Sample records for yeast dbf4 sequences

  1. A Dbf4p BRCA1 C-Terminal-Like Domain Required for the Response to Replication Fork Arrest in Budding Yeast

    PubMed Central

    Gabrielse, Carrie; Miller, Charles T.; McConnell, Kristopher H.; DeWard, Aaron; Fox, Catherine A.; Weinreich, Michael

    2006-01-01

    Dbf4p is an essential regulatory subunit of the Cdc7p kinase required for the initiation of DNA replication. Cdc7p and Dbf4p orthologs have also been shown to function in the response to DNA damage. A previous Dbf4p multiple sequence alignment identified a conserved ∼40-residue N-terminal region with similarity to the BRCA1 C-terminal (BRCT) motif called “motif N.” BRCT motifs encode ∼100-amino-acid domains involved in the DNA damage response. We have identified an expanded and conserved ∼100-residue N-terminal region of Dbf4p that includes motif N but is capable of encoding a single BRCT-like domain. Dbf4p orthologs diverge from the BRCT motif at the C terminus but may encode a similar secondary structure in this region. We have therefore called this the BRCT and DBF4 similarity (BRDF) motif. The principal role of this Dbf4p motif was in the response to replication fork (RF) arrest; however, it was not required for cell cycle progression, activation of Cdc7p kinase activity, or interaction with the origin recognition complex (ORC) postulated to recruit Cdc7p–Dbf4p to origins. Rad53p likely directly phosphorylated Dbf4p in response to RF arrest and Dbf4p was required for Rad53p abundance. Rad53p and Dbf4p therefore cooperated to coordinate a robust cellular response to RF arrest. PMID:16547092

  2. DNA Replication Checkpoint Signaling Depends on a Rad53–Dbf4 N-Terminal Interaction in Saccharomyces cerevisiae

    PubMed Central

    Chen, Ying-Chou; Kenworthy, Jessica; Gabrielse, Carrie; Hänni, Christine; Zegerman, Philip; Weinreich, Michael

    2013-01-01

    Dbf4-dependent kinase (DDK) and cyclin-dependent kinase (CDK) are essential to initiate DNA replication at individual origins. During replication stress, the S-phase checkpoint inhibits the DDK- and CDK-dependent activation of late replication origins. Rad53 kinase is a central effector of the replication checkpoint and both binds to and phosphorylates Dbf4 to prevent late-origin firing. The molecular basis for the Rad53–Dbf4 physical interaction is not clear but occurs through the Dbf4 N terminus. Here we found that both Rad53 FHA1 and FHA2 domains, which specifically recognize phospho-threonine (pT), interacted with Dbf4 through an N-terminal sequence and an adjacent BRCT domain. Purified Rad53 FHA1 domain (but not FHA2) bound to a pT Dbf4 peptide in vitro, suggesting a possible phospho-threonine-dependent interaction between FHA1 and Dbf4. The Dbf4–Rad53 interaction is governed by multiple contacts that are separable from the Cdc5- and Msa1-binding sites in the Dbf4 N terminus. Importantly, abrogation of the Rad53–Dbf4 physical interaction blocked Dbf4 phosphorylation and allowed late-origin firing during replication checkpoint activation. This indicated that Rad53 must stably bind to Dbf4 to regulate its activity. PMID:23564203

  3. DNA replication checkpoint signaling depends on a Rad53-Dbf4 N-terminal interaction in Saccharomyces cerevisiae.

    PubMed

    Chen, Ying-Chou; Kenworthy, Jessica; Gabrielse, Carrie; Hänni, Christine; Zegerman, Philip; Weinreich, Michael

    2013-06-01

    Dbf4-dependent kinase (DDK) and cyclin-dependent kinase (CDK) are essential to initiate DNA replication at individual origins. During replication stress, the S-phase checkpoint inhibits the DDK- and CDK-dependent activation of late replication origins. Rad53 kinase is a central effector of the replication checkpoint and both binds to and phosphorylates Dbf4 to prevent late-origin firing. The molecular basis for the Rad53-Dbf4 physical interaction is not clear but occurs through the Dbf4 N terminus. Here we found that both Rad53 FHA1 and FHA2 domains, which specifically recognize phospho-threonine (pT), interacted with Dbf4 through an N-terminal sequence and an adjacent BRCT domain. Purified Rad53 FHA1 domain (but not FHA2) bound to a pT Dbf4 peptide in vitro, suggesting a possible phospho-threonine-dependent interaction between FHA1 and Dbf4. The Dbf4-Rad53 interaction is governed by multiple contacts that are separable from the Cdc5- and Msa1-binding sites in the Dbf4 N terminus. Importantly, abrogation of the Rad53-Dbf4 physical interaction blocked Dbf4 phosphorylation and allowed late-origin firing during replication checkpoint activation. This indicated that Rad53 must stably bind to Dbf4 to regulate its activity.

  4. Rif1 controls DNA replication by directing Protein Phosphatase 1 to reverse Cdc7-mediated phosphorylation of the MCM complex.

    PubMed

    Hiraga, Shin-Ichiro; Alvino, Gina M; Chang, Fujung; Lian, Hui-Yong; Sridhar, Akila; Kubota, Takashi; Brewer, Bonita J; Weinreich, Michael; Raghuraman, M K; Donaldson, Anne D

    2014-02-15

    Initiation of eukaryotic DNA replication requires phosphorylation of the MCM complex by Dbf4-dependent kinase (DDK), composed of Cdc7 kinase and its activator, Dbf4. We report here that budding yeast Rif1 (Rap1-interacting factor 1) controls DNA replication genome-wide and describe how Rif1 opposes DDK function by directing Protein Phosphatase 1 (PP1)-mediated dephosphorylation of the MCM complex. Deleting RIF1 partially compensates for the limited DDK activity in a cdc7-1 mutant strain by allowing increased, premature phosphorylation of Mcm4. PP1 interaction motifs within the Rif1 N-terminal domain are critical for its repressive effect on replication. We confirm that Rif1 interacts with PP1 and that PP1 prevents premature Mcm4 phosphorylation. Remarkably, our results suggest that replication repression by Rif1 is itself also DDK-regulated through phosphorylation near the PP1-interacting motifs. Based on our findings, we propose that Rif1 is a novel PP1 substrate targeting subunit that counteracts DDK-mediated phosphorylation during replication. Fission yeast and mammalian Rif1 proteins have also been implicated in regulating DNA replication. Since PP1 interaction sites are evolutionarily conserved within the Rif1 sequence, it is likely that replication control by Rif1 through PP1 is a conserved mechanism.

  5. A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

    PubMed

    Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

    2001-12-01

    The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

  6. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    PubMed

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  7. Characterization of a Drosophila ortholog of the Cdc7 kinase: a role for Cdc7 in endoreplication independent of Chiffon.

    PubMed

    Stephenson, Robert; Hosler, Marcus R; Gavande, Navnath S; Ghosh, Arun K; Weake, Vikki M

    2015-01-16

    Cdc7 is a serine-threonine kinase that phosphorylates components of the pre-replication complex during DNA replication initiation. Cdc7 is highly conserved, and Cdc7 orthologs have been characterized in organisms ranging from yeast to humans. Cdc7 is activated specifically during late G1/S phase by binding to its regulatory subunit, Dbf4. Drosophila melanogaster contains a Dbf4 ortholog, Chiffon, which is essential for chorion amplification in Drosophila egg chambers. However, no Drosophila ortholog of Cdc7 has yet been characterized. Here, we report the functional and biochemical characterization of a Drosophila ortholog of Cdc7. Co-expression of Drosophila Cdc7 and Chiffon is able to complement a growth defect in yeast containing a temperature-sensitive Cdc7 mutant. Cdc7 and Chiffon physically interact and can be co-purified from insect cells. Cdc7 phosphorylates the known Cdc7 substrates Mcm2 and histone H3 in vitro, and Cdc7 kinase activity is stimulated by Chiffon and inhibited by the Cdc7-specific inhibitor XL413. Drosophila egg chamber follicle cells deficient for Cdc7 have a defect in two types of DNA replication, endoreplication and chorion gene amplification. However, follicle cells deficient for Chiffon have a defect in chorion gene amplification but still undergo endocycling. Our results show that Cdc7 interacts with Chiffon to form a functional Dbf4-dependent kinase complex and that Cdc7 is necessary for DNA replication in Drosophila egg chamber follicle cells. Additionally, we show that Chiffon is a member of an expanding subset of DNA replication initiation factors that are not strictly required for endoreplication in Drosophila. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. The product of the Saccharomyces cerevisiae cell cycle gene DBF2 has homology with protein kinases and is periodically expressed in the cell cycle.

    PubMed Central

    Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A

    1990-01-01

    Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271

  9. Structural changes in Mcm5 protein bypass Cdc7-Dbf4 function and reduce replication origin efficiency in Saccharomyces cerevisiae.

    PubMed

    Hoang, Margaret L; Leon, Ronald P; Pessoa-Brandao, Luis; Hunt, Sonia; Raghuraman, M K; Fangman, Walton L; Brewer, Bonita J; Sclafani, Robert A

    2007-11-01

    Eukaryotic chromosomal replication is a complicated process with many origins firing at different efficiencies and times during S phase. Prereplication complexes are assembled on all origins in G(1) phase, and yet only a subset of complexes is activated during S phase by DDK (for Dbf4-dependent kinase) (Cdc7-Dbf4). The yeast mcm5-bob1 (P83L) mutation bypasses DDK but results in reduced intrinsic firing efficiency at 11 endogenous origins and at origins located on minichromosomes. Origin efficiency may result from Mcm5 protein assuming an altered conformation, as predicted from the atomic structure of an archaeal MCM (for minichromosome maintenance) homologue. Similarly, an intragenic mutation in a residue predicted to interact with P83L suppresses the mcm5-bob1 bypass phenotype. We propose DDK phosphorylation of the MCM complex normally results in a single, highly active conformation of Mcm5, whereas the mcm5-bob1 mutation produces a number of conformations, only one of which is permissive for origin activation. Random adoption of these alternate states by the mcm5-bob1 protein can explain both how origin firing occurs independently of DDK and why origin efficiency is reduced. Because similar mutations in mcm2 and mcm4 cannot bypass DDK, Mcm5 protein may be a unique Mcm protein that is the final target of DDK regulation.

  10. Multiple mechanisms determine the order of APC/C substrate degradation in mitosis

    PubMed Central

    Lu, Dan; Hsiao, Jennifer Y.; Davey, Norman E.; Van Voorhis, Vanessa A.; Foster, Scott A.

    2014-01-01

    The ubiquitin protein ligase anaphase-promoting complex or cyclosome (APC/C) controls mitosis by promoting ordered degradation of securin, cyclins, and other proteins. The mechanisms underlying the timing of APC/C substrate degradation are poorly understood. We explored these mechanisms using quantitative fluorescence microscopy of GFP-tagged APC/CCdc20 substrates in living budding yeast cells. Degradation of the S cyclin, Clb5, begins early in mitosis, followed 6 min later by the degradation of securin and Dbf4. Anaphase begins when less than half of securin is degraded. The spindle assembly checkpoint delays the onset of Clb5 degradation but does not influence securin degradation. Early Clb5 degradation depends on its interaction with the Cdk1–Cks1 complex and the presence of a Cdc20-binding “ABBA motif” in its N-terminal region. The degradation of securin and Dbf4 is delayed by Cdk1-dependent phosphorylation near their Cdc20-binding sites. Thus, a remarkably diverse array of mechanisms generates robust ordering of APC/CCdc20 substrate destruction. PMID:25287299

  11. Dbf4-dependent kinase and the Rtt107 scaffold promote Mus81-Mms4 resolvase activation during mitosis.

    PubMed

    Princz, Lissa N; Wild, Philipp; Bittmann, Julia; Aguado, F Javier; Blanco, Miguel G; Matos, Joao; Pfander, Boris

    2017-03-01

    DNA repair by homologous recombination is under stringent cell cycle control. This includes the last step of the reaction, disentanglement of DNA joint molecules (JMs). Previous work has established that JM resolving nucleases are activated specifically at the onset of mitosis. In case of budding yeast Mus81-Mms4, this cell cycle stage-specific activation is known to depend on phosphorylation by CDK and Cdc5 kinases. Here, we show that a third cell cycle kinase, Cdc7-Dbf4 (DDK), targets Mus81-Mms4 in conjunction with Cdc5-both kinases bind to as well as phosphorylate Mus81-Mms4 in an interdependent manner. Moreover, DDK-mediated phosphorylation of Mms4 is strictly required for Mus81 activation in mitosis, establishing DDK as a novel regulator of homologous recombination. The scaffold protein Rtt107, which binds the Mus81-Mms4 complex, interacts with Cdc7 and thereby targets DDK and Cdc5 to the complex enabling full Mus81 activation. Therefore, Mus81 activation in mitosis involves at least three cell cycle kinases, CDK, Cdc5 and DDK Furthermore, tethering of the kinases in a stable complex with Mus81 is critical for efficient JM resolution. © 2017 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  12. Interactions of the Human MCM-BP Protein with MCM Complex Components and Dbf4

    PubMed Central

    Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

    2012-01-01

    MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK. PMID:22540012

  13. Interactions of the human MCM-BP protein with MCM complex components and Dbf4.

    PubMed

    Nguyen, Tin; Jagannathan, Madhav; Shire, Kathy; Frappier, Lori

    2012-01-01

    MCM-BP was discovered as a protein that co-purified from human cells with MCM proteins 3 through 7; results which were recapitulated in frogs, yeast and plants. Evidence in all of these organisms supports an important role for MCM-BP in DNA replication, including contributions to MCM complex unloading. However the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood. Here we show that human MCM-BP is capable of interacting with individual MCM proteins 2 through 7 when co-expressed in insect cells and can greatly increase the recovery of some recombinant MCM proteins. Glycerol gradient sedimentation analysis indicated that MCM-BP interacts most strongly with MCM4 and MCM7. Similar gradient analyses of human cell lysates showed that only a small amount of MCM-BP overlapped with the migration of MCM complexes and that MCM complexes were disrupted by exogenous MCM-BP. In addition, large complexes containing MCM-BP and MCM proteins were detected at mid to late S phase, suggesting that the formation of specific MCM-BP complexes is cell cycle regulated. We also identified an interaction between MCM-BP and the Dbf4 regulatory component of the DDK kinase in both yeast 2-hybrid and insect cell co-expression assays, and this interaction was verified by co-immunoprecipitation of endogenous proteins from human cells. In vitro kinase assays showed that MCM-BP was not a substrate for DDK but could inhibit DDK phosphorylation of MCM4,6,7 within MCM4,6,7 or MCM2-7 complexes, with little effect on DDK phosphorylation of MCM2. Since DDK is known to activate DNA replication through phosphorylation of these MCM proteins, our results suggest that MCM-BP may affect DNA replication in part by regulating MCM phosphorylation by DDK.

  14. Array signal recovery algorithm for a single-RF-channel DBF array

    NASA Astrophysics Data System (ADS)

    Zhang, Duo; Wu, Wen; Fang, Da Gang

    2016-12-01

    An array signal recovery algorithm based on sparse signal reconstruction theory is proposed for a single-RF-channel digital beamforming (DBF) array. A single-RF-channel antenna array is a low-cost antenna array in which signals are obtained from all antenna elements by only one microwave digital receiver. The spatially parallel array signals are converted into time-sequence signals, which are then sampled by the system. The proposed algorithm uses these time-sequence samples to recover the original parallel array signals by exploiting the second-order sparse structure of the array signals. Additionally, an optimization method based on the artificial bee colony (ABC) algorithm is proposed to improve the reconstruction performance. Using the proposed algorithm, the motion compensation problem for the single-RF-channel DBF array can be solved effectively, and the angle and Doppler information for the target can be simultaneously estimated. The effectiveness of the proposed algorithms is demonstrated by the results of numerical simulations.

  15. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    PubMed Central

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis. PMID:18768747

  16. Concerted activities of Mcm4, Sld3, and Dbf4 in control of origin activation and DNA replication fork progression

    PubMed Central

    Sheu, Yi-Jun; Kinney, Justin B.; Stillman, Bruce

    2016-01-01

    Eukaryotic chromosomes initiate DNA synthesis from multiple replication origins in a temporally specific manner during S phase. The replicative helicase Mcm2-7 functions in both initiation and fork progression and thus is an important target of regulation. Mcm4, a helicase subunit, possesses an unstructured regulatory domain that mediates control from multiple kinase signaling pathways, including the Dbf4-dependent Cdc7 kinase (DDK). Following replication stress in S phase, Dbf4 and Sld3, an initiation factor and essential target of Cyclin-Dependent Kinase (CDK), are targets of the checkpoint kinase Rad53 for inhibition of initiation from origins that have yet to be activated, so-called late origins. Here, whole-genome DNA replication profile analysis is used to access under various conditions the effect of mutations that alter the Mcm4 regulatory domain and the Rad53 targets, Sld3 and Dbf4. Late origin firing occurs under genotoxic stress when the controls on Mcm4, Sld3, and Dbf4 are simultaneously eliminated. The regulatory domain of Mcm4 plays an important role in the timing of late origin firing, both in an unperturbed S phase and in dNTP limitation. Furthermore, checkpoint control of Sld3 impacts fork progression under replication stress. This effect is parallel to the role of the Mcm4 regulatory domain in monitoring fork progression. Hypomorph mutations in sld3 are suppressed by a mcm4 regulatory domain mutation. Thus, in response to cellular conditions, the functions executed by Sld3, Dbf4, and the regulatory domain of Mcm4 intersect to control origin firing and replication fork progression, thereby ensuring genome stability. PMID:26733669

  17. Novel Risk Stratification Score for Predicting Early Distant Brain Failure and Salvage Whole Brain Radiotherapy after Stereotactic Radiosurgery for Brain Metastases

    PubMed Central

    Press, Robert H.; Prabhu, Roshan S.; Nickleach, Dana C.; Liu, Yuan; Shu, Hui-Kuo G.; Kandula, Shravan; Patel, Kirtesh R.; Curran, Walter J.; Crocker, Ian

    2015-01-01

    Background The purpose of this study was to evaluate predictors of early distant brain failure (DBF) and salvage whole brain radiotherapy (WBRT) after treatment with stereotactic radiosurgery (SRS) for brain metastases and create a clinically relevant risk score in order to stratify patients’ risk of these events. Methods We reviewed records of 270 patients with brain metastases treated with SRS between 2003-2012. Pre-treatment patient and tumor characteristics were analyzed by univariate and multivariable analyses. Cumulative incidence (CI) of first DBF and salvage WBRT were calculated. Significant factors were used to create a score for stratifying early (6-month) DBF risk. Results No prior WBRT, total lesion volume <1.3 cm3, primary breast cancer or malignant melanoma histology, and multiple metastases (≥2) were found to be significant predictors for early DBF. Each factor was ascribed one point due to similar hazard ratios. Scores of 0-1, 2, and 3-4 were considered low, intermediate, and high risk, respectively. This correlated with 6-month CI of DBF of 16.6%, 28.8%, and 54.4%, respectively (p<0.001). For patients without prior WBRT, the 6-month CI of salvage WBRT by 6-months was 2%, 17.7%, and 25.7%, respectively (p<0.001). Conclusion Early DBF after SRS requiring salvage WBRT remains a significant clinical problem. Patient stratification for early DBF can better inform the decision for initial treatment strategy for brain metastases. The provided risk score may help predict for early DBF and subsequent salvage WBRT if initial SRS is used. External validation is needed prior to clinical implementation. PMID:26242475

  18. An Mcm10 Mutant Defective in ssDNA Binding Shows Defects in DNA Replication Initiation.

    PubMed

    Perez-Arnaiz, Patricia; Kaplan, Daniel L

    2016-11-20

    Mcm10 is an essential protein that functions to initiate DNA replication after the formation of the replication fork helicase. In this manuscript, we identified a budding yeast Mcm10 mutant (Mcm10-m2,3,4) that is defective in DNA binding in vitro. Moreover, this Mcm10-m2,3,4 mutant does not stimulate the phosphorylation of Mcm2 by Dbf4-dependent kinase (DDK) in vitro. When we expressed wild-type levels of mcm10-m2,3,4 in budding yeast cells, we observed a severe growth defect and a substantially decreased DNA replication. We also observed a substantially reduced replication protein A- chromatin immunoprecipitation signal at origins of replication, reduced levels of DDK-phosphorylated Mcm2, and diminished Go, Ichi, Ni, and San (GINS) association with Mcm2-7 in vivo. mcm5-bob1 bypasses the growth defect conferred by DDK-phosphodead Mcm2 in budding yeast. However, the growth defect observed by expressing mcm10-m2,3,4 is not bypassed by the mcm5-bob1 mutation. Furthermore, origin melting and GINS association with Mcm2-7 are substantially decreased for cells expressing mcm10-m2,3,4 in the mcm5-bob1 background. Thus, the origin melting and GINS-Mcm2-7 interaction defects we observed for mcm10-m2,3,4 are not explained by decreased Mcm2 phosphorylation by DDK, since the defects persist in an mcm5-bob1 background. These data suggest that DNA binding by Mcm10 is essential for the initiation of DNA replication. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Elevating the triplet energy levels of dibenzofuran-based ambipolar phosphine oxide hosts for ultralow-voltage-driven efficient blue electrophosphorescence: from D-A to D-π-A systems.

    PubMed

    Han, Chunmiao; Zhang, Zhensong; Xu, Hui; Li, Jing; Zhao, Yi; Yan, Pengfei; Liu, Shiyong

    2013-01-21

    A series of donor (D)-π-acceptor (A)-type phosphine-oxide hosts (DBF(x) POPhCz(n)), which were composed of phenylcarbazole, dibenzofuran (DBF), and diphenylphosphine-oxide (DPPO) moieties, were designed and synthesized. Phenyl π-spacer groups were inserted between the carbazolyl and DBF groups, which effectively weakened the charge transfer and triplet-excited-state extension. As the result, the first triplet energy levels (T(1)) of DBF(x)POPhCz(n) are elevated to about 3.0 eV, 0.1 eV higher than their D-A-type analogues. Nevertheless, the electrochemical analysis and DFT calculations demonstrated the ambipolar characteristics of DBF(x)POPhCz(n). The phenyl π spacers hardly influenced the frontier molecular orbital (FMO) energy levels and the carrier-transporting ability of the materials. Therefore, these D-π-A systems are endowed with higher T(1) states, as well as comparable electrical properties to D-A systems. Phosphorescent blue-light-emitting diodes (PHOLEDs) that were based on DBF(x)POPhCz(n) not only inherited the ultralow driving voltages (2.4 V for onset, about 2.8 V at 200 cd m(-2), and <3.4 V at 1000 cd m(-2)) but also had much-improved efficiencies, including about 26 cd A(-1) for current efficiency, 30 Lm W(-1) for power efficiency, and 13% for external quantum efficiency, which were more than twice the values of devices that are based on conventional unipolar host materials. This performance makes DBFDPOPhCz(n) among the best hosts for ultralow-voltage-driven blue PHOLEDs reported so far. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Cree antidiabetic plant extracts display mechanism-based inactivation of CYP3A4.

    PubMed

    Tam, Teresa W; Liu, Rui; Arnason, John T; Krantis, Anthony; Staines, William A; Haddad, Pierre S; Foster, Brian C

    2011-01-01

    Seventeen Cree antidiabetic medicinal plants were studied to determine their potential to inhibit cytochrome P450 3A4 (CYP3A4) through mechanism-based inactivation (MBI). The ethanolic extracts of the medicinal plants were studied for their inhibition of CYP3A4 using the substrates testosterone and dibenzylfluorescein (DBF) in high pressure liquid chromatography (HPLC) and microtiter fluorometric assays, respectively. Using testosterone as a substrate, extracts of Alnus incana, Sarracenia purpurea, and Lycopodium clavatum were identified as potent CYP3A4 MBIs, while those from Abies balsamea, Picea mariana, Pinus banksiana, Rhododendron tomentosum, Kalmia angustifolia, and Picea glauca were identified as less potent inactivators. Not unexpectedly, the other substrate, DBF, showed a different profile of inhibition. Only A. balsamea was identified as a CYP3A4 MBI using DBF. Abies balsamea displayed both NADPH- and time-dependence of CYP3A4 inhibition using both substrates. Overall, several of the medicinal plants may markedly deplete CYP3A4 through MBI and, consequently, decrease the metabolism of CYP3A4 substrates including numerous medications used by diabetics.

  1. Activation of the yeast Hippo pathway by phosphorylation-dependent assembly of signaling complexes.

    PubMed

    Rock, Jeremy M; Lim, Daniel; Stach, Lasse; Ogrodowicz, Roksana W; Keck, Jamie M; Jones, Michele H; Wong, Catherine C L; Yates, John R; Winey, Mark; Smerdon, Stephen J; Yaffe, Michael B; Amon, Angelika

    2013-05-17

    Scaffold-assisted signaling cascades guide cellular decision-making. In budding yeast, one such signal transduction pathway called the mitotic exit network (MEN) governs the transition from mitosis to the G1 phase of the cell cycle. The MEN is conserved and in metazoans is known as the Hippo tumor-suppressor pathway. We found that signaling through the MEN kinase cascade was mediated by an unusual two-step process. The MEN kinase Cdc15 first phosphorylated the scaffold Nud1. This created a phospho-docking site on Nud1, to which the effector kinase complex Dbf2-Mob1 bound through a phosphoserine-threonine binding domain, in order to be activated by Cdc15. This mechanism of pathway activation has implications for signal transmission through other kinase cascades and might represent a general principle in scaffold-assisted signaling.

  2. Life Cycle Assessment of Biofertilizer Production and Use Compared with Conventional Liquid Digestate Management.

    PubMed

    Styles, David; Adams, Paul; Thelin, Gunnar; Vaneeckhaute, Céline; Chadwick, David; Withers, Paul J A

    2018-06-12

    Handling of digestate produced by anaerobic digestion impacts the environment through emission of greenhouse gases, reactive nitrogen, and phosphorus. Previous life cycle assessments (LCA) evaluating the extraction of nutrients from digestate using struvite precipitation and ammonia stripping did not relate synthetic fertilizer substitution (SFS) to nutrient use efficiency consequences. We applied an expanded LCA to compare the conventional management of 1 m 3 of liquid digestate (LD) from food waste against the production and use of digestate biofertilizer (DBF) extracted from LD, accounting for SFS efficacy. Avoidance of CH 4 , N 2 O, and NH 3 emissions from LD handling and enhanced SFS via more targeted use of nutrients in the versatile DBF product could generate environmental savings of up to 0.129 kg Sb eq, 4.16 kg SO 2 eq, 1.22 kg PO 4 eq, 33 kg CO 2 eq, and 20.6 MJ eq per m 3 LD, for abiotic resource depletion, acidification, eutrophication, global warming, and cumulative energy demand burdens, respectively. However, under worst-case assumptions, DBF extraction could increase global warming and cumulative energy demand by 7.5 kg CO 2 e and 251 MJ eq per m 3 LD owing to processing inputs. Normalizing these results against per capita environmental loadings, we conclude that DBF extraction is environmentally beneficial.

  3. The Hsk1(Cdc7) Replication Kinase Regulates Origin Efficiency

    PubMed Central

    Patel, Prasanta K.; Kommajosyula, Naveen; Rosebrock, Adam; Bensimon, Aaron; Leatherwood, Janet; Bechhoefer, John

    2008-01-01

    Origins of DNA replication are generally inefficient, with most firing in fewer than half of cell cycles. However, neither the mechanism nor the importance of the regulation of origin efficiency is clear. In fission yeast, origin firing is stochastic, leading us to hypothesize that origin inefficiency and stochasticity are the result of a diffusible, rate-limiting activator. We show that the Hsk1-Dfp1 replication kinase (the fission yeast Cdc7-Dbf4 homologue) plays such a role. Increasing or decreasing Hsk1-Dfp1 levels correspondingly increases or decreases origin efficiency. Furthermore, tethering Hsk1-Dfp1 near an origin increases the efficiency of that origin, suggesting that the effective local concentration of Hsk1-Dfp1 regulates origin firing. Using photobleaching, we show that Hsk1-Dfp1 is freely diffusible in the nucleus. These results support a model in which the accessibility of replication origins to Hsk1-Dfp1 regulates origin efficiency and provides a potential mechanistic link between chromatin structure and replication timing. By manipulating Hsk1-Dfp1 levels, we show that increasing or decreasing origin firing rates leads to an increase in genomic instability, demonstrating the biological importance of appropriate origin efficiency. PMID:18799612

  4. Regulated Eukaryotic DNA Replication Origin Firing with Purified Proteins

    PubMed Central

    Yeeles, Joseph T.P.; Deegan, Tom D.; Janska, Agnieszka; Early, Anne; Diffley, John F. X.

    2016-01-01

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric MCM complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45, MCM, GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4 dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication. PMID:25739503

  5. Regulated eukaryotic DNA replication origin firing with purified proteins.

    PubMed

    Yeeles, Joseph T P; Deegan, Tom D; Janska, Agnieszka; Early, Anne; Diffley, John F X

    2015-03-26

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric minichromosome maintenance (MCM) complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45-MCM-GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin-dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4-dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication.

  6. Dielectric boundary force and its crucial role in gramicidin

    NASA Astrophysics Data System (ADS)

    Nadler, Boaz; Hollerbach, Uwe; Eisenberg, R. S.

    2003-08-01

    In an electrostatic problem with nonuniform geometry, a charge Q in one region induces surface charges [called dielectric boundary charges (DBC)] at boundaries between different dielectrics. These induced surface charges, in return, exert a force [called dielectric boundary force (DBF)] on the charge Q that induced them. The DBF is often overlooked. It is not present in standard continuum theories of (point) ions in or near membranes and proteins, such as Gouy-Chapman, Debye-Huckel, Poisson-Boltzmann or Poisson-Nernst- Planck. The DBF is important when a charge Q is near dielectric interfaces, for example, when ions permeate through protein channels embedded in biological membranes. In this paper, we define the DBF and calculate it explicitly for a planar dielectric wall and for a tunnel geometry resembling the ionic channel gramicidin. In general, we formulate the DBF in a form useful for continuum theories, namely, as a solution of a partial differential equation with boundary conditions. The DBF plays a crucial role in the permeation of ions through the gramicidin channel. A positive ion in the channel produces a DBF of opposite sign to that of the fixed charge force (FCF) produced by the permanent charge of the gramicidin polypeptide, and so the net force on the positive ion is reduced. A negative ion creates a DBF of the same sign as the FCF and so the net (repulsive) force on the negative ion is increased. Thus, a positive ion can permeate the channel, while a negative ion is excluded from it. In gramicidin, it is this balance between the FCF and DBF that allows only singly charged positive ions to move into and through the channel. The DBF is not directly responsible, however, for selectivity between the alkali metal ions (e.g., Li+, Na+, K+): we prove that the DBF on a mobile spherical ion is independent of the ion’s radius.

  7. Cometabolic Degradation of Dibenzofuran and Dibenzothiophene by a Naphthalene-Degrading Comamonas sp. JB.

    PubMed

    Ji, Xiangyu; Xu, Jing; Ning, Shuxiang; Li, Nan; Tan, Liang; Shi, Shengnan

    2017-12-01

    Comamonas sp. JB was used to investigate the cometabolic degradation of dibenzofuran (DBF) and dibenzothiophene (DBT) with naphthalene as the primary substrate. Dehydrogenase and ATPase activity of the growing system with the presence of DBF and DBT were decreased when compared to only naphthalene in the growing system, indicating that the presence of DBF and DBT inhibited the metabolic activity of strain JB. The pathways and enzymes involved in the cometabolic degradation were tested. Examination of metabolites elucidated that strain JB cometabolically degraded DBF to 1,2-dihydroxydibenzofuran, subsequently to 2-hydroxy-4-(3'-oxo-3'H-benzofuran-2'-yliden)but-2-enoic acid, and finally to catechol. Meanwhile, strain JB cometabolically degraded DBT to 1,2-dihydroxydibenzothiophene and subsequently to the ring cleavage product. A series of naphthalene-degrading enzymes including naphthalene dioxygenase, 1,2-dihydroxynaphthalene dioxygenase, salicylaldehyde dehydrogenase, salicylate hydroxylase, and catechol 2,3-oxygenase have been detected, confirming that naphthalene was the real inducer of expression the degradation enzymes and metabolic pathways were controlled by naphthalene-degrading enzymes.

  8. Brain Metastasis Velocity: A Novel Prognostic Metric Predictive of Overall Survival and Freedom From Whole-Brain Radiation Therapy After Distant Brain Failure Following Upfront Radiosurgery Alone

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farris, Michael, E-mail: mfarris@wakehealth.edu; McTyre, Emory R.; Cramer, Christina K.

    Purpose: Prior statistical models attempted to identify risk factors for time to distant brain failure (DBF) or time to salvage whole-brain radiation therapy (WBRT) to predict the benefit of early WBRT versus stereotactic radiosurgery (SRS) alone. We introduce a novel clinical metric, brain metastasis velocity (BMV), for predicting clinical outcomes after initial DBF following upfront SRS alone. Methods and Materials: BMV was defined as the cumulative number of new brain metastases that developed over time since first SRS in years. Patients were classified by BMV into low-, intermediate-, and high-risk groups, consisting of <4, 4 to 13, and >13 newmore » metastases per year, respectively. Histology, number of metastases at the time of first SRS, and systemic disease status were assessed for effect on BMV. Results: Of 737 patients treated at our institution with upfront SRS without WBRT, 286 had ≥1 DBF event. A lower BMV predicted for improved overall survival (OS) following initial DBF (log-rank P<.0001). Median OS for the low, intermediate, and high BMV groups was 12.4 months (95% confidence interval [CI], 10.4-16.9 months), 8.2 months (95% CI, 5.0-9.7 months), and 4.3 months (95% CI, 2.6-6.7 months), respectively. Multivariate analysis showed that BMV remained the dominant predictor of OS, with a hazard ratio of 2.75 for the high BMV group (95% CI, 1.94-3.89; P<.0001) and a hazard ratio of 1.65 for the intermediate BMV group (95% CI, 1.18-2.30; P<.004). A lower BMV was associated with decreased rates of salvage WBRT (P=.02) and neurologic death (P=.008). Factors predictive for a higher BMV included ≥2 initial brain metastases (P=.004) and melanoma histology (P=.008). Conclusions: BMV is a novel metric associated with OS, neurologic death, and need for salvage WBRT after initial DBF following upfront SRS alone.« less

  9. How did climate drying reduce ecosystem carbon storage in the forest-steppe ecotone? A case study in Inner Mongolia, China.

    PubMed

    Zhang, Yuke; Liu, Hongyan

    2010-07-01

    The projected recession of forests in the forest-steppe ecotone under projected climate drying would restrict the carbon sink function of terrestrial ecosystems. Previous studies have shown that the forest-steppe ecotone in the southeastern Inner Mongolia Plateau originally resulted from climate drying and vegetation shifts during the mid- to late-Holocene, but the interrelated processes of changing soil carbon storage and vegetation and soil shifts remain unclear. A total of 44 forest soil profiles and 40 steppe soil profiles were excavated to determine soil carbon storage in deciduous broadleaf forests (DBF), coniferous forests (CF) and steppe (ST) in this area. Carbon density was estimated to be 106.51 t/hm(2) (DBF), 73.20 t/hm(2) (CF), and 28.14 t/hm(2) (ST) for these ecosystems. Soil organic carbon (SOC) content was negatively correlated with sand content (R = -0.879, P < 0.01, n = 42), and positively correlated with silt (R = 0.881, P < 0.01, n = 42) and clay (R = 0.858, P < 0.01, n = 42) content. Consistent trends between fractions of coarse sand and a proxy index of relative aridity in sediment sequences from two palaeo-lakes further imply that climate drying reduced SOC through coarsening of the soil texture in the forest-steppe ecotone. Changes in carbon storage caused by climate drying can be divided into two stages: (1) carbon storage of the ecosystem was reduced to 68.7%, mostly by soil coarsening when DBF were replaced by CF at approximately 5,900 (14)C years before present (BP); and (2) carbon storage was reduced to 26.4%, mostly by vegetation shifts when CF were replaced by ST at approximately 2,900 (14)C years BP.

  10. Comparative analyses of ubiquitin-like ATG8 and cysteine protease ATG4 autophagy genes in the plant lineage and cross-kingdom processing of ATG8 by ATG4.

    PubMed

    Seo, Eunyoung; Woo, Jongchan; Park, Eunsook; Bertolani, Steven J; Siegel, Justin B; Choi, Doil; Dinesh-Kumar, Savithramma P

    2016-11-01

    Autophagy is important for degradation and recycling of intracellular components. In a diversity of genera and species, orthologs and paralogs of the yeast Atg4 and Atg8 proteins are crucial in the biogenesis of double-membrane autophagosomes that carry the cellular cargoes to vacuoles and lysosomes. Although many plant genome sequences are available, the ATG4 and ATG8 sequence analysis is limited to some model plants. We identified 28 ATG4 and 116 ATG8 genes from the available 18 different plant genome sequences. Gene structures and protein domain sequences of ATG4 and ATG8 are conserved in plant lineages. Phylogenetic analyses classified ATG8s into 3 subgroups suggesting divergence from the common ancestor. The ATG8 expansion in plants might be attributed to whole genome duplication, segmental and dispersed duplication, and purifying selection. Our results revealed that the yeast Atg4 processes Arabidopsis ATG8 but not human LC3A (HsLC3A). In contrast, HsATG4B can process yeast and plant ATG8s in vitro but yeast and plant ATG4s cannot process HsLC3A. Interestingly, in Nicotiana benthamiana plants the yeast Atg8 is processed compared to HsLC3A. However, HsLC3A is processed when coexpressed with HsATG4B in plants. Molecular modeling indicates that lack of processing of HsLC3A by plant and yeast ATG4 is not due to lack of interaction with HsLC3A. Our in-depth analyses of ATG4 and ATG8 in the plant lineage combined with results of cross-kingdom ATG8 processing by ATG4 further support the evolutionarily conserved maturation of ATG8. Broad ATG8 processing by HsATG4B and lack of processing of HsLC3A by yeast and plant ATG4s suggest that the cross-kingdom ATG8 processing is determined by ATG8 sequence rather than ATG4.

  11. A Novel Non-canonical Forkhead-associated (FHA) Domain-binding Interface Mediates the Interaction between Rad53 and Dbf4 Proteins*

    PubMed Central

    Matthews, Lindsay A.; Selvaratnam, Rajeevan; Jones, Darryl R.; Akimoto, Madoka; McConkey, Brendan J.; Melacini, Giuseppe; Duncker, Bernard P.; Guarné, Alba

    2014-01-01

    Forkhead-associated (FHA) and BRCA1 C-terminal (BRCT) domains are overrepresented in DNA damage and replication stress response proteins. They function primarily as phosphoepitope recognition modules but can also mediate non-canonical interactions. The latter are rare, and only a few have been studied at a molecular level. We have identified a crucial non-canonical interaction between the N-terminal FHA1 domain of the checkpoint effector kinase Rad53 and the BRCT domain of the regulatory subunit of the Dbf4-dependent kinase that is critical to suppress late origin firing and to stabilize stalled forks during replication stress. The Rad53-Dbf4 interaction is phosphorylation-independent and involves a novel non-canonical interface on the FHA1 domain. Mutations within this surface result in hypersensitivity to genotoxic stress. Importantly, this surface is not conserved in the FHA2 domain of Rad53, suggesting that the FHA domains of Rad53 gain specificity by engaging additional interaction interfaces beyond their phosphoepitope-binding site. In general, our results point to FHA domains functioning as complex logic gates rather than mere phosphoepitope-targeting modules. PMID:24285546

  12. Hierarchical MFMO Circuit Modules for an Energy-Efficient SDR DBF

    NASA Astrophysics Data System (ADS)

    Mar, Jeich; Kuo, Chi-Cheng; Wu, Shin-Ru; Lin, You-Rong

    The hierarchical multi-function matrix operation (MFMO) circuit modules are designed using coordinate rotations digital computer (CORDIC) algorithm for realizing the intensive computation of matrix operations. The paper emphasizes that the designed hierarchical MFMO circuit modules can be used to develop a power-efficient software-defined radio (SDR) digital beamformer (DBF). The formulas of the processing time for the scalable MFMO circuit modules implemented in field programmable gate array (FPGA) are derived to allocate the proper logic resources for the hardware reconfiguration. The hierarchical MFMO circuit modules are scalable to the changing number of array branches employed for the SDR DBF to achieve the purpose of power saving. The efficient reuse of the common MFMO circuit modules in the SDR DBF can also lead to energy reduction. Finally, the power dissipation and reconfiguration function in the different modes of the SDR DBF are observed from the experiment results.

  13. Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609.

    PubMed

    Sambles, Christine; Middelhaufe, Sabine; Soanes, Darren; Kolak, Dagmara; Lux, Thomas; Moore, Karen; Matoušková, Petra; Parker, David; Lee, Rob; Love, John; Aves, Stephen J

    2017-09-01

    Most eukaryotic oleaginous species are yeasts and among them the basidiomycete red yeast, Rhodotorula ( Rhodosporidium ) toruloides (Pucciniomycotina) is known to produce high quantities of lipids when grown in nitrogen-limiting media, and has potential for biodiesel production. The genome of the CGMCC 2.1609 strain of this oleaginous red yeast was sequenced using a hybrid of Roche 454 and Illumina technology generating 13 × coverage. The de novo assembly was carried out using MIRA and scaffolded using MAQ and BAMBUS. The sequencing and assembly resulted in 365 scaffolds with total genome size of 33.4 Mb. The complete genome sequence of this strain was deposited in GenBank and the accession number is LKER00000000. The annotation is available on Figshare (doi:10.6084/m9.figshare.4754251).

  14. A nomogram for predicting distant brain failure in patients treated with gamma knife stereotactic radiosurgery without whole brain radiotherapy

    PubMed Central

    Ayala-Peacock, Diandra N.; Peiffer, Ann M.; Lucas, John T.; Isom, Scott; Kuremsky, J. Griff; Urbanic, James J.; Bourland, J. Daniel; Laxton, Adrian W.; Tatter, Stephen B.; Shaw, Edward G.; Chan, Michael D.

