Science.gov

Sample records for yeast dbf4 sequences

  1. A Dbf4p BRCA1 C-Terminal-Like Domain Required for the Response to Replication Fork Arrest in Budding Yeast

    PubMed Central

    Gabrielse, Carrie; Miller, Charles T.; McConnell, Kristopher H.; DeWard, Aaron; Fox, Catherine A.; Weinreich, Michael

    2006-01-01

    Dbf4p is an essential regulatory subunit of the Cdc7p kinase required for the initiation of DNA replication. Cdc7p and Dbf4p orthologs have also been shown to function in the response to DNA damage. A previous Dbf4p multiple sequence alignment identified a conserved ∼40-residue N-terminal region with similarity to the BRCA1 C-terminal (BRCT) motif called “motif N.” BRCT motifs encode ∼100-amino-acid domains involved in the DNA damage response. We have identified an expanded and conserved ∼100-residue N-terminal region of Dbf4p that includes motif N but is capable of encoding a single BRCT-like domain. Dbf4p orthologs diverge from the BRCT motif at the C terminus but may encode a similar secondary structure in this region. We have therefore called this the BRCT and DBF4 similarity (BRDF) motif. The principal role of this Dbf4p motif was in the response to replication fork (RF) arrest; however, it was not required for cell cycle progression, activation of Cdc7p kinase activity, or interaction with the origin recognition complex (ORC) postulated to recruit Cdc7p–Dbf4p to origins. Rad53p likely directly phosphorylated Dbf4p in response to RF arrest and Dbf4p was required for Rad53p abundance. Rad53p and Dbf4p therefore cooperated to coordinate a robust cellular response to RF arrest. PMID:16547092

  2. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    PubMed Central

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis. PMID:18768747

  3. DNA Replication Checkpoint Signaling Depends on a Rad53–Dbf4 N-Terminal Interaction in Saccharomyces cerevisiae

    PubMed Central

    Chen, Ying-Chou; Kenworthy, Jessica; Gabrielse, Carrie; Hänni, Christine; Zegerman, Philip; Weinreich, Michael

    2013-01-01

    Dbf4-dependent kinase (DDK) and cyclin-dependent kinase (CDK) are essential to initiate DNA replication at individual origins. During replication stress, the S-phase checkpoint inhibits the DDK- and CDK-dependent activation of late replication origins. Rad53 kinase is a central effector of the replication checkpoint and both binds to and phosphorylates Dbf4 to prevent late-origin firing. The molecular basis for the Rad53–Dbf4 physical interaction is not clear but occurs through the Dbf4 N terminus. Here we found that both Rad53 FHA1 and FHA2 domains, which specifically recognize phospho-threonine (pT), interacted with Dbf4 through an N-terminal sequence and an adjacent BRCT domain. Purified Rad53 FHA1 domain (but not FHA2) bound to a pT Dbf4 peptide in vitro, suggesting a possible phospho-threonine-dependent interaction between FHA1 and Dbf4. The Dbf4–Rad53 interaction is governed by multiple contacts that are separable from the Cdc5- and Msa1-binding sites in the Dbf4 N terminus. Importantly, abrogation of the Rad53–Dbf4 physical interaction blocked Dbf4 phosphorylation and allowed late-origin firing during replication checkpoint activation. This indicated that Rad53 must stably bind to Dbf4 to regulate its activity. PMID:23564203

  4. DNA replication checkpoint signaling depends on a Rad53-Dbf4 N-terminal interaction in Saccharomyces cerevisiae.

    PubMed

    Chen, Ying-Chou; Kenworthy, Jessica; Gabrielse, Carrie; Hänni, Christine; Zegerman, Philip; Weinreich, Michael

    2013-06-01

    Dbf4-dependent kinase (DDK) and cyclin-dependent kinase (CDK) are essential to initiate DNA replication at individual origins. During replication stress, the S-phase checkpoint inhibits the DDK- and CDK-dependent activation of late replication origins. Rad53 kinase is a central effector of the replication checkpoint and both binds to and phosphorylates Dbf4 to prevent late-origin firing. The molecular basis for the Rad53-Dbf4 physical interaction is not clear but occurs through the Dbf4 N terminus. Here we found that both Rad53 FHA1 and FHA2 domains, which specifically recognize phospho-threonine (pT), interacted with Dbf4 through an N-terminal sequence and an adjacent BRCT domain. Purified Rad53 FHA1 domain (but not FHA2) bound to a pT Dbf4 peptide in vitro, suggesting a possible phospho-threonine-dependent interaction between FHA1 and Dbf4. The Dbf4-Rad53 interaction is governed by multiple contacts that are separable from the Cdc5- and Msa1-binding sites in the Dbf4 N terminus. Importantly, abrogation of the Rad53-Dbf4 physical interaction blocked Dbf4 phosphorylation and allowed late-origin firing during replication checkpoint activation. This indicated that Rad53 must stably bind to Dbf4 to regulate its activity.

  5. Interactions of the Human MCM-BP Protein with MCM Complex Components and Dbf4

    PubMed Central

    Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

    2012-01-01

    MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK. PMID:22540012

  6. Interactions of the human MCM-BP protein with MCM complex components and Dbf4.

    PubMed

    Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

    2012-01-01

    MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK.

  7. Structural changes in Mcm5 protein bypass Cdc7-Dbf4 function and reduce replication origin efficiency in Saccharomyces cerevisiae.

    PubMed

    Hoang, Margaret L; Leon, Ronald P; Pessoa-Brandao, Luis; Hunt, Sonia; Raghuraman, M K; Fangman, Walton L; Brewer, Bonita J; Sclafani, Robert A

    2007-11-01

    Eukaryotic chromosomal replication is a complicated process with many origins firing at different efficiencies and times during S phase. Prereplication complexes are assembled on all origins in G(1) phase, and yet only a subset of complexes is activated during S phase by DDK (for Dbf4-dependent kinase) (Cdc7-Dbf4). The yeast mcm5-bob1 (P83L) mutation bypasses DDK but results in reduced intrinsic firing efficiency at 11 endogenous origins and at origins located on minichromosomes. Origin efficiency may result from Mcm5 protein assuming an altered conformation, as predicted from the atomic structure of an archaeal MCM (for minichromosome maintenance) homologue. Similarly, an intragenic mutation in a residue predicted to interact with P83L suppresses the mcm5-bob1 bypass phenotype. We propose DDK phosphorylation of the MCM complex normally results in a single, highly active conformation of Mcm5, whereas the mcm5-bob1 mutation produces a number of conformations, only one of which is permissive for origin activation. Random adoption of these alternate states by the mcm5-bob1 protein can explain both how origin firing occurs independently of DDK and why origin efficiency is reduced. Because similar mutations in mcm2 and mcm4 cannot bypass DDK, Mcm5 protein may be a unique Mcm protein that is the final target of DDK regulation.

  8. Dbf4-dependent kinase and the Rtt107 scaffold promote Mus81-Mms4 resolvase activation during mitosis.

    PubMed

    Princz, Lissa N; Wild, Philipp; Bittmann, Julia; Aguado, F Javier; Blanco, Miguel G; Matos, Joao; Pfander, Boris

    2017-03-01

    DNA repair by homologous recombination is under stringent cell cycle control. This includes the last step of the reaction, disentanglement of DNA joint molecules (JMs). Previous work has established that JM resolving nucleases are activated specifically at the onset of mitosis. In case of budding yeast Mus81-Mms4, this cell cycle stage-specific activation is known to depend on phosphorylation by CDK and Cdc5 kinases. Here, we show that a third cell cycle kinase, Cdc7-Dbf4 (DDK), targets Mus81-Mms4 in conjunction with Cdc5-both kinases bind to as well as phosphorylate Mus81-Mms4 in an interdependent manner. Moreover, DDK-mediated phosphorylation of Mms4 is strictly required for Mus81 activation in mitosis, establishing DDK as a novel regulator of homologous recombination. The scaffold protein Rtt107, which binds the Mus81-Mms4 complex, interacts with Cdc7 and thereby targets DDK and Cdc5 to the complex enabling full Mus81 activation. Therefore, Mus81 activation in mitosis involves at least three cell cycle kinases, CDK, Cdc5 and DDK Furthermore, tethering of the kinases in a stable complex with Mus81 is critical for efficient JM resolution. © 2017 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  9. Phosphopeptide binding by Sld3 links Dbf4-dependent kinase to MCM replicative helicase activation.

    PubMed

    Deegan, Tom D; Yeeles, Joseph Tp; Diffley, John Fx

    2016-05-02

    The initiation of eukaryotic DNA replication requires the assembly of active CMG (Cdc45-MCM-GINS) helicases at replication origins by a set of conserved and essential firing factors. This process is controlled during the cell cycle by cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), and in response to DNA damage by the checkpoint kinase Rad53/Chk1. Here we show that Sld3, previously shown to be an essential CDK and Rad53 substrate, is recruited to the inactive MCM double hexamer in a DDK-dependent manner. Sld3 binds specifically to DDK-phosphorylated peptides from two MCM subunits (Mcm4, 6) and then recruits Cdc45. MCM mutants that cannot bind Sld3 or Sld3 mutants that cannot bind phospho-MCM or Cdc45 do not support replication. Moreover, phosphomimicking mutants in Mcm4 and Mcm6 bind Sld3 without DDK and facilitate DDK-independent replication. Thus, Sld3 is an essential "reader" of DDK phosphorylation, integrating signals from three distinct protein kinase pathways to coordinate DNA replication during S phase. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  10. Concerted activities of Mcm4, Sld3, and Dbf4 in control of origin activation and DNA replication fork progression

    PubMed Central

    Sheu, Yi-Jun; Kinney, Justin B.; Stillman, Bruce

    2016-01-01

    Eukaryotic chromosomes initiate DNA synthesis from multiple replication origins in a temporally specific manner during S phase. The replicative helicase Mcm2-7 functions in both initiation and fork progression and thus is an important target of regulation. Mcm4, a helicase subunit, possesses an unstructured regulatory domain that mediates control from multiple kinase signaling pathways, including the Dbf4-dependent Cdc7 kinase (DDK). Following replication stress in S phase, Dbf4 and Sld3, an initiation factor and essential target of Cyclin-Dependent Kinase (CDK), are targets of the checkpoint kinase Rad53 for inhibition of initiation from origins that have yet to be activated, so-called late origins. Here, whole-genome DNA replication profile analysis is used to access under various conditions the effect of mutations that alter the Mcm4 regulatory domain and the Rad53 targets, Sld3 and Dbf4. Late origin firing occurs under genotoxic stress when the controls on Mcm4, Sld3, and Dbf4 are simultaneously eliminated. The regulatory domain of Mcm4 plays an important role in the timing of late origin firing, both in an unperturbed S phase and in dNTP limitation. Furthermore, checkpoint control of Sld3 impacts fork progression under replication stress. This effect is parallel to the role of the Mcm4 regulatory domain in monitoring fork progression. Hypomorph mutations in sld3 are suppressed by a mcm4 regulatory domain mutation. Thus, in response to cellular conditions, the functions executed by Sld3, Dbf4, and the regulatory domain of Mcm4 intersect to control origin firing and replication fork progression, thereby ensuring genome stability. PMID:26733669

  11. Recognition of Yeast Species from Gene Sequence Comparisons

    USDA-ARS?s Scientific Manuscript database

    This review discusses recognition of yeast species from gene sequence comparisons, which have been responsible for doubling the number of known yeasts over the past decade. The resolution provided by various single gene sequences is examined for both ascomycetous and basidiomycetous species, and th...

  12. A Novel Non-canonical Forkhead-associated (FHA) Domain-binding Interface Mediates the Interaction between Rad53 and Dbf4 Proteins*

    PubMed Central

    Matthews, Lindsay A.; Selvaratnam, Rajeevan; Jones, Darryl R.; Akimoto, Madoka; McConkey, Brendan J.; Melacini, Giuseppe; Duncker, Bernard P.; Guarné, Alba

    2014-01-01

    Forkhead-associated (FHA) and BRCA1 C-terminal (BRCT) domains are overrepresented in DNA damage and replication stress response proteins. They function primarily as phosphoepitope recognition modules but can also mediate non-canonical interactions. The latter are rare, and only a few have been studied at a molecular level. We have identified a crucial non-canonical interaction between the N-terminal FHA1 domain of the checkpoint effector kinase Rad53 and the BRCT domain of the regulatory subunit of the Dbf4-dependent kinase that is critical to suppress late origin firing and to stabilize stalled forks during replication stress. The Rad53-Dbf4 interaction is phosphorylation-independent and involves a novel non-canonical interface on the FHA1 domain. Mutations within this surface result in hypersensitivity to genotoxic stress. Importantly, this surface is not conserved in the FHA2 domain of Rad53, suggesting that the FHA domains of Rad53 gain specificity by engaging additional interaction interfaces beyond their phosphoepitope-binding site. In general, our results point to FHA domains functioning as complex logic gates rather than mere phosphoepitope-targeting modules. PMID:24285546

  13. Genome sequence of the lager brewing yeast, an interspecies hybrid.

    PubMed

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-04-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.

  14. Genome Sequence of the Lager Brewing Yeast, an Interspecies Hybrid

    PubMed Central

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-01-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production. PMID:19261625

  15. Long-read sequencing data analysis for yeasts.

    PubMed

    Yue, Jia-Xing; Liti, Gianni

    2018-06-01

    Long-read sequencing technologies have become increasingly popular due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast Saccharomyces cerevisiae has many isolates currently being sequenced with long reads. However, analyzing long-read sequencing data to produce high-quality genome assembly and annotation remains challenging. Here, we present a modular computational framework named long-read sequencing data analysis for yeasts (LRSDAY), the first one-stop solution that streamlines this process. Starting from the raw sequencing reads, LRSDAY can produce chromosome-level genome assembly and comprehensive genome annotation in a highly automated manner with minimal manual intervention, which is not possible using any alternative tool available to date. The annotated genomic features include centromeres, protein-coding genes, tRNAs, transposable elements (TEs), and telomere-associated elements. Although tailored for S. cerevisiae, we designed LRSDAY to be highly modular and customizable, making it adaptable to virtually any eukaryotic organism. When applying LRSDAY to an S. cerevisiae strain, it takes ∼41 h to generate a complete and well-annotated genome from ∼100× Pacific Biosciences (PacBio) running the basic workflow with four threads. Basic experience working within the Linux command-line environment is recommended for carrying out the analysis using LRSDAY.

  16. Yeast Prions and Human Prion-like Proteins: Sequence Features and Prediction Methods

    PubMed Central

    Cascarina, Sean; Ross, Eric D.

    2014-01-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis (ALS). This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms. PMID:24390581

  17. Yeast prions and human prion-like proteins: sequence features and prediction methods.

    PubMed

    Cascarina, Sean M; Ross, Eric D

    2014-06-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

  18. Draft Genome Sequence of the Yeast Starmerella bombicola NBRC10243, a Producer of Sophorolipids, Glycolipid Biosurfactants

    PubMed Central

    Matsuzawa, Tomohiko; Koike, Hideaki; Saika, Azusa; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2015-01-01

    The yeast Starmerella bombicola NBRC10243 is an excellent producer of sophorolipids (SLs) from various feedstocks. Here, we report the draft genome sequence of S. bombicola NBRC10243. Analysis of the sequence may provide insight into the properties of this yeast that make it superior for use in the production of functional glycolipids and biomolecules, leading to the further development of S. bombicola NBRC10243 for industrial applications. PMID:25814600

  19. MIPS: a database for protein sequences, homology data and yeast genome information.

    PubMed Central

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  20. Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

    PubMed

    Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

    1996-02-01

    A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

  1. Identification of food and beverage spoilage yeasts from DNA sequence analyses

    USDA-ARS?s Scientific Manuscript database

    Detection, identification, and classification of yeasts has undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of th...

  2. Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936.

    PubMed

    Durrens, Pascal; Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J; Noël, Thierry

    2017-08-03

    Clavispora lusitaniae , an environmental saprophytic yeast belonging to the CTG clade of Candida , can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. Copyright © 2017 Durrens et al.

  3. Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936

    PubMed Central

    Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J.; Noël, Thierry

    2017-01-01

    ABSTRACT Clavispora lusitaniae, an environmental saprophytic yeast belonging to the CTG clade of Candida, can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. PMID:28774979

  4. Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609.

    PubMed

    Sambles, Christine; Middelhaufe, Sabine; Soanes, Darren; Kolak, Dagmara; Lux, Thomas; Moore, Karen; Matoušková, Petra; Parker, David; Lee, Rob; Love, John; Aves, Stephen J

    2017-09-01

    Most eukaryotic oleaginous species are yeasts and among them the basidiomycete red yeast, Rhodotorula ( Rhodosporidium ) toruloides (Pucciniomycotina) is known to produce high quantities of lipids when grown in nitrogen-limiting media, and has potential for biodiesel production. The genome of the CGMCC 2.1609 strain of this oleaginous red yeast was sequenced using a hybrid of Roche 454 and Illumina technology generating 13 × coverage. The de novo assembly was carried out using MIRA and scaffolded using MAQ and BAMBUS. The sequencing and assembly resulted in 365 scaffolds with total genome size of 33.4 Mb. The complete genome sequence of this strain was deposited in GenBank and the accession number is LKER00000000. The annotation is available on Figshare (doi:10.6084/m9.figshare.4754251).

  5. Genome Sequence of Saccharomyces carlsbergensis, the World’s First Pure Culture Lager Yeast

    PubMed Central

    Walther, Andrea; Hesselbart, Ana; Wendland, Jürgen

    2014-01-01

    Lager yeast beer production was revolutionized by the introduction of pure culture strains. The first established lager yeast strain is known as the bottom fermenting Saccharomyces carlsbergensis, which was originally termed Unterhefe No. 1 by Emil Chr. Hansen and has been used in production in since 1883. S. carlsbergensis belongs to group I/Saaz-type lager yeast strains and is better adapted to cold growth conditions than group II/Frohberg-type lager yeasts, e.g., the Weihenstephan strain WS34/70. Here, we sequenced S. carlsbergensis using next generation sequencing technologies. Lager yeasts are descendants from hybrids formed between a S. cerevisiae parent and a parent similar to S. eubayanus. Accordingly, the S. carlsbergensis 19.5-Mb genome is substantially larger than the 12-Mb S. cerevisiae genome. Based on the sequence scaffolds, synteny to the S. cerevisae genome, and by using directed polymerase chain reaction for gap closure, we generated a chromosomal map of S. carlsbergensis consisting of 29 unique chromosomes. We present evidence for genome and chromosome evolution within S. carlsbergensis via chromosome loss and loss of heterozygosity specifically of parts derived from the S. cerevisiae parent. Based on our sequence data and via fluorescence-activated cell-sorting analysis, we determined the ploidy of S. carlsbergensis. This inferred that this strain is basically triploid with a diploid S. eubayanus and haploid S. cerevisiae genome content. In contrast the Weihenstephan strain, which we resequenced, is essentially tetraploid composed of two diploid S. cerevisiae and S. eubayanus genomes. Based on conserved translocations between the parental genomes in S. carlsbergensis and the Weihenstephan strain we propose a joint evolutionary ancestry for lager yeast strains. PMID:24578374

  6. Genomic Sequence of Saccharomyces cerevisiae BAW-6, a Yeast Strain Optimal for Brewing Barley Shochu

    PubMed Central

    Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takashita, Hideharu

    2018-01-01

    ABSTRACT Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. PMID:29622617

  7. Draft Genome Sequence of the Dimorphic Yeast Yarrowia lipolytica Strain W29

    SciTech Connect

    Pomraning, Kyle R.; Baker, Scott E.

    Here, we present the draft genome sequence of the dimorphic ascomycete yeastYarrowia lipolyticastrain W29 (ATCC 20460).Y. lipolyticais a commonly employed model for the industrial production of lipases, small molecules, and more recently for its ability to accumulate lipids.

  8. Gene sequence analyses and other DNA-based methods for yeast species recognition

    USDA-ARS?s Scientific Manuscript database

    DNA sequence analyses, as well as other DNA-based methodologies, have transformed the way in which yeasts are identified. The focus of this chapter will be on the resolution of species using various types of DNA comparisons. In other chapters in this book, Rozpedowska, Piškur and Wolfe discuss mul...

  9. Draft genome sequence of Cryptococcus terricola JCM 24523, an oleaginous yeast capable of expressing exogenous DNA

    DOE PAGES

    Close, Dan; Ojumu, John O.; Zhang, Gui X.

    2016-11-03

    Cryptococcus terricola JCM 24523 has recently been identified as an oleaginous yeast capable of converting starch into fatty acids. Here, this draft genome sequence provides a platform for elucidating its fatty acid production potential and supporting comparisons with other oleaginous species.

  10. Genomic Sequence of Saccharomyces cerevisiae BAW-6, a Yeast Strain Optimal for Brewing Barley Shochu.

    PubMed

    Kajiwara, Yasuhiro; Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takegawa, Kaoru; Takashita, Hideharu

    2018-04-05

    Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. Copyright © 2018 Kajiwara et al.

  11. Draft genome sequence of Cryptococcus terricola JCM 24523, an oleaginous yeast capable of expressing exogenous DNA

    SciTech Connect

    Close, Dan; Ojumu, John O.; Zhang, Gui X.

    Cryptococcus terricola JCM 24523 has recently been identified as an oleaginous yeast capable of converting starch into fatty acids. Here, this draft genome sequence provides a platform for elucidating its fatty acid production potential and supporting comparisons with other oleaginous species.

  12. Draft genome sequence of the oleaginous yeast Cryptococcus curvatus ATCC 20509

    SciTech Connect

    Close, Dan; Ojumu, John O.

    Cryptococcus curvatus ATCC 20509 is a commonly used nonmodel oleaginous yeast capable of converting a variety of carbon sources into fatty acids. In addition, we present the draft genome sequence of this popular organism to provide a means for more in-depth studies of its fatty acid production potential.

  13. Draft genome sequence of the oleaginous yeast Cryptococcus curvatus ATCC 20509

    DOE PAGES

    Close, Dan; Ojumu, John O.

    2016-11-03

    Cryptococcus curvatus ATCC 20509 is a commonly used nonmodel oleaginous yeast capable of converting a variety of carbon sources into fatty acids. In addition, we present the draft genome sequence of this popular organism to provide a means for more in-depth studies of its fatty acid production potential.

  14. LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

    PubMed Central

    Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

    1993-01-01

    The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

  15. Biogas Production from Brewer’s Yeast Using an Anaerobic Sequencing Batch Reactor

    PubMed Central

    2017-01-01

    Summary Renewable energy sources are becoming increasingly important in the beverage and food industries. In the brewing industry, a significant percentage of the used raw materials finishes the process as secondary resource or waste. The research on the anaerobic digestion of brewer’s yeast has been scarce until recent years. One of the reasons for this is its use as a secondary resource in the food industry and as cattle feed. Additionally, market value of brewer’s yeast is higher than its energy value. Due to the increase of energy prices, brewer’s yeast has become of interest as energy substrate despite its difficult degradability in anaerobic conditions. The anaerobic co-digestion of brewer’s yeast and anaerobically treated brewery wastewater was studied using a pilot-scale anaerobic sequencing batch reactor (ASBR) seeded with granular biomass. The experiments showed very good and stable operation with an organic loading rate of up to 8.0 kg/(m3·day), and with a maximum achieved organic loading rate of 13.6 kg/(m3·day) in a single cycle. A specific biogas productivity of over 0.430 m3/kg of the total chemical oxygen demand (COD) inserted, and total COD removal efficiencies of over 90% were achieved. This study suggests that the brewer’s yeast can be successfully digested in an ASBR without adverse effects on the biogas production from brewer’s yeast/wastewater mixtures of up to 8% (by volume). By using the brewer’s yeast in the ASBR process, the biogas production from brewery wastewater could be increased by 50%. PMID:28867948

  16. Synthetic signal sequences that enable efficient secretory protein production in the yeast Kluyveromyces marxianus.

    PubMed

    Yarimizu, Tohru; Nakamura, Mikiko; Hoshida, Hisashi; Akada, Rinji

    2015-02-14

    Targeting of cellular proteins to the extracellular environment is directed by a secretory signal sequence located at the N-terminus of a secretory protein. These signal sequences usually contain an N-terminal basic amino acid followed by a stretch containing hydrophobic residues, although no consensus signal sequence has been identified. In this study, simple modeling of signal sequences was attempted using Gaussia princeps secretory luciferase (GLuc) in the yeast Kluyveromyces marxianus, which allowed comprehensive recombinant gene construction to substitute synthetic signal sequences. Mutational analysis of the GLuc signal sequence revealed that the GLuc hydrophobic peptide length was lower limit for effective secretion and that the N-terminal basic residue was indispensable. Deletion of the 16th Glu caused enhanced levels of secreted protein, suggesting that this hydrophilic residue defined the boundary of a hydrophobic peptide stretch. Consequently, we redesigned this domain as a repeat of a single hydrophobic amino acid between the N-terminal Lys and C-terminal Glu. Stretches consisting of Phe, Leu, Ile, or Met were effective for secretion but the number of residues affected secretory activity. A stretch containing sixteen consecutive methionine residues (M16) showed the highest activity; the M16 sequence was therefore utilized for the secretory production of human leukemia inhibitory factor protein in yeast, resulting in enhanced secreted protein yield. We present a new concept for the provision of secretory signal sequence ability in the yeast K. marxianus, determined by the number of residues of a single hydrophobic residue located between N-terminal basic and C-terminal acidic amino acid boundaries.

  17. Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

    PubMed

    Hopper, A K; Schultz, L D; Shapiro, R A

    1980-03-01

    By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

  18. Draft genome sequence of the D-Xylose-Fermenting yeast Spathaspora xylofermentans UFMG-HMD23.3

    USDA-ARS?s Scientific Manuscript database

    Here, we report the draft genome sequence of the yeast Spathaspora xylofermentans UFMG-HMD23.3 (CBMAI 1427=CBS 12681), a D-xylose fermenting yeast isolated from the Amazonian forest. The genome consists of 298 contigs, with a total size of 15.1 Mb, including the mitochondrial genome, and 5,948 predi...

  19. High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast

    PubMed Central

    Liachko, Ivan; Youngblood, Rachel A.; Keich, Uri; Dunham, Maitreya J.

    2013-01-01

    DNA replication origins are necessary for the duplication of genomes. In addition, plasmid-based expression systems require DNA replication origins to maintain plasmids efficiently. The yeast autonomously replicating sequence (ARS) assay has been a valuable tool in dissecting replication origin structure and function. However, the dearth of information on origins in diverse yeasts limits the availability of efficient replication origin modules to only a handful of species and restricts our understanding of origin function and evolution. To enable rapid study of origins, we have developed a sequencing-based suite of methods for comprehensively mapping and characterizing ARSs within a yeast genome. Our approach finely maps genomic inserts capable of supporting plasmid replication and uses massively parallel deep mutational scanning to define molecular determinants of ARS function with single-nucleotide resolution. In addition to providing unprecedented detail into origin structure, our data have allowed us to design short, synthetic DNA sequences that retain maximal ARS function. These methods can be readily applied to understand and modulate ARS function in diverse systems. PMID:23241746

  20. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

    PubMed

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

    2015-08-25

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

  1. [Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

    PubMed

    Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

    2007-07-01

    To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

  2. Whole-Genome Sequencing of Sake Yeast Saccharomyces cerevisiae Kyokai no. 7

    PubMed Central

    Akao, Takeshi; Yashiro, Isao; Hosoyama, Akira; Kitagaki, Hiroshi; Horikawa, Hiroshi; Watanabe, Daisuke; Akada, Rinji; Ando, Yoshinori; Harashima, Satoshi; Inoue, Toyohisa; Inoue, Yoshiharu; Kajiwara, Susumu; Kitamoto, Katsuhiko; Kitamoto, Noriyuki; Kobayashi, Osamu; Kuhara, Satoru; Masubuchi, Takashi; Mizoguchi, Haruhiko; Nakao, Yoshihiro; Nakazato, Atsumi; Namise, Masahiro; Oba, Takahiro; Ogata, Tomoo; Ohta, Akinori; Sato, Masahide; Shibasaki, Seiji; Takatsume, Yoshifumi; Tanimoto, Shota; Tsuboi, Hirokazu; Nishimura, Akira; Yoda, Koji; Ishikawa, Takeaki; Iwashita, Kazuhiro; Fujita, Nobuyuki; Shimoi, Hitoshi

    2011-01-01

    The term ‘sake yeast’ is generally used to indicate the Saccharomyces cerevisiae strains that possess characteristics distinct from others including the laboratory strain S288C and are well suited for sake brewery. Here, we report the draft whole-genome shotgun sequence of a commonly used diploid sake yeast strain, Kyokai no. 7 (K7). The assembled sequence of K7 was nearly identical to that of the S288C, except for several subtelomeric polymorphisms and two large inversions in K7. A survey of heterozygous bases between the homologous chromosomes revealed the presence of mosaic-like uneven distribution of heterozygosity in K7. The distribution patterns appeared to have resulted from repeated losses of heterozygosity in the ancestral lineage of K7. Analysis of genes revealed the presence of both K7-acquired and K7-lost genes, in addition to numerous others with segmentations and terminal discrepancies in comparison with those of S288C. The distribution of Ty element also largely differed in the two strains. Interestingly, two regions in chromosomes I and VII of S288C have apparently been replaced by Ty elements in K7. Sequence comparisons suggest that these gene conversions were caused by cDNA-mediated recombination of Ty elements. The present study advances our understanding of the functional and evolutionary genomics of the sake yeast. PMID:21900213

  3. Assessing Genetic Diversity among Brettanomyces Yeasts by DNA Fingerprinting and Whole-Genome Sequencing

    PubMed Central

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A.

    2014-01-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. PMID:24814796

  4. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    PubMed

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    PubMed

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  6. Resolution of model Holliday junctions by yeast endonuclease: effect of DNA structure and sequence.

    PubMed Central

    Parsons, C A; Murchie, A I; Lilley, D M; West, S C

    1989-01-01

    The resolution of Holliday junctions in DNA involves specific cleavage at or close to the site of the junction. A nuclease from Saccharomyces cerevisiae cleaves model Holliday junctions in vitro by the introduction of nicks in regions of duplex DNA adjacent to the crossover point. In previous studies [Parsons and West (1988) Cell, 52, 621-629] it was shown that cleavage occurred within homologous arm sequences with precise symmetry across the junction. In contrast, junctions with heterologous arm sequences were cleaved asymmetrically. In this work, we have studied the effect of sequence changes and base modification upon the site of cleavage. It is shown that the specificity of cleavage is unchanged providing that perfect homology is maintained between opposing arm sequences. However, in the absence of homology, cleavage depends upon sequence context and is affected by minor changes such as base modification. These data support the proposed mechanism for cleavage of a Holliday junction, which requires homologous alignment of arm sequences in an enzyme--DNA complex as a prerequisite for symmetrical cleavage by the yeast endonuclease. Images PMID:2653810

  7. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts

    PubMed Central

    Langkjær, R. B.; Casaregola, S.; Ussery, D. W.; Gaillardin, C.; Piškur, J.

    2003-01-01

    The complete sequences of mitochondrial DNA (mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S.cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S.cerevisiae mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S.servazzii contain, in total, five +1 frameshifts. mtDNAs of S.castellii, S.servazzii and S.cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order is very different. Several gene rearrangements have taken place upon separation of the Saccharomyces lineages, and even a part of the transcription units have not been preserved. It seems that the mechanism(s) involved in the generation of the rearrangements has had to ensure that all genes stayed encoded by the same DNA strand. PMID:12799436

  8. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  9. An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes

    PubMed Central

    Kofoed, Megan; Milbury, Karissa L.; Chiang, Jennifer H.; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C.

    2015-01-01

    Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. PMID:26175450

  10. An Updated Collection of Sequence Barcoded Temperature-Sensitive Alleles of Yeast Essential Genes.

    PubMed

    Kofoed, Megan; Milbury, Karissa L; Chiang, Jennifer H; Sinha, Sunita; Ben-Aroya, Shay; Giaever, Guri; Nislow, Corey; Hieter, Philip; Stirling, Peter C

    2015-07-14

    Systematic analyses of essential gene function using mutant collections in Saccharomyces cerevisiae have been conducted using collections of heterozygous diploids, promoter shut-off alleles, through alleles with destabilized mRNA, destabilized protein, or bearing mutations that lead to a temperature-sensitive (ts) phenotype. We previously described a method for construction of barcoded ts alleles in a systematic fashion. Here we report the completion of this collection of alleles covering 600 essential yeast genes. This resource covers a larger gene repertoire than previous collections and provides a complementary set of strains suitable for single gene and genomic analyses. We use deep sequencing to characterize the amino acid changes leading to the ts phenotype in half of the alleles. We also use high-throughput approaches to describe the relative ts behavior of the alleles. Finally, we demonstrate the experimental usefulness of the collection in a high-content, functional genomic screen for ts alleles that increase spontaneous P-body formation. By increasing the number of alleles and improving the annotation, this ts collection will serve as a community resource for probing new aspects of biology for essential yeast genes. Copyright © 2015 Kofoed et al.

  11. Complete Genome Sequence of Kluyveromyces lactis Strain GG799, a Common Yeast Host for Heterologous Protein Expression

    PubMed Central

    Chuzel, Léa; Ganatra, Mehul B.; Schermerhorn, Kelly M.; Gardner, Andrew F.; Anton, Brian P.

    2017-01-01

    ABSTRACT We report the genome sequence of the dairy yeast Kluyveromyces lactis strain GG799 obtained using the Pacific Biosciences RS II platform. K. lactis strain GG799 is a common host for the expression of proteins at both laboratory and industrial scales. PMID:28751387

  12. Draft Genome Sequence of the d-Xylose-Fermenting Yeast Spathaspora arborariae UFMG-HM19.1AT

    PubMed Central

    Lobo, Francisco P.; Gonçalves, Davi L.; Alves, Sergio L.; Gerber, Alexandra L.; de Vasconcelos, Ana Tereza R.; Basso, Luiz C.; Franco, Glória R.; Soares, Marco A.; Cadete, Raquel M.; Rosa, Carlos A.

    2014-01-01

    The draft genome sequence of the yeast Spathaspora arborariae UFMG-HM19.1AT (CBS 11463 = NRRL Y-48658) is presented here. The sequenced genome size is 12.7 Mb, consisting of 41 scaffolds containing a total of 5,625 predicted open reading frames, including many genes encoding enzymes and transporters involved in d-xylose fermentation. PMID:24435867

  13. Yeast diversity during the fermentation of Andean chicha: A comparison of high-throughput sequencing and culture-dependent approaches.

    PubMed

    Mendoza, Lucía M; Neef, Alexander; Vignolo, Graciela; Belloch, Carmela

    2017-10-01

    Diversity and dynamics of yeasts associated with the fermentation of Argentinian maize-based beverage chicha was investigated. Samples taken at different stages from two chicha productions were analyzed by culture-dependent and culture-independent methods. Five hundred and ninety six yeasts were isolated by classical microbiological methods and 16 species identified by RFLPs and sequencing of D1/D2 26S rRNA gene. Genetic typing of isolates from the dominant species, Saccharomyces cerevisiae, by PCR of delta elements revealed up to 42 different patterns. High-throughput sequencing (HTS) of D1/D2 26S rRNA gene amplicons from chicha samples detected more than one hundred yeast species and almost fifty filamentous fungi taxa. Analysis of the data revealed that yeasts dominated the fermentation, although, a significant percentage of filamentous fungi appeared in the first step of the process. Statistical analysis of results showed that very few taxa were represented by more than 1% of the reads per sample at any step of the process. S. cerevisiae represented more than 90% of the reads in the fermentative samples. Other yeast species dominated the pre-fermentative steps and abounded in fermented samples when S. cerevisiae was in percentages below 90%. Most yeasts species detected by pyrosequencing were not recovered by cultivation. In contrast, the cultivation-based methodology detected very few yeast taxa, and most of them corresponded with very few reads in the pyrosequencing analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus

    PubMed Central

    Scannell, Devin R.; Zill, Oliver A.; Rokas, Antonis; Payen, Celia; Dunham, Maitreya J.; Eisen, Michael B.; Rine, Jasper; Johnston, Mark; Hittinger, Chris Todd

    2011-01-01

    High-quality, well-annotated genome sequences and standardized laboratory strains fuel experimental and evolutionary research. We present improved genome sequences of three species of Saccharomyces sensu stricto yeasts: S. bayanus var. uvarum (CBS 7001), S. kudriavzevii (IFO 1802T and ZP 591), and S. mikatae (IFO 1815T), and describe their comparison to the genomes of S. cerevisiae and S. paradoxus. The new sequences, derived by assembling millions of short DNA sequence reads together with previously published Sanger shotgun reads, have vastly greater long-range continuity and far fewer gaps than the previously available genome sequences. New gene predictions defined a set of 5261 protein-coding orthologs across the five most commonly studied Saccharomyces yeasts, enabling a re-examination of the tempo and mode of yeast gene evolution and improved inferences of species-specific gains and losses. To facilitate experimental investigations, we generated genetically marked, stable haploid strains for all three of these Saccharomyces species. These nearly complete genome sequences and the collection of genetically marked strains provide a valuable toolset for comparative studies of gene function, metabolism, and evolution, and render Saccharomyces sensu stricto the most experimentally tractable model genus. These resources are freely available and accessible through www.SaccharomycesSensuStricto.org. PMID:22384314

  15. Genome Sequence of the Native Apiculate Wine Yeast Hanseniaspora vineae T02/19AF

    PubMed Central

    Giorello, Facundo M.; Berná, Luisa; Greif, Gonzalo; Camesasca, Laura; Salzman, Valentina; Medina, Karina; Robello, Carlos; Gaggero, Carina; Aguilar, Pablo S.

    2014-01-01

    The use of novel yeast strains for winemaking improves quality and provides variety including subtle characteristic differences in fine wines. Here we report the first genome of a yeast strain native to Uruguay, Hanseniaspora vineae T02/19AF, which has been shown to positively contribute to aroma and wine quality. PMID:24874663

  16. Genome Sequence of the Native Apiculate Wine Yeast Hanseniaspora vineae T02/19AF.

    PubMed

    Giorello, Facundo M; Berná, Luisa; Greif, Gonzalo; Camesasca, Laura; Salzman, Valentina; Medina, Karina; Robello, Carlos; Gaggero, Carina; Aguilar, Pablo S; Carrau, Francisco

    2014-05-29

    The use of novel yeast strains for winemaking improves quality and provides variety including subtle characteristic differences in fine wines. Here we report the first genome of a yeast strain native to Uruguay, Hanseniaspora vineae T02/19AF, which has been shown to positively contribute to aroma and wine quality. Copyright © 2014 Giorello et al.

  17. Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

    PubMed Central

    Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

    2007-01-01

    Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

  18. Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes

    PubMed Central

    Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.

    2016-01-01

    The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

  19. Gleaning evolutionary insights from the genome sequence of a probiotic yeast Saccharomyces boulardii.

    PubMed

    Khatri, Indu; Akhtar, Akil; Kaur, Kamaldeep; Tomar, Rajul; Prasad, Gandham Satyanarayana; Ramya, Thirumalai Nallan Chakravarthy; Subramanian, Srikrishna

    2013-10-22

    The yeast Saccharomyces boulardii is used worldwide as a probiotic to alleviate the effects of several gastrointestinal diseases and control antibiotics-associated diarrhea. While many studies report the probiotic effects of S. boulardii, no genome information for this yeast is currently available in the public domain. We report the 11.4 Mbp draft genome of this probiotic yeast. The draft genome was obtained by assembling Roche 454 FLX + shotgun data into 194 contigs with an N50 of 251 Kbp. We compare our draft genome with all other Saccharomyces cerevisiae genomes. Our analysis confirms the close similarity of S. boulardii to S. cerevisiae strains and provides a framework to understand the probiotic effects of this yeast, which exhibits unique physiological and metabolic properties.

  20. Gleaning evolutionary insights from the genome sequence of a probiotic yeast Saccharomyces boulardii

    PubMed Central

    2013-01-01

    Background The yeast Saccharomyces boulardii is used worldwide as a probiotic to alleviate the effects of several gastrointestinal diseases and control antibiotics-associated diarrhea. While many studies report the probiotic effects of S. boulardii, no genome information for this yeast is currently available in the public domain. Results We report the 11.4 Mbp draft genome of this probiotic yeast. The draft genome was obtained by assembling Roche 454 FLX + shotgun data into 194 contigs with an N50 of 251 Kbp. We compare our draft genome with all other Saccharomyces cerevisiae genomes. Conclusions Our analysis confirms the close similarity of S. boulardii to S. cerevisiae strains and provides a framework to understand the probiotic effects of this yeast, which exhibits unique physiological and metabolic properties. PMID:24148866

  1. Isolated yeast promoter sequence and a method of regulated heterologous expression

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2005-05-31

    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  2. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    SciTech Connect

    Chang, Soo-Ik; Hammes, G.G.

    1989-11-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less

  3. Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

    PubMed Central

    Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

    1988-01-01

    Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

  4. The genome sequence of Saccharomyces eubayanus and the domestication of lager-brewing yeasts

    DOE PAGES

    Baker, Emily Clare; Wang, Bing; Bellora, Nicolas; ...

    2015-08-11

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae ( S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts havemore » experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. In conclusion, our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions.« less

  5. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts

    PubMed Central

    Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A.; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd

    2015-01-01

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. PMID:26269586

  6. Genome Sequence of the Thermotolerant Yeast Kluyveromyces marxianus var. marxianus KCTC 17555

    PubMed Central

    Jeong, Haeyoung; Lee, Dae-Hee; Kim, Sun Hong; Kim, Hyun-Jin; Lee, Kyusang; Song, Ju Yeon; Kim, Byung Kwon; Sung, Bong Hyun; Sohn, Jung Hoon; Koo, Hyun Min

    2012-01-01

    Kluyveromyces marxianus is a thermotolerant yeast that has been explored for potential use in biotechnological applications, such as production of biofuels, single-cell proteins, enzymes, and other heterologous proteins. Here, we present the high-quality draft of the 10.9-Mb genome of K. marxianus var. marxianus KCTC 17555 (= CBS 6556 = ATCC 26548). PMID:23193140

  7. Purification and Characterization of Enzymes from Yeast: An Extended Undergraduate Laboratory Sequence for Large Classes

    ERIC Educational Resources Information Center

    Johanson, Kelly E.; Watt, Terry J.; McIntyre, Neil R.; Thompson, Marleesa

    2013-01-01

    Providing a project-based experience in an undergraduate biochemistry laboratory class can be complex with large class sizes and limited resources. We have designed a 6-week curriculum during which students purify and characterize the enzymes invertase and phosphatase from bakers yeast. Purification is performed in two stages via ethanol…

  8. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts.

    PubMed

    Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd

    2015-11-01

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis

    Treesearch

    Thomas W. Jeffries; Igor V. Grigroriev; Jane Grimwood; Jose M. Laplaza; Andrea Aerts; Asaf Salamov; Jeremy Schmutz; Erika Lindquist; Paramvir Dehal; Harris Shapiro; Yong-Su Jin; Volkmar Passoth; Paul M. Richardson

    2007-01-01

    Xylose is a major constituent of plant lignocellulose, and its fermentation is important for the bioconversion of plant biomass to fuels and chemicals. Pichia stipitis is a well-studied, native xylose-fermenting yeast. The mechanism and regulation of xylose metabolism in P. stipitis have been characterized and genes from P. stipitis have been used to engineer xylose...

  10. de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer

    PubMed Central

    Istace, Benjamin; Friedrich, Anne; d'Agata, Léo; Faye, Sébastien; Payen, Emilie; Beluche, Odette; Caradec, Claudia; Davidas, Sabrina; Cruaud, Corinne; Liti, Gianni; Lemainque, Arnaud; Engelen, Stefan; Wincker, Patrick; Schacherer, Joseph

    2017-01-01

    Abstract Background: Oxford Nanopore Technologies Ltd (Oxford, UK) have recently commercialized MinION, a small single-molecule nanopore sequencer, that offers the possibility of sequencing long DNA fragments from small genomes in a matter of seconds. The Oxford Nanopore technology is truly disruptive; it has the potential to revolutionize genomic applications due to its portability, low cost, and ease of use compared with existing long reads sequencing technologies. The MinION sequencer enables the rapid sequencing of small eukaryotic genomes, such as the yeast genome. Combined with existing assembler algorithms, near complete genome assemblies can be generated and comprehensive population genomic analyses can be performed. Results: Here, we resequenced the genome of the Saccharomyces cerevisiae S288C strain to evaluate the performance of nanopore-only assemblers. Then we de novo sequenced and assembled the genomes of 21 isolates representative of the S. cerevisiae genetic diversity using the MinION platform. The contiguity of our assemblies was 14 times higher than the Illumina-only assemblies and we obtained one or two long contigs for 65 % of the chromosomes. This high contiguity allowed us to accurately detect large structural variations across the 21 studied genomes. Conclusion: Because of the high completeness of the nanopore assemblies, we were able to produce a complete cartography of transposable elements insertions and inspect structural variants that are generally missed using a short-read sequencing strategy. Our analyses show that the Oxford Nanopore technology is already usable for de novo sequencing and assembly; however, non-random errors in homopolymers require polishing the consensus using an alternate sequencing technology. PMID:28369459

  11. de novo assembly and population genomic survey of natural yeast isolates with the Oxford Nanopore MinION sequencer.

    PubMed

    Istace, Benjamin; Friedrich, Anne; d'Agata, Léo; Faye, Sébastien; Payen, Emilie; Beluche, Odette; Caradec, Claudia; Davidas, Sabrina; Cruaud, Corinne; Liti, Gianni; Lemainque, Arnaud; Engelen, Stefan; Wincker, Patrick; Schacherer, Joseph; Aury, Jean-Marc

    2017-02-01

    Oxford Nanopore Technologies Ltd (Oxford, UK) have recently commercialized MinION, a small single-molecule nanopore sequencer, that offers the possibility of sequencing long DNA fragments from small genomes in a matter of seconds. The Oxford Nanopore technology is truly disruptive; it has the potential to revolutionize genomic applications due to its portability, low cost, and ease of use compared with existing long reads sequencing technologies. The MinION sequencer enables the rapid sequencing of small eukaryotic genomes, such as the yeast genome. Combined with existing assembler algorithms, near complete genome assemblies can be generated and comprehensive population genomic analyses can be performed. Here, we resequenced the genome of the Saccharomyces cerevisiae S288C strain to evaluate the performance of nanopore-only assemblers. Then we de novo sequenced and assembled the genomes of 21 isolates representative of the S. cerevisiae genetic diversity using the MinION platform. The contiguity of our assemblies was 14 times higher than the Illumina-only assemblies and we obtained one or two long contigs for 65 % of the chromosomes. This high contiguity allowed us to accurately detect large structural variations across the 21 studied genomes. Because of the high completeness of the nanopore assemblies, we were able to produce a complete cartography of transposable elements insertions and inspect structural variants that are generally missed using a short-read sequencing strategy. Our analyses show that the Oxford Nanopore technology is already usable for de novo sequencing and assembly; however, non-random errors in homopolymers require polishing the consensus using an alternate sequencing technology. © The Author 2017. Published by Oxford University Press.

  12. Genome Sequence of the Lager-Brewing Yeast Saccharomyces sp. Strain M14, Used in the High-Gravity Brewing Industry in China.

    PubMed

    Liu, Chunfeng; Li, Qi; Niu, Chengtuo; Zheng, Feiyun; Li, Yongxian; Zhao, Yun; Yin, Xiangsheng

    2017-10-26

    Lager-brewing yeasts are mainly used for the production of lager beers. Illumina and PacBio-based sequence analyses revealed an approximate genome size of 22.8 Mb, with a GC content of 38.98%, for the Chinese lager-brewing yeast Saccharomyces sp. strain M14. Based on ab initio prediction, 9,970 coding genes were annotated. Copyright © 2017 Liu et al.

  13. Genome Sequence of the Lager-Brewing Yeast Saccharomyces sp. Strain M14, Used in the High-Gravity Brewing Industry in China

    PubMed Central

    Liu, Chunfeng; Niu, Chengtuo; Zheng, Feiyun; Li, Yongxian; Zhao, Yun; Yin, Xiangsheng

    2017-01-01

    ABSTRACT Lager-brewing yeasts are mainly used for the production of lager beers. Illumina and PacBio-based sequence analyses revealed an approximate genome size of 22.8 Mb, with a GC content of 38.98%, for the Chinese lager-brewing yeast Saccharomyces sp. strain M14. Based on ab initio prediction, 9,970 coding genes were annotated. PMID:29074666

  14. Global investigation of protein-protein interactions in yeast Saccharomyces cerevisiae using re-occurring short polypeptide sequences.

