fluid transfer line insulation (2) Web coating drying uniformity (3) Web slitter knives (4) Heating/cooling coils (5) Overheated tail bearings, and (6) Electrical phase imbalance. The substantial cost benefits gained from these applications of infrared thermography substantiate the practicality of this approach and indicate the desirability of researching further appl i cati ons.
Paoletti, M G; Dufour, D L; Cerda, H; Torres, F; Pizzoferrato, L; Pimentel, D
2000-11-22
At least 32 Amerindian groups in the Amazon basin use terrestrial invertebrates as food. Leaf- and litter-consuming invertebrates provide the more important, underestimated food sources for many Amerindian groups. Further, litter-consuming earthworms are also an important food resource for the Ye'Kuana (also known as Makiritare) in the Alto Orinoco (Amazonas, Venezuela). By selecting these small invertebrates the Amerindians are choosing their animal food from those food webs in the rainforest which have the highest energy flow and which constitute the greatest renewable stock of readily available nutrients. Here we show that the consumption of leaf- and litter-feeding invertebrates as a means of recovering protein, fat and vitamins by the forest-living peoples offers a new perspective for the development of sustainable animal food production within the paradigm of biodiversity maintenance.
Grant T. Kirker; Samuel L. Zelinka; Leandro Passarini
2016-01-01
Salt damage is a frequent problem in wood exposed to seawater and other saline environments. Symptoms of salt damage are often referred to as fuzzy wood and have been historically considered non-structural damage, but a growing number of customer inquiries have prompted a re-evaluation of this phenomenon. This paper details several case studies involving salt damage,...
Model Independent Determination of Electron Fraction for Individual SNIa
NASA Astrophysics Data System (ADS)
De, Soma; Timmes, F.; Hawley, W.; Chamulak, D.; Athanassiadou, T.; Jack, D.; Calder, A.; Brown, E.; Townsley, D.
2013-01-01
Ye of individual supernova Type Ia at the time of explosion by using the silicon, sulfur, and calcium features from single epoch and multi-epoch spectra near maximum light. Most one-dimensional Chandrasekhar mass models of supernova Type Ia in the single-degenerate scenario produce their intermediate-mass elements in a burn to quasi-nuclear statistical equilibrium between the mass shells 0.8 and 1.1 M. We find a near linear dependence of the intermediate-mass element nuclear yields on the white dwarf’s initial metallicity from such SNe Ia explosion models, and the effect this dependence has on synthetic spectra near maximum light. We demonstrate that these metallicity signatures are only due to material achieving the necessary thermodynamic conditions. In addition, we find that global abundance of silicon is insensitive to change in metallicity but sulfur and calcium abundances change significantly
1994-09-07
• It's easy to mock, I know, and we all have our own little peculiarities, but there's a new magazine out aimed specifically at collectors of phone cards. Yes, Publishing reports that Telecard Collector International is about to hit the streets, complete with the obligatory glamorous woman on the front to boost sales. In this case, the woman is Julia Swalha - Saffi, in Absolutely Fabulous - who is obviously a phonecard fan. (Whatever would Patsy say?) But titter ye not. 'Overall, this is an infuriatingly compulsive read,' says Publishing. And with some cards apparently reaching asking prices of £950, the anorak brigade obviously knows a thing or two. But before you start hanging on to all those cards you feed into the nursing home phone, be warned. They apparently increase in value if they are unused. Fabulous.
Universal Faraday Rotation in HgTe Wells with Critical Thickness
NASA Astrophysics Data System (ADS)
Shuvaev, A.; Dziom, V.; Kvon, Z. D.; Mikhailov, N. N.; Pimenov, A.
2016-09-01
The universal value of the Faraday rotation angle close to the fine structure constant (α ≈1 /137 ) is experimentally observed in thin HgTe quantum wells with a thickness on the border between trivial insulating and the topologically nontrivial Dirac phases. The quantized value of the Faraday angle remains robust in the broad range of magnetic fields and gate voltages. Dynamic Hall conductivity of the holelike carriers extracted from the analysis of the transmission data shows a theoretically predicted universal value of σx y=e2/h , which is consistent with the doubly degenerate Dirac state. On shifting the Fermi level by the gate voltage, the effective sign of the charge carriers changes from positive (holes) to negative (electrons). The electronlike part of the dynamic response does not show quantum plateaus and is well described within the classical Drude model.
Dynamical thermalization in isolated quantum dots and black holes
NASA Astrophysics Data System (ADS)
Kolovsky, Andrey R.; Shepelyansky, Dima L.
2017-01-01
We study numerically a model of quantum dot with interacting fermions. At strong interactions with small conductance the model is reduced to the Sachdev-Ye-Kitaev black-hole model while at weak interactions and large conductance it describes a Landau-Fermi liquid in a regime of quantum chaos. We show that above the Åberg threshold for interactions there is an onset of dynamical themalization with the Fermi-Dirac distribution describing the eigenstates of an isolated dot. At strong interactions in the isolated black-hole regime there is also the onset of dynamical thermalization with the entropy described by the quantum Gibbs distribution. This dynamical thermalization takes place in an isolated system without any contact with a thermostat. We discuss the possible realization of these regimes with quantum dots of 2D electrons and cold ions in optical lattices.
A hybridized formulation for the weak Galerkin mixed finite element method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mu, Lin; Wang, Junping; Ye, Xiu
This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less
A hybridized formulation for the weak Galerkin mixed finite element method
Mu, Lin; Wang, Junping; Ye, Xiu
2016-01-14
This paper presents a hybridized formulation for the weak Galerkin mixed finite element method (WG-MFEM) which was introduced and analyzed in Wang and Ye (2014) for second order elliptic equations. The WG-MFEM method was designed by using discontinuous piecewise polynomials on finite element partitions consisting of polygonal or polyhedral elements of arbitrary shape. The key to WG-MFEM is the use of a discrete weak divergence operator which is defined and computed by solving inexpensive problems locally on each element. The hybridized formulation of this paper leads to a significantly reduced system of linear equations involving only the unknowns arising frommore » the Lagrange multiplier in hybridization. Optimal-order error estimates are derived for the hybridized WG-MFEM approximations. In conclusion, some numerical results are reported to confirm the theory and a superconvergence for the Lagrange multiplier.« less
Spline Approximation of Thin Shell Dynamics
NASA Technical Reports Server (NTRS)
delRosario, R. C. H.; Smith, R. C.
1996-01-01
A spline-based method for approximating thin shell dynamics is presented here. While the method is developed in the context of the Donnell-Mushtari thin shell equations, it can be easily extended to the Byrne-Flugge-Lur'ye equations or other models for shells of revolution as warranted by applications. The primary requirements for the method include accuracy, flexibility and efficiency in smart material applications. To accomplish this, the method was designed to be flexible with regard to boundary conditions, material nonhomogeneities due to sensors and actuators, and inputs from smart material actuators such as piezoceramic patches. The accuracy of the method was also of primary concern, both to guarantee full resolution of structural dynamics and to facilitate the development of PDE-based controllers which ultimately require real-time implementation. Several numerical examples provide initial evidence demonstrating the efficacy of the method.
Montes-Perez, J; Cruz-Vera, A; Herrera, J N
2011-12-01
This work presents the full analytic expressions for the thermodynamic properties and the static structure factor for a hard sphere plus 1-Yukawa fluid within the mean spherical approximation. To obtain these properties of the fluid type Yukawa analytically it was necessary to solve an equation of fourth order for the scaling parameter on a large scale. The physical root of this equation was determined by imposing physical conditions. The results of this work are obtained from seminal papers of Blum and Høye. We show that is not necessary the use the series expansion to solve the equation for the scaling parameter. We applied our theoretical result to find the thermodynamic and the static structure factor for krypton. Our results are in good agreement with those obtained in an experimental form or by simulation using the Monte Carlo method.
Fine Grained Chaos in AdS2 Gravity
NASA Astrophysics Data System (ADS)
Haehl, Felix M.; Rozali, Moshe
2018-03-01
Quantum chaos can be characterized by an exponential growth of the thermal out-of-time-order four-point function up to a scrambling time u^*. We discuss generalizations of this statement for certain higher-point correlation functions. For concreteness, we study the Schwarzian theory of a one-dimensional time reparametrization mode, which describes two-dimensional anti-de Sitter space (AdS2 ) gravity and the low-energy dynamics of the Sachdev-Ye-Kitaev model. We identify a particular set of 2 k -point functions, characterized as being both "maximally braided" and "k -out of time order," which exhibit exponential growth until progressively longer time scales u^*(k)˜(k -1 )u^*. We suggest an interpretation as scrambling of increasingly fine grained measures of quantum information, which correspondingly take progressively longer time to reach their thermal values.
Fine Grained Chaos in AdS_{2} Gravity.
Haehl, Felix M; Rozali, Moshe
2018-03-23
Quantum chaos can be characterized by an exponential growth of the thermal out-of-time-order four-point function up to a scrambling time u[over ^]_{*}. We discuss generalizations of this statement for certain higher-point correlation functions. For concreteness, we study the Schwarzian theory of a one-dimensional time reparametrization mode, which describes two-dimensional anti-de Sitter space (AdS_{2}) gravity and the low-energy dynamics of the Sachdev-Ye-Kitaev model. We identify a particular set of 2k-point functions, characterized as being both "maximally braided" and "k-out of time order," which exhibit exponential growth until progressively longer time scales u[over ^]_{*}^{(k)}∼(k-1)u[over ^]_{*}. We suggest an interpretation as scrambling of increasingly fine grained measures of quantum information, which correspondingly take progressively longer time to reach their thermal values.
NASA Astrophysics Data System (ADS)
Hill, V.; Christlieb, N.; Beers, T. C.; Barklem, P. S.; Kratz, K.-L.; Nordström, B.; Pfeiffer, B.; Farouqi, K.
2017-11-01
We report an abundance analysis for the highly r-process-enhanced (r-II) star CS 29497-004, a very metal-poor giant with solar system Teff = 5013 K and [Fe/H] = -2.85, whose nature was initially discovered in the course of the HERES project. Our analysis is based on high signal-to-noise ratio, high-resolution (R 75 000) VLT/UVES spectra and MARCS model atmospheres under the assumption of local thermodynamic equilibrium, and obtains abundance measurements for a total of 46 elements, 31 of which are neutron-capture elements. As is the case for the other 25 r-II stars currently known, the heavy-element abundance pattern of CS 29497-004 well-matches a scaled solar system second peak r-process-element abundance pattern. We confirm our previous detection of Th, and demonstrate that this star does not exhibit an "actinide boost". Uranium is also detected (log ɛ(U) = -2.20 ± 0.30), albeit with a large measurement error that hampers its use as a precision cosmo-chronometer. Combining the various elemental chronometer pairs that are available for this star, we derive a mean age of 12.2 ± 3.7 Gyr using the theoretical production ratios from published waiting-point approximation models. We further explore the high-entropy wind model (Farouqi et al. 2010, ApJ, 712, 1359) production ratios arising from different neutron richness of the ejecta (Ye), and derive an age of 13.7 ± 4.4 Gyr for a best-fitting Ye = 0.447. The U/Th nuclei-chronometer is confirmed to be the most resilient to theoretical production ratios and yields an age of 16.5 ± 6.6 Gyr. Lead (Pb) is also tentatively detected in CS 29497-004, at a level compatible with a scaled solar r-process, or with the theoretical expectations for a pure r-process in this star. Based on observations collected at the European Southern Observatory, Paranal, Chile (Proposal Number 170.D-0010).Table B.1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http
China cuts energy intensity, but overall energy growth continues, report notes
NASA Astrophysics Data System (ADS)
Showstack, Randy
2012-02-01
A new report states that China has cut its energy intensity—defined as energy use per unit of economic output—by 19.1% from 2006 to 2010, reversing the previous upward trend. However, energy use and carbon emissions in the country continue to grow sharply, according to the Climate Policy Initiative's (CPI) Annual Review of Low-Carbon Development in China: 2010, the second of such reports. China nearly hit its goal of a 20% target reduction in energy intensity during that time period, which spanned the country's eleventh Five-Year Period (FYP) for social and economic development, but during that same period energy-related growth in carbon dioxide (CO2) emissions in China increased by 33.6%, from 5.15 billion tons to 6.88 billion tons, said Qi Ye, CPI's Beijing office director, at a 2 February briefing held at the Brookings Institution in Washington, D. C.
Swift and NuSTAR observations of GW170817: Detection of a blue kilonova
Evans, P. A.; Cenko, S. B.; Kennea, J. A.; ...
2017-10-16
With the first direct detection of merging black holes in 2015, the era of gravitational wave (GW) astrophysics began. However, a complete picture of compact object mergers requires the detection of an electromagnetic (EM) counterpart. Here, we report ultraviolet (UV) and x-ray observations by Swift and the Nuclear Spectroscopic Telescope ARray (NuSTAR) of the EM counterpart of the binary neutron star merger GW 170817. The bright, rapidly fading ultraviolet emission indicates a high mass (≈ 0.03 solar masses) wind-driven outflow with moderate electron fraction (Ye ≈ 0.27). Combined with the x-ray limits, we favor an observer viewing angle of ≈30°more » away from the orbital rotation axis, which avoids both obscuration from the heaviest elements in the orbital plane and a direct view of any ultra-relativistic, highly collimated ejecta (a γ-ray burst afterglow).« less
NASA Technical Reports Server (NTRS)
Morozov, S. K.; Krasitskiy, O. P.
1978-01-01
A computational scheme and a standard program is proposed for solving systems of nonstationary spatially one-dimensional nonlinear differential equations using Newton's method. The proposed scheme is universal in its applicability and its reduces to a minimum the work of programming. The program is written in the FORTRAN language and can be used without change on electronic computers of type YeS and BESM-6. The standard program described permits the identification of nonstationary (or stationary) solutions to systems of spatially one-dimensional nonlinear (or linear) partial differential equations. The proposed method may be used to solve a series of geophysical problems which take chemical reactions, diffusion, and heat conductivity into account, to evaluate nonstationary thermal fields in two-dimensional structures when in one of the geometrical directions it can take a small number of discrete levels, and to solve problems in nonstationary gas dynamics.
An Updated Nuclear Equation of State for Neutron Stars and Supernova Simulations
NASA Astrophysics Data System (ADS)
Meixner, M. A.; Mathews, G. J.; Dalhed, H. E.; Lan, N. Q.
2011-10-01
We present an updated and improved Equation of State based upon the framework originally developed by Bowers & Wilson. The details of the EoS and improvements are described along with a description of how to access this EOS for numerical simulations. Among the improvements are an updated compressibility based upon recent measurements, the possibility of the formation of proton excess (Ye> 0.5) material and an improved treatment of the nuclear statistical equilibrium and the transition to pasta nuclei as the density approaches nuclear matter density. The possibility of a QCD chiral phase transition is also included at densities above nuclear matter density. We show comparisons of this EOS with the other two publicly available equations of state used in supernova collapse simulations. The advantages of the present EoS is that it is easily amenable to phenomenological parameterization to fit observed explosion properties and to accommodate new physical parameters.
Swift and NuSTAR observations of GW170817: Detection of a blue kilonova
DOE Office of Scientific and Technical Information (OSTI.GOV)
Evans, P. A.; Cenko, S. B.; Kennea, J. A.
With the first direct detection of merging black holes in 2015, the era of gravitational wave (GW) astrophysics began. However, a complete picture of compact object mergers requires the detection of an electromagnetic (EM) counterpart. Here, we report ultraviolet (UV) and x-ray observations by Swift and the Nuclear Spectroscopic Telescope ARray (NuSTAR) of the EM counterpart of the binary neutron star merger GW 170817. The bright, rapidly fading ultraviolet emission indicates a high mass (≈ 0.03 solar masses) wind-driven outflow with moderate electron fraction (Ye ≈ 0.27). Combined with the x-ray limits, we favor an observer viewing angle of ≈30°more » away from the orbital rotation axis, which avoids both obscuration from the heaviest elements in the orbital plane and a direct view of any ultra-relativistic, highly collimated ejecta (a γ-ray burst afterglow).« less
Topological Defects in Double Exchange Materials and Anomalous Hall Resistance.
NASA Astrophysics Data System (ADS)
Calderón, M. J.; Brey, L.
2000-03-01
Recently it has been proposed that the anomalous Hall effect observed in Double Exchange materials is due to Berry phase effects caused by carrier hopping in a nontrivial spins background (J.Ye et al.) Phys.Rev.Lett. 83, 3737 1999.In order to study this possibility we have performed Monte Carlo simulations of the Double Exchange model and we have computed, as a function of the temperature, the number of topological defects in the system and the internal gauge magnetic field associated with these defects. In the simplest Double Exchange model the gauge magnetic field is random, and its average value is zero. The inclusion in the problem of spin-orbit coupling privileges the opposite direction of the magnetization and an anomalous Hall resistance (AHR) effect arises. We have computed the AHR, and we have obtained its temperature dependence. In agreement with previous experiments we obtain that AHR increases exponentially at low temperature and presents a maximum at a temperature slightly higher than the critical temperature.
Scrambling of quantum information in quantum many-body systems
NASA Astrophysics Data System (ADS)
Iyoda, Eiki; Sagawa, Takahiro
2018-04-01
We systematically investigate scrambling (or delocalizing) processes of quantum information encoded in quantum many-body systems by using numerical exact diagonalization. As a measure of scrambling, we adopt the tripartite mutual information (TMI) that becomes negative when quantum information is delocalized. We clarify that scrambling is an independent property of the integrability of Hamiltonians; TMI can be negative or positive for both integrable and nonintegrable systems. This implies that scrambling is a separate concept from conventional quantum chaos characterized by nonintegrability. Specifically, we argue that there are a few exceptional initial states that do not exhibit scrambling, and show that such exceptional initial states have small effective dimensions. Furthermore, we calculate TMI in the Sachdev-Ye-Kitaev (SYK) model, a fermionic toy model of quantum gravity. We find that disorder does not make scrambling slower but makes it smoother in the SYK model, in contrast to many-body localization in spin chains.
Zhang, Shou-Peng; Huang, Rong; Li, Fang-Fang; Wei, Hong-Xia; Fang, Xiao-Wei; Xie, Xiao-Song; Lin, Dong-Guo; Wu, Shao-Hua; He, Jian
2016-07-01
A new hydroanthraquinone derivative, 6-O-demethyl-4-dehydroxyaltersolanol A (1), and two new azaphilones, 8,11-didehydrochermesinone B (6) and (7S)-7-hydroxy-3,7-dimethyl-isochromene-6,8-dione (8), along with five known analogues (2-5 and 7), were isolated from the culture broth of Nigrospora sp. YE3033, an endophytic fungus obtained from Aconitum carmichaeli. Their structures were elucidated on the basis of spectroscopic analyses. Biological activity test indicated that compounds 1-3, and 7 exhibited the inhibitory effects on influenza viral strain of A/Puerto Rico/8/34 (H1N1) with the IC50 values of 2.59, 8.35, 7.82, and 0.80μg/mL, respectively, while the low cytotoxicity of 7 with the CC50 value of 184.75μg/mL, displaying a promising potential of 7 in the development of anti-influenza A virus drugs. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cau Dit Coumes, Céline, E-mail: celine.cau-dit-coumes@cea.fr; Dhoury, Mélanie; Champenois, Jean-Baptiste
This work investigates the influence of lithium ions on the hydration at 25 °C of two calcium sulfoaluminate (CSA) cements comprising 0 or 10% gypsum. Small concentrations of lithium salts (LiOH, LiNO{sub 3}) accelerate the early hydration of both CSA cements either in paste or in diluted and stirred suspension. The effect of the lithium cation is much stronger than its counter-ion. Hydration is accelerated by an increase in the lithium concentration up to 30 μmol Li/g of the used CSA cement (with a high ye'elimite content), and then levels off. The postulated mechanism relies on a fast precipitation ofmore » amorphous Li-containing Al(OH){sub 3}, which acts as seeds for accelerating the precipitation of amorphous Al(OH){sub 3} that speeds up the whole hydration process. This process seems to be closely related to the one involved in the acceleration of the hydration of calcium aluminate cement by lithium ions.« less
Multi-millennial-scale climate variability in Antarctica during the past seven glacial periods
NASA Astrophysics Data System (ADS)
Kawamura, K.