    2014-01-01

    Background We review our single institution experience to determine predictive factors for early and delayed distant brain failure (DBF) after radiosurgery without whole brain radiotherapy (WBRT) for brain metastases. Materials and methods Between January 2000 and December 2010, a total of 464 patients were treated with Gamma Knife stereotactic radiosurgery (SRS) without WBRT for primary management of newly diagnosed brain metastases. Histology, systemic disease, RPA class, and number of metastases were evaluated as possible predictors of DBF rate. DBF rates were determined by serial MRI. Kaplan–Meier method was used to estimate rate of DBF. Multivariate analysis was performed using Cox Proportional Hazard regression. Results Median number of lesions treated was 1 (range 1–13). Median time to DBF was 4.9 months. Twenty-seven percent of patients ultimately required WBRT with median time to WBRT of 5.6 months. Progressive systemic disease (χ2= 16.748, P < .001), number of metastases at SRS (χ2 = 27.216, P < .001), discovery of new metastases at time of SRS (χ2 = 9.197, P < .01), and histology (χ2 = 12.819, P < .07) were factors that predicted for earlier time to distant failure. High risk histologic subtypes (melanoma, her2 negative breast, χ2 = 11.020, P < .001) and low risk subtypes (her2 + breast, χ2 = 11.343, P < .001) were identified. Progressive systemic disease (χ2 = 9.549, P < .01), number of brain metastases (χ2 = 16.953, P < .001), minimum SRS dose (χ2 = 21.609, P < .001), and widespread metastatic disease (χ2 = 29.396, P < .001) were predictive of shorter time to WBRT. Conclusion Systemic disease, number of metastases, and histology are factors that predict distant failure rate after primary radiosurgical management of brain metastases. PMID:24558022

  15. The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

    PubMed

    Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

    2015-12-01

    The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  16. Development and validation of a Database Forensic Metamodel (DBFM)

    PubMed Central

    Al-dhaqm, Arafat; Razak, Shukor; Othman, Siti Hajar; Ngadi, Asri; Ahmed, Mohammed Nazir; Ali Mohammed, Abdulalem

    2017-01-01

    Database Forensics (DBF) is a widespread area of knowledge. It has many complex features and is well known amongst database investigators and practitioners. Several models and frameworks have been created specifically to allow knowledge-sharing and effective DBF activities. However, these are often narrow in focus and address specified database incident types. We have analysed 60 such models in an attempt to uncover how numerous DBF activities are really public even when the actions vary. We then generate a unified abstract view of DBF in the form of a metamodel. We identified, extracted, and proposed a common concept and reconciled concept definitions to propose a metamodel. We have applied a metamodelling process to guarantee that this metamodel is comprehensive and consistent. PMID:28146585

  17. External validity of two nomograms for predicting distant brain failure after radiosurgery for brain metastases in a bi-institutional independent patient cohort.

    PubMed

    Prabhu, Roshan S; Press, Robert H; Boselli, Danielle M; Miller, Katherine R; Lankford, Scott P; McCammon, Robert J; Moeller, Benjamin J; Heinzerling, John H; Fasola, Carolina E; Patel, Kirtesh R; Asher, Anthony L; Sumrall, Ashley L; Curran, Walter J; Shu, Hui-Kuo G; Burri, Stuart H

    2018-03-01

    Patients treated with stereotactic radiosurgery (SRS) for brain metastases (BM) are at increased risk of distant brain failure (DBF). Two nomograms have been recently published to predict individualized risk of DBF after SRS. The goal of this study was to assess the external validity of these nomograms in an independent patient cohort. The records of consecutive patients with BM treated with SRS at Levine Cancer Institute and Emory University between 2005 and 2013 were reviewed. Three validation cohorts were generated based on the specific nomogram or recursive partitioning analysis (RPA) entry criteria: Wake Forest nomogram (n = 281), Canadian nomogram (n = 282), and Canadian RPA (n = 303) validation cohorts. Freedom from DBF at 1-year in the Wake Forest study was 30% compared with 50% in the validation cohort. The validation c-index for both the 6-month and 9-month freedom from DBF Wake Forest nomograms was 0.55, indicating poor discrimination ability, and the goodness-of-fit test for both nomograms was highly significant (p < 0.001), indicating poor calibration. The 1-year actuarial DBF in the Canadian nomogram study was 43.9% compared with 50.9% in the validation cohort. The validation c-index for the Canadian 1-year DBF nomogram was 0.56, and the goodness-of-fit test was also highly significant (p < 0.001). The validation accuracy and c-index of the Canadian RPA classification was 53% and 0.61, respectively. The Wake Forest and Canadian nomograms for predicting risk of DBF after SRS were found to have limited predictive ability in an independent bi-institutional validation cohort. These results reinforce the importance of validating predictive models in independent patient cohorts.

  18. Cdc7 kinase - a new target for drug development.

    PubMed

    Swords, Ronan; Mahalingam, Devalingam; O'Dwyer, Michael; Santocanale, Corrado; Kelly, Kevin; Carew, Jennifer; Giles, Francis

    2010-01-01

    The cell division cycle 7 (Cdc7) is a serine threonine kinase that is of critical importance in the regulation of normal cell cycle progression. Cdc7 kinase is highly conserved during evolution and much has been learned about its biological roles in humans through the study of lower eukaryotes, particularly yeasts. Two important regulator proteins, Dbf4 and Drf1, bind to and modulate the kinase activity of human Cdc7 which phosphorylates several sites on Mcm2 (minichromosome maintenance protein 2), one of the six subunits of the replicative DNA helicase needed for duplication of the genome. Through regulation of both DNA synthesis and DNA damage response, both key functions in the survival of tumour cells, Cdc7 becomes an attractive target for pharmacological inhibition. There are much data available on the pre-clinical anti-cancer effects of Cdc7 depletion and although there are no available Cdc7 inhibitors in clinical trials as yet, several lead compounds are being optimised for this purpose. In this review, we will address the current status of Cdc7 as an important target for new drug development.

  19. Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

    PubMed

    Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

    2015-03-01

    Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

  20. Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

    2008-06-06

    Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

  1. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  2. Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.

    PubMed

    Vandenbol, M; Jauniaux, J C; Grenson, M

    1989-11-15

    The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.

  3. Prediction of new brain metastases after radiosurgery: validation and analysis of performance of a multi-institutional nomogram.

    PubMed

    Ayala-Peacock, Diandra N; Attia, Albert; Braunstein, Steve E; Ahluwalia, Manmeet S; Hepel, Jaroslaw; Chung, Caroline; Contessa, Joseph; McTyre, Emory; Peiffer, Ann M; Lucas, John T; Isom, Scott; Pajewski, Nicholas M; Kotecha, Rupesh; Stavas, Mark J; Page, Brandi R; Kleinberg, Lawrence; Shen, Colette; Taylor, Robert B; Onyeuku, Nasarachi E; Hyde, Andrew T; Gorovets, Daniel; Chao, Samuel T; Corso, Christopher; Ruiz, Jimmy; Watabe, Kounosuke; Tatter, Stephen B; Zadeh, Gelareh; Chiang, Veronica L S; Fiveash, John B; Chan, Michael D

    2017-11-01

    Stereotactic radiosurgery (SRS) without whole brain radiotherapy (WBRT) for brain metastases can avoid WBRT toxicities, but with risk of subsequent distant brain failure (DBF). Sole use of number of metastases to triage patients may be an unrefined method. Data on 1354 patients treated with SRS monotherapy from 2000 to 2013 for new brain metastases was collected across eight academic centers. The cohort was divided into training and validation datasets and a prognostic model was developed for time to DBF. We then evaluated the discrimination and calibration of the model within the validation dataset, and confirmed its performance with an independent contemporary cohort. Number of metastases (≥8, HR 3.53 p = 0.0001), minimum margin dose (HR 1.07 p = 0.0033), and melanoma histology (HR 1.45, p = 0.0187) were associated with DBF. A prognostic index derived from the training dataset exhibited ability to discriminate patients' DBF risk within the validation dataset (c-index = 0.631) and Heller's explained relative risk (HERR) = 0.173 (SE = 0.048). Absolute number of metastases was evaluated for its ability to predict DBF in the derivation and validation datasets, and was inferior to the nomogram. A nomogram high-risk threshold yielding a 2.1-fold increased need for early WBRT was identified. Nomogram values also correlated to number of brain metastases at time of failure (r = 0.38, p < 0.0001). We present a multi-institutionally validated prognostic model and nomogram to predict risk of DBF and guide risk-stratification of patients who are appropriate candidates for radiosurgery versus upfront WBRT.

  4. Centromere-Like Regions in the Budding Yeast Genome

    PubMed Central

    Lefrançois, Philippe; Auerbach, Raymond K.; Yellman, Christopher M.; Roeder, G. Shirleen; Snyder, Michael

    2013-01-01

    Accurate chromosome segregation requires centromeres (CENs), the DNA sequences where kinetochores form, to attach chromosomes to microtubules. In contrast to most eukaryotes, which have broad centromeres, Saccharomyces cerevisiae possesses sequence-defined point CENs. Chromatin immunoprecipitation followed by sequencing (ChIP–Seq) reveals colocalization of four kinetochore proteins at novel, discrete, non-centromeric regions, especially when levels of the centromeric histone H3 variant, Cse4 (a.k.a. CENP-A or CenH3), are elevated. These regions of overlapping protein binding enhance the segregation of plasmids and chromosomes and have thus been termed Centromere-Like Regions (CLRs). CLRs form in close proximity to S. cerevisiae CENs and share characteristics typical of both point and regional CENs. CLR sequences are conserved among related budding yeasts. Many genomic features characteristic of CLRs are also associated with these conserved homologous sequences from closely related budding yeasts. These studies provide general and important insights into the origin and evolution of centromeres. PMID:23349633

  5. Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.

    PubMed

    Niki, Hironori

    2014-03-01

    The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.

  6. Effects of the dose and viability of Saccharomyces cerevisiae. 1. Diversity of ruminal microbes as analyzed by Illumina MiSeq sequencing and quantitative PCR.

    PubMed

    Jiang, Y; Ogunade, I M; Qi, S; Hackmann, T J; Staples, C R; Adesogan, A T

    2017-01-01

    This study was conducted to examine effects of the dose and viability of supplemental Saccharomyces cerevisiae on the ruminal fermentation and bacteria population and the performance of lactating dairy cows. Four ruminally cannulated lactating cows averaging 284±18d in milk were assigned to 4 treatments arranged in a 4×4 Latin square design with four 21-d periods. Cows were fed a total mixed ration containing 41.7% corn silage, 12.1% brewer's grains, and 46.2% concentrate on a dry matter basis. The diet was supplemented with no yeast (control) or with a low dose of live yeast (5.7×10 7 cfu/cow per day; LLY), a high dose of live yeast (6.0×10 8 cfu/cow per day; HLY), or a high dose of killed yeast (6.0×10 8 cfu/cow per day; HDY). Microbial diversity was examined by high-throughput Illumina MiSeq sequencing (Illumina Inc., San Diego, CA) of the V4 region of the 16S rRNA gene. The relative abundance of select ruminal bacteria was also quantified by quantitative PCR (qPCR). Adding LLY to the diet increased the relative abundance of some ruminal cellulolytic bacteria (Ruminococcus and Fibrobacter succinogenes) and amylolytic bacteria (Ruminobacter, Bifidobacterium, and Selenomonas ruminantium). Adding live instead of killed yeast increased the relative abundance of Ruminococcus and F. succinogenes; adding HDY increased the relative abundance of Ruminobacter, Bifidobacterium, Streptococcus bovis, and Selenomonas ruminantium. The most dominant (≥1% of total sequences) bacteria that responded to LLY addition whose functions are among the least understood in relation to the mode of action of yeast include Paraprevotellaceae, CF231, Treponema, and Lachnospiraceae. Future studies should aim to speciate, culture, and examine the function of these bacteria to better understand their roles in the mode of action of yeast. A relatively precise relationship was detected between the relative abundance of F. succinogenes (R 2 =0.67) from qPCR and MiSeq sequencing, but weak relationships were detected for Megasphaera elsdenii, Ruminococcus flavefaciens, and S. ruminantium (R 2 ≤0.19). Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation

    DTIC Science & Technology

    2016-02-11

    the White- head Genome Technology Core for sequencing . This work was supported by the UCSF Program for Breakthrough Biomedical Research (funded in...landscape of the yeast genome defined by RNA sequencing . Science 320, 1344–1349. Nedialkova, D.D., and Leidel, S.A. (2015). Optimization of Codon Translation... the CC BY license (http://creativecommons.org/licenses/by/4.0/). SUMMARY Ribosome-footprint profiling provides genome -wide snapshots of translation

  8. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

  9. Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

    PubMed Central

    On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

    2014-01-01

    Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

  10. A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

    PubMed

    Frazer, LilyAnn Novak; O'Keefe, Raymond T

    2007-09-01

    The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

  11. Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin

    PubMed Central

    Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.

    2015-01-01

    Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315

  12. Determination of torasemide by fluorescence quenching method with some dihalogenated fluorescein dyes as probes

    NASA Astrophysics Data System (ADS)

    Cui, Zhiping; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Hu, Xiaoli; Tian, Jing

    2013-10-01

    A novel fluorescence quenching method for the determination of torasemide (TOR) with some dihalogenated fluorescein dyes as fluorescence probes was developed. In acidulous medium, TOR could interact with some dihalogenated fluorescein dyes such as dichlorofluorescein (DCF), dibromofluorescein (DBF) and diiodofluorescein (DIF) to form binary complexes, which could lead to fluorescence quenching of above dihalogenated fluorescein dyes. The maximum fluorescence emission wavelengths were located at 532 nm (TOR-DCF), 535 nm (TOR-DBF) and 554 nm (TOR-DIF). The relative fluorescence intensities (ΔF = F0 - F) were proportional to the concentration of TOR in certain ranges. The detection limits were 4.8 ng mL-1 for TOR-DCF system, 9.8 ng mL-1 for TOR-DBF system and 35.1 ng mL-1 for TOR-DIF system. The optimum reaction conditions, influencing factors were studied; and the effect of coexisting substances was investigated owing to the highest sensitivity of TOR-DCF system. In addition, the reaction mechanism, composition and structure of the complex were discussed by quantum chemical calculation and Job's method. The fluorescence quenching of dihalogenated fluorescein dyes by TOR was a static quenching process judging from the effect of temperature and the Stern-Volmer plots. The method was satisfactorily applied to the determination of TOR in tablets and human urine samples.

  13. Bridge effects on light harvesting of a DBfA type polymer system

    NASA Astrophysics Data System (ADS)

    Sun, Sam-Shajing; Hasib, Muhammad; Gavrilenko, Alexander V.; Devan, Joshua; Gavrilenko, Vladimir

    2016-09-01

    Plastic optoelectronic materials and thin film devices are very attractive in future optical sensor and solar energy applications due to their lightweight, flexible shape, high photon absorption coefficients, low cost, and environmental benefits. In this study, optoelectronic properties of D, D/fA blend, DfA, and a series of DBfA type of conjugated block copolymers has been investigated, where D is a donor type PPV conjugated block, B is a non-conjugated and flexible aliphatic hydrocarbon bridge chain containing different number of aliphatic methylene units, and fA is a fluorinated acceptor type PPV conjugated block. The optical absorptions of the D/fA blend, DfA, and DBfAs are typical overlaps of individual absorptions of D and fA blocks, while the solution steady state photoluminescence (PL) emission of D were quenched to different levels in blends and block copolymers, with DBfAs containing one methylene unit bridge (DB1fA) quenched most. This could be attributed to an intra-molecular photo induced electron transfer or charge separation in DBfA systems. Theoretical first principles study of the equilibrium atomic configuration of DfA reveals the existence of twisting angles between the D and fA blocks in DfA stable states which may account for a less PL quenching of DfA as compared to DB1fA. These results are important for designing and developing high efficiency polymer based optoelectronic systems.

  14. Deep bottleneck features for spoken language identification.

    PubMed

    Jiang, Bing; Song, Yan; Wei, Si; Liu, Jun-Hua; McLoughlin, Ian Vince; Dai, Li-Rong

    2014-01-01

    A key problem in spoken language identification (LID) is to design effective representations which are specific to language information. For example, in recent years, representations based on both phonotactic and acoustic features have proven their effectiveness for LID. Although advances in machine learning have led to significant improvements, LID performance is still lacking, especially for short duration speech utterances. With the hypothesis that language information is weak and represented only latently in speech, and is largely dependent on the statistical properties of the speech content, existing representations may be insufficient. Furthermore they may be susceptible to the variations caused by different speakers, specific content of the speech segments, and background noise. To address this, we propose using Deep Bottleneck Features (DBF) for spoken LID, motivated by the success of Deep Neural Networks (DNN) in speech recognition. We show that DBFs can form a low-dimensional compact representation of the original inputs with a powerful descriptive and discriminative capability. To evaluate the effectiveness of this, we design two acoustic models, termed DBF-TV and parallel DBF-TV (PDBF-TV), using a DBF based i-vector representation for each speech utterance. Results on NIST language recognition evaluation 2009 (LRE09) show significant improvements over state-of-the-art systems. By fusing the output of phonotactic and acoustic approaches, we achieve an EER of 1.08%, 1.89% and 7.01% for 30 s, 10 s and 3 s test utterances respectively. Furthermore, various DBF configurations have been extensively evaluated, and an optimal system proposed.

  15. SEDIMENT DATA - COMMENCEMENT BAY HYLEBOS WATERWAY - TACOMA, WA - PRE-REMEDIAL DESIGN PROGRAM

    EPA Science Inventory

    Event 1A/1B Data Files URL address: http://www.epa.gov/r10earth/datalib/superfund/hybos1ab.htm. Sediment Chemistry Data (Database Format): HYBOS1AB.EXE is a self-extracting file which expands to the single-value per record .DBF format database file HYBOS1AB.DBF. This file contai...

  16. Recognition of Yeast Species from Gene Sequence Comparisons

    USDA-ARS?s Scientific Manuscript database

    This review discusses recognition of yeast species from gene sequence comparisons, which have been responsible for doubling the number of known yeasts over the past decade. The resolution provided by various single gene sequences is examined for both ascomycetous and basidiomycetous species, and th...

  17. Expressed Sequence Tag Analysis of the Human Pathogen Paracoccidioides brasiliensis Yeast Phase: Identification of Putative Homologues of Candida albicans Virulence and Pathogenicity Genes

    PubMed Central

    Goldman, Gustavo H.; dos Reis Marques, Everaldo; Custódio Duarte Ribeiro, Diógenes; Ângelo de Souza Bernardes, Luciano; Quiapin, Andréa Carla; Vitorelli, Patrícia Marostica; Savoldi, Marcela; Semighini, Camile P.; de Oliveira, Regina C.; Nunes, Luiz R.; Travassos, Luiz R.; Puccia, Rosana; Batista, Wagner L.; Ferreira, Leslie Ecker; Moreira, Júlio C.; Bogossian, Ana Paula; Tekaia, Fredj; Nobrega, Marina Pasetto; Nobrega, Francisco G.; Goldman, Maria Helena S.

    2003-01-01

    Paracoccidioides brasiliensis, a thermodimorphic fungus, is the causative agent of the prevalent systemic mycosis in Latin America, paracoccidioidomycosis. We present here a survey of expressed genes in the yeast pathogenic phase of P. brasiliensis. We obtained 13,490 expressed sequence tags from both 5′ and 3′ ends. Clustering analysis yielded the partial sequences of 4,692 expressed genes that were functionally classified by similarity to known genes. We have identified several Candida albicans virulence and pathogenicity homologues in P. brasiliensis. Furthermore, we have analyzed the expression of some of these genes during the dimorphic yeast-mycelium-yeast transition by real-time quantitative reverse transcription-PCR. Clustering analysis of the mycelium-yeast transition revealed three groups: (i) RBT, hydrophobin, and isocitrate lyase; (ii) malate dehydrogenase, contigs Pb1067 and Pb1145, GPI, and alternative oxidase; and (iii) ubiquitin, delta-9-desaturase, HSP70, HSP82, and HSP104. The first two groups displayed high mRNA expression in the mycelial phase, whereas the third group showed higher mRNA expression in the yeast phase. Our results suggest the possible conservation of pathogenicity and virulence mechanisms among fungi, expand considerably gene identification in P. brasiliensis, and provide a broader basis for further progress in understanding its biological peculiarities. PMID:12582121

  18. Identification of yeasts and evaluation of their distribution in Taiwanese Kefir and Viili starters.

    PubMed

    Wang, S Y; Chen, H C; Liu, J R; Lin, Y C; Chen, M J

    2008-10-01

    The objective of the present study was to investigate yeast communities in kefir grains and viili starters in Taiwan through conventional microbiological cultivation and polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). The DNA sequencing was used as a validity technique to ensure that all isolates within each group belonged to just one species, and to confirm the identified results of PCR-DGGE. Results indicated that a combination of conventional microbiological cultivation with PCR-DGGE and sequencing could successfully identify 4 yeast species from both types of cultures in Taiwan. Kluyveromyces marxianus, Saccharomyces turicensis, and Pichia fermentans were found in Taiwanese kefir grains with a distribution of 76, 22, and 2%, respectively, whereas Klu. marxianus, Saccharomyces unisporus and P. fermentans were identified in viili starters corresponding to 58, 11, and 31% of the total cell counts, respectively. Furthermore, the culture-independent method was applied to identify the yeast species using DGGE. Only 2 yeast species, Klu. marxianus and S. turicensis, were found in kefir grains and 2, Klu. marxianus and P. fermentans, in viili starters. These results suggest that in samples containing multiple species, PCR-DGGE may fail to detect some species. Sequences of yeast isolates reported in this study have been deposited in the GenBank database under accession nos. DQ139802, AF398485, DQ377652, and AY007920.

  19. Draft Genome Sequence of Cryophilic Basidiomycetous Yeast Mrakia blollopis SK-4, Isolated from an Algal Mat of Naga-ike Lake in the Skarvsnes Ice-Free Area, East Antarctica.

    PubMed

    Tsuji, Masaharu; Kudoh, Sakae; Hoshino, Tamotsu

    2015-01-22

    Mrakia blollopis strain SK-4 was isolated from an algal mat of Naga-ike, a lake in Skarvsnes, East Antarctica. Here, we report the draft genome sequence of M. blollopis SK-4. This is the first report on the genome sequence of any cold-adapted fungal species. Copyright © 2015 Tsuji et al.

  20. Phosphopeptide binding by Sld3 links Dbf4-dependent kinase to MCM replicative helicase activation.

    PubMed

    Deegan, Tom D; Yeeles, Joseph Tp; Diffley, John Fx

    2016-05-02

    The initiation of eukaryotic DNA replication requires the assembly of active CMG (Cdc45-MCM-GINS) helicases at replication origins by a set of conserved and essential firing factors. This process is controlled during the cell cycle by cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), and in response to DNA damage by the checkpoint kinase Rad53/Chk1. Here we show that Sld3, previously shown to be an essential CDK and Rad53 substrate, is recruited to the inactive MCM double hexamer in a DDK-dependent manner. Sld3 binds specifically to DDK-phosphorylated peptides from two MCM subunits (Mcm4, 6) and then recruits Cdc45. MCM mutants that cannot bind Sld3 or Sld3 mutants that cannot bind phospho-MCM or Cdc45 do not support replication. Moreover, phosphomimicking mutants in Mcm4 and Mcm6 bind Sld3 without DDK and facilitate DDK-independent replication. Thus, Sld3 is an essential "reader" of DDK phosphorylation, integrating signals from three distinct protein kinase pathways to coordinate DNA replication during S phase. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  1. Characterization of the Upper Pathway Genes for Fluorene Metabolism in Terrabacter sp. Strain DBF63

    PubMed Central

    Habe, Hiroshi; Chung, Jin-Sung; Kato, Hiroyuki; Ayabe, Yuko; Kasuga, Kano; Yoshida, Takako; Nojiri, Hideaki; Yamane, Hisakazu; Omori, Toshio

    2004-01-01

    Genes involved in the degradation of fluorene to phthalate were characterized in the fluorene degrader Terrabacter sp. strain DBF63. The initial attack on both fluorene and 9-fluorenone was catalyzed by DbfA to yield 9-fluorenol and 1,1a-dihydroxy-1-hydro-9-fluorenone, respectively. The FlnB protein exhibited activities against both 9-fluorenol and 1,1a-dihydroxy-1-hydro-9-fluorenone to produce 9-fluorenone and 2′-carboxy-2,3-dihydroxybiphenyl, respectively. FlnD is a heteromeric protein encoded by flnD1 and ORF16, being a member of the class III two-subunit extradiol dioxygenase. FlnE was identified as a serine hydrolase for the meta-cleavage products that yield phthalate. PMID:15317800

  2. Repeat-Associated Fission Yeast-Like Regional Centromeres in the Ascomycetous Budding Yeast Candida tropicalis

    PubMed Central

    Chatterjee, Gautam; Sankaranarayanan, Sundar Ram; Guin, Krishnendu; Thattikota, Yogitha; Padmanabhan, Sreedevi; Siddharthan, Rahul; Sanyal, Kaustuv

    2016-01-01

    The centromere, on which kinetochore proteins assemble, ensures precise chromosome segregation. Centromeres are largely specified by the histone H3 variant CENP-A (also known as Cse4 in yeasts). Structurally, centromere DNA sequences are highly diverse in nature. However, the evolutionary consequence of these structural diversities on de novo CENP-A chromatin formation remains elusive. Here, we report the identification of centromeres, as the binding sites of four evolutionarily conserved kinetochore proteins, in the human pathogenic budding yeast Candida tropicalis. Each of the seven centromeres comprises a 2 to 5 kb non-repetitive mid core flanked by 2 to 5 kb inverted repeats. The repeat-associated centromeres of C. tropicalis all share a high degree of sequence conservation with each other and are strikingly diverged from the unique and mostly non-repetitive centromeres of related Candida species—Candida albicans, Candida dubliniensis, and Candida lusitaniae. Using a plasmid-based assay, we further demonstrate that pericentric inverted repeats and the underlying DNA sequence provide a structural determinant in CENP-A recruitment in C. tropicalis, as opposed to epigenetically regulated CENP-A loading at centromeres in C. albicans. Thus, the centromere structure and its influence on de novo CENP-A recruitment has been significantly rewired in closely related Candida species. Strikingly, the centromere structural properties along with role of pericentric repeats in de novo CENP-A loading in C. tropicalis are more reminiscent to those of the distantly related fission yeast Schizosaccharomyces pombe. Taken together, we demonstrate, for the first time, fission yeast-like repeat-associated centromeres in an ascomycetous budding yeast. PMID:26845548

  3. Single nucleotide polymorphisms of PAD1 and FDC1 show a positive relationship with ferulic acid decarboxylation ability among industrial yeasts used in alcoholic beverage production.

    PubMed

    Mukai, Nobuhiko; Masaki, Kazuo; Fujii, Tsutomu; Iefuji, Haruyuki

    2014-07-01

    Among industrial yeasts used for alcoholic beverage production, most wine and weizen beer yeasts decarboxylate ferulic acid to 4-vinylguaiacol, which has a smoke-like flavor, whereas sake, shochu, top-fermenting, and bottom-fermenting yeast strains lack this ability. However, the factors underlying this difference among industrial yeasts are not clear. We previously confirmed that both PAD1 (phenylacrylic acid decarboxylase gene, YDR538W) and FDC1 (ferulic acid decarboxylase gene, YDR539W) are essential for the decarboxylation of phenylacrylic acids in Saccharomyces cerevisiae. In the present study, single nucleotide polymorphisms (SNPs) of PAD1 and FDC1 in sake, shochu, wine, weizen, top-fermenting, bottom-fermenting, and laboratory yeast strains were examined to clarify the differences in ferulic acid decarboxylation ability between these types of yeast. For PAD1, a nonsense mutation was observed in the gene sequence of standard top-fermenting yeast. Gene sequence analysis of FDC1 revealed that sake, shochu, and standard top-fermenting yeasts contained a nonsense mutation, whereas a frameshift mutation was identified in the FDC1 gene of bottom-fermenting yeast. No nonsense or frameshift mutations were detected in laboratory, wine, or weizen beer yeast strains. When FDC1 was introduced into sake and shochu yeast strains, the transformants exhibited ferulic acid decarboxylation activity. Our findings indicate that a positive relationship exists between SNPs in PAD1 and FDC1 genes and the ferulic acid decarboxylation ability of industrial yeast strains. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Mutation of the Ser18 phosphorylation site on the sole Saccharomyces cerevisiae UCS protein, She4, can compromise high-temperature survival.

    PubMed

    Gomez-Escalante, Susana; Piper, Peter W; Millson, Stefan H

    2017-01-01

    Folding of the myosin head often requires the joint actions of Hsp90 and a dedicated UNC45, Cro1, She4 (UCS) domain-containing cochaperone protein. Relatively weak sequence conservation exists between the single UCS protein of simple eukaryotes (She4 in budding yeast) and the two UCS proteins of higher organisms (the general cell and smooth muscle UNC45s; UNC45-GC and UNC45-SM respectively). In vertebrates, UNC45-GC facilitates cytoskeletal function whereas the 55% identical UNC45-SM assists in the assembly of the contractile apparatus of cardiac and skeletal muscles. UNC45-SM, unlike UNC45-GC, shares with yeast She4 an IDSL sequence motif known to be a site of in vivo serine phosphorylation in yeast. Investigating this further, we found that both a non-phosphorylatable (S18A) and a phosphomimetic (S18E) mutant form of She4 could rescue the type 1 myosin localisation and endocytosis defects of the yeast she4Δ mutant at 39 °C. Nevertheless, at higher temperature (45 °C), only She4 (S18A), not She4(S18E), could substantially rescue the cell lysis defect of she4Δ mutant cells. In the yeast two-hybrid system, the non-phosphorylatable S18A and S251A mutant forms of She4 and UNC45-SM still displayed the stress-enhanced in vivo interaction with Hsp90 seen with the wild-type She4 and UNC45-SM. Such high-temperature enforcement to interaction was though lost with the phosphomimetic mutant forms (She4(S18E) and UNC45-SM (S251E)), an indication that phosphorylation might suppress these increases in She4/Hsp90 and UNC45-SM/Hsp90 interaction with stress.

  5. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    NASA Astrophysics Data System (ADS)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  6. Candida potacharoeniae sp. nov. and Candida spenceri sp. nov., two novel galactose-containing ascomycetous anamorphic yeast species isolated in Thailand.

    PubMed

    Nakase, Takashi; Jindamorakot, Sasitorn; Imanishi, Yumi; Am-In, Somjit; Ninomiya, Shinya; Kawasaki, Hiroko; Limtong, Savitree

    2010-08-01

    Fifteen strains of anamorphic yeasts isolated from various natural substrates collected in various places in Thailand were found to represent two novel species of anamorphic yeast genus Candida based on the sequence analysis of the D1/D2 domain of the large subunit rRNA genes, chemotaxonomic and conventional properties used for the classification of yeasts. These strains are located in the clade including Candida etchellsii and Candida magnoliae. Fourteen strains represented by ST-490(T) (BCC 15176(T)=NBRC 106439(T)= CBS 11674(T)) are closely related to Candida sorbosivorans in the D1/D2 sequences but 11 nucleotides (2.4%) were substituted. The remaining strain, ST-594(T) (=BCC 15278(T)=NBRC 106446(T)=CBS 11673(T)) showed a close relationship to Candida geochares but 21 nucleotides (4.7%) were substituted. Apparently, these strains represent two novel Candida species of the Starmerella clade. The two species are described as Candida potacharoeniae sp. nov. and Candida spenceri sp. nov. in the present paper. Like the most species of this clade, the two species contain galactose in the cells in addition to glucose and mannose and have high mol% G + C of 54.4-55.9 and 54.9, respectively.

  7. Ultra-low background DNA cloning system.

    PubMed

    Goto, Kenta; Nagano, Yukio

    2013-01-01

    Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

  8. Diversity and killer activity of yeasts in Malaysian fermented food samples.

    PubMed

    Lim, S L; Tay, S T

    2011-08-01

    The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.

  9. Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

    PubMed

    Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

    1996-02-01

    A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

  10. Conserved mechanism for coordinating replication fork helicase assembly with phosphorylation of the helicase

    PubMed Central

    Bruck, Irina; Kaplan, Daniel L.

    2015-01-01

    Dbf4-dependent kinase (DDK) phosphorylates minichromosome maintenance 2 (Mcm2) during S phase in yeast, and Sld3 recruits cell division cycle 45 (Cdc45) to minichromosome maintenance 2-7 (Mcm2-7). We show here DDK-phosphoryled Mcm2 preferentially interacts with Cdc45 in vivo, and that Sld3 stimulates DDK phosphorylation of Mcm2 by 11-fold. We identified a mutation of the replication initiation factor Sld3, Sld3-m16, that is specifically defective in stimulating DDK phosphorylation of Mcm2. Wild-type expression levels of sld3-m16 result in severe growth and DNA replication defects. Cells expressing sld3-m16 exhibit no detectable Mcm2 phosphorylation in vivo, reduced replication protein A-ChIP signal at an origin, and diminished Go, Ichi, Ni, and San association with Mcm2-7. Treslin, the human homolog of Sld3, stimulates human DDK phosphorylation of human Mcm2 by 15-fold. DDK phosphorylation of human Mcm2 decreases the affinity of Mcm5 for Mcm2, suggesting a potential mechanism for helicase ring opening. These data suggest a conserved mechanism for replication initiation: Sld3/Treslin coordinates Cdc45 recruitment to Mcm2-7 with DDK phosphorylation of Mcm2 during S phase. PMID:26305950

  11. Conserved mechanism for coordinating replication fork helicase assembly with phosphorylation of the helicase.

    PubMed

    Bruck, Irina; Kaplan, Daniel L

    2015-09-08

    Dbf4-dependent kinase (DDK) phosphorylates minichromosome maintenance 2 (Mcm2) during S phase in yeast, and Sld3 recruits cell division cycle 45 (Cdc45) to minichromosome maintenance 2-7 (Mcm2-7). We show here DDK-phosphoryled Mcm2 preferentially interacts with Cdc45 in vivo, and that Sld3 stimulates DDK phosphorylation of Mcm2 by 11-fold. We identified a mutation of the replication initiation factor Sld3, Sld3-m16, that is specifically defective in stimulating DDK phosphorylation of Mcm2. Wild-type expression levels of sld3-m16 result in severe growth and DNA replication defects. Cells expressing sld3-m16 exhibit no detectable Mcm2 phosphorylation in vivo, reduced replication protein A-ChIP signal at an origin, and diminished Go, Ichi, Ni, and San association with Mcm2-7. Treslin, the human homolog of Sld3, stimulates human DDK phosphorylation of human Mcm2 by 15-fold. DDK phosphorylation of human Mcm2 decreases the affinity of Mcm5 for Mcm2, suggesting a potential mechanism for helicase ring opening. These data suggest a conserved mechanism for replication initiation: Sld3/Treslin coordinates Cdc45 recruitment to Mcm2-7 with DDK phosphorylation of Mcm2 during S phase.

  12. Interannual influence of spring phenological transitions on the water use efficiency of forest ecosystem

    NASA Astrophysics Data System (ADS)

    Jin, Jiaxin; Wang, Ying

    2017-04-01

    Climate change has significantly influenced the productivity of terrestrial ecosystems through water cycles. Understanding the phenological regulation mechanisms underlying coupled carbon-water cycles is important for improving ecological assessments and projecting terrestrial ecosystem responses and feedback to climate change. In this study, we present an analysis of the interannual relationships among flux-based spring phenological transitions (referred as photosynthetic onset) and water use efficiency (WUE) in North America and Europe using 166 site-years of data from 22 flux sites, including 10 deciduous broadleaf forest (DBF) and 12 evergreen needleleaf forest (ENF) ecosystems. We found that the WUE responses to variations in spring phenological transitions differed substantially across plant functional types (PFTs) and growth periods. During the early spring (defined as one month from spring onset) in the DBF ecosystem, photosynthetic onset dominated changes in WUE by dominating gross primary production (GPP), with one day of advanced onset increasing the WUE by 0.037 gC kg-1H2O in early spring. For the ENF sites, although advanced photosynthetic onset also significantly promoted GPP, earlier onset did not have a significant positive impact on WUE in early spring because it was not significantly correlated to evapotranspiration (ET), which is a more dominant factor for WUE than GPP across the ENF sites. Statistically significant correlations were not observed between interannual variability in photosynthetic onset and WUE for either the DBF or ENF ecosystems following a prolonged period after photosynthetic onset. For the DBF sites, the interannual variability of photosynthetic onset provided a better explanation of the variations in WUE (ca. 51.4%) compared with climatic factors, although this was only applicable to the early spring. For the ENF sites, photosynthetic onset variations did not provide a better explanation of the interannual WUE variations compared with climatic factors within any growth period. Notably, the negative correlation between the interannual variability of early spring WUE and photosynthetic onset gradually declined from boreal forests (r = -0.73) to subtropical Mediterranean forests (r = 0.35), indicating that the positive effect of earlier spring phenological transitions decreased or even reversed from cold climates to warm climates. This result suggests that the effect of the phenological regulatory mechanism on coupled carbon-water cycles is not only determined by the PFT but also by the habitat climate of an ecosystem. These observed differences between the ENF and DBF ecosystems will likely influence future phenological shifts related to competition for water and other resources in mixed species stands.

  13. MIPS: a database for protein sequences, homology data and yeast genome information.

    PubMed Central

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  14. Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme.

    PubMed Central

    Motorin, Y; Grosjean, H

    1999-01-01

    Several genes encoding putative RNA:5-methylcytidine-transferases (m5C-transferases) from different organisms, including yeast, have been identified by sequence homology with the recently identified 16S rRNA:m5C967-methyltransferase (gene SUN) from Escherichia coli. One of the yeast ORFs (YBL024w) was amplified by PCR, inserted in the expression vector pET28b, and the corresponding protein was hyperexpressed in E. coli BL21 (DE3). The resulting N-terminally His6-tagged recombinant Ybl024p was purified to apparent homogeneity by one-step affinity chromatography on Ni2+-NTA-agarose column. The activity and substrate specificity of the purified Ybl024p were tested in vitro using T7 transcripts of different yeast tRNAs as substrates and S-adenosyl-L-methionine as a donor of the methyl groups. The results indicate that yeast ORF YBL024w encodes S-adenosyl-L-methionine-dependent tRNA: m5C-methyltransferase that is capable of methylating cytosine to m5C at several positions in different yeast tRNAs and pre-tRNAs containing intron. Modification of tRNA occurs at all four positions (34, 40, 48, and 49) at which m5C has been found in yeast tRNAs sequenced so far. Disruption of the ORF YBL024w leads to the complete absence of m5C in total yeast tRNA. Moreover no tRNA:m5C-methyltransferase activity towards all potential m5C methylation sites was detected in the extract of the disrupted yeast strain. These results demonstrate that the protein product of a single gene is responsible for complete m5C methylation of yeast tRNA. Because this newly characterized multisite-specific modification enzyme Ybl024p is the fourth tRNA-specific methyltransferase identified in yeast, we suggest designating it as TRM4, the gene corresponding to ORF YBL024w. PMID:10445884

  15. [Extraction of temperate vegetation phenology thresholds in North America based on flux tower observation data].

    PubMed

    Zhao, Jing-Jing; Liu, Liang-Yun

    2013-02-01

    Flux tower method can effectively monitor the vegetation seasonal and phenological variation processes. At present, the differences in the detection and quantitative evaluation of various phenology extraction methods were not well validated and quantified. Based on the gross primary productivity (GPP) and net ecosystem productivity (NEP) data of temperate forests from 9 forest FLUXNET sites in North America, and by using the start dates (SOS) and end dates (EOS) of the temperate forest growth seasons extracted by different phenology threshold extraction methods, in combining with the forest ecosystem carbon source/sink functions, this paper analyzed the effects of different threshold standards on the extraction results of the vegetations phenology. The results showed that the effects of different threshold standards on the stability of the extracted results of deciduous broadleaved forest (DBF) phenology were smaller than those on the stability of the extracted results of evergreen needleleaved forest (ENF) phenology. Among the extracted absolute and relative thresholds of the forests GPP, the extracted threshold of the DBF daily GPP= 2 g C.m-2.d-1 had the best agreement with the DBF daily GPP = 20% maximum GPP (GPPmax) , the phenological metrics with a threshold of daily GPP = 4 g C.m-2.d-1 was close to that between daily GPP = 20% GPPmax and daily GPP = 50% GPPmax, and the start date of ecosystem carbon sink function was close to the SOS metrics between daily GPP = 4 g C.m-2.d-1 and daily GPP= 20% GPPmax. For ENF, the phenological metrics with a threshold of daily GPP = 2 g C.m-2.d-1 and daily GPP = 4 g C.m-2.d-1 had the best agreement with the daily GPP = 20% GPPmax and daily GPP = 50% GPPmax, respectively, and the start date of the ecosystem carbon sink function was close to the SOS metrics between daily GPP = 2 g C.m-2.d-1 and daily GPP= 10% GPPmax.

  16. Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

    PubMed Central

    Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

    2007-01-01

    Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

  17. Gleaning evolutionary insights from the genome sequence of a probiotic yeast Saccharomyces boulardii

    PubMed Central

    2013-01-01

    Background The yeast Saccharomyces boulardii is used worldwide as a probiotic to alleviate the effects of several gastrointestinal diseases and control antibiotics-associated diarrhea. While many studies report the probiotic effects of S. boulardii, no genome information for this yeast is currently available in the public domain. Results We report the 11.4 Mbp draft genome of this probiotic yeast. The draft genome was obtained by assembling Roche 454 FLX + shotgun data into 194 contigs with an N50 of 251 Kbp. We compare our draft genome with all other Saccharomyces cerevisiae genomes. Conclusions Our analysis confirms the close similarity of S. boulardii to S. cerevisiae strains and provides a framework to understand the probiotic effects of this yeast, which exhibits unique physiological and metabolic properties. PMID:24148866

  18. Gleaning evolutionary insights from the genome sequence of a probiotic yeast Saccharomyces boulardii.

    PubMed

    Khatri, Indu; Akhtar, Akil; Kaur, Kamaldeep; Tomar, Rajul; Prasad, Gandham Satyanarayana; Ramya, Thirumalai Nallan Chakravarthy; Subramanian, Srikrishna

    2013-10-22

    The yeast Saccharomyces boulardii is used worldwide as a probiotic to alleviate the effects of several gastrointestinal diseases and control antibiotics-associated diarrhea. While many studies report the probiotic effects of S. boulardii, no genome information for this yeast is currently available in the public domain. We report the 11.4 Mbp draft genome of this probiotic yeast. The draft genome was obtained by assembling Roche 454 FLX + shotgun data into 194 contigs with an N50 of 251 Kbp. We compare our draft genome with all other Saccharomyces cerevisiae genomes. Our analysis confirms the close similarity of S. boulardii to S. cerevisiae strains and provides a framework to understand the probiotic effects of this yeast, which exhibits unique physiological and metabolic properties.