    PubMed

    Pitre, S; North, C; Alamgir, M; Jessulat, M; Chan, A; Luo, X; Green, J R; Dumontier, M; Dehne, F; Golshani, A

    2008-08-01

    Protein-protein interaction (PPI) maps provide insight into cellular biology and have received considerable attention in the post-genomic era. While large-scale experimental approaches have generated large collections of experimentally determined PPIs, technical limitations preclude certain PPIs from detection. Recently, we demonstrated that yeast PPIs can be computationally predicted using re-occurring short polypeptide sequences between known interacting protein pairs. However, the computational requirements and low specificity made this method unsuitable for large-scale investigations. Here, we report an improved approach, which exhibits a specificity of approximately 99.95% and executes 16,000 times faster. Importantly, we report the first all-to-all sequence-based computational screen of PPIs in yeast, Saccharomyces cerevisiae in which we identify 29,589 high confidence interactions of approximately 2 x 10(7) possible pairs. Of these, 14,438 PPIs have not been previously reported and may represent novel interactions. In particular, these results reveal a richer set of membrane protein interactions, not readily amenable to experimental investigations. From the novel PPIs, a novel putative protein complex comprised largely of membrane proteins was revealed. In addition, two novel gene functions were predicted and experimentally confirmed to affect the efficiency of non-homologous end-joining, providing further support for the usefulness of the identified PPIs in biological investigations.

  15. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    PubMed

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  16. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands.

  17. Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

    PubMed Central

    Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

    2000-01-01

    Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

  18. Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

    PubMed Central

    Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

    2017-01-01

    Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

  19. Complete genome sequence and comparative genomics of the probiotic yeast Saccharomyces boulardii.

    PubMed

    Khatri, Indu; Tomar, Rajul; Ganesan, K; Prasad, G S; Subramanian, Srikrishna

    2017-03-23

    The probiotic yeast, Saccharomyces boulardii (Sb) is known to be effective against many gastrointestinal disorders and antibiotic-associated diarrhea. To understand molecular basis of probiotic-properties ascribed to Sb we determined the complete genomes of two strains of Sb i.e. Biocodex and unique28 and the draft genomes for three other Sb strains that are marketed as probiotics in India. We compared these genomes with 145 strains of S. cerevisiae (Sc) to understand genome-level similarities and differences between these yeasts. A distinctive feature of Sb from other Sc is absence of Ty elements Ty1, Ty3, Ty4 and associated LTR. However, we could identify complete Ty2 and Ty5 elements in Sb. The genes for hexose transporters HXT11 and HXT9, and asparagine-utilization are absent in all Sb strains. We find differences in repeat periods and copy numbers of repeats in flocculin genes that are likely related to the differential adhesion of Sb as compared to Sc. Core-proteome based taxonomy places Sb strains along with wine strains of Sc. We find the introgression of five genes from Z. bailii into the chromosome IV of Sb and wine strains of Sc. Intriguingly, genes involved in conferring known probiotic properties to Sb are conserved in most Sc strains.

  20. Assessing fluctuating evolutionary pressure in yeast and mammal evolutionary rate covariation using bioinformatics of meiotic protein genetic sequences

    NASA Astrophysics Data System (ADS)

    Dehipawala, Sunil; Nguyen, A.; Tremberger, G.; Cheung, E.; Holden, T.; Lieberman, D.; Cheung, T.

    2013-09-01

    The evolutionary rate co-variation in meiotic proteins has been reported for yeast and mammal using phylogenic branch lengths which assess retention, duplication and mutation. The bioinformatics of the corresponding DNA sequences could be classified as a diagram of fractal dimension and Shannon entropy. Results from biomedical gene research provide examples on the diagram methodology. The identification of adaptive selection using entropy marker and functional-structural diversity using fractal dimension would support a regression analysis where the coefficient of determination would serve as evolutionary pathway marker for DNA sequences and be an important component in the astrobiology community. Comparisons between biomedical genes such as EEF2 (elongation factor 2 human, mouse, etc), WDR85 in epigenetics, HAR1 in human specificity, clinical trial targeted cancer gene CD47, SIRT6 in spermatogenesis, and HLA-C in mosquito bite immunology demonstrate the diagram classification methodology. Comparisons to the SEPT4-XIAP pair in stem cell apoptosis, testesexpressed taste genes TAS1R3-GNAT3 pair, and amyloid beta APLP1-APLP2 pair with the yeast-mammal DNA sequences for meiotic proteins RAD50-MRE11 pair and NCAPD2-ICK pair have accounted for the observed fluctuating evolutionary pressure systematically. Regression with high R-sq values or a triangular-like cluster pattern for concordant pairs in co-variation among the studied species could serve as evidences for the possible location of common ancestors in the entropy-fractal dimension diagram, consistent with an example of the human-chimp common ancestor study using the FOXP2 regulated genes reported in human fetal brain study. The Deinococcus radiodurans R1 Rad-A could be viewed as an outlier in the RAD50 diagram and also in the free energy versus fractal dimension regression Cook's distance, consistent with a non-Earth source for this radiation resistant bacterium. Convergent and divergent fluctuating evolutionary

  1. Expressed Sequence Tag Analysis of the Human Pathogen Paracoccidioides brasiliensis Yeast Phase: Identification of Putative Homologues of Candida albicans Virulence and Pathogenicity Genes

    PubMed Central

    Goldman, Gustavo H.; dos Reis Marques, Everaldo; Custódio Duarte Ribeiro, Diógenes; Ângelo de Souza Bernardes, Luciano; Quiapin, Andréa Carla; Vitorelli, Patrícia Marostica; Savoldi, Marcela; Semighini, Camile P.; de Oliveira, Regina C.; Nunes, Luiz R.; Travassos, Luiz R.; Puccia, Rosana; Batista, Wagner L.; Ferreira, Leslie Ecker; Moreira, Júlio C.; Bogossian, Ana Paula; Tekaia, Fredj; Nobrega, Marina Pasetto; Nobrega, Francisco G.; Goldman, Maria Helena S.

    2003-01-01

    Paracoccidioides brasiliensis, a thermodimorphic fungus, is the causative agent of the prevalent systemic mycosis in Latin America, paracoccidioidomycosis. We present here a survey of expressed genes in the yeast pathogenic phase of P. brasiliensis. We obtained 13,490 expressed sequence tags from both 5′ and 3′ ends. Clustering analysis yielded the partial sequences of 4,692 expressed genes that were functionally classified by similarity to known genes. We have identified several Candida albicans virulence and pathogenicity homologues in P. brasiliensis. Furthermore, we have analyzed the expression of some of these genes during the dimorphic yeast-mycelium-yeast transition by real-time quantitative reverse transcription-PCR. Clustering analysis of the mycelium-yeast transition revealed three groups: (i) RBT, hydrophobin, and isocitrate lyase; (ii) malate dehydrogenase, contigs Pb1067 and Pb1145, GPI, and alternative oxidase; and (iii) ubiquitin, delta-9-desaturase, HSP70, HSP82, and HSP104. The first two groups displayed high mRNA expression in the mycelial phase, whereas the third group showed higher mRNA expression in the yeast phase. Our results suggest the possible conservation of pathogenicity and virulence mechanisms among fungi, expand considerably gene identification in P. brasiliensis, and provide a broader basis for further progress in understanding its biological peculiarities. PMID:12582121

  2. High-throughput analysis of the protein sequence-stability landscape using a quantitative "yeast surface two-hybrid" system and fragment reconstitution

    PubMed Central

    Dutta, Sanjib; Koide, Akiko; Koide, Shohei

    2008-01-01

    Stability evaluation of many mutants can lead to a better understanding of the sequence determinants of a structural motif and of factors governing protein stability and protein evolution. The traditional biophysical analysis of protein stability is low throughput, limiting our ability to widely explore the sequence space in a quantitative manner. In this study, we have developed a high-throughput library screening method for quantifying stability changes, which is based on protein fragment reconstitution and yeast surface display. Our method exploits the thermodynamic linkage between protein stability and fragment reconstitution and the ability of the yeast surface display technique to quantitatively evaluate protein-protein interactions. The method was applied to a fibronectin type III (FN3) domain. Characterization of fragment reconstitution was facilitated by the co-expression of two FN3 fragments, thus establishing a "yeast surface two-hybrid" method. Importantly, our method does not rely on competition between clones and thus eliminates a common limitation of high-throughput selection methods in which the most stable variants are predominantly recovered. Thus, it allows for the isolation of sequences that exhibits a desired level of stability. We identified over one hundred unique sequences for a β-bulge motif, which was significantly more informative than natural sequences of the FN3 family in revealing the sequence determinants for the β-bulge. Our method provides a powerful means to rapidly assess stability of many variants, to systematically assess contribution of different factors to protein stability and to enhance protein stability. PMID:18674545

  3. Natural sequence variants of yeast environmental sensors confer cell-to-cell expression variability

    PubMed Central

    Fehrmann, Steffen; Bottin-Duplus, Hélène; Leonidou, Andri; Mollereau, Esther; Barthelaix, Audrey; Wei, Wu; Steinmetz, Lars M; Yvert, Gaël

    2013-01-01

    Living systems may have evolved probabilistic bet hedging strategies that generate cell-to-cell phenotypic diversity in anticipation of environmental catastrophes, as opposed to adaptation via a deterministic response to environmental changes. Evolution of bet hedging assumes that genotypes segregating in natural populations modulate the level of intraclonal diversity, which so far has largely remained hypothetical. Using a fluorescent Pmet17-GFP reporter, we mapped four genetic loci conferring to a wild yeast strain an elevated cell-to-cell variability in the expression of MET17, a gene regulated by the methionine pathway. A frameshift mutation in the Erc1p transmembrane transporter, probably resulting from a release of laboratory strains from negative selection, reduced Pmet17-GFP expression variability. At a second locus, cis-regulatory polymorphisms increased mean expression of the Mup1p methionine permease, causing increased expression variability in trans. These results demonstrate that an expression quantitative trait locus (eQTL) can simultaneously have a deterministic effect in cis and a probabilistic effect in trans. Our observations indicate that the evolution of transmembrane transporter genes can tune intraclonal variation and may therefore be implicated in both reactive and anticipatory strategies of adaptation. PMID:24104478

  4. The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo.

    PubMed

    Ribeyre, Cyril; Lopes, Judith; Boulé, Jean-Baptiste; Piazza, Aurèle; Guédin, Aurore; Zakian, Virginia A; Mergny, Jean-Louis; Nicolas, Alain

    2009-05-01

    In budding yeast, the Pif1 DNA helicase is involved in the maintenance of both nuclear and mitochondrial genomes, but its role in these processes is still poorly understood. Here, we provide evidence for a new Pif1 function by demonstrating that its absence promotes genetic instability of alleles of the G-rich human minisatellite CEB1 inserted in the Saccharomyces cerevisiae genome, but not of other tandem repeats. Inactivation of other DNA helicases, including Sgs1, had no effect on CEB1 stability. In vitro, we show that CEB1 repeats formed stable G-quadruplex (G4) secondary structures and the Pif1 protein unwinds these structures more efficiently than regular B-DNA. Finally, synthetic CEB1 arrays in which we mutated the potential G4-forming sequences were no longer destabilized in pif1Delta cells. Hence, we conclude that CEB1 instability in pif1Delta cells depends on the potential to form G-quadruplex structures, suggesting that Pif1 could play a role in the metabolism of G4-forming sequences.

  5. Discovery of high affinity anti-ricin antibodies by B cell receptor sequencing and by yeast display of combinatorial VH:VL libraries from immunized animals.

    PubMed

    Wang, Bo; Lee, Chang-Han; Johnson, Erik L; Kluwe, Christien A; Cunningham, Josephine C; Tanno, Hidetaka; Crooks, Richard M; Georgiou, George; Ellington, Andrew D

    2016-01-01

    Ricin is a toxin that could potentially be used as a bioweapon. We identified anti-ricin A chain antibodies by sequencing the antibody repertoire from immunized mice and by selecting high affinity antibodies using yeast surface display. These methods led to the isolation of multiple antibodies with high (sub-nanomolar) affinity. Interestingly, the antibodies identified by the 2 independent approaches are from the same clonal lineages, indicating for the first time that yeast surface display can identify native antibodies. The new antibodies represent well-characterized reagents for biodefense diagnostics and therapeutics development.

  6. Sequence and Analysis of the Genome of the Pathogenic Yeast Candida orthopsilosis

    PubMed Central

    Riccombeni, Alessandro; Vidanes, Genevieve; Proux-Wéra, Estelle; Wolfe, Kenneth H.; Butler, Geraldine

    2012-01-01

    Candida orthopsilosis is closely related to the fungal pathogen Candida parapsilosis. However, whereas C. parapsilosis is a major cause of disease in immunosuppressed individuals and in premature neonates, C. orthopsilosis is more rarely associated with infection. We sequenced the C. orthopsilosis genome to facilitate the identification of genes associated with virulence. Here, we report the de novo assembly and annotation of the genome of a Type 2 isolate of C. orthopsilosis. The sequence was obtained by combining data from next generation sequencing (454 Life Sciences and Illumina) with paired-end Sanger reads from a fosmid library. The final assembly contains 12.6 Mb on 8 chromosomes. The genome was annotated using an automated pipeline based on comparative analysis of genomes of Candida species, together with manual identification of introns. We identified 5700 protein-coding genes in C. orthopsilosis, of which 5570 have an ortholog in C. parapsilosis. The time of divergence between C. orthopsilosis and C. parapsilosis is estimated to be twice as great as that between Candida albicans and Candida dubliniensis. There has been an expansion of the Hyr/Iff family of cell wall genes and the JEN family of monocarboxylic transporters in C. parapsilosis relative to C. orthopsilosis. We identified one gene from a Maltose/Galactoside O-acetyltransferase family that originated by horizontal gene transfer from a bacterium to the common ancestor of C. orthopsilosis and C. parapsilosis. We report that TFB3, a component of the general transcription factor TFIIH, undergoes alternative splicing by intron retention in multiple Candida species. We also show that an intein in the vacuolar ATPase gene VMA1 is present in C. orthopsilosis but not C. parapsilosis, and has a patchy distribution in Candida species. Our results suggest that the difference in virulence between C. parapsilosis and C. orthopsilosis may be associated with expansion of gene families. PMID:22563396

  7. Draft genome sequence of Sugiyamaella xylanicola UFMG-CM-Y1884T, a xylan-degrading yeast species isolated from rotting wood samples in Brazil.

    PubMed

    Batista, Thiago M; Moreira, Rennan G; Hilário, Heron O; Morais, Camila G; Franco, Glória R; Rosa, Luiz H; Rosa, Carlos A

    2017-03-01

    We present the draft genome sequence of the type strain of the yeast Sugiyamaella xylanicola UFMG-CM-Y1884 T (= UFMG-CA-32.1 T  = CBS 12683 T ), a xylan-degrading species capable of fermenting d-xylose to ethanol. The assembled genome has a size of ~ 13.7 Mb and a GC content of 33.8% and contains 5971 protein-coding genes. We identified 15 genes with significant similarity to the d-xylose reductase gene from several other fungal species. The draft genome assembled from whole-genome shotgun sequencing of the yeast Sugiyamaella xylanicola UFMG-CM-Y1884 T (= UFMG-CA-32.1 T  = CBS 12683 T ) has been deposited at DDBJ/ENA/GenBank under the accession number MQSX00000000 under version MQSX01000000.

  8. The new modern era of yeast genomics: community sequencing and the resulting annotation of multiple Saccharomyces cerevisiae strains at the Saccharomyces Genome Database

    PubMed Central

    Engel, Stacia R.; Cherry, J. Michael

    2013-01-01

    The first completed eukaryotic genome sequence was that of the yeast Saccharomyces cerevisiae, and the Saccharomyces Genome Database (SGD; http://www.yeastgenome.org/) is the original model organism database. SGD remains the authoritative community resource for the S. cerevisiae reference genome sequence and its annotation, and continues to provide comprehensive biological information correlated with S. cerevisiae genes and their products. A diverse set of yeast strains have been sequenced to explore commercial and laboratory applications, and a brief history of those strains is provided. The publication of these new genomes has motivated the creation of new tools, and SGD will annotate and provide comparative analyses of these sequences, correlating changes with variations in strain phenotypes and protein function. We are entering a new era at SGD, as we incorporate these new sequences and make them accessible to the scientific community, all in an effort to continue in our mission of educating researchers and facilitating discovery. Database URL: http://www.yeastgenome.org/ PMID:23487186

  9. LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

    PubMed Central

    Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

    1994-01-01

    We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. In this database each sequence has been attributed a single genetic name. In the case of duplicated sequences a simple method has been applied to distinguish between sequences of one and the same gene from non-allelic sequences of duplicated genes. If necessary, synonyms are given in the case of allelic duplicated sequences. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, Swissprot and EMBL accession numbers. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). PMID:7937046

  10. The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

    PubMed

    Xiao, W; Rank, G H

    1989-03-15

    The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

  11. LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

    PubMed Central

    Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

    1996-01-01

    We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. As in previous editions the genetic names are consistently associated to each sequence with a known and confirmed ORF. If necessary, synonyms are given in the case of allelic duplicated sequences. Although the first publication of a sequence gives-according to our rules-the genetic name of a gene, in some instances more commonly used names are given to avoid nomenclature problems and the use of ancient designations which are no longer used. In these cases the old designation is given as synonym. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, SWISSPROT and EMBL accession numbers. New entries will also contain the name from the systematic sequencing efforts. Since the release of LISTA4.1 we update the database continuously. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. This release includes reports from full Smith and Watermann peptide-level searches against a non-redundant protein sequence database. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). The database is available by FTP and on World Wide Web. PMID:8594599

  12. Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast.

    PubMed

    Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A

    2016-06-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3' end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. Copyright © 2016 Larson et al.

  13. Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast

    PubMed Central

    Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A.

    2016-01-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3ʹ end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. PMID:27172183

  14. Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

    PubMed

    Siede, W; Friedberg, E C

    1992-03-01

    In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

  15. Signal sequence-independent targeting of MID2 mRNA to the endoplasmic reticulum by the yeast RNA-binding protein Khd1p.

    PubMed

    Syed, Muhammad Ibrahim; Moorthy, Balaji T; Jenner, Andreas; Fetka, Ingrid; Jansen, Ralf-Peter

    2018-05-17

    Localization of mRNAs depends on specific RNA-binding proteins (RBPs) and critically contributes not only to cell polarization but also to basal cell function. The yeast RBP Khd1p binds to several hundred mRNAs, the majority of which encodes secreted or membrane proteins. We demonstrate that a subfraction of Khd1p associates with artificial liposomes and endoplasmic reticulum (ER), and that Khd1p endomembrane association is partially dependent on its binding to RNA. ER targeting of at least two mRNAs, MID2 and SLG1/WSC1, requires KHD1 but is independent of their translation. Together, our results suggest interdependence of Khd1p and mRNA for their targeting to the ER and presents additional evidence for signal sequence-independent, RBP-mediated mRNA targeting. © 2018 Federation of European Biochemical Societies.

  16. Genomic evolution of the ascomycetous yeasts

    USDA-ARS?s Scientific Manuscript database

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphr...

  17. Regions flanking ori sequences affect the replication efficiency of the mitochondrial genome of ori+ petite mutants from yeast.

    PubMed

    Rayko, E; Goursot, R; Cherif-Zahar, B; Melis, R; Bernardi, G

    1988-03-31

    The mitochondrial genomes of progenies from 26 crosses between 17 cytoplasmic, spontaneous, suppressive, ori+ petite mutants of Saccharomyces cerevisiae have been studied by electrophoresis of restriction fragments. Only parental genomes (or occasionally, genomes derived from them by secondary excisions) were found in the progenies of the almost 500 diploids investigated; no evidence for illegitimate, site-specific mitochondrial recombination was detected. One of the parental genomes was always found to be predominate over the other one, although to different extents in different crosses. This predominance appears to be due to a higher replication efficiency, which is correlated with a greater density of ori sequences on the mitochondrial genome (and with a shorter repeat unit size of the latter). Exceptions to the 'repeat-unit-size rule' were found, however, even when the parental mitochondrial genomes carried the same ori sequence. This indicates that noncoding, intergenic sequences outside ori sequences also play a role in modulating replication efficiency. Since in different petites such sequences differ in primary structure, size, and position relative to ori sequences, this modulation is likely to take place through an indirect effect on DNA and nucleoid structure.

  18. Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae

    SciTech Connect

    Eid, Rawan; Department of Biology, Queen's University, Kingston, Ontario; Boucher, Eric

    Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomycesmore » cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress. - Highlights: • Human ferritin, heavy polypeptide 1 (FTH1) was identified as a suppressor of the pro-apoptotic Bax in yeast. • Based on its similarity to ferritin we examined Rgi1p/YER067W for potential ferritin like functions. • Like human H-ferritin, RGI1 confers increased resistance to apoptotic inducing stresses in

  19. Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae.

    PubMed

    Eid, Rawan; Boucher, Eric; Gharib, Nada; Khoury, Chamel; Arab, Nagla T T; Murray, Alistair; Young, Paul G; Mandato, Craig A; Greenwood, Michael T

    2016-03-01

    Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomyces cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Whole Genome Sequence Analysis of Mutations Accumulated in rad27Δ Yeast Strains with Defects in the Processing of Okazaki Fragments Indicates Template-Switching Events

    PubMed Central

    Omer, Sumita; Lavi, Bar; Mieczkowski, Piotr A.; Covo, Shay; Hazkani-Covo, Einat

    2017-01-01

    Okazaki fragments that are formed during lagging strand DNA synthesis include an initiating primer consisting of both RNA and DNA. The RNA fragment must be removed before the fragments are joined. In Saccharomyces cerevisiae, a key player in this process is the structure-specific flap endonuclease, Rad27p (human homolog FEN1). To obtain a genomic view of the mutational consequence of loss of RAD27, a S. cerevisiae rad27Δ strain was subcultured for 25 generations and sequenced using Illumina paired-end sequencing. Out of the 455 changes observed in 10 colonies isolated the two most common types of events were insertions or deletions (INDELs) in simple sequence repeats (SSRs) and INDELs mediated by short direct repeats. Surprisingly, we also detected a previously neglected class of 21 template-switching events. These events were presumably generated by quasi-palindrome to palindrome correction, as well as palindrome elongation. The formation of these events is best explained by folding back of the stalled nascent strand and resumption of DNA synthesis using the same nascent strand as a template. Evidence of quasi-palindrome to palindrome correction that could be generated by template switching appears also in yeast genome evolution. Out of the 455 events, 55 events appeared in multiple isolates; further analysis indicates that these loci are mutational hotspots. Since Rad27 acts on the lagging strand when the leading strand should not contain any gaps, we propose a mechanism favoring intramolecular strand switching over an intermolecular mechanism. We note that our results open new ways of understanding template switching that occurs during genome instability and evolution. PMID:28974572

  1. Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

    PubMed

    Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

    2013-07-30

    Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

  2. Transition of yeast Can1 transporter to the inward-facing state unveils an α-arrestin target sequence promoting its ubiquitylation and endocytosis.

    PubMed

    Gournas, Christos; Saliba, Elie; Krammer, Eva-Maria; Barthelemy, Céline; Prévost, Martine; André, Bruno

    2017-10-15

    Substrate-transport-elicited endocytosis is a common control mechanism of membrane transporters avoiding excess uptake of external compounds, though poorly understood at the molecular level. In yeast, endocytosis of transporters is triggered by their ubiquitylation mediated by the Rsp5 ubiquitin-ligase, recruited by α-arrestin-family adaptors. We here report that transport-elicited ubiquitylation of the arginine transporter Can1 is promoted by transition to an inward-facing state. This conformational change unveils a region of the N-terminal cytosolic tail targeted by the Art1 α-arrestin, which is activated via the TORC1 kinase complex upon arginine uptake. Can1 mutants altered in the arginine-binding site or a cytosolic tripeptide sequence permanently expose the α-arrestin-targeted region so that Art1 activation via TORC1 is sufficient to trigger their endocytosis. We also provide evidence that substrate-transport elicited endocytosis of other amino acid permeases similarly involves unmasking of a cytosolic Art1-target region coupled to activation of Art1 via TORC1. Our results unravel a mechanism likely involved in regulation of many other transporters by their own substrates. They also support the emerging view that transporter ubiquitylation relies on combinatorial interaction rules such that α-arrestins, stimulated via signaling cascades or in their basal state, recognize transporter regions permanently facing the cytosol or unveiled during transport. © 2017 Gournas et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  3. Evolutionary History of Ascomyceteous Yeasts

    SciTech Connect

    Haridas, Sajeet; Riley, Robert; Salamov, Asaf

    2014-06-06

    Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with amore » large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.« less

  4. Counting Yeast.

    ERIC Educational Resources Information Center

    Bealer, Jonathan; Welton, Briana

    1998-01-01

    Describes changes to a traditional study of population in yeast colonies. Changes to the procedures include: (1) only one culture per student team; (2) cultures are inoculated only once; and (3) the same tube is sampled daily. (DDR)

  5. The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor.

    PubMed Central

    Donald, R G; Schindler, U; Batschauer, A; Cashmore, A R

    1990-01-01

    G box and I box sequences of the Arabidopsis thaliana ribulose-bisphosphate-1,5-carboxylase small subunit (RBCS) promoter are required for expression mediated by the Arabidopsis rbcS-1A promoter in transgenic tobacco plants and are bound in vitro by factors from plant nuclear extracts termed GBF and GA-1, respectively. We show here that a -390 to -60 rbcS-1A promoter fragment containing the G box and two I boxes activates transcription from a truncated iso-1-cytochrome c (CYC1) gene promoter in Saccharomyces cerevisiae. Mutagenesis of either the rbcS-1A G box or both I box sequences eliminated the expression mediated by this fragment. When polymerized, I box oligonucleotides were also capable of enhancing expression from the truncated CYC1 promoter. Single-copy G box sequences from the Arabidopsis rbcS-1A, Arabidopsis Adh and tomato rbcS-3A promoters were more potent activators and were used in mobility shift assays to identify a DNA binding activity in yeast functionally similar to GBF. In methylation interference experiments, the binding specificity of the yeast protein was indistinguishable from that obtained with plant nuclear extracts. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2161333

  6. Atypical yeasts identified as Saccharomyces cerevisiae by MALDI-TOF MS and gene sequencing are the main responsible of fermentation of chicha, a traditional beverage from Peru.

    PubMed

    Vallejo, Juan Andrés; Miranda, Patricia; Flores-Félix, José David; Sánchez-Juanes, Fernando; Ageitos, José M; González-Buitrago, José Manuel; Velázquez, Encarna; Villa, Tomás G

    2013-12-01

    Chicha is a drink prepared in several Andean countries from Inca's times by maize fermentation. Currently this fermentation is carried out in familiar artesanal "chicherías" that make one of the most known types of chicha, the "chicha de jora". In this study we isolate and identify the yeasts mainly responsible of the fermentation process in this type of chicha in 10 traditional "chicherías" in Cusco region in Peru. We applied by first time MALDI-TOF MS analysis for the identification of yeast of non-clinic origin and the results showed that all of yeast strains isolated belong to the species Saccharomyces cerevisiae. These results agree with those obtained after the analysis of the D1/D2 and 5.8S-ITS regions. However the chicha strains have a phenotypic profile that differed in more than 40% as compared to that of current S. cerevisiae strains. To the best of our knowledge this is the first report concerning the yeasts involved in chicha fermentation. Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. Yeast Infection (Vaginal)

    MedlinePlus

    Yeast infection (vaginal) Overview A vaginal yeast infection is a fungal infection that causes irritation, discharge and intense itchiness ... symptoms Causes The fungus candida causes a vaginal yeast infection. Your vagina naturally contains a balanced mix of yeast, including ...

  8. Yeast Droplets

    NASA Astrophysics Data System (ADS)

    Nguyen, Baochi; Upadhyaya, Arpita; van Oudenaarden, Alexander; Brenner, Michael

    2002-11-01

    It is well known that the Young's law and surface tension govern the shape of liquid droplets on solid surfaces. Here we address through experiments and theory the shape of growing aggregates of yeast on agar substrates, and assess whether these ideas still hold. Experiments are carried out on Baker's yeast, with different levels of expressions of an adhesive protein governing cell-cell and cell-substrate adhesion. Changing either the agar concentration or the expression of this protein modifies the local contact angle of a yeast droplet. When the colony is small, the shape is a spherical cap with the contact angle obeying Young's law. However, above a critical volume this structure is unstable, and the droplet becomes nonspherical. We present a theoretical model where this instability is caused by bulk elastic effects. The model predicts that the transition depends on both volume and contact angle, in a manner quantitatively consistent with our experiments.

  9. The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

    PubMed Central

    White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

    1991-01-01

    By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

  10. Lager Yeast Comes of Age

    PubMed Central

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  11. Comparative genomics of biotechnologically important yeasts

    USDA-ARS?s Scientific Manuscript database

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the...

  12. G-rich telomeric and ribosomal DNA sequences from the fission yeast genome form stable G-quadruplex DNA structures in vitro and are unwound by the Pfh1 DNA helicase

    PubMed Central

    Wallgren, Marcus; Mohammad, Jani B.; Yan, Kok-Phen; Pourbozorgi-Langroudi, Parham; Ebrahimi, Mahsa; Sabouri, Nasim

    2016-01-01

    Certain guanine-rich sequences have an inherent propensity to form G-quadruplex (G4) structures. G4 structures are e.g. involved in telomere protection and gene regulation. However, they also constitute obstacles during replication if they remain unresolved. To overcome these threats to genome integrity, organisms harbor specialized G4 unwinding helicases. In Schizosaccharomyces pombe, one such candidate helicase is Pfh1, an evolutionarily conserved Pif1 homolog. Here, we addressed whether putative G4 sequences in S. pombe can adopt G4 structures and, if so, whether Pfh1 can resolve them. We tested two G4 sequences, derived from S. pombe ribosomal and telomeric DNA regions, and demonstrated that they form inter- and intramolecular G4 structures, respectively. Also, Pfh1 was enriched in vivo at the ribosomal G4 DNA and telomeric sites. The nuclear isoform of Pfh1 (nPfh1) unwound both types of structure, and although the G4-stabilizing compound Phen-DC3 significantly enhanced their stability, nPfh1 still resolved them efficiently. However, stable G4 structures significantly inhibited adenosine triphosphate hydrolysis by nPfh1. Because ribosomal and telomeric DNA contain putative G4 regions conserved from yeasts to humans, our studies support the important role of G4 structure formation in these regions and provide further evidence for a conserved role for Pif1 helicases in resolving G4 structures. PMID:27185885

  13. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    NASA Astrophysics Data System (ADS)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  14. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    PubMed

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  15. Yeast Genetics and Biotechnological Applications

    NASA Astrophysics Data System (ADS)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  16. Phylogenetics of Saccharomycetales, the ascomycete yeasts.

    PubMed

    Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André

    2006-01-01

    Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available.

  17. The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

    PubMed Central

    Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

    1981-01-01

    We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

  18. The wine and beer yeast Dekkera bruxellensis

    PubMed Central

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd. PMID:24932634

  19. The wine and beer yeast Dekkera bruxellensis.

    PubMed

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd.

  20. The Budding Yeast Nucleus

    PubMed Central

    Taddei, Angela; Schober, Heiko; Gasser, Susan M.

    2010-01-01

    The budding yeast nucleus, like those of other eukaryotic species, is highly organized with respect to both chromosomal sequences and enzymatic activities. At the nuclear periphery interactions of nuclear pores with chromatin, mRNA, and transport factors promote efficient gene expression, whereas centromeres, telomeres, and silent chromatin are clustered and anchored away from pores. Internal nuclear organization appears to be function-dependent, reflecting localized sites for tRNA transcription, rDNA transcription, ribosome assembly, and DNA repair. Recent advances have identified new proteins involved in the positioning of chromatin and have allowed testing of the functional role of higher-order chromatin organization. The unequal distribution of silent information regulatory factors and histone modifying enzymes, which arises in part from the juxtaposition of telomeric repeats, has been shown to influence chromatin-mediated transcriptional repression. Other localization events suppress unwanted recombination. These findings highlight the contribution budding yeast genetics and cytology have made to dissecting the functional role of nuclear structure. PMID:20554704

  1. Whole genome sequencing analysis of the cutaneous pathogenic yeast Malassezia restricta and identification of the major lipase expressed on the scalp of patients with dandruff.

    PubMed

    Park, Minji; Cho, Yong-Joon; Lee, Yang Won; Jung, Won Hee

    2017-03-01

    Malassezia species are opportunistic pathogenic fungi that are frequently associated with seborrhoeic dermatitis, including dandruff. Most Malassezia species are lipid dependent, a property that is compensated by breaking down host sebum into fatty acids by lipases. In this study, we aimed to sequence and analyse the whole genome of Malassezia restricta KCTC 27527, a clinical isolate from a Korean patient with severe dandruff, to search for lipase orthologues and identify the lipase that is the most frequently expressed on the scalp of patients with dandruff. The genome of M. restricta KCTC 27527 was sequenced using the Illumina MiSeq and PacBio platforms. Lipase orthologues were identified by comparison with known lipase genes in the genomes of Malassezia globosa and Malassezia sympodialis. The expression of the identified lipase genes was directly evaluated in swab samples from the scalps of 56 patients with dandruff. We found that, among the identified lipase-encoding genes, the gene encoding lipase homolog MRES_03670, named LIP5 in this study, was the most frequently expressed lipase in the swab samples. Our study provides an overview of the genome of a clinical isolate of M. restricta and fundamental information for elucidating the role of lipases during fungus-host interaction. © 2016 Blackwell Verlag GmbH.

  2. Between science and industry-applied yeast research.

    PubMed

    Korhola, Matti

    2018-03-01

    I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.

  3. Yeast Based Sensors

    NASA Astrophysics Data System (ADS)

    Shimomura-Shimizu, Mifumi; Karube, Isao

    Since the first microbial cell sensor was studied by Karube et al. in 1977, many types of yeast based sensors have been developed as analytical tools. Yeasts are known as facultative anaerobes. Facultative anaerobes can survive in both aerobic and anaerobic conditions. The yeast based sensor consisted of a DO electrode and an immobilized omnivorous yeast. In yeast based sensor development, many kinds of yeast have been employed by applying their characteristics to adapt to the analyte. For example, Trichosporon cutaneum was used to estimate organic pollution in industrial wastewater. Yeast based sensors are suitable for online control of biochemical processes and for environmental monitoring. In this review, principles and applications of yeast based sensors are summarized.

  4. Vaginal yeast infection

    MedlinePlus

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

  5. Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.

    PubMed

    Niki, Hironori

    2014-03-01

    The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.

  6. Genomic Evolution of the Ascomycete Yeasts

    SciTech Connect

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and amore » tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.« less

  7. Yeast for virus research

    PubMed Central

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  8. Multiplication of Legionella pneumophila Sequence Types 1, 47, and 62 in Buffered Yeast Extract Broth and Biofilms Exposed to Flowing Tap Water at Temperatures of 38°C to 42°C

    PubMed Central

    van der Kooij, Dick; Brouwer-Hanzens, Anke J.; Veenendaal, Harm R.

    2016-01-01

    ABSTRACT Legionella pneumophila proliferates in freshwater environments at temperatures ranging from 25 to 45°C. To investigate the preference of different sequence types (ST) for a specific temperature range, growth of L. pneumophila serogroup 1 (SG1) ST1 (environmental strains), ST47, and ST62 (disease-associated strains) was measured in buffered yeast extract broth (BYEB) and biofilms grown on plasticized polyvinyl chloride in flowing heated drinking water originating from a groundwater supply. The optimum growth temperatures in BYEB were approximately 37°C (ST1), 39°C (ST47), and 41°C (ST62), with maximum growth temperatures of 42°C (ST1) and 43°C (ST47 and ST62). In the biofilm at 38°C, the ST47 and ST62 strains multiplied equally well compared to growth of the environmental ST1 strain and an indigenous L. pneumophila non-SG1 strain, all attaining a concentration of approximately 107 CFU/cm−2. Raising the temperature to 41°C did not impact these levels within 4 weeks, but the colony counts of all strains tested declined (at a specific decline rate of 0.14 to 0.41 day−1) when the temperature was raised to 42°C. At this temperature, the concentration of Vermamoeba vermiformis in the biofilm, determined with quantitative PCR (qPCR), was about 2 log units lower than the concentration at 38°C. In columns operated at a constant temperature, ranging from 38 to 41°C, none of the tested strains multiplied in the biofilm at 41°C, in which also V. vermiformis was not detected. These observations suggest that strains of ST47 and ST62 did not multiply in the biofilm at a temperature of ≥41°C because of the absence of a thermotolerant host. IMPORTANCE Growth of Legionella pneumophila in tap water installations is a serious public health concern. The organism includes more than 2,100 varieties (sequence types). More than 50% of the reported cases of Legionnaires' disease are caused by a few sequence types which are very rarely detected in the environment

  9. The secretory pathway: exploring yeast diversity.

    PubMed

    Delic, Marizela; Valli, Minoska; Graf, Alexandra B; Pfeffer, Martin; Mattanovich, Diethard; Gasser, Brigitte

    2013-11-01

    Protein secretion is an essential process for living organisms. In eukaryotes, this encompasses numerous steps mediated by several hundred cellular proteins. The core functions of translocation through the endoplasmic reticulum membrane, primary glycosylation, folding and quality control, and vesicle-mediated secretion are similar from yeasts to higher eukaryotes. However, recent research has revealed significant functional differences between yeasts and mammalian cells, and even among diverse yeast species. This review provides a current overview of the canonical protein secretion pathway in the model yeast Saccharomyces cerevisiae, highlighting differences to mammalian cells as well as currently unresolved questions, and provides a genomic comparison of the S. cerevisiae pathway to seven other yeast species where secretion has been investigated due to their attraction as protein production platforms, or for their relevance as pathogens. The analysis of Candida albicans, Candida glabrata, Kluyveromyces lactis, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, and Schizosaccharomyces pombe reveals that many - but not all - secretion steps are more redundant in S. cerevisiae due to duplicated genes, while some processes are even absent in this model yeast. Recent research obviates that even where homologous genes are present, small differences in protein sequence and/or differences in the regulation of gene expression may lead to quite different protein secretion phenotypes. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. History of genome editing in yeast.

    PubMed

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  11. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

  12. Prions in Yeast

    PubMed Central

    Liebman, Susan W.; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in understanding cellular control of prion propagation, prion structure, mechanisms of de novo prion formation, specificity of prion transmission, and the biological roles of prions. This review summarizes what has been learned from yeast prions. PMID:22879407

  13. The ecology of the Drosophila-yeast mutualism in wineries

    PubMed Central

    2018-01-01

    The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila. PMID:29768432

  14. The ecology of the Drosophila-yeast mutualism in wineries.

    PubMed

    Quan, Allison S; Eisen, Michael B

    2018-01-01

    The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila.

  15. Recombinant yeast with improved ethanol tolerance and related methods of use

    DOEpatents

    Gasch, Audrey P [Madison, WI; Lewis, Jeffrey A [Madison, WI

    2012-05-15

    The present invention provides isolated Elo1 and Mig3 nucleic acid sequences capable of conferring increased ethanol tolerance on recombinant yeast and methods of using same in biofuel production, particularly ethanol production. Methods of bioengineering yeast using the Elo1 and, or, Mig3 nucleic acid sequences are also provided.

  16. Yeast Infection Test

    MedlinePlus

    ... infections of the skin and genitals. Serious yeast infections occur more often in hospital patients and in people with weakened immune systems. References Centers for Disease Control and Prevention [Internet]. Atlanta: U.S. Department of Health ...

  17. Vaginal Yeast Infections

    MedlinePlus

    ... for sure if yogurt with Lactobacillus or other probiotics can prevent or treat vaginal yeast infections. If ... Chen, H., et al. (2013). Impact of eating probiotic yogurt on colonization by Candida species of the ...

  18. Nitrile Metabolizing Yeasts

    NASA Astrophysics Data System (ADS)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  19. Forces in yeast flocculation

    NASA Astrophysics Data System (ADS)

    El-Kirat-Chatel, Sofiane; Beaussart, Audrey; Vincent, Stéphane P.; Abellán Flos, Marta; Hols, Pascal; Lipke, Peter N.; Dufrêne, Yves F.

    2015-01-01

    In the baker's yeast Saccharomyces cerevisiae, cell-cell adhesion (``flocculation'') is conferred by a family of lectin-like proteins known as the flocculin (Flo) proteins. Knowledge of the adhesive and mechanical properties of flocculins is important for understanding the mechanisms of yeast adhesion, and may help controlling yeast behaviour in biotechnology. We use single-molecule and single-cell atomic force microscopy (AFM) to explore the nanoscale forces engaged in yeast flocculation, focusing on the role of Flo1 as a prototype of flocculins. Using AFM tips labelled with mannose, we detect single flocculins on Flo1-expressing cells, showing they are widely exposed on the cell surface. When subjected to force, individual Flo1 proteins display two distinct force responses, i.e. weak lectin binding forces and strong unfolding forces reflecting the force-induced extension of hydrophobic tandem repeats. We demonstrate that cell-cell adhesion bonds also involve multiple weak lectin interactions together with strong unfolding forces, both associated with Flo1 molecules. Single-molecule and single-cell data correlate with microscale cell adhesion behaviour, suggesting strongly that Flo1 mechanics is critical for yeast flocculation. These results favour a model in which not only weak lectin-sugar interactions are involved in yeast flocculation but also strong hydrophobic interactions resulting from protein unfolding.

  20. The yeast actin cytoskeleton.

    PubMed

    Mishra, Mithilesh; Huang, Junqi; Balasubramanian, Mohan K

    2014-03-01

    The actin cytoskeleton is a complex network of dynamic polymers, which plays an important role in various fundamental cellular processes, including maintenance of cell shape, polarity, cell division, cell migration, endocytosis, vesicular trafficking, and mechanosensation. Precise spatiotemporal assembly and disassembly of actin structures is regulated by the coordinated activity of about 100 highly conserved accessory proteins, which nucleate, elongate, cross-link, and sever actin filaments. Both in vivo studies in a wide range of organisms from yeast to metazoans and in vitro studies of purified proteins have helped shape the current understanding of actin dynamics and function. Molecular genetics, genome-wide functional analysis, sophisticated real-time imaging, and ultrastructural studies in concert with biochemical analysis have made yeast an attractive model to understand the actin cytoskeleton, its molecular dynamics, and physiological function. Studies of the yeast actin cytoskeleton have contributed substantially in defining the universal mechanism regulating actin assembly and disassembly in eukaryotes. Here, we review some of the important insights generated by the study of actin cytoskeleton in two important yeast models the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  1. Evolutionary biology through the lens of budding yeast comparative genomics.

    PubMed

    Marsit, Souhir; Leducq, Jean-Baptiste; Durand, Éléonore; Marchant, Axelle; Filteau, Marie; Landry, Christian R

    2017-10-01

    The budding yeast Saccharomyces cerevisiae is a highly advanced model system for studying genetics, cell biology and systems biology. Over the past decade, the application of high-throughput sequencing technologies to this species has contributed to this yeast also becoming an important model for evolutionary genomics. Indeed, comparative genomic analyses of laboratory, wild and domesticated yeast populations are providing unprecedented detail about many of the processes that govern evolution, including long-term processes, such as reproductive isolation and speciation, and short-term processes, such as adaptation to natural and domestication-related environments.

  2. Specialist nectar-yeasts decline with urbanization in Berlin

    NASA Astrophysics Data System (ADS)

    Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik

    2017-03-01

    Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior.

  3. Designed Electroresponsive Biomaterials: Sequence-Controlled Behavior

    DTIC Science & Technology

    2010-06-29

    protein of the M13 . Traditional phage and yeast display methodologies indicate that peptide sequences with high affinities for electrode materials...drug delivery. The original vision for this work was to employ combinatorial tools such as phage and yeast display under electrical selection pressure...and drug delivery. The original vision for this work was to employ combinatorial tools such as phage and yeast display under electrical selection

  4. Yeast killer systems.

    PubMed Central

    Magliani, W; Conti, S; Gerloni, M; Bertolotti, D; Polonelli, L

    1997-01-01

    The killer phenomenon in yeasts has been revealed to be a multicentric model for molecular biologists, virologists, phytopathologists, epidemiologists, industrial and medical microbiologists, mycologists, and pharmacologists. The surprisingly widespread occurrence of the killer phenomenon among taxonomically unrelated microorganisms, including prokaryotic and eukaryotic pathogens, has engendered a new interest in its biological significance as well as its theoretical and practical applications. The search for therapeutic opportunities by using yeast killer systems has conceptually opened new avenues for the prevention and control of life-threatening fungal diseases through the idiotypic network that is apparently exploited by the immune system in the course of natural infections. In this review, the biology, ecology, epidemiology, therapeutics, serology, and idiotypy of yeast killer systems are discussed. PMID:9227858

  5. Yeast species associated with wine grapes in China.

    PubMed

    Li, Shuang-Shi; Cheng, Chao; Li, Zheng; Chen, Jing-Yu; Yan, Bin; Han, Bei-Zhong; Reeves, Malcolm

    2010-03-31

    Having more information on the yeast ecology of grapes is important for wine-makers to produce wine with high quality and typical attributes. China is a significant wine-consuming country and is becoming a serious wine-producer, but little has been reported about the yeast ecology of local ecosystems. This study provides the first step towards the exploitation of the yeast wealth in China's vine-growing regions. The aim of this study was to investigate the yeast population density and diversity on three grape varieties cultivated in four representative vine-growing regions of China. Yeast species diversity was evaluated by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequence analysis of the 5.8S internal transcribed spacer (ITS) ribosomal DNA (rDNA) region of cultivable yeasts. The grapes harbored yeast populations at 10(2)-10(6)CFU/mL, consisting mostly of non-Saccharomyces species. Seventeen different yeast species belonging to eight genera were detected on the grape samples tested, including Hanseniaspora uvarum, Cryptococcus flavescens, Pichia fermentans, Candida zemplinina, Cryptococcus carnescens, Candida inconpicua, Zygosaccharomyces fermentati, Issatchenkia terricola, Candida quercitrusa, Hanseniaspora guilliermondii, Candida bombi, Zygosaccharomyces bailii, Sporidiobolus pararoseus, Cryptococcus magnus, Metschnikowia pulcherrima, Issatchenkia orientalis and Pichia guilliermondii. H. uvarum and C. flavescens were the dominant species present on the grapes. For the first time Sporidiobolus pararoseus was discovered as an inhabitant of the grape ecosystem. The yeast community on grape berries was influenced by the grape chemical composition, vine-variety and vine-growing region. This study is the first to identify the yeast communities associated with grapes in China using molecular methods. The results enrich our knowledge of wine-related microorganisms, and can be used to promote the development of the local wine

  6. Genetics of Yeasts

    NASA Astrophysics Data System (ADS)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  7. L-arabinose fermenting yeast

    DOEpatents

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  8. Repeat-Associated Fission Yeast-Like Regional Centromeres in the Ascomycetous Budding Yeast Candida tropicalis

    PubMed Central

    Chatterjee, Gautam; Sankaranarayanan, Sundar Ram; Guin, Krishnendu; Thattikota, Yogitha; Padmanabhan, Sreedevi; Siddharthan, Rahul; Sanyal, Kaustuv

    2016-01-01

    The centromere, on which kinetochore proteins assemble, ensures precise chromosome segregation. Centromeres are largely specified by the histone H3 variant CENP-A (also known as Cse4 in yeasts). Structurally, centromere DNA sequences are highly diverse in nature. However, the evolutionary consequence of these structural diversities on de novo CENP-A chromatin formation remains elusive. Here, we report the identification of centromeres, as the binding sites of four evolutionarily conserved kinetochore proteins, in the human pathogenic budding yeast Candida tropicalis. Each of the seven centromeres comprises a 2 to 5 kb non-repetitive mid core flanked by 2 to 5 kb inverted repeats. The repeat-associated centromeres of C. tropicalis all share a high degree of sequence conservation with each other and are strikingly diverged from the unique and mostly non-repetitive centromeres of related Candida species—Candida albicans, Candida dubliniensis, and Candida lusitaniae. Using a plasmid-based assay, we further demonstrate that pericentric inverted repeats and the underlying DNA sequence provide a structural determinant in CENP-A recruitment in C. tropicalis, as opposed to epigenetically regulated CENP-A loading at centromeres in C. albicans. Thus, the centromere structure and its influence on de novo CENP-A recruitment has been significantly rewired in closely related Candida species. Strikingly, the centromere structural properties along with role of pericentric repeats in de novo CENP-A loading in C. tropicalis are more reminiscent to those of the distantly related fission yeast Schizosaccharomyces pombe. Taken together, we demonstrate, for the first time, fission yeast-like repeat-associated centromeres in an ascomycetous budding yeast. PMID:26845548

  9. Draft Genome Sequence of Cryophilic Basidiomycetous Yeast Mrakia blollopis SK-4, Isolated from an Algal Mat of Naga-ike Lake in the Skarvsnes Ice-Free Area, East Antarctica.

    PubMed

    Tsuji, Masaharu; Kudoh, Sakae; Hoshino, Tamotsu

    2015-01-22

    Mrakia blollopis strain SK-4 was isolated from an algal mat of Naga-ike, a lake in Skarvsnes, East Antarctica. Here, we report the draft genome sequence of M. blollopis SK-4. This is the first report on the genome sequence of any cold-adapted fungal species. Copyright © 2015 Tsuji et al.