2009-12-01
Nakazawa, Fumihiko Nishio, Ichio Obinata, Rumi Ohgaito, Akira Oka, Junichi Okuyama, Frédéric Parrenin, Frank Pattyn, Fuyuki Saito, Takashi Saito, Takeshi Saito, Kimikazu Sasa, Yasuyuki Shibata, Kunio Shinbori, Keisuke Suzuki, Toshitaka Suzuki, Akiyoshi Takahashi, Shuhei Takahashi, Tsutomu Takahashi, Morimasa Takata, Michiko Tamari, Yoichi Tanaka, Yuki Tosaki, Ryu Uemura, Genta Watanabe, Okitsugu Watanabe, Tetsuhide Yamasaki, Kotaro Yokoyama, Takayasu Yoshimoto
Kimura, Masaki; Shimura, Satoru; Tai, Toshihiro; Kobayashi, Hideyuki; Baba, Shiro; Kano, Munehide; Nagao, Koichi
2013-12-01
Erection hardness is an elemental component of men's sexual quality of life that can be easily measured by the Erection Hardness Score (EHS). However, there are few published data regarding EHS, and there is little understanding of its relationships to aging, men's sexual behavior, sexual confidence, and risk factors in Japan. To assess EHS and how it correlates to aging, sexual behaviors, sexual self-confidence, and risk factors in a Japanese population database. A web-based cross-sectional nationwide survey conducted between March and May 2009 in Japan. EHS, lifestyle factors, comorbidities, general health, sexual confidence, frequency of sexual behaviors, and attitudes toward treatment of erectile dysfunction (ED). A total of 7,710 men with a mean age of 39.3 ± 13.0 years participated in this survey. In 6,528 participants who were not using phosphodiesterase type 5 inhibitors, 3,540 (54.2%) had EHS ≤ 3 and 1,196 (18.3%) had EHS ≤ 2. We found a significant age-dependent decrease in EHS, sexual confidence, and frequency of sexual activities. Sexual confidence was strongly associated with higher EHS but was also associated with older age groups, presence of offspring, awareness of better general health, and greater frequency of sexual activity. In age-adjusted multivariate logistic regression, risk factors for a lower EHS (defined as EHS ≤ 2) were heavy smoking, which was defined as more than two packs per day (odds ratio [OR], 1.7) or a history of metabolic syndrome (OR, 1.4), hypertension (OR, 1.2), and diabetes mellitus (OR, 1.4). EHS correlates to various elements, such as aging, sexual behaviors, sexual confidence, and ED-related risk factors, and can be a valuable tool in clinical practice for monitoring and treating ED and thereby improving the quality of life for men and their sexual partners. Kimura M, Shimura S, Tai T, Kobayashi H, Baba S, Kano M, and Nagao K. A web-based survey of Erection Hardness Score and its relationship to aging, sexual
Kimura, Masaki; Shimura, Satoru; Tai, Toshihiro; Kobayashi, Hideyuki; Baba, Shiro; Kano, Munehide; Nagao, Koichi
2013-01-01
Introduction Erection hardness is an elemental component of men's sexual quality of life that can be easily measured by the Erection Hardness Score (EHS). However, there are few published data regarding EHS, and there is little understanding of its relationships to aging, men's sexual behavior, sexual confidence, and risk factors in Japan. Aim To assess EHS and how it correlates to aging, sexual behaviors, sexual self-confidence, and risk factors in a Japanese population database. Methods A web-based cross-sectional nationwide survey conducted between March and May 2009 in Japan. Main Outcome Measures EHS, lifestyle factors, comorbidities, general health, sexual confidence, frequency of sexual behaviors, and attitudes toward treatment of erectile dysfunction (ED). Results A total of 7,710 men with a mean age of 39.3 ± 13.0 years participated in this survey. In 6,528 participants who were not using phosphodiesterase type 5 inhibitors, 3,540 (54.2%) had EHS ≤ 3 and 1,196 (18.3%) had EHS ≤ 2. We found a significant age-dependent decrease in EHS, sexual confidence, and frequency of sexual activities. Sexual confidence was strongly associated with higher EHS but was also associated with older age groups, presence of offspring, awareness of better general health, and greater frequency of sexual activity. In age-adjusted multivariate logistic regression, risk factors for a lower EHS (defined as EHS ≤ 2) were heavy smoking, which was defined as more than two packs per day (odds ratio [OR], 1.7) or a history of metabolic syndrome (OR, 1.4), hypertension (OR, 1.2), and diabetes mellitus (OR, 1.4). Conclusions EHS correlates to various elements, such as aging, sexual behaviors, sexual confidence, and ED-related risk factors, and can be a valuable tool in clinical practice for monitoring and treating ED and thereby improving the quality of life for men and their sexual partners. Kimura M, Shimura S, Tai T, Kobayashi H, Baba S, Kano M, and Nagao K. A web-based survey of
Whitlock, C.; Sarna-Wojcicki, A. M.; Bartlein, P.J.; Nickmann, R.J.
2000-01-01
Sediment cores from Carp Lake provide a pollen record of the last ca. 125,000 years that helps disclose vegetational and climatic conditions from the present day to the previous interglaciation (120-133 ka). The core also contained 15 tephra layers, which were characterised by electron-microprobe analysis of volcanic glass shards. Identified tephra include Mount St. Helens Ye, 3.69 ka; Mazama ash bed, 7.54 ka; Mount St. Helens layer C, 35-50 ka; an unnamed Mount St. Helens tephra, 75-150 ka; the tephra equivalent of layer E at Pringle Falls, Oregon, <218 ka; and an andesitic tephra layer similar to that at Tulelake, California, 174 ka. Ten calibrated radiocarbon ages and the ages of Mount St. Helens Ye, Mazama ash, and the unnamed Mount St. Helens tephra were used to develop an age-depth model. This model was refined by also incorporating the age of marine oxygen isotope stage (IS) boundary 4/5 (73.9 ka) and the age of IS-5e (125 ka). The justification for this age-model is based on an analysis of the pollen record and lithologic data. The pollen record is divided into 11 assemblage zones that describe alternations between periods of montane conifer forest, pine forest, and steppe. The previous interglacial period (IS-5e) supported temperate xerothermic forests of pine and oak and a northward and westward expansion of steppe and juniper woodland, compared to their present occurrence. The period from 83 to 117 ka contains intervals of pine forest and parkland alternating with pine-spruce forest, suggesting shifts from cold humid to cool temperate conditions. Between 73 and 83 ka, a forest of oak, hemlock, Douglas-fir, and fir was present that has no modem analogue. It suggests warm wet summers and cool wet winters. Cool humid conditions during the mid-Wisconsin interval supported mixed conifer forest with Douglas-fir and spruce. The glacial interval featured cold dry steppe, with an expansion of spruce in the late-glacial. Xerothermic communities prevailed in the
Talko, V V; Loganovsky, K M; Drozd, I P; Tukalenko, Ye V; Loganovska, T K; Nechayev, S Yu; Masiuk, S V; Prokhorova, Ye M
2017-12-01
hemisphere hippocampus. Decreased theta band spectral power (4-7 Hz range) of cerebral bioelectrical activity in the left frontotemporal area is suggestive of hippocampal dysfunction mainly in dominant hemisphere of prenatally irradiated persons. Disorders of hippocam pal neurogenesis due to prenatal exposure by radioactive iodine can be a biologic basis here. Innovative approach es in social adaptation, psychoprophylaxis and psychorehabilitation involve the maximum effective application and development of just the most developed psychological and cognitive abilities in survivors. V. V. Talko, K. M. Loganovsky, I. P. Drozd, Ye. V. Tukalenko, T. K. Loganovska, S. Yu. Nechayev, S. V. Masiuk, Ye. M. Prokhorova.
Sieburth, John McN.; Jensen, Arne
1967-01-01
Meal from the brown seaweed Ascophyllum nodosum (L.) Le Jol. is mainly used as an animal feed supplement. Since moist weed often develops a marked mold growth and since little was known about the microflora of seaweed meal, a cultural procedure was developed to enumerate the populations of bacteria, yeasts, and molds of seaweed meals manufactured by different drying processes. The microflora could be supported by a variety of media varying in levels of nutrition and in the source and concentration of salts. Fresh weed contained less than 103 bacteria and less than 102 yeasts and molds per g (dry weight). The type and extent of microbial populations in seaweed meal appeared to be dependent upon the method of seaweed drying. Rotary drum-drying at temperatures decreasing from 800 to 80 C maintained or reduced the microbial populations to 103 organisms per g (dry weight). Although meals with high nutritional quality can be obtained with warm air- or rock-dried weed, these conditions can also permit bacterial and mold development. Extended rock-drying in variable weather conditions and prolonged storage of moist weed, both of which decrease the nutritional quality, also lead to high bacterial numbers and to a marked development of the halophilic brown mold Sporendonema minutum which attained populations of 108 viable spores per g of dried weed. A poultry diet containing 5% badly molded weed had no apparent toxic or growth-depressing effect when fed to chicks. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:6069160
NASA Astrophysics Data System (ADS)
Rozenberg, E.
2004-03-01
In recent papers Ye et al. (J. Magn. Magn. Mater. 248 (2002) 26) and Lakshmi et al. (J. Magn. Magn. Mater. 257 (2003) 195) reported the characteristic features of electrical resistivity ( ρ) versus temperature ( T) dependences of polycrystalline-doped manganites La 1- xAg xMnO 3 and La 0.67Ca 0.33Mn 1- xRu xO 3. Infact, two peaks on ρ( T) curve coexist: broad one at some Tmax below the Curie points ( TC) of these compounds and a sharp peak near TC. Authors interpreted such coexistence as an evidence of electronic/magnetic phase separation in the above-noted systems below its TC. It is shown in this comment that such an interpretation is obviously invalid for La 1- xAg xMnO 3 system and is very questionable for La 0.67Ca 0.33Mn 1- xRu xO 3. The simplest and natural reason for the appearance of considered features on ρ( T) dependences of polycrystalline manganites is the well-known grain-boundary effects.
The bound states of ultracold KRb molecules
NASA Astrophysics Data System (ADS)
Julienne, Paul; Hanna, Thomas
2009-03-01
Recently ultracold vibrational ground state ^40K^87Rb polar molecules have been made using magnetoassociation of two cold atoms to a weakly bound Feshbach molecule, followed by a two-color optical STIRAP process to transfer molecules to the molecular ground state [1]. We have used accurate potential energy curves for the singlet and triplet states of the KRb molecule [2] with coupled channels calculations to calculate all of the bound states of the ^40K^87Rb molecule as a function of magnetic field from the cold atom collision threshold to the v=0 ground state. We have also developed approximate models for understanding the changing properties of the molecular bound states as binding energy increases. Some overall conclusions from these calculations will be presented. [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science, 2008, 322, 231--235. [2] A. Pashov, O. Docenko, M. Tamanis, R. Ferber, H. Kn"ockel, and E. Tiemann, Phys. Rev. A, 2007, 76, 022511.
Electric manipulation of ultracold polar ^40K^87Rb molecules in a magnetic field
NASA Astrophysics Data System (ADS)
Quéméner, Goulven; Bohn, John
2009-05-01
Ultracold fermionic polar molecules of ^40K^87Rb in their absolute rovibronic ground state (v=0,n=0,^1σ) have been created recently [1] in a magnetic trap and open new perspectives to create fermionic degenerate gases of polar molecules. To achieve this goal, it is very important to understand the collisional properties of such molecules under magnetic and electric fields. In our presentation, we investigate ground state fermionic ^40K^87Rb + ^40K^87Rb collisions in the presence of a magnetic field and explore the possibility to control these collisions when an electric field is applied. We will explore the main physical processes that can lead to such manipulation. This problem is complicated by the Zeeman and Stark splitting of all levels of the polar molecules and by the possibility of forming ^40K2 + ^87Rb2 chemical products. 1 - K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Pe'er, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science 322, 231 (2008).
Gutiérrez-Gamboa, Gastón; Portu, Javier; López, Rosa; Santamaría, Pilar; Garde-Cerdán, Teresa
2018-04-01
Elicitors and nitrogen foliar applications to vineyards could regulate grape nitrogen composition, which has an important effect on grape and wine quality. Thus the aim of this research was to study the effect of foliar elicitor treatments, methyl jasmonate (MeJ) and yeast extract (YE), and foliar nitrogen applications, urea (Ur) and phenylalanine (Phe), to Garnacha, Graciano and Tempranillo vines on grape amino acid composition. The results showed that elicitor and nitrogen foliar applications to Garnacha and Tempranillo grapevines decreased the must amino acid concentration. However, Phe application to these two grapevines increased the must Phe content. The treatments applied to Graciano grapevines barely effected the grape amino acid content. According to the percentage of variance attributable, the variety had a higher impact on the must amino acid composition than the treatments and their interaction, except in certain amino acids such as Phe. The influence of elicitor and nitrogen foliar applications to grapevines on grape amino acid concentration was strongly conditioned by the variety. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Forward orbital evolution of the Vesta Family with and without the Yarkovsky effect
NASA Astrophysics Data System (ADS)
Wlodarczyk, Ireneusz; Leliwa-Kopystynski, Jacek
2018-02-01
Vesta family members (VFMs), totally 17164, were selected by means of hierarchical clustering method (HCM) from the data base containing 393347 synthetic proper elements of numbered asteroids from the ASTDyS Catalogue (2015) updated in May 5, 2015. Keplerian elements from the Lowell Catalogue (2015) were used for studying orbital evolution of all 17164 VFMs in the time interval 1 Gy forward. Two cases were considered: evolution pass without the Yarkovsky effect (YN) and evolution pass with it (YY). It has been found that swarm of asteroids disperses about 28 times more efficient for the case YY than in the case YN. Efficiency of dispersion was studied versus semiaxis of asteroids relative to Vesta (smaller or larger than semiaxis of Vesta) as well as versus the sizes of asteroids. Weak relationships between size and efficiency of dispersion on YE have been found for the both cases YN and YY. The loss of number of the asteroids from VF weakly depends on their sizes. The total lost by number as well by mass is about 10% per 1 Gy.
Urea enhances cell lysis of Schizosaccharomyces pombe ura4 mutants.
Nishino, Kohei; Kushima, Misaki; Kaino, Tomohiro; Matsuo, Yasuhiro; Kawamukai, Makoto
2017-07-01
Cell lysis is induced in Schizosaccharomyces pombe ∆ura4 cells grown in YPD medium, which contains yeast extract, polypeptone, and glucose. To identify the medium components that induce cell lysis, we first tested various kinds of yeast extracts from different suppliers. Cell lysis of ∆ura4 cells on YE medium was observed when yeast extracts from OXOID, BD, Oriental, and Difco were used, but not when using yeast extract from Kyokuto. To determine which compounds induced cell lysis, we subjected yeast extract and polypeptone to GC-MS analysis. Ten kinds of compounds were detected in OXOID and BD yeast extracts, but not in Kyokuto yeast extract. Among them was urea, which was also present in polypeptone, and it clearly induced cell lysis. Deletion of the ure2 gene, which is responsible for utilizing urea, abolished the lytic effect of urea. The effect of urea was suppressed by deletion of pub1, and a similar phenotype was observed in the presence of polypeptone. Thus, urea is an inducer of cell lysis in S. pombe ∆ura4 cells.
He, Lan-Juan; Zhu, Xiang-Dong
2016-06-01
To analyze the regularities of prescriptions in "a guide to clinical practice with medical record" (Ye Tianshi) for diarrhoea based on traditional Chinese medicine inheritance support system(V2.5), and provide a reference for further research and development of new traditional Chinese medicines in treating diarrhoea. Traditional Chinese medicine inheritance support system was used to build a prescription database of Chinese medicines for diarrhoea. The software integration data mining method was used to analyze the prescriptions according to "four natures", "five flavors" and "meridians" in the database and achieve frequency statistics, syndrome distribution, prescription regularity and new prescription analysis. An analysis on 94 prescriptions for diarrhoea was used to determine the frequencies of medicines in prescriptions, commonly used medicine pairs and combinations, and achieve 13 new prescriptions. This study indicated that the prescriptions for diarrhoea in "a guide to clinical practice with medical record" are mostly of eliminating dampness and tonifying deficienccy, with neutral drug property, sweet, bitter or hot in flavor, and reflecting the treatment principle of "activating spleen-energy and resolving dampness". Copyright© by the Chinese Pharmaceutical Association.
Goldberg, Vera; Martinez, Boris; Cnop, Katia; Rohloff, Peter
2017-05-16
We present a female infant with a right-sided facial and neck haemangioma, from a remote, resource-poor community in rural Guatemala. She received first-line treatment, propranolol, with marked reduction in tumour size and erythema. Treatment was stopped after 35 weeks due to recurrent diarrhoea and sustained weight loss. Propranolol can be used to safely treat infants with haemangiomas in remote, rural communities if there is adequate follow-up, education and communication. Periocular haemangiomas should be treated promptly to avoid visual impairment. Infants with large facial haemangiomas should be screened for P osterior fossa anomalies, H emangioma, A rterial anomalies, C ardiac anomalies, and E ye anomalies (PHACE) syndrome, and specialists should be involved. The case also highlights the difficulty of providing treatment for a complex illness when basic health needs, such as food security and water sanitation, are limited. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
NASA Astrophysics Data System (ADS)
Benedetti, Dario; Carrozza, Sylvain; Gurau, Razvan; Sfondrini, Alessandro
2018-01-01
We define and study various tensorial generalizations of the Gross-Neveu model in two dimensions, that is, models with four-fermion interactions and G 3 symmetry, where we take either G = U( N) or G = O( N). Such models can also be viewed as two-dimensional generalizations of the Sachdev-Ye-Kitaev model, or more precisely of its tensorial counterpart introduced by Klebanov and Tarnopolsky, which is in part our motivation for studying them. Using the Schwinger-Dyson equations at large- N, we discuss the phenomenon of dynamical mass generation and possible combinations of couplings to avoid it. For the case G = U( N),we introduce an intermediate field representation and perform a stability analysis of the vacua. It turns out that the only apparently viable combination of couplings that avoids mass generation corresponds to an unstable vacuum. The stable vacuum breaks U( N)3 invariance, in contradiction with the Coleman-Mermin-Wagner theorem, but this is an artifact of the large- N expansion, similar to the breaking of continuous chiral symmetry in the chiral Gross-Neveu model.
NASA Technical Reports Server (NTRS)
Borisenko, V. I., G.g.; Stetsenko, Z. A.
1980-01-01
The functions were discribed and the operating instructions, the block diagram and the proposed versions are given for modifying the program in order to obtain the statistical characteristics of multi-channel video information. The program implements certain man-machine methods for investigating video information. It permits representation of the material and its statistical characteristics in a form which is convenient for the user.
Single-atom cavity QED and optomicromechanics
NASA Astrophysics Data System (ADS)
Wallquist, M.; Hammerer, K.; Zoller, P.; Genes, C.; Ludwig, M.; Marquardt, F.; Treutlein, P.; Ye, J.; Kimble, H. J.
2010-02-01
In a recent publication [K. Hammerer, M. Wallquist, C. Genes, M. Ludwig, F. Marquardt, P. Treutlein, P. Zoller, J. Ye, and H. J. Kimble, Phys. Rev. Lett. 103, 063005 (2009)] we have shown the possibility to achieve strong coupling of the quantized motion of a micron-sized mechanical system to the motion of a single trapped atom. In the proposed setup the coherent coupling between a SiN membrane and a single atom is mediated by the field of a high finesse cavity and can be much larger than the relevant decoherence rates. This makes the well-developed tools of cavity quantum electrodynamics with single atoms available in the realm of cavity optomechanics. In this article we elaborate on this scheme and provide detailed derivations and technical comments. Moreover, we give numerical as well as analytical results for a number of possible applications for transfer of squeezed or Fock states from atom to membrane as well as entanglement generation, taking full account of dissipation. In the limit of strong-coupling the preparation and verification of nonclassical states of a mesoscopic mechanical system is within reach.