  19. Barcode Identifiers as a Practical Tool for Reliable Species Assignment of Medically Important Black Yeast Species

    PubMed Central

    Heinrichs, Guido; de Hoog, G. Sybren

    2012-01-01

    Herpotrichiellaceous black yeasts and relatives comprise severe pathogens flanked by nonpathogenic environmental siblings. Reliable identification by conventional methods is notoriously difficult. Molecular identification is hampered by the sequence variability in the internal transcribed spacer (ITS) domain caused by difficult-to-sequence homopolymeric regions and by poor taxonomic attribution of sequences deposited in GenBank. Here, we present a potential solution using short barcode identifiers (27 to 50 bp) based on ITS2 ribosomal DNA (rDNA), which allows unambiguous definition of species-specific fragments. Starting from proven sequences of ex-type and authentic strains, we were able to describe 103 identifiers. Multiple BLAST searches of these proposed barcode identifiers in GenBank revealed uniqueness for 100 taxonomic entities, whereas the three remaining identifiers each matched with two entities, but the species of these identifiers could easily be discriminated by differences in the remaining ITS regions. Using the proposed barcode identifiers, a 4.1-fold increase of 100% matches in GenBank was achieved in comparison to the classical approach using the complete ITS sequences. The proposed barcode identifiers will be made accessible for the diagnostic laboratory in a permanently updated online database, thereby providing a highly practical, reliable, and cost-effective tool for identification of clinically important black yeasts and relatives. PMID:22785187

  20. Phosphorylation and cellular function of the human Rpa2 N-terminus in the budding yeast Saccharomyces cerevisiae.

    PubMed

    Ghospurkar, Padmaja L; Wilson, Timothy M; Liu, Shengqin; Herauf, Anna; Steffes, Jenna; Mueller, Erica N; Oakley, Gregory G; Haring, Stuart J

    2015-02-01

    Maintenance of genome integrity is critical for proper cell growth. This occurs through accurate DNA replication and repair of DNA lesions. A key factor involved in both DNA replication and the DNA damage response is the heterotrimeric single-stranded DNA (ssDNA) binding complex Replication Protein A (RPA). Although the RPA complex appears to be structurally conserved throughout eukaryotes, the primary amino acid sequence of each subunit can vary considerably. Examination of sequence differences along with the functional interchangeability of orthologous RPA subunits or regions could provide insight into important regions and their functions. This might also allow for study in simpler systems. We determined that substitution of yeast Replication Factor A (RFA) with human RPA does not support yeast cell viability. Exchange of a single yeast RFA subunit with the corresponding human RPA subunit does not function due to lack of inter-species subunit interactions. Substitution of yeast Rfa2 with domains/regions of human Rpa2 important for Rpa2 function (i.e., the N-terminus and the loop 3-4 region) supports viability in yeast cells, and hybrid proteins containing human Rpa2 N-terminal phospho-mutations result in similar DNA damage phenotypes to analogous yeast Rfa2 N-terminal phospho-mutants. Finally, the human Rpa2 N-terminus (NT) fused to yeast Rfa2 is phosphorylated in a manner similar to human Rpa2 in human cells, indicating that conserved kinases recognize the human domain in yeast. The implication is that budding yeast represents a potential model system for studying not only human Rpa2 N-terminal phosphorylation, but also phosphorylation of Rpa2 N-termini from other eukaryotic organisms. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Multiple α-Glucoside Transporter Genes in Brewer’s Yeast

    PubMed Central

    Jespersen, Lene; Cesar, Lene B.; Meaden, Philip G.; Jakobsen, Mogens

    1999-01-01

    Maltose and maltotriose are the two most abundant fermentable sugars in brewer’s wort, and the rate of uptake of these sugars by brewer’s yeast can have a major impact on fermentation performance. In spite of this, no information is currently available on the genetics of maltose and maltotriose uptake in brewing strains of yeast. In this work, we studied 30 brewing strains of yeast (5 ale strains and 25 lager strains) with the aim of examining the alleles of maltose and maltotriose transporter genes contained by them. To do this, we hybridized gene probes to chromosome blots. Studies performed with laboratory strains have shown that maltose utilization is conferred by any one of five unlinked but highly homologous MAL loci (MAL1 to MAL4 and MAL6). Gene 1 at each locus encodes a maltose transporter. All of the strains of brewer’s yeast examined except two were found to contain MAL11 and MAL31 sequences, and only one of these strains lacked MAL41. MAL21 was not present in the five ale strains and 12 of the lager strains. MAL61 was not found in any of the yeast strains. In three of the lager strains, there was evidence that MAL transporter gene sequences occurred on chromosomes other than those known to carry MAL loci. Sequences corresponding to the AGT1 gene, which encodes a transporter of several α-glucosides, including maltose and maltotriose, were detected in all but one of the yeast strains. Homologues of AGT1 were identified in three of the lager strains, and two of these homologues were mapped, one to chromosome II and the other to chromosome XI. AGT1 appears to be a member of a family of closely related genes, which may have arisen in brewer’s yeast in response to selective pressure. PMID:9925567

  2. Vicilin-like peptides from Capsicum baccatum L. seeds are α-amylase inhibitors and exhibit antifungal activity against important yeasts in medical mycology.

    PubMed

    Vieira Bard, Gabriela C; Nascimento, Viviane V; Oliveira, Antônia Elenir A; Rodrigues, Rosana; Da Cunha, Maura; Dias, Germana B; Vasconcelos, Ilka M; Carvalho, Andre O; Gomes, Valdirene M

    2014-07-01

    The objective of this study was to isolate antimicrobial peptides from Capsicum baccatum seeds and evaluate their antimicrobial activity and inhibitory effects against α-amylase. Initially, proteins from the flour of C. baccatum seeds were extracted in sodium phosphate buffer, pH 5.4, and precipitated with ammonium sulfate at 90% saturation. The D1 and D2 fractions were subjected to antifungal tests against the yeasts Saccharomyces cerevisiae, Candida albicans, Candida tropicalis, and Kluyveromyces marxiannus, and tested against α-amylases from Callosobruchus maculates and human saliva. The D2 fraction presented higher antimicrobial activity and was subjected to further purification and seven new different fractions (H1-H7) were obtained. Peptides in the H4 fraction were sequenced and the N-terminal sequences revealed homology with previously reported storage vicilins from seeds. The H4 fraction exhibited strong antifungal activity and also promoted morphological changes in yeast, including pseudohyphae formation. All fractions, including H4, inhibited mammalian α-amylase activity but only the H4 fraction was able to inhibit C. maculatus α-amylase activity. These results suggest that the fractions isolated from the seeds of C. baccatum can act directly in plant defenses against pathogens and insects. © 2014 Wiley Periodicals, Inc.

  3. G-rich telomeric and ribosomal DNA sequences from the fission yeast genome form stable G-quadruplex DNA structures in vitro and are unwound by the Pfh1 DNA helicase

    PubMed Central

    Wallgren, Marcus; Mohammad, Jani B.; Yan, Kok-Phen; Pourbozorgi-Langroudi, Parham; Ebrahimi, Mahsa; Sabouri, Nasim

    2016-01-01

    Certain guanine-rich sequences have an inherent propensity to form G-quadruplex (G4) structures. G4 structures are e.g. involved in telomere protection and gene regulation. However, they also constitute obstacles during replication if they remain unresolved. To overcome these threats to genome integrity, organisms harbor specialized G4 unwinding helicases. In Schizosaccharomyces pombe, one such candidate helicase is Pfh1, an evolutionarily conserved Pif1 homolog. Here, we addressed whether putative G4 sequences in S. pombe can adopt G4 structures and, if so, whether Pfh1 can resolve them. We tested two G4 sequences, derived from S. pombe ribosomal and telomeric DNA regions, and demonstrated that they form inter- and intramolecular G4 structures, respectively. Also, Pfh1 was enriched in vivo at the ribosomal G4 DNA and telomeric sites. The nuclear isoform of Pfh1 (nPfh1) unwound both types of structure, and although the G4-stabilizing compound Phen-DC3 significantly enhanced their stability, nPfh1 still resolved them efficiently. However, stable G4 structures significantly inhibited adenosine triphosphate hydrolysis by nPfh1. Because ribosomal and telomeric DNA contain putative G4 regions conserved from yeasts to humans, our studies support the important role of G4 structure formation in these regions and provide further evidence for a conserved role for Pif1 helicases in resolving G4 structures. PMID:27185885

  4. The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now

    PubMed Central

    Engel, Stacia R.; Dietrich, Fred S.; Fisk, Dianna G.; Binkley, Gail; Balakrishnan, Rama; Costanzo, Maria C.; Dwight, Selina S.; Hitz, Benjamin C.; Karra, Kalpana; Nash, Robert S.; Weng, Shuai; Wong, Edith D.; Lloyd, Paul; Skrzypek, Marek S.; Miyasato, Stuart R.; Simison, Matt; Cherry, J. Michael

    2014-01-01

    The genome of the budding yeast Saccharomyces cerevisiae was the first completely sequenced from a eukaryote. It was released in 1996 as the work of a worldwide effort of hundreds of researchers. In the time since, the yeast genome has been intensively studied by geneticists, molecular biologists, and computational scientists all over the world. Maintenance and annotation of the genome sequence have long been provided by the Saccharomyces Genome Database, one of the original model organism databases. To deepen our understanding of the eukaryotic genome, the S. cerevisiae strain S288C reference genome sequence was updated recently in its first major update since 1996. The new version, called “S288C 2010,” was determined from a single yeast colony using modern sequencing technologies and serves as the anchor for further innovations in yeast genomic science. PMID:24374639

  5. Candida neustonensis sp. nov., a novel ascomycetous yeast isolated from the sea surface microlayer in Taiwan.

    PubMed

    Chang, Chin-Feng; Lee, Ching-Fu; Liu, Shiu-Mei

    2010-01-01

    A new ascomycetous yeast species, Candida neustonensis is proposed in this study based on four strains (SN92(T), SN47, SJ22, SJ25) isolated from sea surface microlayer in Taiwan. These four yeast strains were morphologically, physiologically and phylogenetically identical to each other. No sexual reproduction was observed on 5% malt extract agar, corn meal agar, V8 agar, McClary's acetate agar and potato-dextrose agar. Phylogenetic analysis of the sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene places C. neustonensis as a member of the Pichia guilliermondii clade, it also reveals that the phylogenetically closest relatives of C. neustonensis are C. fukuyamaensis (4.4% divergence), C. xestobii (4.4% divergence) and P. guilliermondii (4.5% divergence). C. neustonensis also is clearly distinguished from other known species in the P. guilliermondii clade based on the results of physiology tests. From these comparison analyses, the following novel yeast species is proposed: Candida neustonensis sp. nov., with strain SN92(T) (= BCRC 23108(T) = JCM 14892(T) = CBS 11061(T)) as the type strain.

  6. Properties of the intracellular transient receptor potential (TRP) channel in yeast, Yvc1.

    PubMed

    Chang, Yiming; Schlenstedt, Gabriel; Flockerzi, Veit; Beck, Andreas

    2010-05-17

    Transient receptor potential (TRP) channels are found among mammals, flies, worms, ciliates, Chlamydomonas, and yeast but are absent in plants. These channels are believed to be tetramers of proteins containing six transmembrane domains (TMs). Their primary structures are diverse with sequence similarities only in some short amino acid sequence motifs mainly within sequences covering TM5, TM6, and adjacent domains. In the yeast genome, there is one gene encoding a TRP-like sequence. This protein forms an ion channel in the vacuolar membrane and is therefore called Yvc1 for yeast vacuolar conductance 1. In the following we summarize its prominent features. Copyright 2009 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  7. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  8. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    PubMed

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  9. External Validity of a Risk Stratification Score Predicting Early Distant Brain Failure and Salvage Whole Brain Radiation Therapy After Stereotactic Radiosurgery for Brain Metastases.

    PubMed

    Press, Robert H; Boselli, Danielle M; Symanowski, James T; Lankford, Scott P; McCammon, Robert J; Moeller, Benjamin J; Heinzerling, John H; Fasola, Carolina E; Burri, Stuart H; Patel, Kirtesh R; Asher, Anthony L; Sumrall, Ashley L; Curran, Walter J; Shu, Hui-Kuo G; Crocker, Ian R; Prabhu, Roshan S

    2017-07-01

    A scoring system using pretreatment factors was recently published for predicting the risk of early (≤6 months) distant brain failure (DBF) and salvage whole brain radiation therapy (WBRT) after stereotactic radiosurgery (SRS) alone. Four risk factors were identified: (1) lack of prior WBRT; (2) melanoma or breast histologic features; (3) multiple brain metastases; and (4) total volume of brain metastases <1.3 cm 3 , with each factor assigned 1 point. The purpose of this study was to assess the validity of this scoring system and its appropriateness for clinical use in an independent external patient population. We reviewed the records of 247 patients with 388 brain metastases treated with SRS between 2010 at 2013 at Levine Cancer Institute. The Press (Emory) risk score was calculated and applied to the validation cohort population, and subsequent risk groups were analyzed using cumulative incidence. The low-risk (LR) group had a significantly lower risk of early DBF than did the high-risk (HR) group (22.6% vs 44%, P=.004), but there was no difference between the HR and intermediate-risk (IR) groups (41.2% vs 44%, P=.79). Total lesion volume <1.3 cm 3  (P=.004), malignant melanoma (P=.007), and multiple metastases (P<.001) were validated as predictors for early DBF. Prior WBRT and breast cancer histologic features did not retain prognostic significance. Risk stratification for risk of early salvage WBRT were similar, with a trend toward an increased risk for HR compared with LR (P=.09) but no difference between IR and HR (P=.53). The 3-level Emory risk score was shown to not be externally valid, but the model was able to stratify between 2 levels (LR and not-LR [combined IR and HR]) for early (≤6 months) DBF. These results reinforce the importance of validating predictive models in independent cohorts. Further refinement of this scoring system with molecular information and in additional contemporary patient populations is warranted. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Recombinant yeast with improved ethanol tolerance and related methods of use

    DOEpatents

    Gasch, Audrey P [Madison, WI; Lewis, Jeffrey A [Madison, WI

    2012-05-15

    The present invention provides isolated Elo1 and Mig3 nucleic acid sequences capable of conferring increased ethanol tolerance on recombinant yeast and methods of using same in biofuel production, particularly ethanol production. Methods of bioengineering yeast using the Elo1 and, or, Mig3 nucleic acid sequences are also provided.

  11. A purified truncated form of yeast Gal4 expressed in Escherichia coli and used to functionalize poly(lactic acid) nanoparticle surface is transcriptionally active in cellulo.

    PubMed

    Legaz, Sophie; Exposito, Jean-Yves; Borel, Agnès; Candusso, Marie-Pierre; Megy, Simon; Montserret, Roland; Lahaye, Vincent; Terzian, Christophe; Verrier, Bernard

    2015-09-01

    Gal4/UAS system is a powerful tool for the analysis of numerous biological processes. Gal4 is a large yeast transcription factor that activates genes including UAS sequences in their promoter. Here, we have synthesized a minimal form of Gal4 DNA sequence coding for the binding and dimerization regions, but also part of the transcriptional activation domain. This truncated Gal4 protein was expressed as inclusion bodies in Escherichia coli. A structured and active form of this recombinant protein was purified and used to cover poly(lactic acid) (PLA) nanoparticles. In cellulo, these Gal4-vehicles were able to activate the expression of a Green Fluorescent Protein (GFP) gene under the control of UAS sequences, demonstrating that the decorated Gal4 variant can be delivery into cells where it still retains its transcription factor capacities. Thus, we have produced in E. coli and purified a short active form of Gal4 that retains its functions at the surface of PLA-nanoparticles in cellular assay. These decorated Gal4-nanoparticles will be useful to decipher their tissue distribution and their potential after ingestion or injection in UAS-GFP recombinant animal models. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Synthetic genome engineering forging new frontiers for wine yeast.

    PubMed

    Pretorius, Isak S

    2017-02-01

    Over the past 15 years, the seismic shifts caused by the convergence of biomolecular, chemical, physical, mathematical, and computational sciences alongside cutting-edge developments in information technology and engineering have erupted into a new field of scientific endeavor dubbed Synthetic Biology. Recent rapid advances in high-throughput DNA sequencing and DNA synthesis techniques are enabling the design and construction of new biological parts (genes), devices (gene networks) and modules (biosynthetic pathways), and the redesign of biological systems (cells and organisms) for useful purposes. In 2014, the budding yeast Saccharomyces cerevisiae became the first eukaryotic cell to be equipped with a fully functional synthetic chromosome. This was achieved following the synthesis of the first viral (poliovirus in 2002 and bacteriophage Phi-X174 in 2003) and bacterial (Mycoplasma genitalium in 2008 and Mycoplasma mycoides in 2010) genomes, and less than two decades after revealing the full genome sequence of a laboratory (S288c in 1996) and wine (AWRI1631 in 2008) yeast strain. A large international project - the Synthetic Yeast Genome (Sc2.0) Project - is now underway to synthesize all 16 chromosomes (∼12 Mb carrying ∼6000 genes) of the sequenced S288c laboratory strain by 2018. If successful, S. cerevisiae will become the first eukaryote to cross the horizon of in silico design of complex cells through de novo synthesis, reshuffling, and editing of genomes. In the meantime, yeasts are being used as cell factories for the semi-synthetic production of high-value compounds, such as the potent antimalarial artemisinin, and food ingredients, such as resveratrol, vanillin, stevia, nootkatone, and saffron. As a continuum of previously genetically engineered industrially important yeast strains, precision genome engineering is bound to also impact the study and development of wine yeast strains supercharged with synthetic DNA. The first taste of what the future holds is the de novo production of the raspberry ketone aroma compound, 4-[4-hydroxyphenyl]butan-2-one, in a wine yeast strain (AWRI1631), which was recently achieved via metabolic pathway engineering and synthetic enzyme fusion. A peek over the horizon is revealing that the future of "Wine Yeast 2.0" is already here. Therefore, this article seeks to help prepare the wine industry - an industry rich in history and tradition on the one hand, and innovation on the other - for the inevitable intersection of the ancient art practiced by winemakers and the inventive science of pioneering "synthetic genomicists". It would be prudent to proactively engage all stakeholders - researchers, industry practitioners, policymakers, regulators, commentators, and consumers - in a meaningful dialog about the potential challenges and opportunities emanating from Synthetic Biology. To capitalize on the new vistas of synthetic yeast genomics, this paper presents wine yeast research in a fresh context, raises important questions and proposes new directions.

  13. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  14. Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

    PubMed Central

    Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

    2000-01-01

    Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

  15. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    PubMed

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of misidentified isolates. In conclusion, the 18S-ITS1-5.8S region appears to be useful in detecting genetic variability among yeast species, which is valuable for taxonomic purposes and for species identification. We have established an RFLP database for yeast species identified in milk samples using the software GelCompar II and the RFLP database constitutes an initial method for veterinary yeast identification. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Diversity of yeasts associated with the sea surface microlayer and underlying water along the northern coast of Taiwan.

    PubMed

    Chang, Chin-Feng; Lee, Ching-Fu; Lin, Kao-Yung; Liu, Shiu-Mei

    2016-01-01

    Yeast communities inhabiting the sea surface microlayer (SSML) on the northern coast of Taiwan were examined using a cultivation method and compared with those inhabiting the underlying water (UW) at a 50-cm depth. Culturable yeasts were recovered from the SSML and UW samples collected in the morning during 4 field campaigns, and 420 strains were isolated. The 420 isolates were grouped into 43 species using a polyphasic molecular approach, including sequence analysis of the 26S rDNA D1/D2 domain and 5.8S-ITS region. From the SSML samples, 12 genera and 39 species, including 7 new species of Cryptococcus sp. (1), Candida spp. (4), and Rhodotorula spp. (2), were isolated. From the UW samples, 10 genera and 21 species, including one new species of Rhodotorula sp. (1), were isolated. Rhodotorula mucilaginosa was the most abundant species present in the yeast community in SSML (37.6%) and UW (21.6%) samples. Basidiomycetous yeasts (63.6%) and pigmented yeasts (64.5%) comprised the major yeast population. The yeast community in the SSML had a higher species number and abundance than the UW. Moreover, although the majority of yeast community species were from the SSML, individual species distribution in the SSML was unequal. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  17. The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo.

    PubMed

    Ribeyre, Cyril; Lopes, Judith; Boulé, Jean-Baptiste; Piazza, Aurèle; Guédin, Aurore; Zakian, Virginia A; Mergny, Jean-Louis; Nicolas, Alain

    2009-05-01

    In budding yeast, the Pif1 DNA helicase is involved in the maintenance of both nuclear and mitochondrial genomes, but its role in these processes is still poorly understood. Here, we provide evidence for a new Pif1 function by demonstrating that its absence promotes genetic instability of alleles of the G-rich human minisatellite CEB1 inserted in the Saccharomyces cerevisiae genome, but not of other tandem repeats. Inactivation of other DNA helicases, including Sgs1, had no effect on CEB1 stability. In vitro, we show that CEB1 repeats formed stable G-quadruplex (G4) secondary structures and the Pif1 protein unwinds these structures more efficiently than regular B-DNA. Finally, synthetic CEB1 arrays in which we mutated the potential G4-forming sequences were no longer destabilized in pif1Delta cells. Hence, we conclude that CEB1 instability in pif1Delta cells depends on the potential to form G-quadruplex structures, suggesting that Pif1 could play a role in the metabolism of G4-forming sequences.

  18. Draft genome sequence of the D-Xylose-Fermenting yeast Spathaspora xylofermentans UFMG-HMD23.3

    USDA-ARS?s Scientific Manuscript database

    Here, we report the draft genome sequence of the yeast Spathaspora xylofermentans UFMG-HMD23.3 (CBMAI 1427=CBS 12681), a D-xylose fermenting yeast isolated from the Amazonian forest. The genome consists of 298 contigs, with a total size of 15.1 Mb, including the mitochondrial genome, and 5,948 predi...

  19. Draft Genome Sequence of the Yeast Starmerella bombicola NBRC10243, a Producer of Sophorolipids, Glycolipid Biosurfactants

    PubMed Central

    Matsuzawa, Tomohiko; Koike, Hideaki; Saika, Azusa; Fukuoka, Tokuma; Sato, Shun; Habe, Hiroshi; Kitamoto, Dai

    2015-01-01

    The yeast Starmerella bombicola NBRC10243 is an excellent producer of sophorolipids (SLs) from various feedstocks. Here, we report the draft genome sequence of S. bombicola NBRC10243. Analysis of the sequence may provide insight into the properties of this yeast that make it superior for use in the production of functional glycolipids and biomolecules, leading to the further development of S. bombicola NBRC10243 for industrial applications. PMID:25814600

  20. Synthesis of human parainfluenza virus 4 nucleocapsid-like particles in yeast and their use for detection of virus-specific antibodies in human serum.

    PubMed

    Bulavaitė, Aistė; Lasickienė, Rita; Tamošiūnas, Paulius Lukas; Simanavičius, Martynas; Sasnauskas, Kęstutis; Žvirblienė, Aurelija

    2017-04-01

    The aim of this study was to produce human parainfluenza virus type 4 (HPIV4) nucleocapsid (N) protein in yeast Saccharomyces cerevisiae expression system, to explore its structural and antigenic properties and to evaluate its applicability in serology. The use of an optimized gene encoding HPIV4 N protein amino acid (aa) sequence GenBank AGU90031.1 allowed high yield of recombinant N protein forming nucleocapsid-like particles (NLPs) in yeast. A substitution L332D disrupted self-assembly of NLPs, confirming the role of this position in the N proteins of Paramyxovirinae. Three monoclonal antibodies (MAbs) were generated against the NLP-forming HPIV4 N protein. They recognised HPIV4-infected cells, demonstrating the antigenic similarity between the recombinant and virus-derived N proteins. HPIV4 N protein was used as a coating antigen in an indirect IgG ELISA with serum specimens of 154 patients with respiratory tract infection. The same serum specimens were tested with previously generated N protein of a closely related HPIV2, another representative of genus Rubulavirus. Competitive ELISA was developed using related yeast-produced viral antigens to deplete the cross-reactive serum antibodies. In the ELISA either without or with competition using heterologous HPIV (2 or 4) N or mumps virus N proteins, the seroprevalence of HPIV4 N-specific IgG was, respectively, 46.8, 39.6 and 40.3% and the seroprevalence of HPIV2 N-specific IgG-47.4, 39.0 and 37.7%. In conclusion, yeast-produced HPIV4 N protein shares structural and antigenic properties of the native virus nucleocapsids. Yeast-produced HPIV4 and HPIV2 NLPs are prospective tools in serology.

  1. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    PubMed

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  2. Characterization of Alicyclobacillus disufldooxidans HIB4 Isolated from an Acid Mine Drainage Treatment Plant

    NASA Astrophysics Data System (ADS)

    Suto, Koichi; Joe, Seong Jin; Inoue, Chihiro; Chida, Tadashi

    2006-05-01

    A heterotrophic bacterium, designated as HIB4, having an ability to oxidize ferrous iron was isolated from the sample of an enrichment culture with 9K medium, by using the modified WAYE (washed agarose/yeast extract) medium with ferrous sulphate. This isolate was identified as Alicyclobacillus disulfidooxidans from 16S rDNA sequence analysis. The isolate grew and oxidized ferrous iron in an inorganic medium containing 0.02 % (w/v) of yeast extract and Ferrous iron oxidation occurred at the almost end of its logarithmic phase. Yeast extract was an essential substrate for the isolate because the isolate could not grow or oxidize ferrous iron without yeast extract. However, higher concentration of yeast extract inhibited the growth of the isolate. On the other hand, it was confirmed that the isolate was able to grow without ferrous ion so that it did not get any energy by ferrous ion oxidation. Its optimum concentration of yeast extract was 0.02% (w/v) at the concentration of ferrous ion 0.08mol/liter. Its optimum pH was 1.5 and the optimum temperature was 30 °C These physiological characteristics were completely different from A. disulfidooxidans SD-11 which is the type strain.

  3. Identification of food and beverage spoilage yeasts from DNA sequence analyses

    USDA-ARS?s Scientific Manuscript database

    Detection, identification, and classification of yeasts has undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of th...

  4. Candida xinjiangensis sp. nov., a new anamorphic yeast species isolated from Scolytus scheryrewi Semenov in China.

    PubMed

    Zhu, Xiao-Feng; Zhang, Dian-Peng; Yang, Sen; Zhang, Qing-Wen

    2017-03-01

    Three yeast strains designated as S44, XF1 and XF2, respectively, were isolated from Scolytus scheryrewi Semenov of apricot tree in Shule County, Xinjiang, China, and were demonstrated to be a new member of the genus Candida by sequence comparisons of 26S rRNA gene D1/D2 domain and internal transcribed spacer (ITS) region. BLASTn alignments on NCBI showed that the similarity of 26S rRNA gene sequences of S44 (type strain) to all sequences of other Candida yeasts was very low (≦93 %). The phylogenetic tree based on the 26S rRNA gene D1/D2 domain and ITS region sequences revealed that the strain S44 is closely related to C. blattae, C. dosseyi, C. pruni, C. asparagi, C. fructus and C. musae. However, the strain S44 is distinguished from these Candida species by the physiological characteristics. Moreover, the strain S44 formed typical pseudohyphae when grown on cornmeal agar at 25 °C for 7 days, but did not form ascospores in sporulation medium for 3-4 weeks. Therefore, the name Candida xinjiangensis is proposed for the novel species, with S44 (=KCTC T 27747) as the type strain.

  5. The role of spring and autumn phenological switches on spatiotemporal variation in temperate and boreal forest C balance: A FLUXNET synthesis

    NASA Astrophysics Data System (ADS)

    Richardson, A. D.; Reichstein, M.; Piao, S.; Ciais, P.; Luyssaert, S.; Stockli, R.; Friedl, M.; Gobron, N.; Fluxnet Site Pis, 21

    2009-04-01

    In temperate and boreal ecosystems, phenological transitions (particularly the timing of spring onset and autumn senescence) are thought to represent a major control on spatial and temporal variation in forest carbon sequestration. To investigate these patterns, we analyzed 153 site-years of data from the FLUXNET ‘La Thuile' database. Eddy covariance measurements of surface-atmosphere exchanges of carbon and water from 21 research sites at latitudes from 36°N to 67°N were used in the synthesis. We defined a range of phenological indicators based on the first (spring) and last (autumn) dates of (1) C source/sink transitions (‘carbon uptake period'); (2) measurable photosynthetic uptake (‘physiologically active period'); (3) relative thresholds for latent heat (evapotranspiration) flux; (4) phenological thresholds derived from a range of remote sensing products (JRC fAPAR, MOD12Q2, and the PROGNOSTIC model with MODIS data assimilation); and (5) a climatological metric based on the date where soil temperature equals mean annual air temperature. We then tested whether site-level flux anomalies were significantly correlated with phenological anomalies across these metrics, and whether the slopes of these relationships (representing the sensitivity to phenological variation) differed between deciduous broadleaf (DBF) and evergreen needleleaf (ENF) forests. Within sites, interannual variation in most phenological metrics was about 5-10 d, compared to 10-30 d across sites. Both spatial and temporal phenological variation were consistently larger at ENF, compared to DBF, sites. Averaged across metrics, phenological variability was roughly comparable in spring and autumn, both across (17 d) and within (9 d) sites. However, patterns of interannual variation in fluxes were less well explained by the derived phenological metrics than were patterns of spatial variation in fluxes. Also, the observed pattern strongly depended on the metric used, with flux-derived metrics generally explaining more, and remote sensing-derived metrics generally explaining less, of the variation in flux anomalies. We found that GPP (gross primary productivity) was consistently more sensitive (both in terms of magnitude and statistical significance; ≈3 g C m-2 d-1 for DBF and ≈2 g C m-2 d-1 for ENF) to phenology than was Reco (ecosystem respiration), which meant that NEP (net ecosystem productivity) tended to be increased both by earlier springs and later autumns. Without exception, when the difference between DBF and ENF in the sensitivity to phenological anomalies was statistically significant, DBF sensitivity was always larger in absolute magnitude than ENF sensitivity. Phenology explained a much larger fraction of the variation in fluxes across sites compared to within sites. Across sites, the rate of increase in GPP with an "exta" day in spring (≈10 g C m-2 d-1) was much larger than in autumn (≈3 g C m-2 d-1). Furthermore, a one-day increase in growing season length across sites increased annual NEP by just ≈2 g C m-2 d-1; this resulted from an increase in GPP of ≈6 g C m-2 d-1 being offset by an increase in RE of ≈4 g C m-2 d-1. In general, there was no statistically significant difference between DBF and ENF in the sensitivity to spatial variation in phenology for either NEP or the component fluxes GPP and Reco. In relation to both within- and across-site variation in phenology and fluxes, the results obtained tended to depend on the phenological metric used, i.e. definition of "start" and "end" of growing season, emphasizing the need for improved understanding of the relationships between these different metrics and ecosystem processes. Furthermore, the differences in flux-phenology relationships in the context of spatial and temporal variation in phenology raise questions about using results from either short-term or space-for-time studies to anticipate responses to future climate change.

  6. Two new anamorphic yeasts species, Cyberlindnera samutprakarnensis sp. nov. and Candida thasaenensis sp. nov., isolated from industrial wastes in Thailand.

    PubMed

    Poomtien, Jamroonsri; Jindamorakot, Sasitorn; Limtong, Savitree; Pinphanichakarn, Pairoh; Thaniyavarn, Jiraporn

    2013-01-01

    Three yeast strains were isolated from industrial wastes in Thailand. Based on the phylogenetic sequence analysis of the D1/D2 region of the large subunit rRNA gene, the internal transcribed spacer (ITS1-5.8S rRNA gene-ITS2; ITS1-2) region, and their physiological characteristics, the three strains were found to represent two novel species of the ascomycetous anamorphic yeast. Strain JP52(T) represent a novel species which was named Cyberlindnera samutprakarnensis sp. nov. (type strain JP52(T); = BCC 46825(T) = JCM 17816(T) = CBS 12528(T), MycoBank no. MB800879), which was differentiated from the closely related species Cyberlindnera mengyuniae CBS 10845(T) by 2.9 % sequence divergence in the D1/D2 region and 4.4 % sequence divergence in the ITS1-2. Strain JP59(T) and JP60 were identical in their D1/D2 and ITS1-2 regions, which were closely related to those of Scheffersomyces spartinae CBS 6059(T) by 0.9 and 1.0 % sequence divergence, respectively. In addition, supportive evidence of actin gene and translational elongation factor gene by sequence divergence of 6.5 % each confirmed their distinct status. Furthermore, JP59(T) and JP60 differentiated from the closely related species in some biochemical and physiological characteristics. These two strains were assigned as a single novel species which was named Candida thasaenensis sp. nov. (type JP59(T) = BCC 46828(T) = JCM 17817(T) = CBS 12529(T), MycoBank no. MB800880).

  7. A comparative study on the potential of epiphytic yeasts isolated from tropical fruits to produce flavoring compounds.

    PubMed

    Grondin, Eric; Shum Cheong Sing, Alain; Caro, Yanis; Raherimandimby, Marson; Randrianierenana, Ando Lalaniaina; James, Steve; Nueno-Palop, Carmen; François, Jean Marie; Petit, Thomas

    2015-06-16

    In recent years, there has been an increasing interest in identifying and characterizing the yeast flora associated with diverse types of habitat because of the many potential desirable technological properties of these microorganisms, especially in food applications. In this study, a total of 101 yeast strains were isolated from the skins of tropical fruits collected in several locations in the South West Indian Ocean. Sequence analysis of the D1/D2 domains of the large subunit (LSU) ribosomal RNA gene identified 26 different species. Among them, two species isolated from the skins of Cape gooseberry and cocoa beans appeared to represent putative new yeast species, as their LSU D1/D2 sequence was only 97.1% and 97.4% identical to that of the yeasts Rhodotorula mucilaginosa and Candida pararugosa, respectively. A total of 52 Volatile Organic Compounds (VOCs) were detected by Head Space Solid Phase Micro Extraction coupled to Gas Chromatography and Mass Spectroscopy (HS-SPME-GC/MS) from the 26 yeast species cultivated on a glucose rich medium. Among these VOCs, 6 uncommon compounds were identified, namely ethyl but-2-enoate, ethyl 2-methylbut-2-enoate (ethyl tiglate), ethyl 3-methylbut-2-enoate, 2-methylpropyl 2-methylbut-2-enoate, butyl 2-methylbut-2-enoate and 3-methylbutyl 2-methylbut-2-enoate, making them possible yeast species-specific markers. In addition, statistical methods such as Principal Component Analysis allowed to associate each yeast species with a specific flavor profile. Among them, Saprochaete suaveolens (syn: Geotrichum fragrans) turned to be the best producer of flavor compounds, with a total of 32 out of the 52 identified VOCs in its flavor profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Designed Electroresponsive Biomaterials: Sequence-Controlled Behavior

    DTIC Science & Technology

    2010-06-29

    protein of the M13 . Traditional phage and yeast display methodologies indicate that peptide sequences with high affinities for electrode materials...drug delivery. The original vision for this work was to employ combinatorial tools such as phage and yeast display under electrical selection pressure...and drug delivery. The original vision for this work was to employ combinatorial tools such as phage and yeast display under electrical selection

  9. Yeast and the AIDS Virus: The Odd Couple

    PubMed Central

    Andréola, Marie-Line; Litvak, Simon

    2012-01-01

    Despite being simple eukaryotic organisms, the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe have been widely used as a model to study human pathologies and the replication of human, animal, and plant viruses, as well as the function of individual viral proteins. The complete genome of S. cerevisiae was the first of eukaryotic origin to be sequenced and contains about 6,000 genes. More than 75% of the genes have an assigned function, while more than 40% share conserved sequences with known or predicted human genes. This strong homology has allowed the function of human orthologs to be unveiled starting from the data obtained in yeast. RNA plant viruses were the first to be studied in yeast. In this paper, we focus on the use of the yeast model to study the function of the proteins of human immunodeficiency virus type 1 (HIV-1) and the search for its cellular partners. This human retrovirus is the cause of AIDS. The WHO estimates that there are 33.4 million people worldwide living with HIV/AIDS, with 2.7 million new HIV infections per year and 2.0 million annual deaths due to AIDS. Current therapy is able to control the disease but there is no permanent cure or a vaccine. By using yeast, it is possible to dissect the function of some HIV-1 proteins and discover new cellular factors common to this simple cell and humans that may become potential therapeutic targets, leading to a long-lasting treatment for AIDS. PMID:22778552

  10. Improvement of aromatic thiol release through the selection of yeasts with increased β-lyase activity.

    PubMed

    Belda, Ignacio; Ruiz, Javier; Navascués, Eva; Marquina, Domingo; Santos, Antonio

    2016-05-16

    The development of a selective medium for the rapid differentiation of yeast species with increased aromatic thiol release activity has been achieved. The selective medium was based on the addition of S-methyl-l-cysteine (SMC) as β-lyase substrate. In this study, a panel of 245 strains of Saccharomyces cerevisiae strains was tested for their ability to grow on YCB-SMC medium. Yeast strains with an increased β-lyase activity grew rapidly because of their ability to release ammonium from SMC in comparison to others, and allowed for the easy isolation and differentiation of yeasts with promising properties in oenology, or another field, for aromatic thiol release. The selective medium was also helpful for the discrimination between those S. cerevisiae strains, which present a common 38-bp deletion in the IRC7 sequence (present in around 88% of the wild strains tested and are likely to be less functional for 4-mercapto-4-methylpentan-2-one (4MMP) production), and those S. cerevisiae strains homozygous for the full-length IRC7 allele. The medium was also helpful for the selection of non-Saccharomyces yeasts with increased β-lyase activity. Based on the same medium, a highly sensitive, reproducible and non-expensive GC-MS method for the evaluation of the potential volatile thiol release by different yeast isolates was developed. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Gibberellin Application at Pre-Bloom in Grapevines Down-Regulates the Expressions of VvIAA9 and VvARF7, Negative Regulators of Fruit Set Initiation, during Parthenocarpic Fruit Development

    PubMed Central

    Jung, Chan Jin; Hur, Youn Young; Yu, Hee-Ju; Noh, Jung-Ho; Park, Kyo-Sun; Lee, Hee Jae

    2014-01-01

    Fruit set is initiated only after fertilization and is tightly regulated primarily by gibberellins (GAs) and auxins. The application of either of these hormones induces parthenocarpy, fruit set without fertilization, but the molecular mechanism underlying this induction is poorly understood. In the present study, we have shown that the parthenocarpic fruits induced by GA application at pre-bloom result from the interaction of GA with auxin signaling. The transcriptional levels of the putative negative regulators of fruit set initiation, including Vitis auxin/indole-3-acetic acid transcription factor 9 (VvIAA9), Vitis auxin response factor 7 (VvARF7), and VvARF8 were monitored during inflorescence development in seeded diploid ‘Tamnara’ grapevines with or without GA application. Without GA application, VvIAA9, VvARF7, and VvARF8 were expressed at a relatively high level before full bloom, but decreased thereafter following pollination. After GA application at 14 days before full bloom (DBF); however, the expression levels of VvIAA9 and VvARF7 declined at 5 DBF prior to pollination. The effects of GA application on auxin levels or auxin signaling were also analyzed by monitoring the expression patterns of auxin biosynthesis genes and auxin-responsive genes with or without GA application. Transcription levels of the auxin biosynthesis genes Vitis anthranilate synthase β subunit (VvASB1-like), Vitis YUCCA2 (VvYUC2), and VvYUC6 were not significantly changed by GA application. However, the expressions of Vitis Gretchen Hagen3.2 (VvGH3.2) and VvGH3.3, auxin-responsive genes, were up-regulated from 2 DBF to full bloom with GA application. Furthermore, the Vitis GA signaling gene, VvDELLA was up-regulated by GA application during 12 DBF to 7 DBF, prior to down-regulation of VvIAA9 and VvARF7. These results suggest that VvIAA9 and VvARF7 are negative regulators of fruit set initiation in grapevines, and GA signaling is integrated with auxin signaling via VvDELLA during parthenocarpic fruit development in grapevines. PMID:24743886

  12. Gibberellin application at pre-bloom in grapevines down-regulates the expressions of VvIAA9 and VvARF7, negative regulators of fruit set initiation, during parthenocarpic fruit development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Yu, Hee-Ju; Noh, Jung-Ho; Park, Kyo-Sun; Lee, Hee Jae

    2014-01-01

    Fruit set is initiated only after fertilization and is tightly regulated primarily by gibberellins (GAs) and auxins. The application of either of these hormones induces parthenocarpy, fruit set without fertilization, but the molecular mechanism underlying this induction is poorly understood. In the present study, we have shown that the parthenocarpic fruits induced by GA application at pre-bloom result from the interaction of GA with auxin signaling. The transcriptional levels of the putative negative regulators of fruit set initiation, including Vitis auxin/indole-3-acetic acid transcription factor 9 (VvIAA9), Vitis auxin response factor 7 (VvARF7), and VvARF8 were monitored during inflorescence development in seeded diploid 'Tamnara' grapevines with or without GA application. Without GA application, VvIAA9, VvARF7, and VvARF8 were expressed at a relatively high level before full bloom, but decreased thereafter following pollination. After GA application at 14 days before full bloom (DBF); however, the expression levels of VvIAA9 and VvARF7 declined at 5 DBF prior to pollination. The effects of GA application on auxin levels or auxin signaling were also analyzed by monitoring the expression patterns of auxin biosynthesis genes and auxin-responsive genes with or without GA application. Transcription levels of the auxin biosynthesis genes Vitis anthranilate synthase β subunit (VvASB1-like), Vitis YUCCA2 (VvYUC2), and VvYUC6 were not significantly changed by GA application. However, the expressions of Vitis Gretchen Hagen3.2 (VvGH3.2) and VvGH3.3, auxin-responsive genes, were up-regulated from 2 DBF to full bloom with GA application. Furthermore, the Vitis GA signaling gene, VvDELLA was up-regulated by GA application during 12 DBF to 7 DBF, prior to down-regulation of VvIAA9 and VvARF7. These results suggest that VvIAA9 and VvARF7 are negative regulators of fruit set initiation in grapevines, and GA signaling is integrated with auxin signaling via VvDELLA during parthenocarpic fruit development in grapevines.

  13. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  14. Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936.

    PubMed

    Durrens, Pascal; Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J; Noël, Thierry

    2017-08-03

    Clavispora lusitaniae , an environmental saprophytic yeast belonging to the CTG clade of Candida , can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. Copyright © 2017 Durrens et al.