  10. Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina)

    PubMed Central

    Dujon, Bernard A.; Louis, Edward J.

    2017-01-01

    Considerable progress in our understanding of yeast genomes and their evolution has been made over the last decade with the sequencing, analysis, and comparisons of numerous species, strains, or isolates of diverse origins. The role played by yeasts in natural environments as well as in artificial manufactures, combined with the importance of some species as model experimental systems sustained this effort. At the same time, their enormous evolutionary diversity (there are yeast species in every subphylum of Dikarya) sparked curiosity but necessitated further efforts to obtain appropriate reference genomes. Today, yeast genomes have been very informative about basic mechanisms of evolution, speciation, hybridization, domestication, as well as about the molecular machineries underlying them. They are also irreplaceable to investigate in detail the complex relationship between genotypes and phenotypes with both theoretical and practical implications. This review examines these questions at two distinct levels offered by the broad evolutionary range of yeasts: inside the best-studied Saccharomyces species complex, and across the entire and diversified subphylum of Saccharomycotina. While obviously revealing evolutionary histories at different scales, data converge to a remarkably coherent picture in which one can estimate the relative importance of intrinsic genome dynamics, including gene birth and loss, vs. horizontal genetic accidents in the making of populations. The facility with which novel yeast genomes can now be studied, combined with the already numerous available reference genomes, offer privileged perspectives to further examine these fundamental biological questions using yeasts both as eukaryotic models and as fungi of practical importance. PMID:28592505

  11. Opportunistic Pathogenic Yeasts

    NASA Astrophysics Data System (ADS)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  12. Breeding research on sake yeasts in Japan: history, recent technological advances, and future perspectives.

    PubMed

    Kitagaki, Hiroshi; Kitamoto, Katsuhiko

    2013-01-01

    Sake is an alcoholic beverage of Japan, with a tradition lasting more than 1,300 years; it is produced from rice and water by fermenting with the koji mold Aspergillus oryzae and sake yeast Saccharomyces cerevisiae. Breeding research on sake yeasts was originally developed in Japan by incorporating microbiological and genetic research methodologies adopted in other scientific areas. Since the advent of a genetic paradigm, isolation of yeast mutants has been a dominant approach for the breeding of favorable sake yeasts. These sake yeasts include (a) those that do not form foams (produced by isolating a mutant that does not stick to foams, thus decreasing the cost of sake production); (b) those that do not produce urea, which leads to the formation of ethyl carbamate, a possible carcinogen (isolated by positive selection in a canavanine-, arginine-, and ornithine-containing medium); (c) those that produce an increased amount of ethyl caproate, an apple-like flavor (produced by isolating a mutant resistant to cerulenin, an inhibitor of fatty-acid synthesis); and (d) those that produce a decreased amount of pyruvate (produced by isolating a mutant resistant to an inhibitor of mitochondrial transport, thus decreasing the amount of diacetyl). Given that sake yeasts perform sexual reproduction, sporulation and mating are potent approaches for their breeding. Recently, the genome sequences of sake yeasts have been determined and made publicly accessible. By utilizing this information, the quantitative trait loci (QTLs) for the brewing characteristics of sake yeasts have been identified, which paves a way to DNA marker-assisted selection of the mated strains. Genetic engineering technologies for experimental yeast strains have recently been established by academic groups, and these technologies have also been applied to the breeding of sake yeasts. Sake yeasts whose genomes have been modified with these technologies correspond to genetically modified organisms (GMOs

  13. Industrial Relevance of Chromosomal Copy Number Variation in Saccharomyces Yeasts

    PubMed Central

    Gorter de Vries, Arthur R.; Pronk, Jack T.

    2017-01-01

    ABSTRACT Chromosomal copy number variation (CCNV) plays a key role in evolution and health of eukaryotes. The unicellular yeast Saccharomyces cerevisiae is an important model for studying the generation, physiological impact, and evolutionary significance of CCNV. Fundamental studies of this yeast have contributed to an extensive set of methods for analyzing and introducing CCNV. Moreover, these studies provided insight into the balance between negative and positive impacts of CCNV in evolutionary contexts. A growing body of evidence indicates that CCNV not only frequently occurs in industrial strains of Saccharomyces yeasts but also is a key contributor to the diversity of industrially relevant traits. This notion is further supported by the frequent involvement of CCNV in industrially relevant traits acquired during evolutionary engineering. This review describes recent developments in genome sequencing and genome editing techniques and discusses how these offer opportunities to unravel contributions of CCNV in industrial Saccharomyces strains as well as to rationally engineer yeast chromosomal copy numbers and karyotypes. PMID:28341679

  14. L-arabinose fermenting yeast

    SciTech Connect

    Zhang, Min; Singh, Arjun; Suominen, Pirkko

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  15. L-arabinose fermenting yeast

    DOEpatents

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2014-09-23

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  16. Cyberlindnera xylolytica sp. nov., a xylitol-producing yeast species isolated from lignocellulosic materials

    USDA-ARS?s Scientific Manuscript database

    Independent surveys of yeasts associated with lignocellulosic-related materials led to the discovery of a novel yeast species belonging to the Cyberlindnera clade (Saccharomycotina, Ascomycota). Analysis of the sequences of the internal transcribed spacer (ITS) region and the D1/D2 domains of the la...

  17. Disseminated yeast (Order Saccharomycetales) infection in a Muscovy duckling (Cairina moschata)

    PubMed Central

    Ravi, Madhu; Hill, Janet E.; Fernando, Champika; Wobeser, Gary

    2016-01-01

    A Muscovy duckling was presented for necropsy due to ongoing mortalities on a farm. Microscopic examination revealed multisystemic inflammatory lesions with intralesional and intracytoplasmic yeast-like organisms. We identified these agents as yeast belonging to the Order Saccharomycetales based on sequence data obtained from the ribosomal RNA operon. PMID:27807382

  18. Yeast ecology of Kombucha fermentation.

    PubMed

    Teoh, Ai Leng; Heard, Gillian; Cox, Julian

    2004-09-01

    Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.

  19. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    NASA Astrophysics Data System (ADS)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  20. Tapping into yeast diversity.

    PubMed

    Fay, Justin C

    2012-11-01

    Domesticated organisms demonstrate our capacity to influence wild species but also provide us with the opportunity to understand rapid evolution in the context of substantially altered environments and novel selective pressures. Recent advances in genetics and genomics have brought unprecedented insights into the domestication of many organisms and have opened new avenues for further improvements to be made. Yet, our ability to engineer biological systems is not without limits; genetic manipulation is often quite difficult. The budding yeast, Saccharomyces cerevisiae, is not only one of the most powerful model organisms, but is also the premier producer of fermented foods and beverages around the globe. As a model system, it entertains a hefty workforce dedicated to deciphering its genome and the function it encodes at a rich mechanistic level. As a producer, it is used to make leavened bread, and dozens of different alcoholic beverages, such as beer and wine. Yet, applying the awesome power of yeast genetics to understanding its origins and evolution requires some knowledge of its wild ancestors and the environments from which they were derived. A number of surprisingly diverse lineages of S. cerevisiae from both primeval and secondary forests in China have been discovered by Wang and his colleagues. These lineages substantially expand our knowledge of wild yeast diversity and will be a boon to elucidating the ecology, evolution and domestication of this academic and industrial workhorse.

  1. Yeast species diversity in apple juice for cider production evidenced by culture-based method.

    PubMed

    Lorenzini, Marilinda; Simonato, Barbara; Zapparoli, Giacomo

    2018-05-07

    Identification of yeasts isolated from apple juices of two cider houses (one located in a plain area and one in an alpine area) was carried out by culture-based method. Wallerstein Laboratory Nutrient Agar was used as medium for isolation and preliminary yeasts identification. A total of 20 species of yeasts belonging to ten different genera were identified using both BLAST algorithm for pairwise sequence comparison and phylogenetic approaches. A wide variety of non-Saccharomyces species was found. Interestingly, Candida railenensis, Candida cylindracea, Hanseniaspora meyeri, Hanseniaspora pseudoguilliermondii, and Metschnikowia sinensis were recovered for the first time in the yeast community of an apple environment. Phylogenetic analysis revealed a better resolution in identifying Metschnikowia and Moesziomyces isolates than comparative analysis using the GenBank or YeastIP gene databases. This study provides important data on yeast microbiota of apple juice and evidenced differences between two geographical cider production areas in terms of species composition.

  2. The yeast genome may harbor hypoxia response elements (HRE).

    PubMed

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  3. Wine yeasts for the future.

    PubMed

    Fleet, Graham H

    2008-11-01

    International competition within the wine market, consumer demands for newer styles of wines and increasing concerns about the environmental sustainability of wine production are providing new challenges for innovation in wine fermentation. Within the total production chain, the alcoholic fermentation of grape juice by yeasts is a key process where winemakers can creatively engineer wine character and value through better yeast management and, thereby, strategically tailor wines to a changing market. This review considers the importance of yeast ecology and yeast metabolic reactions in determining wine quality, and then discusses new directions for exploiting yeasts in wine fermentation. It covers criteria for selecting and developing new commercial strains, the possibilities of using yeasts other than those in the genus of Saccharomyces, the prospects for mixed culture fermentations and explores the possibilities for high cell density, continuous fermentations.

  4. Functional conservation of the yeast and Arabidopsis RAD54-like genes.

    PubMed

    Klutstein, Michael; Shaked, Hezi; Sherman, Amir; Avivi-Ragolsky, Naomi; Shema, Efrat; Zenvirth, Drora; Levy, Avraham A; Simchen, Giora

    2008-04-01

    The Saccharomyces cerevisiae RAD54 gene has critical roles in DNA double-strand break repair, homologous recombination, and gene targeting. Previous results show that the yeast gene enhances gene targeting when expressed in Arabidopsis thaliana. In this work we address the trans-species compatibility of Rad54 functions. We show that overexpression of yeast RAD54 in Arabidopsis enhances DNA damage resistance severalfold. Thus, the yeast gene is active in the Arabidopsis homologous-recombination repair system. Moreover, we have identified an A. thaliana ortholog of yeast RAD54, named AtRAD54. This gene, with close sequence similarity to RAD54, complements methylmethane sulfonate (MMS) sensitivity but not UV sensitivity or gene targeting defects of rad54Delta mutant yeast cells. Overexpression of AtRAD54 in Arabidopsis leads to enhanced resistance to DNA damage. This gene's assignment as a RAD54 ortholog is further supported by the interaction of AtRad54 with AtRad51 and the interactions between alien proteins (i.e., yeast Rad54 with AtRAD51 and yeast Rad51 with AtRad54) in a yeast two-hybrid experiment. These interactions hint at the molecular nature of this interkingdom complementation, although the stronger effect of the yeast Rad54 in plants than AtRad54 in yeast might be explained by an ability of the Rad54 protein to act alone, independently of its interaction with Rad51.

  5. Active role of a human genomic insert in replication of a yeast artificial chromosome.

    PubMed

    van Brabant, A J; Fangman, W L; Brewer, B J

    1999-06-01

    Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

  6. Yeast diversity on grapes in two German wine growing regions.

    PubMed

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-02

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples. Copyright © 2015. Published by Elsevier B.V.

  7. The Yeast Deletion Collection: A Decade of Functional Genomics

    PubMed Central

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  8. Synthetic Genetic Arrays: Automation of Yeast Genetics.

    PubMed

    Kuzmin, Elena; Costanzo, Michael; Andrews, Brenda; Boone, Charles

    2016-04-01

    Genome-sequencing efforts have led to great strides in the annotation of protein-coding genes and other genomic elements. The current challenge is to understand the functional role of each gene and how genes work together to modulate cellular processes. Genetic interactions define phenotypic relationships between genes and reveal the functional organization of a cell. Synthetic genetic array (SGA) methodology automates yeast genetics and enables large-scale and systematic mapping of genetic interaction networks in the budding yeast,Saccharomyces cerevisiae SGA facilitates construction of an output array of double mutants from an input array of single mutants through a series of replica pinning steps. Subsequent analysis of genetic interactions from SGA-derived mutants relies on accurate quantification of colony size, which serves as a proxy for fitness. Since its development, SGA has given rise to a variety of other experimental approaches for functional profiling of the yeast genome and has been applied in a multitude of other contexts, such as genome-wide screens for synthetic dosage lethality and integration with high-content screening for systematic assessment of morphology defects. SGA-like strategies can also be implemented similarly in a number of other cell types and organisms, includingSchizosaccharomyces pombe,Escherichia coli, Caenorhabditis elegans, and human cancer cell lines. The genetic networks emerging from these studies not only generate functional wiring diagrams but may also play a key role in our understanding of the complex relationship between genotype and phenotype. © 2016 Cold Spring Harbor Laboratory Press.

  9. Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae

    PubMed Central

    Woolford, John L.; Baserga, Susan J.

    2013-01-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  10. Comparative genomics of biotechnologically important yeasts

    PubMed Central

    Riley, Robert; Haridas, Sajeet; Wolfe, Kenneth H.; Lopes, Mariana R.; Hittinger, Chris Todd; Göker, Markus; Salamov, Asaf A.; Wisecaver, Jennifer H.; Long, Tanya M.; Aerts, Andrea L.; Barry, Kerrie W.; Choi, Cindy; Clum, Alicia; Coughlan, Aisling Y.; Deshpande, Shweta; Douglass, Alexander P.; Hanson, Sara J.; Klenk, Hans-Peter; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lipzen, Anna M.; Meier-Kolthoff, Jan P.; Ohm, Robin A.; Otillar, Robert P.; Pangilinan, Jasmyn L.; Peng, Yi; Rosa, Carlos A.; Scheuner, Carmen; Sibirny, Andriy A.; Slot, Jason C.; Stielow, J. Benjamin; Sun, Hui; Kurtzman, Cletus P.; Blackwell, Meredith; Grigoriev, Igor V.

    2016-01-01

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the clade sister to the known CUG-Ser clade. Our well-resolved yeast phylogeny shows that some traits, such as methylotrophy, are restricted to single clades, whereas others, such as l-rhamnose utilization, have patchy phylogenetic distributions. Gene clusters, with variable organization and distribution, encode many pathways of interest. Genomics can predict some biochemical traits precisely, but the genomic basis of others, such as xylose utilization, remains unresolved. Our data also provide insight into early evolution of ascomycetes. We document the loss of H3K9me2/3 heterochromatin, the origin of ascomycete mating-type switching, and panascomycete synteny at the MAT locus. These data and analyses will facilitate the engineering of efficient biosynthetic and degradative pathways and gateways for genomic manipulation. PMID:27535936

  11. Yeast identification: reassessment of assimilation tests as sole universal identifiers.

    PubMed

    Spencer, J; Rawling, S; Stratford, M; Steels, H; Novodvorska, M; Archer, D B; Chandra, S

    2011-11-01

    To assess whether assimilation tests in isolation remain a valid method of identification of yeasts, when applied to a wide range of environmental and spoilage isolates. Seventy-one yeast strains were isolated from a soft drinks factory. These were identified using assimilation tests and by D1/D2 rDNA sequencing. When compared to sequencing, assimilation test identifications (MicroLog™) were 18·3% correct, a further 14·1% correct within the genus and 67·6% were incorrectly identified. The majority of the latter could be attributed to the rise in newly reported yeast species. Assimilation tests alone are unreliable as a universal means of yeast identification, because of numerous new species, variability of strains and increasing coincidence of assimilation profiles. Assimilation tests still have a useful role in the identification of common species, such as the majority of clinical isolates. It is probable, based on these results, that many yeast identifications reported in older literature are incorrect. This emphasizes the crucial need for accurate identification in present and future publications. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  12. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    PubMed

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  13. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    PubMed Central

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  14. The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

    PubMed

    Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

    2015-12-01

    The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  15. Mammalian amyloidogenic proteins promote prion nucleation in yeast.

    PubMed

    Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

    2018-03-02

    Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Yeast prions assembly and propagation

    PubMed Central

    2011-01-01

    Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the “non-prion” domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others. PMID:22052349

  17. Genomics and the making of yeast biodiversity

    USDA-ARS?s Scientific Manuscript database

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces ...

  18. Yeast as a model system for mammalian seven-transmembrane segment receptors

    SciTech Connect

    Jeansonne, N.E.

    1994-05-01

    Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomalmore » location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.« less

  19. Cross-referencing yeast genetics and mammalian genomes

    SciTech Connect

    Hieter, P.; Basset, D.; Boguski, M.

    1994-09-01

    We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less

  20. Paraphyly and (yeast) classification.

    PubMed

    Lachance, Marc-André

    2016-12-01

    Yeast systematics has wholeheartedly embraced the phylogenetic approach. Central to this has been the unspoken convention that taxa at all ranks be strictly monophyletic. This can result in a proliferation of small genera and instances of nomenclatural instability, counter to the expected benefit of phylogenetic systematics. But the literature abounds with examples, at all taxonomic levels, where paraphyly is a reality that can no longer be ignored. The very concepts of Bacteria or Archaea, under the constraint of monophyly, are in peril. It is therefore desirable to effect a shift in practices that will recognize the existence of paraphyletic taxa.

  1. Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

    PubMed

    Ricchetti, M; Fairhead, C; Dujon, B

    1999-11-04

    The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.

  2. Phage and Yeast Display.

    PubMed

    Sheehan, Jared; Marasco, Wayne A

    2015-02-01

    Despite the availability of antimicrobial drugs, the continued development of microbial resistance--established through escape mutations and the emergence of resistant strains--limits their clinical utility. The discovery of novel, therapeutic, monoclonal antibodies (mAbs) offers viable clinical alternatives in the treatment and prophylaxis of infectious diseases. Human mAb-based therapies are typically nontoxic in patients and demonstrate high specificity for the intended microbial target. This specificity prevents negative impacts on the patient microbiome and avoids driving the resistance of nontarget species. The in vitro selection of human antibody fragment libraries displayed on phage or yeast surfaces represents a group of well-established technologies capable of generating human mAbs. The advantage of these forms of microbial display is the large repertoire of human antibody fragments present during a single selection campaign. Furthermore, the in vitro selection environments of microbial surface display allow for the rapid isolation of antibodies--and their encoding genes--against infectious pathogens and their toxins that are impractical within in vivo systems, such as murine hybridomas. This article focuses on the technologies of phage display and yeast display, as these strategies relate to the discovery of human mAbs for the treatment and vaccine development of infectious diseases.

  3. Studying Functions of All Yeast Genes Simultaneously

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

    2006-01-01

    A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

  4. Eighteen new oleaginous yeast species.

    PubMed

    Garay, Luis A; Sitepu, Irnayuli R; Cajka, Tomas; Chandra, Idelia; Shi, Sandy; Lin, Ting; German, J Bruce; Fiehn, Oliver; Boundy-Mills, Kyria L

    2016-07-01

    Of 1600 known species of yeasts, about 70 are known to be oleaginous, defined as being able to accumulate over 20 % intracellular lipids. These yeasts have value for fundamental and applied research. A survey of yeasts from the Phaff Yeast Culture Collection, University of California Davis was performed to identify additional oleaginous species within the Basidiomycota phylum. Fifty-nine strains belonging to 34 species were grown in lipid inducing media, and total cell mass, lipid yield and triacylglycerol profiles were determined. Thirty-two species accumulated at least 20 % lipid and 25 species accumulated over 40 % lipid by dry weight. Eighteen of these species were not previously reported to be oleaginous. Triacylglycerol profiles were suitable for biodiesel production. These results greatly expand the number of known oleaginous yeast species, and reveal the wealth of natural diversity of triacylglycerol profiles within wild-type oleaginous Basidiomycetes.

  5. Novel features of ARS selection in budding yeast Lachancea kluyveri

    PubMed Central

    2011-01-01

    Background The characterization of DNA replication origins in yeast has shed much light on the mechanisms of initiation of DNA replication. However, very little is known about the evolution of origins or the evolution of mechanisms through which origins are recognized by the initiation machinery. This lack of understanding is largely due to the vast evolutionary distances between model organisms in which origins have been examined. Results In this study we have isolated and characterized autonomously replicating sequences (ARSs) in Lachancea kluyveri - a pre-whole genome duplication (WGD) budding yeast. Through a combination of experimental work and rigorous computational analysis, we show that L. kluyveri ARSs require a sequence that is similar but much longer than the ARS Consensus Sequence well defined in Saccharomyces cerevisiae. Moreover, compared with S. cerevisiae and K. lactis, the replication licensing machinery in L. kluyveri seems more tolerant to variations in the ARS sequence composition. It is able to initiate replication from almost all S. cerevisiae ARSs tested and most Kluyveromyces lactis ARSs. In contrast, only about half of the L. kluyveri ARSs function in S. cerevisiae and less than 10% function in K. lactis. Conclusions Our findings demonstrate a replication initiation system with novel features and underscore the functional diversity within the budding yeasts. Furthermore, we have developed new approaches for analyzing biologically functional DNA sequences with ill-defined motifs. PMID:22204614

  6. Novel features of ARS selection in budding yeast Lachancea kluyveri.

    PubMed

    Liachko, Ivan; Tanaka, Emi; Cox, Katherine; Chung, Shau Chee Claire; Yang, Lu; Seher, Arael; Hallas, Lindsay; Cha, Eugene; Kang, Gina; Pace, Heather; Barrow, Jasmine; Inada, Maki; Tye, Bik-Kwoon; Keich, Uri

    2011-12-28

    The characterization of DNA replication origins in yeast has shed much light on the mechanisms of initiation of DNA replication. However, very little is known about the evolution of origins or the evolution of mechanisms through which origins are recognized by the initiation machinery. This lack of understanding is largely due to the vast evolutionary distances between model organisms in which origins have been examined. In this study we have isolated and characterized autonomously replicating sequences (ARSs) in Lachancea kluyveri - a pre-whole genome duplication (WGD) budding yeast. Through a combination of experimental work and rigorous computational analysis, we show that L. kluyveri ARSs require a sequence that is similar but much longer than the ARS Consensus Sequence well defined in Saccharomyces cerevisiae. Moreover, compared with S. cerevisiae and K. lactis, the replication licensing machinery in L. kluyveri seems more tolerant to variations in the ARS sequence composition. It is able to initiate replication from almost all S. cerevisiae ARSs tested and most Kluyveromyces lactis ARSs. In contrast, only about half of the L. kluyveri ARSs function in S. cerevisiae and less than 10% function in K. lactis. Our findings demonstrate a replication initiation system with novel features and underscore the functional diversity within the budding yeasts. Furthermore, we have developed new approaches for analyzing biologically functional DNA sequences with ill-defined motifs.

  7. Natural gene expression variation studies in yeast.

    PubMed

    Thompson, Dawn A; Cubillos, Francisco A

    2017-01-01

    The rise of sequence information across different yeast species and strains is driving an increasing number of studies in the emerging field of genomics to associate polymorphic variants, mRNA abundance and phenotypic differences between individuals. Here, we gathered evidence from recent studies covering several layers that define the genotype-phenotype gap, such as mRNA abundance, allele-specific expression and translation efficiency to demonstrate how genetic variants co-evolve and define an individual's genome. Moreover, we exposed several antecedents where inter- and intra-specific studies led to opposite conclusions, probably owing to genetic divergence. Future studies in this area will benefit from the access to a massive array of well-annotated genomes and new sequencing technologies, which will allow the fine breakdown of the complex layers that delineate the genotype-phenotype map. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Suppression Analysis Reveals a Functional Difference between the Serines in Positions Two and Five in the Consensus Sequence of the C-Terminal Domain of Yeast RNA Polymerase II

    PubMed Central

    Yuryev, A.; Corden, J. L.

    1996-01-01

    The largest subunit of RNA polymerase II contains a repetitive C-terminal domain (CTD) consisting of tandem repeats of the consensus sequence Tyr(1)Ser(2)Pro(3)Thr(4) Ser(5)Pro(6) Ser(7). Substitution of nonphosphorylatable amino acids at positions two or five of the Saccharomyces cerevisiae CTD is lethal. We developed a selection ssytem for isolating suppressors of this lethal phenotype and cloned a gene, SCA1 (suppressor of CTD alanine), which complements recessive suppressors of lethal multiple-substitution mutations. A partial deletion of SCA1 (sca1Δ::hisG) suppresses alanine or glutamate substitutions at position two of the consensus CTD sequence, and a lethal CTD truncation mutation, but SCA1 deletion does not suppress alanine or glutamate substitutions at position five. SCA1 is identical to SRB9, a suppressor of a cold-sensitive CTD truncation mutation. Strains carrying dominant SRB mutations have the same suppression properties as a sca1Δ::hisG strain. These results reveal a functional difference between positions two and five of the consensus CTD heptapeptide repeat. The ability of SCA1 and SRB mutant alleles to suppress CTD truncation mutations suggest that substitutions at position two, but not at position five, cause a defect in RNA polymerase II function similar to that introduced by CTD truncation. PMID:8725217

  9. Contamination of sequence databases with adaptor sequences

    SciTech Connect

    Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

    Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

  10. Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.

    PubMed

    Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A

    2017-02-01

    Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. Water quality and antifungal susceptibility of opportunistic yeast pathogens from rivers.

    PubMed

    Monapathi, M E; Bezuidenhout, C C; Rhode, O H J

    2017-03-01

    Yeasts from water sources have been associated with diseases ranging from superficial mucosal infections to life threatening diseases. The aim of this study was to determine the water quality as well as diversity and antifungal susceptibility of yeasts from two rivers. Yeast levels and physico-chemical parameter data were analyzed by principal component analysis to determine correlations between physico-chemical data and yeast levels. Yeast morphotypes were identified by biochemical tests and 26S rRNA gene sequencing. Disk diffusion antifungal susceptibility tests were conducted. Physico-chemical parameters of the water were within target water quality range (TWQR) for livestock farming. For irrigational use, total dissolved solids and nitrates were not within the TWQR. Yeast levels ranged between 27 ± 10 and 2,573 ± 306 cfu/L. Only non-pigmented, ascomycetous yeasts were isolated. Saccharomyces cerevisiae and Candida glabrata were most frequently isolated. Several other opportunistic pathogens were also isolated. A large number of isolates were resistant to azoles, especially fluconazole, but also to other antifungal classes. Candida species were resistant to almost all the antifungal classes. These water sources are used for recreation and religious as well as for watering livestock and irrigation. Of particular concern is the direct contact of individuals with opportunistic yeast, especially the immune-compromised. Resistance of these yeast species to antifungal agents is a further health concern.

  13. Diversity and adaptive evolution of Saccharomyces wine yeast: a review

    PubMed Central

    Marsit, Souhir; Dequin, Sylvie

    2015-01-01

    Saccharomyces cerevisiae and related species, the main workhorses of wine fermentation, have been exposed to stressful conditions for millennia, potentially resulting in adaptive differentiation. As a result, wine yeasts have recently attracted considerable interest for studying the evolutionary effects of domestication. The widespread use of whole-genome sequencing during the last decade has provided new insights into the biodiversity, population structure, phylogeography and evolutionary history of wine yeasts. Comparisons between S. cerevisiae isolates from various origins have indicated that a variety of mechanisms, including heterozygosity, nucleotide and structural variations, introgressions, horizontal gene transfer and hybridization, contribute to the genetic and phenotypic diversity of S. cerevisiae. This review will summarize the current knowledge on the diversity and evolutionary history of wine yeasts, focusing on the domestication fingerprints identified in these strains. PMID:26205244

  14. Production, characterization and gene cloning of the extracellular enzymes from the marine-derived yeasts and their potential applications.

    PubMed

    Chi, Zhenming; Chi, Zhe; Zhang, Tong; Liu, Guanglei; Li, Jing; Wang, Xianghong

    2009-01-01

    In this review article, the extracellular enzymes production, their properties and cloning of the genes encoding the enzymes from marine yeasts are overviewed. Several yeast strains which could produce different kinds of extracellular enzymes were selected from the culture collection of marine yeasts available in this laboratory. The strains selected belong to different genera such as Yarrowia, Aureobasidium, Pichia, Metschnikowia and Cryptococcus. The extracellular enzymes include cellulase, alkaline protease, aspartic protease, amylase, inulinase, lipase and phytase, as well as killer toxin. The conditions and media for the enzyme production by the marine yeasts have been optimized and the enzymes have been purified and characterized. Some genes encoding the extracellular enzymes from the marine yeast strains have been cloned, sequenced and expressed. It was found that some properties of the enzymes from the marine yeasts are unique compared to those of the homologous enzymes from terrestrial yeasts and the genes encoding the enzymes in marine yeasts are different from those in terrestrial yeasts. Therefore, it is of very importance to further study the enzymes and their genes from the marine yeasts. This is the first review on the extracellular enzymes and their genes from the marine yeasts.

  15. Bioprotective Role of Yeasts

    PubMed Central

    Muccilli, Serena; Restuccia, Cristina

    2015-01-01

    The yeasts constitute a large group of microorganisms characterized by the ability to grow and survive in different and stressful conditions and then to colonize a wide range of environmental and human ecosystems. The competitive traits against other microorganisms have attracted increasing attention from scientists, who proposed their successful application as bioprotective agents in the agricultural, food and medical sectors. These antagonistic activities rely on the competition for nutrients, production and tolerance of high concentrations of ethanol, as well as the synthesis of a large class of antimicrobial compounds, known as killer toxins, which showed clearly a large spectrum of activity against food spoilage microorganisms, but also against plant, animal and human pathogens. This review describes the antimicrobial mechanisms involved in the antagonistic activity, their applications in the processed and unprocessed food sectors, as well as the future perspectives in the development of new bio-drugs, which may overcome the limitations connected to conventional antimicrobial and drug resistance. PMID:27682107

  16. Oral yeast colonization throughout pregnancy

    PubMed Central

    Rio, Rute; Simões-Silva, Liliana; Garro, Sofia; Silva, Mário-Jorge; Azevedo, Álvaro

    2017-01-01

    Background Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. Material and Methods The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Results Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Conclusions Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment. Key words:Oral yeast, fungi, pregnancy, saliva pH. PMID:28160578

  17. [Thermoresistance in Saccharomyces cerevisiae yeasts].

    PubMed

    Kaliuzhin, V A

    2011-01-01

    Under natural conditions, yeast Saccharomyces cerevisiae reproduce, as a rule, on the surface of solid or liquid medium. Thus, life cycle of yeast populations is substantially influenced by diurnal changes in ambient temperature. The pattern in the response of unrestricted yeast S. cerevisiae culture to changes in the temperature of cultivation is revealed experimentally. Yeast population, in the absence of environmental constraints on the functioning of cell chemosmotic bioenergetic system, demonstrates the ability of thermoresistance when the temperature of cultivation switches from the range of 12-36 degrees C to 37.5-40 degrees C. During the transient period that is associated with the temperature switching and lasts from 1 to 4 turnover cycles, yeast reproduction rate remains 1.5-2 times higher than under stationary conditions. This is due to evolutionary acquired adaptive activity of cell chemosmotic system. After the adaptive resources exhausting, yeast thermoresistance fully recovers at the temperature range of 12-36 degrees C within one generation time under conditions of both restricted and unrestricted nourishment. Adaptive significance of such thermoresistance seems obvious enough--it allows maintaining high reproduction rate in yeast when ambient temperature is reaching a brief maximum shortly after noon.

  18. Interaction Between Yeasts and Zinc

    NASA Astrophysics Data System (ADS)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  19. Isolation and expression of a gene (CGR1) regulated during the yeast-hyphal transition in Candida albicans.

    PubMed

    Cho, T; Sudoh, M; Tanaka, T; Nakashima, Y; Chibana, H; Kaminishi, H

    2001-01-26

    We used RNA fingerprinting of arbitrarily primed PCR to isolate genes upregulated during the yeast-hyphal transition in Candida albicans. The sequence and expression of one of these genes (CGR1, Candida growth regulation) are presented. Our results suggest that CGR1 expression is associated with a growth cessation of yeast cells, a prerequisite for germination in this organism.

  20. Screening wild yeast strains for alcohol fermentation from various fruits.

    PubMed

    Lee, Yeon-Ju; Choi, Yu-Ri; Lee, So-Young; Park, Jong-Tae; Shim, Jae-Hoon; Park, Kwan-Hwa; Kim, Jung-Wan

    2011-03-01

    Wild yeasts on the surface of various fruits including grapes were surveyed to obtain yeast strains suitable for fermenting a novel wine with higher alcohol content and supplemented with rice starch. We considered selected characteristics, such as tolerance to alcohol and osmotic pressure, capability of utilizing maltose, and starch hydrolysis. Among 637 putative yeast isolates, 115 strains exhibiting better growth in yeast-peptone-dextrose broth containing 30% dextrose, 7% alcohol, or 2% maltose were selected, as well as five α-amylase producers. Nucleotide sequence analysis of the 26S rDNA gene classified the strains into 13 species belonging to five genera; Pichia anomala was the most prevalent (41.7%), followed by Wickerhamomyces anomalus (19.2%), P. guilliermondii (15%), Candida spp. (5.8%), Kodamaea ohmeri (2.5%), and Metschnikowia spp. (2.5%). All of the α-amylase producers were Aureobasidium pullulans. Only one isolate (NK28) was identified as Saccharomyces cerevisiae. NK28 had all of the desired properties for the purpose of this study, except α-amylase production, and fermented alcohol better than commercial wine yeasts.

  1. Divergence of Iron Metabolism in Wild Malaysian Yeast

    PubMed Central

    Lee, Hana N.; Mostovoy, Yulia; Hsu, Tiffany Y.; Chang, Amanda H.; Brem, Rachel B.

    2013-01-01

    Comparative genomic studies have reported widespread variation in levels of gene expression within and between species. Using these data to infer organism-level trait divergence has proven to be a key challenge in the field. We have used a wild Malaysian population of S. cerevisiae as a test bed in the search to predict and validate trait differences based on observations of regulatory variation. Malaysian yeast, when cultured in standard medium, activated regulatory programs that protect cells from the toxic effects of high iron. Malaysian yeast also showed a hyperactive regulatory response during culture in the presence of excess iron and had a unique growth defect in conditions of high iron. Molecular validation experiments pinpointed the iron metabolism factors AFT1, CCC1, and YAP5 as contributors to these molecular and cellular phenotypes; in genome-scale sequence analyses, a suite of iron toxicity response genes showed evidence for rapid protein evolution in Malaysian yeast. Our findings support a model in which iron metabolism has diverged in Malaysian yeast as a consequence of a change in selective pressure, with Malaysian alleles shifting the dynamic range of iron response to low-iron concentrations and weakening resistance to extreme iron toxicity. By dissecting the iron scarcity specialist behavior of Malaysian yeast, our work highlights the power of expression divergence as a signpost for biologically and evolutionarily relevant variation at the organismal level. Interpreting the phenotypic relevance of gene expression variation is one of the primary challenges of modern genomics. PMID:24142925

  2. Divergence of iron metabolism in wild Malaysian yeast.

    PubMed

    Lee, Hana N; Mostovoy, Yulia; Hsu, Tiffany Y; Chang, Amanda H; Brem, Rachel B

    2013-12-09

    Comparative genomic studies have reported widespread variation in levels of gene expression within and between species. Using these data to infer organism-level trait divergence has proven to be a key challenge in the field. We have used a wild Malaysian population of S. cerevisiae as a test bed in the search to predict and validate trait differences based on observations of regulatory variation. Malaysian yeast, when cultured in standard medium, activated regulatory programs that protect cells from the toxic effects of high iron. Malaysian yeast also showed a hyperactive regulatory response during culture in the presence of excess iron and had a unique growth defect in conditions of high iron. Molecular validation experiments pinpointed the iron metabolism factors AFT1, CCC1, and YAP5 as contributors to these molecular and cellular phenotypes; in genome-scale sequence analyses, a suite of iron toxicity response genes showed evidence for rapid protein evolution in Malaysian yeast. Our findings support a model in which iron metabolism has diverged in Malaysian yeast as a consequence of a change in selective pressure, with Malaysian alleles shifting the dynamic range of iron response to low-iron concentrations and weakening resistance to extreme iron toxicity. By dissecting the iron scarcity specialist behavior of Malaysian yeast, our work highlights the power of expression divergence as a signpost for biologically and evolutionarily relevant variation at the organismal level. Interpreting the phenotypic relevance of gene expression variation is one of the primary challenges of modern genomics.

  3. Downsides and benefits of unicellularity in budding yeast

    NASA Astrophysics Data System (ADS)

    Balazsi, Gabor; Chen, Lin; Kuzdzal-Fick, Jennie

    Yeast cells that do not separate after cell division form clumps. Clumping was shown to aid utilization of certain sugars, but its effects in stressful conditions are unknown. Generally speaking, what are the costs and benefits of unicellularity versus clumping multicellularity in normal and stressful conditions? To address this question, we evolved clumping yeast towards unicellularity by continuously propagating only those cells that remain suspended in liquid culture after settling. Whole-genome sequencing indicated that mutations in the AMN1 (antagonist of mitotic exit network) gene underlie the changes from clumping to unicellular phenotypes in these evolved yeast cells. Simple models predict that clumping should hinder growth in normal conditions while being protective in stress. Accordingly, we find experimentally that yeast clumps are more resistant to freeze/thaw, hydrogen peroxide, and ethanol stressors than their unicellular counterparts. On the other hand, unicellularity seems to be advantageous in normal conditions. Overall, these results reveal the downsides and benefits of unicellularity in different environmental conditions and uncover its genetic bases in yeast. This research was supported by the NIH Director's New Innovator Award Program (1DP2 OD006481-01), by NSF/IOS 1021675 and the Laufer Center for Physical & Quantitative Biology.

  4. [Distiller Yeasts Producing Antibacterial Peptides].

    PubMed

    Klyachko, E V; Morozkina, E V; Zaitchik, B Ts; Benevolensky, S V

    2015-01-01

    A new method of controlling lactic acid bacteria contamination was developed with the use of recombinant Saccharomyces cerevisiae strains producing antibacterial peptides. Genes encoding the antibacterial peptides pediocin and plantaricin with codons preferable for S. cerevisiae were synthesized, and a system was constructed for their secretory expression. Recombinant S. cerevisiae strains producing antibacterial peptides effectively inhibit the growth of Lactobacillus sakei, Pediacoccus pentasaceus, Pediacoccus acidilactici, etc. The application of distiller yeasts producing antibacterial peptides enhances the ethanol yield in cases of bacterial contamination. Recombinant yeasts producing the antibacterial peptides pediocin and plantaricin can successfully substitute the available industrial yeast strains upon ethanol production.

  5. Yeasts as distinct life forms of fungi

    USDA-ARS?s Scientific Manuscript database

    This review describes all presently recognized genera of the Ascomycete yeasts (Saccharomycotina, budding yeasts, and the Taphrinomycotina, fission yeasts and related) as well as all currently recognized genera of the Basidiomycete yeasts. This update will be the lead chapter for a book entitled “Ye...

  6. 21 CFR 172.896 - Dried yeasts.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Dried yeasts. 172.896 Section 172.896 Food and... PERMITTED FOR DIRECT ADDITION TO FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis...

  7. 21 CFR 172.896 - Dried yeasts.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic acid...

  8. 21 CFR 172.896 - Dried yeasts.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic acid...

  9. 21 CFR 172.896 - Dried yeasts.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic acid...

  10. 21 CFR 172.896 - Dried yeasts.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Dried yeasts. 172.896 Section 172.896 Food and... Multipurpose Additives § 172.896 Dried yeasts. Dried yeast (Saccharomyces cerevisiae and Saccharomyces fragilis) and dried torula yeast (Candida utilis) may be safely used in food provided the total folic acid...

  11. Marine yeast isolation and industrial application

    PubMed Central

    Zaky, Abdelrahman Saleh; Tucker, Gregory A; Daw, Zakaria Yehia; Du, Chenyu

    2014-01-01

    Over the last century, terrestrial yeasts have been widely used in various industries, such as baking, brewing, wine, bioethanol and pharmaceutical protein production. However, only little attention has been given to marine yeasts. Recent research showed that marine yeasts have several unique and promising features over the terrestrial yeasts, for example higher osmosis tolerance, higher special chemical productivity and production of industrial enzymes. These indicate that marine yeasts have great potential to be applied in various industries. This review gathers the most recent techniques used for marine yeast isolation as well as the latest applications of marine yeast in bioethanol, pharmaceutical and enzyme production fields. PMID:24738708

  12. Spores of the mycorrhizal fungus Glomus mosseae host yeasts that solubilize phosphate and accumulate polyphosphates.

    PubMed

    Mirabal Alonso, Loreli; Kleiner, Diethelm; Ortega, Eduardo

    2008-04-01

    The present paper reports the presence of bacteria and yeasts tightly associated with spores of an isolate of Glomus mosseae. Healthy spores were surface disinfected by combining chloramine-T 5%, Tween-40, and cephalexin 2.5 g L(-1) (CTCf). Macerates of these spores were incubated on agar media, microorganisms were isolated, and two yeasts were characterized (EndoGm1, EndoGm11). Both yeasts were able to solubilize low-soluble P sources (Ca and Fe phosphates) and accumulate polyphosphates (polyPs). Sequence analysis of 18S ribosomal deoxyribonucleic acid showed that the yeasts belong to the genera Rhodotorula or Rhodosporidium (EndoGm1) and Cryptococcus (EndoGm11). Results from inoculation experiments showed an effect of the spore-associated yeasts on the root growth of rice, suggesting potential tripartite interactions with mycorrhizal fungi and plants.

  13. Yeast proteome map (last update).

    PubMed

    Perrot, Michel; Moes, Suzette; Massoni, Aurélie; Jenoe, Paul; Boucherie, Hélian

    2009-10-01

    The identification of proteins separated on 2-D gels is essential to exploit the full potential of 2-D gel electrophoresis for proteomic investigations. For this purpose we have undertaken the systematic identification of Saccharomyces cerevisiae proteins separated on 2-D gels. We report here the identification by mass spectrometry of 100 novel yeast protein spots that have so far not been tackled due to their scarcity on our standard 2-D gels. These identifications extend the number of protein spots identified on our yeast 2-D proteome map to 716. They correspond to 485 unique proteins. Among these, 154 were resolved into several isoforms. The present data set can now be expanded to report for the first time a map of 363 protein isoforms that significantly deepens our knowledge of the yeast proteome. The reference map and a list of all identified proteins can be accessed on the Yeast Protein Map server (www.ibgc.u-bordeaux2.fr/YPM).

  14. Properties of the intracellular transient receptor potential (TRP) channel in yeast, Yvc1.

    PubMed

    Chang, Yiming; Schlenstedt, Gabriel; Flockerzi, Veit; Beck, Andreas

    2010-05-17

    Transient receptor potential (TRP) channels are found among mammals, flies, worms, ciliates, Chlamydomonas, and yeast but are absent in plants. These channels are believed to be tetramers of proteins containing six transmembrane domains (TMs). Their primary structures are diverse with sequence similarities only in some short amino acid sequence motifs mainly within sequences covering TM5, TM6, and adjacent domains. In the yeast genome, there is one gene encoding a TRP-like sequence. This protein forms an ion channel in the vacuolar membrane and is therefore called Yvc1 for yeast vacuolar conductance 1. In the following we summarize its prominent features. Copyright 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  15. Advances in yeast systematics and phylogeny and their use as predictors of biotechnologically important metabolic pathways

    USDA-ARS?s Scientific Manuscript database

    Detection, identification, and classification of yeasts have undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of t...

  16. Impact of recent molecular phylogenetic studies on classification of ascomycete yeasts

    USDA-ARS?s Scientific Manuscript database

    Analyses of concatenated gene sequences as well as whole genome sequences are resolving relationships among the ascomycete yeasts (Saccharomycotina), thus allowing classification of members of this subphylum to be based on phylogeny. In addition, changes implemented in the new Botanical Code [Intern...

  17. Use of CYP52A2A promoter to increase gene expression in yeast

    DOEpatents

    Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan

    2004-01-06

    A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

  18. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    PubMed

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  19. Yeast diversity isolated from grape musts during spontaneous fermentation from a Brazilian winery.

    PubMed

    Bezerra-Bussoli, Carolina; Baffi, Milla Alves; Gomes, Eleni; Da-Silva, Roberto

    2013-09-01

    Saccharomyces and non-Saccharomyces yeast species from a winery located in Brazil were identified by ribosomal gene-sequencing analysis. A total of 130 yeast strains were isolated from grape surfaces and musts during alcoholic fermentation from Isabel, Bordeaux, and Cabernet Sauvignon varieties. Samples were submitted to PCR-RFLP analysis and genomic sequencing. Thirteen species were identified: Candida quercitrusa, Candida stellata, Cryptococcus flavescens, Cryptococcus laurentii, Hanseniaspora uvarum, Issatchenkia occidentalis, Issatchenkia orientalis, Issatchenkia terricola, Pichia kluyveri, Pichia guilliermondii, Pichia sp., Saccharomyces cerevisiae, and Sporidiobolus pararoseus. A sequential substitution of species during the different stages of fermentation, with a dominance of non-Saccharomyces yeasts at the beginning, and a successive replacement of species by S. cerevisiae strains at the final steps were observed. This is the first report about the yeast distribution present throughout the alcoholic fermentation in a Brazilian winery, providing supportive information for future studies on their contribution to wine quality.

  20. GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

    PubMed Central

    Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.

    2014-01-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708

  1. Study of amyloids using yeast

    PubMed Central

    Wickner, Reed B.; Kryndushkin, Dmitry; Shewmaker, Frank; McGlinchey, Ryan; Edskes, Herman K.

    2012-01-01

    Summary Saccharomyces cerevisiae has been a useful model organism in such fields as the cell cycle, regulation of transcription, protein trafficking and cell biology, primarily because of its ease of genetic manipulation. This is no less so in the area of amyloid studies. The endogenous yeast amyloids described to date include prions, infectious proteins (Table 1), and some cell wall proteins (1). and amyloids of humans and a fungal prion have also been studied using the yeast system. Accordingly, the emphasis of this chapter will be on genetic, biochemical, cell biological and physical methods particularly useful in the study of yeast prions and other amyloids studied in yeast. We limit our description of these methods to those aspects which have been most useful in studying yeast prions, citing more detailed expositions in the literature. Volumes on yeast genetics methods (2–4), and on amyloids and prions (5, 6) are useful, and Masison has edited a volume of Methods on “Identification, analysis and characterization of fungal prions” which covers some of this territory (7). We also outline some useful physical methods, pointing the reader to more extensive and authoratative descriptions. PMID:22528100

  2. Biotechnological Applications of Dimorphic Yeasts

    NASA Astrophysics Data System (ADS)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  3. Oral yeast colonization throughout pregnancy.

    PubMed

    Rio, R; Simões-Silva, L; Garro, S; Silva, M-J; Azevedo, Á; Sampaio-Maia, B

    2017-03-01

    Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment.

  4. The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now

    PubMed Central

    Engel, Stacia R.; Dietrich, Fred S.; Fisk, Dianna G.; Binkley, Gail; Balakrishnan, Rama; Costanzo, Maria C.; Dwight, Selina S.; Hitz, Benjamin C.; Karra, Kalpana; Nash, Robert S.; Weng, Shuai; Wong, Edith D.; Lloyd, Paul; Skrzypek, Marek S.; Miyasato, Stuart R.; Simison, Matt; Cherry, J. Michael

    2014-01-01

    The genome of the budding yeast Saccharomyces cerevisiae was the first completely sequenced from a eukaryote. It was released in 1996 as the work of a worldwide effort of hundreds of researchers. In the time since, the yeast genome has been intensively studied by geneticists, molecular biologists, and computational scientists all over the world. Maintenance and annotation of the genome sequence have long been provided by the Saccharomyces Genome Database, one of the original model organism databases. To deepen our understanding of the eukaryotic genome, the S. cerevisiae strain S288C reference genome sequence was updated recently in its first major update since 1996. The new version, called “S288C 2010,” was determined from a single yeast colony using modern sequencing technologies and serves as the anchor for further innovations in yeast genomic science. PMID:24374639

  5. Relationships among genera of the Saccharomycotina from multigene sequence analysis

    USDA-ARS?s Scientific Manuscript database

    Most known species of the subphylum Saccharomycotina (budding ascomycetous yeasts) have now been placed in phylogenetically defined clades following multigene sequence analysis. Terminal clades, which are usually well supported from bootstrap analysis, are viewed as phylogenetically circumscribed ge...

  6. Modifying Expression Modes of Human Neurotensin Receptor Type 1 Alters Sensing Capabilities for Agonists in Yeast Signaling Biosensor.