Chen, Weicai; Zhang, Wei; Zhou, Shichu; Li, Ning; Huang, Yong; Mo, Yunming
2013-01-01
Lepobrachiun guangxiense Fei, Mo, Ye and Jiang, 2009 (Anura: Megophryidae), is presently thought to be endemic to Shangsi, Guangxi Province, China. A molecular phylogenetic analysis and morphological data were performed to gain insight into the phylogenetic position of this species. Maximum parsimony, maximum likelihood, and Bayesian inference methods were employed to reconstruct phylogenetic relationship, using 1914 bp of sequences from mtDNA genes of 12S rRNA, tRNAVal and 16S rRNA. Topologies revealed that L. guangxiense and Tam Dao (Vietnam) L. chapaense lineage (3A) formed a monophyletic group with well-supported values. The uncorrected p-distance of ~1.4k bp 16S rRNA data-sets between Tam Dao L. chapaense lineage (3A) and L. guangxiense is only 0.1%. Morphologically, L. guangxiense and Tam Dao L. chapaense lineage (3A) shared the same characters, and are distinguishable from "true" L. chapaense from the type locality in Sa Pa, Vietnam. Based on morphological characters and mitochondrial DNA, we suggested that the Tam Dao lineages of L. chapaense are conspecific with L. guangxiense. This represents a range extension for L. guangxiense, and a new country record for Vietnam.
Matrix effects on organic pollutants analysis in marine sediment
NASA Astrophysics Data System (ADS)
Azis, M. Y.; Asia, L.; Piram, A.; Buchari, B.; Doumenq, P.; Setiyanto, H.
2018-05-01
Interference from the matrix sample can influence of the accurate analytical method. Accelerated Solvent Extraction and their purification methods were tried to separate the organic micropollutants respectively in marine sediment. Those matrix were as organic pollutants evaluation in marine environment. Polychlorinated Biphenyls (PCBs) and Organochlorine pesticides (OCPs) are two examples organic pollutant in environment which are carcinogenic and mutagenic. Marine sediments are important matrices of information regarding the human activities in coastal areas as well as the fate and behavior of organic pollutants, which are persistent in long-term. This research purpose to evaluate the matrice effect and the recovery from marine sediment spiking with several standar solution and deuterium of molecular target from organic pollutants in not polluted sample of sediment. Matrice samples was tested from indicate in unpolluted location. The methods were evaluated with standard calibration curve (linearity < 0.999, LOQ various ranged 0.5-1000 pg.μL-1 and LOD > LOQ). Recovery (YE) relative, Matrice Effect (ME) relative correction with deuteriated standar were evaluated the interference the matrix. Interference effect for OCPs compounds were higher than PCBs in marine sediment.
Simulation of Quantum Many-Body Dynamics for Generic Strongly-Interacting Systems
NASA Astrophysics Data System (ADS)
Meyer, Gregory; Machado, Francisco; Yao, Norman
2017-04-01
Recent experimental advances have enabled the bottom-up assembly of complex, strongly interacting quantum many-body systems from individual atoms, ions, molecules and photons. These advances open the door to studying dynamics in isolated quantum systems as well as the possibility of realizing novel out-of-equilibrium phases of matter. Numerical studies provide insight into these systems; however, computational time and memory usage limit common numerical methods such as exact diagonalization to relatively small Hilbert spaces of dimension 215 . Here we present progress toward a new software package for dynamical time evolution of large generic quantum systems on massively parallel computing architectures. By projecting large sparse Hamiltonians into a much smaller Krylov subspace, we are able to compute the evolution of strongly interacting systems with Hilbert space dimension nearing 230. We discuss and benchmark different design implementations, such as matrix-free methods and GPU based calculations, using both pre-thermal time crystals and the Sachdev-Ye-Kitaev model as examples. We also include a simple symbolic language to describe generic Hamiltonians, allowing simulation of diverse quantum systems without any modification of the underlying C and Fortran code.
The La Silla-QUEST Kuiper Belt Survey
NASA Astrophysics Data System (ADS)
Rabinowitz, David; Schwamb, Megan E.; Hadjiyska, Elena; Tourtellotte, Suzanne
2012-11-01
We describe the instrumentation and detection software and characterize the detection efficiency of an automated, all-sky, southern-hemisphere search for Kuiper Belt Objects (KBOs) brighter than R mag 21.4. The search relies on Yale University's 160 Megapixel QUEST camera, previously used for the successful surveys at Palomar that detected most of the distant dwarf planets, and now installed on the ESO 1.0 m Schmidt telescope at La Silla, Chile. Extensive upgrades were made to the telescope control system to support automation, and significant improvements were made to the camera. To date, 63 new KBOs have been discovered, including a new member of the Haumea collision family (2009 YE7) and a new distant object with an inclination exceeding 70° (2010 WG9). In a survey covering ~7500 deg2, we have thus far detected 77 KBOs and Centaurs, more than any other full-hemisphere search to date. Using a pattern of dithered pointings, we demonstrate a search efficiency exceeding 80%. We are currently on track to complete the southern-sky survey and detect any bright KBOs that have eluded detection from the north.
Cha, Hye-Geun; Kim, Yi-Ok; Choi, Woon Yong; Kang, Do-Hyung; Lee, Hyeon-Yong; Jung, Kyung-Hwan
2015-03-01
Herein, we established a repeated-batch process for ethanol production from glycerol by immobilized Pachysolen tannophilus. The aim of this study was to develop a more practical and applicable ethanol production process for biofuel. In particular, using industrial-grade medium ingredients, the microaeration rate was optimized for maximization of the ethanol production, and the relevant metabolic parameters were then analyzed. The microaeration rate of 0.11 vvm, which is far lower than those occurring in a shaking flask culture, was found to be the optimal value for ethanol production from glycerol. In addition, it was found that, among those tested, Celite was a more appropriate carrier for the immobilization of P. tannophilus to induce production of ethanol from glycerol. Finally, through a repeated-batch culture, the ethanol yield (Ye/g) of 0.126 ± 0.017 g-ethanol/g-glycerol (n = 4) was obtained, and this value was remarkably comparable with a previous report. In the future, it is expected that the results of this study will be applied for the development of a more practical and profitable long-term ethanol production process, thanks to the industrial-grade medium preparation, simple immobilization method, and easy repeated-batch operation.
Neutrino Astrophysics in Slowly Rotating Spacetimes Permeated by Nonlinear Electrodynamics Fields
NASA Astrophysics Data System (ADS)
Mosquera Cuesta, Herman J.
2017-02-01
Many theoretical and astrophysical arguments involve consideration of the effects of super strong electromagnetic fields and the rotation during the late stages of core-collapse supernovae. In what follows, we solve Einstein field equations that are minimally coupled to an arbitrary (current-free) Born-Infeld nonlinear Lagrangian L(F,G) of electrodynamics (NLED) in the slow rotation regime a ≪ r+ (outer horizon size), up to first order in a/r. We cross-check the physical properties of such NLED spacetime w.r.t. against the Maxwell one. A study case on both neutrino flavor ({ν }e\\to {ν }μ ,{ν }τ ) oscillations and flavor+helicity (spin) flip ({ν }e\\to {\\overline{ν }}μ ,τ ) gyroscopic precession proves that in the spacetime of a slowly rotating nonlinear charged black hole (RNCBH), the neutrino dynamics translates into a positive enhancement of the r-process (reduction of the electron fraction Ye < 0.5). Consequently, it guarantees successful hyperluminous core-collapse supernova explosions due to the enlargement of the number and amount of decaying nuclide species. This posits that, as far as the whole luminosity is concerned, hypernovae will be a proof of the formation of astrophysical RNCBH.
NASA Astrophysics Data System (ADS)
Wu, Guoxiong; He, Bian; Duan, Anmin; Liu, Yimin; Yu, Wei
2017-10-01
To cherish the memory of the late Professor Duzheng YE on what would have been his 100th birthday, and to celebrate his great accomplishment in opening a new era of Tibetan Plateau (TP) meteorology, this review paper provides an assessment of the atmospheric heat source (AHS) over the TP from different data resources, including observations from local meteorological stations, satellite remote sensing data, and various reanalysis datasets. The uncertainty and applicability of these heat source data are evaluated. Analysis regarding the formation of the AHS over the TP demonstrates that it is not only the cause of the atmospheric circulation, but is also a result of that circulation. Based on numerical experiments, the review further demonstrates that land-sea thermal contrast is only one part of the monsoon story. The thermal forcing of the Tibetan-Iranian Plateau plays a significant role in generating the Asian summer monsoon (ASM), i.e., in addition to pumping water vapor from sea to land and from the lower to the upper troposphere, it also generates a subtropical monsoon-type meridional circulation subject to the angular momentum conservation, providing an ascending-air large-scale background for the development of the ASM.
Laboratory modeling of dust impact detection by the Cassini spacecraft
NASA Astrophysics Data System (ADS)
Nouzák, L.; Hsu, S.; Malaspina, D.; Thayer, F. M.; Ye, S.-Y.; Pavlů, J.; Němeček, Z.; Šafránková, J.; Sternovsky, Z.
2018-07-01
The paper presents laboratory investigations of the response of a scaled down model of the Cassini spacecraft to impacts of submicron iron grains accelerated to velocities 5-25 km/s. The aim of the study is to help in a detailed analysis and interpretation of signals provided by the RPWS (Radio Wave Plasma Science) instrument that were attributed to dust impacts onto RPWS antennas or spacecraft body. The paper describes the experimental set-up, discusses its limitations, and presents the first results. Both monopole and dipole antenna configurations are investigated. We demonstrate that the amplitude and polarity of the impulse signals recorded by antenna amplifiers depend on the voltages applied onto the antennas or the spacecraft body and briefly introduce the mechanism leading to the signal generation. The experimental results support the recent suggestion by Ye et al. (2016) that antennas operated in a dipole mode are greatly insensitive to dust impacts on the spacecraft body. The pre-peak phenomenon, commonly observed in space, is also reproduced in the measurements and explained as the induced charge on the antenna from the impact plasma cloud that is becoming non-neutral due to the escape of the faster electrons.
Emergency Medical Service (EMS) Utilization by Syrian Refugees Residing in Ankara, Turkey.
Altıner, Ali Osman; Yeşil, Sıdıka Tekeli
2018-04-01
Introduction Many Syrians have left their country and migrated to other countries since March 2011, due to the civil war. As of March 2016, a total of 2,747,946 Syrian refugees had immigrated to Turkey. Some Syrian refugees have been living in camps, while 2,475,134 have been living in metropolitan areas, such as Ankara. Study Objective This study investigated Emergency Medical Service (EMS) utilization among Syrian refugees residing in Ankara. This study was a descriptive, cross-sectional database analysis using data obtained from the Department of EMS of the Ankara Provincial Health Directorate. Five stations in the Altındağ region of Ankara responded to 42% of all calls from Syrian refugees. Prehospital EMS in Ankara have been used mostly by Syrian refugees younger than 18-years-old. Study findings also suggest that medical staff in regions where Syrian refugees are likely to be treated should be supported and provided with the ability to overcome language barriers and cultural differences. Altıner AO , Tekeli Yeşil S . Emergency Medical Service (EMS) utilization by Syrian refugees residing in Ankara, Turkey. Prehosp Disaster Med. 2018;33(2):160-164.
ERIC Educational Resources Information Center
Hilton, John, III.
2010-01-01
Lack of access prevents many from benefiting from educational resources. Digital technologies now enable educational resources, such as books, to be openly available to those with access to the Internet. This study examined the financial viability of a religious publisher's putting free digital versions of eight of its books on the Internet. The…
Cryosalt Formation in Delaminated Clays
NASA Astrophysics Data System (ADS)
Yeşilbaş, Merve; Boily, Jean-François
2017-04-01
-montmorillonite at hosting hydrohalite, the results of this study can be used to suggest that delaminated Na-montmorillonite sheets encapsulate the salt solutions and by preventing sublimation of water, promotes crystallization of hydrohalite. As delamination is not possible in Ca-montmorillonite, water more readily sublimated from the system, leaving behind a dry Ca-montmorillonite/NaCl assemblage. As such, this work identified processes through which clay minerals can affect the formation of cryosalts that are not only of importance to terrestrial environments of the cryosphere but also to atmospheric processes involving dust aerosols. [1] Yeşilbaş, M. and Boily, J.-F. (2016), Scientific Reports. 6, 32136. [2] Yeşilbaş, M. and Boily, J.-F. (2016), J. Phys. Chem. Lett. 7, 2849-2855. [3] Wagner, R., Möhler O., Schnaiter, M. (2012), 33, 8557-8571.
Farnese, M L; Barbieri, B; Bellò, B; Bartone, P T
2017-01-01
Within a Job Demands-Resources Model framework, formal mentoring can be conceived as a job resource expressing the organization's support for new members, which may prevent their being at risk for burnout. This research aims at understanding the protective role of formal mentoring on burnout, through the effect of increasing learning personal resources. Specifically, we hypothesized that formal mentoring enhances newcomers' learning about job and social domains related to the new work context, thus leading to lower burnout. In order to test the hypotheses, a multiple regression analysis using the bootstrapping method was used. Based on a questionnaire administered to 117 correctional officer newcomers who had a formal mentor assigned, our results confirm that formal mentoring exerts a positive influence on newcomers' adjustment, and that this in turn exerts a protective influence against burnout onset by reducing cynicism and interpersonal stress and also enhancing the sense of personal accomplishment. Confirming previous literature's suggestions, supportive mentoring and effective socialization seem to represent job and personal resources that are protective against burnout. This study provides empirical support for this relation in the prison context.
NASA Astrophysics Data System (ADS)
D'Odorico, S.
1987-12-01
The first international school for young astronomers organized jointly by ESO and the Astronomical Council of the USSR Academy of Sciences took place from the 22nd to the 29th of September at the Byurakan Astrophysical Observatory of the Academy of Sciences of Armenia and was dedicated to "Observations with Large Telescopes". It was appropriately closed with a oneday visit to the Special Astrophysical Observatory at Zelenchukskaja, in northern Caucasus, home of the 6-m telescope, the largest in the world. The lecturers came from ESO and from the Soviet Union; the 45 participants were from ESO member states, from Bulgaria, Czechoslovakia, the German Democratic Republic, Poland, Spain and the USSR. After the welcome addresses by Academician V.A. Ambartsumian and by E. Ye Khachikian, Chairman of the Local Organizing Committee, the school was opened by M. Tarenghi of ESO who spoke on the characteristics of existing ESO telescopes and on the innovative features of the ESO 3.5-m New Technology Telescope, to be erected at La Silla next year. H. A. Abrahamian and J.A. Stepanian of the Byurakan Observatory presented the Byurakan 2.6-m telescope and the 1-m Schmidt respectively, illustrating the scientific programmes carried out in the recent past and presently at these two facilities.
Leung, Elvis M K; Tang, Phyllis N Y; Ye, Yuran; Chan, Wan
2013-10-16
2-Alkylcyclobutanones (2-ACBs) have long been considered as unique radiolytic products that can be used as indicators for irradiated food identification. A recent report on the natural existence of 2-ACB in non-irradiated nutmeg and cashew nut samples aroused worldwide concern because it contradicts the general belief that 2-ACBs are specific to irradiated food. The goal of this study is to test the natural existence of 2-ACBs in nut samples using our newly developed liquid chromatography-tandem mass spectrometry (LC-MS/MS) method with enhanced analytical sensitivity and selectivity ( Ye , Y. ; Liu , H. ; Horvatovich , P. ; Chan , W. Liquid chromatography-electrospray ionization tandem mass spectrometric analysis of 2-alkylcyclobutanones in irradiated chicken by precolumn derivatization with hydroxylamine . J. Agric. Food Chem. 2013 , 61 , 5758 - 5763 ). The validated method was applied to identify 2-dodecylcyclobutanone (2-DCB) and 2-tetradecylcyclobutanone (2-TCB) in nutmeg, cashew nut, pine nut, and apricot kernel samples (n = 22) of different origins. Our study reveals that 2-DCB and 2-TCB either do not exist naturally or exist at concentrations below the detection limit of the existing method. Thus, 2-DCB and 2-TCB are still valid to be used as biomarkers for identifying irradiated food.
Towards fundamental understanding of ultracold KRb
NASA Astrophysics Data System (ADS)
Kotochigova, Svetlana
2009-05-01
The recent formation of ultracold KRb molecules in their absolute rovibrational ground state [1] has created great promise for study of collective phenomena that rely on the long-range interactions between polar molecules. Here we discuss the theoretical analysis of various essential properties of the KRb molecules [2] that accompanied these experimental advances. This analysis is based on multi-channel bound-state calculations of both ground and excited electronic states. We have found that the theoretical hyperfine and Zeeman mixed X^1&+circ; and a^3&+circ; vibrational structure shows excellent agreement with the experimentally observed structure. In addition, multi-channel calculations of the rovibrational structure of the excited state potentials have allowed us to find the optimal transitions to the lowest v=0 vibrational levels. Finally, we examine the dynamic polarizability of vibrationally cold KRb molecules as a function of laser frequency. Based on this knowledge, laser frequencies can be selected to minimize decoherence from loss of molecules due to spontaneous or laser-induced transitions. [1] K.-K. Ni, S. Ospelkaus, M. H. G. de Miranda, A. Peer, B. Neyenhuis, J. J. Zirbel, S. Kotochigova, P. S. Julienne, D. S. Jin, and J. Ye, Science 322, 231 (2008). [2] S. Kotochigova, E. Tiesinga, and P. S. Julienne, submitted to New J. Phys. (2009).
Bucci, Maria Pia; Nassibi, Naziha; Gerard, Christophe-Loic; Bui-Quoc, Emmanuel; Seassau, Magali
2012-01-01
Studies comparing binocular eye movements during reading and visual search in dyslexic children are, at our knowledge, inexistent. In the present study we examined ocular motor characteristics in dyslexic children versus two groups of non dyslexic children with chronological/reading age-matched. Binocular eye movements were recorded by an infrared system (mobileEBT®, e(ye)BRAIN) in twelve dyslexic children (mean age 11 years old) and a group of chronological age-matched (N = 9) and reading age-matched (N = 10) non dyslexic children. Two visual tasks were used: text reading and visual search. Independently of the task, the ocular motor behavior in dyslexic children is similar to those reported in reading age-matched non dyslexic children: many and longer fixations as well as poor quality of binocular coordination during and after the saccades. In contrast, chronological age-matched non dyslexic children showed a small number of fixations and short duration of fixations in reading task with respect to visual search task; furthermore their saccades were well yoked in both tasks. The atypical eye movement's patterns observed in dyslexic children suggest a deficiency in the visual attentional processing as well as an immaturity of the ocular motor saccade and vergence systems interaction. PMID:22438934
Convection Destroys the Core/Mantle Structure in Hybrid C/O/Ne White Dwarfs
NASA Astrophysics Data System (ADS)
Brooks, Jared; Schwab, Josiah; Bildsten, Lars; Quataert, Eliot; Paxton, Bill
2017-01-01
A hybrid C/O/Ne white dwarf (WD)—an unburned C/O core surrounded by an O/Ne/Na mantle—can be formed if the carbon flame is quenched in a super-AGB star or white dwarf merger remnant. We show that this segregated hybrid structure becomes unstable to rapid mixing within 2000 years of the onset of WD cooling. Carbon burning includes a weak reaction that removes electrons, resulting in a lower electron-to-baryon ratio ({Y}{{e}}) in the regions processed by carbon burning compared to the unburned C/O core, making the O/Ne mantle denser than the C/O core as the WD cools. This is unstable to efficient mixing. We use the results of {\\mathtt{MESA}} models with different size C/O cores to quantify the rate at which the cores mix with the mantle as they cool. In all cases, we find that the WDs undergo significant core/mantle mixing on timescales shorter than the time available to grow the WD to the Chandrasekhar mass (MCh) by accretion. As a result, hybrid WDs that reach MCh due to later accretion will have lower central carbon fractions than assumed thus far. We briefly discuss the implications of these results for the possibility of SNe Ia from hybrid WDs.