  15. Genome Sequence of the Yeast Clavispora lusitaniae Type Strain CBS 6936

    PubMed Central

    Klopp, Christophe; Biteau, Nicolas; Fitton-Ouhabi, Valérie; Dementhon, Karine; Accoceberry, Isabelle; Sherman, David J.; Noël, Thierry

    2017-01-01

    ABSTRACT Clavispora lusitaniae, an environmental saprophytic yeast belonging to the CTG clade of Candida, can behave occasionally as an opportunistic pathogen in humans. We report here the genome sequence of the type strain CBS 6936. Comparison with sequences of strain ATCC 42720 indicates conservation of chromosomal structure but significant nucleotide divergence. PMID:28774979

  16. Control of the mitotic exit network during meiosis

    PubMed Central

    Attner, Michelle A.; Amon, Angelika

    2012-01-01

    The mitotic exit network (MEN) is an essential GTPase signaling pathway that triggers exit from mitosis in budding yeast. We show here that during meiosis, the MEN is dispensable for exit from meiosis I but contributes to the timely exit from meiosis II. Consistent with a role for the MEN during meiosis II, we find that the signaling pathway is active only during meiosis II. Our analysis further shows that MEN signaling is modulated during meiosis in several key ways. Whereas binding of MEN components to spindle pole bodies (SPBs) is necessary for MEN signaling during mitosis, during meiosis MEN signaling occurs off SPBs and does not require the SPB recruitment factor Nud1. Furthermore, unlike during mitosis, MEN signaling is controlled through the regulated interaction between the MEN kinase Dbf20 and its activating subunit Mob1. Our data lead to the conclusion that a pathway essential for vegetative growth is largely dispensable for the specialized meiotic divisions and provide insights into how cell cycle regulatory pathways are modulated to accommodate different modes of cell division. PMID:22718910

  17. Spatial control of translation repression and polarized growth by conserved NDR kinase Orb6 and RNA-binding protein Sts5.

    PubMed

    Nuñez, Illyce; Rodriguez Pino, Marbelys; Wiley, David J; Das, Maitreyi E; Chen, Chuan; Goshima, Tetsuya; Kume, Kazunori; Hirata, Dai; Toda, Takashi; Verde, Fulvia

    2016-07-30

    RNA-binding proteins contribute to the formation of ribonucleoprotein (RNP) granules by phase transition, but regulatory mechanisms are not fully understood. Conserved fission yeast NDR (Nuclear Dbf2-Related) kinase Orb6 governs cell morphogenesis in part by spatially controlling Cdc42 GTPase. Here we describe a novel, independent function for Orb6 kinase in negatively regulating the recruitment of RNA-binding protein Sts5 into RNPs to promote polarized cell growth. We find that Orb6 kinase inhibits Sts5 recruitment into granules, its association with processing (P) bodies, and degradation of Sts5-bound mRNAs by promoting Sts5 interaction with 14-3-3 protein Rad24. Many Sts5-bound mRNAs encode essential factors for polarized cell growth, and Orb6 kinase spatially and temporally controls the extent of Sts5 granule formation. Disruption of this control system affects cell morphology and alters the pattern of polarized cell growth, revealing a role for Orb6 kinase in the spatial control of translational repression that enables normal cell morphogenesis.

  18. Regulation of Neurospora crassa cell wall remodeling via the cot-1 pathway is mediated by gul-1.

    PubMed

    Herold, Inbal; Yarden, Oded

    2017-02-01

    Impairment of the Neurospora crassa Nuclear DBF2-related kinase-encoding gene cot-1 results in pleiotropic effects, including abnormally thick hyphal cell walls and septa. An increase in the transcript abundance of genes encoding chitin and glucan synthases and the chitinase gh18-5, but not the cell wall integrity pathway transcription factor rlm-1, accompany the phenotypic changes observed. Deletion of chs-5 or chs-7 in a cot-1 background results in a reduction of hyperbranching frequency characteristic of the cot-1 parent. gul-1 (a homologue of the yeast SSD1 gene) encodes a translational regulator and has been shown to partially suppress cot-1. We demonstrate that the high expression levels of the cell wall remodeling genes analyzed is curbed, and reaches near wild type levels, when gul-1 is inactivated. This is accompanied by morphological changes that include reduced cell wall thickness and restoration of normal chitin levels. We conclude that gul-1 is a mediator of cell wall remodeling within the cot-1 pathway.

  19. Biological diversity of yeasts in the gastrointestinal tract of weaned piglets kept under different farm conditions.

    PubMed

    Urubschurov, Vladimir; Janczyk, Pawel; Pieper, Robert; Souffrant, Wolfgang B

    2008-12-01

    The study was conducted to determine yeasts present in the gastrointestinal tract (GIT) of piglets kept under experimental farm (EF) and commercial farm (CF) conditions. Ninety five German Landrace full- and half-sibling piglets were sacrificed at 39 days of age. Sixty eight piglets were weaned at 28th day of life, when they were offered one diet ad libitum. Twenty seven piglets remained unweaned by their dams. None of the piglets received any creep feed before weaning. Digesta samples were collected from 1/3 distal small intestine (SI), caecum and proximal colon. One hundred seventy three colonies of isolated yeasts were characterized by sequence analysis of the PCR-amplified D1/D2 domain of the 26S rRNA gene with following alignment of the recovered sequences to GenBank entries. From the 17 phylotypes found, isolates most closely related to Galactomyces geotrichum, Kazachstania slooffiae and Candida catenulata dominated in the GIT of CF piglets. Kazachstania slooffiae and Candida glabrata dominated in GIT of EF piglets. Sørenson and Morisita-Horn similarity indices between farms were low (0.44 and 0.54 respectively) and the Simpson diversity index was higher for EF (7.58) than for CF (4.34). The study brings new data on yeasts composition in the pig GIT and shows differences in yeasts biodiversity between farms operated at different hygiene conditions.

  20. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

    2012-05-03

    Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

  1. Isolation and Characterization of Hydrocarbon-Degrading Yeast Strains from Petroleum Contaminated Industrial Wastewater

    PubMed Central

    Gargouri, Boutheina; Mhiri, Najla; Karray, Fatma; Aloui, Fathi; Sayadi, Sami

    2015-01-01

    Two yeast strains are enriched and isolated from industrial refinery wastewater. These strains were observed for their ability to utilize several classes of petroleum hydrocarbons substrates, such as n-alkanes and aromatic hydrocarbons as a sole carbon source. Phylogenetic analysis based on the D1/D2 variable domain and the ITS-region sequences indicated that strains HC1 and HC4 were members of the genera Candida and Trichosporon, respectively. The mechanism of hydrocarbon uptaking by yeast, Candida, and Trichosporon has been studied by means of the kinetic analysis of hydrocarbons-degrading yeasts growth and substrate assimilation. Biodegradation capacity and biomass quantity were daily measured during twelve days by gravimetric analysis and gas chromatography coupled with mass spectrometry techniques. Removal of n-alkanes indicated a strong ability of hydrocarbon biodegradation by the isolated yeast strains. These two strains grew on long-chain n-alkane, diesel oil, and crude oil but failed to grow on short-chain n-alkane and aromatic hydrocarbons. Growth measurement attributes of the isolates, using n-hexadecane, diesel oil, and crude oil as substrates, showed that strain HC1 had better degradation for hydrocarbon substrates than strain HC4. In conclusion, these yeast strains can be useful for the bioremediation process and decreasing petroleum pollution in wastewater contaminated with petroleum hydrocarbons. PMID:26339653

  2. Isolation and Characterization of Hydrocarbon-Degrading Yeast Strains from Petroleum Contaminated Industrial Wastewater.

    PubMed

    Gargouri, Boutheina; Mhiri, Najla; Karray, Fatma; Aloui, Fathi; Sayadi, Sami

    2015-01-01

    Two yeast strains are enriched and isolated from industrial refinery wastewater. These strains were observed for their ability to utilize several classes of petroleum hydrocarbons substrates, such as n-alkanes and aromatic hydrocarbons as a sole carbon source. Phylogenetic analysis based on the D1/D2 variable domain and the ITS-region sequences indicated that strains HC1 and HC4 were members of the genera Candida and Trichosporon, respectively. The mechanism of hydrocarbon uptaking by yeast, Candida, and Trichosporon has been studied by means of the kinetic analysis of hydrocarbons-degrading yeasts growth and substrate assimilation. Biodegradation capacity and biomass quantity were daily measured during twelve days by gravimetric analysis and gas chromatography coupled with mass spectrometry techniques. Removal of n-alkanes indicated a strong ability of hydrocarbon biodegradation by the isolated yeast strains. These two strains grew on long-chain n-alkane, diesel oil, and crude oil but failed to grow on short-chain n-alkane and aromatic hydrocarbons. Growth measurement attributes of the isolates, using n-hexadecane, diesel oil, and crude oil as substrates, showed that strain HC1 had better degradation for hydrocarbon substrates than strain HC4. In conclusion, these yeast strains can be useful for the bioremediation process and decreasing petroleum pollution in wastewater contaminated with petroleum hydrocarbons.

  3. Genome Sequence of Saccharomyces carlsbergensis, the World’s First Pure Culture Lager Yeast

    PubMed Central

    Walther, Andrea; Hesselbart, Ana; Wendland, Jürgen

    2014-01-01

    Lager yeast beer production was revolutionized by the introduction of pure culture strains. The first established lager yeast strain is known as the bottom fermenting Saccharomyces carlsbergensis, which was originally termed Unterhefe No. 1 by Emil Chr. Hansen and has been used in production in since 1883. S. carlsbergensis belongs to group I/Saaz-type lager yeast strains and is better adapted to cold growth conditions than group II/Frohberg-type lager yeasts, e.g., the Weihenstephan strain WS34/70. Here, we sequenced S. carlsbergensis using next generation sequencing technologies. Lager yeasts are descendants from hybrids formed between a S. cerevisiae parent and a parent similar to S. eubayanus. Accordingly, the S. carlsbergensis 19.5-Mb genome is substantially larger than the 12-Mb S. cerevisiae genome. Based on the sequence scaffolds, synteny to the S. cerevisae genome, and by using directed polymerase chain reaction for gap closure, we generated a chromosomal map of S. carlsbergensis consisting of 29 unique chromosomes. We present evidence for genome and chromosome evolution within S. carlsbergensis via chromosome loss and loss of heterozygosity specifically of parts derived from the S. cerevisiae parent. Based on our sequence data and via fluorescence-activated cell-sorting analysis, we determined the ploidy of S. carlsbergensis. This inferred that this strain is basically triploid with a diploid S. eubayanus and haploid S. cerevisiae genome content. In contrast the Weihenstephan strain, which we resequenced, is essentially tetraploid composed of two diploid S. cerevisiae and S. eubayanus genomes. Based on conserved translocations between the parental genomes in S. carlsbergensis and the Weihenstephan strain we propose a joint evolutionary ancestry for lager yeast strains. PMID:24578374

  4. Phylogenetics of Saccharomycetales, the ascomycete yeasts.

    PubMed

    Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André

    2006-01-01

    Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available.

  5. Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

    PubMed

    Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

    2004-07-01

    The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

  6. Dynamics of glass-forming di-n-butyl phthalate as studied by NMR.

    PubMed

    Szcześniak, E; Głowinkowski, S; Suchański, W; Jurga, S

    1997-04-01

    Spin-lattice relaxation times T1 and nuclear Overhauser effect (NOE) enhancement factors for the individual ring carbons in di-n-butyl phthalate (DBF) show that the reorientational correlation function corresponding to the global dynamics in supercooled liquid can be described by a Davidson-Cole distribution. Measurements of proton spin-lattice relaxation times T1 and T1p, as well as 1H NMR spectra at temperatures below the glass transition temperature, Tg, reveal that the same distribution holds also for description of local dynamics in glassy DBF. The activation parameters of the motions detected are derived.

  7. The plant G box promoter sequence activates transcription in Saccharomyces cerevisiae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor.

    PubMed Central

    Donald, R G; Schindler, U; Batschauer, A; Cashmore, A R

    1990-01-01

    G box and I box sequences of the Arabidopsis thaliana ribulose-bisphosphate-1,5-carboxylase small subunit (RBCS) promoter are required for expression mediated by the Arabidopsis rbcS-1A promoter in transgenic tobacco plants and are bound in vitro by factors from plant nuclear extracts termed GBF and GA-1, respectively. We show here that a -390 to -60 rbcS-1A promoter fragment containing the G box and two I boxes activates transcription from a truncated iso-1-cytochrome c (CYC1) gene promoter in Saccharomyces cerevisiae. Mutagenesis of either the rbcS-1A G box or both I box sequences eliminated the expression mediated by this fragment. When polymerized, I box oligonucleotides were also capable of enhancing expression from the truncated CYC1 promoter. Single-copy G box sequences from the Arabidopsis rbcS-1A, Arabidopsis Adh and tomato rbcS-3A promoters were more potent activators and were used in mobility shift assays to identify a DNA binding activity in yeast functionally similar to GBF. In methylation interference experiments, the binding specificity of the yeast protein was indistinguishable from that obtained with plant nuclear extracts. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:2161333

  8. Genome Sequence of the Lager-Brewing Yeast Saccharomyces sp. Strain M14, Used in the High-Gravity Brewing Industry in China

    PubMed Central

    Liu, Chunfeng; Niu, Chengtuo; Zheng, Feiyun; Li, Yongxian; Zhao, Yun; Yin, Xiangsheng

    2017-01-01

    ABSTRACT Lager-brewing yeasts are mainly used for the production of lager beers. Illumina and PacBio-based sequence analyses revealed an approximate genome size of 22.8 Mb, with a GC content of 38.98%, for the Chinese lager-brewing yeast Saccharomyces sp. strain M14. Based on ab initio prediction, 9,970 coding genes were annotated. PMID:29074666

  9. The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

    PubMed Central

    Van Kreijl, C F; Bos, J L

    1977-01-01

    The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

  10. Identification of Candida albicans and Candida dubliniensis Species Isolated from Bronchoalveolar Lavage Samples Using Genotypic and Phenotypic Methods.

    PubMed

    Kianipour, Sahar; Ardestani, Mohammad Emami; Dehghan, Parvin

    2018-01-01

    Candida dubliniensis is a newly diagnosed species very similar to Candida albicans phenotypically and first discovered in the mouth of people with AIDS in 1995. Among the different phenotypic and genotypic methods, a cost-effective method should be selected which makes it possible to differentiate these similar species. Polymerase chain reaction (PCR)-restriction fragment length polymorphism with MspI enzyme and the Duplex-PCR method were done by DNA extraction using boiling. The sequencing of the amplified ribosomal region was used to confirm the C. dubliniensis species. Direct examination and colony count of the yeasts were applied for bronchoalveolar lavage (BAL) samples and the growth rate of the yeasts were studied at 45°C. To understand the ability formation of chlamydoconidia in yeast isolates, they were separately cultured on the sunflower seed agar, wheat flour agar, and corn meal agar media. Fifty-nine (49.2%) yeast colonies were identified from the total of 120 BAL specimens. Twenty-nine isolated yeasts; including 17 (58.6%) of C. albicans / dubliniensis complex and 12 (41.4%) of nonalbicans isolates produced pseudohypha or blastoconidia in direct smear with a mean colony count of 42000 CFU/mL. C. albicans with the frequency of 15 (42.9%) were the most common isolated yeasts, whereas C. dubliniensis was identified in two nonHIV patients. Sequencing of the replicated gene fragment is the best method for identifying the yeasts, but the determination of the species by phenotypic methods such as the creation of chlamydoconidia in sunflower seeds agar and wheat flour agar media can be cost-effective, have sensitivity and acceptable quality.

  11. Point mutation of H3/H4 histones affects acetic acid tolerance in Saccharomyces cerevisiae.

    PubMed

    Liu, Xiangyong; Zhang, Xiaohua; Zhang, Zhaojie

    2014-10-10

    The molecular mechanism of acetic acid tolerance in yeast remains unclear despite of its importance for efficient cellulosic ethanol production. In this study, we examined the effects of histone H3/H4 point mutations on yeast acetic acid tolerance by comprehensively screening a histone H3/H4 mutant library. A total of 24 histone H3/H4 mutants (six acetic acid resistant and 18 sensitive) were identified. Compared to the wild-type strain, the histone acetic acid-resistant mutants exhibited improved ethanol fermentation performance under acetic acid stress. Genome-wide transcriptome analysis revealed that changes in the gene expression in the acetic acid-resistant mutants H3 K37A and H4 K16Q were mainly related to energy production, antioxidative stress. Our results provide novel insights into yeast acetic acid tolerance on the basis of histone, and suggest a novel approach to improve ethanol production by altering the histone H3/H4 sequences. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Genetic transformation of the yeast Dekkera/Brettanomyces bruxellensis with non-homologous DNA.

    PubMed

    Miklenić, Marina; Štafa, Anamarija; Bajić, Ana; Žunar, Bojan; Lisnić, Berislav; Svetec, Ivan-Krešimir

    2013-05-01

    Yeast Dekkera/Brettanomyces bruxellensis is probably the most common contaminant in wineries and ethanol production processes. The considerable economic losses caused by this yeast, but also its ability to produce and tolerate high ethanol concentrations, make it an attractive subject for research with potential for industrial applications. Unfortunately, efforts to understand the biology of D. bruxellensis and facilitate its broader use in industry are hampered by the lack of adequate procedures for delivery of exogenous DNA into this organism. Here we describe the development of transformation protocols (spheroplast transformation, LiAc/PEG method, and electroporation) and report the first genetic transformation of yeast D. bruxellensis. A linear heterologous DNA fragment carrying the kanMX4 sequence was used for transformation, which allowed transformants to be selected on plates containing geneticin. We found the spheroplast transformation method using 1M sorbitol as osmotic stabilizer to be inappropriate because sorbitol strikingly decreases the plating efficiency of both D. bruxellensis spheroplast and intact cells. However, we managed to modify the LiAc/ PEG transformation method and electroporation to accommodate D. bruxellensis transformation, achieving efficiencies of 0.6-16 and 10-20 transformants/microg DNA, respectively. The stability of the transformants ranged from 93.6% to 100%. All putative transformants were analyzed by Southern blot using the kanMX4 sequence as a hybridization probe, which confirmed that the transforming DNA fragment had integrated into the genome. The results of the molecular analysis were consistent with the expected illegitimate integration of a heterologous transforming fragment.

  13. The Awesome Power of Yeast Evolutionary Genetics: New Genome Sequences and Strain Resources for the Saccharomyces sensu stricto Genus

    PubMed Central

    Scannell, Devin R.; Zill, Oliver A.; Rokas, Antonis; Payen, Celia; Dunham, Maitreya J.; Eisen, Michael B.; Rine, Jasper; Johnston, Mark; Hittinger, Chris Todd

    2011-01-01

    High-quality, well-annotated genome sequences and standardized laboratory strains fuel experimental and evolutionary research. We present improved genome sequences of three species of Saccharomyces sensu stricto yeasts: S. bayanus var. uvarum (CBS 7001), S. kudriavzevii (IFO 1802T and ZP 591), and S. mikatae (IFO 1815T), and describe their comparison to the genomes of S. cerevisiae and S. paradoxus. The new sequences, derived by assembling millions of short DNA sequence reads together with previously published Sanger shotgun reads, have vastly greater long-range continuity and far fewer gaps than the previously available genome sequences. New gene predictions defined a set of 5261 protein-coding orthologs across the five most commonly studied Saccharomyces yeasts, enabling a re-examination of the tempo and mode of yeast gene evolution and improved inferences of species-specific gains and losses. To facilitate experimental investigations, we generated genetically marked, stable haploid strains for all three of these Saccharomyces species. These nearly complete genome sequences and the collection of genetically marked strains provide a valuable toolset for comparative studies of gene function, metabolism, and evolution, and render Saccharomyces sensu stricto the most experimentally tractable model genus. These resources are freely available and accessible through www.SaccharomycesSensuStricto.org. PMID:22384314

  14. Impact of recent molecular phylogenetic studies on classification of ascomycete yeasts

    USDA-ARS?s Scientific Manuscript database

    Analyses of concatenated gene sequences as well as whole genome sequences are resolving relationships among the ascomycete yeasts (Saccharomycotina), thus allowing classification of members of this subphylum to be based on phylogeny. In addition, changes implemented in the new Botanical Code [Intern...

  15. The dominant microbial community associated with fermentation of Obushera (sorghum and millet beverages) determined by culture-dependent and culture-independent methods.

    PubMed

    Mukisa, Ivan M; Porcellato, Davide; Byaruhanga, Yusuf B; Muyanja, Charles M B K; Rudi, Knut; Langsrud, Thor; Narvhus, Judith A

    2012-11-01

    Obushera includes four fermented cereal beverages from Uganda namely: Obutoko, Enturire, Ekitiribita and Obuteire, whose microbial diversity has not hitherto been fully investigated. Knowledge of the microbial diversity and dynamics in these products is crucial for understanding their safety and development of appropriate starter cultures for controlled industrial processing. Culture-dependent and culture-independent techniques including denaturating gradient gel electrophoresis (DGGE) and mixed DNA sequencing of polymerase chain reaction (PCR) amplified ribosomal RNA genes were used to study the bacteria and yeast diversity of Obushera. The pH dropped from 6.0-4.6 to 3.5-4.0 within 1-2 days for Obutoko, Enturire and Obuteire whereas that of Ekitiribita decreased to 4.4 after 4 days. Counts of lactic acid bacteria (LAB) increased from 5.0 to 11.0 log cfug(-1) and yeasts increased from 3.4 to 7.1 log cfug(-1) while coliform counts decreased from 2.0 to <1 log cfug(-1) during four days of fermentation. LAB and yeast isolates were identified by rRNA gene sequence analysis. LAB isolates included: Enterococcus spp., Lactobacillus (Lb.) plantarum, Lb. fermentum, Lb. delbrueckii, Lactococcus lactis, Leuconostoc lactis, Streptococcus (S.) infantarius subsp. infantarius, Pediococcus pentosaceus and Weisella (W.) confusa. DGGE indicated predominance of S. gallolyticus, S. infantarius subsp. infantarius, Lb. fermentum, Lb. delbrueckii, W. confusa, Lb. reuteri, Fructobacillus spp., L. lactis and L. lactis. Yeast isolates included Clavispora lusitaniae, Cyberlindnera fabianii, Issatchenkia orientalis and Saccharomyces cerevisiae. DGGE indicated predominance of S. cerevisiae in Obutoko, Enturire and Obuteire and also detected Pichia spp. and I. orientalis in Obutoko. Obushera produced in the laboratory was initially dominated by Enterobacteriaceae and later by Lactococcus spp. Enterobacteriaceae and Bacillus spp. were also detected in Ekitiribita. Development of starters for Obushera may require combinations of LAB and S. cerevisiae for Obutoko, Enturire and Obuteire and LAB for Ekitiribita. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Genome Sequence of the Lager-Brewing Yeast Saccharomyces sp. Strain M14, Used in the High-Gravity Brewing Industry in China.

    PubMed

    Liu, Chunfeng; Li, Qi; Niu, Chengtuo; Zheng, Feiyun; Li, Yongxian; Zhao, Yun; Yin, Xiangsheng

    2017-10-26

    Lager-brewing yeasts are mainly used for the production of lager beers. Illumina and PacBio-based sequence analyses revealed an approximate genome size of 22.8 Mb, with a GC content of 38.98%, for the Chinese lager-brewing yeast Saccharomyces sp. strain M14. Based on ab initio prediction, 9,970 coding genes were annotated. Copyright © 2017 Liu et al.

  17. Construction of a lactose-assimilating strain of baker's yeast.

    PubMed

    Adam, A C; Prieto, J A; Rubio-Texeira, M; Polaina, J

    1999-09-30

    A recombinant strain of baker's yeast has been constructed which can assimilate lactose efficiently. This strain has been designed to allow its propagation in whey, the byproduct resulting from cheese-making. The ability to metabolize lactose is conferred by the functional expression of two genes from Kluyveromyces lactis, LAC12 and LAC4, which encode a lactose permease and a beta-galactosidase, respectively. To make the recombinant strain more acceptable for its use in bread-making, the genetic transformation of the host baker's yeast was carried out with linear fragments of DNA of defined sequence, carrying as the only heterologous material the coding regions of the two K. lactis genes. Growth of the new strain on cheese whey affected neither the quality of bread nor the yeast gassing power. The significance of the newly developed strain is two-fold: it affords a cheap alternative to the procedure generally used for the propagation of baker's yeast, and it offers a profitable use for cheese whey. Copyright 1999 John Wiley & Sons, Ltd.

  18. Draft Genome Sequence of the d-Xylose-Fermenting Yeast Spathaspora arborariae UFMG-HM19.1AT

    PubMed Central

    Lobo, Francisco P.; Gonçalves, Davi L.; Alves, Sergio L.; Gerber, Alexandra L.; de Vasconcelos, Ana Tereza R.; Basso, Luiz C.; Franco, Glória R.; Soares, Marco A.; Cadete, Raquel M.; Rosa, Carlos A.

    2014-01-01

    The draft genome sequence of the yeast Spathaspora arborariae UFMG-HM19.1AT (CBS 11463 = NRRL Y-48658) is presented here. The sequenced genome size is 12.7 Mb, consisting of 41 scaffolds containing a total of 5,625 predicted open reading frames, including many genes encoding enzymes and transporters involved in d-xylose fermentation. PMID:24435867

  19. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Draft Genome Sequence of the Dimorphic Yeast Yarrowia lipolytica Strain W29

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pomraning, Kyle R.; Baker, Scott E.

    Here, we present the draft genome sequence of the dimorphic ascomycete yeastYarrowia lipolyticastrain W29 (ATCC 20460).Y. lipolyticais a commonly employed model for the industrial production of lipases, small molecules, and more recently for its ability to accumulate lipids.

  1. Breeding research on sake yeasts in Japan: history, recent technological advances, and future perspectives.

    PubMed

    Kitagaki, Hiroshi; Kitamoto, Katsuhiko

    2013-01-01

    Sake is an alcoholic beverage of Japan, with a tradition lasting more than 1,300 years; it is produced from rice and water by fermenting with the koji mold Aspergillus oryzae and sake yeast Saccharomyces cerevisiae. Breeding research on sake yeasts was originally developed in Japan by incorporating microbiological and genetic research methodologies adopted in other scientific areas. Since the advent of a genetic paradigm, isolation of yeast mutants has been a dominant approach for the breeding of favorable sake yeasts. These sake yeasts include (a) those that do not form foams (produced by isolating a mutant that does not stick to foams, thus decreasing the cost of sake production); (b) those that do not produce urea, which leads to the formation of ethyl carbamate, a possible carcinogen (isolated by positive selection in a canavanine-, arginine-, and ornithine-containing medium); (c) those that produce an increased amount of ethyl caproate, an apple-like flavor (produced by isolating a mutant resistant to cerulenin, an inhibitor of fatty-acid synthesis); and (d) those that produce a decreased amount of pyruvate (produced by isolating a mutant resistant to an inhibitor of mitochondrial transport, thus decreasing the amount of diacetyl). Given that sake yeasts perform sexual reproduction, sporulation and mating are potent approaches for their breeding. Recently, the genome sequences of sake yeasts have been determined and made publicly accessible. By utilizing this information, the quantitative trait loci (QTLs) for the brewing characteristics of sake yeasts have been identified, which paves a way to DNA marker-assisted selection of the mated strains. Genetic engineering technologies for experimental yeast strains have recently been established by academic groups, and these technologies have also been applied to the breeding of sake yeasts. Sake yeasts whose genomes have been modified with these technologies correspond to genetically modified organisms (GMOs). However, technologies that enable the elimination of extraneous DNA sequences from the genome of sake yeast have been developed. Sake yeasts genetically modified with these technologies are called self-cloning yeasts and do not contain extraneous DNA sequences. These yeasts were exempted from the Japanese government's guidelines for genetically modified food. Protoplast fusion has also been utilized to breed favorable sake yeasts. Future directions for the breeding of sake yeasts are also proposed in this review. The reviewed research provides perspectives for the breeding of brewery yeasts in other fermentation industries.

  2. High efficiency family shuffling based on multi-step PCR and in vivo DNA recombination in yeast: statistical and functional analysis of a combinatorial library between human cytochrome P450 1A1 and 1A2.

    PubMed

    Abécassis, V; Pompon, D; Truan, G

    2000-10-15

    The design of a family shuffling strategy (CLERY: Combinatorial Libraries Enhanced by Recombination in Yeast) associating PCR-based and in vivo recombination and expression in yeast is described. This strategy was tested using human cytochrome P450 CYP1A1 and CYP1A2 as templates, which share 74% nucleotide sequence identity. Construction of highly shuffled libraries of mosaic structures and reduction of parental gene contamination were two major goals. Library characterization involved multiprobe hybridization on DNA macro-arrays. The statistical analysis of randomly selected clones revealed a high proportion of chimeric genes (86%) and a homogeneous representation of the parental contribution among the sequences (55.8 +/- 2.5% for parental sequence 1A2). A microtiter plate screening system was designed to achieve colorimetric detection of polycyclic hydrocarbon hydroxylation by transformed yeast cells. Full sequences of five randomly picked and five functionally selected clones were analyzed. Results confirmed the shuffling efficiency and allowed calculation of the average length of sequence exchange and mutation rates. The efficient and statistically representative generation of mosaic structures by this type of family shuffling in a yeast expression system constitutes a novel and promising tool for structure-function studies and tuning enzymatic activities of multicomponent eucaryote complexes involving non-soluble enzymes.

  3. A Comprehensive Analysis of Transcript-Supported De Novo Genes in Saccharomyces sensu stricto Yeasts

    PubMed Central

    Lu, Tzu-Chiao; Leu, Jun-Yi; Lin, Wen-Chang

    2017-01-01

    Abstract Novel genes arising from random DNA sequences (de novo genes) have been suggested to be widespread in the genomes of different organisms. However, our knowledge about the origin and evolution of de novo genes is still limited. To systematically understand the general features of de novo genes, we established a robust pipeline to analyze >20,000 transcript-supported coding sequences (CDSs) from the budding yeast Saccharomyces cerevisiae. Our analysis pipeline combined phylogeny, synteny, and sequence alignment information to identify possible orthologs across 20 Saccharomycetaceae yeasts and discovered 4,340 S. cerevisiae-specific de novo genes and 8,871 S. sensu stricto-specific de novo genes. We further combine information on CDS positions and transcript structures to show that >65% of de novo genes arose from transcript isoforms of ancient genes, especially in the upstream and internal regions of ancient genes. Fourteen identified de novo genes with high transcript levels were chosen to verify their protein expressions. Ten of them, including eight transcript isoform-associated CDSs, showed translation signals and five proteins exhibited specific cytosolic localizations. Our results suggest that de novo genes frequently arise in the S. sensu stricto complex and have the potential to be quickly integrated into ancient cellular network. PMID:28981695

  4. Genomic evolution of the ascomycetous yeasts

    USDA-ARS?s Scientific Manuscript database

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphr...

  5. Yeast Prions and Human Prion-like Proteins: Sequence Features and Prediction Methods

    PubMed Central

    Cascarina, Sean; Ross, Eric D.

    2014-01-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis (ALS). This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms. PMID:24390581

  6. Yeast prions and human prion-like proteins: sequence features and prediction methods.

    PubMed

    Cascarina, Sean M; Ross, Eric D

    2014-06-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

  7. Draft genome sequence of Cryptococcus terricola JCM 24523, an oleaginous yeast capable of expressing exogenous DNA

    DOE PAGES

    Close, Dan; Ojumu, John O.; Zhang, Gui X.

    2016-11-03

    Cryptococcus terricola JCM 24523 has recently been identified as an oleaginous yeast capable of converting starch into fatty acids. Here, this draft genome sequence provides a platform for elucidating its fatty acid production potential and supporting comparisons with other oleaginous species.

  8. Draft genome sequence of Cryptococcus terricola JCM 24523, an oleaginous yeast capable of expressing exogenous DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Close, Dan; Ojumu, John O.; Zhang, Gui X.

    Cryptococcus terricola JCM 24523 has recently been identified as an oleaginous yeast capable of converting starch into fatty acids. Here, this draft genome sequence provides a platform for elucidating its fatty acid production potential and supporting comparisons with other oleaginous species.

  9. Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: new insights into the role of intracellular lipases and lipid body organisation.

    PubMed

    Dulermo, Thierry; Tréton, Brigitte; Beopoulos, Athanasios; Kabran Gnankon, Affoué Philomène; Haddouche, Ramdane; Nicaud, Jean-Marc

    2013-09-01

    Eukaryotes store lipids in a specialised organelle, the lipid body (LB), mainly as triglycerides (TAGs). Both the rates of synthesis and degradation contribute to the control of the accumulation of TAGs. The synthesis of TAGs in yeasts has been well documented, especially in the model yeast Saccharomyces cerevisiae and in the oleaginous yeast Yarrowia lipolytica. However, descriptions of the processes involved in TAG degradation are more scarce and mostly for S. cerevisiae. Here, we report the characterisation of two Y. lipolytica genes, YlTGL3 and YlTGL4, encoding intracellular lipases involved in TAG degradation. The two proteins are localised in lipid bodies, and YlTgl4 was mainly found at the interface between LBs. Surprisingly, the spatial organisation of YlTgl3 and YlTgl4 depends on the culture medium and on the physiological phase of the cell. Inactivation of one or both genes doubles the lipid accumulation capacity of Y. lipolytica, increasing the cell's capacity to accumulate TAGs. The amino acid sequence of YlTgl4 contains the consensus sequence motif (G/A)XSXG, typical of serine hydrolases, whereas YlTgl3 does not. Single and double mutants are unable to degrade TAGs, and higher expression of YlTgl4 correlates with TAG degradation. Therefore, we propose that YlTgl4 is the main lipase responsible for TAG degradation and that YlTgl3 may act as a positive regulator of YlTgl4 rather than a functional lipase. Thus, contrary to S. cerevisiae, Y. lipolytica possesses two intracellular lipases with distinct roles and with distinct localisations in the LB. © 2013. Published by Elsevier B.V. All rights reserved.

  10. Comparative genomics of biotechnologically important yeasts

    USDA-ARS?s Scientific Manuscript database

    Ascomycete yeasts are metabolically diverse, with great potential for biotechnology. Here, we report the comparative genome analysis of 29 taxonomically and biotechnologically important yeasts, including 16 newly sequenced. We identify a genetic code change, CUG-Ala, in Pachysolen tannophilus in the...

  11. Study on the effects of near-future ocean acidification on marine yeasts: a microcosm approach

    NASA Astrophysics Data System (ADS)

    Krause, Evamaria; Wichels, Antje; Erler, René; Gerdts, Gunnar

    2013-12-01

    Marine yeasts play an important role in biodegradation and nutrient cycling and are often associated with marine flora and fauna. They show maximum growth at pH levels lower than present-day seawater pH. Thus, contrary to many other marine organisms, they may actually profit from ocean acidification. Hence, we conducted a microcosm study, incubating natural seawater from the North Sea at present-day pH (8.10) and two near-future pH levels (7.81 and 7.67). Yeasts were isolated from the initial seawater sample and after 2 and 4 weeks of incubation. Isolates were classified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and representative isolates were identified by partial sequencing of the large subunit rRNA gene. From the initial seawater sample, we predominantly isolated a yeast-like filamentous fungus related to Aureobasidium pullulans, Cryptococcus sp., Candida sake, and various cold-adapted yeasts. After incubation, we found more different yeast species at near-future pH levels than at present-day pH. Yeasts reacting to low pH were related to Leucosporidium scottii, Rhodotorula mucilaginosa, Cryptococcus sp., and Debaryomyces hansenii. Our results suggest that these yeasts will benefit from seawater pH reductions and give a first indication that the importance of yeasts will increase in a more acidic ocean.

  12. High quality de novo sequencing and assembly of the Saccharomyces arboricolus genome

    PubMed Central

    2013-01-01

    Background Comparative genomics is a formidable tool to identify functional elements throughout a genome. In the past ten years, studies in the budding yeast Saccharomyces cerevisiae and a set of closely related species have been instrumental in showing the benefit of analyzing patterns of sequence conservation. Increasing the number of closely related genome sequences makes the comparative genomics approach more powerful and accurate. Results Here, we report the genome sequence and analysis of Saccharomyces arboricolus, a yeast species recently isolated in China, that is closely related to S. cerevisiae. We obtained high quality de novo sequence and assemblies using a combination of next generation sequencing technologies, established the phylogenetic position of this species and considered its phenotypic profile under multiple environmental conditions in the light of its gene content and phylogeny. Conclusions We suggest that the genome of S. arboricolus will be useful in future comparative genomics analysis of the Saccharomyces sensu stricto yeasts. PMID:23368932

  13. The yeast genome may harbor hypoxia response elements (HRE).

    PubMed

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  14. A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.

    PubMed

    Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew

    2012-12-20

    The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

    PubMed

    Ricchetti, M; Fairhead, C; Dujon, B

    1999-11-04

    The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.

  16. Gene sequence analyses and other DNA-based methods for yeast species recognition

    USDA-ARS?s Scientific Manuscript database

    DNA sequence analyses, as well as other DNA-based methodologies, have transformed the way in which yeasts are identified. The focus of this chapter will be on the resolution of species using various types of DNA comparisons. In other chapters in this book, Rozpedowska, Piškur and Wolfe discuss mul...

  17. Draft genome sequence of the oleaginous yeast Cryptococcus curvatus ATCC 20509

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Close, Dan; Ojumu, John O.

    Cryptococcus curvatus ATCC 20509 is a commonly used nonmodel oleaginous yeast capable of converting a variety of carbon sources into fatty acids. In addition, we present the draft genome sequence of this popular organism to provide a means for more in-depth studies of its fatty acid production potential.

  18. Complete Genome Sequence of Kluyveromyces lactis Strain GG799, a Common Yeast Host for Heterologous Protein Expression

    PubMed Central

    Chuzel, Léa; Ganatra, Mehul B.; Schermerhorn, Kelly M.; Gardner, Andrew F.; Anton, Brian P.

    2017-01-01

    ABSTRACT We report the genome sequence of the dairy yeast Kluyveromyces lactis strain GG799 obtained using the Pacific Biosciences RS II platform. K. lactis strain GG799 is a common host for the expression of proteins at both laboratory and industrial scales. PMID:28751387

  19. Draft genome sequence of the oleaginous yeast Cryptococcus curvatus ATCC 20509

    DOE PAGES

    Close, Dan; Ojumu, John O.

    2016-11-03

    Cryptococcus curvatus ATCC 20509 is a commonly used nonmodel oleaginous yeast capable of converting a variety of carbon sources into fatty acids. In addition, we present the draft genome sequence of this popular organism to provide a means for more in-depth studies of its fatty acid production potential.

  20. High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast

    PubMed Central

    Liachko, Ivan; Youngblood, Rachel A.; Keich, Uri; Dunham, Maitreya J.

    2013-01-01

    DNA replication origins are necessary for the duplication of genomes. In addition, plasmid-based expression systems require DNA replication origins to maintain plasmids efficiently. The yeast autonomously replicating sequence (ARS) assay has been a valuable tool in dissecting replication origin structure and function. However, the dearth of information on origins in diverse yeasts limits the availability of efficient replication origin modules to only a handful of species and restricts our understanding of origin function and evolution. To enable rapid study of origins, we have developed a sequencing-based suite of methods for comprehensively mapping and characterizing ARSs within a yeast genome. Our approach finely maps genomic inserts capable of supporting plasmid replication and uses massively parallel deep mutational scanning to define molecular determinants of ARS function with single-nucleotide resolution. In addition to providing unprecedented detail into origin structure, our data have allowed us to design short, synthetic DNA sequences that retain maximal ARS function. These methods can be readily applied to understand and modulate ARS function in diverse systems. PMID:23241746

  1. Synthetic signal sequences that enable efficient secretory protein production in the yeast Kluyveromyces marxianus.

    PubMed

    Yarimizu, Tohru; Nakamura, Mikiko; Hoshida, Hisashi; Akada, Rinji

    2015-02-14

    Targeting of cellular proteins to the extracellular environment is directed by a secretory signal sequence located at the N-terminus of a secretory protein. These signal sequences usually contain an N-terminal basic amino acid followed by a stretch containing hydrophobic residues, although no consensus signal sequence has been identified. In this study, simple modeling of signal sequences was attempted using Gaussia princeps secretory luciferase (GLuc) in the yeast Kluyveromyces marxianus, which allowed comprehensive recombinant gene construction to substitute synthetic signal sequences. Mutational analysis of the GLuc signal sequence revealed that the GLuc hydrophobic peptide length was lower limit for effective secretion and that the N-terminal basic residue was indispensable. Deletion of the 16th Glu caused enhanced levels of secreted protein, suggesting that this hydrophilic residue defined the boundary of a hydrophobic peptide stretch. Consequently, we redesigned this domain as a repeat of a single hydrophobic amino acid between the N-terminal Lys and C-terminal Glu. Stretches consisting of Phe, Leu, Ile, or Met were effective for secretion but the number of residues affected secretory activity. A stretch containing sixteen consecutive methionine residues (M16) showed the highest activity; the M16 sequence was therefore utilized for the secretory production of human leukemia inhibitory factor protein in yeast, resulting in enhanced secreted protein yield. We present a new concept for the provision of secretory signal sequence ability in the yeast K. marxianus, determined by the number of residues of a single hydrophobic residue located between N-terminal basic and C-terminal acidic amino acid boundaries.

  2. Genomic and Phenotypic Characterization of Yeast Biosensor for Deep-space Radiation

    NASA Technical Reports Server (NTRS)

    Marina, Diana B.; Santa Maria, Sergio; Bhattacharya, Sharmila

    2016-01-01

    The BioSentinel mission was selected to launch as a secondary payload onboard NASA Exploration Mission 1 (EM-1) in 2018. In BioSentinel, the budding yeast Saccharomyces cerevisiae will be used as a biosensor to measure the long-term impact of deep-space radiation to living organisms. In the 4U-payload, desiccated yeast cells from different strains will be stored inside microfluidic cards equipped with 3-color LED optical detection system to monitor cell growth and metabolic activity. At different times throughout the 12-month mission, these cards will be filled with liquid yeast growth media to rehydrate and grow the desiccated cells. The growth and metabolic rates of wild-type and radiation-sensitive strains in deep-space radiation environment will be compared to the rates measured in the ground- and microgravity-control units. These rates will also be correlated with measurements obtained from onboard physical dosimeters. In our preliminary long-term desiccation study, we found that air-drying yeast cells in 10% trehalose is the best method of cell preservation in order to survive the entire 18-month mission duration (6-month pre-launch plus 12-month full-mission periods). However, our study also revealed that desiccated yeast cells have decreasing viability over time when stored in payload-like environment. This suggests that the yeast biosensor will have different population of cells at different time points during the long-term mission. In this study, we are characterizing genomic and phenotypic changes in our yeast biosensor due to long-term storage and desiccation. For each yeast strain that will be part of the biosensor, several clones were reisolated after long-term storage by desiccation. These clones were compared to their respective original isolate in terms of genomic composition, desiccation tolerance and radiation sensitivity. Interestingly, clones from a radiation-sensitive mutant have better desiccation tolerance compared to their original isolate without losing radiation sensitivity. We employed Next-Generation Sequencing technology to better understand this phenotypic variation. Current effort is focusing on the analysis of high-throughput sequencing data to look for genomic changes in these reisolated clones compared to their original isolate.

  3. Genome sequence of the lager brewing yeast, an interspecies hybrid.

    PubMed

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-04-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.

  4. Genome Sequence of the Lager Brewing Yeast, an Interspecies Hybrid

    PubMed Central

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-01-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production. PMID:19261625

  5. Replacement of the yeast TRP4 3' untranslated region by a hammerhead ribozyme results in a stable and efficiently exported mRNA that lacks a poly(A) tail.