    PubMed

    Hashi, Hiroki; Nakamura, Yasuyuki; Ishii, Jun; Kondo, Akihiko

    2018-04-01

    Neurotensin receptor type 1 (NTSR1), a member of the G-protein-coupled receptor (GPCR) family, is naturally activated by binding of a neurotensin peptide, leading to a variety of physiological effects. The budding yeast Saccharomyces cerevisiae is a proven host organism for assaying the agonistic activation of human GPCRs. Previous studies showed that yeast cells can functionally express human NTSR1 receptor, permitting the detection of neurotensin-promoted signaling using a ZsGreen fluorescent reporter gene. However, the fluorescence intensity (sensitivity) of NTSR1-expressing yeast cells is low compared to that of yeast cells expressing other human GPCRs (e.g., human somatostatin receptors). The present study sought to increase the sensitivity of the NTSR1-expressing yeast for use as a fluorescent biosensor, including modification of the expression of human NTSR1 in yeast. Changes in the transcription, translation, and transport of the receptor are attempted by altering the promoter, consensus Kozak-like sequence, and secretion signal sequences of the NTSR1-encoding gene. The resulting yeast cells exhibited increased sensitivity to exogenously added peptide. The cells are further engineered by using cell-surface display technology to ensure that the agonistic peptides are secreted and tethered to the yeast cell wall, yielding cells with enhanced NTSR1 activation. This yeast biosensor holds promise for the identification of agonists to treat NTSR1-related diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The presence of a mycangium in European Sinodendron cylindricum (Coleoptera: Lucanidae) and the associated yeast symbionts

    PubMed Central

    Tanahashi, Masahiko; Hawes, Colin J.

    2016-01-01

    Part of the exoskeleton of some wood-inhabiting insects is modified to form a mycangium, which is a specialized organ used to convey fungal spores or yeasts to their offspring. Although most stag beetles (Coleoptera: Lucanidae) are known to have female-specific mycangia and associated yeast symbionts, the evolutionary origin of the mycangium in this group remains unresolved. Here, we report the presence of a mycangium and associated yeast symbionts in the European horned stag beetle Sinodendron cylindricum (L.), which belongs to an ancestral clade of the Lucanidae. The mycangium of S. cylindricum is shown to be female-specific and have the same developmental origin as that of other stag beetles. A total of five yeast strains were isolated from adult mycangia and larval gut of S. cylindricum. Of these, we suggest that SICYAM1 is an undescribed yeast with taxonomic novelty, and have identified SICYLG3 as the xylose-fermenting yeast Scheffersomyces insectosa using nuclear ribosomal RNA and ITS sequences. The remaining three yeast strains, SICYAM2, SICYLG1, and SICYLG2, were assigned to the genus Sugiyamaella. Yeast density in the adult mycangium was lower than that of the more evolutionarily advanced stag beetles, the European Lucanus cervus (L.) and Dorcus parallelipipedus (L.), which were also examined in this study. No living yeasts were isolated from the adult guts. However, a third instar larva of S. cylindricum harbored 104–106 living yeasts in each gut region, which suggests that gut yeasts play an important role in these wood-feeding larvae. PMID:27432353

  8. Metabolic regulation of yeast

    NASA Astrophysics Data System (ADS)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  9. PomBase: a comprehensive online resource for fission yeast

    PubMed Central

    Wood, Valerie; Harris, Midori A.; McDowall, Mark D.; Rutherford, Kim; Vaughan, Brendan W.; Staines, Daniel M.; Aslett, Martin; Lock, Antonia; Bähler, Jürg; Kersey, Paul J.; Oliver, Stephen G.

    2012-01-01

    PomBase (www.pombase.org) is a new model organism database established to provide access to comprehensive, accurate, and up-to-date molecular data and biological information for the fission yeast Schizosaccharomyces pombe to effectively support both exploratory and hypothesis-driven research. PomBase encompasses annotation of genomic sequence and features, comprehensive manual literature curation and genome-wide data sets, and supports sophisticated user-defined queries. The implementation of PomBase integrates a Chado relational database that houses manually curated data with Ensembl software that supports sequence-based annotation and web access. PomBase will provide user-friendly tools to promote curation by experts within the fission yeast community. This will make a key contribution to shaping its content and ensuring its comprehensiveness and long-term relevance. PMID:22039153

  10. Zygosaccharomyces kombuchaensis, a new ascosporogenous yeast from 'Kombucha tea'.

    PubMed

    Kurtzman, C P; Robnett, C J; Basehoar-Powers, E

    2001-07-01

    A new ascosporogenous yeast, Zygosaccharomyces kombuchaensis sp. n. (type strain NRRL YB-4811, CBS 8849), is described; it was isolated from Kombucha tea, a popular fermented tea-based beverage. The four known strains of the new species have identical nucleotide sequences in domain D1/D2 of 26S rDNA. Phylogenetic analysis of D1/D2 and 18S rDNA sequences places Z. kombuchaensis near Zygosaccharomyces lentus. The two species are indistinguishable on standard physiological tests used for yeast identification, but can be recognized from differences in restriction fragment length polymorphism patterns obtained by digestion of 18S-ITS1 amplicons with the restriction enzymes DdeI and MboI.

  11. Diversity and killer activity of yeasts in Malaysian fermented food samples.

    PubMed

    Lim, S L; Tay, S T

    2011-08-01

    The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.

  12. Yeast diversity associated to sediments and water from two Colombian artificial lakes

    PubMed Central

    Silva-Bedoya, L.M.; Ramírez-Castrillón, M.; Osorio-Cadavid, E.

    2014-01-01

    In Colombia, knowledge of the yeast and yeast-like fungi community is limited because most studies have focused on species with clinical importance. Sediments and water represent important habitats for the study of yeast diversity, especially for yeast species with industrial, biotechnological, and bioremediation potential. The main purpose of this study was to identify and compare the diversity of yeast species associated with sediment and water samples from two artificial lakes in Universidad del Valle (Cali-Colombia). Yeast samplings were performed from fifteen sediment samples and ten water samples. Grouping of similar isolates was initially based on colony and cell morphology, which was then complemented by micro/mini satellite primed PCR banding pattern analysis by using GTG5 as single primer. A representative isolate for each group established was chosen for D1/D2 domain sequencing and identification. In general, the following yeast species were identified: Candida albicans, Candida diversa, Candida glabrata, Candida pseudolambica, Cryptococcus podzolicus, Cryptococcus rajasthanensis, Cryptococcus laurentii, Williopsis saturnus, Hanseniaspora thailandica, Hanseniaspora uvarum, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, Torulaspora delbrueckii, Torulaspora pretoriensis, Tricosporon jirovecii, Trichosporon laibachii and Yarrowia lypolitica. Two possible new species were also found, belonging to the Issatchenkia sp. and Bullera sp. genera. In conclusion, the lakes at the Universidad del Valle campus have significant differences in yeast diversity and species composition between them. PMID:24948924

  13. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    PubMed

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  14. Study on the effects of near-future ocean acidification on marine yeasts: a microcosm approach

    NASA Astrophysics Data System (ADS)

    Krause, Evamaria; Wichels, Antje; Erler, René; Gerdts, Gunnar

    2013-12-01

    Marine yeasts play an important role in biodegradation and nutrient cycling and are often associated with marine flora and fauna. They show maximum growth at pH levels lower than present-day seawater pH. Thus, contrary to many other marine organisms, they may actually profit from ocean acidification. Hence, we conducted a microcosm study, incubating natural seawater from the North Sea at present-day pH (8.10) and two near-future pH levels (7.81 and 7.67). Yeasts were isolated from the initial seawater sample and after 2 and 4 weeks of incubation. Isolates were classified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and representative isolates were identified by partial sequencing of the large subunit rRNA gene. From the initial seawater sample, we predominantly isolated a yeast-like filamentous fungus related to Aureobasidium pullulans, Cryptococcus sp., Candida sake, and various cold-adapted yeasts. After incubation, we found more different yeast species at near-future pH levels than at present-day pH. Yeasts reacting to low pH were related to Leucosporidium scottii, Rhodotorula mucilaginosa, Cryptococcus sp., and Debaryomyces hansenii. Our results suggest that these yeasts will benefit from seawater pH reductions and give a first indication that the importance of yeasts will increase in a more acidic ocean.

  15. Polyphenolic substrates and dyes degradation by yeasts from 25 de Mayo/King George Island (Antarctica).

    PubMed

    Rovati, José I; Pajot, Hipólito F; Ruberto, Lucas; Mac Cormack, Walter; Figueroa, Lucía I C

    2013-11-01

    Antarctica offers a range of extreme climatic conditions, such as low temperatures, high solar radiation and low nutrient availability, and constitutes one of the harshest environments on Earth. Despite that, it has been successfully colonized by ’cold-loving’ fungi, which play a key role in decomposition cycles in cold ecosystems. However, knowledge about the ecological role of yeasts in nutrient or organic matter recycling/mineralization remains highly fragmentary. The aim of this work was to study the yeast microbiota in samples collected on 25 de Mayo/King George Island regarding the scope of their ability to degrade polyphenolic substrates such as lignin and azo dyes. Sixty-one yeast isolates were obtained from 37 samples, including soil, rocks, wood and bones. Molecular analyses based on rDNA sequences revealed that 35 yeasts could be identified at the species level and could be classified in the genera Leucosporidiella, Rhodotorula, Cryptococcus, Bullera and Candida. Cryptococcus victoriae was by far the most ubiquitous species. In total, 33% of the yeast isolates examined showed significant activity for dye decolorization, 25% for laccase activity and 38% for ligninolytic activity. Eleven yeasts did not show positive activity in any of the assays performed and no isolates showed positive activity across all tested substrates. A high diversity of yeasts were isolated in this work, possibly including undescribed species and conspicuous Antarctic yeasts, most of them belonging to oligotrophic, slow-growing and metabolically diverse basidiomycetous genera.

  16. Indole-3-Acetic Acid-Producing Yeasts in the Phyllosphere of the Carnivorous Plant Drosera indica L

    PubMed Central

    Shin, Li-Ying; Wei, Jyuan-Yu; Fu, Shih-Feng; Chou, Jui-Yu

    2014-01-01

    Yeasts are widely distributed in nature and exist in association with other microorganisms as normal inhabitants of soil, vegetation, and aqueous environments. In this study, 12 yeast strains were enriched and isolated from leaf samples of the carnivorous plant Drosera indica L., which is currently threatened because of restricted habitats and use in herbal industries. According to similarities in large subunit and small subunit ribosomal RNA gene sequences, we identified 2 yeast species in 2 genera of the phylum Ascomycota, and 5 yeast species in 5 genera of the phylum Basidiomycota. All of the isolated yeasts produced indole-3-acetic acid (IAA) when cultivated in YPD broth supplemented with 0.1% L-tryptophan. Growth conditions, such as the pH and temperature of the medium, influenced yeast IAA production. Our results also suggested the existence of a tryptophan-independent IAA biosynthetic pathway. We evaluated the effects of various concentrations of exogenous IAA on yeast growth and observed that IAA produced by wild yeasts modifies auxin-inducible gene expression in Arabidopsis. Our data suggest that yeasts can promote plant growth and support ongoing prospecting of yeast strains for inclusion into biofertilizer for sustainable agriculture. PMID:25464336

  17. Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

    PubMed Central

    Erickson, J. R.; Johnston, M.

    1993-01-01

    We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

  18. (GTG)5 MSP-PCR fingerprinting as a technique for discrimination of wine associated yeasts?

    PubMed

    Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure.

  19. (GTG)5 MSP-PCR Fingerprinting as a Technique for Discrimination of Wine Associated Yeasts?

    PubMed Central

    Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure. PMID:25171185

  20. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    NASA Astrophysics Data System (ADS)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  1. Initiation preference at a yeast origin of replication.

    PubMed

    Brewer, B J; Fangman, W L

    1994-04-12

    Replication origins in the yeast Saccharomyces cerevisiae are identified as autonomous replication sequence (ARS) elements. To examine the effect of origin density on replication initiation, we have analyzed the replication of a plasmid that contains two copies of the same origin, ARS1. The activation of origins and the direction that replication forks move through flanking sequences can be physically determined by analyzing replication intermediates on two-dimensional agarose gels. We find that only one of the two identical ARSs on the plasmid initiates replication on any given plasmid molecule; that is, this close spacing of ARSs results in an apparent interference between the potential origins. Moreover, in the particular plasmid that we constructed, one of the two identical copies of ARS1 is used four times more frequently than the other one. These results show that the plasmid context is critical for determining the preferred origin. This origin preference is also exhibited when the tandem copies of ARS1 are introduced into a yeast chromosome. The sequences responsible for establishing the origin preference have been identified by deletion analysis and are found to reside in a portion of the yeast URA3 gene.

  2. Binding properties of SUMO-interacting motifs (SIMs) in yeast.

    PubMed

    Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

    2015-03-01

    Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

  3. Preparation of Total RNA from Fission Yeast.

    PubMed

    Bähler, Jürg; Wise, Jo Ann

    2017-04-03

    Treatment with hot phenol breaks open fission yeast cells and begins to strip away bound proteins from RNA. Deproteinization is completed by multiple extractions with chloroform/isoamyl alcohol and separation of the aqueous and organic phases using MaXtract gel, an inert material that acts as a physical barrier between the phases. The final step is concentration of the RNA by ethanol precipitation. The protocol can be used to prepare RNA from several cultures grown in parallel, but it is important not to process too many samples at once because delays can be detrimental to RNA quality. A reasonable number of samples to process at once would be three to four for microarray or RNA sequencing analyses and six for preliminary investigations of mutants implicated in RNA metabolism. © 2017 Cold Spring Harbor Laboratory Press.

  4. Kinetics of hairpin ribozyme cleavage in yeast.

    PubMed Central

    Donahue, C P; Fedor, M J

    1997-01-01

    Hairpin ribozymes catalyze a self-cleavage reaction that provides a simple model for quantitative analyses of intracellular mechanisms of RNA catalysis. Decay rates of chimeric mRNAs containing self-cleaving ribozymes give a direct measure of intracellular cleavage kinetics in yeast. Intracellular ribozyme-mediated cleavage occurs at similar rates and shows similar inhibition by ribozyme mutations as ribozyme-mediated reactions in vitro, but only when ribozymes are located in a favorable mRNA sequence context. The impact of cleavage on mRNA abundance is shown to depend directly on intrinsic mRNA stability. Surprisingly, cleavage products are no more labile than uncleaved mRNAs despite the loss of terminal cap structures or poly (A). PMID:9292496

  5. Debaryomyces hansenii: An Osmotolerant and Halotolerant Yeast

    NASA Astrophysics Data System (ADS)

    Aggarwal, Monika; Mondal, Alok K.

    The yeast Debaryomyces hansenii which was isolated from saline environments such as sea water, concentrated brines, salty food, is one of the most halotolerant species. It can grow in media containing as high as 4 M NaCl, while the growth of Saccharomyces cerevisiae is limited in media with more than 1.7 M NaCl. This species is very important for food industry as it is used for surface ripening of cheese and meat products. In the recent past, there is growing interest in understanding the molecular mechanisms of high halotolerance exhibited by D. hansenii. Availability of genome sequence of D. hansenii has opened up new vistas in this direction

  6. Yeast Identification During Fermentation of Turkish Gemlik Olives.

    PubMed

    Mujdeci, Gamze; Arévalo-Villena, María; Ozbas, Z Yesim; Briones Pérez, Ana

    2018-05-01

    Naturally fermented black table olives of the Gemlik variety are one of the most consumed fermented products in Turkey. The objective of this work was to identify yeast strains isolated during their natural fermentation by using Restriction Fragments Lengths Polymorphism-Polimerase Chain Reaction (RFLP-PCR) and DNA sequencing methods. The study also focused on determining the effect of regional differences on yeast microflora of naturally fermented Gemlik olives. A total of 47 yeast strains belonging to 12 different species which had been previously isolated from the natural brine of Akhisar and Iznik-Gemlik cv. olives were characterized by molecular methods. Forty-two of the tested strains could be identified by RFLP-PCR to species level. These yeast species were determined as Candida mycetangi, Candida hellenica, Candida membranaefaciens, Candida famata, Candida pelliculosa, Saccharomyces cerevisiae, and Zygosaccharomyces mrakii. Five strains were identified by DNA sequencing. These strains belonged to three different species: Aureobasidium pullulans, Kloeckera apiculate, and Cryptococcus saitoi. The most frequent species were C. famata and C. pelliculosa in both regions. This work studies the yeasts from Turkish table olives which could prove to be of importance to the food industry in that area. On the other hand, it compares identification by molecular and classical biochemical methods and offers an idea about the differences between the ecosystems of Gemlik olives in the Akhisar (AO) and Iznik (IO) regions. The study could be useful in characterizing a very important product and, in this way, could help to promote its marketing. © 2018 Institute of Food Technologists®.

  7. Yeast and the AIDS Virus: The Odd Couple

    PubMed Central

    Andréola, Marie-Line; Litvak, Simon

    2012-01-01

    Despite being simple eukaryotic organisms, the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe have been widely used as a model to study human pathologies and the replication of human, animal, and plant viruses, as well as the function of individual viral proteins. The complete genome of S. cerevisiae was the first of eukaryotic origin to be sequenced and contains about 6,000 genes. More than 75% of the genes have an assigned function, while more than 40% share conserved sequences with known or predicted human genes. This strong homology has allowed the function of human orthologs to be unveiled starting from the data obtained in yeast. RNA plant viruses were the first to be studied in yeast. In this paper, we focus on the use of the yeast model to study the function of the proteins of human immunodeficiency virus type 1 (HIV-1) and the search for its cellular partners. This human retrovirus is the cause of AIDS. The WHO estimates that there are 33.4 million people worldwide living with HIV/AIDS, with 2.7 million new HIV infections per year and 2.0 million annual deaths due to AIDS. Current therapy is able to control the disease but there is no permanent cure or a vaccine. By using yeast, it is possible to dissect the function of some HIV-1 proteins and discover new cellular factors common to this simple cell and humans that may become potential therapeutic targets, leading to a long-lasting treatment for AIDS. PMID:22778552

  8. Yeast community in traditional Portuguese Serpa cheese by culture-dependent and -independent DNA approaches.

    PubMed

    Gonçalves Dos Santos, Maria Teresa P; Benito, María José; Córdoba, María de Guía; Alvarenga, Nuno; Ruiz-Moyano Seco de Herrera, Santiago

    2017-12-04

    This study investigated the yeast community present in the traditional Portuguese cheese, Serpa, by culture-dependent and -independent methods. Sixteen batches of Serpa cheeses from various regional industries registered with the Protected Designation of Origin (PDO) versus non-PDO registered, during spring and winter, were used. Irrespective of the producer, the yeast counts were around 5log CFU/g in winter and, overall, were lower in spring. The yeast species identified at the end of ripening (30days), using PCR-RFLP analysis and sequencing of the 26S rRNA, mainly corresponded to Debaryomyces hansenii and Kluyveromyces marxianus, with Candida spp. and Pichia spp. present to a lesser extent. The culture-independent results, obtained using high-throughput sequencing analysis, confirmed the prevalence of Debaryomyces spp. and Kluyveromyces spp. but, also, that Galactomyces spp. was relevant for three of the five producers, which indicates its importance during the early stages of the cheese ripening process, considering it was not found among the dominant viable yeast species. In addition, differences between the identified yeast isolated from cheeses obtained from PDO and non-PDO registered industries, showed that the lack of regulation of the cheese-making practice, may unfavourably influence the final yeast microbiota. The new knowledge provided by this study of the yeast diversity in Serpa cheese, could be used to modify the cheese ripening conditions, to favour desirable yeast species. Additionally, the prevalent yeast isolates identified, Debaryomyces hansenii and Kluyveromyces spp., may have an important role during cheese ripening and in the final sensorial characteristics. Thus, the study of their technological and functional properties could be relevant, in the development of an autochthonous starter culture, to ensure final quality and safety of the cheese. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Competitive Genomic Screens of Barcoded Yeast Libraries

    PubMed Central

    Urbanus, Malene; Proctor, Michael; Heisler, Lawrence E.; Giaever, Guri; Nislow, Corey

    2011-01-01

    By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment. PMID:21860376

  10. Synthetic genome engineering forging new frontiers for wine yeast.

    PubMed

    Pretorius, Isak S

    2017-02-01

    Over the past 15 years, the seismic shifts caused by the convergence of biomolecular, chemical, physical, mathematical, and computational sciences alongside cutting-edge developments in information technology and engineering have erupted into a new field of scientific endeavor dubbed Synthetic Biology. Recent rapid advances in high-throughput DNA sequencing and DNA synthesis techniques are enabling the design and construction of new biological parts (genes), devices (gene networks) and modules (biosynthetic pathways), and the redesign of biological systems (cells and organisms) for useful purposes. In 2014, the budding yeast Saccharomyces cerevisiae became the first eukaryotic cell to be equipped with a fully functional synthetic chromosome. This was achieved following the synthesis of the first viral (poliovirus in 2002 and bacteriophage Phi-X174 in 2003) and bacterial (Mycoplasma genitalium in 2008 and Mycoplasma mycoides in 2010) genomes, and less than two decades after revealing the full genome sequence of a laboratory (S288c in 1996) and wine (AWRI1631 in 2008) yeast strain. A large international project - the Synthetic Yeast Genome (Sc2.0) Project - is now underway to synthesize all 16 chromosomes (∼12 Mb carrying ∼6000 genes) of the sequenced S288c laboratory strain by 2018. If successful, S. cerevisiae will become the first eukaryote to cross the horizon of in silico design of complex cells through de novo synthesis, reshuffling, and editing of genomes. In the meantime, yeasts are being used as cell factories for the semi-synthetic production of high-value compounds, such as the potent antimalarial artemisinin, and food ingredients, such as resveratrol, vanillin, stevia, nootkatone, and saffron. As a continuum of previously genetically engineered industrially important yeast strains, precision genome engineering is bound to also impact the study and development of wine yeast strains supercharged with synthetic DNA. The first taste of what the future

  11. The yeast replicative aging model.

    PubMed

    He, Chong; Zhou, Chuankai; Kennedy, Brian K

    2018-03-08

    It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.

  12. [Yeast species in vulvovaginitis candidosa].

    PubMed

    Nemes-Nikodém, Éva; Tamási, Béla; Mihalik, Noémi; Ostorházi, Eszter

    2015-01-04

    Vulvovaginal candidiasis is the most common mycosis, however, the available information about antifungal susceptibilities of these yeasts is limited. To compare the gold standard fungal culture with a new molecular identification method and report the incidence of yeast species in vulvovaginitis candidosa. The authors studied 370 yeasts isolated from vulvovaginal candidiasis and identified them by phenotypic and molecular methods. The most common species was Candida albicans (85%), followed by Candida glabrata, and other Candida species. At present there are no recommendations for the evaluation of antifungal susceptibility of pathogenic fungal species occurring in vulvovaginal candidiasis and the natural antifungal resistance of the different species is known only. Matrix Assisted Laser Desorption Ionization Time of Flight identification can be used to differentiate the fluconazole resistant Candida dubliniensis and the sensitive Candida albicans strains.

  13. Centromere-Like Regions in the Budding Yeast Genome

    PubMed Central

    Lefrançois, Philippe; Auerbach, Raymond K.; Yellman, Christopher M.; Roeder, G. Shirleen; Snyder, Michael

    2013-01-01

    Accurate chromosome segregation requires centromeres (CENs), the DNA sequences where kinetochores form, to attach chromosomes to microtubules. In contrast to most eukaryotes, which have broad centromeres, Saccharomyces cerevisiae possesses sequence-defined point CENs. Chromatin immunoprecipitation followed by sequencing (ChIP–Seq) reveals colocalization of four kinetochore proteins at novel, discrete, non-centromeric regions, especially when levels of the centromeric histone H3 variant, Cse4 (a.k.a. CENP-A or CenH3), are elevated. These regions of overlapping protein binding enhance the segregation of plasmids and chromosomes and have thus been termed Centromere-Like Regions (CLRs). CLRs form in close proximity to S. cerevisiae CENs and share characteristics typical of both point and regional CENs. CLR sequences are conserved among related budding yeasts. Many genomic features characteristic of CLRs are also associated with these conserved homologous sequences from closely related budding yeasts. These studies provide general and important insights into the origin and evolution of centromeres. PMID:23349633

  14. Construction of a lactose-assimilating strain of baker's yeast.

    PubMed

    Adam, A C; Prieto, J A; Rubio-Texeira, M; Polaina, J

    1999-09-30

    A recombinant strain of baker's yeast has been constructed which can assimilate lactose efficiently. This strain has been designed to allow its propagation in whey, the byproduct resulting from cheese-making. The ability to metabolize lactose is conferred by the functional expression of two genes from Kluyveromyces lactis, LAC12 and LAC4, which encode a lactose permease and a beta-galactosidase, respectively. To make the recombinant strain more acceptable for its use in bread-making, the genetic transformation of the host baker's yeast was carried out with linear fragments of DNA of defined sequence, carrying as the only heterologous material the coding regions of the two K. lactis genes. Growth of the new strain on cheese whey affected neither the quality of bread nor the yeast gassing power. The significance of the newly developed strain is two-fold: it affords a cheap alternative to the procedure generally used for the propagation of baker's yeast, and it offers a profitable use for cheese whey. Copyright 1999 John Wiley & Sons, Ltd.

  15. Industrial Relevance of Chromosomal Copy Number Variation in Saccharomyces Yeasts.

    PubMed

    Gorter de Vries, Arthur R; Pronk, Jack T; Daran, Jean-Marc G

    2017-06-01

    Chromosomal copy number variation (CCNV) plays a key role in evolution and health of eukaryotes. The unicellular yeast Saccharomyces cerevisiae is an important model for studying the generation, physiological impact, and evolutionary significance of CCNV. Fundamental studies of this yeast have contributed to an extensive set of methods for analyzing and introducing CCNV. Moreover, these studies provided insight into the balance between negative and positive impacts of CCNV in evolutionary contexts. A growing body of evidence indicates that CCNV not only frequently occurs in industrial strains of Saccharomyces yeasts but also is a key contributor to the diversity of industrially relevant traits. This notion is further supported by the frequent involvement of CCNV in industrially relevant traits acquired during evolutionary engineering. This review describes recent developments in genome sequencing and genome editing techniques and discusses how these offer opportunities to unravel contributions of CCNV in industrial Saccharomyce s strains as well as to rationally engineer yeast chromosomal copy numbers and karyotypes. Copyright © 2017 Gorter de Vries et al.

  16. 'Yeast mail': a novel Saccharomyces application (NSA) to encrypt messages.

    PubMed

    Rosemeyer, Helmut; Paululat, Achim; Heinisch, Jürgen J

    2014-09-01

    The universal genetic code is used by all life forms to encode biological information. It can also be used to encrypt semantic messages and convey them within organisms without anyone but the sender and recipient knowing, i.e., as a means of steganography. Several theoretical, but comparatively few experimental, approaches have been dedicated to this subject, so far. Here, we describe an experimental system to stably integrate encrypted messages within the yeast genome using a polymerase chain reaction (PCR)-based, one-step homologous recombination system. Thus, DNA sequences encoding alphabetical and/or numerical information will be inherited by yeast propagation and can be sent in the form of dried yeast. Moreover, due to the availability of triple shuttle vectors, Saccharomyces cerevisiae can also be used as an intermediate construction device for transfer of information to either Drosophila or mammalian cells as steganographic containers. Besides its classical use in alcoholic fermentation and its modern use for heterologous gene expression, we here show that baker's yeast can thus be employed in a novel Saccharomyces application (NSA) as a simple steganographic container to hide and convey messages. Copyright © 2014 Verlag Helvetica Chimica Acta AG, Zürich.

  17. Prion-based memory of heat stress in yeast

    PubMed Central

    Chernova, Tatiana A.; Wilkinson, Keith D.

    2017-01-01

    ABSTRACT Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses. PMID:28521568

  18. Prion-based memory of heat stress in yeast.

    PubMed

    Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D

    2017-05-04

    Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.

  19. MAP kinase pathways in the yeast Saccharomyces cerevisiae

    NASA Technical Reports Server (NTRS)

    Gustin, M. C.; Albertyn, J.; Alexander, M.; Davenport, K.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    A cascade of three protein kinases known as a mitogen-activated protein kinase (MAPK) cascade is commonly found as part of the signaling pathways in eukaryotic cells. Almost two decades of genetic and biochemical experimentation plus the recently completed DNA sequence of the Saccharomyces cerevisiae genome have revealed just five functionally distinct MAPK cascades in this yeast. Sexual conjugation, cell growth, and adaptation to stress, for example, all require MAPK-mediated cellular responses. A primary function of these cascades appears to be the regulation of gene expression in response to extracellular signals or as part of specific developmental processes. In addition, the MAPK cascades often appear to regulate the cell cycle and vice versa. Despite the success of the gene hunter era in revealing these pathways, there are still many significant gaps in our knowledge of the molecular mechanisms for activation of these cascades and how the cascades regulate cell function. For example, comparison of different yeast signaling pathways reveals a surprising variety of different types of upstream signaling proteins that function to activate a MAPK cascade, yet how the upstream proteins actually activate the cascade remains unclear. We also know that the yeast MAPK pathways regulate each other and interact with other signaling pathways to produce a coordinated pattern of gene expression, but the molecular mechanisms of this cross talk are poorly understood. This review is therefore an attempt to present the current knowledge of MAPK pathways in yeast and some directions for future research in this area.

  20. Yeast species associated with the spontaneous fermentation of cider.

    PubMed

    Valles, Belén Suárez; Bedriñana, Rosa Pando; Tascón, Norman Fernández; Simón, Amparo Querol; Madrera, Roberto Rodríguez

    2007-02-01

    This paper reports the influence of cider-making technology (pneumatic and traditional pressing) on the dynamics of wild yeast populations. Yeast colonies isolated from apple juice before and throughout fermentation at a cider cellar of Asturias (Spain), during two consecutive years were studied. The yeast strains were identified by restriction fragment length polymorphism analysis of the 5.8S rRNA gene and the two flanking internal transcribed sequences (ITS). The musts obtained by pneumatic pressing were dominated by non-Saccharomyces yeasts (Hanseniaspora genus and Metschnikowia pulcherrima) whereas in the apple juices obtained by traditional pressing Saccharomyces together with non-Saccharomyces, were always present. The species Saccharomyces present were S. cerevisiae and S. bayanus. Apparently S. bayanus, was the predominant species at the beginning and the middle fermentation steps of the fermentation process, reaching a percentage of isolation between 33% and 41%, whereas S. cerevisiae took over the process in the final stages of fermentation. During the 2001 harvest, with independence of cider-making technology, the species Hanseniaspora valbyensis was always isolated at the end of fermentations.

  1. Marine yeast isolation and industrial application.

    PubMed

    Zaky, Abdelrahman Saleh; Tucker, Gregory A; Daw, Zakaria Yehia; Du, Chenyu

    2014-09-01

    Over the last century, terrestrial yeasts have been widely used in various industries, such as baking, brewing, wine, bioethanol and pharmaceutical protein production. However, only little attention has been given to marine yeasts. Recent research showed that marine yeasts have several unique and promising features over the terrestrial yeasts, for example higher osmosis tolerance, higher special chemical productivity and production of industrial enzymes. These indicate that marine yeasts have great potential to be applied in various industries. This review gathers the most recent techniques used for marine yeast isolation as well as the latest applications of marine yeast in bioethanol, pharmaceutical and enzyme production fields. © 2014 The Authors FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  2. Yeast Can Affect Behavior and Learning.

    ERIC Educational Resources Information Center

    Crook, William G.

    1984-01-01

    A pediatrician recounts his experiences in diagnosing and treating allergies to common yeast germs that may result in behavior and learning problems. He lists characteristics that may predispose children to yeast-connected health problems. (CL)

  3. Advances in yeast genome engineering.

    PubMed

    David, Florian; Siewers, Verena

    2015-02-01

    Genome engineering based on homologous recombination has been applied to yeast for many years. However, the growing importance of yeast as a cell factory in metabolic engineering and chassis in synthetic biology demands methods for fast and efficient introduction of multiple targeted changes such as gene knockouts and introduction of multistep metabolic pathways. In this review, we summarize recent improvements of existing genome engineering methods, the development of novel techniques, for example for advanced genome redesign and evolution, and the importance of endonucleases as genome engineering tools. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  4. The Yeast Nuclear Pore Complex

    PubMed Central

    Rout, Michael P.; Aitchison, John D.; Suprapto, Adisetyantari; Hjertaas, Kelly; Zhao, Yingming; Chait, Brian T.

    2000-01-01

    An understanding of how the nuclear pore complex (NPC) mediates nucleocytoplasmic exchange requires a comprehensive inventory of the molecular components of the NPC and a knowledge of how each component contributes to the overall structure of this large molecular translocation machine. Therefore, we have taken a comprehensive approach to classify all components of the yeast NPC (nucleoporins). This involved identifying all the proteins present in a highly enriched NPC fraction, determining which of these proteins were nucleoporins, and localizing each nucleoporin within the NPC. Using these data, we present a map of the molecular architecture of the yeast NPC and provide evidence for a Brownian affinity gating mechanism for nucleocytoplasmic transport. PMID:10684247

  5. Chromatin and Transcription in Yeast

    PubMed Central

    Rando, Oliver J.; Winston, Fred

    2012-01-01

    Understanding the mechanisms by which chromatin structure controls eukaryotic transcription has been an intense area of investigation for the past 25 years. Many of the key discoveries that created the foundation for this field came from studies of Saccharomyces cerevisiae, including the discovery of the role of chromatin in transcriptional silencing, as well as the discovery of chromatin-remodeling factors and histone modification activities. Since that time, studies in yeast have continued to contribute in leading ways. This review article summarizes the large body of yeast studies in this field. PMID:22345607

  6. A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

    PubMed

    Frazer, LilyAnn Novak; O'Keefe, Raymond T

    2007-09-01

    The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

  7. Yeast: A Research Organism for Teaching Genetics.

    ERIC Educational Resources Information Center

    Manney, Thomas R.; Manney, Monta L.

    1992-01-01

    Explains why laboratory strains of bakers yeast, Saccharomyces cerevisiae, are particularly suited for classroom science activities. Describes the sexual life cycle of yeast and the genetic system with visible mutations. Presents an overview of activities that can be done with yeast and gives a source for teachers to obtain more information. (PR)

  8. Fungal genome sequencing: basic biology to biotechnology.

    PubMed

    Sharma, Krishna Kant

    2016-08-01

    The genome sequences provide a first glimpse into the genomic basis of the biological diversity of filamentous fungi and yeast. The genome sequence of the budding yeast, Saccharomyces cerevisiae, with a small genome size, unicellular growth, and rich history of genetic and molecular analyses was a milestone of early genomics in the 1990s. The subsequent completion of fission yeast, Schizosaccharomyces pombe and genetic model, Neurospora crassa initiated a revolution in the genomics of the fungal kingdom. In due course of time, a substantial number of fungal genomes have been sequenced and publicly released, representing the widest sampling of genomes from any eukaryotic kingdom. An ambitious genome-sequencing program provides a wealth of data on metabolic diversity within the fungal kingdom, thereby enhancing research into medical science, agriculture science, ecology, bioremediation, bioenergy, and the biotechnology industry. Fungal genomics have higher potential to positively affect human health, environmental health, and the planet's stored energy. With a significant increase in sequenced fungal genomes, the known diversity of genes encoding organic acids, antibiotics, enzymes, and their pathways has increased exponentially. Currently, over a hundred fungal genome sequences are publicly available; however, no inclusive review has been published. This review is an initiative to address the significance of the fungal genome-sequencing program and provides the road map for basic and applied research.

  9. Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

    PubMed Central

    Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

    1998-01-01

    In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

  10. Functional Coupling of a Nematode Chemoreceptor to the Yeast Pheromone Response Pathway

    PubMed Central

    Tehseen, Muhammad; Dumancic, Mira; Briggs, Lyndall; Wang, Jian; Berna, Amalia; Anderson, Alisha; Trowell, Stephen

    2014-01-01

    Sequencing of the Caenorhabditis elegans genome revealed sequences encoding more than 1,000 G-protein coupled receptors, hundreds of which may respond to volatile organic ligands. To understand how the worm's simple olfactory system can sense its chemical environment there is a need to characterise a representative selection of these receptors but only very few receptors have been linked to a specific volatile ligand. We therefore set out to design a yeast expression system for assigning ligands to nematode chemoreceptors. We showed that while a model receptor ODR-10 binds to C. elegans Gα subunits ODR-3 and GPA-3 it cannot bind to yeast Gα. However, chimaeras between the nematode and yeast Gα subunits bound to both ODR-10 and the yeast Gβγ subunits. FIG2 was shown to be a superior MAP-dependent promoter for reporter expression. We replaced the endogenous Gα subunit (GPA1) of the Saccharomyces cerevisiae (ste2Δ sst2Δ far1Δ) triple mutant (“Cyb”) with a Gpa1/ODR-3 chimaera and introduced ODR-10 as a model nematode GPCR. This strain showed concentration-dependent activation of the yeast MAP kinase pathway in the presence of diacetyl, the first time that the native form of a nematode chemoreceptor has been functionally expressed in yeast. This is an important step towards en masse de-orphaning of C. elegans chemoreceptors. PMID:25415379

  11. The Genetics of Non-conventional Wine Yeasts: Current Knowledge and Future Challenges

    PubMed Central

    Masneuf-Pomarede, Isabelle; Bely, Marina; Marullo, Philippe; Albertin, Warren

    2016-01-01

    Saccharomyces cerevisiae is by far the most widely used yeast in oenology. However, during the last decade, several other yeasts species has been purposed for winemaking as they could positively impact wine quality. Some of these non-conventional yeasts (Torulaspora delbrueckii, Metschnikowia pulcherrima, Pichia kluyveri, Lachancea thermotolerans, etc.) are now proposed as starters culture for winemakers in mixed fermentation with S. cerevisiae, and several others are the subject of various studies (Hanseniaspora uvarum, Starmerella bacillaris, etc.). Along with their biotechnological use, the knowledge of these non-conventional yeasts greatly increased these last 10 years. The aim of this review is to describe the last updates and the current state-of-art of the genetics of non-conventional yeasts (including S. uvarum, T. delbrueckii, S. bacillaris, etc.). We describe how genomics and genetics tools provide new data into the population structure and biodiversity of non-conventional yeasts in winemaking environments. Future challenges will lie on the development of selection programs and/or genetic improvement of these non-conventional species. We discuss how genetics, genomics and the advances in next-generation sequencing will help the wine industry to develop the biotechnological use of non-conventional yeasts to improve the quality and differentiation of wines. PMID:26793188

  12. Construction of the yeast whole-cell Rhizopus oryzae lipase biocatalyst with high activity.

    PubMed

    Chen, Mei-ling; Guo, Qin; Wang, Rui-zhi; Xu, Juan; Zhou, Chen-wei; Ruan, Hui; He, Guo-qing

    2011-07-01

    Surface display is effectively utilized to construct a whole-cell biocatalyst. Codon optimization has been proven to be effective in maximizing production of heterologous proteins in yeast. Here, the cDNA sequence of Rhizopus oryzae lipase (ROL) was optimized and synthesized according to the codon bias of Saccharomyces cerevisiae, and based on the Saccharomyces cerevisiae cell surface display system with α-agglutinin as an anchor, recombinant yeast displaying fully codon-optimized ROL with high activity was successfully constructed. Compared with the wild-type ROL-displaying yeast, the activity of the codon-optimized ROL yeast whole-cell biocatalyst (25 U/g dried cells) was 12.8-fold higher in a hydrolysis reaction using p-nitrophenyl palmitate (pNPP) as the substrate. To our knowledge, this was the first attempt to combine the techniques of yeast surface display and codon optimization for whole-cell biocatalyst construction. Consequently, the yeast whole-cell ROL biocatalyst was constructed with high activity. The optimum pH and temperature for the yeast whole-cell ROL biocatalyst were pH 7.0 and 40 °C. Furthermore, this whole-cell biocatalyst was applied to the hydrolysis of tributyrin and the resulted conversion of butyric acid reached 96.91% after 144 h.

  13. Human alpha beta hydrolase domain containing protein 11 and its yeast homolog are lipid hydrolases

    SciTech Connect

    Arya, Madhuri; Srinivasan, Malathi; Rajasekharan, Ram

    Mammalian alpha/beta hydrolase domain (ABHD) family of proteins have emerged as key regulators of lipid metabolism and are found to be associated with human diseases. Human α/β-hydrolase domain containing protein 11 (ABHD11) has recently been predicted as a potential biomarker for human lung adenocarcinoma. In silico analyses of the ABHD11 protein sequence revealed the presence of a conserved lipase motif GXSXG. However, the role of ABHD11 in lipid metabolism is not known. To understand the biological function of ABHD11, we heterologously expressed the human ABHD11 in budding yeast, Saccharomyces cerevisiae. In vivo [{sup 14}C]acetate labeling of cellular lipids in yeast cellsmore » overexpressing ABHD11 showed a decrease in triacylglycerol content. Overexpression of ABHD11 also alters the molecular species of triacylglycerol in yeast. Similar activity was observed in its yeast homolog, Ygr031w. The role of the conserved lipase motif in the hydrolase activity was proven by the mutation of all conserved amino acid residues of GXSXG motif. Collectively, our results demonstrate that human ABHD11 and its yeast homolog YGR031W have a pivotal role in the lipid metabolism. - Highlights: • Overexpression of ABHD11 protein and its yeast homolog Ygr031w cause a reduction in triacylglycerol levels in yeast. • The reduction in triacylglycerol is due to the presence of lipase motif GXSXG. • Overexpression of ABHD11 and Ygr031w alters the molecular species of triacylglycerol.« less

  14. The Genetics of Non-conventional Wine Yeasts: Current Knowledge and Future Challenges.

    PubMed

    Masneuf-Pomarede, Isabelle; Bely, Marina; Marullo, Philippe; Albertin, Warren

    2015-01-01

    Saccharomyces cerevisiae is by far the most widely used yeast in oenology. However, during the last decade, several other yeasts species has been purposed for winemaking as they could positively impact wine quality. Some of these non-conventional yeasts (Torulaspora delbrueckii, Metschnikowia pulcherrima, Pichia kluyveri, Lachancea thermotolerans, etc.) are now proposed as starters culture for winemakers in mixed fermentation with S. cerevisiae, and several others are the subject of various studies (Hanseniaspora uvarum, Starmerella bacillaris, etc.). Along with their biotechnological use, the knowledge of these non-conventional yeasts greatly increased these last 10 years. The aim of this review is to describe the last updates and the current state-of-art of the genetics of non-conventional yeasts (including S. uvarum, T. delbrueckii, S. bacillaris, etc.). We describe how genomics and genetics tools provide new data into the population structure and biodiversity of non-conventional yeasts in winemaking environments. Future challenges will lie on the development of selection programs and/or genetic improvement of these non-conventional species. We discuss how genetics, genomics and the advances in next-generation sequencing will help the wine industry to develop the biotechnological use of non-conventional yeasts to improve the quality and differentiation of wines.

  15. Engineering yeasts for xylose metabolism

    Treesearch

    Thomas W. Jeffries

    2006-01-01

    Technologies for the production of alternative fuels are receiving increased attention owing to concerns over the rising cost of petrol and global warming. One such technology under development is the use of yeasts for the commercial fermentation of xylose to ethanol. Several approaches have been employed to engineer xylose metabolism. These involve modeling, flux...

  16. Yeast as factory and factotum.

    PubMed

    Dixon, B

    2000-02-01

    After centuries of vigorous activity in making fine wines, beers and breads, Saccharomyces cerevisiae is now acquiring a rich new portfolio of skills, bestowed by genetic manipulation. As shown in a recent shop-window of research supported by the European Commission, yeasts will soon be benefiting industries as diverse as fish farming, pharmaceuticals and laundering.

  17. A Molecular Portrait of De Novo Genes in Yeasts.

    PubMed

    Vakirlis, Nikolaos; Hebert, Alex S; Opulente, Dana A; Achaz, Guillaume; Hittinger, Chris Todd; Fischer, Gilles; Coon, Joshua J; Lafontaine, Ingrid

    2018-03-01

    New genes, with novel protein functions, can evolve "from scratch" out of intergenic sequences. These de novo genes can integrate the cell's genetic network and drive important phenotypic innovations. Therefore, identifying de novo genes and understanding how the transition from noncoding to coding occurs are key problems in evolutionary biology. However, identifying de novo genes is a difficult task, hampered by the presence of remote homologs, fast evolving sequences and erroneously annotated protein coding genes. To overcome these limitations, we developed a procedure that handles the usual pitfalls in de novo gene identification and predicted the emergence of 703 de novo gene candidates in 15 yeast species from 2 genera whose phylogeny spans at least 100 million years of evolution. We validated 85 candidates by proteomic data, providing new translation evidence for 25 of them through mass spectrometry experiments. We also unambiguously identified the mutations that enabled the transition from noncoding to coding for 30 Saccharomyces de novo genes. We established that de novo gene origination is a widespread phenomenon in yeasts, only a few being ultimately maintained by selection. We also found that de novo genes preferentially emerge next to divergent promoters in GC-rich intergenic regions where the probability of finding a fortuitous and transcribed ORF is the highest. Finally, we found a more than 3-fold enrichment of de novo genes at recombination hot spots, which are GC-rich and nucleosome-free regions, suggesting that meiotic recombination contributes to de novo gene emergence in yeasts.

  18. Yeast communities associated with artisanal mezcal fermentations from Agave salmiana.

    PubMed

    Verdugo Valdez, A; Segura Garcia, L; Kirchmayr, M; Ramírez Rodríguez, P; González Esquinca, A; Coria, R; Gschaedler Mathis, A

    2011-11-01

    The aims of this work were to characterize the fermentation process of mezcal from San Luis Potosi, México and identify the yeasts present in the fermentation using molecular culture-dependent methods (RFLP of the 5.8S-ITS and sequencing of the D1/D2 domain) and also by using a culture-independent method (DGGE). The alcoholic fermentations of two separate musts obtained from Agave salmiana were analyzed. Sugar, ethanol and major volatile compounds concentrations were higher in the first fermentation, which shows the importance of having a quality standard for raw materials, particularly in the concentration of fructans, in order to produce fermented Agave salmiana must with similar characteristics. One hundred ninety-two (192) different yeast colonies were identified, from those present on WL agar plates, by RFLP analysis of the ITS1-5.8S- ITS2 from the rRNA gene, with restriction endonucleases, HhaI, HaeIII and HinfI. The identified yeasts were: Saccharomyces cerevisiae, Kluyveromyces marxianus, Pichia kluyveri, Zygosaccharomyces bailii, Clavispora lusitaniae, Torulaspora delbrueckii, Candida ethanolica and Saccharomyces exiguus. These identifications were confirmed by sequencing the D1-D2 region of the 26S rRNA gene. With the PCR-DGGE method, bands corresponding to S. cerevisiae, K. marxianus and T. delbrueckii were clearly detected, confirming the results obtained with classic techniques.

  19. Functional Analysis With a Barcoder Yeast Gene Overexpression System

    PubMed Central

    Douglas, Alison C.; Smith, Andrew M.; Sharifpoor, Sara; Yan, Zhun; Durbic, Tanja; Heisler, Lawrence E.; Lee, Anna Y.; Ryan, Owen; Göttert, Hendrikje; Surendra, Anu; van Dyk, Dewald; Giaever, Guri; Boone, Charles; Nislow, Corey; Andrews, Brenda J.

    2012-01-01

    Systematic analysis of gene overexpression phenotypes provides an insight into gene function, enzyme targets, and biological pathways. Here, we describe a novel functional genomics platform that enables a highly parallel and systematic assessment of overexpression phenotypes in pooled cultures. First, we constructed a genome-level collection of ~5100 yeast barcoder strains, each of which carries a unique barcode, enabling pooled fitness assays with a barcode microarray or sequencing readout. Second, we constructed a yeast open reading frame (ORF) galactose-induced overexpression array by generating a genome-wide set of yeast transformants, each of which carries an individual plasmid-born and sequence-verified ORF derived from the Saccharomyces cerevisiae full-length EXpression-ready (FLEX) collection. We combined these collections genetically using synthetic genetic array methodology, generating ~5100 strains, each of which is barcoded and overexpresses a specific ORF, a set we termed “barFLEX.” Additional synthetic genetic array allows the barFLEX collection to be moved into different genetic backgrounds. As a proof-of-principle, we describe the properties of the barFLEX overexpression collection and its application in synthetic dosage lethality studies under different environmental conditions. PMID:23050238

  20. Budding yeast chromatin is dispersed in a crowded nucleoplasm in vivo

    PubMed Central

    Chen, Chen; Lim, Hong Hwa; Shi, Jian; Tamura, Sachiko; Maeshima, Kazuhiro; Surana, Uttam; Gan, Lu

    2016-01-01

    Chromatin organization has an important role in the regulation of eukaryotic systems. Although recent studies have refined the three-dimensional models of chromatin organization with high resolution at the genome sequence level, little is known about how the most fundamental units of chromatin—nucleosomes—are positioned in three dimensions in vivo. Here we use electron cryotomography to study chromatin organization in the budding yeast Saccharomyces cerevisiae. Direct visualization of yeast nuclear densities shows no evidence of 30-nm fibers. Aside from preribosomes and spindle microtubules, few nuclear structures are larger than a tetranucleosome. Yeast chromatin does not form compact structures in interphase or mitosis and is consistent with being in an “open” configuration that is conducive to high levels of transcription. From our study and those of others, we propose that yeast can regulate its transcription using local nucleosome–nucleosome associations. PMID:27605704

  1. Epidemiology and antifungal susceptibilities of yeast isolates causing invasive infections across urban Beijing, China.