Characterizing and Improving Distributed Intrusion Detection Systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hurd, Steven A; Proebstel, Elliot P.
2007-11-01
Due to ever-increasing quantities of information traversing networks, network administrators are developing greater reliance upon statistically sampled packet information as the source for their intrusion detection systems (IDS). Our research is aimed at understanding IDS performance when statistical packet sampling is used. Using the Snort IDS and a variety of data sets, we compared IDS results when an entire data set is used to the results when a statistically sampled subset of the data set is used. Generally speaking, IDS performance with statistically sampled information was shown to drop considerably even under fairly high sampling rates (such as 1:5). Characterizingmore » and Improving Distributed Intrusion Detection Systems4AcknowledgementsThe authors wish to extend our gratitude to Matt Bishop and Chen-Nee Chuah of UC Davis for their guidance and support on this work. Our thanks are also extended to Jianning Mai of UC Davis and Tao Ye of Sprint Advanced Technology Labs for their generous assistance.We would also like to acknowledge our dataset sources, CRAWDAD and CAIDA, without which this work would not have been possible. Support for OC48 data collection is provided by DARPA, NSF, DHS, Cisco and CAIDA members.« less
NASA Astrophysics Data System (ADS)
Görmüş, Muhittin; Sami Us, Muhammed; Özer, Sacit; Tekin, Erdoǧan; Akpınar, Serap; Kabakcı, Büşra
2016-04-01
Transgressive to regressive succession of the Cretaceous Period and Cretaceous Paleogene boundary from the Nallıhan-Beypazarı area have significant data to interpret the past geological history of northwestern Turkey. In the literature, main scientific differences are seen on the formation/lithodem names, their ages, contact relations and environmental interpretations. In the study, a revision has been made for a proper stratigraphy of the area. For the revised stratigraphy, the obtained results from our field and laboratory works and the literature information were used. The following stratigraphy were established from basement to top: the Permo-Triassic aged Sekli metamorphics, Jurassic to lower Cretaceous Soǧukçam formation, Campanian to Maastrichtian aged Dereköy Group-Haremiköy conglomerates, Çeǧiköy reefs, Nardin formation (Seben formation), Taraklı formation; the Paleogene aged Kızılçay group including Kızılbayır formation, Karaköy volcanoclastics, Selvipınar limestone, the Miocene-Pliocene terrestrial sediments, Çoraklar formation, Hırka formation, Akpınar formation, Çayırhan formation, Teke volkanics, Bozbelen formation, Kirmir formation. The main unconformities are between Jura and Campanian, Maastrichtian and Paleogene, Eocene and Miocene times. Among the geological units, the Çeǧiköy reefs having rich rudist fauna overlie the Haremiköy conglomerates in both sides at the north-Yeşilyurt village and at the south-Gökçeöz village. Another outcrop, Emincik is between two mentioned villages. Biohermal reefs mainly includes very rich rudists up to 40 centimetres in size around the Yeşilköy such as: Pironaea polystyla, Vaccinites loftusi, Hippurites sublaevis. Larger foraminifera Orbitoides medius, O. apiculatus, Siderolites calcitrapoides, Pseodosiderolites vidali are also common in the fore reef areas. Around the Gökçeöz at the south part, the identified rudists are as follows: Vaccinites sp., Hippurites aff. sublaevis
USDA-ARS?s Scientific Manuscript database
The transcriptome provides a functional footprint of the genome by enumerating the molecular components of cells and tissues. The field of transcript discovery has been revolutionized through high-throughput mRNA sequencing (RNA-seq). Here, we present a methodology that replicates and improves exist...
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers
2012-01-01
Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534
NASA Astrophysics Data System (ADS)
Sun, Guoxiang; Liu, Ying; Li, Yong; Li, Xian; Wang, Shunkui
2015-10-01
The effects of different feeds and feeding regimes on growth performance, flesh quality and fecal viscosity of Atlantic salmon ( Salmo salar L.) in recirculating aquaculture systems (RAS) were investigated. Fish (initial body weight of 1677 g ± 157 g) were fed with four commercial feeds (Nosan salmon-NS, Aller gold-AG, Skretting salmon-SS and Han ye-HY) in two feeding regimes (80% and 100% satiation) for 78 d. The results showed that salmon specific growth ratio (SGR) and weight gain ratio (WGR) were significantly affected by feed type and feeding regime ( P < 0.05). Feed conversion ratio (FCR) varied between 0.93 and 3.40, which was significantly affected by feed type ( P < 0.05), and slightly improved with increased satiation degree. The activities of digestive enzymes including protease, lipase and amylase were also significantly affected by feed type and feeding regime ( P < 0.05), increasing with satiation degree. Flesh qualities for vitamin E, hydroxyproline (HYP), liquid loss and muscle pH among all groups showed significant differences ( P < 0.05), ranging from 26.67 to 29.67, while no obvious difference was found in flesh color. Fecal viscosity for different treatments showed no significant difference, though improvement was found in 100% satiation group. From present experiment, it was concluded that both feed type and feeding regime can affect the important quality attributes of Atlantic salmon.
Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio
2018-01-01
Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216
Nuclear pasta in hot dense matter and its implications for neutrino scattering
NASA Astrophysics Data System (ADS)
Roggero, Alessandro; Margueron, Jérôme; Roberts, Luke F.; Reddy, Sanjay
2018-04-01
The abundance of large clusters of nucleons in neutron-rich matter at subnuclear density is found to be greatly reduced by finite-temperature effects when matter is close to β equilibrium, compared to the case where the electron fraction is fixed at Ye>0.1 , as often considered in the literature. Large nuclei and exotic nonspherical nuclear configurations called pasta, favored in the vicinity of the transition to uniform matter at T =0 , dissolve at a relatively low temperature Tu as protons leak out of nuclei and pasta. For matter at β equilibrium with a negligible neutrino chemical potential we find that Tuβ≃4 ±1 MeV for realistic equations of state. This is lower than the maximum temperature Tmaxβ≃9 ±1 MeV at which nuclei can coexist with a gas of nucleons and can be explained by a change in the nature of the transition to uniform matter called retrograde condensation. An important new finding is that coherent neutrino scattering from nuclei and pasta makes a modest contribution to the opacity under the conditions encountered in supernovas and neutron star mergers. This is because large nuclear clusters dissolve at most relevant temperatures, and at lower temperatures, when clusters are present, Coulomb correlations between them suppress coherent neutrino scattering off individual clusters. Implications for neutrino signals from galactic supernovas are briefly discussed.
Operation and Equivalent Loads of Wind Turbines in Large Wind Farms
NASA Astrophysics Data System (ADS)
Andersen, Soren Juhl; Sorensen, Jens Norkaer; Mikkelsen, Robert Flemming
2017-11-01
Wind farms continue to grow in size and as the technology matures, the design of wind farms move towards including dynamic effects besides merely annual power production estimates. The unsteady operation of wind turbines in large wind farms has been modelled with EllipSys3D(Michelsen, 1992, and Sørensen, 1995) for a number of different scenarios using a fully coupled large eddy simulations(LES) and aero-elastic framework. The turbines are represented in the flow fields using the actuator line method(Sørensen and Shen, 2002), where the aerodynamic forces and deflections are derived from an aero-elastic code, Flex5(Øye, 1996). The simulations constitute a database of full turbine operation in terms of both production and loads for various wind speeds, turbulence intensities, and turbine spacings. The operating conditions are examined in terms of averaged power production and thrust force, as well as 10min equivalent flapwise bending, yaw, and tilt moment loads. The analyses focus on how the performance and loads change throughout a given farm as well as comparing how various input parameters affect the operation and loads of the wind turbines during different scenarios. COMWIND(Grant 2104-09- 067216/DSF), Nordic Consortium on Optimization and Control of Wind Farms, Eurotech Greentech Wind project, Winds2Loads, and CCA LES. Ressources Granted on SNIC and JESS. The Vestas NM80 turbine has been used.
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.
Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A
2012-04-30
Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.
Ceapă, Corina Diana; Vázquez-Hernández, Melissa; Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R; Sánchez, Sergio
2018-01-01
Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, X.; Ye, S; Guo, S
Phosphagen kinase (PK) family members catalyze the reversible phosphoryl transfer between phosphagen and ADP to reserve or release energy in cell energy metabolism. The structures of classic quaternary complexes of dimeric creatine kinase (CK) revealed asymmetric ligand binding states of two protomers, but the significance and mechanism remain unclear. To understand this negative cooperativity further, we determined the first structure of dimeric arginine kinase (dAK), another PK family member, at 1.75 {angstrom}, as well as the structure of its ternary complex with AMPPNP and arginine. Further structural analysis shows that the ligand-free protomer in a ligand-bound dimer opens more widelymore » than the protomers in a ligand-free dimer, which leads to three different states of a dAK protomer. The unexpected allostery of the ligand-free protomer in a ligand-bound dimer should be relayed from the ligand-binding-induced allostery of its adjacent protomer. Mutations that weaken the interprotomer connections dramatically reduced the catalytic activities of dAK, indicating the importance of the allosteric propagation mediated by the homodimer interface. These results suggest a reciprocating mechanism of dimeric PK, which is shared by other ATP related oligomeric enzymes, e.g., ATP synthase. - Wu, X., Ye, S., Guo, S., Yan, W., Bartlam, M., Rao, Z. Structural basis for a reciprocating mechanism of negative cooperativity in dimeric phosphagen kinase activity.« less
NASA Astrophysics Data System (ADS)
Buckley, David A. H.; Andreoni, Igor; Barway, Sudhanshu; Cooke, Jeff; Crawford, Steven M.; Gorbovskoy, Evgeny; Gromadzki, Mariusz; Lipunov, Vladimir; Mao, Jirong; Potter, Stephen B.; Pretorius, Magaretha L.; Pritchard, Tyler A.; Romero-Colmenero, Encarni; Shara, Michael M.; Väisänen, Petri; Williams, Ted B.
2018-02-01
We report on SALT low-resolution optical spectroscopy and optical/IR photometry undertaken with other SAAO telescopes (MASTER-SAAO and IRSF) of the kilonova AT 2017gfo (a.k.a. SSS17a) in the galaxy NGC4993 during the first 10 d of discovery. This event has been identified as the first ever electromagnetic counterpart of a gravitational wave event, namely GW170817, which was detected by the LIGO and Virgo gravitational wave observatories. The event is likely due to a merger of two neutron stars, resulting in a kilonova explosion. SALT was the third observatory to obtain spectroscopy of AT 2017gfo and the first spectrum, 1.2 d after the merger, is quite blue and shows some broad features, but no identifiable spectral lines and becomes redder by the second night. We compare the spectral and photometric evolution with recent kilonova simulations and conclude that they are in qualitative agreement for post-merger wind models with proton:nucleon ratios of Ye = 0.25-0.30. The blue colour of the first spectrum is consistent with the lower opacity of the lanthanide-free r-process elements in the ejecta. Differences between the models and observations are likely due to the choice of system parameters combined with the absence of atomic data for more elements in the ejecta models.
Yi, Qiang; Liu, Yinghong; Zhang, Xiangge; Hou, Xianbin; Zhang, Junjie; Liu, Hanmei; Hu, Yufeng; Yu, Guowu; Huang, Yubi
2018-03-01
Tassel architecture is an important trait in maize breeding and hybrid seed production. In this study, we investigated total tassel length (TTL) and tassel branch number (TBN) in 266 F 2:3 families across six environments and in 301 recombinant inbred lines (RILs) across three environments, where all the plants were derived from a cross between 08-641 and Ye478. We compared the genetic architecture of the two traits across two generations through combined analysis. In total, 27 quantitative trait loci (QTLs) (15 in F 2:3 ; 16 in RIL), two QTL × environment interactions (both in F 2:3 ), 11 pairs of epistatic interactions (seven in F 2:3 ; four in RIL) and four stable QTLs in both the F 2:3 and RILs were detected. The RIL population had higher detection power than the F 2:3 population. Nevertheless, QTL × environment interactions and epistatic interactions could be more easily detected in the F 2:3 population than in the RILs. Overall, the QTL mapping results in the F 2:3 and RILs were greatly influenced by genetic generations and environments. Finally, fine mapping for a novel and major QTL, qTTL-2-3 (bin 2.07), which accounted for over 8.49% of the phenotypic variation across different environments and generations, could be useful in marker-assisted breeding.
Toward Rotational State-Selective Photoionization of ThF+ Ions
NASA Astrophysics Data System (ADS)
Zhou, Yan; Ng, Kia Boon; Gresh, Dan; Cairncross, William; Grau, Matt; Ni, Yiqi; Cornell, Eric; Ye, Jun
2016-06-01
ThF+ has been chosen to replace HfF+ for a second-generation measurement of the electric dipole moment of the electron (eEDM). Compared to the currently running HfF+ eEDM experiment, ThF+ has several advantages: (i) the eEDM-sensitive state (3Δ1) is the ground state, which facilitates a long coherence time [1]; (ii) its effective electric field (35 GV/cm) is 50% larger than that of HfF+, which promises a direct increase of the eEDM sensitivity [2]; and (iii) the ionization energy of neutral ThF is lower than its dissociation energy, which introduces greater flexibility in rotational state-selective photoionization via core-nonpenetrating Rydberg states [3]. In this talk, we first present our strategy of preparing and utilizing core-nonpenetrating Rydberg states for rotational state-selective ionization. Then, we report spectroscopic data of laser-induced fluorescence of neutral ThF, which provides critical information for multi-photon ionization spectroscopy. [1] D. N. Gresh, K. C. Cossel, Y. Zhou, J. Ye, E. A. Cornell, Journal of Molecular Spectroscopy, 319 (2016), 1-9 [2] M. Denis, M. S. Nørby, H. J. A. Jensen, A. S. P. Gomes, M. K. Nayak, S. Knecht, T. Fleig, New Journal of Physics, 17 (2015) 043005. [3] Z. J. Jakubek, R. W. Field, Journal of Molecular Spectroscopy 205 (2001) 197-220.
NASA Astrophysics Data System (ADS)
Purohit, Suresh; Suthar, Shyam Sunder; Vyas, Mahendra; Beniwal, Ram Chandra
2018-05-01
The main transport properties of liquid or liquid mixtures are viscosity, diffusion, transference and electrical conductance. Viscosities of various liquid mixtures have been studied and their analyses have also been done by the help of some parameters. For each solution, the excess thermodynamic properties (YE) have been investigated. These excess thermodynamic properties are excess molar volume (VE), viscosity deviation (Δη) and excess Gibbs free energy of activation of viscous flow (ΔG*E). These parameters provide us the important information about interaction between molecules. For example, the negative value of VE and positive value of Δη shows the strong interaction between the solute and solvent molecules while positive value of VE and negative value of Δη shows the weak interaction between solute and solvent molecules. Above parameters and their discussion have been made in our earlier paper. In the present research paper, the viscosity data have been correlated with the equations of Grunberg and Nissan, Hind et al., Tamura and Kurata Katti. The excess values have been correlated using Redlich-Kister polynomial equation to obtain their coefficients and standard deviations. It has been found that in all cases, the data obtained fitted with the values correlated by the corresponding models very well. The results are interpreted in terms of molecular interactions occurring in the solution.
NASA Astrophysics Data System (ADS)
Tomitori, Masahiko; Onishi, Hiroshi
2007-02-01
exchange among participants. We hope that all of the participants enjoyed the activities of the conference and the town of Kobe. We are indebted to the members of the international steering committee and the local organizing committee for this successful conference. The operation of conference business by the Kobe Convention and Visitors Association, and by the staff in Professor Morita's lab in Osaka University, and Professor Onishi's lab in Kobe University, is greatly acknowledged. We would like to express our sincere gratitude to the 167th committee on Nano-probe Technology of Japan Society for the Promotion of Science, Nanotechnology Researchers Network Center of Japan, Foundation Advanced Technology Institute, Tsutomu Nakauchi Foundation, and all of the exhibitors at the conference for their financial support. The funding from Kobe Advanced ICT Research Center, National Institute of Information and Communications Technology, is greatly appreciated and enabled these proceedings to be published by IOP Publishing (IOP). We also thank the editorial staff of IOP for their professional work in publishing this special issue.
Embedded random matrix ensembles from nuclear structure and their recent applications
NASA Astrophysics Data System (ADS)
Kota, V. K. B.; Chavda, N. D.
Embedded random matrix ensembles generated by random interactions (of low body rank and usually two-body) in the presence of a one-body mean field, introduced in nuclear structure physics, are now established to be indispensable in describing statistical properties of a large number of isolated finite quantum many-particle systems. Lie algebra symmetries of the interactions, as identified from nuclear shell model and the interacting boson model, led to the introduction of a variety of embedded ensembles (EEs). These ensembles with a mean field and chaos generating two-body interaction generate in three different stages, delocalization of wave functions in the Fock space of the mean-field basis states. The last stage corresponds to what one may call thermalization and complex nuclei, as seen from many shell model calculations, lie in this region. Besides briefly describing them, their recent applications to nuclear structure are presented and they are (i) nuclear level densities with interactions; (ii) orbit occupancies; (iii) neutrinoless double beta decay nuclear transition matrix elements as transition strengths. In addition, their applications are also presented briefly that go beyond nuclear structure and they are (i) fidelity, decoherence, entanglement and thermalization in isolated finite quantum systems with interactions; (ii) quantum transport in disordered networks connected by many-body interactions with centrosymmetry; (iii) semicircle to Gaussian transition in eigenvalue densities with k-body random interactions and its relation to the Sachdev-Ye-Kitaev (SYK) model for majorana fermions.
Kwon, Hyuk-Joon; Cho, Sun-Hee; Kim, Tae-Eun; Won, Yong-Jin; Jeong, Jihye; Park, Se Chang; Kim, Jae-Hong; Yoo, Han-Sang; Park, Yong-Ho; Kim, Sun-Joong
2008-11-01
PhiSG-JL2 is a newly discovered lytic bacteriophage infecting Salmonella enterica serovar Gallinarum biovar Gallinarum but is nonlytic to a rough vaccine strain of serovar Gallinarum biovar Gallinarum (SG-9R), S. enterica serovar Enteritidis, S. enterica serovar Typhimurium, and S. enterica serovar Gallinarum biovar Pullorum. The phiSG-JL2 genome is 38,815 bp in length (GC content, 50.9%; 230-bp-long direct terminal repeats), and 55 putative genes may be transcribed from the same strand. Functions were assigned to 30 genes based on high amino acid similarity to known proteins. Most of the expected proteins except tail fiber (31.9%) and the overall organization of the genomes were similar to those of yersiniophage phiYeO3-12. phiSG-JL2 could be classified as a new T7-like virus and represents the first serovar Gallinarum biovar Gallinarum phage genome to be sequenced. On the basis of intraspecific ratios of nonsynonymous to synonymous nucleotide changes (Pi[a]/Pi[s]), gene 2 encoding the host RNA polymerase inhibitor displayed Darwinian positive selection. Pretreatment of chickens with phiSG-JL2 before intratracheal challenge with wild-type serovar Gallinarum biovar Gallinarum protected most birds from fowl typhoid. Therefore, phiSG-JL2 may be useful for the differentiation of serovar Gallinarum biovar Gallinarum from other Salmonella serotypes, prophylactic application in fowl typhoid control, and understanding of the vertical evolution of T7-like viruses.