    PubMed Central

    Düvel, Katrin; Valerius, Oliver; Mangus, David A; Jacobson, Allan; Braus, Gerhard H

    2002-01-01

    The mRNA poly(A) tail serves different purposes, including the facilitation of nuclear export, mRNA stabilization, efficient translation, and, finally, specific degradation. The posttranscriptional addition of a poly(A) tail depends on sequence motifs in the 3' untranslated region (3' UTR) of the mRNA and a complex trans-acting protein machinery. In this study, we have replaced the 3' UTR of the yeast TRP4 gene with sequences encoding a hammerhead ribozyme that efficiently cleaves itself in vivo. Expression of the TRP4-ribozyme allele resulted in the accumulation of a nonpolyadenylated mRNA. Cells expressing the TRP4-ribozyme mRNA showed a reduced growth rate due to a reduction in Trp4p enzyme activity. The reduction in enzyme activity was not caused by inefficient mRNA export from the nucleus or mRNA destabilization. Rather, analyses of mRNA association with polyribosomes indicate that translation of the ribozyme-containing mRNA is impaired. This translational defect allows sufficient synthesis of Trp4p to support growth of trp4 cells, but is, nevertheless, of such magnitude as to activate the general control network of amino acid biosynthesis. PMID:12003493

  6. Deciphering the Origin, Evolution, and Physiological Function of the Subtelomeric Aryl-Alcohol Dehydrogenase Gene Family in the Yeast Saccharomyces cerevisiae.

    PubMed

    Yang, Dong-Dong; de Billerbeck, Gustavo M; Zhang, Jin-Jing; Rosenzweig, Frank; Francois, Jean-Marie

    2018-01-01

    Homology searches indicate that Saccharomyces cerevisiae strain BY4741 contains seven redundant genes that encode putative aryl-alcohol dehydrogenases (AAD). Yeast AAD genes are located in subtelomeric regions of different chromosomes, and their functional role(s) remain enigmatic. Here, we show that two of these genes, AAD4 and AAD14 , encode functional enzymes that reduce aliphatic and aryl-aldehydes concomitant with the oxidation of cofactor NADPH, and that Aad4p and Aad14p exhibit different substrate preference patterns. Other yeast AAD genes are undergoing pseudogenization. The 5' sequence of AAD15 has been deleted from the genome. Repair of an AAD3 missense mutation at the catalytically essential Tyr 73 residue did not result in a functional enzyme. However, ancestral-state reconstruction by fusing Aad6 with Aad16 and by N-terminal repair of Aad10 restores NADPH-dependent aryl-alcohol dehydrogenase activities. Phylogenetic analysis indicates that AAD genes are narrowly distributed in wood-saprophyte fungi and in yeast that occupy lignocellulosic niches. Because yeast AAD genes exhibit activity on veratraldehyde, cinnamaldehyde, and vanillin, they could serve to detoxify aryl-aldehydes released during lignin degradation. However, none of these compounds induce yeast AAD gene expression, and Aad activities do not relieve aryl-aldehyde growth inhibition. Our data suggest an ancestral role for AAD genes in lignin degradation that is degenerating as a result of yeast's domestication and use in brewing, baking, and other industrial applications. IMPORTANCE Functional characterization of hypothetical genes remains one of the chief tasks of the postgenomic era. Although the first Saccharomyces cerevisiae genome sequence was published over 20 years ago, 22% of its estimated 6,603 open reading frames (ORFs) remain unverified. One outstanding example of this category of genes is the enigmatic seven-member AAD family. Here, we demonstrate that proteins encoded by two members of this family exhibit aliphatic and aryl-aldehyde reductase activity, and further that such activity can be recovered from pseudogenized AAD genes via ancestral-state reconstruction. The phylogeny of yeast AAD genes suggests that these proteins may have played an important ancestral role in detoxifying aromatic aldehydes in ligninolytic fungi. However, in yeast adapted to niches rich in sugars, AAD genes become subject to mutational erosion. Our findings shed new light on the selective pressures and molecular mechanisms by which genes undergo pseudogenization. Copyright © 2017 Yang et al.

  7. Deciphering the Origin, Evolution, and Physiological Function of the Subtelomeric Aryl-Alcohol Dehydrogenase Gene Family in the Yeast Saccharomyces cerevisiae

    PubMed Central

    de Billerbeck, Gustavo M.; Zhang, Jin-jing; Rosenzweig, Frank

    2017-01-01

    ABSTRACT Homology searches indicate that Saccharomyces cerevisiae strain BY4741 contains seven redundant genes that encode putative aryl-alcohol dehydrogenases (AAD). Yeast AAD genes are located in subtelomeric regions of different chromosomes, and their functional role(s) remain enigmatic. Here, we show that two of these genes, AAD4 and AAD14, encode functional enzymes that reduce aliphatic and aryl-aldehydes concomitant with the oxidation of cofactor NADPH, and that Aad4p and Aad14p exhibit different substrate preference patterns. Other yeast AAD genes are undergoing pseudogenization. The 5′ sequence of AAD15 has been deleted from the genome. Repair of an AAD3 missense mutation at the catalytically essential Tyr73 residue did not result in a functional enzyme. However, ancestral-state reconstruction by fusing Aad6 with Aad16 and by N-terminal repair of Aad10 restores NADPH-dependent aryl-alcohol dehydrogenase activities. Phylogenetic analysis indicates that AAD genes are narrowly distributed in wood-saprophyte fungi and in yeast that occupy lignocellulosic niches. Because yeast AAD genes exhibit activity on veratraldehyde, cinnamaldehyde, and vanillin, they could serve to detoxify aryl-aldehydes released during lignin degradation. However, none of these compounds induce yeast AAD gene expression, and Aad activities do not relieve aryl-aldehyde growth inhibition. Our data suggest an ancestral role for AAD genes in lignin degradation that is degenerating as a result of yeast's domestication and use in brewing, baking, and other industrial applications. IMPORTANCE Functional characterization of hypothetical genes remains one of the chief tasks of the postgenomic era. Although the first Saccharomyces cerevisiae genome sequence was published over 20 years ago, 22% of its estimated 6,603 open reading frames (ORFs) remain unverified. One outstanding example of this category of genes is the enigmatic seven-member AAD family. Here, we demonstrate that proteins encoded by two members of this family exhibit aliphatic and aryl-aldehyde reductase activity, and further that such activity can be recovered from pseudogenized AAD genes via ancestral-state reconstruction. The phylogeny of yeast AAD genes suggests that these proteins may have played an important ancestral role in detoxifying aromatic aldehydes in ligninolytic fungi. However, in yeast adapted to niches rich in sugars, AAD genes become subject to mutational erosion. Our findings shed new light on the selective pressures and molecular mechanisms by which genes undergo pseudogenization. PMID:29079624

  8. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Piskur, Jure; Ling, Zhihao; Marcet-Houben, Marina

    2012-03-14

    The yeast Dekkera/Brettanomyces bruxellensis can cause enormous economic losses in wine industry due to production of phenolic off-flavor compounds. D. bruxellensis is a distant relative of baker's yeast Saccharomyces cerevisiae. Nevertheless, these two yeasts are often found in the same habitats and share several food-related traits, such as production of high ethanol levels and ability to grow without oxygen. In some food products, like lambic beer, D. bruxellensis can importantly contribute to flavor development. We determined the 13.4 Mb genome sequence of the D. bruxellensis strain Y879 (CBS2499) and deduced the genetic background of several ?food-relevant? properties and evolutionary historymore » of this yeast. Surprisingly, we find that this yeast is phylogenetically distant to other food-related yeasts and most related to Pichia (Komagataella) pastoris, which is an aerobic poor ethanol producer. We further show that the D. bruxellensis genome does not contain an excess of lineage specific duplicated genes nor a horizontally transferred URA1 gene, two crucial events that promoted the evolution of the food relevant traits in the S. cerevisiae lineage. However, D. bruxellensis has several independently duplicated ADH and ADH-like genes, which are likely responsible for metabolism of alcohols, including ethanol, and also a range of aromatic compounds.« less

  9. Yeast diversity during the fermentation of Andean chicha: A comparison of high-throughput sequencing and culture-dependent approaches.

    PubMed

    Mendoza, Lucía M; Neef, Alexander; Vignolo, Graciela; Belloch, Carmela

    2017-10-01

    Diversity and dynamics of yeasts associated with the fermentation of Argentinian maize-based beverage chicha was investigated. Samples taken at different stages from two chicha productions were analyzed by culture-dependent and culture-independent methods. Five hundred and ninety six yeasts were isolated by classical microbiological methods and 16 species identified by RFLPs and sequencing of D1/D2 26S rRNA gene. Genetic typing of isolates from the dominant species, Saccharomyces cerevisiae, by PCR of delta elements revealed up to 42 different patterns. High-throughput sequencing (HTS) of D1/D2 26S rRNA gene amplicons from chicha samples detected more than one hundred yeast species and almost fifty filamentous fungi taxa. Analysis of the data revealed that yeasts dominated the fermentation, although, a significant percentage of filamentous fungi appeared in the first step of the process. Statistical analysis of results showed that very few taxa were represented by more than 1% of the reads per sample at any step of the process. S. cerevisiae represented more than 90% of the reads in the fermentative samples. Other yeast species dominated the pre-fermentative steps and abounded in fermented samples when S. cerevisiae was in percentages below 90%. Most yeasts species detected by pyrosequencing were not recovered by cultivation. In contrast, the cultivation-based methodology detected very few yeast taxa, and most of them corresponded with very few reads in the pyrosequencing analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Active role of a human genomic insert in replication of a yeast artificial chromosome.

    PubMed

    van Brabant, A J; Fangman, W L; Brewer, B J

    1999-06-01

    Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

  11. Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

    PubMed Central

    Erickson, J. R.; Johnston, M.

    1993-01-01

    We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

  12. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

    PubMed Central

    2012-01-01

    Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

  13. Advances in yeast systematics and phylogeny and their use as predictors of biotechnologically important metabolic pathways

    USDA-ARS?s Scientific Manuscript database

    Detection, identification, and classification of yeasts have undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of t...

  14. Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

    PubMed

    Hopper, A K; Schultz, L D; Shapiro, R A

    1980-03-01

    By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

  15. CYP98A6 from Lithospermum erythrorhizon encodes 4-coumaroyl-4'-hydroxyphenyllactic acid 3-hydroxylase involved in rosmarinic acid biosynthesis.

    PubMed

    Matsuno, Michiyo; Nagatsu, Akito; Ogihara, Yukio; Ellis, Brian E; Mizukami, Hajime

    2002-03-13

    Rosmarinic acid is the dominant hydroxycinnamic acid ester accumulated in Boraginaceae and Lamiaceae plants. A cytochrome P450 cDNA was isolated by differential display from cultured cells of Lithospermum erythrorhizon, and the gene product was designated CYP98A6 based on the deduced amino acid sequence. After expression in yeast, the P450 was shown to catalyze the 3-hydroxylation of 4-coumaroyl-4'-hydroxyphenyllactic acid, one of the final two steps leading to rosmarinic acid. The expression level of CYP98A6 is dramatically increased by addition of yeast extract or methyl jasmonate to L. erythrorhizon cells, and its expression pattern reflected the elicitor-induced change in rosmarinic acid production, indicating that CYP98A6 plays an important role in regulation of rosmarinic acid biosynthesis.

  16. Construction of a laccase chimerical gene: recombinant protein characterization and gene expression via yeast surface display.

    PubMed

    Bleve, G; Lezzi, C; Spagnolo, S; Rampino, P; Perrotta, C; Mita, G; Grieco, Francesco

    2014-03-01

    The ERY4 laccase gene from Pleurotus eryngii was expressed in Saccharomyces cerevisiae and the recombinant laccase resulted to be not biologically active. This gene was thus modified to obtain chimerical enzymes derived from the substitution of N-, C- and both N- and C-terminal regions with the corresponding regions of Ery3 laccase, another laccase isoform of P. eryngii. The chimerical isoform named 4NC3, derived from the substitution of both N- and C-terminal regions, showed the best performances in terms of enzymatic activities, affinities for different substrates and stability at a broad range of temperatures and pHs. The chimerical 4NC3 laccase isoform was displayed on the cell surface of S. cerevisiae using the N-terminal fusion with either the Pir2 or the Flo1 S. cerevisiae proteins as anchor attachment sequence. Immunofluorescence microscopy and Western blot analyses confirmed the localization of 4NC3 on the yeast cell surface. The enzyme activity on specific laccase substrates revealed that 4NC3 laccase was immobilized in active form on the cell surface. To our knowledge, this is the first example of expression of a chimerical fungal laccase by yeast cell display.

  17. (GTG)5 MSP-PCR fingerprinting as a technique for discrimination of wine associated yeasts?

    PubMed

    Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure.

  18. (GTG)5 MSP-PCR Fingerprinting as a Technique for Discrimination of Wine Associated Yeasts?

    PubMed Central

    Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure. PMID:25171185

  19. Purification and characterization of a novel extracellular inulinase from a new yeast species Candida kutaonensis sp. nov. KRF1(T).

    PubMed

    Yuan, Bo; Hu, Nan; Sun, Juan; Wang, Shi-An; Li, Fu-Li

    2012-12-01

    A novel extracellular exoinulinase was purified and characterized from a new yeast strain KRF1(T), and the gene encoding the enzyme was successfully cloned. The enzyme was stable at low pH between 3.0 and 6.5. The K (m) and V (max) values of the purified enzyme for inulin were 2.3 mg/mL and 4.8 mg/min, respectively. The optimum temperature of the inulinase was 50 °C, and the enzyme remained 78 % of activity at 60 °C for 2 h. The inulinase showed an amino acid sequence identity of 58 % to its closest homolog in Meyerozyma (Pichia) guilliermondii. In the secondary structure, the domain G (VMEVH) of the enzyme contained three unique residues (V, M, and H). Compared with previously reported inulinases, the enzyme from strain KRF1(T) displayed strong acid resistance, notable thermostability, and high affinity for the substrate of inulin. Based on sequence analysis of the 26S rDNA D1/D2 domain and phenotypic characterization, the yeast strain KRF1(T) was found to represent a novel anamorphic, ascomycetous yeast species. A complete description of the species is given and the name Candida kutaonensis sp. nov (type strain = KRF1(T) = AS 2.4027(T) = CBS 11388(T)) is proposed.

  20. GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

    PubMed Central

    Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.

    2014-01-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708

  1. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    PubMed

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  2. Yeast diversity isolated from grape musts during spontaneous fermentation from a Brazilian winery.

    PubMed

    Bezerra-Bussoli, Carolina; Baffi, Milla Alves; Gomes, Eleni; Da-Silva, Roberto

    2013-09-01

    Saccharomyces and non-Saccharomyces yeast species from a winery located in Brazil were identified by ribosomal gene-sequencing analysis. A total of 130 yeast strains were isolated from grape surfaces and musts during alcoholic fermentation from Isabel, Bordeaux, and Cabernet Sauvignon varieties. Samples were submitted to PCR-RFLP analysis and genomic sequencing. Thirteen species were identified: Candida quercitrusa, Candida stellata, Cryptococcus flavescens, Cryptococcus laurentii, Hanseniaspora uvarum, Issatchenkia occidentalis, Issatchenkia orientalis, Issatchenkia terricola, Pichia kluyveri, Pichia guilliermondii, Pichia sp., Saccharomyces cerevisiae, and Sporidiobolus pararoseus. A sequential substitution of species during the different stages of fermentation, with a dominance of non-Saccharomyces yeasts at the beginning, and a successive replacement of species by S. cerevisiae strains at the final steps were observed. This is the first report about the yeast distribution present throughout the alcoholic fermentation in a Brazilian winery, providing supportive information for future studies on their contribution to wine quality.

  3. The new modern era of yeast genomics: community sequencing and the resulting annotation of multiple Saccharomyces cerevisiae strains at the Saccharomyces Genome Database

    PubMed Central

    Engel, Stacia R.; Cherry, J. Michael

    2013-01-01

    The first completed eukaryotic genome sequence was that of the yeast Saccharomyces cerevisiae, and the Saccharomyces Genome Database (SGD; http://www.yeastgenome.org/) is the original model organism database. SGD remains the authoritative community resource for the S. cerevisiae reference genome sequence and its annotation, and continues to provide comprehensive biological information correlated with S. cerevisiae genes and their products. A diverse set of yeast strains have been sequenced to explore commercial and laboratory applications, and a brief history of those strains is provided. The publication of these new genomes has motivated the creation of new tools, and SGD will annotate and provide comparative analyses of these sequences, correlating changes with variations in strain phenotypes and protein function. We are entering a new era at SGD, as we incorporate these new sequences and make them accessible to the scientific community, all in an effort to continue in our mission of educating researchers and facilitating discovery. Database URL: http://www.yeastgenome.org/ PMID:23487186

  4. Set1/COMPASS and Mediator are repurposed to promote epigenetic transcriptional memory.

    PubMed

    D'Urso, Agustina; Takahashi, Yoh-Hei; Xiong, Bin; Marone, Jessica; Coukos, Robert; Randise-Hinchliff, Carlo; Wang, Ji-Ping; Shilatifard, Ali; Brickner, Jason H

    2016-06-23

    In yeast and humans, previous experiences can lead to epigenetic transcriptional memory: repressed genes that exhibit mitotically heritable changes in chromatin structure and promoter recruitment of poised RNA polymerase II preinitiation complex (RNAPII PIC), which enhances future reactivation. Here, we show that INO1 memory in yeast is initiated by binding of the Sfl1 transcription factor to the cis-acting Memory Recruitment Sequence, targeting INO1 to the nuclear periphery. Memory requires a remodeled form of the Set1/COMPASS methyltransferase lacking Spp1, which dimethylates histone H3 lysine 4 (H3K4me2). H3K4me2 recruits the SET3C complex, which plays an essential role in maintaining this mark. Finally, while active INO1 is associated with Cdk8(-) Mediator, during memory, Cdk8(+) Mediator recruits poised RNAPII PIC lacking the Kin28 CTD kinase. Aspects of this mechanism are generalizable to yeast and conserved in human cells. Thus, COMPASS and Mediator are repurposed to promote epigenetic transcriptional poising by a highly conserved mechanism.

  5. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

    PubMed Central

    Williams, N P; Mueller, P P; Hinnebusch, A G

    1988-01-01

    Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

  6. Infant feeding patterns and eczema in children in the first 6 years of life.

    PubMed

    Soto-Ramírez, N; Kar, S; Zhang, H; Karmaus, W

    2017-10-01

    Modes of infant feeding such as direct and indirect breastfeeding, and formula feeding, and their combinations may play a role in child health. The aim was to investigate which feeding patterns in the first 6 months pose risks of eczema/skin allergy in children up to 6 years compared to direct breastfeeding for at least 3 months. The Infant Feeding Practices Study II in the United States and its 6-year follow-up provided data on feeding modes in infancy and doctor's diagnosed eczema/skin allergy in the first 6 years of life (1387 infants), based on parental reports. Different feeding patterns were identified. Log-linear models were used to estimate prevalence ratios (PRs) of feeding patterns for doctor's diagnosed eczema/skin allergy in the first 6 years of life, adjusting for confounders. Compared to "direct breastfeeding for at least 3 months" (DBF3m), the combination of "direct feeding at the breast (DBF), pumping and feeding breast milk (BM), and formula (FF) in the first months" (DBF/BM/FF) showed a statistically significant higher risk of eczema/skin allergy in the first 6 years of life (PR = 1.46), adjusting for confounders. DBF combined with BM for the first 3 months followed by mixed feeding also had an increased risk (PR = 1.26), although not statistically significant. Formula feeding introduced since birth had no effect on eczema. Among the confounders, paternal eczema and race/ethnicity (Hispanic vs White) were associated with a higher risk of eczema/skin allergy. Mixed infant feeding may carry a higher risk of eczema/skin allergy compared to direct feeding at the breast. The recent epidemic of pumping and feeding in the United States and the use of mixed infant feeding modes requires additional studies to provide appropriate and renewed assessments of the risks of feeding modes for the future development of allergies. © 2017 John Wiley & Sons Ltd.

  7. The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells

    DTIC Science & Technology

    2007-04-01

    and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast

  8. Cyberlindnera xylolytica sp. nov., a xylitol-producing yeast species isolated from lignocellulosic materials

    USDA-ARS?s Scientific Manuscript database

    Independent surveys of yeasts associated with lignocellulosic-related materials led to the discovery of a novel yeast species belonging to the Cyberlindnera clade (Saccharomycotina, Ascomycota). Analysis of the sequences of the internal transcribed spacer (ITS) region and the D1/D2 domains of the la...

  9. Use of CYP52A2A promoter to increase gene expression in yeast

    DOEpatents

    Craft, David L.; Wilson, C. Ron; Eirich, Dudley; Zhang, Yeyan

    2004-01-06

    A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

  10. Genomic Sequence of Saccharomyces cerevisiae BAW-6, a Yeast Strain Optimal for Brewing Barley Shochu.

    PubMed

    Kajiwara, Yasuhiro; Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takegawa, Kaoru; Takashita, Hideharu

    2018-04-05

    Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. Copyright © 2018 Kajiwara et al.

  11. Genomic Sequence of Saccharomyces cerevisiae BAW-6, a Yeast Strain Optimal for Brewing Barley Shochu

    PubMed Central

    Mori, Kazuki; Tashiro, Kosuke; Higuchi, Yujiro; Takashita, Hideharu

    2018-01-01

    ABSTRACT Here, we report the draft genome sequence of Saccharomyces cerevisiae strain BAW-6, which is used for the production of barley shochu, a traditional Japanese spirit. This genomic information can be used to elucidate the genetic basis underlying the high alcohol production capacity and citric acid tolerance of shochu yeast. PMID:29622617

  12. Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eid, Rawan; Department of Biology, Queen's University, Kingston, Ontario; Boucher, Eric

    Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomycesmore » cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress. - Highlights: • Human ferritin, heavy polypeptide 1 (FTH1) was identified as a suppressor of the pro-apoptotic Bax in yeast. • Based on its similarity to ferritin we examined Rgi1p/YER067W for potential ferritin like functions. • Like human H-ferritin, RGI1 confers increased resistance to apoptotic inducing stresses in yeast. • Rgi1p is a pro-survival protein that is not a ferritin but that may play a role in iron metabolism of yeast.« less

  13. Functional mapping of yeast genomes by saturated transposition

    PubMed Central

    Michel, Agnès H; Hatakeyama, Riko; Kimmig, Philipp; Arter, Meret; Peter, Matthias; Matos, Joao; De Virgilio, Claudio; Kornmann, Benoît

    2017-01-01

    Yeast is a powerful model for systems genetics. We present a versatile, time- and labor-efficient method to functionally explore the Saccharomyces cerevisiae genome using saturated transposon mutagenesis coupled to high-throughput sequencing. SAturated Transposon Analysis in Yeast (SATAY) allows one-step mapping of all genetic loci in which transposons can insert without disrupting essential functions. SATAY is particularly suited to discover loci important for growth under various conditions. SATAY (1) reveals positive and negative genetic interactions in single and multiple mutant strains, (2) can identify drug targets, (3) detects not only essential genes, but also essential protein domains, (4) generates both null and other informative alleles. In a SATAY screen for rapamycin-resistant mutants, we identify Pib2 (PhosphoInositide-Binding 2) as a master regulator of TORC1. We describe two antagonistic TORC1-activating and -inhibiting activities located on opposite ends of Pib2. Thus, SATAY allows to easily explore the yeast genome at unprecedented resolution and throughput. DOI: http://dx.doi.org/10.7554/eLife.23570.001 PMID:28481201

  14. Genomic and probiotic characterization of SJP-SNU strain of Pichia kudriavzevii.

    PubMed

    Hong, Seung-Min; Kwon, Hyuk-Joon; Park, Se-Joon; Seong, Won-Jin; Kim, Ilhwan; Kim, Jae-Hong

    2018-05-17

    The yeast strain SJP-SNU was investigated as a probiotic and was characterized with respect to growth temperature, bile salt resistance, hydrogen sulfide reducing activity, intestinal survival ability and chicken embryo pathogenicity. In addition, we determined the complete genomic and mitochondrial sequences of SJP-SNU and conducted comparative genomics analyses. SJP-SNU grew rapidly at 37 °C and formed colonies on MacConkey agar containing bile salt. SJP-SNU reduced hydrogen sulfide produced by Salmonella serotype Enteritidis and, after being fed to 4-week-old chickens, could be isolated from cecal feces. SJP-SNU did not cause mortality in 10-day-old chicken embryos. From 13 initial contigs, 11 were finally assembled and represented 10 chromosomal sequences and 1 mitochondrial DNA sequence. Comparative genomic analyses revealed that SJP-SNU was a strain of Pichia kudriavzevii. Although SJP-SNU possesses pathogenicity-related genes, they showed very low amino acid sequence identities to those of Candida albicans. Furthermore, SJP-SNU possessed useful genes, such as phytases and cellulase. Thus, SJP-SNU is a useful yeast possessing the basic traits of a probiotic, and further studies to demonstrate its efficacy as a probiotic in the future may be warranted.

  15. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-03-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress.

  16. Unexpected expansion of tRNA substrate recognition by the yeast m1G9 methyltransferase Trm10.

    PubMed

    Swinehart, William E; Henderson, Jeremy C; Jackman, Jane E

    2013-08-01

    N-1 Methylation of the nearly invariant purine residue found at position 9 of tRNA is a nucleotide modification found in multiple tRNA species throughout Eukarya and Archaea. First discovered in Saccharomyces cerevisiae, the tRNA methyltransferase Trm10 is a highly conserved protein both necessary and sufficient to catalyze all known instances of m1G9 modification in yeast. Although there are 19 unique tRNA species that contain a G at position 9 in yeast, and whose fully modified sequence is known, only 9 of these tRNA species are modified with m1G9 in wild-type cells. The elements that allow Trm10 to distinguish between structurally similar tRNA species are not known, and sequences that are shared between all substrate or all nonsubstrate tRNAs have not been identified. Here, we demonstrate that the in vitro methylation activity of yeast Trm10 is not sufficient to explain the observed pattern of modification in vivo, as additional tRNA species are substrates for Trm10 m1G9 methyltransferase activity. Similarly, overexpression of Trm10 in yeast yields m1G9 containing tRNA species that are ordinarily unmodified in vivo. Thus, yeast Trm10 has a significantly broader tRNA substrate specificity than is suggested by the observed pattern of modification in wild-type yeast. These results may shed light onto the suggested involvement of Trm10 in other pathways in other organisms, particularly in higher eukaryotes that contain up to three different genes with sequence similarity to the single TRM10 gene in yeast, and where these other enzymes have been implicated in pathways beyond tRNA processing.

  17. Candida northwykensis sp. nov., a novel yeast isolated from the gut of the click beetle Melanotus villosus.

    PubMed

    Ravella, Sreenivas Rao; Donovan, Neil; James, Stephen A; Shivaji, Sisinthy; Arunasri, Kotakonda; Bond, Christopher J; Roberts, Ian N; Hobbs, Phil J

    2011-08-01

    Two yeast morphotypes, BET 4(T) and BET 7, were isolated from the gut of click beetle Melanotus villosus. Click beetles were collected from the decaying timber within the woodlands of North Wyke Research, South West England, UK (latitude, 50°46'29″N; longitude, 3°55'23″W). Morphotype BET 7 was identified as Debaryomyces hansenii, and the other morphotype, BET 4(T), was found to differ from Priceomyces castillae and Priceomyces haplophilus, its closest phylogenetic neighbours, by 5.0% with respect to the nucleotide sequence of the D1/D2 domain of the large-subunit (LSU) rRNA gene, and by 8.0% with respect to the ribosomal internal-transcribed spacer (ITS) region. BET 4(T) also differ from P. castillae and P. haplophilus in a number of different phenotypic characteristics. Thus, based on the unique nucleotide sequences of its D1/D2 domain and ITS region, its physiological characteristics and an inability to sporulate, strain BET 4(T) is assigned the status of a new species of Candida, for which the name Candida northwykensis sp. nov., is proposed. The type strain is BET 4(T) (NCYC 3525(T) = CBS 11370(T)).

  18. Production of recombinant porcine colipase secreted by Pichia pastoris and its application to improve dietary fat digestion and growth of postweaning piglets.

    PubMed

    Liu, Fang-Chueh; Chen, Hsiao-Ling; Chong, Kowit-Yu; Hsu, A-Li; Chen, Chuan-Mu

    2008-01-01

    Recombinant porcine pancreatic colipase (pCoL) was produced in the methylotrophic yeast Pichia pastoris. A synthetic yeast secretion cassette was constructed with the constitutive promoter of the glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene and the yeast alpha-mating factor signal peptide. The pCoL cDNA corresponding in the coding sequence, excluding a 16-amino acid segment of the native signal sequence, was cloned into the pGAPZalphaB vector and integrated into the genome of P. pastoris. Yeast transformants were cultured and bioactive pCoL protein was detected in the supernatant at a high-level of 126.8 mg/L after 3 days of culture. The transformed yeast containing the highest recombinant colipase level (pCoL yeast) and native yeast GS 115 not containing pCoL (non-pCoL yeast, as a control group) were separately cultured and the supernatants were adsorbed by dried skim milk. In an animal trial, two concentrations of colipase activity (0 vs. 5,000 U/kg in the diet) were blended with the pig corn-soybean basal diet and fed to weaned piglets for 4 weeks. The pCoL-administrated test group gained significantly more weight than piglets in the control group when measured at Day 15 (11.84 +/- 0.70 vs. 10.59 +/- 0.39 kg, P < 0.05), Day 22 (15.84 +/- 0.95 vs. 14.32 +/- 0.59 kg, P < 0.01), and Day 28 (20.19 +/- 1.47 vs. 18.54 +/- 0.92 kg, P < 0.01) after weaning. The blood triglyceride (TG) concentrations were significantly increased in the experimental test group that received recombinant colipase on the 28th day of postweaning when compared with that of the control group (32.50 vs. 16.37 mg/dL; P < 0.0001). These experimental data suggest that the use of recombinant porcine colipase as a dietary supplement provides an alternative approach for improving fat digestion and enhancing growth in postweaning piglets.

  19. Rapid Identification of Cryptococcus neoformans var. grubii, C. neoformans var. neoformans, and C. gattii by Use of Rapid Biochemical Tests, Differential Media, and DNA Sequencing ▿

    PubMed Central

    McTaggart, Lisa; Richardson, Susan E.; Seah, Christine; Hoang, Linda; Fothergill, Annette; Zhang, Sean X.

    2011-01-01

    Rapid identification of Cryptococcus neoformans var. grubii, Cryptococcus neoformans var. neoformans, and Cryptococcus gattii is imperative for facilitation of prompt treatment of cryptococcosis and for understanding the epidemiology of the disease. Our purpose was to evaluate a test algorithm incorporating commercial rapid biochemical tests, differential media, and DNA sequence analysis that will allow us to differentiate these taxa rapidly and accurately. We assessed 147 type, reference, and clinical isolates, including 6 other Cryptococcus spp. (10 isolates) and 14 other yeast species (24 isolates), using a 4-hour urea broth test (Remel), a 24-hour urea broth test (Becton Dickinson), a 4-hour caffeic acid disk test (Hardy Diagnostics and Remel), 40- to 44-hour growth assessment on l-canavanine glycine bromothymol blue (CGB) agar, and intergenic spacer (IGS) sequence analysis. All 123 Cryptococcus isolates hydrolyzed urea, along with 7 isolates of Rhodotorula and Trichosporon. Eighty-five of 86 C. neoformans (99%) and 26 of 27 C. gattii (96%) isolates had positive caffeic acid results, unlike the other cryptococci (0/10) and yeast species (0/24). Together, these two tests positively identified virtually all C. neoformans/C. gattii isolates (98%) within 4 h. CGB agar or IGS sequencing further differentiated these isolates within 48 h. On CGB, 25 of 27 (93%) C. gattii strains induced a blue color change, in contrast to 0 of 86 C. neoformans isolates. Neighbor-joining cluster analysis of IGS sequences differentiated C. neoformans var. grubii, C. neoformans var. neoformans, and C. gattii. Based on these results, we describe a rapid identification algorithm for use in a microbiology laboratory to distinguish clinically relevant Cryptococcus spp. PMID:21593254

  20. Rapid identification of Cryptococcus neoformans var. grubii, C. neoformans var. neoformans, and C. gattii by use of rapid biochemical tests, differential media, and DNA sequencing.

    PubMed

    McTaggart, Lisa; Richardson, Susan E; Seah, Christine; Hoang, Linda; Fothergill, Annette; Zhang, Sean X

    2011-07-01

    Rapid identification of Cryptococcus neoformans var. grubii, Cryptococcus neoformans var. neoformans, and Cryptococcus gattii is imperative for facilitation of prompt treatment of cryptococcosis and for understanding the epidemiology of the disease. Our purpose was to evaluate a test algorithm incorporating commercial rapid biochemical tests, differential media, and DNA sequence analysis that will allow us to differentiate these taxa rapidly and accurately. We assessed 147 type, reference, and clinical isolates, including 6 other Cryptococcus spp. (10 isolates) and 14 other yeast species (24 isolates), using a 4-hour urea broth test (Remel), a 24-hour urea broth test (Becton Dickinson), a 4-hour caffeic acid disk test (Hardy Diagnostics and Remel), 40- to 44-hour growth assessment on l-canavanine glycine bromothymol blue (CGB) agar, and intergenic spacer (IGS) sequence analysis. All 123 Cryptococcus isolates hydrolyzed urea, along with 7 isolates of Rhodotorula and Trichosporon. Eighty-five of 86 C. neoformans (99%) and 26 of 27 C. gattii (96%) isolates had positive caffeic acid results, unlike the other cryptococci (0/10) and yeast species (0/24). Together, these two tests positively identified virtually all C. neoformans/C. gattii isolates (98%) within 4 h. CGB agar or IGS sequencing further differentiated these isolates within 48 h. On CGB, 25 of 27 (93%) C. gattii strains induced a blue color change, in contrast to 0 of 86 C. neoformans isolates. Neighbor-joining cluster analysis of IGS sequences differentiated C. neoformans var. grubii, C. neoformans var. neoformans, and C. gattii. Based on these results, we describe a rapid identification algorithm for use in a microbiology laboratory to distinguish clinically relevant Cryptococcus spp.

  1. Genome Sequencing and Comparative Analysis of Saccharomyces cerevisiae Strains of the Peterhof Genetic Collection

    PubMed Central

    Drozdova, Polina B.; Tarasov, Oleg V.; Matveenko, Andrew G.; Radchenko, Elina A.; Sopova, Julia V.; Polev, Dmitrii E.; Inge-Vechtomov, Sergey G.; Dobrynin, Pavel V.

    2016-01-01

    The Peterhof genetic collection of Saccharomyces cerevisiae strains (PGC) is a large laboratory stock that has accumulated several thousands of strains for over than half a century. It originated independently of other common laboratory stocks from a distillery lineage (race XII). Several PGC strains have been extensively used in certain fields of yeast research but their genomes have not been thoroughly explored yet. Here we employed whole genome sequencing to characterize five selected PGC strains including one of the closest to the progenitor, 15V-P4, and several strains that have been used to study translation termination and prions in yeast (25-25-2V-P3982, 1B-D1606, 74-D694, and 6P-33G-D373). The genetic distance between the PGC progenitor and S288C is comparable to that between two geographically isolated populations. The PGC seems to be closer to two bakery strains than to S288C-related laboratory stocks or European wine strains. In genomes of the PGC strains, we found several loci which are absent from the S288C genome; 15V-P4 harbors a rare combination of the gene cluster characteristic for wine strains and the RTM1 cluster. We closely examined known and previously uncharacterized gene variants of particular strains and were able to establish the molecular basis for known phenotypes including phenylalanine auxotrophy, clumping behavior and galactose utilization. Finally, we made sequencing data and results of the analysis available for the yeast community. Our data widen the knowledge about genetic variation between Saccharomyces cerevisiae strains and can form the basis for planning future work in PGC-related strains and with PGC-derived alleles. PMID:27152522

  2. LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

    PubMed Central

    Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

    1996-01-01

    We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. As in previous editions the genetic names are consistently associated to each sequence with a known and confirmed ORF. If necessary, synonyms are given in the case of allelic duplicated sequences. Although the first publication of a sequence gives-according to our rules-the genetic name of a gene, in some instances more commonly used names are given to avoid nomenclature problems and the use of ancient designations which are no longer used. In these cases the old designation is given as synonym. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, SWISSPROT and EMBL accession numbers. New entries will also contain the name from the systematic sequencing efforts. Since the release of LISTA4.1 we update the database continuously. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. This release includes reports from full Smith and Watermann peptide-level searches against a non-redundant protein sequence database. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). The database is available by FTP and on World Wide Web. PMID:8594599

  3. High-throughput analysis of the protein sequence-stability landscape using a quantitative "yeast surface two-hybrid" system and fragment reconstitution

    PubMed Central

    Dutta, Sanjib; Koide, Akiko; Koide, Shohei

    2008-01-01

    Stability evaluation of many mutants can lead to a better understanding of the sequence determinants of a structural motif and of factors governing protein stability and protein evolution. The traditional biophysical analysis of protein stability is low throughput, limiting our ability to widely explore the sequence space in a quantitative manner. In this study, we have developed a high-throughput library screening method for quantifying stability changes, which is based on protein fragment reconstitution and yeast surface display. Our method exploits the thermodynamic linkage between protein stability and fragment reconstitution and the ability of the yeast surface display technique to quantitatively evaluate protein-protein interactions. The method was applied to a fibronectin type III (FN3) domain. Characterization of fragment reconstitution was facilitated by the co-expression of two FN3 fragments, thus establishing a "yeast surface two-hybrid" method. Importantly, our method does not rely on competition between clones and thus eliminates a common limitation of high-throughput selection methods in which the most stable variants are predominantly recovered. Thus, it allows for the isolation of sequences that exhibits a desired level of stability. We identified over one hundred unique sequences for a β-bulge motif, which was significantly more informative than natural sequences of the FN3 family in revealing the sequence determinants for the β-bulge. Our method provides a powerful means to rapidly assess stability of many variants, to systematically assess contribution of different factors to protein stability and to enhance protein stability. PMID:18674545

  4. Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer

    DTIC Science & Technology

    2015-09-01

    Award Number: W81XWH-12-1-0333 TITLE: Determining the Location of DNA Modification and Mutation Caused by UVB Light in Skin Cancer PRINCIPAL...COVERED 15 Aug 2012 – 14 Aug 2015 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-12-1-0333 Determining the Location of DNA Modification and Mutation ...sequencing libraries generated for both yeast and human cells show pyrimidine bias on the 5’ end, indicating that we are sequencing the dimers

  5. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla

    2015-01-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  6. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans.

    PubMed

    Shahin-Jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-Mohammadi, Shahla

    2016-05-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence.

  7. Modifying Expression Modes of Human Neurotensin Receptor Type 1 Alters Sensing Capabilities for Agonists in Yeast Signaling Biosensor.

    PubMed

    Hashi, Hiroki; Nakamura, Yasuyuki; Ishii, Jun; Kondo, Akihiko

    2018-04-01

    Neurotensin receptor type 1 (NTSR1), a member of the G-protein-coupled receptor (GPCR) family, is naturally activated by binding of a neurotensin peptide, leading to a variety of physiological effects. The budding yeast Saccharomyces cerevisiae is a proven host organism for assaying the agonistic activation of human GPCRs. Previous studies showed that yeast cells can functionally express human NTSR1 receptor, permitting the detection of neurotensin-promoted signaling using a ZsGreen fluorescent reporter gene. However, the fluorescence intensity (sensitivity) of NTSR1-expressing yeast cells is low compared to that of yeast cells expressing other human GPCRs (e.g., human somatostatin receptors). The present study sought to increase the sensitivity of the NTSR1-expressing yeast for use as a fluorescent biosensor, including modification of the expression of human NTSR1 in yeast. Changes in the transcription, translation, and transport of the receptor are attempted by altering the promoter, consensus Kozak-like sequence, and secretion signal sequences of the NTSR1-encoding gene. The resulting yeast cells exhibited increased sensitivity to exogenously added peptide. The cells are further engineered by using cell-surface display technology to ensure that the agonistic peptides are secreted and tethered to the yeast cell wall, yielding cells with enhanced NTSR1 activation. This yeast biosensor holds promise for the identification of agonists to treat NTSR1-related diseases. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Cross-referencing yeast genetics and mammalian genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hieter, P.; Basset, D.; Boguski, M.

    1994-09-01

    We have initiated a project that will systematically transfer information about yeast genes onto the genetic maps of mice and human beings. Rapidly expanding human EST data will serve as a source of candidate human homologs that will be repeatedly searched using yeast protein sequence queries. Search results will be automatically reported to participating labs. Human cDNA sequences from which the ESTs are derived will be mapped at high resolution in the human and mouse genomes. The comparative mapping information cross-references the genomic position of novel human cDNAs with functional information known about the cognate yeast genes. This should facilitatemore » the initial identification of genes responsible for mammalian mutant phenotypes, including human disease. In addition, the identification of mammalian homologs of yeast genes provides reagents for determining evolutionary conservation and for performing direct experiments in multicellular eukaryotes to enhance study of the yeast protein`s function. For example, ESTs homologous to CDC27 and CDC16 were identified, and the corresponding cDNA clones were obtained from ATTC, completely sequenced, and mapped on human and mouse chromosomes. In addition, the CDC17hs cDNA has been used to raise antisera to the CDC27Hs protein and used in subcellular localization experiments and junctional studies in mammalian cells. We have received funding from the National Center for Human Genome Research to provide a community resource which will establish comprehensive cross-referencing among yeast, human, and mouse loci. The project is set up as a service and information on how to communicate with this effort will be provided.« less

  9. Disseminated yeast (Order Saccharomycetales) infection in a Muscovy duckling (Cairina moschata)

    PubMed Central

    Ravi, Madhu; Hill, Janet E.; Fernando, Champika; Wobeser, Gary

    2016-01-01

    A Muscovy duckling was presented for necropsy due to ongoing mortalities on a farm. Microscopic examination revealed multisystemic inflammatory lesions with intralesional and intracytoplasmic yeast-like organisms. We identified these agents as yeast belonging to the Order Saccharomycetales based on sequence data obtained from the ribosomal RNA operon. PMID:27807382

  10. Yeast identification: reassessment of assimilation tests as sole universal identifiers.

    PubMed

    Spencer, J; Rawling, S; Stratford, M; Steels, H; Novodvorska, M; Archer, D B; Chandra, S

    2011-11-01

    To assess whether assimilation tests in isolation remain a valid method of identification of yeasts, when applied to a wide range of environmental and spoilage isolates. Seventy-one yeast strains were isolated from a soft drinks factory. These were identified using assimilation tests and by D1/D2 rDNA sequencing. When compared to sequencing, assimilation test identifications (MicroLog™) were 18·3% correct, a further 14·1% correct within the genus and 67·6% were incorrectly identified. The majority of the latter could be attributed to the rise in newly reported yeast species. Assimilation tests alone are unreliable as a universal means of yeast identification, because of numerous new species, variability of strains and increasing coincidence of assimilation profiles. Assimilation tests still have a useful role in the identification of common species, such as the majority of clinical isolates. It is probable, based on these results, that many yeast identifications reported in older literature are incorrect. This emphasizes the crucial need for accurate identification in present and future publications. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  11. Fungal genome sequencing: basic biology to biotechnology.