    PubMed

    Guo, Li-Na; Xiao, Meng; Cao, Bin; Qu, Fen; Zhan, Yu-Liang; Hu, Yun-Jian; Wang, Xin-Ru; Liang, Guo-Wei; Gu, Hai-Tong; Qi, Jun; Yuan, Hui; Min, Rong; Wang, Fei-Yan; Liu, Lin-Juan; Wang, Hai-Bin; Jiang, Wei; Duan, Xue-Guang; Xu, Wen-Jian; Yu, Yan-Hua; Su, Jian-Rong; Zhang, Jian-Zhong; Nong, Jin-Qing; Liu, Shu-Mei; Li, Jun; Liu, Jun-Ting; Yue, Zhi-Gang; Yang, Duo; Guo, Jie; Zhao, Rui; Zhang, Ya-Nan; Yang, Xi-Ming; Liu, Xiao-Qing; Hsueh, Po-Ren; Xu, Ying-Chun

    2017-09-01

    To investigate the species distribution and antifungal susceptibility profiles of yeast isolates causing invasive infections across Beijing. A total of 1201 yeast isolates recovered from blood and other sterile body fluids were correctly identified by matrix-assisted laser desorption/ionization TOF MS supplemented by DNA sequencing. Antifungal susceptibility testing was performed according to the Clinical and Laboratory Standards Institute broth microdilution method. Candida (95.5%) remained the most common yeast species isolated; Candida albicans (38.8%) and Candida parapsilosis (22.6%) were the leading species of candidemia. Azole resistances were mainly observed in Candida glabrata and Candida tropicalis isolates. This study outlined the epidemiologic data of invasive yeast infections and highlighted the need for continuous monitoring of azole resistances among C. glabrata and C. tropicalis isolates in Beijing.

  2. MPact: the MIPS protein interaction resource on yeast.

    PubMed

    Güldener, Ulrich; Münsterkötter, Martin; Oesterheld, Matthias; Pagel, Philipp; Ruepp, Andreas; Mewes, Hans-Werner; Stümpflen, Volker

    2006-01-01

    In recent years, the Munich Information Center for Protein Sequences (MIPS) yeast protein-protein interaction (PPI) dataset has been used in numerous analyses of protein networks and has been called a gold standard because of its quality and comprehensiveness [H. Yu, N. M. Luscombe, H. X. Lu, X. Zhu, Y. Xia, J. D. Han, N. Bertin, S. Chung, M. Vidal and M. Gerstein (2004) Genome Res., 14, 1107-1118]. MPact and the yeast protein localization catalog provide information related to the proximity of proteins in yeast. Beside the integration of high-throughput data, information about experimental evidence for PPIs in the literature was compiled by experts adding up to 4300 distinct PPIs connecting 1500 proteins in yeast. As the interaction data is a complementary part of CYGD, interactive mapping of data on other integrated data types such as the functional classification catalog [A. Ruepp, A. Zollner, D. Maier, K. Albermann, J. Hani, M. Mokrejs, I. Tetko, U. Güldener, G. Mannhaupt, M. Münsterkötter and H. W. Mewes (2004) Nucleic Acids Res., 32, 5539-5545] is possible. A survey of signaling proteins and comparison with pathway data from KEGG demonstrates that based on these manually annotated data only an extensive overview of the complexity of this functional network can be obtained in yeast. The implementation of a web-based PPI-analysis tool allows analysis and visualization of protein interaction networks and facilitates integration of our curated data with high-throughput datasets. The complete dataset as well as user-defined sub-networks can be retrieved easily in the standardized PSI-MI format. The resource can be accessed through http://mips.gsf.de/genre/proj/mpact.

  3. Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin

    PubMed Central

    Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.

    2015-01-01

    Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315

  4. Automated multiplex genome-scale engineering in yeast

    PubMed Central

    Si, Tong; Chao, Ran; Min, Yuhao; Wu, Yuying; Ren, Wen; Zhao, Huimin

    2017-01-01

    Genome-scale engineering is indispensable in understanding and engineering microorganisms, but the current tools are mainly limited to bacterial systems. Here we report an automated platform for multiplex genome-scale engineering in Saccharomyces cerevisiae, an important eukaryotic model and widely used microbial cell factory. Standardized genetic parts encoding overexpression and knockdown mutations of >90% yeast genes are created in a single step from a full-length cDNA library. With the aid of CRISPR-Cas, these genetic parts are iteratively integrated into the repetitive genomic sequences in a modular manner using robotic automation. This system allows functional mapping and multiplex optimization on a genome scale for diverse phenotypes including cellulase expression, isobutanol production, glycerol utilization and acetic acid tolerance, and may greatly accelerate future genome-scale engineering endeavours in yeast. PMID:28469255

  5. Mapping the yeast genome by melting in nanofluidic devices

    NASA Astrophysics Data System (ADS)

    Welch, Robert L.; Czolkos, Ilja; Sladek, Rob; Reisner, Walter

    2012-02-01

    Optical mapping of DNA provides large-scale genomic information that can be used to assemble contigs from next-generation sequencing, and to detect re-arrangements between single cells. A recent optical mapping technique called denaturation mapping has the unique advantage of using physical principles rather than the action of enzymes to probe genomic structure. The absence of reagents or reaction steps makes denaturation mapping simpler than other protocols. Denaturation mapping uses fluorescence microscopy to image the pattern of partial melting along a DNA molecule extended in a channel of cross-section ˜100nm at the heart of a nanofluidic device. We successfully aligned melting maps from single DNA molecules to a theoretical map of the yeast genome (11.6Mbp) to identify their location. By aligning hundreds of molecules we assembled a consensus melting map of the yeast genome with 95% coverage.

  6. Contrasting evolutionary genome dynamics between domesticated and wild yeasts

    PubMed Central

    Yue, Jia-Xing; Li, Jing; Aigrain, Louise; Hallin, Johan; Persson, Karl; Oliver, Karen; Bergström, Anders; Coupland, Paul; Warringer, Jonas; Lagomarsino, Marco Consentino; Fischer, Gilles; Durbin, Richard; Liti, Gianni

    2017-01-01

    Structural rearrangements have long been recognized as an important source of genetic variation with implications in phenotypic diversity and disease, yet their detailed evolutionary dynamics remain elusive. Here, we use long-read sequencing to generate end-to-end genome assemblies for 12 strains representing major subpopulations of the partially domesticated yeast Saccharomyces cerevisiae and its wild relative Saccharomyces paradoxus. These population-level high-quality genomes with comprehensive annotation allow for the first time a precise definition of chromosomal boundaries between cores and subtelomeres and a high-resolution view of evolutionary genome dynamics. In chromosomal cores, S. paradoxus exhibits faster accumulation of balanced rearrangements (inversions, reciprocal translocations and transpositions) whereas S. cerevisiae accumulates unbalanced rearrangements (novel insertions, deletions and duplications) more rapidly. In subtelomeres, both species show extensive interchromosomal reshuffling, with a higher tempo in S. cerevisiae. Such striking contrasts between wild and domesticated yeasts likely reflect the influence of human activities on structural genome evolution. PMID:28416820

  7. Brewing characteristics of piezosensitive sake yeasts

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru

    2018-04-01

    Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.

  8. Identification of yeasts and evaluation of their distribution in Taiwanese Kefir and Viili starters.

    PubMed

    Wang, S Y; Chen, H C; Liu, J R; Lin, Y C; Chen, M J

    2008-10-01

    The objective of the present study was to investigate yeast communities in kefir grains and viili starters in Taiwan through conventional microbiological cultivation and polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). The DNA sequencing was used as a validity technique to ensure that all isolates within each group belonged to just one species, and to confirm the identified results of PCR-DGGE. Results indicated that a combination of conventional microbiological cultivation with PCR-DGGE and sequencing could successfully identify 4 yeast species from both types of cultures in Taiwan. Kluyveromyces marxianus, Saccharomyces turicensis, and Pichia fermentans were found in Taiwanese kefir grains with a distribution of 76, 22, and 2%, respectively, whereas Klu. marxianus, Saccharomyces unisporus and P. fermentans were identified in viili starters corresponding to 58, 11, and 31% of the total cell counts, respectively. Furthermore, the culture-independent method was applied to identify the yeast species using DGGE. Only 2 yeast species, Klu. marxianus and S. turicensis, were found in kefir grains and 2, Klu. marxianus and P. fermentans, in viili starters. These results suggest that in samples containing multiple species, PCR-DGGE may fail to detect some species. Sequences of yeast isolates reported in this study have been deposited in the GenBank database under accession nos. DQ139802, AF398485, DQ377652, and AY007920.

  9. Multiple α-Glucoside Transporter Genes in Brewer’s Yeast

    PubMed Central

    Jespersen, Lene; Cesar, Lene B.; Meaden, Philip G.; Jakobsen, Mogens

    1999-01-01

    Maltose and maltotriose are the two most abundant fermentable sugars in brewer’s wort, and the rate of uptake of these sugars by brewer’s yeast can have a major impact on fermentation performance. In spite of this, no information is currently available on the genetics of maltose and maltotriose uptake in brewing strains of yeast. In this work, we studied 30 brewing strains of yeast (5 ale strains and 25 lager strains) with the aim of examining the alleles of maltose and maltotriose transporter genes contained by them. To do this, we hybridized gene probes to chromosome blots. Studies performed with laboratory strains have shown that maltose utilization is conferred by any one of five unlinked but highly homologous MAL loci (MAL1 to MAL4 and MAL6). Gene 1 at each locus encodes a maltose transporter. All of the strains of brewer’s yeast examined except two were found to contain MAL11 and MAL31 sequences, and only one of these strains lacked MAL41. MAL21 was not present in the five ale strains and 12 of the lager strains. MAL61 was not found in any of the yeast strains. In three of the lager strains, there was evidence that MAL transporter gene sequences occurred on chromosomes other than those known to carry MAL loci. Sequences corresponding to the AGT1 gene, which encodes a transporter of several α-glucosides, including maltose and maltotriose, were detected in all but one of the yeast strains. Homologues of AGT1 were identified in three of the lager strains, and two of these homologues were mapped, one to chromosome II and the other to chromosome XI. AGT1 appears to be a member of a family of closely related genes, which may have arisen in brewer’s yeast in response to selective pressure. PMID:9925567

  10. RNA interactome capture in yeast.

    PubMed

    Beckmann, Benedikt M

    2017-04-15

    RNA-binding proteins (RBPs) are key players in post-transcriptional regulation of gene expression in eukaryotic cells. To be able to unbiasedly identify RBPs in Saccharomyces cerevisiae, we developed a yeast RNA interactome capture protocol which employs RNA labeling, covalent UV crosslinking of RNA and proteins at 365nm wavelength (photoactivatable-ribonucleoside-enhanced crosslinking, PAR-CL) and finally purification of the protein-bound mRNA. The method can be easily implemented in common workflows and takes about 3days to complete. Next to a comprehensive explanation of the method, we focus on our findings about the choice of crosslinking in yeast and discuss the rationale of individual steps in the protocol. Copyright © 2016. Published by Elsevier Inc.

  11. The Isolation of Invertase from Baker's Yeast: A Four-Part Exercise in Protein Purification and Characterization

    ERIC Educational Resources Information Center

    Timerman, Anthony P.; Fenrick, Angela M.; Zamis, Thomas M.

    2009-01-01

    A sequence of exercises for the isolation and characterization of invertase (E.C. 3.1.2.26) from baker's yeast obtained from a local grocery store is outlined. Because the enzyme is colorless, the use of colored markers and the sequence of purification steps are designed to "visualize" the process by which a colorless protein is selectively…

  12. Quantitative phenotyping via deep barcode sequencing.

    PubMed

    Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

    2009-10-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

  13. Quantitative phenotyping via deep barcode sequencing

    PubMed Central

    Smith, Andrew M.; Heisler, Lawrence E.; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J.; Chee, Mark; Roth, Frederick P.; Giaever, Guri; Nislow, Corey

    2009-01-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or “Bar-seq,” outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that ∼20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene–environment interactions on a genome-wide scale. PMID:19622793

  14. Structure, replication efficiency and fragility of yeast ARS elements.

    PubMed

    Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana

    2012-05-01

    DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  15. Yeast flocculation: New story in fuel ethanol production.

    PubMed

    Zhao, X Q; Bai, F W

    2009-01-01

    Yeast flocculation has been used in the brewing industry to facilitate biomass recovery for a long time, and thus its mechanism of yeast flocculation has been intensively studied. However, the application of flocculating yeast in ethanol production garnered attention mainly in the 1980s and 1990s. In this article, updated research progress in the molecular mechanism of yeast flocculation and the impact of environmental conditions on yeast flocculation are reviewed. Construction of flocculating yeast strains by genetic approach and utilization of yeast flocculation for ethanol production from various feedstocks were presented. The concept of self-immobilized yeast cells through their flocculation is revisited through a case study of continuous ethanol fermentation with the flocculating yeast SPSC01, and their technical and economic advantages are highlighted by comparing with yeast cells immobilized with supporting materials and regular free yeast cells as well. Taking the flocculating yeast SPSC01 as an example, the ethanol tolerance of the flocculating yeast was also discussed.

  16. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  17. Diversity of yeasts associated with the sea surface microlayer and underlying water along the northern coast of Taiwan.

    PubMed

    Chang, Chin-Feng; Lee, Ching-Fu; Lin, Kao-Yung; Liu, Shiu-Mei

    2016-01-01

    Yeast communities inhabiting the sea surface microlayer (SSML) on the northern coast of Taiwan were examined using a cultivation method and compared with those inhabiting the underlying water (UW) at a 50-cm depth. Culturable yeasts were recovered from the SSML and UW samples collected in the morning during 4 field campaigns, and 420 strains were isolated. The 420 isolates were grouped into 43 species using a polyphasic molecular approach, including sequence analysis of the 26S rDNA D1/D2 domain and 5.8S-ITS region. From the SSML samples, 12 genera and 39 species, including 7 new species of Cryptococcus sp. (1), Candida spp. (4), and Rhodotorula spp. (2), were isolated. From the UW samples, 10 genera and 21 species, including one new species of Rhodotorula sp. (1), were isolated. Rhodotorula mucilaginosa was the most abundant species present in the yeast community in SSML (37.6%) and UW (21.6%) samples. Basidiomycetous yeasts (63.6%) and pigmented yeasts (64.5%) comprised the major yeast population. The yeast community in the SSML had a higher species number and abundance than the UW. Moreover, although the majority of yeast community species were from the SSML, individual species distribution in the SSML was unequal. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  18. Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

    PubMed

    Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

    2015-03-01

    Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

  19. 21 CFR 172.898 - Bakers yeast glycan.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Bakers yeast glycan. 172.898 Section 172.898 Food... Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized, and dried cell walls of the yeast...

  20. Yeasts Diversity in Fermented Foods and Beverages

    NASA Astrophysics Data System (ADS)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  1. Nutrient supplements boost yeast transformation efficiency

    PubMed Central

    Yu, Sheng-Chun; Dawson, Alexander; Henderson, Alyssa C.; Lockyer, Eloise J.; Read, Emily; Sritharan, Gayathri; Ryan, Marjah; Sgroi, Mara; Ngou, Pok M.; Woodruff, Rosie; Zhang, Ruifeng; Ren Teen Chia, Travis; Liu, Yu; Xiang, Yiyu; Spanu, Pietro D.

    2016-01-01

    Efficiency of yeast transformation is determined by the rate of yeast endocytosis. The aim of this study was to investigate the effect of introducing amino acids and other nutrients (inositol, adenine, or p-aminobenzoic acid) in the transformation medium to develop a highly efficient yeast transformation protocol. The target of rapamycin complex 1 (TORC1) kinase signalling complex influences the rate of yeast endocytosis. TORC signaling is induced by amino acids in the media. Here, we found that increasing the concentration of amino acids and other nutrients in the growth media lead to an increase yeast transformation efficiency up to 107 CFU per μg plasmid DNA and per 108 cells with a 13.8 kb plasmid DNA. This is over 130 times that of current published methods. This improvement may facilitate more efficient experimentation in which transformation efficiency is critical, such as yeast two-hybrid screening. PMID:27760994

  2. [Treatment of oil-manufacturing wastewater by yeast-SBR system].

    PubMed

    Lü, Wen-zhou; Liu, Ying; Huang, Yi-zhen

    2008-04-01

    Eight yeast strains were applied to a sequencing batch reactor (SBR) to treat high-strength oil-containing wastewater. The removal performance, yeast cultivation method and key factors affecting the stability of system were discussed. The results show yeast sludge with MLSS of 19 g/L and SVI of 35 mL/g can be obtained in 6 d in an open system without any molds and bacteria inhibitor addition; In 30 d continuous wastewater treatment, COD and oil removal rate achieve 86.8%-96.9% and above 99.5% respectively under the influent conditions of the COD of 9000-23000 mg/L and oil of 4500-16000 mg/L; Short period of pH impact brings reversible effects on the system and the sludge retention time can affect the SVI of the yeast; Absence of nitrogen induces morphology conversion of some yeast cells from single cell to filamentous one and impairs the settling capability of the yeast.

  3. Diversity of endophytic yeasts from sweet orange and their localization by scanning electron microscopy.

    PubMed

    Gai, Cláudia Santos; Lacava, Paulo Teixeira; Maccheroni, Walter; Glienke, Chirlei; Araújo, Welington Luiz; Miller, Thomas Albert; Azevedo, João Lúcio

    2009-10-01

    Endophytes are microorganisms that colonize plant tissues internally without causing harm to the host. Despite the increasing number of studies on sweet orange pathogens and endophytes, yeast has not been described as a sweet orange endophyte. In the present study, endophytic yeasts were isolated from sweet orange plants and identified by sequencing of internal transcribed spacer (ITS) rRNA. Plants sampled from four different sites in the state of São Paulo, Brazil exhibited different levels of CVC (citrus variegated chlorosis) development. Three citrus endophytic yeasts (CEYs), chosen as representative examples of the isolates observed, were identified as Rhodotorula mucilaginosa, Pichia guilliermondii and Cryptococcus flavescens. These strains were inoculated into axenic Citrus sinensis seedlings. After 45 days, endophytes were re-isolated in populations ranging from 10(6) to 10(9) CFU/g of plant tissue, but, in spite of the high concentrations of yeast cells, no disease symptoms were observed. Colonized plant material was examined by scanning electron microscopy (SEM), and yeast cells were found mainly in the stomata and xylem of plants, reinforcing their endophytic nature. P. guilliermondii was isolated primarily from plants colonized by the causal agent of CVC, Xylella fastidiosa. The supernatant from a culture of P. guilliermondii increased the in vitro growth of X. fastidiosa, suggesting that the yeast could assist in the establishment of this pathogen in its host plant and, therefore, contribute to the development of disease symptoms. Copyright 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. [Yeast colonization of urinary catheters and the significance of biofilm formation].

    PubMed

    Růžička, Filip; Holá, Veronika; Mahelová, Martina; Procházková, Alena

    2012-08-01

    Urinary catheters are colonized by a wide range of microorganisms, including numerous yeasts. The catheters are usually colonized by more microbial species forming a community - multispecies biofilm. Catheter colonization usually does not affect the patient's clinical status in any significant way. On the other hand, the biofilm can become a source of endogenous infection and its presence can affect functionality of the catheter and formation of urinary stones. Material a A total of 721 urinary catheters were studied. Microorganisms were released from catheters by sonication and subsequently cultured. Their identification was performed with the use of common phenotypic tests, as well as using MALDI TOF. Yeasts whose identification was ambiguous were recognized by sequencing. Biofilm formation was assessed by growth in a microtiter plate. Yeast colonization was proved in 244 urinary catheters. However, a total of 274 yeast strains were isolated. Most of them occurred together with other yeast species and/or bacteria on the catheters, producing multispecies biofilm there. The most frequent species was Candida albicans (a total of 144 isolated strains), followed by Candida glabrata (41), Candida tropicalis (41) and Candida parapsilosis sensu stricto (14). Other isolated species were as follows: Candida kefyr (10), Candida krusei (9), Candida fabianii (6), Candida lusitaniae (5), Candida dubliniensis (3) and Saccharomyces cerevisiae (one case). Most of the yeasts rather readily formed a firmly adhering biofilm layer on artificial surfaces.

  5. The yeast Golgi apparatus: insights and mysteries

    PubMed Central

    Papanikou, Effrosyni; Glick, Benjamin S.

    2009-01-01

    The Golgi apparatus is known to modify and sort newly synthesized secretory proteins. However, fundamental mysteries remain about the structure, operation, and dynamics of this organelle. Important insights have emerged from studying the Golgi in yeasts. For example, yeasts have provided direct evidence for Golgi cisternal maturation, a mechanism that is likely to be broadly conserved. Here, we highlight features of the yeast Golgi as well as challenges that lie ahead. PMID:19879270

  6. Yeasts in floral nectar: a quantitative survey

    PubMed Central

    Herrera, Carlos M.; de Vega, Clara; Canto, Azucena; Pozo, María I.

    2009-01-01

    Background and Aims One peculiarity of floral nectar that remains relatively unexplored from an ecological perspective is its role as a natural habitat for micro-organisms. This study assesses the frequency of occurrence and abundance of yeast cells in floral nectar of insect-pollinated plants from three contrasting plant communities on two continents. Possible correlations between interspecific differences in yeast incidence and pollinator composition are also explored. Methods The study was conducted at three widely separated areas, two in the Iberian Peninsula (Spain) and one in the Yucatán Peninsula (Mexico). Floral nectar samples from 130 species (37–63 species per region) in 44 families were examined microscopically for the presence of yeast cells. For one of the Spanish sites, the relationship across species between incidence of yeasts in nectar and the proportion of flowers visited by each of five major pollinator categories was also investigated. Key Results Yeasts occurred regularly in the floral nectar of many species, where they sometimes reached extraordinary densities (up to 4 × 105 cells mm−3). Depending on the region, between 32 and 44 % of all nectar samples contained yeasts. Yeast cell densities in the order of 104 cells mm−3 were commonplace, and densities >105 cells mm−3 were not rare. About one-fifth of species at each site had mean yeast cell densities >104 cells mm−3. Across species, yeast frequency and abundance were directly correlated with the proportion of floral visits by bumble-bees, and inversely with the proportion of visits by solitary bees. Conclusions Incorporating nectar yeasts into the scenario of plant–pollinator interactions opens up a number of intriguing avenues for research. In addition, with yeasts being as ubiquitous and abundant in floral nectars as revealed by this study, and given their astounding metabolic versatility, studies focusing on nectar chemical features should carefully control for the presence

  7. Single nucleotide polymorphisms of PAD1 and FDC1 show a positive relationship with ferulic acid decarboxylation ability among industrial yeasts used in alcoholic beverage production.

    PubMed

    Mukai, Nobuhiko; Masaki, Kazuo; Fujii, Tsutomu; Iefuji, Haruyuki

    2014-07-01

    Among industrial yeasts used for alcoholic beverage production, most wine and weizen beer yeasts decarboxylate ferulic acid to 4-vinylguaiacol, which has a smoke-like flavor, whereas sake, shochu, top-fermenting, and bottom-fermenting yeast strains lack this ability. However, the factors underlying this difference among industrial yeasts are not clear. We previously confirmed that both PAD1 (phenylacrylic acid decarboxylase gene, YDR538W) and FDC1 (ferulic acid decarboxylase gene, YDR539W) are essential for the decarboxylation of phenylacrylic acids in Saccharomyces cerevisiae. In the present study, single nucleotide polymorphisms (SNPs) of PAD1 and FDC1 in sake, shochu, wine, weizen, top-fermenting, bottom-fermenting, and laboratory yeast strains were examined to clarify the differences in ferulic acid decarboxylation ability between these types of yeast. For PAD1, a nonsense mutation was observed in the gene sequence of standard top-fermenting yeast. Gene sequence analysis of FDC1 revealed that sake, shochu, and standard top-fermenting yeasts contained a nonsense mutation, whereas a frameshift mutation was identified in the FDC1 gene of bottom-fermenting yeast. No nonsense or frameshift mutations were detected in laboratory, wine, or weizen beer yeast strains. When FDC1 was introduced into sake and shochu yeast strains, the transformants exhibited ferulic acid decarboxylation activity. Our findings indicate that a positive relationship exists between SNPs in PAD1 and FDC1 genes and the ferulic acid decarboxylation ability of industrial yeast strains. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Initiation at closely spaced replication origins in a yeast chromosome.

    PubMed

    Brewer, B J; Fangman, W L

    1993-12-10

    Replication of eukaryotic chromosomes involves initiation at origins spaced an average of 50 to 100 kilobase pairs. In yeast, potential origins can be recognized as autonomous replication sequences (ARSs) that allow maintenance of plasmids. However, there are more ARS elements than active chromosomal origins. The possibility was examined that close spacing of ARSs can lead to inactive origins. Two ARSs located 6.5 kilobase pairs apart can indeed interfere with each other. Replication is initiated from one or the other ARS with equal probability, but rarely (< 5%) from both ARSs on the same DNA molecule.

  9. PomBase: The Scientific Resource for Fission Yeast.

    PubMed

    Lock, Antonia; Rutherford, Kim; Harris, Midori A; Wood, Valerie

    2018-01-01

    The fission yeast Schizosaccharomyces pombe has become well established as a model species for studying conserved cell-level biological processes, especially the mechanics and regulation of cell division. PomBase integrates the S. pombe genome sequence with traditional genetic, molecular, and cell biological experimental data as well as the growing body of large datasets generated by emerging high-throughput methods. This chapter provides insight into the curation philosophy and data organization at PomBase, and provides a guide to using PomBase for infrequent visitors and anyone considering exploring S. pombe in their research.

  10. Metabolic reconstruction and flux analysis of industrial Pichia yeasts.

    PubMed

    Chung, Bevan Kai-Sheng; Lakshmanan, Meiyappan; Klement, Maximilian; Ching, Chi Bun; Lee, Dong-Yup

    2013-03-01

    Pichia yeasts have been recognized as important microbial cell factories in the biotechnological industry. Notably, the Pichia pastoris and Pichia stipitis species have attracted much research interest due to their unique cellular physiology and metabolic capability: P. pastoris has the ability to utilize methanol for cell growth and recombinant protein production, while P. stipitis is capable of assimilating xylose to produce ethanol under oxygen-limited conditions. To harness these characteristics for biotechnological applications, it is highly required to characterize their metabolic behavior. Recently, following the genome sequencing of these two Pichia species, genome-scale metabolic networks have been reconstructed to model the yeasts' metabolism from a systems perspective. To date, there are three genome-scale models available for each of P. pastoris and P. stipitis. In this mini-review, we provide an overview of the models, discuss certain limitations of previous studies, and propose potential future works that can be conducted to better understand and engineer Pichia yeasts for industrial applications.

  11. Antigenic characterisation of yeast-expressed lyssavirus nucleoproteins.

    PubMed

    Kucinskaite, Indre; Juozapaitis, Mindaugas; Serva, Andrius; Zvirbliene, Aurelija; Johnson, Nicholas; Staniulis, Juozas; Fooks, Anthony R; Müller, Thomas; Sasnauskas, Kestutis; Ulrich, Rainer G

    2007-12-01

    In Europe, three genotypes of the genus Lyssavirus, family Rhabdoviridae, are present, classical rabies virus (RABV, genotype 1), European bat lyssavirus type 1 (EBLV-1, genotype 5) and European bat lyssavirus type 2 (EBLV-2, genotype 6). The entire authentic nucleoprotein (N protein) encoding sequences of RABV (challenge virus standard, CVS, strain), EBLV-1 and EBLV-2 were expressed in yeast Saccharomyces cerevisiae at high level. Purification of recombinant N proteins by caesium chloride gradient centrifugation resulted in yields between 14-17, 25-29 and 18-20 mg/l of induced yeast culture for RABV-CVS, EBLV-1 and EBLV-2, respectively. The purified N proteins were evaluated by negative staining electron microscopy, which revealed the formation of nucleocapsid-like structures. The antigenic conformation of the N proteins was investigated for their reactivity with monoclonal antibodies (mAbs) directed against different lyssaviruses. The reactivity pattern of each mAb was virtually identical between immunofluorescence assay with virus-infected cells, and ELISA and dot blot assay using the corresponding recombinant N proteins. These observations lead us to conclude that yeast-expressed lyssavirus N proteins share antigenic properties with naturally expressed virus protein. These recombinant proteins have the potential for use as components of serological assays for lyssaviruses.

  12. Engineering yeasts as platform organisms for cannabinoid biosynthesis.

    PubMed

    Zirpel, Bastian; Degenhardt, Friederike; Martin, Chantale; Kayser, Oliver; Stehle, Felix

    2017-10-10

    Δ 9 -tetrahydrocannabinolic acid (THCA) is a plant derived secondary natural product from the plant Cannabis satival. The discovery of the human endocannabinoid system in the late 1980s resulted in a growing number of known physiological functions of both synthetic and plant derived cannabinoids. Thus, manifold therapeutic indications of cannabinoids currently comprise a significant area of research. Here we reconstituted the final biosynthetic cannabinoid pathway in yeasts. The use of the soluble prenyltransferase NphB from Streptomyces sp. strain CL190 enables the replacement of the native transmembrane prenyltransferase cannabigerolic acid synthase from C. sativa. In addition to the desired product cannabigerolic acid, NphB catalyzes an O-prenylation leading to 2-O-geranyl olivetolic acid. We show for the first time that the bacterial prenyltransferase and the final enzyme of the cannabinoid pathway tetrahydrocannabinolic acid synthase can both be actively expressed in the yeasts Saccharomyces cerevisiae and Komagataella phaffii simultaneously. While enzyme activities in S. cerevisiae were insufficient to produce THCA from olivetolic acid and geranyl diphosphate, genomic multi-copy integrations of the enzyme's coding sequences in K. phaffii resulted in successful synthesis of THCA from olivetolic acid and geranyl diphosphate. This study is an important step toward total biosynthesis of valuable cannabinoids and derivatives and demonstrates the potential for developing a sustainable and secure yeast bio-manufacturing platform. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Protein aggregation induced during glass bead lysis of yeast

    PubMed Central

    Papanayotou, Irene; Sun, Beimeng; Roth, Amy F.; Davis, Nicholas G.

    2013-01-01

    Yeast cell lysates produced by mechanical glass bead disruption are widely used in a variety of applications, including for the analysis of native function, e.g. protein–protein interaction, enzyme assays and membrane fractionations. Below, we report a striking case of protein denaturation and aggregation that is induced by this lysis protocol. Most of this analysis focuses on the type 1 casein kinase Yck2, which normally tethers to the plasma membrane through C-terminal palmitoylation. Surprisingly, when cells are subjected to glass bead disruption, non-palmitoylated, cytosolic forms of the kinase denature and aggregate, while membrane-associated forms, whether attached through their native palmitoyl tethers or through a variety of artificial membrane-tethering sequences, are wholly protected from denaturation and aggregation. A wider look at the yeast proteome finds that, while the majority of proteins resist glass bead-induced aggregation, a significant subset does, in fact, succumb to such denaturation. Thus, yeast researchers should be aware of this potential artifact when embarking on biochemical analyses that employ glass bead lysates to look at native protein function. Finally, we demonstrate an experimental utility for glass bead-induced aggregation, using its fine discrimination of membrane-associated from non-associated Yck2 forms to discern fractional palmitoylation states of Yck2 mutants that are partially defective for palmitoylation. PMID:20641011

  14. Generation of henipavirus nucleocapsid proteins in yeast Saccharomyces cerevisiae.

    PubMed

    Juozapaitis, Mindaugas; Serva, Andrius; Zvirbliene, Aurelija; Slibinskas, Rimantas; Staniulis, Juozas; Sasnauskas, Kestutis; Shiell, Brian J; Wang, Lin-Fa; Michalski, Wojtek P

    2007-03-01

    Hendra and Nipah viruses are newly emerged, zoonotic viruses and their genomes have nucleotide and predicted amino acid homologies placing them in the family Paramyxoviridae. Currently these viruses are classified in the new genus Henipavirus, within the subfamily Paramyxovirinae, family Paramyxoviridae. The genes encoding HeV and NiV nucleocapsid proteins were cloned into the yeast Saccharomyces cerevisiae expression vector pFGG3 under control of GAL7 promoter. A high level of expression of these proteins (18-20 mg l(-1) of yeast culture) was obtained. Mass spectrometric analysis confirmed the primary structure of both proteins with 92% sequence coverage obtained using MS/MS analysis. Electron microscopy demonstrated the assembly of typical herring-bone structures of purified recombinant nucleocapsid proteins, characteristic for other paramyxoviruses. The nucleocapsid proteins revealed stability in yeast and can be easily purified by cesium chloride gradient ultracentrifugation. HeV nucleocapsid protein was detected by sera derived from fruit bats, humans, horses infected with HeV, and NiV nucleocapsid protein was immunodetected with sera from, fruit bats, humans and pigs. The development of an efficient and cost-effective system for generation of henipavirus nucleocapsid proteins might help to improve reagents for diagnosis of viruses.

  15. Naumovozyma castellii: an alternative model for budding yeast molecular biology.

    PubMed

    Karademir Andersson, Ahu; Cohn, Marita

    2017-03-01

    Naumovozyma castellii (Saccharomyces castellii) is a member of the budding yeast family Saccharomycetaceae. It has been extensively used as a model organism for telomere biology research and has gained increasing interest as a budding yeast model for functional analyses owing to its amenability to genetic modifications. Owing to the suitable phylogenetic distance to S. cerevisiae, the whole genome sequence of N. castellii has provided unique data for comparative genomic studies, and it played a key role in the establishment of the timing of the whole genome duplication and the evolutionary events that took place in the subsequent genomic evolution of the Saccharomyces lineage. Here we summarize the historical background of its establishment as a laboratory yeast species, and the development of genetic and molecular tools and strains. We review the research performed on N. castellii, focusing on areas where it has significantly contributed to the discovery of new features of molecular biology and to the advancement of our understanding of molecular evolution. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

    PubMed

    Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

    2016-09-01

    Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

  17. Functional mapping of yeast genomes by saturated transposition

    PubMed Central

    Michel, Agnès H; Hatakeyama, Riko; Kimmig, Philipp; Arter, Meret; Peter, Matthias; Matos, Joao; De Virgilio, Claudio; Kornmann, Benoît

    2017-01-01

    Yeast is a powerful model for systems genetics. We present a versatile, time- and labor-efficient method to functionally explore the Saccharomyces cerevisiae genome using saturated transposon mutagenesis coupled to high-throughput sequencing. SAturated Transposon Analysis in Yeast (SATAY) allows one-step mapping of all genetic loci in which transposons can insert without disrupting essential functions. SATAY is particularly suited to discover loci important for growth under various conditions. SATAY (1) reveals positive and negative genetic interactions in single and multiple mutant strains, (2) can identify drug targets, (3) detects not only essential genes, but also essential protein domains, (4) generates both null and other informative alleles. In a SATAY screen for rapamycin-resistant mutants, we identify Pib2 (PhosphoInositide-Binding 2) as a master regulator of TORC1. We describe two antagonistic TORC1-activating and -inhibiting activities located on opposite ends of Pib2. Thus, SATAY allows to easily explore the yeast genome at unprecedented resolution and throughput. DOI: http://dx.doi.org/10.7554/eLife.23570.001 PMID:28481201

  18. Evidence for a high mutation rate at rapidly evolving yeast centromeres.

    PubMed

    Bensasson, Douda

    2011-07-18

    Although their role in cell division is essential, centromeres evolve rapidly in animals, plants and yeasts. Unlike the complex centromeres of plants and aminals, the point centromeres of Saccharomcyes yeasts can be readily sequenced to distinguish amongst the possible explanations for fast centromere evolution. Using DNA sequences of all 16 centromeres from 34 strains of Saccharomyces cerevisiae and population genomic data from Saccharomyces paradoxus, I show that centromeres in both species evolve 3 times more rapidly even than selectively unconstrained DNA. Exceptionally high levels of polymorphism seen in multiple yeast populations suggest that rapid centromere evolution does not result from the repeated selective sweeps expected under meiotic drive. I further show that there is little evidence for crossing-over or gene conversion within centromeres, although there is clear evidence for recombination in their immediate vicinity. Finally I show that the mutation spectrum at centromeres is consistent with the pattern of spontaneous mutation elsewhere in the genome. These results indicate that rapid centromere evolution is a common phenomenon in yeast species. Furthermore, these results suggest that rapid centromere evolution does not result from the mutagenic effect of gene conversion, but from a generalised increase in the mutation rate, perhaps arising from the unusual chromatin structure at centromeres in yeast and other eukaryotes.

  19. Evidence for a high mutation rate at rapidly evolving yeast centromeres

    PubMed Central

    2011-01-01

    Background Although their role in cell division is essential, centromeres evolve rapidly in animals, plants and yeasts. Unlike the complex centromeres of plants and aminals, the point centromeres of Saccharomcyes yeasts can be readily sequenced to distinguish amongst the possible explanations for fast centromere evolution. Results Using DNA sequences of all 16 centromeres from 34 strains of Saccharomyces cerevisiae and population genomic data from Saccharomyces paradoxus, I show that centromeres in both species evolve 3 times more rapidly even than selectively unconstrained DNA. Exceptionally high levels of polymorphism seen in multiple yeast populations suggest that rapid centromere evolution does not result from the repeated selective sweeps expected under meiotic drive. I further show that there is little evidence for crossing-over or gene conversion within centromeres, although there is clear evidence for recombination in their immediate vicinity. Finally I show that the mutation spectrum at centromeres is consistent with the pattern of spontaneous mutation elsewhere in the genome. Conclusions These results indicate that rapid centromere evolution is a common phenomenon in yeast species. Furthermore, these results suggest that rapid centromere evolution does not result from the mutagenic effect of gene conversion, but from a generalised increase in the mutation rate, perhaps arising from the unusual chromatin structure at centromeres in yeast and other eukaryotes. PMID:21767380

  20. Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.

    PubMed

    Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

    2010-11-15

    The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO₂ and temperature) useful for industrial application. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Septin Organization and Functions in Budding Yeast

    PubMed Central

    Glomb, Oliver; Gronemeyer, Thomas

    2016-01-01

    The septins are a conserved family of GTP-binding proteins present in all eukaryotic cells except plants. They were originally discovered in the baker's yeast Saccharomyces cerevisiae that serves until today as an important model organism for septin research. In yeast, the septins assemble into a highly ordered array of filaments at the mother bud neck. The septins are regulators of spatial compartmentalization in yeast and act as key players in cytokinesis. This minireview summarizes the recent findings about structural features and cell biology of the yeast septins. PMID:27857941

  2. Evaluation of Automated Yeast Identification System

    NASA Technical Reports Server (NTRS)

    McGinnis, M. R.

    1996-01-01

    One hundred and nine teleomorphic and anamorphic yeast isolates representing approximately 30 taxa were used to evaluate the accuracy of the Biolog yeast identification system. Isolates derived from nomenclatural types, environmental, and clinica isolates of known identity were tested in the Biolog system. Of the isolates tested, 81 were in the Biolog database. The system correctly identified 40, incorrectly identified 29, and was unable to identify 12. Of the 28 isolates not in the database, 18 were given names, whereas 10 were not. The Biolog yeast identification system is inadequate for the identification of yeasts originating from the environment during space program activities.

  3. Rif1 controls DNA replication by directing Protein Phosphatase 1 to reverse Cdc7-mediated phosphorylation of the MCM complex.

    PubMed

    Hiraga, Shin-Ichiro; Alvino, Gina M; Chang, Fujung; Lian, Hui-Yong; Sridhar, Akila; Kubota, Takashi; Brewer, Bonita J; Weinreich, Michael; Raghuraman, M K; Donaldson, Anne D

    2014-02-15

    Initiation of eukaryotic DNA replication requires phosphorylation of the MCM complex by Dbf4-dependent kinase (DDK), composed of Cdc7 kinase and its activator, Dbf4. We report here that budding yeast Rif1 (Rap1-interacting factor 1) controls DNA replication genome-wide and describe how Rif1 opposes DDK function by directing Protein Phosphatase 1 (PP1)-mediated dephosphorylation of the MCM complex. Deleting RIF1 partially compensates for the limited DDK activity in a cdc7-1 mutant strain by allowing increased, premature phosphorylation of Mcm4. PP1 interaction motifs within the Rif1 N-terminal domain are critical for its repressive effect on replication. We confirm that Rif1 interacts with PP1 and that PP1 prevents premature Mcm4 phosphorylation. Remarkably, our results suggest that replication repression by Rif1 is itself also DDK-regulated through phosphorylation near the PP1-interacting motifs. Based on our findings, we propose that Rif1 is a novel PP1 substrate targeting subunit that counteracts DDK-mediated phosphorylation during replication. Fission yeast and mammalian Rif1 proteins have also been implicated in regulating DNA replication. Since PP1 interaction sites are evolutionarily conserved within the Rif1 sequence, it is likely that replication control by Rif1 through PP1 is a conserved mechanism.

  4. Candida davenportii sp. nov., a potential soft-drinks spoilage yeast isolated from a wasp.

    PubMed

    Stratford, M; Bond, C J; James, S A; Roberts, N; Steels, H

    2002-07-01

    During a survey of yeast ecology in a soft-drinks production facility, a dead wasp was removed from the sampling tap of an external sugar-syrup storage tank. A yeast isolated from the dead wasp was found to be similar, although not identical, in its physiological characteristics to Candida lactis-condensi and Candida stellata. Sequence analysis of the 26S rDNA D1/D2 variable domain revealed that this isolate was most closely related to C stellata, but differed sufficiently in its D1/D2 sequence to indicate that it belonged to a separate species. The yeast species has been named Candida davenportii sp. nov.; the type strain is NCYC 3013T (= CBS 9069T). C davenportii sp. nov. was osmotolerant, moderately preservative-resistant and able to grow in very acidic conditions, i.e. pH 14. This yeast grew well in fruit-containing soft drinks, cola-type beverages and a synthetic soft drink and is therefore a potential cause of spoilage of soft drinks and other sugary food products. Other related yeast species in the same taxonomic clade as C davenportii sp. nov. are also osmotolerant, growing in < 50% (w/v) sugar. Many of these species are associated with insects, specifically bees, bumblebees and leafcutter bees, and many have been reported as the causative agent of spoilage of sugary foods, such as condensed milk, fruit juices and concentrates. It is proposed that C davenportii sp. nov. and other closely related yeasts are primarily associated with Aculeates (bees and wasps). In turn, bees and wasps are attracted by sugary residues in foods such as fruit juices and concentrates, forming the source of infection of these yeasts and thus instigating spoilage.

  5. Whole-Genome Analysis of Three Yeast Strains Used for Production of Sherry-Like Wines Revealed Genetic Traits Specific to Flor Yeasts

    PubMed Central

    Eldarov, Mikhail A.; Beletsky, Alexey V.; Tanashchuk, Tatiana N.; Kishkovskaya, Svetlana A.; Ravin, Nikolai V.; Mardanov, Andrey V.

    2018-01-01

    Flor yeast strains represent a specialized group of Saccharomyces cerevisiae yeasts used for biological wine aging. We have sequenced the genomes of three flor strains originated from different geographic regions and used for production of sherry-like wines in Russia. According to the obtained phylogeny of 118 yeast strains, flor strains form very tight cluster adjacent to the main wine clade. SNP analysis versus available genomes of wine and flor strains revealed 2,270 genetic variants in 1,337 loci specific to flor strains. Gene ontology analysis in combination with gene content evaluation revealed a complex landscape of possibly adaptive genetic changes in flor yeast, related to genes associated with cell morphology, mitotic cell cycle, ion homeostasis, DNA repair, carbohydrate metabolism, lipid metabolism, and cell wall biogenesis. Pangenomic analysis discovered the presence of several well-known “non-reference” loci of potential industrial importance. Events of gene loss included deletions of asparaginase genes, maltose utilization locus, and FRE-FIT locus involved in iron transport. The latter in combination with a flor-yeast-specific mutation in the Aft1 transcription factor gene is likely to be responsible for the discovered phenotype of increased iron sensitivity and improved iron uptake of analyzed strains. Expansion of the coding region of the FLO11 flocullin gene and alteration of the balance between members of the FLO gene family are likely to positively affect the well-known propensity of flor strains for velum formation. Our study provides new insights in the nature of genetic variation in flor yeast strains and demonstrates that different adaptive properties of flor yeast strains could have evolved through different mechanisms of genetic variation. PMID:29867869

  6. Biological Control of Botrytis cinerea: Interactions with Native Vineyard Yeasts from Washington State.

    PubMed

    Wang, Xuefei; Glawe, Dean A; Kramer, Elizabeth; Weller, David; Okubara, Patricia A

    2018-06-01

    Native yeasts are of increasing interest to researchers, grape growers, and vintners because of their potential for biocontrol activity and their contributions to the aroma, flavor, and mouthfeel qualities of wines. To assess biocontrol activity, we tested 11 yeasts from Washington vineyards, representing isolates of Candida saitoana, Curvibasidium pallidicorallinum, Metschnikowia chrysoperlae, M. pulcherrima, Meyerozyma guilliermondii, Saccharomyces cerevisiae, and Wickerhamomyces anomalus, for ability to colonize Thompson Seedless grape berries, inhibit the growth of Botrytis cinerea in vitro, and suppress disease symptoms on isolated berries. The yeast-like fungus Aureobasidium pullulans was also included based on its known biocontrol activity against B. cinerea in studies on apple and grape. All yeast strains multiplied rapidly in grape berries and reached densities of over log 6 cells per wound as early as 2 days after inoculation with 200 cells. One of the Botrytis isolates used in this study was much less virulent than the others and was provisionally identified as B. prunorum based on multilocus sequence analysis. Suppression of the growth of B. cinerea isolates 111bb, 207a, 207cb, and 407cb occurred on berries treated with A. pullulans P01A006, Metschnikowia chrysoperlae P34A004 and P40A002, M. pulcherrima P01A016 and P01C004, Meyerozyma guilliermondii P34D003, and S. cerevisiae HNN11516. Inhibition of Botrytis isolates by the yeast strains was more common on berries than in vitro, suggesting the possibility that niche competition was a more likely biocontrol mechanism than antibiosis in planta. Metabolic profiling of yeast strains and B. cinerea isolates using Biolog YT plates revealed seven distinct metabolic groups. Furthermore, the yeast strains showed partial to complete tolerance to the commonly used fungicides fluopyram, triflumizole, metrafenone, pyraclostrobin, and boscalid. Implications of these findings for field deployment of native Washington

  7. Post-fermentative production of glutathione by baker's yeast (S. cerevisiae) in compressed and dried forms.

    PubMed

    Musatti, Alida; Manzoni, Matilde; Rollini, Manuela

    2013-01-25

    The study was aimed at investigating the best biotransformation conditions to increase intracellular glutathione (GSH) levels in samples of baker's yeast (Saccharomyces cerevisiae) employing either the commercially available compressed and dried forms. Glucose, GSH precursors amino acids, as well as other cofactors, were dissolved in a biotransformation solution and yeast cells were added (5%dcw). Two response surface central composite designs (RSCCDs) were performed in sequence: in the first step the influence of amino acid composition (cysteine, glycine, glutamic acid and serine) on GSH accumulation was investigated; once their formulation was set up, the influence of other components was studied. Initial GSH content was found 0.53 and 0.47%dcw for compressed and dried forms. GSH accumulation ability of baker's yeast in compressed form was higher at the beginning of shelf life, that is, in the first week, and a maximum of 2.04%dcw was obtained. Performance of yeast in dried form was not found satisfactory, as the maximum GSH level was 1.18%dcw. When cysteine lacks from the reaction solution, yeast cells do not accumulate GSH. With dried yeast, the highest GSH yields occurred when cysteine was set at 3 g/L, glycine and glutamic acid at least at 4 g/L, without serine. Employing compressed yeast, the highest GSH yields occurred when cysteine and glutamic acid were set at 2-3 g/L, while glycine and serine higher than 2 g/L. Results allowed to set up an optimal and feasible procedure to obtain GSH-enriched yeast biomass, with up to threefold increase with respect to initial content. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage

    PubMed Central

    Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

    2018-01-01

    Objective This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Methods Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. Results In addition to species of Candida glabrata and Pichia kudriavzevii (P. kudriavzevii) previously isolated in WCC and TMR, Pichia manshurica (P. manshurica), Candida ethanolica (C. ethanolica), and Zygosaccharomyces bailii (Z. bailii) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. Conclusion The inhibition of yeasts, particularly P. kudriavzevii, probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast

  9. Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage.

    PubMed

    Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

    2018-02-01

    This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. In addition to species of Candida glabrata and Pichia kudriavzevii ( P. kudriavzevii ) previously isolated in WCC and TMR, Pichia manshurica ( P. manshurica ), Candida ethanolica ( C. ethanolica ), and Zygosaccharomyces bailii ( Z. bailii ) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. The inhibition of yeasts, particularly P. kudriavzevii , probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast species during aerobic

  10. 21 CFR 172.381 - Vitamin D2 bakers yeast.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... conventional bakers yeast. (c) The additive may be used in yeast-leavened baked goods and baking mixes and yeast-leavened baked snack foods at levels not to exceed 400 International Units of vitamin D2 per 100...