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-01-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-l-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., 1994), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. PMID:24286468
NASA Astrophysics Data System (ADS)
Melentyev, Vladimir; Vladimirovich Melentyev, Konstantin; Petterssen, Lasse Herbert; Andreevna Zakharova, Tatiana
2013-04-01
In our studies we are following for the classification of the marine and ice landscapes of the Arctic that was suggested by prof. Ye.S. Korotkevich who had provided summarizing results of the long-term in situ field experiments and airborne studies that was fulfilled by scientists of Arctic and Antarctic Research Institute (AARI) under his leadership in Russian Arctic after the 2-nd World War. But satellite multispectral observations show significant temporal and spatial modification of the suggested scheme especially for Arctic ice landscapes that had occurred in nowadays due to the climate change and anthropogenic press. Design main principle and rules of satellite ecological criminalistics - science of crime detection of ecocatastrophe and incidents on sea and fresh waters with using aerospace survey as well for the control, for the management and the preventing of ecological instability of the marine and lakes ecosystems was done by Academician Kirill Kondratiev together with his apprentices and follower in 1970-s. In frame proposed paper we shall present results of our comprehensive satellite-airborne studies of the marine and ice landscapes as well discuss the incidents that happened in Arctic inside the inland and international waters in past and present days and were revealed with using multispectral remote sensing. But for all that we need to mention that our contemporary investigations are based on the all-weather satellite ERS-1/2 - Envisat - RADARSAT SAR survey archived since 1990-s by SUAI and NERSC/NIERSC.
Supersonic Molecular Beam Optical Stark Spectroscopy of MnH.
NASA Astrophysics Data System (ADS)
Gengler, Jamie; Ma, Tongmei; Harrison, Jeremy; Steimle, Timothy
2006-03-01
The large moment of inertia, large magnetic moment, and possible large permanent electric dipole moment of manganese monohydride, MnH, makes it a prime candidate for ultra-cold molecule production via Stark deceleration and magnetic trapping. Here we report the first molecular beam production of MnH and the analysis of the Stark effect in the (0,0) A^7 π -- X^ 7σ^+ band. The sample was prepared by laser ablation of solid Mn in an H2 supersonic expansion. The low rotational temperature (<50 K) and near natural linewidth resolution (˜50 MHz) facilitated analysis of the ^55Mn (I=5/2) and ^1H (I=1/2) hyperfine structure. A comparison of the derived field-free parameters with those obtained from sub- Doppler optical measurements will be made. Progress on the analysis of the Stark effect will be given. J.R. Bochinski, E.R. Hudson, H.J. Lewandowski, and J. Ye, Phys. Rev. A 70, 043410 (2004). S.Y.T. van de Meerakker, R.T. Jongma, H.L. Bethlem, and G. Meijer, Phys. Rev. A 64, 041401(R) (2001) report the first molecular beam production of MnH and the analysis of T.D. Varberg, J.A. Gray, R.W. Field, and A.J. Merer, J. Mol. Spec. 156, 296-318 (1992). I.E. Gordon, D.R.T. Appadoo, A. Shayesteh, K.A. Walker, and P.F. Bernath, J. Mol. Spec., 229, 145-149 (2005).
Development of mechanical circulatory support devices in China.
Wang, Wei; Zhu, De-Ming; Ding, Wen-Xiang
2009-11-01
Myocardial dysfunction leading to low cardiac output syndrome is a common clinical pathophysiological state. Currently, the use of mechanical circulatory support (MCS) is an essential aspect of the treatment of patients with cardiac failure. Several groups in China are engaged in the design and development of MCS devices. These devices can be classified as pulsatile, rotary, and total artificial heart (TAH). There are two types of pulsatile pump, which are driven by air (pneumatic). One of these pumps, the Luo-Ye pump, has been used clinically for short-term support since 1998. The other is a push-plate left ventricular device, which has a variable rate mode. Various rotary devices are classified into axial and centrifugal pumps, depending on the impeller geometry. Most rotary pumps are based on the maglev principle, and some types have been used clinically. Others are still being studied in the laboratory or in animal experiments. Furthermore, certain types of total implantable pump, such as the UJS-III axial pump and the UJS-IV aortic valvo-pump, have been developed. Only one type of TAH has been developed in China. The main constituents of this artificial heart are two axial pumps, two reservoir tanks mimicking the right and left atria, flow meters, two pressure gauges, and a resistance adaptor. Although the development of mechanical assist devices in China is still in a nascent stage, a number of different types of MCS devices are currently being studied.
Xiong, Mengneng; Zhu, Zhiping; Tian, Suwen; Zhu, Ruping; Bai, Shun; Fu, Kaiqiang; Davis, James G; Sun, Zheng; Baur, Joseph A; Zheng, Ke; Ye, Lan
2017-09-01
Rapamycin is a clinically important drug that is used in transplantation and cancer therapy but which causes a number of side effects, including male infertility. Its canonical target, mammalian target of rapamycin complex 1 (mTORC1), plays a key role in metabolism and binds chromatin; however, its precise role in the male germline has not been elucidated. Here, we inactivate the core component, Raptor, to show that mTORC1 function is critical for male meiosis and the inactivation of sex chromosomes. Disruption of the Raptor gene impairs chromosomal synapsis and prevents the efficient spreading of silencing factors into the XY chromatin. Accordingly, mRNA for XY-linked genes remains inappropriately expressed in Raptor -deficient mice. Molecularly, the failure to suppress gene expression corresponded with deficiencies in 2 repressive chromatin markers, H3K9 dimethylation and H3K9 trimethylation, in the XY body. Together, these results demonstrate that mTORC1 has an essential role in the meiotic progression and silencing of sex chromosomes in the male germline, which may explain the infertility that has been associated with such inhibitors as rapamycin.-Xiong, M., Zhu, Z., Tian, S., Zhu, R., Bai, S., Fu, K., Davis, J. G., Sun, Z., Baur, J. A., Zheng, K., Ye, L. Conditional ablation of Raptor in the male germline causes infertility due to meiotic arrest and impaired inactivation of sex chromosomes. © FASEB.
ERIC Educational Resources Information Center
Smith, Jeffrey
2007-01-01
The ongoing moral panic surrounding adolescent boys continues to cause concern, proving pivotal in popular discourses centring on the "problem of youth". Drawing on ethnographic data from a large co-educational secondary school, this paper illustrates how school outcomes are adversely affected by working class boys' investments in peer…
Menie, Michael A. Woodley of; Fernandes, Heitor B. F.; José Figueredo, Aurelio; Meisenberg, Gerhard
2015-01-01
It has been theorized that declines in general intelligence (g) due to genetic selection stemming from the inverse association between completed fertility and IQ and the Flynn effect co-occur, with the effects of the latter being concentrated on less heritable non-g sources of intelligence variance. Evidence for this comes from the observation that 19th century populations were more intellectually productive, and also exhibited faster simple reaction times than modern ones, suggesting greater information-processing ability and therefore higher g. This co-occurrence model is tested via examination of historical changes in the utilization frequencies of words from the highly g-loaded WORDSUM test across 5.9 million texts spanning the period 1850–2005. Consistent with predictions, words with higher difficulties (δ parameters from Item Response Theory) and stronger negative correlations between pass rates and completed fertility declined in use over time whereas less difficult and less strongly selected words, increased in use over time, consistent with a Flynn effect stemming in part from the vocabulary enriching effects of increases in population literacy. These findings persisted when explicitly controlled for word age, changing literacy rates and temporal autocorrelation. These trends constitute compelling evidence for the co-occurrence model. PMID:25954211
NASA Astrophysics Data System (ADS)
Cosentino, Domenico; Öǧretmen, Nazik; Cipollari, Paola; Gliozzi, Elsa; Radeff, Giuditta; Yıldırım, Cengiz; Baykara, Oruc M.; Shen, Chuan-Chou
2016-04-01
Along the Mediterranean coastal area of southern Anatolia, markers of ancient sea-level have been reported west of Alanya and east of the Göksu delta. In both areas, bioconstructed fossil rims, consisting mainly of calcareous algae, are situated 0.5 m above the live counterpart. The fossil rim to the west of Alanya has been dated between 2690 to 1545 yrs BP, evidencing late Holocene rock uplift at the CAP southern margin. More recently, based on beachrocks along the coastal area from Incekum to the south of Adana, authors showed that the shoreline was raised around 0.5 m after 19 BC-200 AD. Based on new field observations along the coast between Aydı ncı k and Ayaş (Mersin, southern Turkey), together with AMS 14C dating and high-resolution U-Th chronology, a more complex uplift history can be suggested. Along the coast of Yeşilovacı k, we observed up to seven uplifted marine notches, from 0.5 m to 6.10 m above sea level. Some of them show relationships with a travertine crust that yielded U-Th ages of 2727 ± 1559 years and 5236 ± 2255 years. In the same area, a calcareous algae fossil trottoir related to a marine notch 5.40 m above sea level yielded an AMS 14C 2σ age of 32700 to 31645 years cal BP. Considering that the global ocean was 60 m below the present sea level at 32 ka, the Yeşilovacı k coastal area has been uplifted at 2 mm/yr. Moving to the east, in a small embayment at Eǧribük, two distinct well cemented beach deposits containing Murex brandaris, Cerithium vulgatum, and Columbella rustica have been uplifted at 0.3 m and 0.7 m above the present sea level. Although it is difficult to reconstruct the paleodepth of those beach deposits, AMS 14C 2σ ages of 5575 to 5445 years cal BP and 2130 to 1965 years cal BP show late Holocene uplift. In the Narlı kuyu area, up to seven different uplifted markers of sea level were observed between 0.8 and 7.2 m above the present sea level. In addition, near Ayaş new insights for late Holocene uplift are
Computer modeling of bidirectional spectra: the role of geometry of illumination/observation
NASA Astrophysics Data System (ADS)
Grynko, Ye.; Shkuratov, Yu.; Mall, U.
delivers the absolute surface reflectance as function of wavelength for a given geometrical illumination/observation condition In this paper we study the dependence of the reflectance spectra on the phase angle. The angle of incidence is constant and equals to 70°. The phase angle changes from 0° to 160°. For the substance which the particles are made of we chose average value 1 for the complex refractive index corresponding to lunar mare and highlands. Our calculations reveal a strong dependence of the spectral slopes on the phase angle. This confirms the previous general conclusion given in [2] that the larger the phase angle is the redder is the spectrum. A decomposition of the reflected flux into different scattering components shows that this is caused by the indicatrix of single scattering. Multiple scattering has almost no influence on spectral slope. The shape of the absorption bands also varies with phase angle but this dependence is not regular. The 1 µm feature is more pronounced at small and moderate phase angles and becomes wide and less visible at very large phase angles. References. [1] Yu. Shkuratov et al., Icarus, 137, 235-246 (1999). [2] C. M. Pieters et al., LPSC XXII, Abstract #1069 (1991). [3] A. Cord et al., Icarus, 165, 414-427 (2003). [4] Ye. Grynko and Yu. Shkuratov, J. Quant. Spectrosc. Rad. Trans. 78, 319- 340 (2003). [5] Yu. Shkuratov and Ye. Grynko, Icarus, 173, 16-28 (2006). 2
ERIC Educational Resources Information Center
Bowers, Alex J.; Chen, Jingjing
2015-01-01
The purpose of this study is to bring together recent innovations in the research literature around school district capital facility finance, municipal bond elections, statistical models of conditional time-varying outcomes, and data mining algorithms for automated text mining of election ballot proposals to examine the factors that influence the…
Ahmadinejad, Mojtaba; Aliepour, Asghar; Anbari, Khatereh; Kaviani, Mojhgan; Ganjizadeh, Hasan; Nadri, Sedigheh; Foroutani, Niloufar; Meysami, Masoumeh; Almasi, Vahid
2015-12-01
Several methods are used to evaluate the thyroid nodules. The aim of this study was to determine the sensitivity, specificity, false positive and negative rates, positive predictive value (PPV), and negative predictive value (NPV) of touch imprint, crush preparation, and fine-needle aspiration (FNA) methods. This cross-sectional study was done in Shohada-ye Ashayer University Hospital in Khorramabad. All the patients who underwent thyroid surgery due to thyroid nodules in this hospital between March and September 2011 were evaluated. The thyroid nodules of all the patients were evaluated by touch imprint, crush preparation, FNA, and permanent pathology methods. Finally, the results of the first three methods were compared with the result of permanent pathology method. The mean age of 104 patients who underwent thyroid surgery was 42.6 ± 11.9 years old. Based on permanent pathology, touch imprint, crush preparation, and FNA methods, 15.3, 6.25, 6.25, and 4.4 % of thyroid nodules were malignant, respectively. Sensitivity, specificity, false positive rate, false negative rate, PPV, and NPV of FNA biopsy were 62.5, 100, 0, 37.5, 100, and 95.3 %, respectively. Also, sensitivity, specificity, false positive rate, false negative rate, PPV, and NPV of touch imprint and crush preparation were equal and were 80, 100, 0, 20, 100, and 96.7 %, respectively. Using touch imprint and crush preparation in evaluation of thyroid nodules for rapid evaluation of these nodules in operating rooms seems to be logical, and it can prevent further surgeries.
Medical Mucilage Used in Traditional Persian Medicine Practice
Heydarirad, Ghazaleh; Choopani, Rasool; Mehdi, Pasalar; Jafari, Jamileh Mahdavi
2016-01-01
Background: Mucilage compounds are pharmaceutically important polysaccharides that have an extensive range of applications, including binding agents, thickeners, water retention agents, emulsion stabilizers, suspending agents, disintegrates, film formers, and gelling agents. A historical approach to medical science written by Iranian scholars could help in identifying excellent ideas and provide valuable information in this field for proper application. The aim of the current study was to introduce some mucilage uses derived from traditional Persian medicine (TPM). Methods: In this literature review, we assessed a few main traditional manuscripts of Iranian medicine, including the books Al Havi, Canon of Medicine, Qarabadine-kabir, Zakhireh-ye Khwarazm shahi, Tuhfat ul-Momineen and Makhzan-ul-Adwiah. The word “loab” in the aforementioned books were searched and all data about mucilage compounds were collected. Results: The use of medicinal plants containing mucilage in Iran dates back to ancient times. In traditional Persian manuscripts, mucilage is one of the most cited applications of medicinal plants for therapeutic objectives. There are various mucilage-producing plants in TPM such as Malva silvestris, Linum usitissimum, Althaea officinalis, Plantago psyllium, Descureania sophia and Ziziphus vulgaris. They have been used traditionally via oral or topical routes for respiratory, gastrointestinal, urinary, musculoskeletal, and genital systems as well as skin disorders. Certain applications are unique and promising for today’s chronic ailments. Conclusion: A scientific assessment of these valuable manuscripts would provide a better insight into the thoughts of the past sages and applicable for clinical use of the mucilage compounds. This may lead to research opportunities in the future. PMID:27516674
Zeeman interaction in the Δ31 state of HfF+ to search for the electron electric dipole moment
NASA Astrophysics Data System (ADS)
Petrov, A. N.; Skripnikov, L. V.; Titov, A. V.
2017-08-01
A theoretical study devoted to suppression of magnetic systematic effects in HfF+ cation for an experiment to search for the electron electric dipole moment is reported. The g factors for J =1 , F =3 /2 , | MF|=3 /2 hyperfine levels of the Δ31 state are calculated as functions of the external electric field. The minimal value for the difference between the g factors of Ω -doublet levels, Δ g =3 ×10-6 , is attained at the electric field 7 V/cm. The body-fixed g factor, G∥, was obtained both within the ab initio electronic structure calculations and with our fit of the experimental data [H. Loh, K. C. Cossel, M. C. Grau, K.-K. Ni, E. R. Meyer, J. L. Bohn, J. Ye, and E. A. Cornell, Science 342, 1220 (2013), 10.1126/science.1243683]. For the electronic structure calculations we used a combined scheme to perform correlation calculations of HfF+, which includes both the direct four-component all-electron and generalized relativistic effective core potential approaches. The electron correlation effects were treated using the coupled cluster methods. The calculated value G∥=0.0115 agrees very well with the G∥=0.0118 obtained with our fitting procedure. The calculated ab initio value D∥=-1.53 a.u. for the molecule-frame dipole moment (with the origin in the center of mass) is in agreement with the experimental datum D∥=-1.54 (1 ) a.u. [H. Loh, Ph.D. thesis, Massachusetts Institute of Technology, 2006.].
Tang, Ho Man; Liu, Sanzhen; Hill-Skinner, Sarah; Wu, Wei; Reed, Danielle; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S
2014-02-01
The midribs of maize brown midrib (bm) mutants exhibit a reddish-brown color associated with reductions in lignin concentration and alterations in lignin composition. Here, we report the mapping, cloning, and functional and biochemical analyses of the bm2 gene. The bm2 gene was mapped to a small region of chromosome 1 that contains a putative methylenetetrahydrofolate reductase (MTHFR) gene, which is down-regulated in bm2 mutant plants. Analyses of multiple Mu-induced bm2-Mu mutant alleles confirmed that this constitutively expressed gene is bm2. Yeast complementation experiments and a previously published biochemical characterization show that the bm2 gene encodes a functional MTHFR. Quantitative RT-PCR analyses demonstrated that the bm2 mutants accumulate substantially reduced levels of bm2 transcript. Alteration of MTHFR function is expected to influence accumulation of the methyl donor S-adenosyl-L-methionine (SAM). Because SAM is consumed by two methyltransferases in the lignin pathway (Ye et al., ), the finding that bm2 encodes a functional MTHFR is consistent with its lignin phenotype. Consistent with this functional assignment of bm2, the expression patterns of genes in a variety of SAM-dependent or -related pathways, including lignin biosynthesis, are altered in the bm2 mutant. Biochemical assays confirmed that bm2 mutants accumulate reduced levels of lignin with altered composition compared to wild-type. Hence, this study demonstrates a role for MTHFR in lignin biosynthesis. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Jaeggi, Adrian V; Kramer, Karen L; Hames, Raymond; Kiely, Evan J; Gomes, Cristina; Kaplan, Hillard; Gurven, Michael
2017-04-01
Grooming has important utilitarian and social functions in primates but little is known about grooming and its functional analogues in traditional human societies. We compare human grooming to typical primate patterns to test its hygienic and social functions. Bayesian phylogenetic analyses were used to derive expected human grooming time given the potential associations between grooming, group size, body size, terrestriality, and several climatic variables across 69 primate species. This was compared against observed times dedicated to grooming, other hygienic behavior, and conversation among the Maya, Pumé, Sanöma, Tsimane', Yanomamö, and Ye'kwana (mean number of behavioral scans = 23,514). Expected grooming time for humans was 4% (95% Credible Interval = 0.07%-14%), similar to values observed in primates, based largely on terrestriality and phylogenetic signal (mean λ = 0.56). No other covariates strongly associated with grooming across primates. Observed grooming time across societies was 0.8%, lower than 89% of the expected values. However, the observed times dedicated to any hygienic behavior (3.0%) or "vocal grooming," that is conversation (7.3%), fell within the expected range. We found (i) that human grooming may be a (recent) phylogenetic outlier when defined narrowly as parasite removal but not defined broadly as personal hygiene, (ii) there was no support for thermoregulatory functions of grooming, and (iii) no support for the "vocal grooming" hypothesis of language having evolved as a less time-consuming means of bonding. Thus, human grooming reflects decreased hygienic needs, but similar social needs compared to primate grooming. © 2017 Wiley Periodicals, Inc.