    PubMed

    Sharma, Krishna Kant

    2016-08-01

    The genome sequences provide a first glimpse into the genomic basis of the biological diversity of filamentous fungi and yeast. The genome sequence of the budding yeast, Saccharomyces cerevisiae, with a small genome size, unicellular growth, and rich history of genetic and molecular analyses was a milestone of early genomics in the 1990s. The subsequent completion of fission yeast, Schizosaccharomyces pombe and genetic model, Neurospora crassa initiated a revolution in the genomics of the fungal kingdom. In due course of time, a substantial number of fungal genomes have been sequenced and publicly released, representing the widest sampling of genomes from any eukaryotic kingdom. An ambitious genome-sequencing program provides a wealth of data on metabolic diversity within the fungal kingdom, thereby enhancing research into medical science, agriculture science, ecology, bioremediation, bioenergy, and the biotechnology industry. Fungal genomics have higher potential to positively affect human health, environmental health, and the planet's stored energy. With a significant increase in sequenced fungal genomes, the known diversity of genes encoding organic acids, antibiotics, enzymes, and their pathways has increased exponentially. Currently, over a hundred fungal genome sequences are publicly available; however, no inclusive review has been published. This review is an initiative to address the significance of the fungal genome-sequencing program and provides the road map for basic and applied research.

  12. Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae.

    PubMed

    Eid, Rawan; Boucher, Eric; Gharib, Nada; Khoury, Chamel; Arab, Nagla T T; Murray, Alistair; Young, Paul G; Mandato, Craig A; Greenwood, Michael T

    2016-03-01

    Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomyces cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. The Isolation of Invertase from Baker's Yeast: A Four-Part Exercise in Protein Purification and Characterization

    ERIC Educational Resources Information Center

    Timerman, Anthony P.; Fenrick, Angela M.; Zamis, Thomas M.

    2009-01-01

    A sequence of exercises for the isolation and characterization of invertase (E.C. 3.1.2.26) from baker's yeast obtained from a local grocery store is outlined. Because the enzyme is colorless, the use of colored markers and the sequence of purification steps are designed to "visualize" the process by which a colorless protein is selectively…

  14. Risk assessment for the spread of Candida sp. in dental chair unit waterlines using molecular techniques.

    PubMed

    Mazari, Wissame; Boucherit-Otmani, Zahia; El Haci, Imad Abdelhamid; Ilahi, Amine; Boucherit, Kebir

    2018-05-04

    The aim of this study was to evaluate the presence of yeasts in dental chair unit waterlines (DCUWLs) and to test their ability to form biofilms. Eighteen dental waterlines were analysed by culture in liquid Sabouraud in order to allow the quantification and the purification of isolated yeasts from their internal surfaces. All isolates were identified by standard laboratory procedures, including CHROMagar Candida medium for orientation, commercial yeast identification system Api Candida, MALDI-TOF MS and DNA sequencing. To evaluate their kinetics of antifungal susceptibility during different phases of biofilm formation, these yeasts were subjected to three antifungal agents. From the 18 DCUWLs studied, 10 were altered (55.56%). Eleven strains of Candida sp. [Candida albicans (2), Candida guilliermondii (5) and Candida glabrata (4)] and two species of non-Candida; Rhodotorula spp. (1) and Trichosporon spp. (2) were identified. The majority of yeasts in planktonic form were susceptible to amphotericin B, caspofungin and voriconazole, except C. albicans was resistant to voriconazole. In the biofilm form, caspofungin was the most effective antifungal agent for all isolated strains. For the other antifungal agents, sessile cells were resistant. Several types of yeasts were identified; the most frequently isolated genus was Candida. The majority of these yeasts had the ability to form biofilms and resisted antifungal agents used in this study. © 2018 FDI World Dental Federation.

  15. The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties.

    PubMed

    Piškur, Jure; Ling, Zhihao; Marcet-Houben, Marina; Ishchuk, Olena P; Aerts, Andrea; LaButti, Kurt; Copeland, Alex; Lindquist, Erika; Barry, Kerrie; Compagno, Concetta; Bisson, Linda; Grigoriev, Igor V; Gabaldón, Toni; Phister, Trevor

    2012-07-02

    The yeast Dekkera/Brettanomyces bruxellensis can cause enormous economic losses in wine industry due to production of phenolic off-flavor compounds. D. bruxellensis is a distant relative of baker's yeast Saccharomyces cerevisiae. Nevertheless, these two yeasts are often found in the same habitats and share several food-related traits, such as production of high ethanol levels and ability to grow without oxygen. In some food products, like lambic beer, D. bruxellensis can importantly contribute to flavor development. We determined the 13.4 Mb genome sequence of the D. bruxellensis strain Y879 (CBS2499) and deduced the genetic background of several "food-relevant" properties and evolutionary history of this yeast. Surprisingly, we find that this yeast is phylogenetically distant to other food-related yeasts and most related to Pichia (Komagataella) pastoris, which is an aerobic poor ethanol producer. We further show that the D. bruxellensis genome does not contain an excess of lineage specific duplicated genes nor a horizontally transferred URA1 gene, two crucial events that promoted the evolution of the food relevant traits in the S. cerevisiae lineage. However, D. bruxellensis has several independently duplicated ADH and ADH-like genes, which are likely responsible for metabolism of alcohols, including ethanol, and also a range of aromatic compounds. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Quantitative phenotyping via deep barcode sequencing.

    PubMed

    Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

    2009-10-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

  17. Novel features of ARS selection in budding yeast Lachancea kluyveri

    PubMed Central

    2011-01-01

    Background The characterization of DNA replication origins in yeast has shed much light on the mechanisms of initiation of DNA replication. However, very little is known about the evolution of origins or the evolution of mechanisms through which origins are recognized by the initiation machinery. This lack of understanding is largely due to the vast evolutionary distances between model organisms in which origins have been examined. Results In this study we have isolated and characterized autonomously replicating sequences (ARSs) in Lachancea kluyveri - a pre-whole genome duplication (WGD) budding yeast. Through a combination of experimental work and rigorous computational analysis, we show that L. kluyveri ARSs require a sequence that is similar but much longer than the ARS Consensus Sequence well defined in Saccharomyces cerevisiae. Moreover, compared with S. cerevisiae and K. lactis, the replication licensing machinery in L. kluyveri seems more tolerant to variations in the ARS sequence composition. It is able to initiate replication from almost all S. cerevisiae ARSs tested and most Kluyveromyces lactis ARSs. In contrast, only about half of the L. kluyveri ARSs function in S. cerevisiae and less than 10% function in K. lactis. Conclusions Our findings demonstrate a replication initiation system with novel features and underscore the functional diversity within the budding yeasts. Furthermore, we have developed new approaches for analyzing biologically functional DNA sequences with ill-defined motifs. PMID:22204614

  18. Novel features of ARS selection in budding yeast Lachancea kluyveri.

    PubMed

    Liachko, Ivan; Tanaka, Emi; Cox, Katherine; Chung, Shau Chee Claire; Yang, Lu; Seher, Arael; Hallas, Lindsay; Cha, Eugene; Kang, Gina; Pace, Heather; Barrow, Jasmine; Inada, Maki; Tye, Bik-Kwoon; Keich, Uri

    2011-12-28

    The characterization of DNA replication origins in yeast has shed much light on the mechanisms of initiation of DNA replication. However, very little is known about the evolution of origins or the evolution of mechanisms through which origins are recognized by the initiation machinery. This lack of understanding is largely due to the vast evolutionary distances between model organisms in which origins have been examined. In this study we have isolated and characterized autonomously replicating sequences (ARSs) in Lachancea kluyveri - a pre-whole genome duplication (WGD) budding yeast. Through a combination of experimental work and rigorous computational analysis, we show that L. kluyveri ARSs require a sequence that is similar but much longer than the ARS Consensus Sequence well defined in Saccharomyces cerevisiae. Moreover, compared with S. cerevisiae and K. lactis, the replication licensing machinery in L. kluyveri seems more tolerant to variations in the ARS sequence composition. It is able to initiate replication from almost all S. cerevisiae ARSs tested and most Kluyveromyces lactis ARSs. In contrast, only about half of the L. kluyveri ARSs function in S. cerevisiae and less than 10% function in K. lactis. Our findings demonstrate a replication initiation system with novel features and underscore the functional diversity within the budding yeasts. Furthermore, we have developed new approaches for analyzing biologically functional DNA sequences with ill-defined motifs.

  19. Whole Genome Analysis of 132 Clinical Saccharomyces cerevisiae Strains Reveals Extensive Ploidy Variation

    PubMed Central

    Zhu, Yuan O.; Sherlock, Gavin; Petrov, Dmitri A.

    2016-01-01

    Budding yeast has undergone several independent transitions from commercial to clinical lifestyles. The frequency of such transitions suggests that clinical yeast strains are derived from environmentally available yeast populations, including commercial sources. However, despite their important role in adaptive evolution, the prevalence of polyploidy and aneuploidy has not been extensively analyzed in clinical strains. In this study, we have looked for patterns governing the transition to clinical invasion in the largest screen of clinical yeast isolates to date. In particular, we have focused on the hypothesis that ploidy changes have influenced adaptive processes. We sequenced 144 yeast strains, 132 of which are clinical isolates. We found pervasive large-scale genomic variation in both overall ploidy (34% of strains identified as 3n/4n) and individual chromosomal copy numbers (36% of strains identified as aneuploid). We also found evidence for the highly dynamic nature of yeast genomes, with 35 strains showing partial chromosomal copy number changes and eight strains showing multiple independent chromosomal events. Intriguingly, a lineage identified to be baker’s/commercial derived with a unique damaging mutation in NDC80 was particularly prone to polyploidy, with 83% of its members being triploid or tetraploid. Polyploidy was in turn associated with a >2× increase in aneuploidy rates as compared to other lineages. This dataset provides a rich source of information on the genomics of clinical yeast strains and highlights the potential importance of large-scale genomic copy variation in yeast adaptation. PMID:27317778

  20. LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

    PubMed Central

    Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

    1993-01-01

    The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

  1. Debaryomyces hansenii: An Osmotolerant and Halotolerant Yeast

    NASA Astrophysics Data System (ADS)

    Aggarwal, Monika; Mondal, Alok K.

    The yeast Debaryomyces hansenii which was isolated from saline environments such as sea water, concentrated brines, salty food, is one of the most halotolerant species. It can grow in media containing as high as 4 M NaCl, while the growth of Saccharomyces cerevisiae is limited in media with more than 1.7 M NaCl. This species is very important for food industry as it is used for surface ripening of cheese and meat products. In the recent past, there is growing interest in understanding the molecular mechanisms of high halotolerance exhibited by D. hansenii. Availability of genome sequence of D. hansenii has opened up new vistas in this direction

  2. Discovery of high affinity anti-ricin antibodies by B cell receptor sequencing and by yeast display of combinatorial VH:VL libraries from immunized animals.

    PubMed

    Wang, Bo; Lee, Chang-Han; Johnson, Erik L; Kluwe, Christien A; Cunningham, Josephine C; Tanno, Hidetaka; Crooks, Richard M; Georgiou, George; Ellington, Andrew D

    2016-01-01

    Ricin is a toxin that could potentially be used as a bioweapon. We identified anti-ricin A chain antibodies by sequencing the antibody repertoire from immunized mice and by selecting high affinity antibodies using yeast surface display. These methods led to the isolation of multiple antibodies with high (sub-nanomolar) affinity. Interestingly, the antibodies identified by the 2 independent approaches are from the same clonal lineages, indicating for the first time that yeast surface display can identify native antibodies. The new antibodies represent well-characterized reagents for biodefense diagnostics and therapeutics development.

  3. Identification of yeast and bacteria involved in the mezcal fermentation of Agave salmiana.

    PubMed

    Escalante-Minakata, P; Blaschek, H P; Barba de la Rosa, A P; Santos, L; De León-Rodríguez, A

    2008-06-01

    To identify the yeast and bacteria present in the mezcal fermentation from Agave salmiana. The restriction and sequence analysis of the amplified region, between 18S and 28S rDNA and 16S rDNA genes, were used for the identification of yeast and bacteria, respectively. Eleven different micro-organisms were identified in the mezcal fermentation. Three of them were the following yeast: Clavispora lusitaniae, Pichia fermentans and Kluyveromyces marxianus. The bacteria found were Zymomonas mobilis subsp. mobilis and Zymomonas mobilis subsp. pomaceae, Weissella cibaria, Weissella paramesenteroides, Lactobacillus pontis, Lactobacillus kefiri, Lactobacillus plantarum and Lactobacillus farraginis. The phylogenetic analysis of 16S rDNA and ITS sequences showed that microbial diversity present in mezcal is dominated by bacteria, mainly lactic acid bacteria species and Zymomonas mobilis. Pichia fermentans and K. marxianus could be micro-organisms with high potential for the production of some volatile compounds in mezcal. We identified the community of bacteria and yeast present in mezcal fermentation from Agave salmiana.

  4. The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

    PubMed Central

    Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

    1981-01-01

    We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

  5. Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

    PubMed

    Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

    2017-05-01

    Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

  6. Validation of a mobility item bank for older patients in primary care.

    PubMed

    Cabrero-García, Julio; Ramos-Pichardo, Juan Diego; Muñoz-Mendoza, Carmen Luz; Cabañero-Martínez, María José; González-Llopis, Lorena; Reig-Ferrer, Abilio

    2012-12-05

    To develop and validate an item bank to measure mobility in older people in primary care and to analyse differential item functioning (DIF) and differential bundle functioning (DBF) by sex. A pool of 48 mobility items was administered by interview to 593 older people attending primary health care practices. The pool contained four domains based on the International Classification of Functioning: changing and maintaining body position, carrying, lifting and pushing, walking and going up and down stairs. The Late Life Mobility item bank consisted of 35 items, and measured with a reliability of 0.90 or more across the full spectrum of mobility, except at the higher end of better functioning. No evidence was found of non-uniform DIF but uniform DIF was observed, mainly for items in the changing and maintaining body position and carrying, lifting and pushing domains. The walking domain did not display DBF, but the other three domains did, principally the carrying, lifting and pushing items. During the design and validation of an item bank to measure mobility in older people, we found that strength (carrying, lifting and pushing) items formed a secondary dimension that produced DBF. More research is needed to determine how best to include strength items in a mobility measure, or whether it would be more appropriate to design separate measures for each construct.

  7. The use of biochemical responses to assess ecotoxicological effects of Pharmaceutical and Personal Care Products (PPCPs) after injection in the mussel Elliptio complanata.

    PubMed

    Martín-Díaz, M Laura; Gagné, François; Blaise, Christian

    2009-09-01

    A biomarker approach was undertaken using the mussel Elliptio complanata to assess the ecotoxicological effects after injection of a range concentration (0-10mM) of three different PPCPs: carbamazepine, caffeine, methotrexate; and an effluent extract (C8) from St. Lawrence wastewaters treatment plant (Montreal, Canada). A battery of biomarkers, involving oxidative stress and genotoxicity responses: glutation-S-transferase (GST), ethoxyresorufin O-deethylase (EROD), dibenzylflourescein dealkylase (DBF), xanthine oxidoreductase (XOR) activities, lipid peroxidation (LPO) and DNA damage were determined in gonad and digestive gland tissues after 48 h of injection. Results showed an induction of the oxidative metabolism with increasing pharmaceutical concentration in those mussels injected with the PPCPs and the effluent extract. Phase I detoxification enzymes were significantly induced (p<0.05), concretely DBF activity was significantly induced after caffeine, carbamazipine and C8 injection; and EROD activity after C8 and methotrexate injection. Oxidative stress induction only lead to lipid peroxidation (p<0.05) in organisms injected with carbamazepine and caffeine and DNA damage in organisms injected with methotrexate (p<0.05). EROD and DBF enzymatic activities have been found to be suitable biomarkers to determine bioavailability of pharmaceuticals. LPO and DNA damage to determine possible associated adverse effects. Nevertheless, their validation in realistic exposure scenarios and under exposure conditions should be performed in future research.

  8. Genome Sequence of the Native Apiculate Wine Yeast Hanseniaspora vineae T02/19AF

    PubMed Central

    Giorello, Facundo M.; Berná, Luisa; Greif, Gonzalo; Camesasca, Laura; Salzman, Valentina; Medina, Karina; Robello, Carlos; Gaggero, Carina; Aguilar, Pablo S.

    2014-01-01

    The use of novel yeast strains for winemaking improves quality and provides variety including subtle characteristic differences in fine wines. Here we report the first genome of a yeast strain native to Uruguay, Hanseniaspora vineae T02/19AF, which has been shown to positively contribute to aroma and wine quality. PMID:24874663

  9. Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

    PubMed

    Gamalinda, Michael; Woolford, John L

    2014-11-01

    Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Dimorphic cycle in Candida citri sp. nov., a novel yeast species isolated from rotting fruit in Borneo.

    PubMed

    Sipiczki, Matthias

    2011-03-01

    Five dimorphic yeast strains were isolated from rotting lime fruits in Borneo. The sequences of the D1/D2 domains of the 26S rRNA genes, the internal transcribed spacer (ITS) chromosomal regions and the 18S rRNA genes were identical in the isolates and differed from the corresponding sequences of all known yeast species. Based on the sequence differences (12-15% in the D1/D2 domain) from the closest relatives and the different pattern of taxonomic traits, the new isolates are assigned the status of a new species, for which the name Candida citri sp. nov. is proposed. Its type strain is 11-469(T) , which has been deposited in Centralbureau voor Schimmelcultures (Utrecht, the Netherlands) as CBS 11858(T) , Culture Collection of Yeasts (Bratislava, Slovakia) as CCY 29-181-1(T) and the National Collection of Agricultural and Industrial Microorganisms (Budapest, Hungary) as NCAIM Y.01978(T) . MycoBank number: MB 519100. The GenBank accession numbers for nucleotide sequences of its D1/D2 domain, ITS and 18S regions are HM803241, HM803242 and HM803243, respectively. Candida citri produces invasive mycelium composed of true septate hyphae that grow towards nutrient-rich parts of the medium and develop large vacuoles at the nongrowing ends of their cells. The hyphae produce blastoconidia, which can establish satellite yeast colonies in the invaded solid substrate. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  11. The transcriptome of Candida albicans mitochondria and the evolution of organellar transcription units in yeasts.

    PubMed

    Kolondra, Adam; Labedzka-Dmoch, Karolina; Wenda, Joanna M; Drzewicka, Katarzyna; Golik, Pawel

    2015-10-21

    Yeasts show remarkable variation in the organization of their mitochondrial genomes, yet there is little experimental data on organellar gene expression outside few model species. Candida albicans is interesting as a human pathogen, and as a representative of a clade that is distant from the model yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe. Unlike them, it encodes seven Complex I subunits in its mtDNA. No experimental data regarding organellar expression were available prior to this study. We used high-throughput RNA sequencing and traditional RNA biology techniques to study the mitochondrial transcriptome of C. albicans strains BWP17 and SN148. The 14 protein-coding genes, two ribosomal RNA genes, and 24 tRNA genes are expressed as eight primary polycistronic transcription units. We also found transcriptional activity in the noncoding regions, and antisense transcripts that could be a part of a regulatory mechanism. The promoter sequence is a variant of the nonanucleotide identified in other yeast mtDNAs, but some of the active promoters show significant departures from the consensus. The primary transcripts are processed by a tRNA punctuation mechanism into the monocistronic and bicistronic mature RNAs. The steady state levels of various mature transcripts exhibit large differences that are a result of posttranscriptional regulation. Transcriptome analysis allowed to precisely annotate the positions of introns in the RNL (2), COB (2) and COX1 (4) genes, as well as to refine the annotation of tRNAs and rRNAs. Comparative study of the mitochondrial genome organization in various Candida species indicates that they undergo shuffling in blocks usually containing 2-3 genes, and that their arrangement in primary transcripts is not conserved. tRNA genes with their associated promoters, as well as GC-rich sequence elements play an important role in these evolutionary events. The main evolutionary force shaping the mitochondrial genomes of yeasts is the frequent recombination, constantly breaking apart and joining genes into novel primary transcription units. The mitochondrial transcription units are constantly rearranged in evolution shaping the features of gene expression, such as the presence of secondary promoter sites that are inactive, or act as "booster" promoters, simplified transcriptional regulation and reliance on posttranscriptional mechanisms.

  12. Developing a set of strong intronic promoters for robust metabolic engineering in oleaginous Rhodotorula (Rhodosporidium) yeast species.

    PubMed

    Liu, Yanbin; Yap, Sihui Amy; Koh, Chong Mei John; Ji, Lianghui

    2016-11-25

    Red yeast species in the Rhodotorula/Rhodosporidium genus are outstanding producers of triacylglyceride and cell biomass. Metabolic engineering is expected to further enhance the productivity and versatility of these hosts for the production of biobased chemicals and fuels. Promoters with strong activity during oil-accumulation stage are critical tools for metabolic engineering of these oleaginous yeasts. The upstream DNA sequences of 6 genes involved in lipid biosynthesis or accumulation in Rhodotorula toruloides were studied by luciferase reporter assay. The promoter of perilipin/lipid droplet protein 1 gene (LDP1) displayed much stronger activity (4-11 folds) than that of glyceraldehyde-3-phosphate dehydrogenase gene (GPD1), one of the strongest promoters known in yeasts. Depending on the stage of cultivation, promoter of acetyl-CoA carboxylase gene (ACC1) and fatty acid synthase β subunit gene (FAS1) exhibited intermediate strength, displaying 50-160 and 20-90% levels of GPD1 promoter, respectively. Interestingly, introns significantly modulated promoter strength at high frequency. The incorporation of intron 1 and 2 of LDP1 (LDP1in promoter) enhanced its promoter activity by 1.6-3.0 folds. Similarly, the strength of ACC1 promoter was enhanced by 1.5-3.2 folds if containing intron 1. The intron 1 sequences of ACL1 and FAS1 also played significant regulatory roles. When driven by the intronic promoters of ACC1 and LDP1 (ACC1in and LDP1in promoter, respectively), the reporter gene expression were up-regulated by nitrogen starvation, independent of de novo oil biosynthesis and accumulation. As a proof of principle, overexpression of the endogenous acyl-CoA-dependent diacylglycerol acyltransferase 1 gene (DGA1) by LDP1in promoter was significantly more efficient than GPD1 promoter in enhancing lipid accumulation. Intronic sequences play an important role in regulating gene expression in R. toruloides. Three intronic promoters, LDP1in, ACC1in and FAS1in, are excellent promoters for metabolic engineering in the oleaginous and carotenogenic yeast, R. toruloides.

  13. Homology of aspartyl- and lysyl-tRNA synthetases.

    PubMed Central

    Gampel, A; Tzagoloff, A

    1989-01-01

    The yeast nuclear gene MSD1 coding for mitochondrial aspartyl-tRNA synthetase has been cloned and sequenced. The identity of the gene is confirmed by the following evidence. (i) The primary structure of the protein derived from the gene sequence is similar to that of the yeast cytoplasmic aspartyl-tRNA synthetase. (ii) In situ disruption of MSD1 in a respiratory-competent haploid strain of yeast induces a pleiotropic phenotype consistent with a lesion in mitochondrial protein synthesis. (iii) Mitochondria from a mutant with a disrupted chromosomal copy of MSD1 are unable to acylate mitochondrial aspartyl-tRNA. The primary structures of the cytoplasmic and mitochondrial aspartyl-tRNA synthetases are similar to the yeast cytoplasmic lysyl-tRNA synthetase, suggesting that the two types of synthetases may have a common evolutionary origin. Searches of the current protein banks also have revealed a high degree of sequence similarity of the lysyl-tRNA synthetase to the product of the Escherichia coli herC gene and to the partial sequence of a protein encoded by an unidentified reading frame located adjacent to the E. coli frdA gene. Based on the sequence similarities and the map positions of the herC and frdA loci, we propose herC to be the structural gene of the constitutively expressed lysyl-tRNA synthetase of E. coli and the unidentified reading frame to be the structural gene of the heat-inducible lysyl-tRNA synthetase. Images PMID:2668951

  14. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  15. Genome Sequence of the Native Apiculate Wine Yeast Hanseniaspora vineae T02/19AF.

    PubMed

    Giorello, Facundo M; Berná, Luisa; Greif, Gonzalo; Camesasca, Laura; Salzman, Valentina; Medina, Karina; Robello, Carlos; Gaggero, Carina; Aguilar, Pablo S; Carrau, Francisco

    2014-05-29

    The use of novel yeast strains for winemaking improves quality and provides variety including subtle characteristic differences in fine wines. Here we report the first genome of a yeast strain native to Uruguay, Hanseniaspora vineae T02/19AF, which has been shown to positively contribute to aroma and wine quality. Copyright © 2014 Giorello et al.

  16. Draft genome sequence of Sugiyamaella xylanicola UFMG-CM-Y1884T, a xylan-degrading yeast species isolated from rotting wood samples in Brazil.

    PubMed

    Batista, Thiago M; Moreira, Rennan G; Hilário, Heron O; Morais, Camila G; Franco, Glória R; Rosa, Luiz H; Rosa, Carlos A

    2017-03-01

    We present the draft genome sequence of the type strain of the yeast Sugiyamaella xylanicola UFMG-CM-Y1884 T (= UFMG-CA-32.1 T  = CBS 12683 T ), a xylan-degrading species capable of fermenting d-xylose to ethanol. The assembled genome has a size of ~ 13.7 Mb and a GC content of 33.8% and contains 5971 protein-coding genes. We identified 15 genes with significant similarity to the d-xylose reductase gene from several other fungal species. The draft genome assembled from whole-genome shotgun sequencing of the yeast Sugiyamaella xylanicola UFMG-CM-Y1884 T (= UFMG-CA-32.1 T  = CBS 12683 T ) has been deposited at DDBJ/ENA/GenBank under the accession number MQSX00000000 under version MQSX01000000.

  17. Cryptococcus nanyangensis sp. nov., a new basidiomycetous yeast isolated from the gut of wood-boring larvae.

    PubMed

    Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia

    2012-11-01

    Two strains of a novel basidiomycetous yeast species were isolated from the gut of wood-boring larvae collected in the Baotianman Nature Reserve, the central China. Sequence analysis of the D1/D2 domains of the large subunit (LSU) rRNA gene and internal transcribed spacer (ITS) regions showed that these yeasts belong to the Bulleromyces clade and formed a cluster together with eleven undescribed Cryptococcus species. The novel species differed from its closest known species, Cryptococcus rajasthanensis, by 3.3 % divergence (15 substitutions and 6 gaps over 630 bases) in the D1/D2 domains, and by 13.4 % divergence (41 substitutions and 27 gaps over 508 bases) in the ITS regions. Physiologically, the fermentation of glucose, galactose, sucrose, trehalose, and raffinose in Durham tubes was observed for the strains of this new yeast. Based on the phenotypical and molecular characteristics presented, the two strains are proposed as a new species, Cryptococcus nanyangensis sp. nov., with the type strain KCY-1(T) (=CICC 1976(T) = CBS 12474(T)).

  18. Zygosaccharomyces kombuchaensis, a new ascosporogenous yeast from 'Kombucha tea'.

    PubMed

    Kurtzman, C P; Robnett, C J; Basehoar-Powers, E

    2001-07-01

    A new ascosporogenous yeast, Zygosaccharomyces kombuchaensis sp. n. (type strain NRRL YB-4811, CBS 8849), is described; it was isolated from Kombucha tea, a popular fermented tea-based beverage. The four known strains of the new species have identical nucleotide sequences in domain D1/D2 of 26S rDNA. Phylogenetic analysis of D1/D2 and 18S rDNA sequences places Z. kombuchaensis near Zygosaccharomyces lentus. The two species are indistinguishable on standard physiological tests used for yeast identification, but can be recognized from differences in restriction fragment length polymorphism patterns obtained by digestion of 18S-ITS1 amplicons with the restriction enzymes DdeI and MboI.

  19. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed Central

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-01-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress. PMID:8467224

  20. Mutants of Saccharomyces cerevisiae defective in the farnesylation of Ras proteins.

    PubMed Central

    Goodman, L E; Judd, S R; Farnsworth, C C; Powers, S; Gelb, M H; Glomset, J A; Tamanoi, F

    1990-01-01

    Ras proteins are post-translationally modified by farnesylation. In the present investigation, we identified an activity in crude soluble extracts of yeast cells that catalyzes the transfer of a farnesyl moiety from farnesyl pyrophosphate to yeast RAS2 protein. RAS2 proteins having a C-terminal Cys-Ali-Ali-Xaa sequence (where Ali is an aliphatic amino acid and Xaa is the unspecified C-terminal amino acid) served as substrates for this reaction, whereas RAS2 proteins with an altered or deleted Cys-Ali-Ali-Xaa sequence did not. A yeast mutant, dpr1/ram1, originally isolated as a Ras-processing mutant was shown to be defective in farnesyltransferase activity. In addition, another mutant, ram2, also was defective in the transferase activity. These results demonstrate that at least two genes, DPR1/RAM1 and RAM2, are required for the farnesyltransferase activity in yeast. Images PMID:2124698

  1. Quantitative phenotyping via deep barcode sequencing

    PubMed Central

    Smith, Andrew M.; Heisler, Lawrence E.; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J.; Chee, Mark; Roth, Frederick P.; Giaever, Guri; Nislow, Corey

    2009-01-01

    Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or “Bar-seq,” outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that ∼20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene–environment interactions on a genome-wide scale. PMID:19622793

  2. Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

    PubMed

    Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

    2017-06-02

    G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Post-fermentative production of glutathione by baker's yeast (S. cerevisiae) in compressed and dried forms.

    PubMed

    Musatti, Alida; Manzoni, Matilde; Rollini, Manuela

    2013-01-25

    The study was aimed at investigating the best biotransformation conditions to increase intracellular glutathione (GSH) levels in samples of baker's yeast (Saccharomyces cerevisiae) employing either the commercially available compressed and dried forms. Glucose, GSH precursors amino acids, as well as other cofactors, were dissolved in a biotransformation solution and yeast cells were added (5%dcw). Two response surface central composite designs (RSCCDs) were performed in sequence: in the first step the influence of amino acid composition (cysteine, glycine, glutamic acid and serine) on GSH accumulation was investigated; once their formulation was set up, the influence of other components was studied. Initial GSH content was found 0.53 and 0.47%dcw for compressed and dried forms. GSH accumulation ability of baker's yeast in compressed form was higher at the beginning of shelf life, that is, in the first week, and a maximum of 2.04%dcw was obtained. Performance of yeast in dried form was not found satisfactory, as the maximum GSH level was 1.18%dcw. When cysteine lacks from the reaction solution, yeast cells do not accumulate GSH. With dried yeast, the highest GSH yields occurred when cysteine was set at 3 g/L, glycine and glutamic acid at least at 4 g/L, without serine. Employing compressed yeast, the highest GSH yields occurred when cysteine and glutamic acid were set at 2-3 g/L, while glycine and serine higher than 2 g/L. Results allowed to set up an optimal and feasible procedure to obtain GSH-enriched yeast biomass, with up to threefold increase with respect to initial content. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  5. MIPS: a database for protein sequences and complete genomes.

    PubMed Central

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  6. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  7. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  9. Cloning and characterization of an inulinase gene from the marine yeast Candida membranifaciens subsp. flavinogenie W14-3 and its expression in Saccharomyces sp. W0 for ethanol production.

    PubMed

    Zhang, Lin-Lin; Tan, Mei-Juan; Liu, Guang-Lei; Chi, Zhe; Wang, Guang-Yuan; Chi, Zhen-Ming

    2015-04-01

    The INU1 gene encoding an exo-inulinase from the marine-derived yeast Candida membranifaciens subsp. flavinogenie W14-3 was cloned and characterized. It had an open reading frame of 1,536 bp long encoding an inulinase. The coding region of it was not interrupted by any intron. The cloned gene encoded 512 amino acid residues of a protein with a putative signal peptide of 23 amino acids and a calculated molecular mass of 57.8 kDa. The protein sequence deduced from the inulinase gene contained the inulinase consensus sequences (WMNDPNGL), (RDP), ECP FS and Q. The protein also had six conserved putative N-glycosylation sites. The deduced inulinase from the yeast strain W14-3 was found to be closely related to that from Candida kutaonensis sp. nov. KRF1, Kluyveromyces marxianus, and Cryptococcus aureus G7a. The inulinase gene with its signal peptide encoding sequence was subcloned into the pMIRSC11 expression vector and expressed in Saccharomyces sp. W0. The recombinant yeast strain W14-3-INU-112 obtained could produce 16.8 U/ml of inulinase activity and 12.5 % (v/v) ethanol from 250 g/l of inulin within 168 h. The monosaccharides were detected after the hydrolysis of inulin with the crude inulinase (the yeast culture). All the results indicated that the cloned gene and the recombinant yeast strain W14-3-INU-112 had potential applications in biotechnology.

  10. Long-read sequencing data analysis for yeasts.

    PubMed

    Yue, Jia-Xing; Liti, Gianni

    2018-06-01

    Long-read sequencing technologies have become increasingly popular due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast Saccharomyces cerevisiae has many isolates currently being sequenced with long reads. However, analyzing long-read sequencing data to produce high-quality genome assembly and annotation remains challenging. Here, we present a modular computational framework named long-read sequencing data analysis for yeasts (LRSDAY), the first one-stop solution that streamlines this process. Starting from the raw sequencing reads, LRSDAY can produce chromosome-level genome assembly and comprehensive genome annotation in a highly automated manner with minimal manual intervention, which is not possible using any alternative tool available to date. The annotated genomic features include centromeres, protein-coding genes, tRNAs, transposable elements (TEs), and telomere-associated elements. Although tailored for S. cerevisiae, we designed LRSDAY to be highly modular and customizable, making it adaptable to virtually any eukaryotic organism. When applying LRSDAY to an S. cerevisiae strain, it takes ∼41 h to generate a complete and well-annotated genome from ∼100× Pacific Biosciences (PacBio) running the basic workflow with four threads. Basic experience working within the Linux command-line environment is recommended for carrying out the analysis using LRSDAY.

  11. High-frequency transformation of a methylotrophic yeast, Candida boidinii, with autonomously replicating plasmids which are also functional in Saccharomyces cerevisiae.

    PubMed

    Sakai, Y; Goh, T K; Tani, Y

    1993-06-01

    We have developed a transformation system which uses autonomous replicating plasmids for a methylotrophic yeast, Candida boidinii. Two autonomous replication sequences, CARS1 and CARS2, were newly cloned from the genome of C. boidinii. Plasmids having both a CARS fragment and the C. boidinii URA3 gene transformed C. boidinii ura3 cells to Ura+ phenotype at frequencies of up to 10(4) CFU/micrograms of DNA. From Southern blot analysis, CARS plasmids seemed to exist in polymeric forms as well as in monomeric forms in C. boidinii cells. The C. boidinii URA3 gene was overexpressed in C. boidinii on these CARS vectors. CARS1 and CARS2 were found to function as an autonomous replicating element in Saccharomyces cerevisiae as well. Different portions of the CARS1 sequence were needed for autonomous replicating activity in C. boidinii and S. cerevisiae. C. boidinii could also be transformed with vectors harboring a CARS fragment and the S. cerevisiae URA3 gene.

  12. Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

    PubMed Central

    Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

    1988-01-01

    Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

  13. Yeast community in traditional Portuguese Serpa cheese by culture-dependent and -independent DNA approaches.

    PubMed

    Gonçalves Dos Santos, Maria Teresa P; Benito, María José; Córdoba, María de Guía; Alvarenga, Nuno; Ruiz-Moyano Seco de Herrera, Santiago

    2017-12-04

    This study investigated the yeast community present in the traditional Portuguese cheese, Serpa, by culture-dependent and -independent methods. Sixteen batches of Serpa cheeses from various regional industries registered with the Protected Designation of Origin (PDO) versus non-PDO registered, during spring and winter, were used. Irrespective of the producer, the yeast counts were around 5log CFU/g in winter and, overall, were lower in spring. The yeast species identified at the end of ripening (30days), using PCR-RFLP analysis and sequencing of the 26S rRNA, mainly corresponded to Debaryomyces hansenii and Kluyveromyces marxianus, with Candida spp. and Pichia spp. present to a lesser extent. The culture-independent results, obtained using high-throughput sequencing analysis, confirmed the prevalence of Debaryomyces spp. and Kluyveromyces spp. but, also, that Galactomyces spp. was relevant for three of the five producers, which indicates its importance during the early stages of the cheese ripening process, considering it was not found among the dominant viable yeast species. In addition, differences between the identified yeast isolated from cheeses obtained from PDO and non-PDO registered industries, showed that the lack of regulation of the cheese-making practice, may unfavourably influence the final yeast microbiota. The new knowledge provided by this study of the yeast diversity in Serpa cheese, could be used to modify the cheese ripening conditions, to favour desirable yeast species. Additionally, the prevalent yeast isolates identified, Debaryomyces hansenii and Kluyveromyces spp., may have an important role during cheese ripening and in the final sensorial characteristics. Thus, the study of their technological and functional properties could be relevant, in the development of an autochthonous starter culture, to ensure final quality and safety of the cheese. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    PubMed Central

    Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.

    2015-01-01

    The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241

  15. Rapid Molecular Identification of Pathogenic Yeasts by Pyrosequencing Analysis of 35 Nucleotides of Internal Transcribed Spacer 2 ▿

    PubMed Central

    Borman, Andrew M.; Linton, Christopher J.; Oliver, Debra; Palmer, Michael D.; Szekely, Adrien; Johnson, Elizabeth M.

    2010-01-01

    Rapid identification of yeast species isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. Here, we have evaluated the utility of pyrosequencing analysis of a portion of the internal transcribed spacer 2 region (ITS2) for identification of pathogenic yeasts. A total of 477 clinical isolates encompassing 43 different fungal species were subjected to pyrosequencing analysis in a strictly blinded study. The molecular identifications produced by pyrosequencing were compared with those obtained using conventional biochemical tests (AUXACOLOR2) and following PCR amplification and sequencing of the D1-D2 portion of the nuclear 28S large rRNA gene. More than 98% (469/477) of isolates encompassing 40 of the 43 fungal species tested were correctly identified by pyrosequencing of only 35 bp of ITS2. Moreover, BLAST searches of the public synchronized databases with the ITS2 pyrosequencing signature sequences revealed that there was only minimal sequence redundancy in the ITS2 under analysis. In all cases, the pyrosequencing signature sequences were unique to the yeast species (or species complex) under investigation. Finally, when pyrosequencing was combined with the Whatman FTA paper technology for the rapid extraction of fungal genomic DNA, molecular identification could be accomplished within 6 h from the time of starting from pure cultures. PMID:20702674

  16. Yeasts associated with the curculionid beetle Xyloterinus politus: Candida xyloterini sp. nov., Candida palmyrensis sp. nov. and three common ambrosia yeasts.

    PubMed

    Suh, Sung-Oui; Zhou, Jianlong

    2010-07-01

    Seven yeast strains were isolated from the body surface and galleries of Xyloterinus politus, the ambrosia beetle that attacks black oak trees. Based on rDNA sequence comparisons and other taxonomic characteristics, five of the strains were identified as members of the species Saccharomycopsis microspora, Wickerhamomyces hampshirensis and Candida mycetangii, which have been reported previously as being associated with insects. The remaining two yeast strains were proposed as representatives of two novel species, Candida xyloterini sp. nov. (type strain ATCC 62898(T)=CBS 11547(T)) and Candida palmyrensis sp. nov. (type strain ATCC 62899(T)=CBS 11546(T)). C. xyloterini sp. nov. is a close sister taxon to Ogataea dorogensis and assimilates methanol as a sole carbon source but lacks ascospores. On the other hand, C. palmyrensis sp. nov. is phylogenetically distinct from any other ambrosia yeast reported so far. The species was placed near Candida sophiae-reginae and Candida beechii based on DNA sequence analyses, but neither of these were close sister taxa to C. palmyrensis sp. nov.

  17. The power of fission: yeast as a tool for understanding complex splicing.

    PubMed

    Fair, Benjamin Jung; Pleiss, Jeffrey A

    2017-06-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression. Many metazoans, including humans, regulate alternative splicing patterns to generate expansions of their proteome from a limited number of genes. Importantly, a considerable fraction of human disease causing mutations manifest themselves through altering the sequences that shape the splicing patterns of genes. Thus, understanding the mechanistic bases of this complex pathway will be an essential component of combating these diseases. Dating almost to the initial discovery of splicing, researchers have taken advantage of the genetic tractability of budding yeast to identify the components and decipher the mechanisms of splicing. However, budding yeast lacks the complex splicing machinery and alternative splicing patterns most relevant to humans. More recently, many researchers have turned their efforts to study the fission yeast, Schizosaccharomyces pombe, which has retained many features of complex splicing, including degenerate splice site sequences, the usage of exonic splicing enhancers, and SR proteins. Here, we review recent work using fission yeast genetics to examine pre-mRNA splicing, highlighting its promise for modeling the complex splicing seen in higher eukaryotes.

  18. Yeast One-Hybrid Gγ Recruitment System for Identification of Protein Lipidation Motifs

    PubMed Central

    Fukuda, Nobuo; Doi, Motomichi; Honda, Shinya

    2013-01-01

    Fatty acids and isoprenoids can be covalently attached to a variety of proteins. These lipid modifications regulate protein structure, localization and function. Here, we describe a yeast one-hybrid approach based on the Gγ recruitment system that is useful for identifying sequence motifs those influence lipid modification to recruit proteins to the plasma membrane. Our approach facilitates the isolation of yeast cells expressing lipid-modified proteins via a simple and easy growth selection assay utilizing G-protein signaling that induces diploid formation. In the current study, we selected the N-terminal sequence of Gα subunits as a model case to investigate dual lipid modification, i.e., myristoylation and palmitoylation, a modification that is widely conserved from yeast to higher eukaryotes. Our results suggest that both lipid modifications are required for restoration of G-protein signaling. Although we could not differentiate between myristoylation and palmitoylation, N-terminal position 7 and 8 play some critical role. Moreover, we tested the preference for specific amino-acid residues at position 7 and 8 using library-based screening. This new approach will be useful to explore protein-lipid associations and to determine the corresponding sequence motifs. PMID:23922919

  19. Initiation preference at a yeast origin of replication.

    PubMed

    Brewer, B J; Fangman, W L

    1994-04-12

    Replication origins in the yeast Saccharomyces cerevisiae are identified as autonomous replication sequence (ARS) elements. To examine the effect of origin density on replication initiation, we have analyzed the replication of a plasmid that contains two copies of the same origin, ARS1. The activation of origins and the direction that replication forks move through flanking sequences can be physically determined by analyzing replication intermediates on two-dimensional agarose gels. We find that only one of the two identical ARSs on the plasmid initiates replication on any given plasmid molecule; that is, this close spacing of ARSs results in an apparent interference between the potential origins. Moreover, in the particular plasmid that we constructed, one of the two identical copies of ARS1 is used four times more frequently than the other one. These results show that the plasmid context is critical for determining the preferred origin. This origin preference is also exhibited when the tandem copies of ARS1 are introduced into a yeast chromosome. The sequences responsible for establishing the origin preference have been identified by deletion analysis and are found to reside in a portion of the yeast URA3 gene.