  11. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  12. MIPS: a database for protein sequences and complete genomes.

    PubMed Central

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  13. Phosphorylation and cellular function of the human Rpa2 N-terminus in the budding yeast Saccharomyces cerevisiae.

    PubMed

    Ghospurkar, Padmaja L; Wilson, Timothy M; Liu, Shengqin; Herauf, Anna; Steffes, Jenna; Mueller, Erica N; Oakley, Gregory G; Haring, Stuart J

    2015-02-01

    Maintenance of genome integrity is critical for proper cell growth. This occurs through accurate DNA replication and repair of DNA lesions. A key factor involved in both DNA replication and the DNA damage response is the heterotrimeric single-stranded DNA (ssDNA) binding complex Replication Protein A (RPA). Although the RPA complex appears to be structurally conserved throughout eukaryotes, the primary amino acid sequence of each subunit can vary considerably. Examination of sequence differences along with the functional interchangeability of orthologous RPA subunits or regions could provide insight into important regions and their functions. This might also allow for study in simpler systems. We determined that substitution of yeast Replication Factor A (RFA) with human RPA does not support yeast cell viability. Exchange of a single yeast RFA subunit with the corresponding human RPA subunit does not function due to lack of inter-species subunit interactions. Substitution of yeast Rfa2 with domains/regions of human Rpa2 important for Rpa2 function (i.e., the N-terminus and the loop 3-4 region) supports viability in yeast cells, and hybrid proteins containing human Rpa2 N-terminal phospho-mutations result in similar DNA damage phenotypes to analogous yeast Rfa2 N-terminal phospho-mutants. Finally, the human Rpa2 N-terminus (NT) fused to yeast Rfa2 is phosphorylated in a manner similar to human Rpa2 in human cells, indicating that conserved kinases recognize the human domain in yeast. The implication is that budding yeast represents a potential model system for studying not only human Rpa2 N-terminal phosphorylation, but also phosphorylation of Rpa2 N-termini from other eukaryotic organisms. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    PubMed Central

    Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast density and species composition. When yeast densities were compared in pieces of the same fruits assigned to different treatments, fruits that developed low yeast densities in the absence of flies developed significantly higher yeast densities when exposed to larvae. Across all of the fruits, larvae regulated yeast densities within narrow limits, as compared to a much wider range of yeast densities that developed in pieces of the same fruits not exposed to flies. Larvae also affected yeast species composition, dramatically reducing species diversity across fruits, reducing variation in yeast communities from one fruit to the next (beta diversity), and encouraging the consistent development of a yeast community composed of three species of yeast (Candida californica, C. zemplinina, and Pichia kluvyeri), all of which were palatable to larvae. Larvae excreted viable cells of these three yeast species in their fecal pools, and discouraged the growth of filamentous fungi, processes which may have contributed to their effects on the yeast communities in banana fruits. These and other findings suggest that D. melanogaster adults and their larval offspring together engage in ‘niche construction’, facilitating a predictable microbial environment in the fruit substrates in which the larvae live and develop. PMID:22860093

  15. Phosphatidic acid synthesis in yeast

    PubMed Central

    Kuhn, N. J.; Lynen, F.

    1965-01-01

    1. The presence of palmitoyl-CoA–l-glycerol 1-phosphate palmitoyltransferase (EC2.3.1.15) has been demonstrated in a particulate fraction of baker's yeast. 2. The enzyme has been characterized, and its activity studied as a function of pH and concentration of substrates. 3. Inhibition by thiol poisons and protection by acyl-CoA have been used to obtain information on the active site. 4. By various methods of supplying acyl radicals, the species `palmitoyl-CoA' has been shown to be the true acyl donor to the transferase. PMID:14342236

  16. Chemostat Culture for Yeast Physiology.

    PubMed

    Kerr, Emily O; Dunham, Maitreya J

    2017-07-05

    The use of chemostat culture facilitates the careful comparison of different yeast strains growing in well-defined conditions. Variations in physiology can be measured by examining gene expression, metabolite levels, protein content, and cell morphology. In this protocol, we show how a combination of sample types can be collected during harvest from a single 20-mL chemostat in a ministat array, with special attention to coordinating the handling of the most time-sensitive sample types. © 2017 Cold Spring Harbor Laboratory Press.

  17. Surface Structure of Yeast Protoplasts

    PubMed Central

    Streiblová, Eva

    1968-01-01

    The fine structure of the yeast cell wall during protoplast formation was studied by means of phase-contrast microscopy and the freeze-etching technique. The freeze-etching results indicated that at least in some cases the entire wall substance was not removed from the surface of the protoplasts. After a treatment of 30 min to 3 hr with 2% snail enzymes, an innermost thin wall layer as well as remnants of the fibrillar middle layer sometimes could be demonstrated. Images PMID:4867751

  18. Experimental evolution in budding yeast

    NASA Astrophysics Data System (ADS)

    Murray, Andrew

    2012-02-01

    I will discuss our progress in analyzing evolution in the budding yeast, Saccharomyces cerevisiae. We take two basic approaches. The first is to try and examine quantitative aspects of evolution, for example by determining how the rate of evolution depends on the mutation rate and the population size or asking whether the rate of mutation is uniform throughout the genome. The second is to try to evolve qualitatively novel, cell biologically interesting phenotypes and track the mutations that are responsible for the phenotype. Our efforts include trying to alter cell morphology, evolve multicellularity, and produce a biological oscillator.

  19. Big data mining powers fungal research: recent advances in fission yeast systems biology approaches.

    PubMed

    Wang, Zhe

    2017-06-01

    Biology research has entered into big data era. Systems biology approaches therefore become the powerful tools to obtain the whole landscape of how cell separate, grow, and resist the stresses. Fission yeast Schizosaccharomyces pombe is wonderful unicellular eukaryote model, especially studying its division and metabolism can facilitate to understanding the molecular mechanism of cancer and discovering anticancer agents. In this perspective, we discuss the recent advanced fission yeast systems biology tools, mainly focus on metabolomics profiling and metabolic modeling, protein-protein interactome and genetic interaction network, DNA sequencing and applications, and high-throughput phenotypic screening. We therefore hope this review can be useful for interested fungal researchers as well as bioformaticians.

  20. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection

    PubMed Central

    Gelperin, Daniel M.; White, Michael A.; Wilkinson, Martha L.; Kon, Yoshiko; Kung, Li A.; Wise, Kevin J.; Lopez-Hoyo, Nelson; Jiang, Lixia; Piccirillo, Stacy; Yu, Haiyuan; Gerstein, Mark; Dumont, Mark E.; Phizicky, Eric M.; Snyder, Michael; Grayhack, Elizabeth J.

    2005-01-01

    Functional analysis of the proteome is an essential part of genomic research. To facilitate different proteomic approaches, a MORF (moveable ORF) library of 5854 yeast expression plasmids was constructed, each expressing a sequence-verified ORF as a C-terminal ORF fusion protein, under regulated control. Analysis of 5573 MORFs demonstrates that nearly all verified ORFs are expressed, suggests the authenticity of 48 ORFs characterized as dubious, and implicates specific processes including cytoskeletal organization and transcriptional control in growth inhibition caused by overexpression. Global analysis of glycosylated proteins identifies 109 new confirmed N-linked and 345 candidate glycoproteins, nearly doubling the known yeast glycome. PMID:16322557

  1. Mitochondrial Telomeres as Molecular Markers for Identification of the Opportunistic Yeast Pathogen Candida parapsilosis

    PubMed Central

    Nosek, Jozef; Tomáška, L'ubomír; Ryčovská, Adriana; Fukuhara, Hiroshi

    2002-01-01

    Recent studies have demonstrated that a large number of organisms carry linear mitochondrial DNA molecules possessing specialized telomeric structures at their ends. Based on this specific structural feature of linear mitochondrial genomes, we have developed an approach for identification of the opportunistic yeast pathogen Candida parapsilosis. The strategy for identification of C. parapsilosis strains is based on PCR amplification of specific DNA sequences derived from the mitochondrial telomere region. This assay is complemented by immunodetection of a protein component of mitochondrial telomeres. The results demonstrate that mitochondrial telomeres represent specific molecular markers with potential applications in yeast diagnostics and taxonomy. PMID:11923346

  2. Prevention of Yeast Spoilage in Feed and Food by the Yeast Mycocin HMK

    PubMed Central

    Lowes, K. F.; Shearman, C. A.; Payne, J.; MacKenzie, D.; Archer, D. B.; Merry, R. J.; Gasson, M. J.

    2000-01-01

    The yeast Williopsis mrakii produces a mycocin or yeast killer toxin designated HMK; this toxin exhibits high thermal stability, high pH stability, and a broad spectrum of activity against other yeasts. We describe construction of a synthetic gene for mycocin HMK and heterologous expression of this toxin in Aspergillus niger. Mycocin HMK was fused to a glucoamylase protein carrier, which resulted in secretion of biologically active mycocin into the culture media. A partial purification protocol was developed, and a comparison with native W. mrakii mycocin showed that the heterologously expressed mycocin had similar physiological properties and an almost identical spectrum of biological activity against a number of yeasts isolated from silage and yoghurt. Two food and feed production systems prone to yeast spoilage were used as models to assess the ability of mycocin HMK to act as a biocontrol agent. The onset of aerobic spoilage in mature maize silage was delayed by application of A. niger mycocin HMK on opening because the toxin inhibited growth of the indigenous spoilage yeasts. This helped maintain both higher lactic acid levels and a lower pH. In yoghurt spiked with dairy spoilage yeasts, A. niger mycocin HMK was active at all of the storage temperatures tested at which yeast growth occurred, and there was no resurgence of resistant yeasts. The higher the yeast growth rate, the more effective the killing action of the mycocin. Thus, mycocin HMK has potential applications in controlling both silage spoilage and yoghurt spoilage caused by yeasts. PMID:10698773

  3. A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.

    PubMed

    Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew

    2012-12-20

    The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  5. Comparative genomics of biotechnologically important yeasts

    USDA-ARS?s Scientific Manuscript database

    Saccharomyces cerevisiae, is used in the vast majority of the world’s bioprocesses, and its economic significance is unchallenged. It, however, represents only a small slice of yeast physiological diversity. Many other yeasts, are used in lesser known, but commercially important processes that take ...

  6. Virgin olive oil yeasts: A review.

    PubMed

    Ciafardini, Gino; Zullo, Biagi Angelo

    2018-04-01

    This review summarizes current knowledge on virgin olive oil yeasts. Newly produced olive oil contains solid particles and micro drops of vegetation water in which yeasts reproduce to become the typical microbiota of olive oil. To date, about seventeen yeast species have been isolated from different types of olive oils and their by-products, of which six species have been identified as new species. Certain yeast species contribute greatly to improving the sensorial characteristics of the newly produced olive oil, whereas other species are considered harmful as they can damage the oil quality through the production of unpleasant flavors and triacylglycerol hydrolysis. Studies carried out in certain yeast strains have demonstrated the presence of defects in olive oil treated with Candida adriatica, Nakazawaea wickerhamii and Candida diddensiae specific strains, while other olive oil samples treated with other Candida diddensiae strains were defect-free after four months of storage and categorized as extra virgin. A new acetic acid producing yeast species, namely, Brettanomyces acidodurans sp. nov., which was recently isolated from olive oil, could be implicated in the wine-vinegary defect of the product. Other aspects related to the activity of the lipase-producing yeasts and the survival of the yeast species in the flavored olive oils are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Yeast: An Experimental Organism for Modern Biology.

    ERIC Educational Resources Information Center

    Botstein, David; Fink, Gerald R.

    1988-01-01

    Discusses the applicability and advantages of using yeasts as popular and ideal model systems for studying and understanding eukaryotic biology at the cellular and molecular levels. Cites experimental tractability and the cooperative tradition of the research community of yeast biologists as reasons for this success. (RT)

  8. Yeasts in sustainable bioethanol production: A review.

    PubMed

    Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

    2017-07-01

    Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

  9. The essence of yeast quiescence.

    PubMed

    De Virgilio, Claudio

    2012-03-01

    Like all microorganisms, yeast cells spend most of their natural lifetime in a reversible, quiescent state that is primarily induced by limitation for essential nutrients. Substantial progress has been made in defining the features of quiescent cells and the nutrient-signaling pathways that shape these features. A view that emerges from the wealth of new data is that yeast cells dynamically configure the quiescent state in response to nutritional challenges by using a set of key nutrient-signaling pathways, which (1) regulate pathway-specific effectors, (2) converge on a few regulatory nodes that bundle multiple inputs to communicate unified, graded responses, and (3) mutually modulate their competences to transmit signals. Here, I present an overview of our current understanding of the architecture of these pathways, focusing on how the corresponding core signaling protein kinases (i.e. PKA, TORC1, Snf1, and Pho85) are wired to ensure an adequate response to nutrient starvation, which enables cells to tide over decades, if not centuries, of famine. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  10. Break-induced replication and recombinational telomere elongation in yeast.

    PubMed

    McEachern, Michael J; Haber, James E

    2006-01-01

    When a telomere becomes unprotected or if only one end of a chromosomal double-strand break succeeds in recombining with a template sequence, DNA can be repaired by a recombination-dependent DNA replication process termed break-induced replication (BIR). In budding yeasts, there are two BIR pathways, one dependent on the Rad51 recombinase protein and one Rad51 independent; these two repair processes lead to different types of survivors in cells lacking the telomerase enzyme that is required for normal telomere maintenance. Recombination at telomeres is triggered by either excessive telomere shortening or disruptions in the function of telomere-binding proteins. Telomere elongation by BIR appears to often occur through a "roll and spread" mechanism. In this process, a telomeric circle produced by recombination at a dysfunctional telomere acts as a template for a rolling circle BIR event to form an elongated telomere. Additional BIR events can then copy the elongated sequence to all other telomeres.

  11. Electron transport chain in a thermotolerant yeast.

    PubMed

    Mejía-Barajas, Jorge A; Martínez-Mora, José A; Salgado-Garciglia, Rafael; Noriega-Cisneros, Ruth; Ortiz-Avila, Omar; Cortés-Rojo, Christian; Saavedra-Molina, Alfredo

    2017-04-01

    Yeasts capable of growing and surviving at high temperatures are regarded as thermotolerant. For appropriate functioning of cellular processes and cell survival, the maintenance of an optimal redox state is critical of reducing and oxidizing species. We studied mitochondrial functions of the thermotolerant Kluyveromyces marxianus SLP1 and the mesophilic OFF1 yeasts, through the evaluation of its mitochondrial membrane potential (ΔΨ m ), ATPase activity, electron transport chain (ETC) activities, alternative oxidase activity, lipid peroxidation. Mitochondrial membrane potential and the cytoplasmic free Ca 2+ ions (Ca 2+ cyt) increased in the SLP1 yeast when exposed to high temperature, compared with the mesophilic yeast OFF1. ATPase activity in the mesophilic yeast diminished 80% when exposed to 40° while the thermotolerant SLP1 showed no change, despite an increase in the mitochondrial lipid peroxidation. The SLP1 thermotolerant yeast exposed to high temperature showed a diminution of 33% of the oxygen consumption in state 4. The uncoupled state 3 of oxygen consumption did not change in the mesophilic yeast when it had an increase of temperature, whereas in the thermotolerant SLP1 yeast resulted in an increase of 2.5 times when yeast were grown at 30 o , while a decrease of 51% was observed when it was exposed to high temperature. The activities of the ETC complexes were diminished in the SLP1 when exposed to high temperature, but also it was distinguished an alternative oxidase activity. Our results suggest that the mitochondria state, particularly ETC state, is an important characteristic of the thermotolerance of the SLP1 yeast strain.

  12. A Three-Dimensional Model of the Yeast Genome

    NASA Astrophysics Data System (ADS)

    Noble, William; Duan, Zhi-Jun; Andronescu, Mirela; Schutz, Kevin; McIlwain, Sean; Kim, Yoo Jung; Lee, Choli; Shendure, Jay; Fields, Stanley; Blau, C. Anthony

    Layered on top of information conveyed by DNA sequence and chromatin are higher order structures that encompass portions of chromosomes, entire chromosomes, and even whole genomes. Interphase chromosomes are not positioned randomly within the nucleus, but instead adopt preferred conformations. Disparate DNA elements co-localize into functionally defined aggregates or factories for transcription and DNA replication. In budding yeast, Drosophila and many other eukaryotes, chromosomes adopt a Rabl configuration, with arms extending from centromeres adjacent to the spindle pole body to telomeres that abut the nuclear envelope. Nonetheless, the topologies and spatial relationships of chromosomes remain poorly understood. Here we developed a method to globally capture intra- and inter-chromosomal interactions, and applied it to generate a map at kilobase resolution of the haploid genome of Saccharomyces cerevisiae. The map recapitulates known features of genome organization, thereby validating the method, and identifies new features. Extensive regional and higher order folding of individual chromosomes is observed. Chromosome XII exhibits a striking conformation that implicates the nucleolus as a formidable barrier to interaction between DNA sequences at either end. Inter-chromosomal contacts are anchored by centromeres and include interactions among transfer RNA genes, among origins of early DNA replication and among sites where chromosomal breakpoints occur. Finally, we constructed a three-dimensional model of the yeast genome. Our findings provide a glimpse of the interface between the form and function of a eukaryotic genome.

  13. Yeast prion architecture explains how proteins can be genes

    NASA Astrophysics Data System (ADS)

    Wickner, Reed

    2013-03-01

    Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452

  14. Ends-in Vs. Ends-Out Recombination in Yeast

    PubMed Central

    Hastings, P. J.; McGill, C.; Shafer, B.; Strathern, J. N.

    1993-01-01

    Integration of linearized plasmids into yeast chromosomes has been used as a model system for the study of recombination initiated by double-strand breaks. The linearized plasmid DNA recombines efficiently into sequences homologous to the ends of the DNA. This efficient recombination occurs both for the configuration in which the break is in a contiguous region of homology (herein called the ends-in configuration) and for ``omega'' insertions in which plasmid sequences interrupt a linear region of homology (herein called the ends-out configuration). The requirements for integration of these two configurations are expected to be different. We compared these two processes in a yeast strain containing an ends-in target and an ends-out target for the same cut plasmid. Recovery of ends-in events exceeds ends-out events by two- to threefold. Possible causes for the origin of this small bias are discussed. The lack of an extreme difference in frequency implies that cooperativity between the two ends does not contribute to the efficiency with which cut circular plasmids are integrated. This may also be true for the repair of chromosomal double-strand breaks. PMID:8307337

  15. Distribution of tannin-'tolerant yeasts isolated from Miang, a traditional fermented tea leaf (Camellia sinensis var. assamica) in northern Thailand.

    PubMed

    Kanpiengjai, Apinun; Chui-Chai, Naradorn; Chaikaew, Siriporn; Khanongnuch, Chartchai

    2016-12-05

    Miang is a fermented food product prepared from the tea leaves of Camellia sinensis var. assamica, and is traditionally produced in mountainous areas of northern Thailand. Although Miang has a long history and reveals deep-rooted cultural involvement with local people in northern Thailand, little is known regarding its microbial diversity. Yeasts were isolated from 47 Miang samples collected from 28 sampling sites, including eight provinces in upper northern Thailand. A hundred and seven yeast isolates were recovered and identified within 14 species based on the comparison of the D1/D2 sequence of the large subunit (LSU) rRNA gene. Candida ethanolica was determined to be the dominant species that was frequently found in Miang together with minor resident yeast species. All yeast isolates demonstrated their tannin-tolerant capability when cultivated on yeast malt agar (YMA) containing 50g/l tannin, but nine isolates displayed clear zones forming around their colonies, e.g., Debaryomyces hansenii, Cyberlindnera rhodanensis, and Sporidiobolus ruineniae. The results obtained from a visual reading method of tannase revealed that all yeast isolates were positive for methyl gallate, indicating that they possess tannase activity. It is assumed that a tannin-tolerant ability is one of the most important factors for developing a yeast community in Miang. This research study is the first report to describe tannin-tolerant yeasts and yeast communities in traditionally fermented tea leaves. Copyright © 2016. Published by Elsevier B.V.

  16. The AWA1 Gene Is Required for the Foam-Forming Phenotype and Cell Surface Hydrophobicity of Sake Yeast

    PubMed Central

    Shimoi, Hitoshi; Sakamoto, Kazutoshi; Okuda, Masaki; Atthi, Ratchanee; Iwashita, Kazuhiro; Ito, Kiyoshi

    2002-01-01

    Sake, a traditional alcoholic beverage in Japan, is brewed with sake yeasts, which are classified as Saccharomyces cerevisiae. Almost all sake yeasts form a thick foam layer on sake mash during the fermentation process because of their cell surface hydrophobicity, which increases the cells' affinity for bubbles. To reduce the amount of foam, nonfoaming mutants were bred from foaming sake yeasts. Nonfoaming mutants have hydrophilic cell surfaces and no affinity for bubbles. We have cloned a gene from a foam-forming sake yeast that confers foaming ability to a nonfoaming mutant. This gene was named AWA1 and structures of the gene and its product were analyzed. The N- and C-terminal regions of Awa1p have the characteristic sequences of a glycosylphosphatidylinositol anchor protein. The entire protein is rich in serine and threonine residues and has a lot of repetitive sequences. These results suggest that Awa1p is localized in the cell wall. This was confirmed by immunofluorescence microscopy and Western blotting analysis using hemagglutinin-tagged Awa1p. Moreover, an awa1 disruptant of sake yeast was hydrophilic and showed a nonfoaming phenotype in sake mash. We conclude that Awa1p is a cell wall protein and is required for the foam-forming phenotype and the cell surface hydrophobicity of sake yeast. PMID:11916725

  17. South Brazilian wines: culturable yeasts associated to bottled wines produced in Rio Grande do Sul and Santa Catarina.

    PubMed

    Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Valente, Patricia

    2017-04-01

    A comprehensive understanding of the presence and role of yeasts in bottled wines helps to know and control the organoleptic quality of the final product. The South Region of Brazil is an important wine producer, and the state of "Rio Grande do Sul" (RS) accounts for 90% of Brazilian wines. The state of "Santa Catarina" (SC) started the production in 1975, and is currently the fifth Brazilian producer. As there is little information about yeasts present in Brazilian wines, our main objective was to assess the composition of culturable yeasts associated to bottled wines produced in RS and SC, South of Brazil. We sampled 20 RS and 29 SC bottled wines produced between 2003 and 2011, and we isolated culturable yeasts in non-selective agar plates. We identified all isolates by sequencing of the D1/D2 domain of LSU rDNA or ITS1-5.8 S-ITS2 region, and comparison with type strain sequences deposited in GenBank database. Six yeast species were shared in the final product in both regions. We obtained two spoilage yeast profiles: RS with Zygosaccharomyces bailii and Pichia membranifaciens (Dekkera bruxellensis was found only in specific table wines); and SC with Dekkera bruxellensis and Pichia manshurica. Knowledge concerning the different spoilage profiles is important for winemaking practices in both regions.

  18. Parallel evolution of the make–accumulate–consume strategy in Saccharomyces and Dekkera yeasts

    PubMed Central

    Rozpędowska, Elżbieta; Hellborg, Linda; Ishchuk, Olena P.; Orhan, Furkan; Galafassi, Silvia; Merico, Annamaria; Woolfit, Megan; Compagno, Concetta; Piškur, Jure

    2011-01-01

    Saccharomyces yeasts degrade sugars to two-carbon components, in particular ethanol, even in the presence of excess oxygen. This characteristic is called the Crabtree effect and is the background for the 'make–accumulate–consume' life strategy, which in natural habitats helps Saccharomyces yeasts to out-compete other microorganisms. A global promoter rewiring in the Saccharomyces cerevisiae lineage, which occurred around 100 mya, was one of the main molecular events providing the background for evolution of this strategy. Here we show that the Dekkera bruxellensis lineage, which separated from the Saccharomyces yeasts more than 200 mya, also efficiently makes, accumulates and consumes ethanol and acetic acid. Analysis of promoter sequences indicates that both lineages independently underwent a massive loss of a specific cis-regulatory element from dozens of genes associated with respiration, and we show that also in D. bruxellensis this promoter rewiring contributes to the observed Crabtree effect. PMID:21556056

  19. Characterization of karyopherins in androgen receptor intracellular trafficking in the yeast model

    PubMed Central

    Nguyen, Minh M; Harmon, Robert M; Wang, Zhou

    2014-01-01

    Background: Mechanisms regulating androgen receptor (AR) subcellular localization represent an essential component of AR signaling. Karyopherins are a family of nucleocytoplasmic trafficking factors. In this paper, we used the yeast model to study the effects of karyopherins on the subcellular localization of the AR. Methods: Yeast mutants deficient in different nuclear transport factors were transformed with various AR based, GFP tagged constructs and their localization was monitored using microscopy. Results: We showed that yeast can mediate androgen-induced AR nuclear localization and that in addition to the import factor, Importinα/β, this process required the import karyopherin Sxm1. We also showed that a previously identified nuclear export sequence (NESAR) in the ligand binding domain of AR does not appear to rely on karyopherins for cytoplasmic localization. Conclusions: These results suggest that while AR nuclear import relies on karyopherin activity, AR nuclear export and/or cytoplasmic localization may require other undefined mechanisms. PMID:25031696

  20. Extraction of genomic DNA from yeasts for PCR-based applications.

    PubMed

    Lõoke, Marko; Kristjuhan, Kersti; Kristjuhan, Arnold

    2011-05-01

    We have developed a quick and low-cost genomic DNA extraction protocol from yeast cells for PCR-based applications. This method does not require any enzymes, hazardous chemicals, or extreme temperatures, and is especially powerful for simultaneous analysis of a large number of samples. DNA can be efficiently extracted from different yeast species (Kluyveromyces lactis, Hansenula polymorpha, Schizosaccharomyces pombe, Candida albicans, Pichia pastoris, and Saccharomyces cerevisiae). The protocol involves lysis of yeast colonies or cells from liquid culture in a lithium acetate (LiOAc)-SDS solution and subsequent precipitation of DNA with ethanol. Approximately 100 nanograms of total genomic DNA can be extracted from 1 × 10(7) cells. DNA extracted by this method is suitable for a variety of PCR-based applications (including colony PCR, real-time qPCR, and DNA sequencing) for amplification of DNA fragments of ≤ 3500 bp.

  1. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    PubMed

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  2. Cystobasidiomycetes yeasts from Patagonia (Argentina): description of Rhodotorula meli sp. nov. from glacial meltwater.

    PubMed

    Libkind, Diego; Sampaio, José Paulo; van Broock, Maria

    2010-09-01

    A basidiomycetous yeast, strain CRUB 1032(T), which formed salmon-pink colonies, was isolated from glacial meltwater in Patagonia, Argentina. Morphological, physiological and biochemical characterization indicated that this strain belonged to the genus Rhodotorula. Molecular taxonomic analysis based on the 26S rDNA D1/D2 domain and internal transcribed spacer region sequences showed that strain CRUB 1032(T) represents an undescribed yeast species, for which the name Rhodotorula meli sp. nov. is proposed (type strain is CRUB 1032(T)=CBS 10797(T)=JCM 15319(T)). Phylogenetic analysis showed that Rhodotorula lamellibrachii was the closest known species, which, together with R. meli, formed a separate cluster related to the Sakaguchia clade within the Cystobasidiomycetes. Additional Patagonian yeast isolates of the class Cystobasidiomycetes are also investigated in the present work.

  3. Under pressure: evolutionary engineering of yeast strains for improved performance in fuels and chemicals production.

    PubMed

    Mans, Robert; Daran, Jean-Marc G; Pronk, Jack T

    2018-04-01

    Evolutionary engineering, which uses laboratory evolution to select for industrially relevant traits, is a popular strategy in the development of high-performing yeast strains for industrial production of fuels and chemicals. By integrating whole-genome sequencing, bioinformatics, classical genetics and genome-editing techniques, evolutionary engineering has also become a powerful approach for identification and reverse engineering of molecular mechanisms that underlie industrially relevant traits. New techniques enable acceleration of in vivo mutation rates, both across yeast genomes and at specific loci. Recent studies indicate that phenotypic trade-offs, which are often observed after evolution under constant conditions, can be mitigated by using dynamic cultivation regimes. Advances in research on synthetic regulatory circuits offer exciting possibilities to extend the applicability of evolutionary engineering to products of yeasts whose synthesis requires a net input of cellular energy. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Discrete dynamical system modelling for gene regulatory networks of 5-hydroxymethylfurfural tolerance for ethanologenic yeast.

    PubMed

    Song, M; Ouyang, Z; Liu, Z L

    2009-05-01

    Composed of linear difference equations, a discrete dynamical system (DDS) model was designed to reconstruct transcriptional regulations in gene regulatory networks (GRNs) for ethanologenic yeast Saccharomyces cerevisiae in response to 5-hydroxymethylfurfural (HMF), a bioethanol conversion inhibitor. The modelling aims at identification of a system of linear difference equations to represent temporal interactions among significantly expressed genes. Power stability is imposed on a system model under the normal condition in the absence of the inhibitor. Non-uniform sampling, typical in a time-course experimental design, is addressed by a log-time domain interpolation. A statistically significant DDS model of the yeast GRN derived from time-course gene expression measurements by exposure to HMF, revealed several verified transcriptional regulation events. These events implicate Yap1 and Pdr3, transcription factors consistently known for their regulatory roles by other studies or postulated by independent sequence motif analysis, suggesting their involvement in yeast tolerance and detoxification of the inhibitor.

  5. Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

    PubMed

    Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

    2016-10-24

    Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

    PubMed

    Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

    2018-05-01

    Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

  7. Rheologically interesting polysaccharides from yeasts

    NASA Technical Reports Server (NTRS)

    Petersen, G. R.; Nelson, G. A.; Cathey, C. A.; Fuller, G. G.

    1989-01-01

    We have examined the relationships between primary, secondary, and tertiary structures of polysaccharides exhibiting the rheological property of friction (drag) reduction in turbulent flows. We found an example of an exopolysaccharide from the yeast Cryptococcus laurentii that possessed high molecular weight but exhibited lower than expected drag reducing activity. Earlier correlations by Hoyt showing that beta 1 --> 3, beta 2 --> 4, and alpha 1 --> 3 linkages in polysaccharides favored drag reduction were expanded to include correlations to secondary structure. The effect of sidechains in a series of gellan gums was shown to be related to sidechain length and position. Disruption of secondary structure in drag reducing polysaccharides reduced drag reducing activity for some but not all exopolysaccharides. The polymer from C. laurentii was shown to be more stable than xanthan gum and other exopolysaccharides under the most vigorous of denaturing conditions. We also showed a direct relationship between extensional viscosity measurements and the drag reducing coefficient for four exopolysaccharides.

  8. The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

    PubMed Central

    Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

    2013-01-01

    Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

  9. Genomics and the making of yeast biodiversity.

    PubMed

    Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

    2015-12-01

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Yeast-based biosensors: design and applications.

    PubMed

    Adeniran, Adebola; Sherer, Michael; Tyo, Keith E J

    2015-02-01

    Yeast-based biosensing (YBB) is an exciting research area, as many studies have demonstrated the use of yeasts to accurately detect specific molecules. Biosensors incorporating various yeasts have been reported to detect an incredibly large range of molecules including but not limited to odorants, metals, intracellular metabolites, carcinogens, lactate, alcohols, and sugars. We review the detection strategies available for different types of analytes, as well as the wide range of output methods that have been incorporated with yeast biosensors. We group biosensors into two categories: those that are dependent upon transcription of a gene to report the detection of a desired molecule and those that are independent of this reporting mechanism. Transcription-dependent biosensors frequently depend on heterologous expression of sensing elements from non-yeast organisms, a strategy that has greatly expanded the range of molecules available for detection by YBBs. Transcription-independent biosensors circumvent the problem of sensing difficult-to-detect analytes by instead relying on yeast metabolism to generate easily detected molecules when the analyte is present. The use of yeast as the sensing element in biosensors has proven to be successful and continues to hold great promise for a variety of applications. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  11. Accelerating Yeast Prion Biology using Droplet Microfluidics

    NASA Astrophysics Data System (ADS)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  12. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  13. Microbiological and fermentative properties of baker's yeast starter used in breadmaking.

    PubMed

    Reale, A; Di Renzo, T; Succi, M; Tremonte, P; Coppola, R; Sorrentino, E

    2013-08-01

    This study assessed the levels of microbial contaminants in liquid, compressed and dry commercial baker's yeasts used as starters in breadmaking. Eumycetes, Enterobacteriaceae, total and fecal coliforms, Bacillus spp., and lactic acid bacteria (LAB), in particular enterococci, were quantified. Results obtained in this study highlighted that baker's yeast could represent a potential vehicle of spoilage and undesirable microorganisms into the baking environment, even if these do not influence the leavening activity in the dough, as ascertained by rheofermentometer analysis. Different microbial groups, such as spore-forming bacteria and moulds, were found in baker's yeast starters. Moreover, different species of LAB, which are considered the main contaminants in large-scale yeast fermentations, were isolated and identified by Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rDNA sequencing. The most recurrent species were Lactobacillus plantarum, Enterococcus faecalis, and Enterococcus durans, isolated from both compressed and dry starters, whereas strains belonging to Leuconostoc and Pediococcus genera were found only in dry ones. Nested-Polymerase Chain Reaction (Nested-PCR) and Randomly Amplified Polymorphic DNA-PCR (RAPD-PCR) were also used to highlight the biodiversity of the different commercial yeast strains, and to ascertain the culture purity. © 2013 Institute of Food Technologists®

  14. Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape.

    PubMed

    Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

    2015-01-01

    Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking.

  15. Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii

    PubMed Central

    Douradinha, Bruno; Reis, Viviane CB; Rogers, Matthew B; Torres, Fernando AG; Evans, Jared D; Marques Jr, Ernesto TA

    2014-01-01

    Saccharomyces boulardii (S. boulardii) is a probiotic yeast related to Saccharomyces cerevisiae (S. cerevisiae) but with distinct genetic, taxonomic and metabolic properties. S. cerevisiae has been used extensively in biotechnological applications. Currently, many strains are available, and multiple genetic tools have been developed, which allow the expression of several exogenous proteins of interest with applications in the fields of medicine, biofuels, the food industry, and scientific research, among others. Although S. boulardii has been widely studied due to its probiotic properties against several gastrointestinal tract disorders, very few studies addressed the use of this yeast as a vector for expression of foreign genes of interest with biotechnological applications. Here we show that, despite the similarity of the two yeasts, not all genetic tools used in S. cerevisiae can be applied in S. boulardii. While transformation of the latter could be obtained using a commercial kit developed for the former, consequent screening of successful transformants had to be optimized. We also show that several genes frequently used in genetic manipulation of S. cerevisiae (e.g., promoters and resistance markers) are present in S. boulardii. Sequencing revealed a high rate of homology (>96%) between the orthologs of the two yeasts. However, we also observed some of them are not eligible to be targeted for transformation of S. boulardii. This work has important applications toward the potential of this probiotic yeast as an expression system for genes of interest. PMID:24013355

  16. Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii.

    PubMed

    Douradinha, Bruno; Reis, Viviane C B; Rogers, Matthew B; Torres, Fernando A G; Evans, Jared D; Marques, Ernesto T A

    2014-01-01

    Saccharomyces boulardii (S. boulardii) is a probiotic yeast related to Saccharomyces cerevisiae (S. cerevisiae) but with distinct genetic, taxonomic and metabolic properties. S. cerevisiae has been used extensively in biotechnological applications. Currently, many strains are available, and multiple genetic tools have been developed, which allow the expression of several exogenous proteins of interest with applications in the fields of medicine, biofuels, the food industry, and scientific research, among others. Although S. boulardii has been widely studied due to its probiotic properties against several gastrointestinal tract disorders, very few studies addressed the use of this yeast as a vector for expression of foreign genes of interest with biotechnological applications. Here we show that, despite the similarity of the two yeasts, not all genetic tools used in S. cerevisiae can be applied in S. boulardii. While transformation of the latter could be obtained using a commercial kit developed for the former, consequent screening of successful transformants had to be optimized. We also show that several genes frequently used in genetic manipulation of S. cerevisiae (e.g., promoters and resistance markers) are present in S. boulardii. Sequencing revealed a high rate of homology (> 96%) between the orthologs of the two yeasts. However, we also observed some of them are not eligible to be targeted for transformation of S. boulardii. This work has important applications toward the potential of this probiotic yeast as an expression system for genes of interest.

  17. Structural differences between yeast and mammalian microtubules revealed by cryo-EM

    SciTech Connect

    Howes, Stuart C.; Geyer, Elisabeth A.; LaFrance, Benjamin

    Microtubules are polymers of αβ-tubulin heterodimers essential for all eukaryotes. Despite sequence conservation, there are significant structural differences between microtubules assembled in vitro from mammalian or budding yeast tubulin. Yeast MTs were not observed to undergo compaction at the interdimer interface as seen for mammalian microtubules upon GTP hydrolysis. Lack of compaction might reflect slower GTP hydrolysis or a different degree of allosteric coupling in the lattice. The microtubule plus end–tracking protein Bim1 binds yeast microtubules both between αβ-tubulin heterodimers, as seen for other organisms, and within tubulin dimers, but binds mammalian tubulin only at interdimer contacts. At the concentrationsmore » used in cryo-electron microscopy, Bim1 causes the compaction of yeast microtubules and induces their rapid disassembly. In conclusion, our studies demonstrate structural differences between yeast and mammalian microtubules that likely underlie their differing polymerization dynamics. These differences may reflect adaptations to the demands of different cell size or range of physiological growth temperatures.« less

  18. Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape

    PubMed Central

    Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

    2015-01-01

    Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking. PMID:26413065

  19. Similar Mutation Rates but Highly Diverse Mutation Spectra in Ascomycete and Basidiomycete Yeasts.

    PubMed

    Long, Hongan; Behringer, Megan G; Williams, Emily; Te, Ronald; Lynch, Michael

    2016-12-01

    Yeast species are extremely diverse and not monophyletic. Because the majority of yeast research focuses on ascomycetes, the mutational determinants of genetic diversity across yeast species are not well understood. By combining mutation-accumulation techniques with whole-genome sequencing, we resolved the genomic mutation rate and spectrum of the oleaginous (oil-producing) ‘red yeast’ Rhodotorula toruloides, the first such study in the fungal phylum Basidiomycota. We find that the mutation spectrum is quite different from what has been observed in all other studied unicellular eukaryotes, but similar to that in most bacteria—a predominance of transitions relative to transversions. Rhodotorula toruloides has a significantly higher A:T→G:C transition rate—possibly elevated by the abundant flanking G/C nucleotides in the GC-rich genome, as well as a much lower G:C→T:A transversion rate. In spite of these striking differences, there are substantial consistencies between R. toruloides and the ascomycete model yeasts: a spontaneous base-substitution mutation rate of 1.90 × 10 −10 per site per cell division as well as an elevated mutation rate at non-methylated 5'CpG3' sites. These results imply the evolution of variable mutation spectra in the face of similar mutation rates in yeasts.

  20. Novel Cysteine-Centered Sulfur Metabolic Pathway in the Thermotolerant Methylotrophic Yeast Hansenula polymorpha

    PubMed Central

    Oh, Doo-Byoung; Kwon, Ohsuk; Lee, Sang Yup; Sibirny, Andriy A.; Kang, Hyun Ah

    2014-01-01

    In yeast and filamentous fungi, sulfide can be condensed either with O-acetylhomoserine to generate homocysteine, the precursor of methionine, or with O-acetylserine to directly generate cysteine. The resulting homocysteine and cysteine can be interconverted through transsulfuration pathway. Here, we systematically analyzed the sulfur metabolic pathway of the thermotolerant methylotrophic yeast Hansenula polymorpha, which has attracted much attention as an industrial yeast strain for various biotechnological applications. Quite interestingly, the detailed sulfur metabolic pathway of H. polymorpha, which was reconstructed based on combined analyses of the genome sequences and validation by systematic gene deletion experiments, revealed the absence of de novo synthesis of homocysteine from inorganic sulfur in this yeast. Thus, the direct biosynthesis of cysteine from sulfide is the only pathway of synthesizing sulfur amino acids from inorganic sulfur in H. polymorpha, despite the presence of both directions of transsulfuration pathway Moreover, only cysteine, but no other sulfur amino acid, was able to repress the expression of a subset of sulfur genes, suggesting its central and exclusive role in the control of H. polymorpha sulfur metabolism. 35S-Cys was more efficiently incorporated into intracellular sulfur compounds such as glutathione than 35S-Met in H. polymorpha, further supporting the cysteine-centered sulfur pathway. This is the first report on the novel features of H. polymorpha sulfur metabolic pathway, which are noticeably distinct from those of other yeast and filamentous fungal species. PMID:24959887

  1. Isolation and Characterization of Hydrocarbon-Degrading Yeast Strains from Petroleum Contaminated Industrial Wastewater

    PubMed Central

    Gargouri, Boutheina; Mhiri, Najla; Karray, Fatma; Aloui, Fathi; Sayadi, Sami

    2015-01-01

    Two yeast strains are enriched and isolated from industrial refinery wastewater. These strains were observed for their ability to utilize several classes of petroleum hydrocarbons substrates, such as n-alkanes and aromatic hydrocarbons as a sole carbon source. Phylogenetic analysis based on the D1/D2 variable domain and the ITS-region sequences indicated that strains HC1 and HC4 were members of the genera Candida and Trichosporon, respectively. The mechanism of hydrocarbon uptaking by yeast, Candida, and Trichosporon has been studied by means of the kinetic analysis of hydrocarbons-degrading yeasts growth and substrate assimilation. Biodegradation capacity and biomass quantity were daily measured during twelve days by gravimetric analysis and gas chromatography coupled with mass spectrometry techniques. Removal of n-alkanes indicated a strong ability of hydrocarbon biodegradation by the isolated yeast strains. These two strains grew on long-chain n-alkane, diesel oil, and crude oil but failed to grow on short-chain n-alkane and aromatic hydrocarbons. Growth measurement attributes of the isolates, using n-hexadecane, diesel oil, and crude oil as substrates, showed that strain HC1 had better degradation for hydrocarbon substrates than strain HC4. In conclusion, these yeast strains can be useful for the bioremediation process and decreasing petroleum pollution in wastewater contaminated with petroleum hydrocarbons. PMID:26339653

  2. Isolation and Characterization of Hydrocarbon-Degrading Yeast Strains from Petroleum Contaminated Industrial Wastewater.

    PubMed

    Gargouri, Boutheina; Mhiri, Najla; Karray, Fatma; Aloui, Fathi; Sayadi, Sami

    2015-01-01

    Two yeast strains are enriched and isolated from industrial refinery wastewater. These strains were observed for their ability to utilize several classes of petroleum hydrocarbons substrates, such as n-alkanes and aromatic hydrocarbons as a sole carbon source. Phylogenetic analysis based on the D1/D2 variable domain and the ITS-region sequences indicated that strains HC1 and HC4 were members of the genera Candida and Trichosporon, respectively. The mechanism of hydrocarbon uptaking by yeast, Candida, and Trichosporon has been studied by means of the kinetic analysis of hydrocarbons-degrading yeasts growth and substrate assimilation. Biodegradation capacity and biomass quantity were daily measured during twelve days by gravimetric analysis and gas chromatography coupled with mass spectrometry techniques. Removal of n-alkanes indicated a strong ability of hydrocarbon biodegradation by the isolated yeast strains. These two strains grew on long-chain n-alkane, diesel oil, and crude oil but failed to grow on short-chain n-alkane and aromatic hydrocarbons. Growth measurement attributes of the isolates, using n-hexadecane, diesel oil, and crude oil as substrates, showed that strain HC1 had better degradation for hydrocarbon substrates than strain HC4. In conclusion, these yeast strains can be useful for the bioremediation process and decreasing petroleum pollution in wastewater contaminated with petroleum hydrocarbons.

  3. PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae

    PubMed Central

    2013-01-01

    Background Saccharomyces cerevisiae is extensively used in bio-industries. However, its genetic engineering to introduce new metabolism pathways can cause unexpected phenotypic alterations. For example, humanisation of the glycosylation pathways is a high priority pharmaceutical industry goal for production of therapeutic glycoproteins in yeast. Genomic modifications can lead to several described physiological changes: biomass yields decrease, temperature sensitivity or cell wall structure modifications. We have observed that deletion of several N-mannosyltransferases in Saccharomyces cerevisiae, results in strains that can no longer be analyzed by classical PCR on yeast colonies. Findings In order to validate our glyco-engineered Saccharomyces cerevisiae strains, we developed a new protocol to carry out PCR directly on genetically modified yeast colonies. A liquid culture phase, combined with the use of a Hot Start DNA polymerase, allows a 3-fold improvement of PCR efficiency. The results obtained are repeatable and independent of the targeted sequence; as such the protocol is well adapted for intensive screening applications. Conclusions The developed protocol enables by-passing of many of the difficulties associated with PCR caused by phenotypic modifications brought about by humanisation of the glycosylation in yeast and allows rapid validation of glyco-engineered Saccharomyces cerevisiae cells. It has the potential to be extended to other yeast strains presenting cell wall structure modifications. PMID:23688076

  4. Improvement of aromatic thiol release through the selection of yeasts with increased β-lyase activity.

    PubMed

    Belda, Ignacio; Ruiz, Javier; Navascués, Eva; Marquina, Domingo; Santos, Antonio

    2016-05-16

    The development of a selective medium for the rapid differentiation of yeast species with increased aromatic thiol release activity has been achieved. The selective medium was based on the addition of S-methyl-l-cysteine (SMC) as β-lyase substrate. In this study, a panel of 245 strains of Saccharomyces cerevisiae strains was tested for their ability to grow on YCB-SMC medium. Yeast strains with an increased β-lyase activity grew rapidly because of their ability to release ammonium from SMC in comparison to others, and allowed for the easy isolation and differentiation of yeasts with promising properties in oenology, or another field, for aromatic thiol release. The selective medium was also helpful for the discrimination between those S. cerevisiae strains, which present a common 38-bp deletion in the IRC7 sequence (present in around 88% of the wild strains tested and are likely to be less functional for 4-mercapto-4-methylpentan-2-one (4MMP) production), and those S. cerevisiae strains homozygous for the full-length IRC7 allele. The medium was also helpful for the selection of non-Saccharomyces yeasts with increased β-lyase activity. Based on the same medium, a highly sensitive, reproducible and non-expensive GC-MS method for the evaluation of the potential volatile thiol release by different yeast isolates was developed. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Efforts to make and apply humanized yeast

    PubMed Central

    Laurent, Jon M.; Young, Jonathan H.; Kachroo, Aashiq H.

    2016-01-01

    Despite a billion years of divergent evolution, the baker’s yeast Saccharomyces cerevisiae has long proven to be an invaluable model organism for studying human biology. Given its tractability and ease of genetic manipulation, along with extensive genetic conservation with humans, it is perhaps no surprise that researchers have been able to expand its utility by expressing human proteins in yeast, or by humanizing specific yeast amino acids, proteins or even entire pathways. These methods are increasingly being scaled in throughput, further enabling the detailed investigation of human biology and disease-specific variations of human genes in a simplified model organism. PMID:26462863

  6. 21 CFR 184.1983 - Bakers yeast extract.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Bakers yeast extract. 184.1983 Section 184.1983... GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract is the food ingredient resulting from concentration of the solubles of mechanically ruptured cells of a selected strain of yeast, Saccharomyces...

  7. 21 CFR 172.898 - Bakers yeast glycan.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized, and...

  8. 21 CFR 184.1983 - Bakers yeast extract.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b) The...

  9. 21 CFR 172.590 - Yeast-malt sprout extract.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  10. 21 CFR 172.590 - Yeast-malt sprout extract.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  11. 21 CFR 172.590 - Yeast-malt sprout extract.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  12. 21 CFR 172.898 - Bakers yeast glycan.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized, and...

  13. 21 CFR 172.590 - Yeast-malt sprout extract.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Yeast-malt sprout extract. 172.590 Section 172.590... Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout extract, as described in this section, may... produced by partial hydrolysis of yeast extract (derived from Saccharomyces cereviseae, Saccharomyces...

  14. 21 CFR 184.1983 - Bakers yeast extract.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b) The...

  15. 21 CFR 172.590 - Yeast-malt sprout extract.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Yeast-malt sprout extract. 172.590 Section 172.590... CONSUMPTION Flavoring Agents and Related Substances § 172.590 Yeast-malt sprout extract. Yeast-malt sprout... prescribed conditions: (a) The additive is produced by partial hydrolysis of yeast extract (derived from...