Hsieh, Shu-Chen; Liu, Jui-Ming; Pua, Xiao-Hui; Ting, Yuwen; Hsu, Ren-Jun; Cheng, Kuan-Chen
2016-03-01
In this study, taro waste (TW) was utilized for Lactobacillus acidophilus BCRC 14079 cultivation and the anti-tumor and immune-modulatory properties of heat-killed cells (HKCs), cytoplasmic fraction (CF), and exopolysaccharide (EPS) were evaluated. The optimum liquefaction enzyme dosage, temperature, and time determined by Box-Behnken design response surface methodology (BBD-RSM) were 9 mL/L of α-amylase, 79.2 °C, and 5 h of reaction, respectively. The optimum temperature and reaction time for saccharification were determined as 60 °C and 3 h. The optimum medium, CGMY1 medium, constitutes of TW hydrolysate containing 37 g/L of glucose, 25 g/L of corn gluten meal (CGM), and 1 g/L of yeast extract (YE). Results of MTT assay showed that HKCs and EPS from CGM medium exhibited the highest anti-proliferative in HT-29 (IC50 of HKCs, 467.25 μg/mL; EPS, 716.10 μg/mL) and in Caco-2 cells (IC50 of EPS, 741.60 μg/mL). Luciferase-based NF-ΚB and COX-2 systems indicated HKCs from CGM medium stimulated the highest expression of luciferin in both systems. The luciferase activities by using 100 and 500 μg/mL of HKCs from CGM were 24.30- and 45.83-fold in NF-ΚB system and 11.54- and 4.93-fold in COX-2 system higher than the control. In conclusion, this study demonstrated the potential of TW medium for L. acidophilus cultivation and the production of non-viable probiotics with enhanced biological activities.
Entire radial solutions of elliptic systems and inequalities of the mean curvature type
NASA Astrophysics Data System (ADS)
Filippucci, Roberta
2007-10-01
In this paper we study first nonexistence of radial entire solutions of elliptic systems of the mean curvature type with a singular or degenerate diffusion depending on the solution u. In particular we extend a previous result given in [R. Filippucci, Nonexistence of radial entire solutions of elliptic systems, J. Differential Equations 188 (2003) 353-389]. Moreover, in the scalar case we obtain nonexistence of all entire solutions, radial or not, of differential inequalities involving again operators of the mean curvature type and a diffusion term. We prove that in the scalar case, nonexistence of entire solutions is due to the explosion of the derivative of every nonglobal radial solution in the right extremum of the maximal interval of existence, while in that point the solution is bounded. This behavior is qualitatively different with respect to what happens for the m-Laplacian operator, studied in [R. Filippucci, Nonexistence of radial entire solutions of elliptic systems, J. Differential Equations 188 (2003) 353-389], where nonexistence of entire solutions is due, even in the vectorial case, to the explosion in norm of the solution at a finite point. Our nonexistence theorems for inequalities extend previous results given by Naito and Usami in [YE Naito, H. Usami, Entire solutions of the inequality div(A(=u)=u)[greater-or-equal, slanted]f(u), Math. Z. 225 (1997) 167-175] and Ghergu and Radulescu in [M. Ghergu, V. Radulescu, Existence and nonexistence of entire solutions to the logistic differential equation, Abstr. Appl. Anal. 17 (2003) 995-1003].
Medical Mucilage Used in Traditional Persian Medicine Practice
Heydarirad, Ghazaleh; Choopani, Rasool; Mehdi, Pasalar; Jafari, Jamileh Mahdavi
2016-01-01
Background: Mucilage compounds are pharmaceutically important polysaccharides that have an extensive range of applications, including binding agents, thickeners, water retention agents, emulsion stabilizers, suspending agents, disintegrates, film formers, and gelling agents. A historical approach to medical science written by Iranian scholars could help in identifying excellent ideas and provide valuable information in this field for proper application. The aim of the current study was to introduce some mucilage uses derived from traditional Persian medicine (TPM). Methods: In this literature review, we assessed a few main traditional manuscripts of Iranian medicine, including the books Al Havi, Canon of Medicine, Qarabadine-kabir, Zakhireh-ye Khwarazm shahi, Tuhfat ul-Momineen and Makhzan-ul-Adwiah. The word “loab” in the aforementioned books were searched and all data about mucilage compounds were collected. Results: The use of medicinal plants containing mucilage in Iran dates back to ancient times. In traditional Persian manuscripts, mucilage is one of the most cited applications of medicinal plants for therapeutic objectives. There are various mucilage-producing plants in TPM such as Malva silvestris, Linum usitissimum, Althaea officinalis, Plantago psyllium, Descureania sophia and Ziziphus vulgaris. They have been used traditionally via oral or topical routes for respiratory, gastrointestinal, urinary, musculoskeletal, and genital systems as well as skin disorders. Certain applications are unique and promising for today’s chronic ailments. Conclusion: A scientific assessment of these valuable manuscripts would provide a better insight into the thoughts of the past sages and applicable for clinical use of the mucilage compounds. This may lead to research opportunities in the future. PMID:27840507
Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A. C.; Ning, Zemin; Slagboom, P. Eline; Ye, Kai
2012-01-01
Motivation: RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon–exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. Results: We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ∼ 137 000 and 173 000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. Availability: The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion Contact: y.zhang@lumc.nl; k.ye@lumc.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22219203
GRP78 plays an essential role in adipogenesis and postnatal growth in mice
Zhu, Genyuan; Ye, Risheng; Jung, Dae Young; Barron, Ernesto; Friedline, Randall H.; Benoit, Vivian M.; Hinton, David R.; Kim, Jason K.; Lee, Amy S.
2013-01-01
To investigate the role of GRP78 in adipogenesis and metabolic homeostasis, we knocked down GRP78 in mouse embryonic fibroblasts and 3T3-L1 preadipocytes induced to undergo differentiation into adipocytes. We also created an adipose Grp78-knockout mouse utilizing the aP2 (fatty acid binding protein 4) promoter-driven Cre-recombinase. Adipogenesis was monitored by molecular markers and histology. Tissues were analyzed by micro-CT and electron microscopy. Glucose homeostasis and cytokine analysis were performed. Our results indicate that GRP78 is essential for adipocyte differentiation in vitro. aP2-cre-mediated GRP78 deletion leads to lipoatrophy with ∼90% reduction in gonadal and subcutaneous white adipose tissue and brown adipose tissue, severe growth retardation, and bone defects. Despite severe abnormality in adipose mass and function, adipose Grp78-knockout mice showed normal plasma triglyceride levels, and plasma glucose and insulin levels were reduced by 40-60% compared to wild-type mice, suggesting enhanced insulin sensitivity. The endoplasmic reticulum is grossly expanded in the residual mutant white adipose tissue. Thus, these studies establish that GRP78 is required for adipocyte differentiation, glucose homeostasis, and balanced secretion of adipokines. Unexpectedly, the phenotypes and metabolic parameters of the mutant mice, which showed early postnatal mortality, are uniquely distinct from previously characterized lipodystrophic mouse models.—Zhu, G., Ye, R., Jung, D. Y., Barron, E., Friedline, R. H., Benoit, V. M., Hinton, D. R., Kim, J. K., Lee, A. S. GRP78 plays an essential role in adipogenesis and postnatal growth in mice. PMID:23180827
Hsieh, Shu-Ching; Lai, Jung-Nien; Lee, Chuan-Fang; Hu, Fu-Chang; Tseng, Wei-Lum; Wang, Jung-Der
2008-06-01
The consumption of Chinese herbal products (CHPs) is increasing exponentially. However, the scientific evidence is lacking and there is an urgent requirement for detailed pharmacoepidemiological information on CHP usage. This study was to investigate CHP prescription patterns in Taiwan. We carried out a cross-sectional analysis on a cohort of 200,000 patients based on 2004 data from the National Health Insurance (NHI) reimbursement database. Data mining techniques were applied to explore CHP co-prescription patterns. A total of 46,938 patients had been prescribed CHPs on at least one occasion in 2004. Patients using CHPs were generally female and middle-aged, made more outpatient visits, had fewer hospitalizations and consumed more medical resources than non-users of CHPs. A total of 1,073,030 CHPs were contained within 220,123 prescriptions, for which acute nasopharyngitis was the most common indication. Yan hu suo and Jia Wei Xiao Yao San were the most frequently prescribed single herb (SH) and herbal formula (HF), respectively. The results of the data mining showed that the best predictions were provided by co-prescriptions of 'Mo yao and Ru xiang', 'Ye jiao teng and Suan Zao Ren Tan' and 'Dang Gui Nian Tong Tang and Shu Jing Huo Xue Tang' in the groups of SH-SH, SH-HF and HF-HF, respectively. This study provides national-level CHP prescription profiles and utilization rates, and documents, for the first time, HF-HF prescription combinations in Chinese medicine (CM) practices in Taiwan. We conclude that more studies are needed to validate the safety and effectiveness of CHP prescriptions.
Potassium currents in the heart: functional roles in repolarization, arrhythmia and therapeutics.
Chiamvimonvat, Nipavan; Chen-Izu, Ye; Clancy, Colleen E; Deschenes, Isabelle; Dobrev, Dobromir; Heijman, Jordi; Izu, Leighton; Qu, Zhilin; Ripplinger, Crystal M; Vandenberg, Jamie I; Weiss, James N; Koren, Gideon; Banyasz, Tamas; Grandi, Eleonora; Sanguinetti, Michael C; Bers, Donald M; Nerbonne, Jeanne M
2017-04-01
This is the second of the two White Papers from the fourth UC Davis Cardiovascular Symposium Systems Approach to Understanding Cardiac Excitation-Contraction Coupling and Arrhythmias (3-4 March 2016), a biennial event that brings together leading experts in different fields of cardiovascular research. The theme of the 2016 symposium was 'K + channels and regulation', and the objectives of the conference were severalfold: (1) to identify current knowledge gaps; (2) to understand what may go wrong in the diseased heart and why; (3) to identify possible novel therapeutic targets; and (4) to further the development of systems biology approaches to decipher the molecular mechanisms and treatment of cardiac arrhythmias. The sessions of the Symposium focusing on the functional roles of the cardiac K + channel in health and disease, as well as K + channels as therapeutic targets, were contributed by Ye Chen-Izu, Gideon Koren, James Weiss, David Paterson, David Christini, Dobromir Dobrev, Jordi Heijman, Thomas O'Hara, Crystal Ripplinger, Zhilin Qu, Jamie Vandenberg, Colleen Clancy, Isabelle Deschenes, Leighton Izu, Tamas Banyasz, Andras Varro, Heike Wulff, Eleonora Grandi, Michael Sanguinetti, Donald Bers, Jeanne Nerbonne and Nipavan Chiamvimonvat as speakers and panel discussants. This article summarizes state-of-the-art knowledge and controversies on the functional roles of cardiac K + channels in normal and diseased heart. We endeavour to integrate current knowledge at multiple scales, from the single cell to the whole organ levels, and from both experimental and computational studies. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.
Liu, Y H; Yi, Q; Hou, X B; Zhang, X G; Zhang, J J; Liu, H M; Hu, Y F; Huang, Y B
2016-06-30
Flowering-related traits in maize are affected by complex factors and are important for the improvement of cropping systems in the maize zone. Quantitative trait loci (QTLs) detected using different materials and methods usually vary. In the present study, 266 maize (Zea mays) F2:3 families and 301 recombinant inbred lines (RIL) derived from a cross between 08-641 (founding parent from southeast China) and Ye478 (founding parent from China) were evaluated for four flowering-related traits, including days to tasseling (DTT), days to pollen shedding (DPS), days to silking (DTS), and anthesis-silking interval. Sixty-six QTLs controlling the target traits were detected in the F2:3 and RIL populations via single environment analysis and joint analysis across all environments (JAAE). The QTLs explained 0.8-13.47% of the phenotypic variation, with 12 QTLs explaining more than 10%. The results of meta-QTL (MQTL) analysis indicated that 41 QTLs could be integrated into 14 MQTLs. One MQTL included 2.9 QTLs, ranging from two to ten QTLs for one to three traits. QTLs, including MQTL1-1 and MQTL9-1, were detected across the F2:3 and RIL populations via SAE and JAAE. Among the MQTLs, nine QTLs were integrated into MQTL9-1 and affected DTT, DPS, and DTS, with the favored allele being derived from 08-641. MQTL3-2 showed high phenotypic variation and was suitable for fine mapping to determine the genetic mechanisms of flowering. MQTL3-2 could be applied to improve inbred lines using marker-assisted selection.
NASA Astrophysics Data System (ADS)
2014-11-01
create strong networks between researchers. We also provide nice opportunities to experience Japanese nature and culture. The special cruise to see the magnificent whirlpool up close will definitely be one of the highlights. Additionally, we will serve Awaji's traditional performing art, Awaji Ningyo Joruri, which has a history of over 500 years and has been inherited through the generations. There are many individuals we would like to thank for their support in organizing PowerMEMS2014. The TPC, chaired by Takayuki Fujita, have given us their valuable time and best effort in reviewing abstracts. The PowerMEMS School chair Yuji Suzuki and the expert speakers made the School possible. The local organizing committee, led by Kensuke Kanda has provided us with invaluable assistance in preparing the PowerMEMS2014 venue. The financial support from both the Tsutomu Nakauchi Foundation, the Hyogo International Association and the conference sponsors have also been gratefully appreciated. Finally, we would like to thank each of you for attending the conference and bringing your expertise. We wish you all a successful conference and an exciting and relaxing stay in Awaji Island.
PREFACE: 7th International Conference on Applications of Physics in Financial Analysis
NASA Astrophysics Data System (ADS)
Takayasu, M.; Watanabe, T.; Ikeda, Y.; Takayasu, H.
2010-04-01
become interested in such datasets, conducting empirical investigations about various aspects of economic activities. Specifically, they have searched for regularities and 'laws' akin to the ones in natural science, successfully producing fascinating results, as shown in the papers contained in this volume. Each paper submitted for publication in this volume has gone through the refereeing process, and has been revised on the basis of comments and discussion at the conference as well as comments from the anonymous referees. Finally, 19 papers were accepted for publication. The editors are very grateful to the colleagues involved in the refereeing process for their rapid and careful reviewing of the papers. We thank Takayuki Mizuno, Koji Sakai, Hiwon Yoon and Hiroki Matsui for their support for the conference. We appreciate the administrative assistance provided by Yayoi Hatano of Hitotsubashi University, and Masahiko Ozaki, Masato Yamada and Tomoko Kase of RIETI. We are most grateful to the authors for their contributions, as well as to the participants, all of whom made this conference stimulating and enjoyable. Misako Takayasu Tokyo Institute of Technology, Japan Tsutomu Watanabe Hitotsubashi University, Japan RIETI, Japan Yuichi Ikeda Hitachi Research Laboratory, Hitachi Ltd, Japan Hideki Takayasu Sony Computer Science Laboratories, Inc, Japan
3D Printing of Personalized Organs and Tissues
NASA Astrophysics Data System (ADS)
Ye, Kaiming
2015-03-01
Authors: Kaiming Ye and Sha Jin, Department of Biomedical Engineering, Watson School of Engineering and Applied Science, Binghamton University, State University of New York, Binghamton, NY 13902-6000 Abstract: Creation of highly organized multicellular constructs, including tissues and organs or organoids, will revolutionize tissue engineering and regenerative medicine. The development of these technologies will enable the production of individualized organs or tissues for patient-tailored organ transplantation or cell-based therapy. For instance, a patient with damaged myocardial tissues due to an ischemic event can receive a myocardial transplant generated using the patient's own induced pluripotent stem cells (iPSCs). Likewise, a type-1 diabetic patient can be treated with lab-generated islets to restore his or her physiological insulin secretion capability. These lab-produced, high order tissues or organs can also serve as disease models for pathophysiological study and drug screening. The remarkable advances in stem cell biology, tissue engineering, microfabrication, and materials science in the last decade suggest the feasibility of generating these tissues and organoids in the laboratory. Nevertheless, major challenges still exist. One of the critical challenges that we still face today is the difficulty in constructing or fabricating multicellular assemblies that recapitulate in vivo microenvironments essential for controlling cell proliferation, migration, differentiation, maturation and assembly into a biologically functional tissue or organoid structure. These challenges can be addressed through developing 3D organ and tissue printing which enables organizing and assembling cells into desired tissue and organ structures. We have shown that human pluripotent stem cells differentiated in 3D environments are mature and possess high degree of biological function necessary for them to function in vivo.
Human Mercury Exposure in Yanomami Indigenous Villages from the Brazilian Amazon.
Vega, Claudia M; Orellana, Jesem D Y; Oliveira, Marcos W; Hacon, Sandra S; Basta, Paulo C
2018-05-23
In the Brazilian Amazon, where the majority of Yanomami villages are settled, mercury (Hg) exposure due to artisanal small-scale gold mining (ASGM) has been reported since the 1980s. This study assessed mercury exposure in the Yanomami reserve and whether the level of contamination was related to the ASGM geographical location. It was conducted using a cross-sectional study of 19 villages. Direct interviews were performed and hair samples were used as a bioindicator of Hg exposure. The Prevalence-Ratio (PR) was estimated as an indicator of association between ASGM geographical locations and human exposure to mercury. Mercury levels (239 hair samples) ranged between 0.4 and 22.1 μg·g -1 and presented substantial differences amongst the villages. In the Waikas-Aracaça region, where current ASGM was reported, we observed the highest Hg concentrations (median = 15.5 μg·g -1 ). Almost all participants presented with hair-Hg levels >6 μg·g -1 (prevalence = 92.3%). In the Paapiu region, we observed the lowest concentrations (median = 3.2 μg·g -1 ; prevalence = 6.7%). Our findings showed that the Waikas Ye'kuana and Waikas Aracaca villages presented with 4.4 (PR = 4.4; Confidence Interval (CI) 95% = 2.2⁻9.0) and 14.0 (PR = 14.0; CI 95% = 7.9⁻24.9) times higher prevalence of hair-Hg concentration, respectively, compared with Paapiu. Considering seasonal variation of Hg-exposure, the lowest concentrations were observed during the wet season (June⁻September) and the highest in the dry season (December⁻April). Our study suggests that there is an association between mercury exposure and ASGM geographical locations.
Spectral evolution with doping of an antiferromagnetic Mott state
NASA Astrophysics Data System (ADS)
Wu, Huan-Kuang; Lee, Ting-Kuo
2017-01-01
Since the discovery of half-filled cuprate to be a Mott insulator, the excitation spectra above the chemical potential for the unoccupied states has attracted much research attention. There were many theoretical works using different numerical techniques to study this problem, but many have reached different conclusions. One of the reasons is the lack of very detailed high-resolution experimental results for the theories to be compared with. Recently, the scanning tunneling spectroscopy [P. Cai et al., Nat. Phys. 12, 1047 (2016), 10.1038/nphys3840; C. Ye et al., Nat. Commun. 4, 1365 (2013), 10.1038/ncomms2369] on lightly doped Mott insulator with an antiferromagnetic order found the presence of in-gap states with energy of order half an eV above the chemical potential. The measured spectral properties with doping are not quite consistent with earlier theoretical works. Although the experiment has disorder and localization effect, but for the energy scale we will study here, a model without disorder is sufficed to illustrate the underlying physics. We perform a diagonalization method on top of the variational Monte Carlo calculation to study the evolution of antiferromagnetic Mott state with doped hole concentration in the Hubbard model. Our results found in-gap states that behave similarly with ones reported by STS. These in-gap states acquire a substantial amount of dynamical spectral weight transferred from the upper Hubbard band. The in-gap states move toward chemical potential with increasing spectral weight as doping increases. Our result also provides information about the energy scale of these in-gap states in relation with the Coulomb coupling strength U .
Stojanoski, Vlatko; Chow, Dar-Chone; Hu, Liya; Sankaran, Banumathi; Gilbert, Hiram F.; Prasad, B. V. Venkataram; Palzkill, Timothy
2015-01-01
β-Lactamases are bacterial enzymes that hydrolyze β-lactam antibiotics. TEM-1 is a prevalent plasmid-encoded β-lactamase in Gram-negative bacteria that efficiently catalyzes the hydrolysis of penicillins and early cephalosporins but not oxyimino-cephalosporins. A previous random mutagenesis study identified a W165Y/E166Y/P167G triple mutant that displays greatly altered substrate specificity with increased activity for the oxyimino-cephalosporin, ceftazidime, and decreased activity toward all other β-lactams tested. Surprisingly, this mutant lacks the conserved Glu-166 residue critical for enzyme function. Ceftazidime contains a large, bulky side chain that does not fit optimally in the wild-type TEM-1 active site. Therefore, it was hypothesized that the substitutions in the mutant expand the binding site in the enzyme. To investigate structural changes and address whether there is an enlargement in the active site, the crystal structure of the triple mutant was solved to 1.44 Å. The structure reveals a large conformational change of the active site Ω-loop structure to create additional space for the ceftazidime side chain. The position of the hydroxyl group of Tyr-166 and an observed shift in the pH profile of the triple mutant suggests that Tyr-166 participates in the hydrolytic mechanism of the enzyme. These findings indicate that the highly conserved Glu-166 residue can be substituted in the mechanism of serine β-lactamases. The results reveal that the robustness of the overall β-lactamase fold coupled with the plasticity of an active site loop facilitates the evolution of enzyme specificity and mechanism. PMID:25713062
The Bar Mode Instability in Deleptonizing Fizzlers
NASA Astrophysics Data System (ADS)
Imamura, James N.; Durisen, R. H.