  20. A novel endo-beta-1,3-glucanase, BGN13.1, involved in the mycoparasitism of Trichoderma harzianum.

    PubMed Central

    de la Cruz, J; Pintor-Toro, J A; Benítez, T; Llobell, A; Romero, L C

    1995-01-01

    The mycoparasitic fungus Trichoderma harzianum CECT 2413 produces at least three extracellular beta-1,3-glucanases. The most basic of these extracellular enzymes, named BGN13.1, was expressed when either fungal cell wall polymers or autoclaved mycelia from different fungi were used as the carbon source. BGN13.1 was purified to electrophoretic homogeneity and was biochemically characterized. The enzyme was specific for beta-1,3 linkages and has an endolytic mode of action. A synthetic oligonucleotide primer based on the sequence of an internal peptide was designed to clone the cDNA corresponding to BGN13.1. The deduced amino acid sequence predicted a molecular mass of 78 kDa for the mature protein. Analysis of the amino acid sequence indicates that the enzyme contains three regions, one N-terminal leader sequence; another, nondefined sequence; and one cysteine-rich C-terminal sequence. Sequence comparison shows that this beta-1,3-glucanase, first described for filamentous fungi, belongs to a family different from that of its previously described bacterial, yeast, and plant counterparts. Enzymatic-activity, protein, and mRNA data indicated that bgn13.1 is repressed by glucose and induced by either fungal cell wall polymers or autoclaved yeast cells and mycelia. Finally, experimental evidence showed that the enzyme hydrolyzes yeast and fungal cell walls. PMID:7592488

  1. Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

    PubMed Central

    Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

    1985-01-01

    Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

  2. Upgrade of deep bed filtration with activated carbon dosage for compact micropollutant removal from wastewater in technical scale.

    PubMed

    Löwenberg, Jonas; Zenker, Armin; Krahnstöver, Thérèse; Boehler, Marc; Baggenstos, Martin; Koch, Gerhard; Wintgens, Thomas

    2016-05-01

    The removal of micropollutants from drinking and wastewater by powdered activated carbon (PAC) adsorption has received considerable attention in research over the past decade with various separation options having been investigated. With Switzerland as the first country in the world having adopted a new legislation, which forces about 100 wastewater treatment plants to be upgraded for the removal of organic micropollutants from municipal wastewater, the topic has reached practical relevance. In this study, the process combination of powdered activated carbon (PAC) adsorption and deep bed filtration (DBF) for advanced municipal wastewater treatment was investigated over an extended period exceeding one year of operation in technical scale. The study aimed to determine optimum process conditions to achieve sufficient micropollutant removal in agreement with the new Swiss Water Ordinance under most economic process design. It was shown that the addition of PAC and Fe(3+) as combined coagulation and flocculation agent improved effluent water quality with respect to dissolved organic pollutants as well as total suspended solids (TSS), turbidity and PO4-P concentration in comparison to a DBF operated without the addition of PAC and Fe(3+). Sufficient micropollutant (MP) removal of around 80% was achieved at PAC dosages of 10 mg/L revealing that PAC retained in the filter bed maintained considerable adsorption capacity. In the investigated process combination the contact reactor serves for adsorption as well as for flocculation and allowed for small hydraulic retention times of minimum 10 min while maintaining sufficient MP removal. The flocculation of two different PAC types was shown to be fully concluded after 10-15 min, which determined the flocculation reactor size while both PAC types proved suitable for the application in combination with DBF and showed no significant differences in MP removal. Finally, the capping of PAC dosage during rain water periods, which resulted in lower dosage concentrations, was efficient in limiting PAC consumption during these events without suffering from negative effects on process performance or effluent quality. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. South Brazilian wines: culturable yeasts associated to bottled wines produced in Rio Grande do Sul and Santa Catarina.

    PubMed

    Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Valente, Patricia

    2017-04-01

    A comprehensive understanding of the presence and role of yeasts in bottled wines helps to know and control the organoleptic quality of the final product. The South Region of Brazil is an important wine producer, and the state of "Rio Grande do Sul" (RS) accounts for 90% of Brazilian wines. The state of "Santa Catarina" (SC) started the production in 1975, and is currently the fifth Brazilian producer. As there is little information about yeasts present in Brazilian wines, our main objective was to assess the composition of culturable yeasts associated to bottled wines produced in RS and SC, South of Brazil. We sampled 20 RS and 29 SC bottled wines produced between 2003 and 2011, and we isolated culturable yeasts in non-selective agar plates. We identified all isolates by sequencing of the D1/D2 domain of LSU rDNA or ITS1-5.8 S-ITS2 region, and comparison with type strain sequences deposited in GenBank database. Six yeast species were shared in the final product in both regions. We obtained two spoilage yeast profiles: RS with Zygosaccharomyces bailii and Pichia membranifaciens (Dekkera bruxellensis was found only in specific table wines); and SC with Dekkera bruxellensis and Pichia manshurica. Knowledge concerning the different spoilage profiles is important for winemaking practices in both regions.

  4. Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

    PubMed Central

    Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

    1998-01-01

    In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

  5. The AWA1 Gene Is Required for the Foam-Forming Phenotype and Cell Surface Hydrophobicity of Sake Yeast

    PubMed Central

    Shimoi, Hitoshi; Sakamoto, Kazutoshi; Okuda, Masaki; Atthi, Ratchanee; Iwashita, Kazuhiro; Ito, Kiyoshi

    2002-01-01

    Sake, a traditional alcoholic beverage in Japan, is brewed with sake yeasts, which are classified as Saccharomyces cerevisiae. Almost all sake yeasts form a thick foam layer on sake mash during the fermentation process because of their cell surface hydrophobicity, which increases the cells' affinity for bubbles. To reduce the amount of foam, nonfoaming mutants were bred from foaming sake yeasts. Nonfoaming mutants have hydrophilic cell surfaces and no affinity for bubbles. We have cloned a gene from a foam-forming sake yeast that confers foaming ability to a nonfoaming mutant. This gene was named AWA1 and structures of the gene and its product were analyzed. The N- and C-terminal regions of Awa1p have the characteristic sequences of a glycosylphosphatidylinositol anchor protein. The entire protein is rich in serine and threonine residues and has a lot of repetitive sequences. These results suggest that Awa1p is localized in the cell wall. This was confirmed by immunofluorescence microscopy and Western blotting analysis using hemagglutinin-tagged Awa1p. Moreover, an awa1 disruptant of sake yeast was hydrophilic and showed a nonfoaming phenotype in sake mash. We conclude that Awa1p is a cell wall protein and is required for the foam-forming phenotype and the cell surface hydrophobicity of sake yeast. PMID:11916725

  6. Functional Coupling of a Nematode Chemoreceptor to the Yeast Pheromone Response Pathway

    PubMed Central

    Tehseen, Muhammad; Dumancic, Mira; Briggs, Lyndall; Wang, Jian; Berna, Amalia; Anderson, Alisha; Trowell, Stephen

    2014-01-01

    Sequencing of the Caenorhabditis elegans genome revealed sequences encoding more than 1,000 G-protein coupled receptors, hundreds of which may respond to volatile organic ligands. To understand how the worm's simple olfactory system can sense its chemical environment there is a need to characterise a representative selection of these receptors but only very few receptors have been linked to a specific volatile ligand. We therefore set out to design a yeast expression system for assigning ligands to nematode chemoreceptors. We showed that while a model receptor ODR-10 binds to C. elegans Gα subunits ODR-3 and GPA-3 it cannot bind to yeast Gα. However, chimaeras between the nematode and yeast Gα subunits bound to both ODR-10 and the yeast Gβγ subunits. FIG2 was shown to be a superior MAP-dependent promoter for reporter expression. We replaced the endogenous Gα subunit (GPA1) of the Saccharomyces cerevisiae (ste2Δ sst2Δ far1Δ) triple mutant (“Cyb”) with a Gpa1/ODR-3 chimaera and introduced ODR-10 as a model nematode GPCR. This strain showed concentration-dependent activation of the yeast MAP kinase pathway in the presence of diacetyl, the first time that the native form of a nematode chemoreceptor has been functionally expressed in yeast. This is an important step towards en masse de-orphaning of C. elegans chemoreceptors. PMID:25415379

  7. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  8. Isolated yeast promoter sequence and a method of regulated heterologous expression

    DOEpatents

    Gao, Johnway; Skeen, Rodney S.; Hooker, Brian S.; Anderson, Daniel B.

    2005-05-31

    The present invention provides the promoter clone discovery of a glucoamylase gene of a starch utilizing yeast strain Schwanniomyces castellii. The isolated glucoamylase promoter is an inducible promoter, which can regulate strong gene expression in starch culture medium.

  9. A specific role of the yeast mitochondrial carriers MRS3/4p in mitochondrial iron acquisition under iron-limiting conditions.

    PubMed

    Mühlenhoff, Ulrich; Stadler, Jochen A; Richhardt, Nadine; Seubert, Andreas; Eickhorst, Thomas; Schweyen, Rudolf J; Lill, Roland; Wiesenberger, Gerlinde

    2003-10-17

    The yeast genes MRS3 and MRS4 encode two members of the mitochondrial carrier family with high sequence similarity. To elucidate their function we utilized genome-wide expression profiling and found that both deletion and overexpression of MRS3/4 lead to up-regulation of several genes of the "iron regulon." We therefore analyzed the two major iron-utilizing processes, heme formation and Fe/S protein biosynthesis in vivo, in organello (intact mitochondria), and in vitro (mitochondrial extracts). Radiolabeling of yeast cells with 55Fe revealed a clear correlation between MRS3/4 expression levels and the efficiency of these biosynthetic reactions indicating a role of the carriers in utilization and/or transport of iron in vivo. Similar effects on both heme formation and Fe/S protein biosynthesis were seen in organello using mitochondria isolated from cells grown under iron-limiting conditions. The correlation between MRS3/4 expression levels and the efficiency of the two iron-utilizing processes was lost upon detergent lysis of mitochondria. As no significant changes in the mitochondrial membrane potential were observed upon overexpression or deletion of MRS3/4, our results suggest that Mrs3/4p carriers are directly involved in mitochondrial iron uptake. Mrs3/4p function in mitochondrial iron transport becomes evident under iron-limiting conditions only, indicating that the two carriers do not represent the sole system for mitochondrial iron acquisition.

  10. Evolutionary biology through the lens of budding yeast comparative genomics.

    PubMed

    Marsit, Souhir; Leducq, Jean-Baptiste; Durand, Éléonore; Marchant, Axelle; Filteau, Marie; Landry, Christian R

    2017-10-01

    The budding yeast Saccharomyces cerevisiae is a highly advanced model system for studying genetics, cell biology and systems biology. Over the past decade, the application of high-throughput sequencing technologies to this species has contributed to this yeast also becoming an important model for evolutionary genomics. Indeed, comparative genomic analyses of laboratory, wild and domesticated yeast populations are providing unprecedented detail about many of the processes that govern evolution, including long-term processes, such as reproductive isolation and speciation, and short-term processes, such as adaptation to natural and domestication-related environments.

  11. Between science and industry-applied yeast research.

    PubMed

    Korhola, Matti

    2018-03-01

    I was fortunate to enter yeast research at the Alko Research Laboratories with a strong tradition in yeast biochemistry and physiology studies. At the same time in the 1980s there was a fundamental or paradigm change in molecular biology research with discoveries in DNA sequencing and other analytical and physical techniques for studying macromolecules and cells. Since that time biotechnological research has expanded the traditional fermentation industries to efficient production of industrial and other enzymes and specialty chemicals. Our efforts were directed towards improving the industrial production organisms: minerals enriched yeasts (Se, Cr, Zn) and high glutathione content yeast, baker´s, distiller´s, sour dough and wine yeasts, and the fungal Trichoderma reesei platform for enzyme production. I am grateful for the trust of my colleagues in several leadership positions at the Alko Research Laboratories, Yeast Industry Platform and at the international yeast community.

  12. Isolation and expression of a gene (CGR1) regulated during the yeast-hyphal transition in Candida albicans.

    PubMed

    Cho, T; Sudoh, M; Tanaka, T; Nakashima, Y; Chibana, H; Kaminishi, H

    2001-01-26

    We used RNA fingerprinting of arbitrarily primed PCR to isolate genes upregulated during the yeast-hyphal transition in Candida albicans. The sequence and expression of one of these genes (CGR1, Candida growth regulation) are presented. Our results suggest that CGR1 expression is associated with a growth cessation of yeast cells, a prerequisite for germination in this organism.

  13. Comparison of Nested PCR and RFLP for Identification and Classification of Malassezia Yeasts from Healthy Human Skin

    PubMed Central

    Oh, Byung Ho; Song, Young Chan; Choe, Yong Beom; Ahn, Kyu Joong

    2009-01-01

    Background Malassezia yeasts are normal flora of the skin found in 75~98% of healthy subjects. The accurate identification of the Malassezia species is important for determining the pathogenesis of the Malassezia yeasts with regard to various skin diseases such as Malassezia folliculitis, seborrheic dermatitis, and atopic dermatitis. Objective This research was conducted to determine a more accurate and rapid molecular test for the identification and classification of Malassezia yeasts. Methods We compared the accuracy and efficacy of restriction fragment length polymorphism (RFLP) and the nested polymerase chain reaction (PCR) for the identification of Malassezia yeasts. Results Although both methods demonstrated rapid and reliable results with regard to identification, the nested PCR method was faster. However, 7 different Malassezia species (1.2%) were identified by the nested PCR compared to the RFLP method. Conclusion Our results show that RFLP method was relatively more accurate and reliable for the detection of various Malassezia species compared to the nested PCR. But, in the aspect of simplicity and time saving, the latter method has its own advantages. In addition, the 26S rDNA, which was targeted in this study, contains highly conserved base sequences and enough sequence variation for inter-species identification of Malassezia yeasts. PMID:20523823

  14. Evidence for a high mutation rate at rapidly evolving yeast centromeres.

    PubMed

    Bensasson, Douda

    2011-07-18

    Although their role in cell division is essential, centromeres evolve rapidly in animals, plants and yeasts. Unlike the complex centromeres of plants and aminals, the point centromeres of Saccharomcyes yeasts can be readily sequenced to distinguish amongst the possible explanations for fast centromere evolution. Using DNA sequences of all 16 centromeres from 34 strains of Saccharomyces cerevisiae and population genomic data from Saccharomyces paradoxus, I show that centromeres in both species evolve 3 times more rapidly even than selectively unconstrained DNA. Exceptionally high levels of polymorphism seen in multiple yeast populations suggest that rapid centromere evolution does not result from the repeated selective sweeps expected under meiotic drive. I further show that there is little evidence for crossing-over or gene conversion within centromeres, although there is clear evidence for recombination in their immediate vicinity. Finally I show that the mutation spectrum at centromeres is consistent with the pattern of spontaneous mutation elsewhere in the genome. These results indicate that rapid centromere evolution is a common phenomenon in yeast species. Furthermore, these results suggest that rapid centromere evolution does not result from the mutagenic effect of gene conversion, but from a generalised increase in the mutation rate, perhaps arising from the unusual chromatin structure at centromeres in yeast and other eukaryotes.

  15. Evidence for a high mutation rate at rapidly evolving yeast centromeres

    PubMed Central

    2011-01-01

    Background Although their role in cell division is essential, centromeres evolve rapidly in animals, plants and yeasts. Unlike the complex centromeres of plants and aminals, the point centromeres of Saccharomcyes yeasts can be readily sequenced to distinguish amongst the possible explanations for fast centromere evolution. Results Using DNA sequences of all 16 centromeres from 34 strains of Saccharomyces cerevisiae and population genomic data from Saccharomyces paradoxus, I show that centromeres in both species evolve 3 times more rapidly even than selectively unconstrained DNA. Exceptionally high levels of polymorphism seen in multiple yeast populations suggest that rapid centromere evolution does not result from the repeated selective sweeps expected under meiotic drive. I further show that there is little evidence for crossing-over or gene conversion within centromeres, although there is clear evidence for recombination in their immediate vicinity. Finally I show that the mutation spectrum at centromeres is consistent with the pattern of spontaneous mutation elsewhere in the genome. Conclusions These results indicate that rapid centromere evolution is a common phenomenon in yeast species. Furthermore, these results suggest that rapid centromere evolution does not result from the mutagenic effect of gene conversion, but from a generalised increase in the mutation rate, perhaps arising from the unusual chromatin structure at centromeres in yeast and other eukaryotes. PMID:21767380

  16. Effect of storage and processing on plasmid, yeast and plant genomic DNA stability in juice from genetically modified oranges.

    PubMed

    Weiss, Julia; Ros-Chumillas, Maria; Peña, Leandro; Egea-Cortines, Marcos

    2007-01-30

    Recombinant DNA technology is an important tool in the development of plant varieties with new favourable features. There is strong opposition towards this technology due to the potential risk of horizontal gene transfer between genetically modified plant material and food-associated bacteria, especially if genes for antibiotic resistance are involved. Since horizontal transfer efficiency depends on size and length of homologous sequences, we investigated the effect of conditions required for orange juice processing on the stability of DNA from three different origins: plasmid DNA, yeast genomic DNA and endogenous genomic DNA from transgenic sweet orange (C. sinensis L. Osb.). Acidic orange juice matrix had a strong degrading effect on plasmid DNA which becomes apparent in a conformation change from supercoiled structure to nicked, linear structure within 5h of storage at 4 degrees C. Genomic yeast DNA was degraded during exposure to acidic orange juice matrix within 4 days, and also the genomic DNA of C. sinensis suffered degradation within 2 days of storage as indicated by amplification results from transgene markers. Standard pasteurization procedures affected DNA integrity depending on the method and time used. Our data show that the current standard industrial procedures to pasteurize orange juice as well as its acidic nature causes a strong degradation of both yeast and endogenous genomic DNA below sizes reported to be suitable for horizontal gene transfer.

  17. Candida pruni sp. nov. is a new yeast species with antagonistic potential against brown rot of peaches.

    PubMed

    Zhang, Dian-peng; Lu, Cai-ge; Zhang, Tao-tao; Spadaro, Davide; Liu, De-wen; Liu, Wei-cheng

    2014-07-01

    Brown rot caused by Monilinia spp. is among the most important postharvest diseases of commercially grown stone fruits, and application of antagonistic yeasts to control brown rot is one promising strategy alternative to chemical fungicides. In this research, new yeast strains were isolated and tested for their activity against peach brown rot caused by Monilinia fructicola. Three yeast strains were originally isolated from the surface of plums (cv Chinese Angelino) collected in the north of China. In artificially wounded inoculation tests, the yeast reduced the brown rot incidence to 20 %. The population of the yeast within inoculated wounds on peaches significantly increased at 25 °C from an initial level of 5.0×10(6) to 4.45×10(7) CFU per wound after 1 day. The antagonistic strains were belonging to a new species of the genus Candida by sequence comparisons of 26 S rDNA D1/D2 domain and internal transcribed spacer region. The strains are most closely related to C. asparagi, C. musae and C. fructus on the basis of the phylogenetic trees based on the D1/D2 region of 26S rDNA. However, the strains are notably different from C. asparagi, C. musae and C. fructus, in morphological and physiological characteristics. Therefore, the name Candida pruni is proposed for the novel species, with sp-Quan (=CBS12814T=KCTC 27526T=GCMC 6582T) as the type strain. Our study showed that Candida pruni is a novel yeast species with potential biocontrol against brown rot caused by M. fructicola on peaches.

  18. LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

    PubMed Central

    Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

    1994-01-01

    We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. In this database each sequence has been attributed a single genetic name. In the case of duplicated sequences a simple method has been applied to distinguish between sequences of one and the same gene from non-allelic sequences of duplicated genes. If necessary, synonyms are given in the case of allelic duplicated sequences. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, Swissprot and EMBL accession numbers. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). PMID:7937046

  19. Comparative Polygenic Analysis of Maximal Ethanol Accumulation Capacity and Tolerance to High Ethanol Levels of Cell Proliferation in Yeast

    PubMed Central

    Pais, Thiago M.; Foulquié-Moreno, María R.; Hubmann, Georg; Duitama, Jorge; Swinnen, Steve; Goovaerts, Annelies; Yang, Yudi; Dumortier, Françoise; Thevelein, Johan M.

    2013-01-01

    The yeast Saccharomyces cerevisiae is able to accumulate ≥17% ethanol (v/v) by fermentation in the absence of cell proliferation. The genetic basis of this unique capacity is unknown. Up to now, all research has focused on tolerance of yeast cell proliferation to high ethanol levels. Comparison of maximal ethanol accumulation capacity and ethanol tolerance of cell proliferation in 68 yeast strains showed a poor correlation, but higher ethanol tolerance of cell proliferation clearly increased the likelihood of superior maximal ethanol accumulation capacity. We have applied pooled-segregant whole-genome sequence analysis to identify the polygenic basis of these two complex traits using segregants from a cross of a haploid derivative of the sake strain CBS1585 and the lab strain BY. From a total of 301 segregants, 22 superior segregants accumulating ≥17% ethanol in small-scale fermentations and 32 superior segregants growing in the presence of 18% ethanol, were separately pooled and sequenced. Plotting SNP variant frequency against chromosomal position revealed eleven and eight Quantitative Trait Loci (QTLs) for the two traits, respectively, and showed that the genetic basis of the two traits is partially different. Fine-mapping and Reciprocal Hemizygosity Analysis identified ADE1, URA3, and KIN3, encoding a protein kinase involved in DNA damage repair, as specific causative genes for maximal ethanol accumulation capacity. These genes, as well as the previously identified MKT1 gene, were not linked in this genetic background to tolerance of cell proliferation to high ethanol levels. The superior KIN3 allele contained two SNPs, which are absent in all yeast strains sequenced up to now. This work provides the first insight in the genetic basis of maximal ethanol accumulation capacity in yeast and reveals for the first time the importance of DNA damage repair in yeast ethanol tolerance. PMID:23754966

  20. Nup93, a Vertebrate Homologue of Yeast Nic96p, Forms a Complex with a Novel 205-kDa Protein and Is Required for Correct Nuclear Pore Assembly

    PubMed Central

    Grandi, Paola; Dang, Tam; Pané, Nelly; Shevchenko, Andrej; Mann, Matthias; Forbes, Douglass; Hurt, Ed

    1997-01-01

    Yeast and vertebrate nuclear pores display significant morphological similarity by electron microscopy, but sequence similarity between the respective proteins has been more difficult to observe. Herein we have identified a vertebrate nucleoporin, Nup93, in both human and Xenopus that has proved to be an evolutionarily related homologue of the yeast nucleoporin Nic96p. Polyclonal antiserum to human Nup93 detects corresponding proteins in human, rat, and Xenopus cells. Immunofluorescence and immunoelectron microscopy localize vertebrate Nup93 at the nuclear basket and at or near the nuclear entry to the gated channel of the pore. Immunoprecipitation from both mammalian and Xenopus cell extracts indicates that a small fraction of Nup93 physically interacts with the nucleoporin p62, just as yeast Nic96p interacts with the yeast p62 homologue. However, a large fraction of vertebrate Nup93 is extracted from pores and is also present in Xenopus egg extracts in complex with a newly discovered 205-kDa protein. Mass spectrometric sequencing of the human 205-kDa protein reveals that this protein is encoded by an open reading frame, KIAAO225, present in the human database. The putative human nucleoporin of 205 kDa has related sequence homologues in Caenorhabditis elegans and Saccharomyces cerevisiae. To analyze the role of the Nup93 complex in the pore, nuclei were assembled that lack the Nup93 complex after immunodepletion of a Xenopus nuclear reconstitution extract. The Nup93-complex–depleted nuclei are clearly defective for correct nuclear pore assembly. From these experiments, we conclude that the vertebrate and yeast pore have significant homology in their functionally important cores and that, with the identification of Nup93 and the 205-kDa protein, we have extended the knowledge of the nearest-neighbor interactions of this core in both yeast and vertebrates. PMID:9348540

  1. Biogas Production from Brewer’s Yeast Using an Anaerobic Sequencing Batch Reactor

    PubMed Central

    2017-01-01

    Summary Renewable energy sources are becoming increasingly important in the beverage and food industries. In the brewing industry, a significant percentage of the used raw materials finishes the process as secondary resource or waste. The research on the anaerobic digestion of brewer’s yeast has been scarce until recent years. One of the reasons for this is its use as a secondary resource in the food industry and as cattle feed. Additionally, market value of brewer’s yeast is higher than its energy value. Due to the increase of energy prices, brewer’s yeast has become of interest as energy substrate despite its difficult degradability in anaerobic conditions. The anaerobic co-digestion of brewer’s yeast and anaerobically treated brewery wastewater was studied using a pilot-scale anaerobic sequencing batch reactor (ASBR) seeded with granular biomass. The experiments showed very good and stable operation with an organic loading rate of up to 8.0 kg/(m3·day), and with a maximum achieved organic loading rate of 13.6 kg/(m3·day) in a single cycle. A specific biogas productivity of over 0.430 m3/kg of the total chemical oxygen demand (COD) inserted, and total COD removal efficiencies of over 90% were achieved. This study suggests that the brewer’s yeast can be successfully digested in an ASBR without adverse effects on the biogas production from brewer’s yeast/wastewater mixtures of up to 8% (by volume). By using the brewer’s yeast in the ASBR process, the biogas production from brewery wastewater could be increased by 50%. PMID:28867948

  2. The wine and beer yeast Dekkera bruxellensis

    PubMed Central

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd. PMID:24932634

  3. The wine and beer yeast Dekkera bruxellensis.

    PubMed

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd.

  4. Priceomyuces M. Suzuki & Kurtzman (2010)

    USDA-ARS?s Scientific Manuscript database

    This chapter describes the ascomycete yeast genus Priceomyces and is to be published in "The Yeasts, A Taxonomic Study, 5th edition." The genus Priceomyces has five described species that were earlier assigned to the genus Pichia, but gene sequence analysis showed that the species, now reclassified...

  5. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    DOEpatents

    Wohlbach, Dana J.; Gasch, Audrey P.

    2015-09-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  6. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    DOEpatents

    Wohlbach, Dana J.; Gasch, Audrey P.

    2016-11-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  7. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    DOEpatents

    Wohlbach, Dana J.; Gasch, Audrey P.

    2014-08-05

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  8. Candida ficus sp. nov., a novel yeast species from the gut of Apriona germari larvae.

    PubMed

    Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Liu, Zheng

    2012-11-01

    A novel yeast species is described based on three strains from the gut of wood-boring larvae collected in a tree trunk of Ficus carica cultivated in parks near Nanyang, central China. Phylogenetic analysis based on sequences of the D1/D2 domains of the large subunit rRNA gene showed that these strains occurred in a separate clade that was genetically distinct from all known ascomycetous yeasts. In terms of pairwise sequence divergence, the novel strains differed by 15.3% divergence from the type strain of Pichia terricola, and by 15.8% divergence from the type strains of Pichia exigua and Candida rugopelliculosa in the D1/D2 domains. All three are ascomycetous yeasts in the Pichia clade. Unlike P. terricola, P. exigua and C. rugopelliculosa, the novel isolates did not ferment glucose. The name Candida ficus sp. nov. is proposed to accommodate these highly divergent organisms, with STN-8(T) (=CICC 1980(T)=CBS 12638(T)) as the type strain.

  9. The diversity of eukaryotic microbiota in the traditional Slovak sheep cheese--bryndza.

    PubMed

    Laurencík, M; Sulo, P; Sláviková, E; Piecková, E; Seman, M; Ebringer, L

    2008-09-30

    We investigated the occurrence and diversity of yeasts and filamentous fungi in bryndza an artisanal Slovak soft spreadable cheese prepared from raw sheep milk or from a mixture of sheep and cow milk. Samples collected during four months of the summer production period from two locations (northern and southern parts of central Slovakia) contained 10(5)-10(7) (cfu) yeasts and about 10(2) (cfu) of mold per gram of wet weight. Further characterization by conventional taxonomy and sequence comparison of D1/D2 region from 26S rRNA gene revealed Mucor circinelloides v. Tieghem as the predominant filamentous fungus. A novel Geotrichum sp. together with Kluyveromyces (K. lactis/K. marxianus) was identified as the most abundant yeast species. Occasionally other yeasts, such as Candida inconspicua, Candida silvae, Pichia fermentans and Trichosporon domesticum were found. Conventional taxonomy readily identified isolates to the genus level, but DNA sequence comparison was capable of discriminating them at the species level.

  10. Establishing biorientation occurs with precocious separation of the sister kinetochores, but not the arms, in the early spindle of budding yeast.

    PubMed

    Goshima, G; Yanagida, M

    2000-03-17

    Sister kinetochores are bioriented toward the spindle poles in higher eukaryotic prometaphase before chromosome segregation. We show that, in budding yeast, the sister kinetochores are separated in the very early spindle, while the sister arms remain associated. Biorientation of the separated kinetochores is achieved already after replication. Mtw1p, a homolog of fission yeast Mis12 required for biorientation, locates at the centromeres in an Ndc10p-dependent manner. Mtw1p and the sequences 1.8 and 3.8 kb from CEN3 and CEN15, respectively, behave like the precociously separated kinetochores, whereas the sequences 23 and 35 kb distant from CEN3 and CEN5 previously used as the centromere markers behave like a part of the arm. Mtw1p and Ndc10p are identically located except for additional spindle localization of Ndc10p. A model explaining small centromeres and early spindle formation in budding yeast is proposed.

  11. Yarrowia lipolytica vesicle-mediated protein transport pathways

    PubMed Central

    Swennen, Dominique; Beckerich, Jean-Marie

    2007-01-01

    Background Protein secretion is a universal cellular process involving vesicles which bud and fuse between organelles to bring proteins to their final destination. Vesicle budding is mediated by protein coats; vesicle targeting and fusion depend on Rab GTPase, tethering factors and SNARE complexes. The Génolevures II sequencing project made available entire genome sequences of four hemiascomycetous yeasts, Yarrowia lipolytica, Debaryomyces hansenii, Kluyveromyces lactis and Candida glabrata. Y. lipolytica is a dimorphic yeast and has good capacities to secrete proteins. The translocation of nascent protein through the endoplasmic reticulum membrane was well studied in Y. lipolytica and is largely co-translational as in the mammalian protein secretion pathway. Results We identified S. cerevisiae proteins involved in vesicular secretion and these protein sequences were used for the BLAST searches against Génolevures protein database (Y. lipolytica, C. glabrata, K. lactis and D. hansenii). These proteins are well conserved between these yeasts and Saccharomyces cerevisiae. We note several specificities of Y. lipolytica which may be related to its good protein secretion capacities and to its dimorphic aspect. An expansion of the Y. lipolytica Rab protein family was observed with autoBLAST and the Rab2- and Rab4-related members were identified with BLAST against NCBI protein database. An expansion of this family is also found in filamentous fungi and may reflect the greater complexity of the Y. lipolytica secretion pathway. The Rab4p-related protein may play a role in membrane recycling as rab4 deleted strain shows a modification of colony morphology, dimorphic transition and permeability. Similarly, we find three copies of the gene (SSO) encoding the plasma membrane SNARE protein. Quantification of the percentages of proteins with the greatest homology between S. cerevisiae, Y. lipolytica and animal homologues involved in vesicular transport shows that 40% of Y. lipolytica proteins are closer to animal ones, whereas they are only 13% in the case of S. cerevisiae. Conclusion These results provide further support for the idea, previously noted about the endoplasmic reticulum translocation pathway, that Y. lipolytica is more representative of vesicular secretion of animals and other fungi than is S. cerevisiae. PMID:17997821

  12. Among-Population Variation in Microbial Community Structure in the Floral Nectar of the Bee-Pollinated Forest Herb Pulmonaria officinalis L

    PubMed Central

    Jacquemyn, Hans; Lenaerts, Marijke; Brys, Rein; Willems, Kris; Honnay, Olivier; Lievens, Bart

    2013-01-01

    Background Microbial communities in floral nectar have been shown to be characterized by low levels of species diversity, yet little is known about among-plant population variation in microbial community composition. Methodology/Principal Findings We investigated the microbial community structure (yeasts and bacteria) in floral nectar of ten fragmented populations of the bee-pollinated forest herb Pulmonaria officinalis. We also explored possible relationships between plant population size and microbial diversity in nectar, and related microbial community composition to the distance separating plant populations. Culturable bacteria and yeasts occurring in the floral nectar of a total of 100 plant individuals were isolated and identified by partially sequencing the 16S rRNA gene and D1/D2 domains of the 26S rRNA gene, respectively. A total of 9 and 11 yeast and 28 and 39 bacterial OTUs was found, taking into account a 3% (OTU0.03) and 1% sequence dissimilarity cut-off (OTU0.01). OTU richness at the plant population level (i.e. the number of OTUs per population) was low for yeasts (mean: 1.7, range: 0–4 OTUs0.01/0.03 per population), whereas on average 6.9 (range: 2–13) OTUs0.03 and 7.9 (range 2–16) OTUs0.01 per population were found for bacteria. Both for yeasts and bacteria, OTU richness was not significantly related to plant population size. Similarity in community composition among populations was low (average Jaccard index: 0.14), and did not decline with increasing distance between populations. Conclusions/Significance We found low similarity in microbial community structure among populations, suggesting that the assembly of nectar microbiota is to a large extent context-dependent. Although the precise factors that affect variation in microbial community structure in floral nectar require further study, our results indicate that both local and regional processes may contribute to among-population variation in microbial community structure in nectar. PMID:23536759

  13. Among-population variation in microbial community structure in the floral nectar of the bee-pollinated forest herb Pulmonaria officinalis L.

    PubMed

    Jacquemyn, Hans; Lenaerts, Marijke; Brys, Rein; Willems, Kris; Honnay, Olivier; Lievens, Bart

    2013-01-01

    Microbial communities in floral nectar have been shown to be characterized by low levels of species diversity, yet little is known about among-plant population variation in microbial community composition. We investigated the microbial community structure (yeasts and bacteria) in floral nectar of ten fragmented populations of the bee-pollinated forest herb Pulmonaria officinalis. We also explored possible relationships between plant population size and microbial diversity in nectar, and related microbial community composition to the distance separating plant populations. Culturable bacteria and yeasts occurring in the floral nectar of a total of 100 plant individuals were isolated and identified by partially sequencing the 16S rRNA gene and D1/D2 domains of the 26S rRNA gene, respectively. A total of 9 and 11 yeast and 28 and 39 bacterial OTUs was found, taking into account a 3% (OTU0.03) and 1% sequence dissimilarity cut-off (OTU0.01). OTU richness at the plant population level (i.e. the number of OTUs per population) was low for yeasts (mean: 1.7, range: 0-4 OTUs0.01/0.03 per population), whereas on average 6.9 (range: 2-13) OTUs0.03 and 7.9 (range 2-16) OTUs0.01 per population were found for bacteria. Both for yeasts and bacteria, OTU richness was not significantly related to plant population size. Similarity in community composition among populations was low (average Jaccard index: 0.14), and did not decline with increasing distance between populations. We found low similarity in microbial community structure among populations, suggesting that the assembly of nectar microbiota is to a large extent context-dependent. Although the precise factors that affect variation in microbial community structure in floral nectar require further study, our results indicate that both local and regional processes may contribute to among-population variation in microbial community structure in nectar.

  14. Histological evaluation of direct pulp capping with all-in-one adhesives in rat teeth.

    PubMed

    Shinkai, Koichi; Taira, Yoshihisa; Kawashima, Satoki; Suzuki, Shiro; Suzuki, Masaya

    2017-05-31

    The aim of this study was to histologically evaluate direct pulp capping using different all-in-one adhesives in rat teeth. Five all-in-one adhesives and a control material (MTA) were used. Each material was applied on the exposed pulp, and each cavity was subsequently restored with the resin composite. Rats were sacrificed 14 days after the surgical procedure. Serial stained sections were histologically evaluated for examining pulp tissue disorganization (PTD), inflammatory cell infiltration (ICI), dentin bridge formation (DBF), and bacterial penetration (BP). We found that rat pulps, which were direct capped with all-in-one adhesives, showed various degrees of PTD, ICI, and DBF depending on the material, and that there were no complete dentin bridges. In contrast, rat pulps capped with MTA showed no PTD and ICI, and there were complete dentin bridges in all, but one specimen. No BP was observed in any specimen.

  15. [Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

    PubMed

    Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

    2007-07-01

    To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

  16. Low-pH production of D-lactic acid using newly isolated acid tolerant yeast Pichia kudriavzevii NG7.

    PubMed

    Park, Hyun Joo; Bae, Jung-Hoon; Ko, Hyeok-Jin; Lee, Sun-Hee; Sung, Bong Hyun; Han, Jong-In; Sohn, Jung-Hoon

    2018-06-13

    Lactic acid is a platform chemical for the sustainable production of various materials. To develop a robust yeast platform for low-pH production of D-lactic acid, an acid-tolerant yeast strain was isolated from grape skins and named Pichia kudriavzevii NG7 by ribosomal RNA sequencing. This strain was able to grow at pH 2.0 and 50°C. For the commercial application of P. kudriavzevii NG7 as a lactic acid producer, the ethanol fermentation pathway was redirected to lactic acid by replacing pyruvate decarboxylase 1 gene (PDC1) with D-lactate dehydrogenase gene (D-LDH) derived from Lactobacillus plantarum. To enhance lactic acid tolerance, this engineered strain was adapted to high lactic acid concentrations, and a new transcriptional regulator, PAR1, responsible for acid tolerance, was identified by whole-genome resequencing. The final engineered strain produced 135 g/L and 154 g/L of D-lactic acid with productivity over 3.66 g/L/h at pH 3.6 and 4.16 g/L/h at pH 4.7, respectively. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. Isolation and characterization of yeasts capable of efficient utilization of hemicellulosic hydrolyzate as the carbon source.

    PubMed

    Cassa-Barbosa, L A; Procópio, R E L; Matos, I T S R; Filho, S A

    2015-09-28

    Few yeasts have shown the potential to efficiently utilize hemicellulosic hydrolyzate as the carbon source. In this study, microorganisms isolated from the Manaus region in Amazonas, Brazil, were characterized based on their utilization of the pentoses, xylose, and arabinose. The yeasts that showed a potential to assimilate these sugars were selected for the better utilization of lignocellulosic biomass. Two hundred and thirty seven colonies of unicellular microorganisms grown on hemicellulosic hydrolyzate, xylose, arabinose, and yeast nitrogen base selective medium were analyzed. Of these, 231 colonies were subjected to sugar assimilation tests. One hundred and twenty five of these were shown to utilize hydrolyzed hemicellulose, xylose, or arabinose as the carbon source for growth. The colonies that showed the best growth (N = 57) were selected, and their internal transcribed spacer-5.8S rDNA was sequenced. The sequenced strains formed four distinct groups in the phylogenetic tree, and showed a high percentage of similarity with Meyerozyma caribbica, Meyerozyma guilliermondii, Trichosporon mycotoxinivorans, Trichosporon loubieri, Pichia kudriavzevii, Candida lignohabitans, and Candida ethanolica. The discovery of these xylose-fermenting yeasts could attract widespread interest, as these can be used in the cost-effective production of liquid fuel from lignocellulosic materials.

  18. PomBase: a comprehensive online resource for fission yeast

    PubMed Central

    Wood, Valerie; Harris, Midori A.; McDowall, Mark D.; Rutherford, Kim; Vaughan, Brendan W.; Staines, Daniel M.; Aslett, Martin; Lock, Antonia; Bähler, Jürg; Kersey, Paul J.; Oliver, Stephen G.

    2012-01-01

    PomBase (www.pombase.org) is a new model organism database established to provide access to comprehensive, accurate, and up-to-date molecular data and biological information for the fission yeast Schizosaccharomyces pombe to effectively support both exploratory and hypothesis-driven research. PomBase encompasses annotation of genomic sequence and features, comprehensive manual literature curation and genome-wide data sets, and supports sophisticated user-defined queries. The implementation of PomBase integrates a Chado relational database that houses manually curated data with Ensembl software that supports sequence-based annotation and web access. PomBase will provide user-friendly tools to promote curation by experts within the fission yeast community. This will make a key contribution to shaping its content and ensuring its comprehensiveness and long-term relevance. PMID:22039153

  19. Assessment of fungal diversity in a water-damaged office building.

    PubMed

    Green, Brett J; Lemons, Angela R; Park, Yeonmi; Cox-Ganser, Jean M; Park, Ju-Hyeong

    2017-04-01

    Recent studies have described fungal communities in indoor environments using gene sequencing-based approaches. In this study, dust-borne fungal communities were elucidated from a water-damaged office building located in the northeastern region of the United States using internal transcribed spacer (ITS) rRNA gene sequencing. Genomic DNA was extracted from 5 mg of floor dust derived from 22 samples collected from either the lower floors (n = 8) or a top floor (n = 14) of the office building. ITS gene sequencing resolved a total of 933 ITS sequences and was clustered into 216 fungal operational taxonomic units (OTUs). Analysis of fungal OTUs at the 97% similarity threshold showed a difference between the lower and top floors that was marginally significant (p = 0.049). Species richness and diversity indices were reduced in the lower floor samples compared to the top floor samples and there was a high degree of compositional dissimilarity within and between the two different areas within the building. Fungal OTUs were placed in the phyla Ascomycota (55%), Basidiomycota (41%), Zygomycota (3%), Glomeromycota (0.4%), Chytridiomycota (0.3%), and unassigned fungi (0.5%). The Ascomycota classes with the highest relative abundances included the Dothideomycetes (30%) and Eurotiomycetes (16%). The Basidiomycota consisted of the classes Ustilaginomycetes (14%), Tremellomycetes (11%), and Agaricomycetes (8%). Sequence reads derived from the plant pathogen Ustilago syntherismae were the most abundant in the analysis as were obligate Basidiomycota yeast species that accounted for 12% and 11% of fungal ITS sequences, respectively. ITS gene sequencing provides additional insight into the diversity of fungal OTUs. These data further highlight the contribution of fungi placed in the phylum Basidiomycota, obligate yeasts, as well as xerophilic species that are typically not resolved using traditional culture methods.