  16. Unexpected expansion of tRNA substrate recognition by the yeast m1G9 methyltransferase Trm10.

    PubMed

    Swinehart, William E; Henderson, Jeremy C; Jackman, Jane E

    2013-08-01

    N-1 Methylation of the nearly invariant purine residue found at position 9 of tRNA is a nucleotide modification found in multiple tRNA species throughout Eukarya and Archaea. First discovered in Saccharomyces cerevisiae, the tRNA methyltransferase Trm10 is a highly conserved protein both necessary and sufficient to catalyze all known instances of m1G9 modification in yeast. Although there are 19 unique tRNA species that contain a G at position 9 in yeast, and whose fully modified sequence is known, only 9 of these tRNA species are modified with m1G9 in wild-type cells. The elements that allow Trm10 to distinguish between structurally similar tRNA species are not known, and sequences that are shared between all substrate or all nonsubstrate tRNAs have not been identified. Here, we demonstrate that the in vitro methylation activity of yeast Trm10 is not sufficient to explain the observed pattern of modification in vivo, as additional tRNA species are substrates for Trm10 m1G9 methyltransferase activity. Similarly, overexpression of Trm10 in yeast yields m1G9 containing tRNA species that are ordinarily unmodified in vivo. Thus, yeast Trm10 has a significantly broader tRNA substrate specificity than is suggested by the observed pattern of modification in wild-type yeast. These results may shed light onto the suggested involvement of Trm10 in other pathways in other organisms, particularly in higher eukaryotes that contain up to three different genes with sequence similarity to the single TRM10 gene in yeast, and where these other enzymes have been implicated in pathways beyond tRNA processing.

  17. Biological diversity of yeasts in the gastrointestinal tract of weaned piglets kept under different farm conditions.

    PubMed

    Urubschurov, Vladimir; Janczyk, Pawel; Pieper, Robert; Souffrant, Wolfgang B

    2008-12-01

    The study was conducted to determine yeasts present in the gastrointestinal tract (GIT) of piglets kept under experimental farm (EF) and commercial farm (CF) conditions. Ninety five German Landrace full- and half-sibling piglets were sacrificed at 39 days of age. Sixty eight piglets were weaned at 28th day of life, when they were offered one diet ad libitum. Twenty seven piglets remained unweaned by their dams. None of the piglets received any creep feed before weaning. Digesta samples were collected from 1/3 distal small intestine (SI), caecum and proximal colon. One hundred seventy three colonies of isolated yeasts were characterized by sequence analysis of the PCR-amplified D1/D2 domain of the 26S rRNA gene with following alignment of the recovered sequences to GenBank entries. From the 17 phylotypes found, isolates most closely related to Galactomyces geotrichum, Kazachstania slooffiae and Candida catenulata dominated in the GIT of CF piglets. Kazachstania slooffiae and Candida glabrata dominated in GIT of EF piglets. Sørenson and Morisita-Horn similarity indices between farms were low (0.44 and 0.54 respectively) and the Simpson diversity index was higher for EF (7.58) than for CF (4.34). The study brings new data on yeasts composition in the pig GIT and shows differences in yeasts biodiversity between farms operated at different hygiene conditions.

  18. Identification of yeast and bacteria involved in the mezcal fermentation of Agave salmiana.

    PubMed

    Escalante-Minakata, P; Blaschek, H P; Barba de la Rosa, A P; Santos, L; De León-Rodríguez, A

    2008-06-01

    To identify the yeast and bacteria present in the mezcal fermentation from Agave salmiana. The restriction and sequence analysis of the amplified region, between 18S and 28S rDNA and 16S rDNA genes, were used for the identification of yeast and bacteria, respectively. Eleven different micro-organisms were identified in the mezcal fermentation. Three of them were the following yeast: Clavispora lusitaniae, Pichia fermentans and Kluyveromyces marxianus. The bacteria found were Zymomonas mobilis subsp. mobilis and Zymomonas mobilis subsp. pomaceae, Weissella cibaria, Weissella paramesenteroides, Lactobacillus pontis, Lactobacillus kefiri, Lactobacillus plantarum and Lactobacillus farraginis. The phylogenetic analysis of 16S rDNA and ITS sequences showed that microbial diversity present in mezcal is dominated by bacteria, mainly lactic acid bacteria species and Zymomonas mobilis. Pichia fermentans and K. marxianus could be micro-organisms with high potential for the production of some volatile compounds in mezcal. We identified the community of bacteria and yeast present in mezcal fermentation from Agave salmiana.

  19. The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

    NASA Technical Reports Server (NTRS)

    Ludwig, D. L.; Bruschi, C. V.

    1991-01-01

    The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

  20. Isolation and characterization of yeasts capable of efficient utilization of hemicellulosic hydrolyzate as the carbon source.

    PubMed

    Cassa-Barbosa, L A; Procópio, R E L; Matos, I T S R; Filho, S A

    2015-09-28

    Few yeasts have shown the potential to efficiently utilize hemicellulosic hydrolyzate as the carbon source. In this study, microorganisms isolated from the Manaus region in Amazonas, Brazil, were characterized based on their utilization of the pentoses, xylose, and arabinose. The yeasts that showed a potential to assimilate these sugars were selected for the better utilization of lignocellulosic biomass. Two hundred and thirty seven colonies of unicellular microorganisms grown on hemicellulosic hydrolyzate, xylose, arabinose, and yeast nitrogen base selective medium were analyzed. Of these, 231 colonies were subjected to sugar assimilation tests. One hundred and twenty five of these were shown to utilize hydrolyzed hemicellulose, xylose, or arabinose as the carbon source for growth. The colonies that showed the best growth (N = 57) were selected, and their internal transcribed spacer-5.8S rDNA was sequenced. The sequenced strains formed four distinct groups in the phylogenetic tree, and showed a high percentage of similarity with Meyerozyma caribbica, Meyerozyma guilliermondii, Trichosporon mycotoxinivorans, Trichosporon loubieri, Pichia kudriavzevii, Candida lignohabitans, and Candida ethanolica. The discovery of these xylose-fermenting yeasts could attract widespread interest, as these can be used in the cost-effective production of liquid fuel from lignocellulosic materials.

  1. The power of fission: yeast as a tool for understanding complex splicing.

    PubMed

    Fair, Benjamin Jung; Pleiss, Jeffrey A

    2017-06-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression. Many metazoans, including humans, regulate alternative splicing patterns to generate expansions of their proteome from a limited number of genes. Importantly, a considerable fraction of human disease causing mutations manifest themselves through altering the sequences that shape the splicing patterns of genes. Thus, understanding the mechanistic bases of this complex pathway will be an essential component of combating these diseases. Dating almost to the initial discovery of splicing, researchers have taken advantage of the genetic tractability of budding yeast to identify the components and decipher the mechanisms of splicing. However, budding yeast lacks the complex splicing machinery and alternative splicing patterns most relevant to humans. More recently, many researchers have turned their efforts to study the fission yeast, Schizosaccharomyces pombe, which has retained many features of complex splicing, including degenerate splice site sequences, the usage of exonic splicing enhancers, and SR proteins. Here, we review recent work using fission yeast genetics to examine pre-mRNA splicing, highlighting its promise for modeling the complex splicing seen in higher eukaryotes.

  2. [Malassezia yeasts and their significance in dermatology].

    PubMed

    Hort, W; Nilles, M; Mayser, P

    2006-07-01

    Yeasts of the genus Malassezia belong to the normal microflora of the human skin. In addition they are known to cause a variety of skin diseases; the most frequent of which is pityriasis versicolor. Malassezia yeasts are also thought to be associated with seborrheic dermatitis, dandruff and Malassezia folliculitis. Recently the significance of Malassezia yeasts as a trigger factor for atopic dermatitis of the head and neck region has been pointed out. The role of the Malassezia yeasts in these different diseases has been controversial in the past and remains an issue because of difficulties in isolation, culture and differentiation of the organism. Thanks to molecular techniques, 10 species can actually be differentiated. The article presents the different Malassezia-associated diseases, their clinical picture, diagnosis and appropriate therapy. In addition the speciation of Malassezia is reviewed.

  3. Yeast Infections: MedlinePlus Health Topic

    MedlinePlus

    ... Foundation for Medical Education and Research) Also in Spanish Diagnosis and Tests Fungal Culture Test (National Library of Medicine) Also in Spanish Yeast Infection Test (National Library of Medicine) Also ...

  4. Experimental Systems to Study Yeast Pexophagy.

    PubMed

    Yamashita, Shun-Ichi; Oku, Masahide; Sakai, Yasuyoshi; Fujiki, Yukio

    2017-01-01

    Peroxisome abundance is tightly regulated according to the physiological contexts, through regulations of both proliferation and degradation of the organelles. Here, we describe detailed methods to analyze processes for autophagic degradation of peroxisomes, termed pexophagy, in yeast organisms. The assay systems include a method for biochemical detection of pexophagy completion, and one for microscopic visualization of specialized membrane structures acting in pexophagy. As a model yeast organism utilized in studies of pexophagy, the methylotrophic yeast Komagataella phaffii (Pichia pastoris) is referred to in this chapter and related information on the studies with baker's yeast (Saccharomyces cerevisiae) is also included. The described techniques facilitate elucidation of molecular machineries for pexophagy and understanding of peroxisome-selective autophagic pathways.

  5. Monitoring Air Quality with Leaf Yeasts.

    ERIC Educational Resources Information Center

    Richardson, D. H. S.; And Others

    1985-01-01

    Proposes that leaf yeast serve as quick, inexpensive, and effective techniques for monitoring air quality. Outlines procedures and provides suggestions for data analysis. Includes results from sample school groups who employed this technique. (ML)

  6. Awa1p on the cell surface of sake yeast inhibits biofilm formation and the co-aggregation between sake yeasts and Lactobacillus plantarum ML11-11.

    PubMed

    Hirayama, Satoru; Shimizu, Masashi; Tsuchiya, Noriko; Furukawa, Soichi; Watanabe, Daisuke; Shimoi, Hitoshi; Takagi, Hiroshi; Ogihara, Hirokazu; Morinaga, Yasushi

    2015-05-01

    We examined mixed-species biofilm formation between Lactobacillus plantarum ML11-11 and both foaming and non-foaming mutant strains of Saccharomyces cerevisiae sake yeasts. Wild-type strains showed significantly lower levels of biofilm formation compared with the non-foaming mutants. Awa1p, a protein involved in foam formation during sake brewing, is a glycosylphosphatidylinositol (GPI)-anchored protein and is associated with the cell wall of sake yeasts. The AWA1 gene of the non-foaming mutant strain Kyokai no. 701 (K701) has lost the C-terminal sequence that includes the GPI anchor signal. Mixed-species biofilm formation and co-aggregation of wild-type strain Kyokai no. 7 (K7) were significantly lower than K701 UT-1 (K701 ura3/ura3 trp1/trp1), while the levels of strain K701 UT-1 carrying the AWA1 on a plasmid were comparable to those of K7. The levels of biofilm formation and co-aggregation of the strain K701 UT-1 harboring AWA1 with a deleted GPI anchor signal were similar to those of K701 UT-1. These results clearly demonstrate that Awa1p present on the surface of sake yeast strain K7 inhibits adhesion between yeast cells and L. plantarum ML11-11, consequently impeding mixed-species biofilm formation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. High quality de novo sequencing and assembly of the Saccharomyces arboricolus genome

    PubMed Central

    2013-01-01

    Background Comparative genomics is a formidable tool to identify functional elements throughout a genome. In the past ten years, studies in the budding yeast Saccharomyces cerevisiae and a set of closely related species have been instrumental in showing the benefit of analyzing patterns of sequence conservation. Increasing the number of closely related genome sequences makes the comparative genomics approach more powerful and accurate. Results Here, we report the genome sequence and analysis of Saccharomyces arboricolus, a yeast species recently isolated in China, that is closely related to S. cerevisiae. We obtained high quality de novo sequence and assemblies using a combination of next generation sequencing technologies, established the phylogenetic position of this species and considered its phenotypic profile under multiple environmental conditions in the light of its gene content and phylogeny. Conclusions We suggest that the genome of S. arboricolus will be useful in future comparative genomics analysis of the Saccharomyces sensu stricto yeasts. PMID:23368932

  8. Yeasts are essential for cocoa bean fermentation.

    PubMed

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  9. Yeast as a model for Ras signalling.

    PubMed

    Tisi, Renata; Belotti, Fiorella; Martegani, Enzo

    2014-01-01

    For centuries yeast species have been popular hosts for classical biotechnology processes, such as baking, brewing, and wine making, and more recently for recombinant proteins production, thanks to the advantages of unicellular organisms (i.e., ease of genetic manipulation and rapid growth) together with the ability to perform eukaryotic posttranslational modifications. Moreover, yeast cells have been used for few decades as a tool for identifying the genes and pathways involved in basic cellular processes such as the cell cycle, aging, and stress response. In the budding yeast S. cerevisiae the Ras/cAMP/PKA pathway is directly involved in the regulation of metabolism, cell growth, stress resistance, and proliferation in response to the availability of nutrients and in the adaptation to glucose, controlling cytosolic cAMP levels and consequently the cAMP-dependent protein kinase (PKA) activity. Moreover, Ras signalling has been identified in several pathogenic yeasts as a key controller for virulence, due to its involvement in yeast morphogenesis. Nowadays, yeasts are still useful for Ras-like proteins investigation, both as model organisms and as a test tube to study variants of heterologous Ras-like proteins.

  10. Flor Yeast: New Perspectives Beyond Wine Aging

    PubMed Central

    Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

    2016-01-01

    The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

  11. The growth of solar radiated yeast

    NASA Technical Reports Server (NTRS)

    Kraft, Tyrone

    1995-01-01

    This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containers with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.

  12. The growth of solar radiated yeast

    SciTech Connect

    Kraft, T.

    This researcher plans to determine if solar radiation affects the growth of yeast. The irradiated yeast was obtained from a sample exposed in space during a Space Shuttle flight of September 9-20, 1994. Further, the control groups were held at: (1) Goddard Space Flight Center (GSFC) in Greenbelt, Maryland; and (2) South Dakota School of Mines and Technology. The procedure used was based on the fact that yeast is most often used in consumable baked goods. Therefore, the yeast was incorporated into a basic Betty Crocker bread recipe. Data was collected by placing measured amounts of dough into sample containersmore » with fifteen minute growth in height measurements collected and recorded. This researcher assumed the viability of yeast to be relative to its ability to produce carbon dioxide gas and cause the dough to rise. As all ingredients and surroundings were equal, this researcher assumed the yeast will produce the only significant difference in data collected. This researcher noted the approximate use date on all sample packages to be prior to arrival and experiment date. All dates equal, it was then assumed each would act in a similar manner of response. This assumption will allow for equally correct data collection.« less

  13. Novel brewing yeast hybrids: creation and application.

    PubMed

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2017-01-01

    The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

  14. Making Sense of the Yeast Sphingolipid Pathway.

    PubMed

    Megyeri, Márton; Riezman, Howard; Schuldiner, Maya; Futerman, Anthony H

    2016-12-04

    Sphingolipids (SL) and their metabolites play key roles both as structural components of membranes and as signaling molecules. Many of the key enzymes and regulators of SL metabolism were discovered using the yeast Saccharomyces cerevisiae, and based on the high degree of conservation, a number of mammalian homologs were identified. Although yeast continues to be an important tool for SL research, the complexity of SL structure and nomenclature often hampers the ability of new researchers to grasp the subtleties of yeast SL biology and discover new modulators of this intricate pathway. Moreover, the emergence of lipidomics by mass spectrometry has enabled the rapid identification of SL species in yeast and rendered the analysis of SL composition under various physiological and pathophysiological conditions readily amenable. However, the complex nomenclature of the identified species renders much of the data inaccessible to non-specialists. In this review, we focus on parsing both the classical SL nomenclature and the nomenclature normally used during mass spectrometry analysis, which should facilitate the understanding of yeast SL data and might shed light on biological processes in which SLs are involved. Finally, we discuss a number of putative roles of various yeast SL species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Physiological and environmental control of yeast prions

    PubMed Central

    Chernova, Tatiana A.; Wilkinson, Keith D.; Chernoff, Yury O.

    2014-01-01

    Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion formation could be beneficial in variable environmental conditions. Yeast and mammalian prions have similar molecular properties. Crucial cellular factors and conditions influencing prion formation and propagation were uncovered in the yeast models. Stress-related chaperones, protein quality control deposits, degradation pathways and cytoskeletal networks control prion formation and propagation in yeast. Environmental stresses trigger prion formation and loss, supposedly acting via influencing intracellular concentrations of the prion-inducing proteins, and/or by localizing prionogenic proteins to the prion induction sites via heterologous ancillary helpers. Physiological and environmental modulation of yeast prions points to new opportunities for pharmacological intervention and/or prophylactic measures targeting general cellular systems rather than the properties of individual amyloids and prions. PMID:24236638

  16. Genomic and Phenotypic Characterization of Yeast Biosensor for Deep-space Radiation

    NASA Technical Reports Server (NTRS)

    Marina, Diana B.; Santa Maria, Sergio; Bhattacharya, Sharmila

    2016-01-01

    The BioSentinel mission was selected to launch as a secondary payload onboard NASA Exploration Mission 1 (EM-1) in 2018. In BioSentinel, the budding yeast Saccharomyces cerevisiae will be used as a biosensor to measure the long-term impact of deep-space radiation to living organisms. In the 4U-payload, desiccated yeast cells from different strains will be stored inside microfluidic cards equipped with 3-color LED optical detection system to monitor cell growth and metabolic activity. At different times throughout the 12-month mission, these cards will be filled with liquid yeast growth media to rehydrate and grow the desiccated cells. The growth and metabolic rates of wild-type and radiation-sensitive strains in deep-space radiation environment will be compared to the rates measured in the ground- and microgravity-control units. These rates will also be correlated with measurements obtained from onboard physical dosimeters. In our preliminary long-term desiccation study, we found that air-drying yeast cells in 10% trehalose is the best method of cell preservation in order to survive the entire 18-month mission duration (6-month pre-launch plus 12-month full-mission periods). However, our study also revealed that desiccated yeast cells have decreasing viability over time when stored in payload-like environment. This suggests that the yeast biosensor will have different population of cells at different time points during the long-term mission. In this study, we are characterizing genomic and phenotypic changes in our yeast biosensor due to long-term storage and desiccation. For each yeast strain that will be part of the biosensor, several clones were reisolated after long-term storage by desiccation. These clones were compared to their respective original isolate in terms of genomic composition, desiccation tolerance and radiation sensitivity. Interestingly, clones from a radiation-sensitive mutant have better desiccation tolerance compared to their original isolate

  17. In Situ Analysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

    PubMed Central

    Kong, Yu; Wu, Qun; Zhang, Yan

    2014-01-01

    The in situ metabolic characteristics of the yeasts involved in spontaneous fermentation process of Chinese light-style liquor are poorly understood. The covariation between metabolic profiles and yeast communities in Chinese light-style liquor was modeled using the partial least square (PLS) regression method. The diversity of yeast species was evaluated by sequence analysis of the 26S ribosomal DNA (rDNA) D1/D2 domains of cultivable yeasts, and the volatile compounds in fermented grains were analyzed by gas chromatography (GC)-mass spectrometry (MS). Eight yeast species and 58 volatile compounds were identified, respectively. The modulation of 16 of these volatile compounds was associated with variations in the yeast population (goodness of prediction [Q2] > 20%). The results showed that Pichia anomala was responsible for the characteristic aroma of Chinese liquor, through the regulation of several important volatile compounds, such as ethyl lactate, octanoic acid, and ethyl tetradecanoate. Correspondingly, almost all of the compounds associated with P. anomala were detected in a pure culture of this yeast. In contrast to the PLS regression results, however, ethyl lactate and ethyl isobutyrate were not detected in the same pure culture, which indicated that some metabolites could be generated by P. anomala only when it existed in a community with other yeast species. Furthermore, different yeast communities provided different volatile patterns in the fermented grains, which resulted in distinct flavor profiles in the resulting liquors. This study could help identify the key yeast species involved in spontaneous fermentation and provide a deeper understanding of the role of individual yeast species in the community. PMID:24727269

  18. Ethanol yield and volatile compound content in fermentation of agave must by Kluyveromyces marxianus UMPe-1 comparing with Saccharomyces cerevisiae baker's yeast used in tequila production.

    PubMed

    López-Alvarez, Arnoldo; Díaz-Pérez, Alma Laura; Sosa-Aguirre, Carlos; Macías-Rodríguez, Lourdes; Campos-García, Jesús

    2012-05-01

    In tequila production, fermentation is an important step. Fermentation determines the ethanol productivity and organoleptic properties of the beverage. In this study, a yeast isolated from native residual agave must was identified as Kluyveromyces marxianus UMPe-1 by 26S rRNA sequencing. This yeast was compared with the baker's yeast Saccharomyces cerevisiae Pan1. Our findings demonstrate that the UMPe-1 yeast was able to support the sugar content of agave must and glucose up to 22% (w/v) and tolerated 10% (v/v) ethanol concentration in the medium with 50% cells survival. Pilot and industrial fermentation of agave must tests showed that the K. marxianus UMPe-1 yeast produced ethanol with yields of 94% and 96% with respect to fermentable sugar content (glucose and fructose, constituting 98%). The S. cerevisiae Pan1 baker's yeast, however, which is commonly used in some tequila factories, showed 76% and 70% yield. At the industrial level, UMPe-1 yeast shows a maximum velocity of fermentable sugar consumption of 2.27g·L(-1)·h(-1) and ethanol production of 1.38g·L(-1)·h(-1), providing 58.78g ethanol·L(-1) at 72h fermentation, which corresponds to 96% yield. In addition, the major and minor volatile compounds in the tequila beverage obtained from UMPe-1 yeast were increased. Importantly, 29 volatile compounds were identified, while the beverage obtained from Pan1-yeast contained fewer compounds and in lower concentrations. The results suggest that the K. marxianus UMPe-1 is a suitable yeast for agave must fermentation, showing high ethanol productivity and increased volatile compound content comparing with a S. cerevisiae baker's yeast used in tequila production. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.

    PubMed

    James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

    2013-01-01

    In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain.

  20. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  1. Competition assays and physiological experiments of soil and phyllosphere yeasts identify Candida subhashii as a novel antagonist of filamentous fungi.

    PubMed

    Hilber-Bodmer, Maja; Schmid, Michael; Ahrens, Christian H; Freimoser, Florian M

    2017-01-05

    While recent advances in next generation sequencing technologies have enabled researchers to readily identify countless microbial species in soil, rhizosphere, and phyllosphere microbiomes, the biological functions of the majority of these species are unknown. Functional studies are therefore urgently needed in order to characterize the plethora of microorganisms that are being identified and to point out species that may be used for biotechnology or plant protection. Here, we used a dual culture assay and growth analyses to characterise yeasts (40 different isolates) and their antagonistic effect on 16 filamentous fungi; comprising plant pathogens, antagonists, and saprophytes. Overall, this competition screen of 640 pairwise combinations revealed a broad range of outcomes, ranging from small stimulatory effects of some yeasts up to a growth inhibition of more than 80% by individual species. On average, yeasts isolated from soil suppressed filamentous fungi more strongly than phyllosphere yeasts and the antagonistic activity was a species-/isolate-specific property and not dependent on the filamentous fungus a yeast was interacting with. The isolates with the strongest antagonistic activity were Metschnikowia pulcherrima, Hanseniaspora sp., Cyberlindnera sargentensis, Aureobasidium pullulans, Candida subhashii, and Pichia kluyveri. Among these, the soil yeasts (C. sargentensis, A. pullulans, C. subhashii) assimilated and/or oxidized more di-, tri- and tetrasaccharides and organic acids than yeasts from the phyllosphere. Only the two yeasts C. subhashii and M. pulcherrima were able to grow with N-acetyl-glucosamine as carbon source. The competition assays and physiological experiments described here identified known antagonists that have been implicated in the biological control of plant pathogenic fungi in the past, but also little characterised species such as C. subhashii. Overall, soil yeasts were more antagonistic and metabolically versatile than yeasts from

  2. Stepwise synthesis of oligonucleotides. XXII. The synthesis of Tpsi-loop fragments of yeast tRNAIVal and their analogs.

    PubMed Central

    Zhenodarova, S M; Klyagina, V P; Smolyaninova, O A; Khabarova, M I; Antonovich, E G; Prokof'yev, M A

    1977-01-01

    The method of the combined use of nucleolytic enzymes was used for the synthesis of Tpsi-loop fragments of yeast valine tRNA and their analogs. Dinucleoside monophosphates, trinucleoside diphosphates and tetranucleoside triphosphates having the sequences of fragments 54-57 and 59-62 or their analogs were synthesized. PMID:896487

  3. Dimorphic cycle in Candida citri sp. nov., a novel yeast species isolated from rotting fruit in Borneo.

    PubMed

    Sipiczki, Matthias

    2011-03-01

    Five dimorphic yeast strains were isolated from rotting lime fruits in Borneo. The sequences of the D1/D2 domains of the 26S rRNA genes, the internal transcribed spacer (ITS) chromosomal regions and the 18S rRNA genes were identical in the isolates and differed from the corresponding sequences of all known yeast species. Based on the sequence differences (12-15% in the D1/D2 domain) from the closest relatives and the different pattern of taxonomic traits, the new isolates are assigned the status of a new species, for which the name Candida citri sp. nov. is proposed. Its type strain is 11-469(T) , which has been deposited in Centralbureau voor Schimmelcultures (Utrecht, the Netherlands) as CBS 11858(T) , Culture Collection of Yeasts (Bratislava, Slovakia) as CCY 29-181-1(T) and the National Collection of Agricultural and Industrial Microorganisms (Budapest, Hungary) as NCAIM Y.01978(T) . MycoBank number: MB 519100. The GenBank accession numbers for nucleotide sequences of its D1/D2 domain, ITS and 18S regions are HM803241, HM803242 and HM803243, respectively. Candida citri produces invasive mycelium composed of true septate hyphae that grow towards nutrient-rich parts of the medium and develop large vacuoles at the nongrowing ends of their cells. The hyphae produce blastoconidia, which can establish satellite yeast colonies in the invaded solid substrate. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. Isolation of the alkane inducible cytochrome P450 (P450alk) gene from the yeast Candida tropicalis

    EPA Science Inventory

    The gene for the alkane-inducible cytochrome P450, P450alk, has been isolated from the yeast Candida tropicalis by immunoscreening a λgt11 library. Isolation of the gene has been identified on the basis of its inducibility and partial DNA sequence. Transcripts of this gene were i...

  5. Draft Genome Sequence of Rhodotorula mucilaginosa, an Emergent Opportunistic Pathogen

    PubMed Central

    Deligios, Massimo; Fraumene, Cristina; Abbondio, Marcello; Mannazzu, Ilaria; Tanca, Alessandro; Addis, Maria Filippa

    2015-01-01

    Rhodotorula mucilaginosa, a yeast with valuable biotechnological features, has also been recorded as an emergent opportunistic pathogen that might cause disease in both immunocompetent and immunocompromised individuals. Here, we report the draft genome sequence of R. mucilaginosa strain C2.5t1, which was isolated from cacao seeds in Cameroon. PMID:25858834

  6. Genetic basis of priority effects: insights from nectar yeast

    PubMed Central

    Hartwig, Thomas

    2016-01-01

    Priority effects, in which the order of species arrival dictates community assembly, can have a major influence on species diversity, but the genetic basis of priority effects remains unknown. Here, we suggest that nitrogen scavenging genes previously considered responsible for starvation avoidance may drive priority effects by causing rapid resource depletion. Using single-molecule sequencing, we de novo assembled the genome of the nectar-colonizing yeast, Metschnikowia reukaufii, across eight scaffolds and complete mitochondrion, with gap-free coverage over gene spaces. We found a high rate of tandem gene duplication in this genome, enriched for nitrogen metabolism and transport. Both high-capacity amino acid importers, GAP1 and PUT4, present as tandem gene arrays, were highly expressed in synthetic nectar and regulated by the availability and quality of amino acids. In experiments with competitive nectar yeast, Candida rancensis, amino acid addition alleviated suppression of C. rancensis by early arrival of M. reukaufii, corroborating that amino acid scavenging may contribute to priority effects. Because niche pre-emption via rapid resource depletion may underlie priority effects in a broad range of microbial, plant and animal communities, nutrient scavenging genes like the ones we considered here may be broadly relevant to understanding priority effects. PMID:27708148

  7. Accelerated and Adaptive Evolution of Yeast Sexual Adhesins

    PubMed Central

    Xie, Xianfa; Qiu, Wei-Gang; Lipke, Peter N.

    2011-01-01

    There is a recent emergence of interest in the genes involved in gametic recognition as drivers of reproductive isolation. The recent population genomic sequencing of two species of sexually primitive yeasts (Liti G, Carter DM, Moses AM, Warringer J, Parts L, James SA, Davey RP, Roberts IN, Burt A, Koufopanou V et al. [23 co-authors]. 2009. Population genomics of domestic and wild yeasts. Nature 458:337–341.) has provided data for systematic study of the roles these genes play in the early evolution of sex and speciation. Here, we discovered that among genes encoding cell surface proteins, the sexual adhesin genes have evolved significantly more rapidly than others, both within and between Saccharomyces cerevisiae and its closest relative S. paradoxus. This result was supported by analyses using the PAML pairwise model, a modified McDonald–Kreitman test, and the PAML branch model. Moreover, using a combination of a new statistic of neutrality, an information theory–based measure of evolutionary variability, and functional characterization of amino acid changes, we found that a higher proportion of amino acid changes are fixed in the sexual adhesins than in other proteins and a greater proportion of the fixed amino acid changes either between the two species or the two subgroups of S. paradoxus are functionally dissimilar or radically different. These results suggest that the accelerated evolution of sexual adhesin genes may facilitate speciation, or incipient speciation, and promote sexual selection in general. PMID:21633112

  8. Can Yeast (S. cerevisiae) Metabolic Volatiles Provide Polymorphic Signaling?

    PubMed Central

    Arguello, J. Roman; Sellanes, Carolina; Lou, Yann Ru; Raguso, Robert A.

    2013-01-01

    Chemical signaling between organisms is a ubiquitous and evolutionarily dynamic process that helps to ensure mate recognition, location of nutrients, avoidance of toxins, and social cooperation. Evolutionary changes in chemical communication systems progress through natural variation within the organism generating the signal as well as the responding individuals. A promising yet poorly understood system with which to probe the importance of this variation exists between D. melanogaster and S. cerevisiae. D. melanogaster relies on yeast for nutrients, while also serving as a vector for yeast cell dispersal. Both are outstanding genetic and genomic models, with Drosophila also serving as a preeminent model for sensory neurobiology. To help develop these two genetic models as an ecological model, we have tested if - and to what extent - S. cerevisiae is capable of producing polymorphic signaling through variation in metabolic volatiles. We have carried out a chemical phenotyping experiment for 14 diverse accessions within a common garden random block design. Leveraging genomic sequences for 11 of the accessions, we ensured a genetically broad sample and tested for phylogenetic signal arising from phenotypic dataset. Our results demonstrate that significant quantitative differences for volatile blends do exist among S. cerevisiae accessions. Of particular ecological relevance, the compounds driving the blend differences (acetoin, 2-phenyl ethanol and 3-methyl-1-butanol) are known ligands for D. melanogasters chemosensory receptors, and are related to sensory behaviors. Though unable to correlate the genetic and volatile measurements, our data point clear ways forward for behavioral assays aimed at understanding the implications of this variation. PMID:23990899

  9. The Effect of Selenium Enrichment on Baker s Yeast Proteome

    PubMed Central

    El-Bayoumy, Karam; Das, Arunangshu; Russell, Stephen; Wolfe, Steven; Jordan, Rick; Renganathan, Kutralanathan; Loughran, Thomas P.; Somiari, Richard

    2011-01-01

    The use of regular yeast (RY) and selenium-enriched yeast (SEY) as dietary supplement is of interest because the Nutritional Prevention of Cancer (NPC) trial revealed that SEY but not RY decreased the incidence of prostate cancer (PC). Using two-dimensional difference in gel electrophoresis (2D-DIGE) – tandem mass spectrometry (MS/MS) approach, we performed proteomic analysis of RY and SEY to identify proteins that are differentially expressed as a result of selenium enrichment. 2D-DIGE revealed 96 candidate protein spots that were differentially expressed (p≤0.05) between SEY and RY. The 96 spots were selected, sequenced by LC/MS/MS and 37 proteins were unequivocally identified. The 37 identified proteins were verified with ProteinProphet software and mapped to existing Gene Ontology categories. Furthermore, the expression profile of 5 of the proteins with validated or putative roles in the carcinogenesis process, and for which antibodies against human forms of the proteins are available commercially were verified by western analysis. This study provides evidence for the first time that SEY contains higher levels of Pyruvate Kinase, HSP70, and Elongation factor 2 and lower levels of Eukaryotic Translation Initiation Factor 5A-2 and Triosephosphate Isomerase than those found in RY. PMID:22067702

  10. Isolation of total RNA from yeast cell cultures.

    PubMed

    Ares, Manuel

    2012-10-01

    This article describes two procedures for isolating total RNA from yeast cell cultures. The first allows the convenient isolation of total RNA from early log-phase cultures (vegetative cells). RNA isolated in this way is intact and sufficiently pure for use in microarray experiments, primer extension, and RNase protection mapping. With additional treatment to remove contaminating genomic DNA, the preparation is suitable for reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), cDNA library construction, high-throughput sequencing of RNA, or other manipulations. However, compared to vegetative cells, the isolation of RNA from cells late in meiosis (asci and ascospores) requires additional effort. This is because a tough cell wall composed of heavily cross-linked polysaccharides and proteins is built around the four spores during meiosis and ascospore development. Therefore, an alternative protocol is presented for extracting RNA from cells late in meiosis. This alternative may also be preferable for cells from stationary cultures or from yeast strains and other fungal species isolated from the environment.

  11. Engineering of synthetic, stress-responsive yeast promoters

    PubMed Central

    Rajkumar, Arun S.; Liu, Guodong; Bergenholm, David; Arsovska, Dushica; Kristensen, Mette; Nielsen, Jens; Jensen, Michael K.; Keasling, Jay D.

    2016-01-01

    Advances in synthetic biology and our understanding of the rules of promoter architecture have led to the development of diverse synthetic constitutive and inducible promoters in eukaryotes and prokaryotes. However, the design of promoters inducible by specific endogenous or environmental conditions is still rarely undertaken. In this study, we engineered and characterized a set of strong, synthetic promoters for budding yeast Saccharomyces cerevisiae that are inducible under acidic conditions (pH ≤ 3). Using available expression and transcription factor binding data, literature on transcriptional regulation, and known rules of promoter architecture we improved the low-pH performance of the YGP1 promoter by modifying transcription factor binding sites in its upstream activation sequence. The engineering strategy outlined for the YGP1 promoter was subsequently applied to create a response to low pH in the unrelated CCW14 promoter. We applied our best promoter variants to low-pH fermentations, enabling ten-fold increased production of lactic acid compared to titres obtained with the commonly used, native TEF1 promoter. Our findings outline and validate a general strategy to iteratively design and engineer synthetic yeast promoters inducible to environmental conditions or stresses of interest. PMID:27325743

  12. Discussion of teleomorphic and anamorphic Ascomycetous yeasts and yeast-like taxa

    USDA-ARS?s Scientific Manuscript database

    The relationship of ascomycetous yeasts with other members of the ascomycete fungi (Ascomycota) has been controversial for over 100 years. Because yeasts are morphologically simple, it was proposed that they represent primitive forms of ascomycetes (e.g., Guilliermond 1912). Alternatively, the ide...

  13. Effect of wine yeast monoculture practice on the biodiversity of non-Saccharomyces yeasts.

    PubMed

    Ganga, M A; Martínez, C

    2004-01-01

    The objective of this work was to study the effect of the use of Saccharomyces cerevisiae monocultures over the biodiversity of non-Saccharomyces yeasts in wine-producing areas in Chile. Microvinifications were carried out with grape musts of two areas. In one of them, the fermentation is carried out mainly in a spontaneous manner, whereas in the other the musts are inoculated with commercial yeasts. The isolated yeasts were identified by the internal transcribed (ITS)/restriction fragment length polymorphism technique. In the industrial production area less variability of yeast genera was observed as compared with the traditional area, an observation that is greatest at the end of the fermentation. Furthermore, a study of the production of extracellular enzymes was done. The majority of the yeasts showed at least one of the activities assayed with the exception of beta-glycosidase. The results suggest that in the industrialized area the diversity of yeasts is less in the traditional area. Likewise, the potentiality of the non-Saccharomyces yeasts as enzyme producers with industrial interest has been confirmed. This study shows the negative effect of the use of monocultures over the biodiversity of yeasts in wine-producing regions.

  14. Yeasts associated with the curculionid beetle Xyloterinus politus: Candida xyloterini sp. nov., Candida palmyrensis sp. nov. and three common ambrosia yeasts.

    PubMed

    Suh, Sung-Oui; Zhou, Jianlong

    2010-07-01

    Seven yeast strains were isolated from the body surface and galleries of Xyloterinus politus, the ambrosia beetle that attacks black oak trees. Based on rDNA sequence comparisons and other taxonomic characteristics, five of the strains were identified as members of the species Saccharomycopsis microspora, Wickerhamomyces hampshirensis and Candida mycetangii, which have been reported previously as being associated with insects. The remaining two yeast strains were proposed as representatives of two novel species, Candida xyloterini sp. nov. (type strain ATCC 62898(T)=CBS 11547(T)) and Candida palmyrensis sp. nov. (type strain ATCC 62899(T)=CBS 11546(T)). C. xyloterini sp. nov. is a close sister taxon to Ogataea dorogensis and assimilates methanol as a sole carbon source but lacks ascospores. On the other hand, C. palmyrensis sp. nov. is phylogenetically distinct from any other ambrosia yeast reported so far. The species was placed near Candida sophiae-reginae and Candida beechii based on DNA sequence analyses, but neither of these were close sister taxa to C. palmyrensis sp. nov.

  15. Functional adaptation between yeast actin and its cognate myosin motors.

    PubMed

    Stark, Benjamin C; Wen, Kuo-Kuang; Allingham, John S; Rubenstein, Peter A; Lord, Matthew

    2011-09-02

    We employed budding yeast and skeletal muscle actin to examine the contribution of the actin isoform to myosin motor function. While yeast and muscle actin are highly homologous, they exhibit different charge density at their N termini (a proposed myosin-binding interface). Muscle myosin-II actin-activated ATPase activity is significantly higher with muscle versus yeast actin. Whether this reflects inefficiency in the ability of yeast actin to activate myosin is not known. Here we optimized the isolation of two yeast myosins to assess actin function in a homogenous system. Yeast myosin-II (Myo1p) and myosin-V (Myo2p) accommodate the reduced N-terminal charge density of yeast actin, showing greater activity with yeast over muscle actin. Increasing the number of negative charges at the N terminus of yeast actin from two to four (as in muscle) had little effect on yeast myosin activity, while other substitutions of charged residues at the myosin interface of yeast actin reduced activity. Thus, yeast actin functions most effectively with its native myosins, which in part relies on associations mediated by its outer domain. Compared with yeast myosin-II and myosin-V, muscle myosin-II activity was very sensitive to salt. Collectively, our findings suggest differing degrees of reliance on electrostatic interactions during weak actomyosin binding in yeast versus muscle. Our study also highlights the importance of native actin isoforms when considering the function of myosins.

  16. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    DTIC Science & Technology

    2016-02-11

    the White- head Genome Technology Core for sequencing . This work was supported by the UCSF Program for Breakthrough Biomedical Research (funded in...landscape of the yeast genome defined by RNA sequencing . Science 320, 1344–1349. Nedialkova, D.D., and Leidel, S.A. (2015). Optimization of Codon Translation... the CC BY license (http://creativecommons.org/licenses/by/4.0/). SUMMARY Ribosome-footprint profiling provides genome -wide snapshots of translation

  17. The Yeast Saccharomyces cerevisiae as a Model for Understanding RAS Proteins and Their Role in Human Tumorigenesis

    PubMed Central

    Cazzanelli, Giulia; Francisco, Rita; Azevedo, Luísa; Carvalho, Patrícia Dias; Almeida, Ana; Côrte-Real, Manuela; Oliveira, Maria José; Lucas, Cândida; Sousa, Maria João

    2018-01-01

    The exploitation of the yeast Saccharomyces cerevisiae as a biological model for the investigation of complex molecular processes conserved in multicellular organisms, such as humans, has allowed fundamental biological discoveries. When comparing yeast and human proteins, it is clear that both amino acid sequences and protein functions are often very well conserved. One example of the high degree of conservation between human and yeast proteins is highlighted by the members of the RAS family. Indeed, the study of the signaling pathways regulated by RAS in yeast cells led to the discovery of properties that were often found interchangeable with RAS proto-oncogenes in human pathways, and vice versa. In this work, we performed an updated critical literature review on human and yeast RAS pathways, specifically highlighting the similarities and differences between them. Moreover, we emphasized the contribution of studying yeast RAS pathways for the understanding of human RAS and how this model organism can contribute to unveil the roles of RAS oncoproteins in the regulation of mechanisms important in the tumorigenic process, like autophagy. PMID:29463063

  18. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties

    SciTech Connect

    Piskur, Jure; Ling, Zhihao; Marcet-Houben, Marina

    2012-03-14

    The yeast Dekkera/Brettanomyces bruxellensis can cause enormous economic losses in wine industry due to production of phenolic off-flavor compounds. D. bruxellensis is a distant relative of baker's yeast Saccharomyces cerevisiae. Nevertheless, these two yeasts are often found in the same habitats and share several food-related traits, such as production of high ethanol levels and ability to grow without oxygen. In some food products, like lambic beer, D. bruxellensis can importantly contribute to flavor development. We determined the 13.4 Mb genome sequence of the D. bruxellensis strain Y879 (CBS2499) and deduced the genetic background of several ?food-relevant? properties and evolutionary historymore » of this yeast. Surprisingly, we find that this yeast is phylogenetically distant to other food-related yeasts and most related to Pichia (Komagataella) pastoris, which is an aerobic poor ethanol producer. We further show that the D. bruxellensis genome does not contain an excess of lineage specific duplicated genes nor a horizontally transferred URA1 gene, two crucial events that promoted the evolution of the food relevant traits in the S. cerevisiae lineage. However, D. bruxellensis has several independently duplicated ADH and ADH-like genes, which are likely responsible for metabolism of alcohols, including ethanol, and also a range of aromatic compounds.« less

  19. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties.

    PubMed

    Piškur, Jure; Ling, Zhihao; Marcet-Houben, Marina; Ishchuk, Olena P; Aerts, Andrea; LaButti, Kurt; Copeland, Alex; Lindquist, Erika; Barry, Kerrie; Compagno, Concetta; Bisson, Linda; Grigoriev, Igor V; Gabaldón, Toni; Phister, Trevor

    2012-07-02

    The yeast Dekkera/Brettanomyces bruxellensis can cause enormous economic losses in wine industry due to production of phenolic off-flavor compounds. D. bruxellensis is a distant relative of baker's yeast Saccharomyces cerevisiae. Nevertheless, these two yeasts are often found in the same habitats and share several food-related traits, such as production of high ethanol levels and ability to grow without oxygen. In some food products, like lambic beer, D. bruxellensis can importantly contribute to flavor development. We determined the 13.4 Mb genome sequence of the D. bruxellensis strain Y879 (CBS2499) and deduced the genetic background of several "food-relevant" properties and evolutionary history of this yeast. Surprisingly, we find that this yeast is phylogenetically distant to other food-related yeasts and most related to Pichia (Komagataella) pastoris, which is an aerobic poor ethanol producer. We further show that the D. bruxellensis genome does not contain an excess of lineage specific duplicated genes nor a horizontally transferred URA1 gene, two crucial events that promoted the evolution of the food relevant traits in the S. cerevisiae lineage. However, D. bruxellensis has several independently duplicated ADH and ADH-like genes, which are likely responsible for metabolism of alcohols, including ethanol, and also a range of aromatic compounds. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.

    PubMed

    Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A

    2018-01-01

    Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.

  1. The environmental and intrinsic yeast diversity of Cuban cocoa bean heap fermentations.

    PubMed

    Fernández Maura, Yurelkys; Balzarini, Tom; Clapé Borges, Pablo; Evrard, Pierre; De Vuyst, Luc; Daniel, H-M

    2016-09-16

    The environmental yeast diversity of spontaneous cocoa bean fermentations in east Cuba was investigated. Seven fermentations, 25 equipment- and handling-related samples, and 115 environmental samples, such as flowers, leaf and cocoa pod surfaces, as well as drosophilid insects, were analysed. The basic fermentation parameters temperature and pH were recorded during five fermentations for at least six days. A total of 435 yeast isolates were identified by a combination of PCR-fingerprinting of genomic DNA with the M13 primer and sequence analysis of DNA from representative isolates, using the internal transcribed spacer region, the D1/D2 region of the large subunit rRNA gene, and an actin gene-encoding fragment, as required. Among 65 yeast species detected, Pichia manshurica and Hanseniaspora opuntiae were the most frequently isolated species, obtained from five and four fermentations, followed in frequency by Pichia kudriavzevii from two fermentations. Saccharomyces cerevisiae was isolated only occasionally. Cocoa fermentation yeast species were also present on processing equipment. The repeated isolation of a preliminarily as Yamadazyma sp. classified species, a group of strains similar to Saccharomycopsis crataegensis from fermentations and equipment, and the isolation of fifteen other potentially novel yeast species in low numbers provides material for further studies. Environmental samples showed higher yeast diversity compared to the fermentations, included the most frequent fermentation species, whereas the most frequently isolated environmental species were Candida carpophila, Candida conglobata, and Candida quercitrusa. Potential selective advantages of the most frequently isolated species were only partly explained by the physiological traits tested. For instance, tolerance to higher ethanol concentrations was more frequent in strains of Pichia spp. and S. cerevisiae compared to Hanseniaspora spp.; the ability to also assimilate ethanol might have

  2. Reconstructing the Backbone of the Saccharomycotina Yeast Phylogeny Using Genome-Scale Data

    PubMed Central

    Shen, Xing-Xing; Zhou, Xiaofan; Kominek, Jacek; Kurtzman, Cletus P.; Hittinger, Chris Todd; Rokas, Antonis

    2016-01-01

    Understanding the phylogenetic relationships among the yeasts of the subphylum Saccharomycotina is a prerequisite for understanding the evolution of their metabolisms and ecological lifestyles. In the last two decades, the use of rDNA and multilocus data sets has greatly advanced our understanding of the yeast phylogeny, but many deep relationships remain unsupported. In contrast, phylogenomic analyses have involved relatively few taxa and lineages that were often selected with limited considerations for covering the breadth of yeast biodiversity. Here we used genome sequence data from 86 publicly available yeast genomes representing nine of the 11 known major lineages and 10 nonyeast fungal outgroups to generate a 1233-gene, 96-taxon data matrix. Species phylogenies reconstructed using two different methods (concatenation and coalescence) and two data matrices (amino acids or the first two codon positions) yielded identical and highly supported relationships between the nine major lineages. Aside from the lineage comprised by the family Pichiaceae, all other lineages were monophyletic. Most interrelationships among yeast species were robust across the two methods and data matrices. However, eight of the 93 internodes conflicted between analyses or data sets, including the placements of: the clade defined by species that have reassigned the CUG codon to encode serine, instead of leucine; the clade defined by a whole genome duplication; and the species Ascoidea rubescens. These phylogenomic analyses provide a robust roadmap for future comparative work across the yeast subphylum in the disciplines of taxonomy, molecular genetics, evolutionary biology, ecology, and biotechnology. To further this end, we have also provided a BLAST server to query the 86 Saccharomycotina genomes, which can be found at http://y1000plus.org/blast. PMID:27672114

  3. Reconstructing the backbone of the Saccharomycotina yeast phylogeny using genome-scale data

    DOE PAGES

    Shen, Xing -Xing; Zhou, Xiaofan; Kominek, Jacek; ...