2009-01-01
Core collapse in massive rotating nonmagnetic stars may hangup before neutron star densities are reached when rotationally supported or partially rotation supported, hot, lepton-rich objects known as fizzlers form. For typical massive core masses, fizzlers may form if the core has angular momentum J > 1049 g cm2 s-1. Newly formed fizzlers are stable to secular and dynamic nonaxisymmetric instabilities because of the high electron fraction per baryon, Ye > 0.3, and high entropy per baryon, Sn = 1-2 k of fizzler material, and the long-term evolution of a fizzler to neutron star density is driven by deleptonization and cooling of the lepton-rich fizzler material. Both processes lead to pressure loss which causes the fizzler to contract and spin-up. All deleptonizing fizzlers eventually become subject to gravito-rotation-driven nonaxisymmetric instabilities before they reach neutron star density. We study the development of barlike instabilities in deleptonizing fizzlers. We find that vigorous growth in barlike modes occurs only after the bar mode dynamic instability threshold is passed. Because barlike modes break axial symmetry, a burst of gravitational wave (GW) radiation is produced as barlike modes develop. For typical fizzler properties, the GW radiation will have frequency 300-600 Hz with strains of 10-23-10-23, for fizzlers at distances of 15 Mpc ( Virgo cluster of galaxies). Fizzlers in the Virgo cluster would be easily detectable by the gravitational wave obervatory LIGO if the barlike mode persisted for several hundred cycles. We find that barlike modes in fizzlers persist for at least 15-30 cycles in our simulations, depending on the deleptonization rate.
He, Juan-Mei; Zhu, Hong; Zheng, Guo-Song; Liu, Pan-Pan; Wang, Jin; Zhao, Guo-Ping; Zhu, Guo-Qiang; Jiang, Wei-Hong; Lu, Yin-Hua
2016-12-16
GlnR, an OmpR-like orphan two-component system response regulator, is a master regulator of nitrogen metabolism in the genus Streptomyces In this work, evidence that GlnR is also directly involved in the regulation of antibiotic biosynthesis is provided. In the model strain Streptomyces coelicolor M145, an in-frame deletion of glnR resulted in markedly increased actinorhodin (ACT) production but reduced undecylprodigiosin (RED) biosynthesis when exposed to R2YE culture medium. Transcriptional analysis coupled with DNA binding studies revealed that GlnR represses ACT but activates RED production directly via the pathway-specific activator genes actII-ORF4 and redZ, respectively. The precise GlnR-binding sites upstream of these two target genes were defined. In addition, the direct involvement of GlnR in antibiotic biosynthesis was further identified in Streptomyces avermitilis, which produces the important anthelmintic agent avermectin. We found that S. avermitilis GlnR (GlnRsav) could stimulate avermectin but repress oligomycin production directly through the respective pathway-specific activator genes, aveR and olmRI/RII To the best of our knowledge, this report describes the first experimental evidence demonstrating that GlnR regulates antibiotic biosynthesis directly through pathway-specific regulators in Streptomyces Our results suggest that GlnR-mediated regulation of antibiotic biosynthesis is likely to be universal in streptomycetes. These findings also indicate that GlnR is not only a master nitrogen regulator but also an important controller of secondary metabolism, which may help to balance nitrogen metabolism and antibiotic biosynthesis in streptomycetes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Oldenburg, Catherine E; Amza, Abdou; Kadri, Boubacar; Nassirou, Beido; Cotter, Sun Y; Stoller, Nicole E; West, Sheila K; Bailey, Robin L; Porco, Travis C; Gaynor, Bruce D; Keenan, Jeremy D; Lietman, Thomas M
2018-02-01
Repeated oral azithromycin distribution targeted only to children has proven effective in reducing the ocular Chlamydia that causes trachoma. Here, we assess whether an enhanced coverage target of at least 90% of children is superior to the World Health Organization recommendation of at least 80%. Twenty-four trachoma-endemic communities in Matamèye, Niger, were randomized to a single day of azithromycin distribution aiming for at least 80% coverage or up to 4 days of treatment and > 90% coverage of children under age 12. All distributions were biannual. Children < 5 years of age and adults > 15 years were monitored for ocular Chlamydia infection by polymerase chain reaction every 6 months for 36 months in children and at baseline and 36 months in adults. Ocular Chlamydia prevalence in children decreased from 24.9% (95% confidence interval [CI] 15.9-33.8%) to 4.4% (95% CI 0.6-8.2%, P < 0.001) at 36 months in the standard coverage arm and from 15.6% (95% CI 10.0-21.2%) to 3.3% (95% CI 1.0-5.5%; P < 0.001) in the enhanced coverage arm. Enhanced coverage reduced ocular Chlamydia prevalence in children more quickly over time compared with standard ( P = 0.04). There was no difference between arms at 36 months in children (2.4% lower with enhanced coverage, 95% CI 7.7-12.5%; P = 0.60). No infection was detected in adults at 36 months. Increasing antibiotic coverage among children from 80% to 90% may yield only short term improvements for trachoma control programs. Targeting treatment to children alone may be sufficient for trachoma control in this setting.
The role of proline-containing peptide triads in β-sheet formation: A kinetic study.
Takor, Gaius A; Higashiya, Seiichiro; Sikirzhytski, Vitali K; Seeley, Jason P; Lednev, Igor K; Welch, John T
2015-06-01
The design of biomimetic materials through molecular self-assembly is a growing area of modern nanotechnology. With problems of protein folding, self-assembly, and sequence-structure relationships as essential in nanotechnology as in biology, the effect of the nucleation of β-hairpin formation by proline on the folding process has been investigated in model studies. Previously such studies were limited to investigations of the influence of proline on the formation of turns in short peptide sequences. The effect of proline-based triads on the folding of an 11-kDa amyloidogenic peptide GH6[(GA)3GY(GA)3GE]8 GAH6 (YE8) was investigated by selective substitution of the proline-substituted triads at the γ-turn sites. The folding and fibrillation of the singly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]7(GA)3GY(GA)3PD-GAH6 (8PD), and doubly proline-substituted polypeptides, e.g., GH6-[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD[(GA)3GY(GA)3GE]3(GA)3GY(GA)3PD-GAH6 (4,8PD), were directly monitored by circular dichroism and deep UV resonance Raman and fluorescence spectroscopies. These findings were used to identify the essential folding domains, i.e., the minimum number of β-strands necessary for stable folding. These experimental findings may be especially useful in the design and construction of peptidic materials for a wide range of applications as well as in understanding the mechanisms of folding critical to fibril formation. © 2015 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Jizhong; He, Zhili
2010-02-28
Project Title: Deduction and Analysis of the Interacting Stress Response Pathways of Metal/Radionuclide-reducing Bacteria DOE Grant Number: DE-FG02-06ER64205 Principal Investigator: Jizhong (Joe) Zhou (University of Oklahoma) Key members: Zhili He, Aifen Zhou, Christopher Hemme, Joy Van Nostrand, Ye Deng, and Qichao Tu Collaborators: Terry Hazen, Judy Wall, Adam Arkin, Matthew Fields, Aindrila Mukhopadhyay, and David Stahl Summary Three major objectives have been conducted in the Zhou group at the University of Oklahoma (OU): (i) understanding of gene function, regulation, network and evolution of Desulfovibrio vugaris Hildenborough in response to environmental stresses, (ii) development of metagenomics technologies for microbial community analysis,more » and (iii) functional characterization of microbial communities with metagenomic approaches. In the past a few years, we characterized four CRP/FNR regulators, sequenced ancestor and evolved D. vulgaris strains, and functionally analyzed those mutated genes identified in salt-adapted strains. Also, a new version of GeoChip 4.0 has been developed, which also includes stress response genes (StressChip), and a random matrix theory-based conceptual framework for identifying functional molecular ecological networks has been developed with the high throughput functional gene array hybridization data as well as pyrosequencing data from 16S rRNA genes. In addition, GeoChip and sequencing technologies as well as network analysis approaches have been used to analyze microbial communities from different habitats. Those studies provide a comprehensive understanding of gene function, regulation, network, and evolution in D. vulgaris, and microbial community diversity, composition and structure as well as their linkages with environmental factors and ecosystem functioning, which has resulted in more than 60 publications.« less
PREFACE International Symposium on Spintronic Devices and Commercialization 2010
NASA Astrophysics Data System (ADS)
Du, You-wei; Judy, Jack; Qian, Zhenghong; Wang, Jianping
2011-01-01
very successful indeed. We are also grateful to the Advisory Committee, the Conference Chairs, the Excutive Chairs, the Academic Committee, the Organization Committee and the Secretariat for their fruitful work. We would especially like to thank all the organizers listed below for their support in all aspects of the conference. We would like to express our thanks to all the authors for their time and genuine efforts, and to the reviewers for their fruitful comments during the preparation of this volume. ISSDC'2010 ORGANIZATION Advisory Committee Chialing Chien, USAJunhao Chu, ChinaBernard Dieny, FranceKoichiro Inomata, Japan Liangmo Mei, ChinaJohn Sivertsen, USAMingjing Tu, ChinaDingsheng Wang, China Zhanguo Wang, ChinaQikun Xue, ChinaWenshan Zhan, China Conference Chairs Jack Judy, USAYouwei Du, China Executive Chairs Zhenghong Qian, USAJianping Wang, USA Organization Committee ChairJiyan Luo, China Vice ChairsGuilin Duan, ChinaLingling Sun, ChinaBaogen Shen, China MembersTiecheng Lu, ChinaDa Ma, ChinaYe Tian, China Jinsong Xu, ChinaQiuling XuChangmao Yang, China Guanghua Yu, ChinaYi Yan, China Academic Committee ChairsZhenghong Qian, USAYongbing Xu, UK Vice ChairsSeongtae Bae, SingaporeYong Jiang, ChinaDexin Wang, USA Huaiwu Zhang, ChinaJianhua Zhao, China MembersJianwang Cai, ChinaXiangdong Chen, ChinaHaifeng Ding, China Chunhong Hou, USAGunther Baubock, USABin Hu, USA Jungchun Huang, TaiwanDexuan Huo, ChinaYoon H Jeong, Korea Chihuang Lai, TaiwanRunwei Li, ChinaWei Liu, China Jing Shi, USAYasushi Takemura, JapanMark Tondra, USA Shan X Wang, USADi Wu, ChinaDesheng Xue, China Minglang Yan, USAShishen Yan, ChinaXiaofei Yang, China Chun Yeol You, KoreaWei Zhao, ChinaShiming Zhou, China Jianguo Zhu, China Secretariat Secretary-generalChangmao Yang, China Vice Secretary-generalJunli Wang, ChinaJinsong Xu, ChinaYe Tian, China MembersRu Bai, ChinaHongliang Zhan, China ISSDC' 2010 Organizers Department of Science and Technology, CSIC, China SpinIC Inc., China Hangzhou
Electrical Coupling: Novel Mechanism for Sleep-Wake Control
Garcia-Rill, Edgar; Heister, David S.; Ye, Meijun; Charlesworth, Amanda; Hayar, Abdallah
2007-01-01
Study Objectives: Recent evidence suggests that certain anesthetic agents decrease electrical coupling, whereas the stimulant modafinil appears to increase electrical coupling. We investigated the potential role of electrical coupling in 2 reticular activating system sites, the subcoeruleus nucleus and in the pedunculopontine nucleus, which has been implicated in the modulation of arousal via ascending cholinergic activation of intralaminar thalamus and descending activation of the subcoeruleus nucleus to generate some of the signs of rapid eye movement sleep. Design: We used 6- to 30-day-old rat pups to obtain brainstem slices to perform whole-cell patch-clamp recordings. Measurements and Results: Recordings from single cells revealed the presence of spikelets, manifestations of action potentials in coupled cells, and of dye coupling of neurons in the pedunculopontine nucleus. Recordings in pairs of pedunculopontine nucleus and subcoeruleus nucleus neurons revealed that some of these were electrically coupled with coupling coefficients of approximately 2%. After blockade of fast synaptic transmission, the cholinergic agonist carbachol was found to induce rhythmic activity in pedunculopontine nucleus and subcoeruleus nucleus neurons, an effect eliminated by the gap junction blockers carbenoxolone or mefloquine. The stimulant modafinil was found to decrease resistance in neurons in the pedunculopontine nucleus and subcoeruleus nucleus after fast synaptic blockade, indicating that the effect may be due to increased coupling. Conclusions: The finding of electrical coupling in specific reticular activating system cell groups supports the concept that this underlying process behind specific neurotransmitter interactions modulates ensemble activity across cell populations to promote changes in sleep-wake state. Citation: Garcia-Rill E; Heister DS; Ye M; Charlesworth A; Hayar A. Electrical coupling: novel mechanism for sleep-wake control. SLEEP 2007;30(11):1405-1414. PMID
The Developmental Decrease in REM Sleep: The Role of Transmitters and Electrical Coupling
Garcia-Rill, Edgar; Charlesworth, Amanda; Heister, David; Ye, Meijun; Hayar, Abdallah
2008-01-01
Study Objectives: This mini-review considers certain factors related to the developmental decrease in rapid eye movement (REM) sleep, which occurs in favor of additional waking time, and its relationship to developmental factors that may influence its potential role in brain development. Design: Specifically, we discuss some of the theories proposed for the occurrence of REM sleep and agree with the classic notion that REM sleep is, at the least, a mechanism that may play a role in the maturation of thalamocortical pathways. The developmental decrease in REM sleep occurs gradually from birth until close to puberty in the human, and in other mammals it is brief and coincides with eye and ear opening and the beginning of massive exogenous activation. Therefore, the purported role for REM sleep may change to involve a number of other functions with age. Measurements and Results: We describe recent findings showing that morphologic and physiologic properties as well as cholinergic, gamma amino-butyric acid, kainic acid, n-methyl-d-aspartic acid, noradrenergic, and serotonergic synaptic inputs to mesopontine cholinergic neurons, as well as the degree of electrical coupling between mostly noncholinergic mesopontine neurons and levels of the neuronal gap-junction protein connexin 36, change dramatically during this critical period in development. A novel mechanism for sleep-wake control based on well-known transmitter interactions, as well as electrical coupling, is described. Conclusion: We hypothesize that a dysregulation of this process could result in life-long disturbances in arousal and REM sleep drive, leading to hypervigilance or hypovigilance such as that observed in a number of disorders that have a mostly postpubertal age of onset. Citation: Garcia-Rill E; Charlesworth A; Heister D; Ye Y; Hayar A. The developmental decrease in REM sleep: the role of transmitters and electrical coupling. SLEEP 2008;31(5):673–690. PMID:18517037
NASA Astrophysics Data System (ADS)
Kutter, S.; Chen, X.; Weckmann, U.
2011-12-01
Magnetotelluric (MT) measurements in areas with electromagnetic (EM) noise sources such as electric fences, power and railway lines pose severe challenges to the standard processing procedures. In order to significantly improve the data quality advanced filtering and processing techniques need to be applied. The presented 5-component MT data set from two field campaigns in 2009 and 2010 in the Barberton/Badplaas area, South Africa, was acquired within the framework of the German-South African geo-scientific research initiative Inkaba yeAfrica. Approximately 200 MT sites aligned along six profiles provide a good areal coverage of the southern part of the Barberton Greenstone Belt (BGB). Since it is one of the few remaining well-preserved geological formations from the Archean, it presents an ideal area to study the tectonic evolution and the role of plate tectonics on Early Earth. Comparing the electric properties, the surrounding high and low grade metamorphic rocks are characteristically resistive whereas mineralized shear zones are possible areas of higher electrical conductivity. Mapping their depth extension is a crucial step towards understanding the formation and the evolution of the BGB. Unfortunately, in the measurement area numerous noise sources were active, producing severe spikes and steps in the EM fields. These disturbances mainly affect long periods which are needed for resolving the deepest structures. The Remote Reference technique as well as two filtering techniques are applied to improve the data in different period ranges. Adjusting their parameters for each site is necessary to obtain the best possible results. The improved data set is used for two-dimensional inversion studies for the six profiles applying the RLM2DI algorithm by Rodi and Mackie (2001, implemented in WinGlink). In the models, areas with higher conductivity can be traced beneath known faults throughout the entire array along different profiles. Resistive zones seem to correlate
Isolation, structural analysis, and expression characteristics of the maize TIFY gene family.
Zhang, Zhongbao; Li, Xianglong; Yu, Rong; Han, Meng; Wu, Zhongyi
2015-10-01
TIFY, previously known as ZIM, comprises a plant-specific family annotated as transcription factors that might play important roles in stress response. Despite TIFY proteins have been reported in Arabidopsis and rice, a comprehensive and systematic survey of ZmTIFY genes has not yet been conducted. To investigate the functions of ZmTIFY genes in this family, we isolated and characterized 30 ZmTIFY (1 TIFY, 3 ZML, and 26 JAZ) genes in an analysis of the maize (Zea mays L.) genome in this study. The 30 ZmTIFY genes were distributed over eight chromosomes. Multiple alignment and motif display results indicated that all ZmTIFY proteins share two conserved TIFY and Jas domains. Phylogenetic analysis revealed that the ZmTIFY family could be divided into two groups. Putative cis-elements, involved in abiotic stress response, phytohormones, pollen grain, and seed development, were detected in the promoters of maize TIFY genes. Microarray data showed that the ZmTIFY genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results indicated that ZmTIFY4, 5, 8, 26, and 28 were induced, while ZmTIFY16, 13, 24, 27, 18, and 30 were suppressed, by drought stress in the maize inbred lines Han21 and Ye478. ZmTIFY1, 19, and 28 were upregulated after infection by three pathogens, whereas ZmTIFY4, 13, 21, 23, 24, and 26 were suppressed. These results indicate that the ZmTIFY family may have vital roles in response to abiotic and biotic stresses. The data presented in this work provide vital clues for further investigating the functions of the genes in the ZmTIFY family.
Modeling biogenic gas bubbles formation and migration in coarse sand
NASA Astrophysics Data System (ADS)
Ye, S.
2011-12-01
Shujun Ye Department of Hydrosciences, School of Earth Sciences and Engineering, Nanjing University, Nanjing 210093, China; sjye@nju.edu.cn Brent E. Sleep Department of Civil Engineering, University of Toronto, Toronto, ON, M5S 1A4 CANADA; sleep@ecf.utoronto.ca Methane gas generation in porous media was investigated in an anaerobic two-dimensional sand-filled cell. Inoculation of the lower portion of the cell with a methanogenic culture and addition of methanol to the bottom of the cell led to biomass growth and formation of a gas phase. The formation, migration, distribution and saturation of gases in the cell were visualized by the charge-coupled device (CCD) camera. Gas generated at the bottom of the cell in the biologically active zone moved upwards in discrete fingers, so that gas phase saturations (gas-filled fraction of void space) in the biologically active zone at the bottom of the cell did not exceed 40-50%, while gas accumulation at the top of the cell produced gas phase saturations as high as 80%. Macroscopic invasion percolation (MIP) at near pore scale[Glass, et al., 2001; Kueper and McWhorter, 1992]was used to model gas bubbles growth in porous media. The nonwetting phase migration pathway can be yielded directly by MIP. MIP was adopted to simulate the expansion, fragmentation, and mobilization of gas clusters in the cell. The production of gas, and gas phash saturations were simulated by a continuum model - compositional simulator (COMPSIM) [Sleep and Sykes, 1993]. So a combination of a continuum model and a MIP model was used to simulate the formation, fragmentation and migration of biogenic gas bubbles. Key words: biogenic gas; two dimensional; porous media; MIP; COMPSIM
Karki, Suman; Surolia, Ranu; Hock, Thomas David; Guroji, Purusotham; Zolak, Jason S.; Duggal, Ryan; Ye, Tong; Thannickal, Victor J.; Antony, Veena B.