    2016-09-26

    Understanding the phylogenetic relationships among the yeasts of the subphylum Saccharomycotina is a prerequisite for understanding the evolution of their metabolisms and ecological lifestyles. In the last two decades, the use of rDNA and multilocus data sets has greatly advanced our understanding of the yeast phylogeny, but many deep relationships remain unsupported. In contrast, phylogenomic analyses have involved relatively few taxa and lineages that were often selected with limited considerations for covering the breadth of yeast biodiversity. Here we used genome sequence data from 86 publicly available yeast genomes representing nine of the 11 known major lineages and 10 nonyeastmore » fungal outgroups to generate a 1233-gene, 96-taxon data matrix. Species phylogenies reconstructed using two different methods (concatenation and coalescence) and two data matrices (amino acids or the first two codon positions) yielded identical and highly supported relationships between the nine major lineages. Aside from the lineage comprised by the family Pichiaceae, all other lineages were monophyletic. Most interrelationships among yeast species were robust across the two methods and data matrices. Furthermore, eight of the 93 internodes conflicted between analyses or data sets, including the placements of: the clade defined by species that have reassigned the CUG codon to encode serine, instead of leucine; the clade defined by a whole genome duplication; and the species Ascoidea rubescens. These phylogenomic analyses provide a robust roadmap for future comparative work across the yeast subphylum in the disciplines of taxonomy, molecular genetics, evolutionary biology, ecology, and biotechnology. To further this end, we have also provided a BLAST server to query the 86 Saccharomycotina genomes, which can be found at http://y1000plus.org/blast.« less

  4. Reconstructing the backbone of the Saccharomycotina yeast phylogeny using genome-scale data

    SciTech Connect

    Shen, Xing -Xing; Zhou, Xiaofan; Kominek, Jacek

    Understanding the phylogenetic relationships among the yeasts of the subphylum Saccharomycotina is a prerequisite for understanding the evolution of their metabolisms and ecological lifestyles. In the last two decades, the use of rDNA and multilocus data sets has greatly advanced our understanding of the yeast phylogeny, but many deep relationships remain unsupported. In contrast, phylogenomic analyses have involved relatively few taxa and lineages that were often selected with limited considerations for covering the breadth of yeast biodiversity. Here we used genome sequence data from 86 publicly available yeast genomes representing nine of the 11 known major lineages and 10 nonyeastmore » fungal outgroups to generate a 1233-gene, 96-taxon data matrix. Species phylogenies reconstructed using two different methods (concatenation and coalescence) and two data matrices (amino acids or the first two codon positions) yielded identical and highly supported relationships between the nine major lineages. Aside from the lineage comprised by the family Pichiaceae, all other lineages were monophyletic. Most interrelationships among yeast species were robust across the two methods and data matrices. Furthermore, eight of the 93 internodes conflicted between analyses or data sets, including the placements of: the clade defined by species that have reassigned the CUG codon to encode serine, instead of leucine; the clade defined by a whole genome duplication; and the species Ascoidea rubescens. These phylogenomic analyses provide a robust roadmap for future comparative work across the yeast subphylum in the disciplines of taxonomy, molecular genetics, evolutionary biology, ecology, and biotechnology. To further this end, we have also provided a BLAST server to query the 86 Saccharomycotina genomes, which can be found at http://y1000plus.org/blast.« less

  5. Probiotic potentials of yeasts isolated from some cereal-based Nigerian traditional fermented food products.

    PubMed

    Ogunremi, O R; Sanni, A I; Agrawal, R

    2015-09-01

    To determine the starter culture and multifunctional potentials of yeast strains from some cereal-based Nigerian traditional fermented food products. Yeast isolates were screened for enzyme production and identified by sequencing the D1/D2 region of 26S rDNA. Pichia kluyveri LKC17, Issatchenkia orientalis OSL11, Pichia kudriavzevii OG32, Pichia kudriavzevii ROM11 and Candida tropicalis BOM21 exhibited the highest protease, lipase and phytase activity. They were selected and further evaluated for gastrointestinal survival and adherence ability. Although strain-specific, they retained viability at 37°C and showed survival at pH 2·0., I. orientalis OSL11 showed the highest survival at 2% bile salts concentration and P. kudriavzevii ROM11 showed the least survival. The yeast strains showed strong autoaggregation ability (81·24-91·85%) and hydrophobicity to n-hexadecane (33·61-42·30%). The highest co-aggregation ability was detected for P. kudriavzevii OG32 and Escherichia coli (71·57%). All the yeast strains removed cholesterol in the range of 49·03-74·05% over 48 h and scavenged for free radicals in methanol reaction system. In this study, we isolated new yeast strains with multifunctional potentials that can be used as functional starter cultures to produce cereal-based probiotic products. The development of probiotic yeast strains as starter culture to improve the quality attributes and confer functional value on cereal-based traditional fermented foods is beneficial. © 2015 The Society for Applied Microbiology.

  6. Comparison of Nested PCR and RFLP for Identification and Classification of Malassezia Yeasts from Healthy Human Skin

    PubMed Central

    Oh, Byung Ho; Song, Young Chan; Choe, Yong Beom; Ahn, Kyu Joong

    2009-01-01

    Background Malassezia yeasts are normal flora of the skin found in 75~98% of healthy subjects. The accurate identification of the Malassezia species is important for determining the pathogenesis of the Malassezia yeasts with regard to various skin diseases such as Malassezia folliculitis, seborrheic dermatitis, and atopic dermatitis. Objective This research was conducted to determine a more accurate and rapid molecular test for the identification and classification of Malassezia yeasts. Methods We compared the accuracy and efficacy of restriction fragment length polymorphism (RFLP) and the nested polymerase chain reaction (PCR) for the identification of Malassezia yeasts. Results Although both methods demonstrated rapid and reliable results with regard to identification, the nested PCR method was faster. However, 7 different Malassezia species (1.2%) were identified by the nested PCR compared to the RFLP method. Conclusion Our results show that RFLP method was relatively more accurate and reliable for the detection of various Malassezia species compared to the nested PCR. But, in the aspect of simplicity and time saving, the latter method has its own advantages. In addition, the 26S rDNA, which was targeted in this study, contains highly conserved base sequences and enough sequence variation for inter-species identification of Malassezia yeasts. PMID:20523823

  7. Yeast One-Hybrid Gγ Recruitment System for Identification of Protein Lipidation Motifs

    PubMed Central

    Fukuda, Nobuo; Doi, Motomichi; Honda, Shinya

    2013-01-01

    Fatty acids and isoprenoids can be covalently attached to a variety of proteins. These lipid modifications regulate protein structure, localization and function. Here, we describe a yeast one-hybrid approach based on the Gγ recruitment system that is useful for identifying sequence motifs those influence lipid modification to recruit proteins to the plasma membrane. Our approach facilitates the isolation of yeast cells expressing lipid-modified proteins via a simple and easy growth selection assay utilizing G-protein signaling that induces diploid formation. In the current study, we selected the N-terminal sequence of Gα subunits as a model case to investigate dual lipid modification, i.e., myristoylation and palmitoylation, a modification that is widely conserved from yeast to higher eukaryotes. Our results suggest that both lipid modifications are required for restoration of G-protein signaling. Although we could not differentiate between myristoylation and palmitoylation, N-terminal position 7 and 8 play some critical role. Moreover, we tested the preference for specific amino-acid residues at position 7 and 8 using library-based screening. This new approach will be useful to explore protein-lipid associations and to determine the corresponding sequence motifs. PMID:23922919

  8. Extensive Horizontal Transfer and Homologous Recombination Generate Highly Chimeric Mitochondrial Genomes in Yeast.

    PubMed

    Wu, Baojun; Buljic, Adnan; Hao, Weilong

    2015-10-01

    The frequency of horizontal gene transfer (HGT) in mitochondrial DNA varies substantially. In plants, HGT is relatively common, whereas in animals it appears to be quite rare. It is of considerable importance to understand mitochondrial HGT across the major groups of eukaryotes at a genome-wide level, but so far this has been well studied only in plants. In this study, we generated ten new mitochondrial genome sequences and analyzed 40 mitochondrial genomes from the Saccharomycetaceae to assess the magnitude and nature of mitochondrial HGT in yeasts. We provide evidence for extensive, homologous-recombination-mediated, mitochondrial-to-mitochondrial HGT occurring throughout yeast mitochondrial genomes, leading to genomes that are highly chimeric evolutionarily. This HGT has led to substantial intraspecific polymorphism in both sequence content and sequence divergence, which to our knowledge has not been previously documented in any mitochondrial genome. The unexpectedly high frequency of mitochondrial HGT in yeast may be driven by frequent mitochondrial fusion, relatively low mitochondrial substitution rates and pseudohyphal fusion to produce heterokaryons. These findings suggest that mitochondrial HGT may play an important role in genome evolution of a much broader spectrum of eukaryotes than previously appreciated and that there is a critical need to systematically study the frequency, extent, and importance of mitochondrial HGT across eukaryotes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

    PubMed

    Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

    2017-05-01

    Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

  10. A comparative study on the potential of epiphytic yeasts isolated from tropical fruits to produce flavoring compounds.

    PubMed

    Grondin, Eric; Shum Cheong Sing, Alain; Caro, Yanis; Raherimandimby, Marson; Randrianierenana, Ando Lalaniaina; James, Steve; Nueno-Palop, Carmen; François, Jean Marie; Petit, Thomas

    2015-06-16

    In recent years, there has been an increasing interest in identifying and characterizing the yeast flora associated with diverse types of habitat because of the many potential desirable technological properties of these microorganisms, especially in food applications. In this study, a total of 101 yeast strains were isolated from the skins of tropical fruits collected in several locations in the South West Indian Ocean. Sequence analysis of the D1/D2 domains of the large subunit (LSU) ribosomal RNA gene identified 26 different species. Among them, two species isolated from the skins of Cape gooseberry and cocoa beans appeared to represent putative new yeast species, as their LSU D1/D2 sequence was only 97.1% and 97.4% identical to that of the yeasts Rhodotorula mucilaginosa and Candida pararugosa, respectively. A total of 52 Volatile Organic Compounds (VOCs) were detected by Head Space Solid Phase Micro Extraction coupled to Gas Chromatography and Mass Spectroscopy (HS-SPME-GC/MS) from the 26 yeast species cultivated on a glucose rich medium. Among these VOCs, 6 uncommon compounds were identified, namely ethyl but-2-enoate, ethyl 2-methylbut-2-enoate (ethyl tiglate), ethyl 3-methylbut-2-enoate, 2-methylpropyl 2-methylbut-2-enoate, butyl 2-methylbut-2-enoate and 3-methylbutyl 2-methylbut-2-enoate, making them possible yeast species-specific markers. In addition, statistical methods such as Principal Component Analysis allowed to associate each yeast species with a specific flavor profile. Among them, Saprochaete suaveolens (syn: Geotrichum fragrans) turned to be the best producer of flavor compounds, with a total of 32 out of the 52 identified VOCs in its flavor profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Replication and meiotic transmission of yeast ribosomal RNA genes.

    PubMed

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  12. XRN1 Is a Species-Specific Virus Restriction Factor in Yeasts

    PubMed Central

    Rowley, Paul A.; Ho, Brandon; Bushong, Sarah; Johnson, Arlen; Sawyer, Sara L.

    2016-01-01

    In eukaryotes, the degradation of cellular mRNAs is accomplished by Xrn1 and the cytoplasmic exosome. Because viral RNAs often lack canonical caps or poly-A tails, they can also be vulnerable to degradation by these host exonucleases. Yeast lack sophisticated mechanisms of innate and adaptive immunity, but do use RNA degradation as an antiviral defense mechanism. We find a highly refined, species-specific relationship between Xrn1p and the “L-A” totiviruses of different Saccharomyces yeast species. We show that the gene XRN1 has evolved rapidly under positive natural selection in Saccharomyces yeast, resulting in high levels of Xrn1p protein sequence divergence from one yeast species to the next. We also show that these sequence differences translate to differential interactions with the L-A virus, where Xrn1p from S. cerevisiae is most efficient at controlling the L-A virus that chronically infects S. cerevisiae, and Xrn1p from S. kudriavzevii is most efficient at controlling the L-A-like virus that we have discovered within S. kudriavzevii. All Xrn1p orthologs are equivalent in their interaction with another virus-like parasite, the Ty1 retrotransposon. Thus, Xrn1p appears to co-evolve with totiviruses to maintain its potent antiviral activity and limit viral propagation in Saccharomyces yeasts. We demonstrate that Xrn1p physically interacts with the Gag protein encoded by the L-A virus, suggesting a host-virus interaction that is more complicated than just Xrn1p-mediated nucleolytic digestion of viral RNAs. PMID:27711183

  13. Isolation and Identification of the Indigenous Yeast Population during Spontaneous Fermentation of Isabella (Vitis labrusca L.) Grape Must

    PubMed Central

    Raymond Eder, María L.; Reynoso, Cristina; Lauret, Santiago C.; Rosa, Alberto L.

    2017-01-01

    Grape must harbors a complex community of yeast species responsible for spontaneous alcoholic fermentation. Although there are detailed studies on the microbiota of Vitis vinifera L. grapes, less is known about the diversity and behavior of yeast communities present on fermenting grape must from other species of Vitis. In this work, we used a culture-dependent method to study the identity and dynamics of the indigenous yeast population present during the spontaneous fermentation of Isabella (Vitis labrusca L.) grape must. Alcoholic fermentation was conducted using standard enological practices, and the associated non-Saccharomyces and S. cerevisiae yeast community was analyzed using selective growth media and 5.8-ITS DNA sequencing. Candida californica, Candida hellenica, Starmerella bacillaris (synonym Candida zemplinina), Hanseniaspora uvarum, and Hanseniaspora vineae were the main non-Saccharomyces species identified on Isabella fermenting must. Issatchenkia hanoiensis, a yeast species rarely found on Vitis vinifera L. grapes, was also recognized on Isabella grape must. Candida azymoides, Candida californica and Pichia cecembensis, identified in this work on Isabella fermenting must, have not previously been found on Vitis vinifera L. grape must. Interestingly, C. azymoides, I. hanoiensis and P. cecembensis have recently been isolated from the surface of Vitis labrusca L. grapes from vineyards in the Azores archipelago, suggesting that specific Vitis-yeast species associations are formed independently of geographic origin. We suggest that C. azymoides, C. californica, and P. cecembensis are yeast species preferentially associated with Vitis labrusca L. grapes. Specific biological interactions between grapevines and yeast species may underlie the assembly of differential Vitis-microbial communities. PMID:28424672

  14. Isolation and Identification of the Indigenous Yeast Population during Spontaneous Fermentation of Isabella (Vitis labrusca L.) Grape Must.

    PubMed

    Raymond Eder, María L; Reynoso, Cristina; Lauret, Santiago C; Rosa, Alberto L

    2017-01-01

    Grape must harbors a complex community of yeast species responsible for spontaneous alcoholic fermentation. Although there are detailed studies on the microbiota of Vitis vinifera L. grapes, less is known about the diversity and behavior of yeast communities present on fermenting grape must from other species of Vitis . In this work, we used a culture-dependent method to study the identity and dynamics of the indigenous yeast population present during the spontaneous fermentation of Isabella ( Vitis labrusca L.) grape must. Alcoholic fermentation was conducted using standard enological practices, and the associated non- Saccharomyces and S. cerevisiae yeast community was analyzed using selective growth media and 5.8-ITS DNA sequencing. Candida californica, Candida hellenica, Starmerella bacillaris (synonym Candida zemplinina ), Hanseniaspora uvarum , and Hanseniaspora vineae were the main non- Saccharomyces species identified on Isabella fermenting must. Issatchenkia hanoiensis , a yeast species rarely found on Vitis vinifera L. grapes, was also recognized on Isabella grape must. Candida azymoides, Candida californica and Pichia cecembensis , identified in this work on Isabella fermenting must, have not previously been found on Vitis vinifera L. grape must. Interestingly, C. azymoides, I. hanoiensis and P. cecembensis have recently been isolated from the surface of Vitis labrusca L. grapes from vineyards in the Azores archipelago, suggesting that specific Vitis -yeast species associations are formed independently of geographic origin. We suggest that C. azymoides, C. californica , and P. cecembensis are yeast species preferentially associated with Vitis labrusca L. grapes. Specific biological interactions between grapevines and yeast species may underlie the assembly of differential Vitis -microbial communities.

  15. MSLICE Sequencing

    NASA Technical Reports Server (NTRS)

    Crockett, Thomas M.; Joswig, Joseph C.; Shams, Khawaja S.; Norris, Jeffrey S.; Morris, John R.

    2011-01-01

    MSLICE Sequencing is a graphical tool for writing sequences and integrating them into RML files, as well as for producing SCMF files for uplink. When operated in a testbed environment, it also supports uplinking these SCMF files to the testbed via Chill. This software features a free-form textural sequence editor featuring syntax coloring, automatic content assistance (including command and argument completion proposals), complete with types, value ranges, unites, and descriptions from the command dictionary that appear as they are typed. The sequence editor also has a "field mode" that allows tabbing between arguments and displays type/range/units/description for each argument as it is edited. Color-coded error and warning annotations on problematic tokens are included, as well as indications of problems that are not visible in the current scroll range. "Quick Fix" suggestions are made for resolving problems, and all the features afforded by modern source editors are also included such as copy/cut/paste, undo/redo, and a sophisticated find-and-replace system optionally using regular expressions. The software offers a full XML editor for RML files, which features syntax coloring, content assistance and problem annotations as above. There is a form-based, "detail view" that allows structured editing of command arguments and sequence parameters when preferred. The "project view" shows the user s "workspace" as a tree of "resources" (projects, folders, and files) that can subsequently be opened in editors by double-clicking. Files can be added, deleted, dragged-dropped/copied-pasted between folders or projects, and these operations are undoable and redoable. A "problems view" contains a tabular list of all problems in the current workspace. Double-clicking on any row in the table opens an editor for the appropriate sequence, scrolling to the specific line with the problem, and highlighting the problematic characters. From there, one can invoke "quick fix" as described

  16. Yeast fuel cell: Application for desalination

    NASA Astrophysics Data System (ADS)

    Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

    2016-02-01

    Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

  17. Freeze-drying of yeast cultures.

    PubMed

    Bond, Chris

    2007-01-01

    A method is described that allows yeast species to be stored using a variation on the standard freeze-drying method, which employs evaporative cooling in a two-stage process. Yeast cultures are placed in glass ampoules after having been mixed with a lyoprotectant. Primary drying is carried out using a centrifuge head connected to a standard freeze-dryer. Once the centrifuge head is running, air is removed and evaporated liquid is captured in the freeze-dryer. Centrifugation continues for 15 min and primary drying for a further 3 h. The ampoules are constricted using a glass blowing torch. They are then placed on the freeze-dryer manifold for secondary drying under vacuum overnight, using phosphorus pentoxide as a desiccant. The ampoules are sealed and removed from the manifold by melting the constricted section. Although the process causes an initial large drop in viability, further losses after storage are minimal. Yeast strains have remained viable for more than 30 yr when stored using this method and sufficient cells are recovered to produce new working stocks. Although survival rates are strain specific, nearly all National Collection of Yeast Cultures strains covering most yeast genera, have been successfully stored with little or no detectable change in strain characteristics.

  18. Anaerobic digestion of food waste using yeast.

    PubMed

    Suwannarat, Jutarat; Ritchie, Raymond J

    2015-08-01

    Fermentative breakdown of food waste seems a plausible alternative to feeding food waste to pigs, incineration or garbage disposal in tourist areas. We determined the optimal conditions for the fermentative breakdown of food waste using yeast (Saccharomyces cerevisiae) in incubations up to 30days. Yeast efficiently broke down food waste with food waste loadings as high as 700g FW/l. The optimum inoculation was ≈46×10(6)cells/l of culture with a 40°C optimum (25-40°C). COD and BOD were reduced by ≈30-50%. Yeast used practically all the available sugars and reduced proteins and lipids by ≈50%. Yeast was able to metabolize lipids much better than expected. Starch was mobilized after very long term incubations (>20days). Yeast was effective in breaking down the organic components of food waste but CO2 gas and ethanol production (≈1.5%) were only significant during the first 7days of incubations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Nectar yeasts: a natural microcosm for ecology.

    PubMed

    Chappell, Callie R; Fukami, Tadashi

    2018-06-01

    The species of yeasts that colonize floral nectar can modify the mutualistic relationships between plants and pollinators by changing the chemical properties of nectar. Recent evidence supporting this possibility has led to increased interest among ecologists in studying these fungi as well as the bacteria that interact with them in nectar. Although not fully explored, nectar yeasts also constitute a promising natural microcosm that can be used to facilitate development of general ecological theory. We discuss the methodological and conceptual advantages of using nectar yeasts from this perspective, including simplicity of communities, tractability of dispersal, replicability of community assembly, and the ease with which the mechanisms of species interactions can be studied in complementary experiments conducted in the field and the laboratory. To illustrate the power of nectar yeasts as a study system, we discuss several topics in community ecology, including environmental filtering, priority effects, and metacommunity dynamics. An exciting new direction is to integrate metagenomics and comparative genomics into nectar yeast research to address these fundamental ecological topics. Copyright © 2018 John Wiley & Sons, Ltd.

  20. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  1. Comparative Polygenic Analysis of Maximal Ethanol Accumulation Capacity and Tolerance to High Ethanol Levels of Cell Proliferation in Yeast

    PubMed Central

    Pais, Thiago M.; Foulquié-Moreno, María R.; Hubmann, Georg; Duitama, Jorge; Swinnen, Steve; Goovaerts, Annelies; Yang, Yudi; Dumortier, Françoise; Thevelein, Johan M.

    2013-01-01

    The yeast Saccharomyces cerevisiae is able to accumulate ≥17% ethanol (v/v) by fermentation in the absence of cell proliferation. The genetic basis of this unique capacity is unknown. Up to now, all research has focused on tolerance of yeast cell proliferation to high ethanol levels. Comparison of maximal ethanol accumulation capacity and ethanol tolerance of cell proliferation in 68 yeast strains showed a poor correlation, but higher ethanol tolerance of cell proliferation clearly increased the likelihood of superior maximal ethanol accumulation capacity. We have applied pooled-segregant whole-genome sequence analysis to identify the polygenic basis of these two complex traits using segregants from a cross of a haploid derivative of the sake strain CBS1585 and the lab strain BY. From a total of 301 segregants, 22 superior segregants accumulating ≥17% ethanol in small-scale fermentations and 32 superior segregants growing in the presence of 18% ethanol, were separately pooled and sequenced. Plotting SNP variant frequency against chromosomal position revealed eleven and eight Quantitative Trait Loci (QTLs) for the two traits, respectively, and showed that the genetic basis of the two traits is partially different. Fine-mapping and Reciprocal Hemizygosity Analysis identified ADE1, URA3, and KIN3, encoding a protein kinase involved in DNA damage repair, as specific causative genes for maximal ethanol accumulation capacity. These genes, as well as the previously identified MKT1 gene, were not linked in this genetic background to tolerance of cell proliferation to high ethanol levels. The superior KIN3 allele contained two SNPs, which are absent in all yeast strains sequenced up to now. This work provides the first insight in the genetic basis of maximal ethanol accumulation capacity in yeast and reveals for the first time the importance of DNA damage repair in yeast ethanol tolerance. PMID:23754966

  2. Molecular genetic diversity of the Saccharomyces yeasts in Taiwan: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii.

    PubMed

    Naumov, Gennadi I; Lee, Ching-Fu; Naumova, Elena S

    2013-01-01

    Genetic hybridization, sequence and karyotypic analyses of natural Saccharomyces yeasts isolated in different regions of Taiwan revealed three biological species: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii. Intraspecies variability of the D1/D2 and ITS1 rDNA sequences was detected among S. cerevisiae and S. kudriavzevii isolates. According to molecular and genetic analyses, the cosmopolitan species S. cerevisiae and S. kudriavzevii contain local divergent populations in Taiwan, Malaysia and Japan. Six of the seven known Saccharomyces species are documented in East Asia: S. arboricola, S. bayanus, S. cerevisiae, S. kudriavzevii, S. mikatae, and S. paradoxus.

  3. Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

    PubMed

    Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

    2014-02-01

    Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

  4. Genome Sequence of Saccharomyces cerevisiae Double-Stranded RNA Virus L-A-28.

    PubMed

    Konovalovas, Aleksandras; Serviené, Elena; Serva, Saulius

    2016-06-16

    We cloned and sequenced the complete genome of the L-A-28 virus from the Saccharomyces cerevisiae K28 killer strain. This sequence completes the set of currently identified L-A helper viruses required for expression of double-stranded RNA-originated killer phenotypes in baking yeast. Copyright © 2016 Konovalovas et al.

  5. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  6. [Urinary infection by Saccharomyces cerevisiae: Emerging yeast?].

    PubMed

    Elkhihal, B; Elhalimi, M; Ghfir, B; Mostachi, A; Lyagoubi, M; Aoufi, S

    2015-12-01

    Saccharomyces cerevisiae is a commensal yeast of the digestive, respiratory and genito-urinary tract. It is widely used as a probiotic for the treatment of post-antibiotic diarrhea. It most often occurs in immunocompromised patients frequently causing fungemia. We report the case of an adult diabetic patient who had a urinary tract infection due to S. cerevisiae. The disease started with urination associated with urinary frequency burns without fever. The diagnosis was established by the presence of yeasts on direct examination and positivity of culture on Sabouraud-chloramphenicol three times. The auxanogramme gallery (Auxacolor BioRad(®)) allowed the identification of S. cerevisiae. The patient was put on fluconazole with good outcome. This observation points out that this is an opportunistic yeast in immunocompromised patients. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Genome dynamics and evolution in yeasts: A long-term yeast-bacteria competition experiment

    PubMed Central

    Katz, Michael; Knecht, Wolfgang; Compagno, Concetta; Piškur, Jure

    2018-01-01

    There is an enormous genetic diversity evident in modern yeasts, but our understanding of the ecological basis of such diversifications in nature remains at best fragmented so far. Here we report a long-term experiment mimicking a primordial competitive environment, in which yeast and bacteria co-exist and compete against each other. Eighteen yeasts covering a wide phylogenetic background spanning approximately 250 million years of evolutionary history were used to establish independent evolution lines for at most 130 passages. Our collection of hundreds of modified strains generated through such a rare two-species cross-kingdom competition experiment re-created the appearance of large-scale genomic rearrangements and altered phenotypes important in the diversification history of yeasts. At the same time, the methodology employed in this evolutionary study would also be a non-gene-technological method of reprogramming yeast genomes and then selecting yeast strains with desired traits. Cross-kingdom competition may therefore be a method of significant value to generate industrially useful yeast strains with new metabolic traits. PMID:29624585

  8. New yeasts-new brews: modern approaches to brewing yeast design and development.

    PubMed

    Gibson, B; Geertman, J-M A; Hittinger, C T; Krogerus, K; Libkind, D; Louis, E J; Magalhães, F; Sampaio, J P

    2017-06-01

    The brewing industry is experiencing a period of change and experimentation largely driven by customer demand for product diversity. This has coincided with a greater appreciation of the role of yeast in determining the character of beer and the widespread availability of powerful tools for yeast research. Genome analysis in particular has helped clarify the processes leading to domestication of brewing yeast and has identified domestication signatures that may be exploited for further yeast development. The functional properties of non-conventional yeast (both Saccharomyces and non-Saccharomyces) are being assessed with a view to creating beers with new flavours as well as producing flavoursome non-alcoholic beers. The discovery of the psychrotolerant S. eubayanus has stimulated research on de novo S. cerevisiae × S. eubayanus hybrids for low-temperature lager brewing and has led to renewed interest in the functional importance of hybrid organisms and the mechanisms that determine hybrid genome function and stability. The greater diversity of yeast that can be applied in brewing, along with an improved understanding of yeasts' evolutionary history and biology, is expected to have a significant and direct impact on the brewing industry, with potential for improved brewing efficiency, product diversity and, above all, customer satisfaction. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

    PubMed

    Vadkertiová, Renáta; Molnárová, Jana; Vránová, Dana; Sláviková, Elena

    2012-12-01

    Yeasts are common inhabitants of the phyllosphere, but our knowledge of their diversity in various plant organs is still limited. This study focused on the diversity of yeasts and yeast-like organisms associated with matured fruits and fully open blossoms of apple, plum, and pear trees, during 2 consecutive years at 3 localities in southwest Slovakia. The occurrence of yeasts and yeast-like organisms in fruit samples was 2½ times higher and the yeast community more diverse than that in blossom samples. Only 2 species (Aureobasidium pullulans and Metschnikowia pulcherrima) occurred regularly in the blossom samples, whereas Galactomyces candidus, Hanseniaspora guilliermondii, Hanseniaspora uvarum, M. pulcherrima, Pichia kluyveri, Pichia kudriavzevii, and Saccharomyces cerevisiae were the most frequently isolated species from the fruit samples. The ratio of the number of samples where only individual species were present to the number of samples where 2 or more species were found (consortium) was counted. The occurrence of individual species in comparison with consortia was much higher in blossom samples than in fruit samples. In the latter, consortia predominated. Aureobasidium pullulans, M. pulcherrima, and S. cerevisiae, isolated from both the fruits and blossoms, can be considered as resident yeast species of various fruit tree species cultivated in southwest Slovakia localities.

  10. The Yeast Saccharomyces cerevisiae: a versatile model system for the identification and characterization of bacterial virulence proteins.

    PubMed

    Siggers, Keri A; Lesser, Cammie F

    2008-07-17

    Microbial pathogens utilize complex secretion systems to deliver proteins into host cells. These effector proteins target and usurp host cell processes to promote infection and cause disease. While secretion systems are conserved, each pathogen delivers its own unique set of effectors. The identification and characterization of these effector proteins has been difficult, often limited by the lack of detectable signal sequences and functional redundancy. Model systems including yeast, worms, flies, and fish are being used to circumvent these issues. This technical review details the versatility and utility of yeast Saccharomyces cerevisiae as a system to identify and characterize bacterial effectors.

  11. [The yeast biofilm in human medicine].

    PubMed

    Růzicka, Filip; Holá, Veronika; Votava, Miroslav

    2007-08-01

    In recent years, the role of Candida yeasts as causative agents of nosocomial infections has increased. One of the important virulence factors contributing to the development of such infections is biofilm production. This virulence factor enables yeast to colonize both native surfaces and artificial implants. The most common sources of infection are patients themselves, in particular the gastrointestinal tract and skin. The vectors of exogenous yeast infections are predominantly the hands of the health personnel and contaminated medical instruments. The adhesion of yeasts to the implant surfaces is determined both by implant surface and yeast characteristics. This is followed by proliferation and production of microcolonies and extracellular matrix. The final biofilm structure is also influenced by the production of hyphae and pseudohyphae. The entire process of biofilm production is controlled by numerous regulatory systems, with the key role being played by the quorum sensing system. Like the adhered bacterial cultures, candidas growing in the form of a biofilm are highly resistant to antimicrobial therapy. Resistance of yeast biofilms to antifungals is a complex process with multiple contributing factors. These are especially increased gene expression (e.g. genes encoding the so called multidrug efflux pumps), limited penetration of substances through the extracellular matrix, inhibited cell growth and altered microenvironment in deeper biofilm layers. The concentrations of antifungals able to effectively affect the biofilm cells exceed, by several orders of magnitude, the values of conventionally determined MICs. High biofilm resistance results in ineffective antifungal therapy of biofilm infections. Therefore, if possible, the colonized implant should be removed. Conservative therapy should involve antifungals with a proven effect on the biofilm (e.g. caspofungin). The most effective measure in fighting biofilm infections is prevention, especially adhering to

  12. Laboratory evolution of copper tolerant yeast strains

    PubMed Central

    2012-01-01

    Background Yeast strains endowed with robustness towards copper and/or enriched in intracellular Cu might find application in biotechnology processes, among others in the production of functional foods. Moreover, they can contribute to the study of human diseases related to impairments of copper metabolism. In this study, we investigated the molecular and physiological factors that confer copper tolerance to strains of baker's yeasts. Results We characterized the effects elicited in natural strains of Candida humilis and Saccharomyces cerevisiae by the exposure to copper in the culture broth. We observed that, whereas the growth of Saccharomyces cells was inhibited already at low Cu concentration, C. humilis was naturally robust and tolerated up to 1 g · L-1 CuSO4 in the medium. This resistant strain accumulated over 7 mg of Cu per gram of biomass and escaped severe oxidative stress thanks to high constitutive levels of superoxide dismutase and catalase. Both yeasts were then "evolved" to obtain hyper-resistant cells able to proliferate in high copper medium. While in S. cerevisiae the evolution of robustness towards Cu was paralleled by the increase of antioxidative enzymes, these same activities decreased in evolved hyper-resistant Candida cells. We also characterized in some detail changes in the profile of copper binding proteins, that appeared to be modified by evolution but, again, in a different way in the two yeasts. Conclusions Following evolution, both Candida and Saccharomyces cells were able to proliferate up to 2.5 g · L-1 CuSO4 and to accumulate high amounts of intracellular copper. The comparison of yeasts differing in their robustness, allowed highlighting physiological and molecular determinants of natural and acquired copper tolerance. We observed that different mechanisms contribute to confer metal tolerance: the control of copper uptake, changes in the levels of enzymes involved in oxidative stress response and changes in the copper

  13. Barcode Identifiers as a Practical Tool for Reliable Species Assignment of Medically Important Black Yeast Species

    PubMed Central

    Heinrichs, Guido; de Hoog, G. Sybren

    2012-01-01

    Herpotrichiellaceous black yeasts and relatives comprise severe pathogens flanked by nonpathogenic environmental siblings. Reliable identification by conventional methods is notoriously difficult. Molecular identification is hampered by the sequence variability in the internal transcribed spacer (ITS) domain caused by difficult-to-sequence homopolymeric regions and by poor taxonomic attribution of sequences deposited in GenBank. Here, we present a potential solution using short barcode identifiers (27 to 50 bp) based on ITS2 ribosomal DNA (rDNA), which allows unambiguous definition of species-specific fragments. Starting from proven sequences of ex-type and authentic strains, we were able to describe 103 identifiers. Multiple BLAST searches of these proposed barcode identifiers in GenBank revealed uniqueness for 100 taxonomic entities, whereas the three remaining identifiers each matched with two entities, but the species of these identifiers could easily be discriminated by differences in the remaining ITS regions. Using the proposed barcode identifiers, a 4.1-fold increase of 100% matches in GenBank was achieved in comparison to the classical approach using the complete ITS sequences. The proposed barcode identifiers will be made accessible for the diagnostic laboratory in a permanently updated online database, thereby providing a highly practical, reliable, and cost-effective tool for identification of clinically important black yeasts and relatives. PMID:22785187

  14. Characterization and stability of lactobacilli and yeast microbiota in kefir grains.

    PubMed

    Vardjan, T; Mohar Lorbeg, P; Rogelj, I; Čanžek Majhenič, A

    2013-05-01

    Characterization and stability of lactobacilli and yeasts from kefir grains using culture-dependent and culture-independent methods were investigated in this study. Culture-dependent analysis, followed by sequencing of 16S ribosomal DNA for bacteria and 26S rRNA gene for yeasts, revealed 3 different species of lactobacilli and yeasts, respectively. The most frequently isolated bacterial species were Lactobacillus kefiranofaciens ssp. kefirgranum, Lb. parakefiri, and Lb. kefiri, whereas yeasts belonged to Kluyveromyces marxianus, Kazachstania exigua, and Rhodosporidium kratochvilovae. This study is the first to report on the presence of R. kratochvilovae in kefir grains. On the other hand, PCR-denaturing gradient gel electrophoresis in the culture-independent method showed that the dominant microorganisms were Lb. kefiranofaciens ssp. kefirgranum, Kl. marxianus and Ka. exigua, but did not reveal bands corresponding to Lb. parakefiri, Lb. kefiri, or R. kratochvilovae. Our results support the necessity of combining more techniques for detailed and reliable study of microbial communities in kefir grains. Another interesting finding confirmed that the detected dominant microbiota of kefir grains is very stable and did not change over experimental time. This finding is important to ensure consistent product quality. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. Identification of Chemical-Genetic Interactions via Parallel Analysis of Barcoded Yeast Strains.

    PubMed

    Suresh, Sundari; Schlecht, Ulrich; Xu, Weihong; Miranda, Molly; Davis, Ronald W; Nislow, Corey; Giaever, Guri; St Onge, Robert P

    2016-09-01

    The Yeast Knockout Collection is a complete set of gene deletion strains for the budding yeast, Saccharomyces cerevisiae In each strain, one of approximately 6000 open-reading frames is replaced with a dominant selectable marker flanked by two DNA barcodes. These barcodes, which are unique to each gene, allow the growth of thousands of strains to be individually measured from a single pooled culture. The collection, and other resources that followed, has ushered in a new era in chemical biology, enabling unbiased and systematic identification of chemical-genetic interactions (CGIs) with remarkable ease. CGIs link bioactive compounds to biological processes, and hence can reveal the mechanism of action of growth-inhibitory compounds in vivo, including those of antifungal, antibiotic, and anticancer drugs. The chemogenomic profiling method described here measures the sensitivity induced in yeast heterozygous and homozygous deletion strains in the presence of a chemical inhibitor of growth (termed haploinsufficiency profiling and homozygous profiling, respectively, or HIPHOP). The protocol is both scalable and amenable to automation. After competitive growth of yeast knockout collection cultures, with and without chemical inhibitors, CGIs can be identified and quantified using either array- or sequencing-based approaches as described here. © 2016 Cold Spring Harbor Laboratory Press.

  16. House microbiotas as sources of lactic acid bacteria and yeasts in traditional Italian sourdoughs.

    PubMed

    Minervini, Fabio; Lattanzi, Anna; De Angelis, Maria; Celano, Giuseppe; Gobbetti, Marco

    2015-12-01

    This study aimed at understanding the extent of contamination by lactic acid bacteria (LAB) and yeasts from the house microbiotas during sourdough back-slopping. Besides sourdoughs, wall, air, storage box, dough mixer and flour of four bakeries were analyzed. Based on plate counts, LAB and yeasts dominated the house microbiota. Based on high throughput sequencing of the 16S rRNA genes, flour harbored the highest number of Firmicutes, but only few of them adapted to storage box, dough mixer and sourdough. Lactobacillus sanfranciscensis showed the highest abundance in dough mixer and sourdoughs. Lactobacillus plantarum persisted only in storage box, dough mixer and sourdough of two bakeries. Weissella cibaria also showed higher adaptability in sourdough than in bakery equipment, suggesting that flour is the main origin of this species. Based on 18S rRNA data, Saccharomyces cerevisiae was the dominant yeast in house and sourdough microbiotas, excepted one bakery dominated by Kazachstania exigua. The results of this study suggest that the dominant species of sourdough LAB and yeasts dominated also the house microbiota. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Using a Euclid distance discriminant method to find protein coding genes in the yeast genome.

    PubMed

    Zhang, Chun-Ting; Wang, Ju; Zhang, Ren

    2002-02-01

    The Euclid distance discriminant method is used to find protein coding genes in the yeast genome, based on the single nucleotide frequencies at three codon positions in the ORFs. The method is extremely simple and may be extended to find genes in prokaryotic genomes or eukaryotic genomes with less introns. Six-fold cross-validation tests have demonstrated that the accuracy of the algorithm is better than 93%. Based on this, it is found that the total number of protein coding genes in the yeast genome is less than or equal to 5579 only, about 3.8-7.0% less than 5800-6000, which is currently widely accepted. The base compositions at three codon positions are analyzed in details using a graphic method. The result shows that the preference codons adopted by yeast genes are of the RGW type, where R, G and W indicate the bases of purine, non-G and A/T, whereas the 'codons' in the intergenic sequences are of the form NNN, where N denotes any base. This fact constitutes the basis of the algorithm to distinguish between coding and non-coding ORFs in the yeast genome. The names of putative non-coding ORFs are listed here in detail.

  18. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  19. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. [Groups and sources of yeasts in house dust].

    PubMed

    Glushakova, A M; Zheltikova, T M; Chernov, I Iu

    2004-01-01

    House dust contains bacteria, mycelial fungi, microarthropods, and yeasts. The house dust samples collected in 25 apartments in Moscow and the Moscow region were found to contain yeasts belonging to the genera Candida, Cryptococcus, Debaryomyces, Rhodotorula, Sporobolomyces, and Trichosporon. The most frequently encountered microorganisms were typical epiphytic yeasts, such as Cryptococcus diffluens and Rhodotorula mucilaginosa, which are capable of long-term preservation in an inactive state. The direct source of epiphytic yeasts occurring in the house dust might be the indoor plants, which were contaminated with these yeasts, albeit to a lesser degree than outdoor plants. Along with the typical epiphytic yeasts, the house dust contained the opportunistic yeast pathogens Candida catenulata, C. guillermondii, C. haemulonii, C. rugosa, and C. tropicalis, which are known as the causal agents of candidiasis. We failed to reveal any correlation between the abundance of particular yeast species in the house dust, residential characteristics, and the atopic dermatitis of the inhabitants.

  1. 21 CFR 172.325 - Bakers yeast protein.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... harmful microbial toxin. (d) The ingredient is used in food as a nutrient supplement as defined in § 170.3... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...

  2. 21 CFR 172.325 - Bakers yeast protein.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... harmful microbial toxin. (d) The ingredient is used in food as a nutrient supplement as defined in § 170.3... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...

  3. 21 CFR 172.325 - Bakers yeast protein.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... harmful microbial toxin. (d) The ingredient is used in food as a nutrient supplement as defined in § 170.3... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...

  4. 21 CFR 172.325 - Bakers yeast protein.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... harmful microbial toxin. (d) The ingredient is used in food as a nutrient supplement as defined in § 170.3... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be...

  5. Yeast species associated with orange juice: evaluation of different identification methods.

    PubMed

    Arias, Covadonga R; Burns, Jacqueline K; Friedrich, Lorrie M; Goodrich, Renee M; Parish, Mickey E

    2002-04-01

    Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice.

  6. Sterol Binding by the Tombusviral Replication Proteins Is Essential for Replication in Yeast and Plants.

    PubMed

    Xu, Kai; Nagy, Peter D

    2017-04-01

    Membranous structures derived from various organelles are important for replication of plus-stranded RNA viruses. Although the important roles of co-opted host proteins in RNA virus replication have been appreciated for a decade, the equally important functions of cellular lipids in virus replication have been gaining full attention only recently. Previous work with Tomato bushy stunt tombusvirus (TBSV) in model host yeast has revealed essential roles for phosphatidylethanolamine and sterols in viral replication. To further our understanding of the role of sterols in tombusvirus replication, in this work we showed that the TBSV p33 and p92 replication proteins could bind to sterols in vitro The sterol binding by p33 is supported by cholesterol recognition/interaction amino acid consensus (CRAC) and CARC-like sequences within the two transmembrane domains of p33. Mutagenesis of the critical Y amino acids within the CRAC and CARC sequences blocked TBSV replication in yeast and plant cells. We also showed the enrichment of sterols in the detergent-resistant membrane (DRM) fractions obtained from yeast and plant cells replicating TBSV. The DRMs could support viral RNA synthesis on both the endogenous and exogenous templates. A lipidomic approach showed the lack of enhancement of sterol levels in yeast and plant cells replicating TBSV. The data support the notion that the TBSV replication proteins are associated with sterol-rich detergent-resistant membranes in yeast and plant cells. Together, the results obtained in this study and the previously published results support the local enrichment of sterols around the viral replication proteins that is critical for TBSV replication. IMPORTANCE One intriguing aspect of viral infections is their dependence on efficient subcellular assembly platforms serving replication, virion assembly, or virus egress via budding out of infected cells. These assembly platforms might involve sterol-rich membrane microdomains, which are

  7. Yeasts of the soil – obscure but precious

    PubMed Central

    2018-01-01

    Abstract Pioneering studies performed in the nineteenth century demonstrated that yeasts are present in below‐ground sources. Soils were regarded more as a reservoir for yeasts that reside in habitats above it. Later studies showed that yeast communities in soils are taxonomically diverse and different from those above‐ground. Soil yeasts possess extraordinary adaptations that allow them to survive in a wide range of environmental conditions. A few species are promising sources of yeast oils and have been used in agriculture as potential antagonists of soil‐borne plant pathogens or as plant growth promoters. Yeasts have been studied mainly in managed soils such as vineyards, orchards and agricultural fields, and to a lesser extent under forests and grasslands. Our knowledge of soil yeasts is further biased towards temperate and boreal forests, whereas data from Africa, the Americas and Asia are scarce. Although soil yeast communities are often species‐poor in a single sample, they are more diverse on the biotope level. Soil yeasts display pronounced endemism along with a surprisingly high proportion of currently unidentified species. However, like other soil inhabitants, yeasts are threatened by habitat alterations owing to anthropogenic activities such as agriculture, deforestation and urbanization. In view of the rapid decline of many natural habitats, the study of soil yeasts in undisturbed or low‐managed biotopes is extremely valuable. The purpose of this review is to encourage researchers, both biologists and soil scientists, to include soil yeasts in future studies. PMID:29365211

  8. Triacetic acid lactone production in industrial Saccharomyces yeast strains

    USDA-ARS?s Scientific Manuscript database

    Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

  9. Antioxidant N-acetyltransferase Mpr1/2 of industrial baker's yeast enhances fermentation ability after air-drying stress in bread dough.

    PubMed

    Sasano, Yu; Takahashi, Shunsuke; Shima, Jun; Takagi, Hiroshi

    2010-03-31

    During bread-making processes, yeast cells are exposed to multiple stresses. Air-drying stress is one of the most harmful stresses by generation of reactive oxygen species (ROS). Previously, we discovered that the novel N-acetyltransferase Mpr1/2 confers oxidative stress tolerance by reducing intracellular ROS level in Saccharomyces cerevisiae Sigma1278b strain. In this study, we revealed that Japanese industrial baker's yeast possesses one MPR gene. The nucleotide sequence of the MPR gene in industrial baker's yeast was identical to the MPR2 gene in Sigma1278b strain. Gene disruption analysis showed that the MPR2 gene in industrial baker's yeast is involved in air-drying stress tolerance by reducing the intracellular oxidation levels. We also found that expression of the Lys63Arg and Phe65Leu variants with enhanced enzymatic activity and stability, respectively, increased the fermentation ability of bread dough after exposure to air-drying stress compared with the wild-type Mpr1. In addition, our recent study showed that industrial baker's yeast cells accumulating proline exhibited enhanced freeze tolerance in bread dough. Proline accumulation also enhanced the fermentation ability after air-drying stress treatment in industrial baker's yeast. Hence, the antioxidant enzyme Mpr1/2 could be promising for breeding novel yeast strains that are tolerant to air-drying stress. Copyright 2010 Elsevier B.V. All rights reserved.

  10. ENGINEERING THE BIOSYNTHESIS OF STYRENE IN YEAST

    EPA Science Inventory

    The strategy pursued was to insert genes for phenylalanine ammonia lysase (pal) and phenolic acid decarboxylase (pad) into the yeast that would convert phenylalanine to styrene through a cinnamic acid intermediate.

    Yeast metabolic engineering for hemicellulosic ethanol production

    Treesearch

    Jennifer Van Vleet; Thomas W. Jeffries

    2009-01-01

    Efficient fermentation of hemicellulosic sugars is critical for the bioconversion of lignocellulosics to ethanol. Efficient sugar uptake through the heterologous expression of yeast and fungal xylose/glucose transporters can improve fermentation if other metabolic steps are not rate limiting. Rectification of cofactor imbalances through heterologous expression of...

  11. 21 CFR 73.355 - Phaffia yeast.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...), not more than 10 parts per million. Astaxanthin, not less than 0.4 percent. (c) Uses and restrictions... fish. (2) The quantity of astaxanthin in finished feed, from phaffia yeast when used alone or in combination with other astaxanthin color additive sources listed in this part 73, shall not exceed 80...

  12. 21 CFR 73.355 - Phaffia yeast.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ...), not more than 10 parts per million. Astaxanthin, not less than 0.4 percent. (c) Uses and restrictions... fish. (2) The quantity of astaxanthin in finished feed, from phaffia yeast when used alone or in combination with other astaxanthin color additive sources listed in this part 73, shall not exceed 80...

  13. 21 CFR 73.355 - Phaffia yeast.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...), not more than 10 parts per million. Astaxanthin, not less than 0.4 percent. (c) Uses and restrictions... fish. (2) The quantity of astaxanthin in finished feed, from phaffia yeast when used alone or in combination with other astaxanthin color additive sources listed in this part 73, shall not exceed 80...

  14. 21 CFR 73.355 - Phaffia yeast.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...), not more than 10 parts per million. Astaxanthin, not less than 0.4 percent. (c) Uses and restrictions... fish. (2) The quantity of astaxanthin in finished feed, from phaffia yeast when used alone or in combination with other astaxanthin color additive sources listed in this part 73, shall not exceed 80...

  15. 21 CFR 73.355 - Phaffia yeast.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ...), not more than 10 parts per million. Astaxanthin, not less than 0.4 percent. (c) Uses and restrictions... fish. (2) The quantity of astaxanthin in finished feed, from phaffia yeast when used alone or in combination with other astaxanthin color additive sources listed in this part 73, shall not exceed 80...

  16. Visualization and Image Analysis of Yeast Cells.

    PubMed

    Bagley, Steve

    2016-01-01

    When converting real-life data via visualization to numbers and then onto statistics the whole system needs to be considered so that conversion from the analogue to the digital is accurate and repeatable. Here we describe the points to consider when approaching yeast cell analysis visualization, processing, and analysis of a population by screening techniques.

  17. Actin and Endocytosis in Budding Yeast

    PubMed Central

    Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

    2015-01-01

    Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

  18. Glucose-Induced Acidification in Yeast Cultures

    ERIC Educational Resources Information Center

    Myers, Alan; Bourn, Julia; Pool, Brynne

    2005-01-01

    We present an investigation (for A-level biology students and equivalent) into the mechanism of glucose-induced extracellular acidification in unbuffered yeast suspensions. The investigation is designed to enhance understanding of aspects of the A-level curriculum that relate to the phenomenon (notably glucose catabolism) and to develop key skills…

  19. Microfermentation Test For Identification Of Yeast

    NASA Technical Reports Server (NTRS)

    Pierson, D. L.; Mishra, S. K.; Molina, Thomas C.

    1995-01-01

    Microfermentation test developed as supplementary method for use in identifying yeasts, especially in clinical and environmental studies. In comparison with traditional fermentation tests, simpler and easier, and requiries less equipment, material, and laboratory space. Results obtained in days instead of weeks.