2014-01-01
Pleural mesothelial cells (PMCs), which are derived from the mesoderm, exhibit an extraordinary capacity to undergo phenotypic changes during development and disease. PMC transformation and trafficking has a newly defined role in idiopathic pulmonary fibrosis (IPF); however, the contribution of Wilms' tumor 1 (Wt1)-positive PMCs to the generation of pathognomonic myofibroblasts remains unclear. PMCs were obtained from IPF lung explants and healthy donor lungs that were not used for transplantation. Short hairpin Wt1-knockdown PMCs (sh Wt1) were generated with Wt1 shRNA, and morphologic and functional assays were performed in vitro. Loss of Wt1 abrogated the PMC phenotype and showed evidence of mesothelial-to-mesenchymal transition (MMT), with a reduced expression of E-cadherin and an increase in the profibrotic markers α-smooth muscle actin (α-SMA) and fibronectin, along with increased migration and contractility, compared with that of the control. Migration of PMCs in response to active transforming growth factor (TGF)-β1 was assessed by live-cell imaging with 2-photon microscopy and 3D imaging, of Wt1-EGFP transgenic mice. Lineage-tracing experiments to map the fate of Wt1+ PMCs in mouse lung in response to TGF-β1 were also performed by using a Cre-loxP system. Our results, for the first time, demonstrate that Wt1 is necessary for the morphologic integrity of pleural membrane and that loss of Wt1 contributes to IPF via MMT of PMCs into a myofibroblast phenotype.—Karki, S., Surolia, R., Hock, T. D., Guroji, P., Zolak, J. S., Duggal, R., Ye, T., Thannickal, V., J., Antony, V. B. Wilms' tumor 1 (Wt1) regulates pleural mesothelial cell plasticity and transition into myofibroblasts in idiopathic pulmonary fibrosis. PMID:24265486
Adverse Drug Event Discovery Using Biomedical Literature: A Big Data Neural Network Adventure.
P Tafti, Ahmad; Badger, Jonathan; LaRose, Eric; Shirzadi, Ehsan; Mahnke, Andrea; Mayer, John; Ye, Zhan; Page, David; Peissig, Peggy
2017-12-08
The study of adverse drug events (ADEs) is a tenured topic in medical literature. In recent years, increasing numbers of scientific articles and health-related social media posts have been generated and shared daily, albeit with very limited use for ADE study and with little known about the content with respect to ADEs. The aim of this study was to develop a big data analytics strategy that mines the content of scientific articles and health-related Web-based social media to detect and identify ADEs. We analyzed the following two data sources: (1) biomedical articles and (2) health-related social media blog posts. We developed an intelligent and scalable text mining solution on big data infrastructures composed of Apache Spark, natural language processing, and machine learning. This was combined with an Elasticsearch No-SQL distributed database to explore and visualize ADEs. The accuracy, precision, recall, and area under receiver operating characteristic of the system were 92.7%, 93.6%, 93.0%, and 0.905, respectively, and showed better results in comparison with traditional approaches in the literature. This work not only detected and classified ADE sentences from big data biomedical literature but also scientifically visualized ADE interactions. To the best of our knowledge, this work is the first to investigate a big data machine learning strategy for ADE discovery on massive datasets downloaded from PubMed Central and social media. This contribution illustrates possible capacities in big data biomedical text analysis using advanced computational methods with real-time update from new data published on a daily basis. ©Ahmad P Tafti, Jonathan Badger, Eric LaRose, Ehsan Shirzadi, Andrea Mahnke, John Mayer, Zhan Ye, David Page, Peggy Peissig. Originally published in JMIR Medical Informatics (http://medinform.jmir.org), 08.12.2017.
A study of chemical remediation on 1,2,4-Trichlorobenzene in groundwater
NASA Astrophysics Data System (ADS)
Ye, S.
2015-12-01
Shujun Ye, Guanqun Wang, and Jichun WuKey Laboratory of Surficial Geochemistry, Ministry of Education; School of Earth Sciences and Engineering, Nanjing University, Nanjing 210093, China, Nanjing, 210093, China; sjye@nju.edu.cn The ground water is contaminated by 1,2,4 Trichlorobenzene (TCB) in a former chemical plant in Nanjing, China. So 1,2,4-TCB is the contaminant of concern in this study. As chemical oxidation technology is a common in-site remediation technique, hydrogen peroxide, sodium sulfate and the two-mixed oxidants under the catalytic condition are used to remove 1,2,4-TCB from groundwater. By changing the values of temperature and pH in the experiments, the best conditions for chemical oxidation with oxidants mentioned above were determined. The fluorescent brightener of PF, manufactured by the former chemical plant, was added to groundwater to evaluate whether its existence made an impact on the chemical oxidation. 1-D sand column tests were conducted to study the degradation effect by using the chemical oxidation technology. The experiment results showed that single oxidant and mixed both oxidants can remove 1,2,4-TCB completely. The oxidation efficiency of both oxidants is influenced by temperature and pH. For hydrogen peroxide, the oxidation efficiency decreases with the increase of pH, while, for sodium sulfate, the efficiency is high under the mild acidic condition. The fluorescent brightener PF has an impact on the oxidation efficiency, with negative effect on the oxidation with hydrogen peroxide but positive effect with sodium sulfate. 1-D sand column tests testified the degradation of 1,2,4-TCB by the chemical oxidation with hydrogen peroxide and sodium sulfate. KEY WORDS: 1,2,4-trichlorobenzene hydrogen peroxide sodium persulfate optical brightener PF chemical oxidation AcknowledgementsFunding for this research from DuPont Company and NSFC Project No. 41472212.
NASA Astrophysics Data System (ADS)
Bhattacharya, R.; Liberty, L. M.; Almeida, R. V.; Hubbard, J.
2016-12-01
We explore the structural and depositional evolution of the Stevenson Basin, Gulf of Alaska from a dense network of 2-D marine seismic profiles that span the Gulf of Alaska continental margin. The grid of 71 seismic profiles was acquired as part of a 1975 Mineral Management Services (MMS) exploration project to assess basin architecture along the Alaska continental shelf. We obtained unmigrated and stacked seismic profiles in TIFF format. We converted the data to SEGY format and migrated each profile. Within the Stevenson Basin, we identify key seismic horizons, including the regional Eocene-Miocene unconformity, that provide insights into its depositional and structural history. Using these observations combined with stacking velocities, sonic logs from wells, and refraction velocities from the Edge profile of Ye et al. (1997), we develop a local 3D velocity model that we use to depth-convert the seismic reflection profiles. By using ties to >2.5 km deep exploration wells, we note the Stevenson Basin is one of many Eocene and younger depocenters that span the forearc between Kodiak and Prince William Sound. Well logs and seismic data suggest basal strata consist of Eocene sediments than are unconformably overlain by Neogene and younger strata. Faults that breach the sea floor suggest active deformation within and at the bounds of this basin, including on new faults that do not follow any pre-existing structural trends. This assessment is consistent with slip models that place tsunamigenic faults that ruptured during the 1964 Great Alaska earthquake in the vicinity of the basin. The catalog of faults, their slip history and the depositional evolution of the Stevenson Basin, all suggest that the basin evolution may be controlled by heterogeneities along the incoming plate.
Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize
Guan, Haiying; Xu, Xiangbo; He, Chunmei; Liu, Chunxiao; Liu, Qiang; Dong, Rui; Liu, Tieshan; Wang, Liming
2016-01-01
A novel yellow-green leaf mutant yellow-green leaf-1 (ygl-1) was isolated in self-pollinated progenies from the cross of maize inbred lines Ye478 and Yuanwu02. The mutant spontaneously showed yellow-green character throughout the lifespan. Meanwhile, the mutant reduced contents of chlorophyll and Car, arrested chloroplast development and lowered the capacity of photosynthesis compared with the wild-type Lx7226. Genetic analysis revealed that the mutant phenotype was controlled by a recessive nuclear gene. The ygl-1 locus was initially mapped to an interval of about 0.86 Mb in bin 1.01 on the short arm of chromosome 1 using 231 yellow-green leaf individuals of an F2 segregating population from ygl-1/Lx7226. Utilizing four new polymorphic SSR markers, the ygl-1 locus was narrowed down to a region of about 48 kb using 2930 and 2247 individuals of F2 and F3 mapping populations, respectively. Among the three predicted genes annotated within this 48 kb region, GRMZM2G007441, which was predicted to encode a cpSRP43 protein, had a 1-bp nucleotide deletion in the coding region of ygl-1 resulting in a frame shift mutation. Semi-quantitative RT-PCR analysis revealed that YGL-1 was constitutively expressed in all tested tissues and its expression level was not significantly affected in the ygl-1 mutant from early to mature stages, while light intensity regulated its expression both in the ygl-1 mutant and wild type seedlings. Furthermore, the mRNA levels of some genes involved in chloroplast development were affected in the six-week old ygl-1 plants. These findings suggested that YGL-1 plays an important role in chloroplast development of maize. PMID:27100184
NASA Astrophysics Data System (ADS)
Armstrong, Richard; Brodzik, Mary Jo; Armstrong, Betsy; Barrett, Andrew; Fetterer, Florence; Hill, Alice; Jodha Khalsa, Siri; Racoviteanu, Adina; Raup, Bruce; Rittger, Karl; Williams, Mark; Wilson, Alana; Ye, Qinghua
2017-04-01
The Contribution to High Asia Runoff from Ice & Snow (CHARIS) project uses remote sensing data combined with modeling from 2000 to the present to improve proportional estimates of melt from glaciers and seasonal snow surfaces. Based at the National Snow and Ice Data Center (NSIDC), University of Colorado, Boulder, USA, the CHARIS project objectives are twofold: 1) capacity-building efforts with CHARIS partners from eight High Asian countries to better forecast future availability and vulnerability of water resources in the region, and 2) improving our ability to systematically assess the role of glaciers and seasonal snow in the freshwater resources of High Asia. Capacity-building efforts include working with CHARIS partners from Bhutan, Nepal, India, Pakistan, Afghanistan, Kazakhstan, Kyrgyzstan and Tajikistan. Our capacity-building activities include training, data sharing, supporting fieldwork, graduate student education and infrastructure development. Because of the scarcity of in situ data in this High Asian region, we are using the wealth of available remote sensing data to characterize digital elevation, daily maps of fractional snow-cover, annual maps of glacier and permanent snow cover area and downscaled reanalysis temperature data in snow melt models to estimate the relative proportions of river runoff from glacierized and seasonally snow-covered surfaces. Current collaboration with Qinghua Ye, visiting scientist at NSIDC from the Institute of Tibetan Plateau Research, CAS, focuses on remote sensing methods to detect changes in the mountain cryosphere. Collaboration with our Asian partners supports the systematic analysis of the annual cycle of seasonal snow and glacier ice melt across the High Mountain Asia region. With our Asian partners, we have derived reciprocal benefits, learning from their specialized local knowledge and obtaining access to their in situ data. We expect that the improved understanding of runoff from snow and glacier surfaces will
Lee, Moon J; Kang, Hannah
2018-05-01
To test whether message framing (ie, gain vs. loss) and risk type (ie, health vs appearance risk) in skin cancer prevention messages interact with one's prior experience. Two experiments with a 2 (message framing: gain vs loss) × 2 (risk type: health vs appearance risk) factorial design were conducted. The participants were given a URL to the experiment website via e-mail. On the first page of the website, the participants were told that they would be asked to evaluate a skin cancer print public service announcement (PSA): Online experiments. A total of 397 individuals participated (236 for experiment 1 and 161 for experiment 2). Apparatus: Four versions of the skin cancer print PSAs were developed. Four PSAs were identical except for the 2 manipulated components: message framing and risk type. Measures were adopted from Cho and Boster (message framing), Jones and Leary and Kiene et al. (risk type), De Vries, Mesters, van't Riet, Willems, and Reubsaet and Knight, Kirincich, Farmer, and Hood (prior experience), and Hammond, Fong, Zanna, Thrasher, and Borland and Hoffner and Ye (behavioral intent). General linear models were used to test hypotheses. Three-way interactions among message framing, risk type, and prior experience were found: When the intent of the message was to encourage sunscreen use, the effects of message framing and risk type were shown to be the exact opposite directions from when the intent was to discourage indoor/outdoor tanning. To discourage tanning among those with prior experience, messages emphasizing losses in terms of one's health will work better. For those with no prior experience, messages emphasizing potential appearance losses will work better for discouraging tanning while messages emphasizing gains like improving appearance will do a better job in encouraging sunscreen use.
Cortactin as a Target for FAK in the Regulation of Focal Adhesion Dynamics
Ghassemian, Majid; Schlaepfer, David D.
2012-01-01
Background Efficient cell movement requires the dynamic regulation of focal adhesion (FA) formation and turnover. FAs are integrin-associated sites of cell attachment and establish linkages to the cellular actin cytoskeleton. Cells without focal adhesion kinase (FAK), an integrin-activated tyrosine kinase, exhibit defects in FA turnover and cell motility. Cortactin is an actin binding adaptor protein that can influence FA dynamics. FAK and cortactin interact, but the cellular role of this complex remains unclear. Principal Findings Using FAK-null fibroblasts stably reconstituted with green fluorescent protein (GFP) tagged FAK constructs, we find that FAK activity and FAK C-terminal proline-rich region 2 (PRR2) and PRR3 are required for FA turnover and cell motility. Cortactin binds directly to FAK PRR2 and PRR3 sites via its SH3 domain and cortactin expression is important in promoting FA turnover and GFP-FAK release from FAs. FAK-cortactin binding is negatively-regulated by FAK activity and associated with cortactin tyrosine phosphorylation. FAK directly phosphorylates cortactin at Y421 and Y466 and over-expression of cortactin Y421, Y466, and Y482 mutated to phenylalanine (3YF) prevented FAK-enhanced FA turnover and cell motility. However, phospho-mimetic cortactin mutated to glutamic acid (3YE) did not affect FA dynamics and did not rescue FA turnover defects in cells with inhibited FAK activity or with PRR2-mutated FAK that does not bind cortactin. Conclusions Our results support a model whereby FAK-mediated FA remodeling may occur through the formation of a FAK-cortactin signaling complex. This involves a cycle of cortactin binding to FAK, cortactin tyrosine phosphorylation, and subsequent cortactin-FAK dissociation accompanied by FA turnover and cell movement. PMID:22952866
Processing grounded-wire TEM signal in time-frequency-pseudo-seismic domain: A new paradigm
NASA Astrophysics Data System (ADS)
Khan, M. Y.; Xue, G. Q.; Chen, W.; Huasen, Z.
2017-12-01
Grounded-wire TEM has received great attention in mineral, hydrocarbon and hydrogeological investigations for the last several years. Conventionally, TEM soundings have been presented as apparent resistivity curves as function of time. With development of sophisticated computational algorithms, it became possible to extract more realistic geoelectric information by applying inversion programs to 1-D & 3-D problems. Here, we analyze grounded-wire TEM data by carrying out analysis in time, frequency and pseudo-seismic domain supported by borehole information. At first, H, K, A & Q type geoelectric models are processed using a proven inversion program (1-D Occam inversion). Second, time-to-frequency transformation is conducted from TEM ρa(t) curves to magneto telluric MT ρa(f) curves for the same models based on all-time apparent resistivity curves. Third, 1-D Bostick's algorithm was applied to the transformed resistivity. Finally, EM diffusion field is transformed into propagating wave field obeying the standard wave equation using wavelet transformation technique and constructed pseudo-seismic section. The transformed seismic-like wave indicates that some reflection and refraction phenomena appear when the EM wave field interacts with geoelectric interface at different depth intervals due to contrast in resistivity. The resolution of the transformed TEM data is significantly improved in comparison to apparent resistivity plots. A case study illustrates the successful hydrogeophysical application of proposed approach in recovering water-filled mined-out area in a coal field located in Ye county, Henan province, China. The results support the introduction of pseudo-seismic imaging technology in short-offset version of TEM which can also be an useful aid if integrated with seismic reflection technique to explore possibilities for high resolution EM imaging in future.
Promoting free flow in the networks: Reimagining the body in early modern Suzhou.
Scheid, Volker
2017-06-01
The history of Chinese medicine is still widely imagined in terms dictated by the discourse of modernity, that is as 'traditional' and 'Chinese.' And yet, so as to be intelligible to us moderns, it must simultaneously be framed through categories that make it comparable somehow to the 'West' and the 'modern' from which it is said to be essentially different. This is accomplished, for instance, by viewing Chinese medicine as fundamentally shaped by cosmological thinking, as focusing on process rather than matter, and as forever hampered by attachments to the past even when it tries to innovate. At the same time, it is described as pursuing its objectives in ways that make sense in 'our' terms, too, such as the goal of creating physiological homeostasis through methods of supplementation and drainage. In this paper, I seek to move beyond this kind of analysis through a two-pronged approach. First, by focusing on the concept of tong - a character that calls forth images of free flow, connectivity, relatedness and understanding - I foreground an important aspect of Chinese medical thinking and practice that has virtually been ignored by Western historians of medicine and science. Second, by exploring how the influential physician Ye Tianshi (1664-1746) employed tong to advance medical thinking and practice at a crucial moment of change in the history of Chinese medicine, I demonstrate that physicians in early modern China moved towards new understandings of the body readily intelligible by modern biomedical anatomy. I argue that this mode of analysis allows us to transcend the limitations inherent in the current historiography of Chinese medicine: because it allows for comparison to emerge from our subject matter rather than imposing our imaginaries onto it in advance.
NASA Astrophysics Data System (ADS)
Li, Z. Y.; Chen, M. T.; Shi, X.; Liu, S.; Wang, H.
2015-12-01
Zi-Ye Li a, Min-Te Chen b, Hou-Jie Wang a, Sheng-Fa Liu c, Xue-Fa Shi ca College of Marine Geosciences, Ocean University of China, Qingdao 266100, P.R. Chinab Institute of Applied Geosciences, National Taiwan Ocean University, Keelung, Taiwan 20224, ROCc First Institute of Oceanography, SOA, Qingdao 266100, P.R. China Indonesian throughflow (ITF) is one of the most important currents responsible for transporting heat and moisture from the western Pacific to the Indian Oceans. The ITF is also well-known as effectively in modulating the global climate change with the interactions among ENSO and Asian monsoons. Here we present an AMS 14C dating controlled sea surface temperature (SST) record from core SO184-10043 (07°18.57'S, 105°03.53'E), which was retrieved from 2171m water depth at a north-south depression located at the southeastern offshore area of Sumatera in the eastern Indian Ocean. Based on our high-resolution SST using Mg/Ca analyses based on planktonic foraminifera shells of Globigerinoides ruber and alkenone index, U k'37-SST, oxygen isotope stratigraphy, and AMC 14C age-controls, our records show that, during the past 32,000 years, the SSTs were decreased which imply weaker ITF during Marine Isotope Stage (MIS) 2 and 3. The weaker UTF may respond to strengthened northeast monsoon during the boreal winter. During 21 to 15ka, the southeast monsoon had been stronger and the northeast monsoon was relatively weaker. During 15 to 8ka, rapid sea level rising may allow the opening of the gateways in the Makassar Strait and Lombok Strait that may have further strengthened the ITF. During the early Holocene, the northeast and southeast monsoons seem to be both strengthened. We will discuss the implications of the hydrographic variability and their age uncertainties in this paper during the meeting.