  20. Production, characterization and gene cloning of the extracellular enzymes from the marine-derived yeasts and their potential applications.

    PubMed

    Chi, Zhenming; Chi, Zhe; Zhang, Tong; Liu, Guanglei; Li, Jing; Wang, Xianghong

    2009-01-01

    In this review article, the extracellular enzymes production, their properties and cloning of the genes encoding the enzymes from marine yeasts are overviewed. Several yeast strains which could produce different kinds of extracellular enzymes were selected from the culture collection of marine yeasts available in this laboratory. The strains selected belong to different genera such as Yarrowia, Aureobasidium, Pichia, Metschnikowia and Cryptococcus. The extracellular enzymes include cellulase, alkaline protease, aspartic protease, amylase, inulinase, lipase and phytase, as well as killer toxin. The conditions and media for the enzyme production by the marine yeasts have been optimized and the enzymes have been purified and characterized. Some genes encoding the extracellular enzymes from the marine yeast strains have been cloned, sequenced and expressed. It was found that some properties of the enzymes from the marine yeasts are unique compared to those of the homologous enzymes from terrestrial yeasts and the genes encoding the enzymes in marine yeasts are different from those in terrestrial yeasts. Therefore, it is of very importance to further study the enzymes and their genes from the marine yeasts. This is the first review on the extracellular enzymes and their genes from the marine yeasts.

  1. Growth inhibition of Saccharomyces cerevisiae by the immunosuppressant leflunomide is due to the inhibition of uracil uptake via Fur4p.

    PubMed

    Fujimura, H

    1998-10-01

    The immunosuppressant leflunomide inhibits cytokine-stimulated proliferation of lymphoid cells in vitro and also inhibits the growth of the eukaryotic microorganism Saccharomyces cerevisiae. To elucidate the molecular mechanism of action of the drug, two yeast genes which suppress the anti-proliferative effect when present in multiple copies were cloned and designated MLF1 and MLF2 for multicopy suppressor of leflunomide sensitivity. DNA sequencing analysis revealed that the MLF1 gene is identical to the FUR4 gene, which encodes a uracil permease and functions to import uracil efficiently. The MLF2 was found to be identical to the URA3 gene. Excess exogenous uracil also overcomes the anti-proliferative effect of leflunomide on yeast cells. Uracil prototrophy also conferred resistance to leflunomide. Uracil uptake was inhibited by leflunomide. Thus, the growth inhibition by leflunomide seen in a S. cerevisiae ura3 auxotroph is due to the inhibition of the entry of exogenous uracil via the Fur4 uracil permease.

  2. [Treatment of oil-manufacturing wastewater by yeast-SBR system].

    PubMed

    Lü, Wen-zhou; Liu, Ying; Huang, Yi-zhen

    2008-04-01

    Eight yeast strains were applied to a sequencing batch reactor (SBR) to treat high-strength oil-containing wastewater. The removal performance, yeast cultivation method and key factors affecting the stability of system were discussed. The results show yeast sludge with MLSS of 19 g/L and SVI of 35 mL/g can be obtained in 6 d in an open system without any molds and bacteria inhibitor addition; In 30 d continuous wastewater treatment, COD and oil removal rate achieve 86.8%-96.9% and above 99.5% respectively under the influent conditions of the COD of 9000-23000 mg/L and oil of 4500-16000 mg/L; Short period of pH impact brings reversible effects on the system and the sludge retention time can affect the SVI of the yeast; Absence of nitrogen induces morphology conversion of some yeast cells from single cell to filamentous one and impairs the settling capability of the yeast.

  3. Yeast species diversity in apple juice for cider production evidenced by culture-based method.

    PubMed

    Lorenzini, Marilinda; Simonato, Barbara; Zapparoli, Giacomo

    2018-05-07

    Identification of yeasts isolated from apple juices of two cider houses (one located in a plain area and one in an alpine area) was carried out by culture-based method. Wallerstein Laboratory Nutrient Agar was used as medium for isolation and preliminary yeasts identification. A total of 20 species of yeasts belonging to ten different genera were identified using both BLAST algorithm for pairwise sequence comparison and phylogenetic approaches. A wide variety of non-Saccharomyces species was found. Interestingly, Candida railenensis, Candida cylindracea, Hanseniaspora meyeri, Hanseniaspora pseudoguilliermondii, and Metschnikowia sinensis were recovered for the first time in the yeast community of an apple environment. Phylogenetic analysis revealed a better resolution in identifying Metschnikowia and Moesziomyces isolates than comparative analysis using the GenBank or YeastIP gene databases. This study provides important data on yeast microbiota of apple juice and evidenced differences between two geographical cider production areas in terms of species composition.

  4. History of genome editing in yeast.

    PubMed

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  5. Distal Insertions of the Biceps Femoris

    PubMed Central

    Branch, Eric A.; Anz, Adam W.

    2015-01-01

    Background: Avulsion of the biceps femoris from the fibula and proximal tibia is encountered in clinical practice. While the anatomy of the primary posterolateral corner structures has been qualitatively and quantitatively described, a quantitative analysis regarding the insertions of the biceps femoris on the fibula and proximal tibia is lacking. Purpose: To quantitatively assess the insertions of the biceps femoris, fibular collateral ligament (FCL), and anterolateral ligament (ALL) on the fibula and proximal tibia as well as establish relationships among these structures and to pertinent surgical anatomy. Study Design: Descriptive laboratory study. Methods: Dissections were performed on 12 nonpaired, fresh-frozen cadaveric specimens identifying the biceps femoris, FCL, and ALL, and their insertions on the proximal tibia and fibula. The footprint areas, orientations, and distances from relevant osseous landmarks were measured using a 3-dimensional coordinate measurement device. Results: Dissection produced 6 easily identifiable and reproducible anatomic footprints. Tibial footprints included the insertion of the ALL and an insertion of the biceps femoris (TBF). Fibular footprints included the insertion of the FCL, a distal insertion of the biceps femoris (DBF), a medial footprint of the biceps femoris (MBF), and a proximal footprint of the biceps femoris (PBF). The mean area of these footprints (95% CI) was as follows: ALL, 53.0 mm2 (38.4-67.6); TBF, 93.9 mm2 (72.0-115.8); FCL, 86.8 mm2 (72.3-101.2); DBF, 119 mm2 (91.1-146.9); MBF, 46.8 mm2 (29.0-64.5); and PBF, 215 mm2 (192.4-237.5). The mean distance (95% CI) from the Gerdy tubercle to the center of the ALL footprint was 24.3 mm (21.6-27.0) and to the center of the TBF was 22.5 mm (21.0-24.0). The center of the DBF was 8.68 mm (7.0-10.3) from the anterior border of the fibula, the center of the FCL was 14.6 mm (12.5-16.7) from the anterior border of the fibula and 20.7 mm (19.0-22.4) from the tip of the fibular styloid, and the center of the PBF was 8.96 mm (8.2-9.7) from the tip of the fibular styloid. Conclusion: A tibial footprint, distal fibular footprint, medial fibular footprint, and proximal fibular footprint were all consistent components of the insertion of the biceps femoris. Consistent relationships existed between the biceps femoris and insertions of the ALL and FCL. Clinical Relevance: The size of these footprints and distances from pertinent surgical landmarks will guide repairs of biceps femoris avulsion injuries. PMID:26535398

  6. Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.

    PubMed

    Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

    2010-11-15

    The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO₂ and temperature) useful for industrial application. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Candida davenportii sp. nov., a potential soft-drinks spoilage yeast isolated from a wasp.

    PubMed

    Stratford, M; Bond, C J; James, S A; Roberts, N; Steels, H

    2002-07-01

    During a survey of yeast ecology in a soft-drinks production facility, a dead wasp was removed from the sampling tap of an external sugar-syrup storage tank. A yeast isolated from the dead wasp was found to be similar, although not identical, in its physiological characteristics to Candida lactis-condensi and Candida stellata. Sequence analysis of the 26S rDNA D1/D2 variable domain revealed that this isolate was most closely related to C stellata, but differed sufficiently in its D1/D2 sequence to indicate that it belonged to a separate species. The yeast species has been named Candida davenportii sp. nov.; the type strain is NCYC 3013T (= CBS 9069T). C davenportii sp. nov. was osmotolerant, moderately preservative-resistant and able to grow in very acidic conditions, i.e. pH 14. This yeast grew well in fruit-containing soft drinks, cola-type beverages and a synthetic soft drink and is therefore a potential cause of spoilage of soft drinks and other sugary food products. Other related yeast species in the same taxonomic clade as C davenportii sp. nov. are also osmotolerant, growing in < 50% (w/v) sugar. Many of these species are associated with insects, specifically bees, bumblebees and leafcutter bees, and many have been reported as the causative agent of spoilage of sugary foods, such as condensed milk, fruit juices and concentrates. It is proposed that C davenportii sp. nov. and other closely related yeasts are primarily associated with Aculeates (bees and wasps). In turn, bees and wasps are attracted by sugary residues in foods such as fruit juices and concentrates, forming the source of infection of these yeasts and thus instigating spoilage.

  8. High-resolution record of the deglaciation of the British-Irish Ice Sheet from North Atlantic deep-sea sediments.

    NASA Astrophysics Data System (ADS)

    Tarlati, S.; Benetti, S.; Callard, L.; O'Cofaigh, C.; Dunlop, P.; Chiverrell, R. C.; Fabel, D.; Moreton, S.; Clark, C.

    2016-12-01

    During the last glacial maximum the British-Irish Ice Sheet (BIIS) covered the majority of Ireland and Britain. Recent studies have described the BIIS as largely marine-based and highly dynamic with several advances and retreats recorded on the continental shelf. The focus of this study is the more recent sediment record from the Donegal Barra Fan (DBF), the largest sediment depocentre formed by the ice streaming of the western BIIS onto the North Atlantic continental margin. In this project, well-preserved, glacially-derived, deep-water sediments from 3 cores, up to 6.7 m long and retrieved from the DBF, are used to investigate and chronologically constrain the pattern of deglaciation of the BIIS. Deep-water sediments can record continuous sedimentation through time, avoiding hiatuses and erosional surfaces characteristic of a glacial environment and allow a detailed reconstruction of deglacial processes. Five lithofacies have been identified using sedimentology, x-rays, physical properties and grain size analysis. They include bioturbated foraminifera-bearing muds, interpreted as hemipelagic and contouritic deposits from interglacial periods. Chaotic and laminated muds, ice-rafted debris (IRD)-rich layers and laminated mud to sand couplets are characteristic of the glacial period including ice-sheet maximum extent and the beginning of retreat. These represent downslope mass movements, plumites from meltwater alongside melting icebergs and turbidites. Radiocarbon dates from foraminifera suggest that the deglacial sedimentary sequence is up to 5m thick. The IRD concentration and abundance of the foraminifera Neogloboquadrina pachyderma sinistral indicate a minimum of 3 different calving events during deglaciation and a marked Younger Dryas cooling and ice calving period. Additionally the δ 18O record will be used to investigate the record of climatic changes in the region and x-ray fluorescence will be used to assess sediment provenance during deglaciation.

  9. Yeast species associated with orange juice: evaluation of different identification methods.

    PubMed

    Arias, Covadonga R; Burns, Jacqueline K; Friedrich, Lorrie M; Goodrich, Renee M; Parish, Mickey E

    2002-04-01

    Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice.

  10. Indole-3-Acetic Acid-Producing Yeasts in the Phyllosphere of the Carnivorous Plant Drosera indica L

    PubMed Central

    Shin, Li-Ying; Wei, Jyuan-Yu; Fu, Shih-Feng; Chou, Jui-Yu

    2014-01-01

    Yeasts are widely distributed in nature and exist in association with other microorganisms as normal inhabitants of soil, vegetation, and aqueous environments. In this study, 12 yeast strains were enriched and isolated from leaf samples of the carnivorous plant Drosera indica L., which is currently threatened because of restricted habitats and use in herbal industries. According to similarities in large subunit and small subunit ribosomal RNA gene sequences, we identified 2 yeast species in 2 genera of the phylum Ascomycota, and 5 yeast species in 5 genera of the phylum Basidiomycota. All of the isolated yeasts produced indole-3-acetic acid (IAA) when cultivated in YPD broth supplemented with 0.1% L-tryptophan. Growth conditions, such as the pH and temperature of the medium, influenced yeast IAA production. Our results also suggested the existence of a tryptophan-independent IAA biosynthetic pathway. We evaluated the effects of various concentrations of exogenous IAA on yeast growth and observed that IAA produced by wild yeasts modifies auxin-inducible gene expression in Arabidopsis. Our data suggest that yeasts can promote plant growth and support ongoing prospecting of yeast strains for inclusion into biofertilizer for sustainable agriculture. PMID:25464336

  11. A method for high-throughput production of sequence-verified DNA libraries and strain collections.

    PubMed

    Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

    2017-02-13

    The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  12. Demonstration of retrotransposition of the Tf1 element in fission yeast.

    PubMed

    Levin, H L; Boeke, J D

    1992-03-01

    Tf1, a retrotransposon from fission yeast, has LTRs and coding sequences resembling the protease, reverse transcriptase and integrase domains of retroviral pol genes. A unique aspect of Tf1 is that it contains a single open reading frame whereas other retroviruses and retrotransposons usually possess two or more open reading frames. To determine whether Tf1 can transpose, we overproduced Tf1 transcripts encoded by a plasmid copy of the element marked with a neo gene. Approximately 0.1-4.0% of the cell population acquired chromosomally inherited resistance to G418. DNA blot analysis demonstrated that such strains had acquired both Tf1 and neo specific sequences within a restriction fragment of the same size; the size of this restriction fragment varied between different isolates. Structural analysis of the cloned DNA flanking the Tf1-neo element of two transposition candidates with the same regions in the parent strain showed that the ability to grow on G418 was due to transposition of Tf1-neo and not other types of recombination events.

  13. Spores of the mycorrhizal fungus Glomus mosseae host yeasts that solubilize phosphate and accumulate polyphosphates.

    PubMed

    Mirabal Alonso, Loreli; Kleiner, Diethelm; Ortega, Eduardo

    2008-04-01

    The present paper reports the presence of bacteria and yeasts tightly associated with spores of an isolate of Glomus mosseae. Healthy spores were surface disinfected by combining chloramine-T 5%, Tween-40, and cephalexin 2.5 g L(-1) (CTCf). Macerates of these spores were incubated on agar media, microorganisms were isolated, and two yeasts were characterized (EndoGm1, EndoGm11). Both yeasts were able to solubilize low-soluble P sources (Ca and Fe phosphates) and accumulate polyphosphates (polyPs). Sequence analysis of 18S ribosomal deoxyribonucleic acid showed that the yeasts belong to the genera Rhodotorula or Rhodosporidium (EndoGm1) and Cryptococcus (EndoGm11). Results from inoculation experiments showed an effect of the spore-associated yeasts on the root growth of rice, suggesting potential tripartite interactions with mycorrhizal fungi and plants.

  14. Assessing fluctuating evolutionary pressure in yeast and mammal evolutionary rate covariation using bioinformatics of meiotic protein genetic sequences

    NASA Astrophysics Data System (ADS)

    Dehipawala, Sunil; Nguyen, A.; Tremberger, G.; Cheung, E.; Holden, T.; Lieberman, D.; Cheung, T.

    2013-09-01

    The evolutionary rate co-variation in meiotic proteins has been reported for yeast and mammal using phylogenic branch lengths which assess retention, duplication and mutation. The bioinformatics of the corresponding DNA sequences could be classified as a diagram of fractal dimension and Shannon entropy. Results from biomedical gene research provide examples on the diagram methodology. The identification of adaptive selection using entropy marker and functional-structural diversity using fractal dimension would support a regression analysis where the coefficient of determination would serve as evolutionary pathway marker for DNA sequences and be an important component in the astrobiology community. Comparisons between biomedical genes such as EEF2 (elongation factor 2 human, mouse, etc), WDR85 in epigenetics, HAR1 in human specificity, clinical trial targeted cancer gene CD47, SIRT6 in spermatogenesis, and HLA-C in mosquito bite immunology demonstrate the diagram classification methodology. Comparisons to the SEPT4-XIAP pair in stem cell apoptosis, testesexpressed taste genes TAS1R3-GNAT3 pair, and amyloid beta APLP1-APLP2 pair with the yeast-mammal DNA sequences for meiotic proteins RAD50-MRE11 pair and NCAPD2-ICK pair have accounted for the observed fluctuating evolutionary pressure systematically. Regression with high R-sq values or a triangular-like cluster pattern for concordant pairs in co-variation among the studied species could serve as evidences for the possible location of common ancestors in the entropy-fractal dimension diagram, consistent with an example of the human-chimp common ancestor study using the FOXP2 regulated genes reported in human fetal brain study. The Deinococcus radiodurans R1 Rad-A could be viewed as an outlier in the RAD50 diagram and also in the free energy versus fractal dimension regression Cook's distance, consistent with a non-Earth source for this radiation resistant bacterium. Convergent and divergent fluctuating evolutionary pressure could be studied with extension to genetic sequences in organisms in possible astrobiology conditions, with the assumption that the continuation of a book of life would require meiotic proteins everywhere in the universe.

  15. Anchoring plant metallothioneins to the inner face of the plasma membrane of Saccharomyces cerevisiae cells leads to heavy metal accumulation.

    PubMed

    Ruta, Lavinia Liliana; Lin, Ya-Fen; Kissen, Ralph; Nicolau, Ioana; Neagoe, Aurora Daniela; Ghenea, Simona; Bones, Atle M; Farcasanu, Ileana Cornelia

    2017-01-01

    In this study we engineered yeast cells armed for heavy metal accumulation by targeting plant metallothioneins to the inner face of the yeast plasma membrane. Metallothioneins (MTs) are cysteine-rich proteins involved in the buffering of excess metal ions, especially Cu(I), Zn(II) or Cd(II). The cDNAs of seven Arabidopsis thaliana MTs (AtMT1a, AtMT1c, AtMT2a, AtMT2b, AtMT3, AtMT4a and AtMT4b) and four Noccaea caerulescens MTs (NcMT1, NcMT2a, NcMT2b and NcMT3) were each translationally fused to the C-terminus of a myristoylation green fluorescent protein variant (myrGFP) and expressed in Saccharomyces cerevisiae cells. The myrGFP cassette introduced a yeast myristoylation sequence which allowed directional targeting to the cytosolic face of the plasma membrane along with direct monitoring of the intracellular localization of the recombinant protein by fluorescence microscopy. The yeast strains expressing plant MTs were investigated against an array of heavy metals in order to identify strains which exhibit the (hyper)accumulation phenotype without developing toxicity symptoms. Among the transgenic strains which could accumulate Cu(II), Zn(II) or Cd(II), but also non-canonical metal ions, such as Co(II), Mn(II) or Ni(II), myrGFP-NcMT3 qualified as the best candidate for bioremediation applications, thanks to the robust growth accompanied by significant accumulative capacity.

  16. Characterization of yakju brewed from glutinous rice and wild-type yeast strains isolated from nuruks.

    PubMed

    Kim, Hye Ryun; Kim, Jae-Ho; Bae, Dong-Hoon; Ahn, Byung-Hak

    2010-12-01

    Korean traditional rice wines yakju and takju are generally brewed with nuruk as the source of the saccharogenic enzymes by natural fermentation. To improve the quality of Korean rice wine, the microorganisms in the nuruk need to be studied. The objective of this research was to improve the quality of Korean wine with the wild-type yeast strains isolated from the fermentation starter, nuruk. Only strain YA-6 showed high activity in 20% ethanol. Precipitation of Y89-5-3 was similar to that of very flocculent yeast (〉80%) at 75.95%. Using 18S rRNA sequencing, all 10 strains were identified as Saccharomyces cerevisiae. Volatile compounds present in yakju were analyzed by gas chromatography-mass selective detector. The principal component analysis (PCA) of the volatile compounds grouped long-chain esters on the right side of the first principal component, PC1; these compounds were found in yakju that was made with strains YA-6, Y89-5-3, Y89-5- 2, Y90-9, and Y89-1-1. On the other side of PC1 were short-chain esters; these compounds were found in wines that were brewed with strains Y183-2, Y268-3, Y54-3, Y98-4, and Y88-4. Overall, the results indicated that using different wild-type yeast strains in the fermentation process significantly affects the chemical characteristics of the glutinous rice wine.

  17. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Soo-Ik; Hammes, G.G.

    1989-11-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less

  18. Saccharomyces cerevisiae Shuttle vectors.

    PubMed

    Gnügge, Robert; Rudolf, Fabian

    2017-05-01

    Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  19. Genetic engineering of industrial Saccharomyces cerevisiae strains using a selection/counter-selection approach.

    PubMed

    Kutyna, Dariusz R; Cordente, Antonio G; Varela, Cristian

    2014-01-01

    Gene modification of laboratory yeast strains is currently a very straightforward task thanks to the availability of the entire yeast genome sequence and the high frequency with which yeast can incorporate exogenous DNA into its genome. Unfortunately, laboratory strains do not perform well in industrial settings, indicating the need for strategies to modify industrial strains to enable strain development for industrial applications. Here we describe approaches we have used to genetically modify industrial strains used in winemaking.

  20. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    PubMed

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  1. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  2. Purification and characterisation of a new hypothalamic satiety peptide, cocaine and amphetamine regulated transcript (CART), produced in yeast.

    PubMed

    Thim, L; Nielsen, P F; Judge, M E; Andersen, A S; Diers, I; Egel-Mitani, M; Hastrup, S

    1998-05-29

    Cocaine and amphetamine regulated transcript (CART) is a newly discovered hypothalamic peptide with a potent appetite suppressing activity following intracerebroventricular administration. When the mature rat CART sequence encoding CART(1-102) was inserted in the yeast expression plasmid three CART peptides could be purified from the fermentation broth reflecting processing at dibasic sequences. None of these corresponded to the naturally occurring CART(55-102). In order to obtain CART(55-102) the precursor Glu-Glu-Ile-Asp-CART(55-102) has been produced and CART(55-102) was generated by digestion of the precursor with dipeptidylaminopeptidase-1. All four generated CART peptides have been characterised by N-terminal amino acid sequencing and mass spectrometry. The CART peptides contain six cysteine residues and using the yeast expressed CART(62-102) the disulphide bond configuration was found to be I-III, II-V and IV-VI. When the four CART peptides were intracerebroventricularly injected in fasted mice (0.1 to 2.0 microg) they all produced a dose dependent inhibition of food intake.

  3. High-Quality Draft Genome Sequence of Candida apicola NRRL Y-50540

    PubMed Central

    Vega-Alvarado, Leticia; Gómez-Angulo, Jorge; Escalante-García, Zazil; Grande, Ricardo; Gschaedler-Mathis, Anne; Amaya-Delgado, Lorena

    2015-01-01

    Candida apicola, a highly osmotolerant ascomycetes yeast, produces sophorolipids (biosurfactants), membrane fatty acids, and enzymes of biotechnological interest. The genome obtained has a high-quality draft for this species and can be used as a reference to perform further analyses, such as differential gene expression in yeast from Candida genera. PMID:26067948

  4. Yarrowia lipolytica possesses two plasma membrane alkali metal cation/H+ antiporters with different functions in cell physiology.

    PubMed

    Papouskova, Klara; Sychrova, Hana

    2006-04-03

    The family of Nha antiporters mediating the efflux of alkali metal cations in exchange for protons across the plasma membrane is conserved in all yeast species. Yarrowia lipolytica is a dimorphic yeast, phylogenetically very distant from the model yeast Saccharomyces cerevisiae. A search in its sequenced genome revealed two genes (designated as YlNHA1 and YlNHA2) with homology to the S. cerevisiae NHA1 gene, which encodes a plasma membrane alkali metal cation/H+ antiporter. Upon heterologous expression of both YlNHA genes in S. cerevisiae, we showed that Y. lipolytica antiporters differ not only in length and sequence, but also in their affinity for individual substrates. While the YlNha1 protein mainly increased cell tolerance to potassium, YlNha2p displayed a remarkable transport capacity for sodium. Thus, Y. lipolytica is the first example of a yeast species with two plasma membrane alkali metal cation/H+ antiporters differing in their putative functions in cell physiology; cell detoxification vs. the maintenance of stable intracellular pH, potassium content and cell volume.

  5. The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

    PubMed

    Xiao, W; Rank, G H

    1989-03-15

    The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

  6. Functional Analysis With a Barcoder Yeast Gene Overexpression System

    PubMed Central

    Douglas, Alison C.; Smith, Andrew M.; Sharifpoor, Sara; Yan, Zhun; Durbic, Tanja; Heisler, Lawrence E.; Lee, Anna Y.; Ryan, Owen; Göttert, Hendrikje; Surendra, Anu; van Dyk, Dewald; Giaever, Guri; Boone, Charles; Nislow, Corey; Andrews, Brenda J.

    2012-01-01

    Systematic analysis of gene overexpression phenotypes provides an insight into gene function, enzyme targets, and biological pathways. Here, we describe a novel functional genomics platform that enables a highly parallel and systematic assessment of overexpression phenotypes in pooled cultures. First, we constructed a genome-level collection of ~5100 yeast barcoder strains, each of which carries a unique barcode, enabling pooled fitness assays with a barcode microarray or sequencing readout. Second, we constructed a yeast open reading frame (ORF) galactose-induced overexpression array by generating a genome-wide set of yeast transformants, each of which carries an individual plasmid-born and sequence-verified ORF derived from the Saccharomyces cerevisiae full-length EXpression-ready (FLEX) collection. We combined these collections genetically using synthetic genetic array methodology, generating ~5100 strains, each of which is barcoded and overexpresses a specific ORF, a set we termed “barFLEX.” Additional synthetic genetic array allows the barFLEX collection to be moved into different genetic backgrounds. As a proof-of-principle, we describe the properties of the barFLEX overexpression collection and its application in synthetic dosage lethality studies under different environmental conditions. PMID:23050238

  7. Binding properties of SUMO-interacting motifs (SIMs) in yeast.

    PubMed

    Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

    2015-03-01

    Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

  8. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

    PubMed

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

    2015-08-25

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

  9. Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov., four anamorphic, ascomycetous yeast species isolated from soil in Taiwan.

    PubMed

    Liu, Chun-Hao; Young, Shuh-Sen; Chang, Tsung-Chain; Lee, Ching-Fu

    2008-08-01

    Nine anamorphic, ascomycetous yeast strains belonging to the Pichia anomala clade were recovered from forest soil in 2006 in Taiwan. The nine yeast strains represent four novel yeast species based on the sequences of their D1/D2 domain of the large subunit (LSU) rRNA gene and their physiological characteristics. The scientific names of Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov. are proposed for these novel yeast species. The type strains are C. dajiaensis SM11S03(T) (=CBS 10590(T)=BCRC 23099(T)), C. yuanshanicus SY3S02(T) (=CBS 10589(T)=BCRC 23100(T)), C. jianshihensis SM8S04(T) (=CBS 10591(T)=BCRC 23096(T)), and C. sanyiensis SA1S06(T) (=CBS 10592(T)=BCRC 23094(T)). Sequence analysis of the D1/D2 of the LSU rRNA gene revealed that the three species, C. dajiaensis, C. yuanshanicus and Pichia onychis, shared a separate branch in the phylogenetic tree, C. jianshihensis is phylogenetically related to Candida ulmi and Pichia alni, and the phylogenetically closest relative of C. sanyiensis is Pichia populi.

  10. The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

    NASA Technical Reports Server (NTRS)

    Ludwig, D. L.; Bruschi, C. V.

    1991-01-01

    The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

  11. The Suppressor of AAC2 Lethality SAL1 Modulates Sensitivity of Heterologously Expressed Artemia ADP/ATP Carrier to Bongkrekate in Yeast

    PubMed Central

    Wysocka-Kapcinska, Monika; Torocsik, Beata; Turiak, Lilla; Tsaprailis, George; David, Cynthia L.; Hunt, Andrea M.; Vekey, Karoly; Adam-Vizi, Vera; Kucharczyk, Roza; Chinopoulos, Christos

    2013-01-01

    The ADP/ATP carrier protein (AAC) expressed in Artemia franciscana is refractory to bongkrekate. We generated two strains of Saccharomyces cerevisiae where AAC1 and AAC3 were inactivated and the AAC2 isoform was replaced with Artemia AAC containing a hemagglutinin tag (ArAAC-HA). In one of the strains the suppressor of ΔAAC2 lethality, SAL1, was also inactivated but a plasmid coding for yeast AAC2 was included, because the ArAACΔsal1Δ strain was lethal. In both strains ArAAC-HA was expressed and correctly localized to the mitochondria. Peptide sequencing of ArAAC expressed in Artemia and that expressed in the modified yeasts revealed identical amino acid sequences. The isolated mitochondria from both modified strains developed 85% of the membrane potential attained by mitochondria of control strains, and addition of ADP yielded bongkrekate-sensitive depolarizations implying acquired sensitivity of ArAAC-mediated adenine nucleotide exchange to this poison, independent from SAL1. However, growth of ArAAC-expressing yeasts in glycerol-containing media was arrested by bongkrekate only in the presence of SAL1. We conclude that the mitochondrial environment of yeasts relying on respiratory growth conferred sensitivity of ArAAC to bongkrekate in a SAL1-dependent manner. PMID:24073201

  12. Lactic acid bacteria and yeasts associated with gowé production from sorghum in Bénin.

    PubMed

    Vieira-Dalodé, G; Jespersen, L; Hounhouigan, J; Moller, P L; Nago, C M; Jakobsen, M

    2007-08-01

    To identify the dominant micro-organisms involved in the production of gowé, a fermented beverage, and to select the most appropriate species for starter culture development. Samples of sorghum gowé produced twice at three different production sites were taken at different fermentation times. DNA amplification by internal transcribed spacer-polymerase chain reaction of 288 lactic acid bacteria (LAB) isolates and 16S rRNA gene sequencing of selected strains revealed that the dominant LAB responsible for gowé fermentation were Lactobacillus fermentum, Weissella confusa, Lactobacillus mucosae, Pediococcus acidilactici, Pediococcus pentosaceus and Weissella kimchii. DNA from 200 strains of yeasts was amplified and the D1/D2 domain of the 26S rRNA gene was sequenced for selected isolates, revealing that the yeasts species were Kluyveromyces marxianus, Pichia anomala, Candida krusei and Candida tropicalis. Gowé processing is characterized by a mixed fermentation dominated by Lact. fermentum, W. confusa and Ped. acidilactici for the LAB and by K. marxianus, P. anomala and C. krusei for the yeasts. The diversity of the LAB and yeasts identified offers new opportunities for technology upgrading and products development in gowé production. The identified species can be used as possible starter for a controlled fermentation of gowé.

  13. Resolution of model Holliday junctions by yeast endonuclease: effect of DNA structure and sequence.

    PubMed Central

    Parsons, C A; Murchie, A I; Lilley, D M; West, S C

    1989-01-01

    The resolution of Holliday junctions in DNA involves specific cleavage at or close to the site of the junction. A nuclease from Saccharomyces cerevisiae cleaves model Holliday junctions in vitro by the introduction of nicks in regions of duplex DNA adjacent to the crossover point. In previous studies [Parsons and West (1988) Cell, 52, 621-629] it was shown that cleavage occurred within homologous arm sequences with precise symmetry across the junction. In contrast, junctions with heterologous arm sequences were cleaved asymmetrically. In this work, we have studied the effect of sequence changes and base modification upon the site of cleavage. It is shown that the specificity of cleavage is unchanged providing that perfect homology is maintained between opposing arm sequences. However, in the absence of homology, cleavage depends upon sequence context and is affected by minor changes such as base modification. These data support the proposed mechanism for cleavage of a Holliday junction, which requires homologous alignment of arm sequences in an enzyme--DNA complex as a prerequisite for symmetrical cleavage by the yeast endonuclease. Images PMID:2653810

  14. Molecular cloning and promoter analysis of squalene synthase and squalene epoxidase genes from Betula platyphylla.

    PubMed

    Zhang, Mengyan; Wang, Siyao; Yin, Jing; Li, Chunxiao; Zhan, Yaguang; Xiao, Jialei; Liang, Tian; Li, Xin

    2016-09-01

    Betula platyphylla is a rich repository of pharmacologically active secondary metabolites known as birch triterpenoids (TBP). Here, we cloned the squalene synthase (SS) and squalene epoxidase genetic (SE) sequences from B. platyphylla that encode the key enzymes that are involved in triterpenoid biosynthesis and analyzed the conserved domains and phylogenetics of their corresponding proteins. The full-length sequence of BpSS is 1588 bp with a poly-A tail, which contained an open reading frame (ORF) of 1241 bp that encoded a protein of 413 amino acids. Additionally, the BpSE full-length sequence of 2040 bp with a poly-A tail was also obtained, which contained an ORF of 1581 bp encoding a protein of 526 amino acids. Their organ-specific expression patterns in 4-week-old tissue culture seedlings of B. platyphylla were detected by real-time PCR and showed that they were all highly expressed in leaves, as compared to stem and root tissues. Additionaly, both BpSS and BpSE were enhanced following stimulation with ethephon and MeJA. The expression of BpSS was enhanced by ABA, whereas BpSE was not. The SA treatment did not affect the BpSS and BpSE transcripts notably. Using a genome walking approach, promoter sequences of 965 and 1193 bp, respectively, for BpSS and BpSE were isolated, and they revealed several key cis-regulatory elements known to be involved in the response to phytohormone and abiotic plant stress. We also found that the BpSS protein is localized in the cytoplasm. Opening reading frames of BpSS and BpSE were ligated into yeast expression plasmid pYES2 under control of GAL1 promoter and introduced into the yeast INVScl1 strain. The transformants were cultured for 12 h, the squalene content of galactose-induced BpSS expression yeast cells was 13.2 times of control (empty vector control yeast cells) by high-performance liquid chromatography (HPLC) test method. And, the squalene epoxidase activity of induced BpSE expression yeast cell was about 11.8 times of control. These indicated that we cloned birch BpSS and BpSE that were indeed involved in the synthesis of triteropenoids. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the triterpenoids biosynthesis of B. platyphylla. This is the first report wherein SS and SE from B. platyphylla were cloned and may be of significant interest to understand the regulatory role of SS and SE in the biosynthesis of birch triterpenoids.

  15. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    PubMed

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  16. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology

    PubMed Central

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K. P.; Woo, Patrick C. Y.

    2015-01-01

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10–49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n = 2), Pichia (Candida) norvegensis (n = 2), Candida tropicalis (n = 1) and Saccharomyces cerevisiae (n = 1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study. PMID:26506340

  17. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    PubMed

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of closely related organisms, and discuss how it could be extended to future studies of multilocus rDNA systems. [concerted evolution; genome hydridisation; phylogenetic analysis; ribosomal DNA; whole genome sequencing; yeast]. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  18. Candida vulturna pro tempore sp. nov., a dimorphic yeast species related to the Candida haemulonis species complex isolated from flowers and clinical sample.

    PubMed

    Sipiczki, Matthias; Tap, Ratna Mohd

    2016-10-01

    In a taxonomic study of yeasts isolated from flowers in Cagayan de Oro, Mindenao Island, The Philippines, strains were identified as representing Kabatiella microsticta, Metschnikowia koreensis and a hitherto undescribed dimorphic species. Sequences of the D1/D2 domains of the LSU 26S rRNA genes, the internal transcribed spacer (ITS) regions and the SSU 18S rRNA genes were identical in the strains of the last-named group and differed from the corresponding sequences of the type strain of the closest related species, Candida duobushaemulonii, by 4 % (D1/D2), 7 % (ITS) and 1 % (SSU). In an independent study, a strain with D1/D2 and ITS sequences very similar to those of the Philippine strains was isolated in Malaysia from the blood of a patient dying of aspiration pneumonia. Both groups of isolates were moderately sensitive to anidulafungin, caspofungin, fluconazole, itraconazole and voriconazole but resistant to amphotericin B. Molecular phylogenetic analysis of the sequences placed the Philippine and Malaysian isolates close to the Candida haemulonis complex of Candida species. To reflect the geographical location of the sites of sample collection, the novel species name Candida vulturna pro tempore sp. nov. is proposed to accommodate these strains. The type strain is 11-1170T (=CBS 14366T=CCY 094-001-001T=NCAIM-Y02177T) isolated in Cagayan de Oro, The Philippines. Mycobank: MB 817222.

  19. Enzymatic synthesis of valerena-4,7(11)-diene by a unique sesquiterpene synthase from the valerian plant (Valeriana officinalis).

    PubMed

    Pyle, Bryan W; Tran, Hue T; Pickel, Benjamin; Haslam, Tegan M; Gao, Zhizeng; MacNevin, Gillian; Vederas, John C; Kim, Soo-Un; Ro, Dae-Kyun

    2012-09-01

    Valerian (Valeriana officinalis) is a popular medicinal plant in North America and Europe. Its root extract is commonly used as a mild sedative and anxiolytic. Among dozens of chemical constituents (e.g. alkaloids, iridoids, flavonoids, and terpenoids) found in valerian root, valerena-4,7(11)-diene and valerenic acid (C15 sesquiterpenoid) have been suggested as the active ingredients responsible for the sedative effect. However, the biosynthesis of the valerena-4,7(11)-diene hydrocarbon skeleton in valerian remains unknown to date. To identify the responsible terpene synthase, next-generation sequencing (Roche 454 pyrosequencing) was used to generate ∼ 1 million transcript reads from valerian root. From the assembled transcripts, two sesquiterpene synthases were identified (VoTPS1 and VoTPS2), both of which showed predominant expression patterns in root. Transgenic yeast expressing VoTPS1 and VoTPS2 produced germacrene C/germacrene D and valerena-4,7(11)-diene, respectively, as major terpene products. Purified VoTPS1 and VoTPS2 recombinant enzymes confirmed these activities in vitro, with competent kinetic properties (K(m) of ∼ 10 μm and k(cat) of 0.01 s(-1) for both enzymes). The structure of the valerena-4,7(11)-diene produced from the yeast expressing VoTPS2 was further substantiated by (13) C-NMR and GC-MS in comparison with the synthetic standard. This study demonstrates an integrative approach involving next-generation sequencing and metabolically engineered microbes to expand our knowledge of terpenoid diversity in medicinal plants. © 2012 The Authors Journal compilation © 2012 FEBS.

  20. Candida kashinagacola sp. nov., C. pseudovanderkliftii sp. nov. and C. vanderkliftii sp. nov., three new yeasts from ambrosia beetle-associated sources.

    PubMed

    Endoh, Rikiya; Suzuki, Motofumi; Benno, Yoshimi; Futai, Kazuyoshi

    2008-10-01

    Three new yeast species, Candida kashinagacola (JCM 15019(T) = CBS 10903(T)), C. pseudovanderkliftii (JCM 15025(T) = CBS 10904(T)), and C. vanderkliftii (JCM 15029(T) = CBS 10905(T)) are described on the basis of comparison of nucleotide sequences of large subunit ribosomal DNA D1/D2 region (LSU rDNA D1/D2). The nearest assigned species of the three new species was Candida llanquihuensis. Candida kashinagacola and C. pseudovanderkliftii differed from C. llanquihuensis by 3.8% nucleotide substitution of the region, while C. vanderkliftii did by 4.4%. Three new species differed in a number of physiological and growth characteristics from any previously assigned species and from one another. A phylogenetic tree based on the sequences of LSU rDNA D1/D2 showed that these new species together with Candida sp. ST-246, Candida sp. JW01-7-11-1-4-y2, Candida sp. BG02-7-20-001A-2-1 and C. llanquihuensis form a clade near Ambrosiozyma species. The new species did not assimilate methanol as a sole source of carbon, which supported the monophyly of these non methanol-assimilating species which are closely related to the methylotrophic yeasts. Candida kashinagacola was frequently isolated from the beetle galleries of Platypus quercivorus in three different host trees (Quercus serrata, Q. laurifolia and Castanopsis cuspidata) located in the sourthern part of Kyoto, Japan, thus indicating that this species may be a primary ambrosia fungus of P. quercivorus. On the other hand, C. pseudovanderkliftii and C. vanderkliftii were isolated only from beetle galleries in Q. laurifolia. Candida vanderkliftii was isolated from beetle gallery of Platypus lewisi as well as those of P. quercivorus. Candida pseudovanderkliftii and C. vanderkliftii are assumed to be auxiliary ambrosia fungi of P. quercivorus.

  1. Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

    PubMed

    Manzano, Mark; Padmanabhan, Radhakrishnan

    2014-01-01

    The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

  2. Influence of gene dosage and autoregulation of the regulatory genes INO2 and INO4 on inositol/choline-repressible gene transcription in the yeast Saccharomyces cerevisiae.

    PubMed

    Schwank, S; Hoffmann, B; Sch-uller, H J

    1997-06-01

    Expression of structural genes of phospholipid biosynthesis in yeast is mediated by the inositol/choline-responsive element (ICRE). ICRE-dependent gene activation, requiring the regulatory genes INO2 and INO4, is repressed in the presence of the phospholipid precursors inositol and choline. INO2 and, to a less extent, INO4 are positively autoregulated by functional ICRE sequences in the respective upstream regions. However, an INO2 allele devoid of its ICRE functionally complemented an ino2 mutation and completely restored inositol/choline regulation of Ino2p-dependent reporter genes. Low-level expression of INO2 and INO4 genes, each under control of the heterologous MET25 promoter, did not alter the regulatory pattern of target genes. Thus, upstream regions of INO2 and INO4 are not crucial for transcriptional control of ICRE-dependent genes by inositol and choline. Interestingly, over-expression of INO2, but not of INO4, counteracted repression by phospholipid precursors. Possibly, a functional antagonism between INO2 and a negative regulator is the key event responsible for repression or de-repression.

  3. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

    PubMed

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

    1979-01-01

    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  4. Large scale solubilization of coal and bioconversion to utilizable energy. Eleventh quarterly technical progress report, April 1, 1996--June 30, 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, N.C.

    1996-10-01

    Neurospora has the capability to solubilize coal and the protein fraction accounting for this ability has been isolated. During this period the cola solubilizing activity (CSA) was fractionated and partially sequenced. The activity has been determined to be a tyrosinase and/or a phenol oxidase. The amino acid sequence of the protein was used to prepare oligonucleotides to identify the clone carrying Neurospora CSA. It is intended to clone the Neurospora gene into yeast, since yeast cannot solubilize coal, to further characterize the CSA.

  5. Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

    PubMed

    Hatakeyama, T; Hatakeyama, T

    1990-07-06

    The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

  6. Evolutionary History of Ascomyceteous Yeasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haridas, Sajeet; Riley, Robert; Salamov, Asaf

    2014-06-06

    Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with amore » large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.« less

  7. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport.

    PubMed Central

    Curie, C; Alonso, J M; Le Jean, M; Ecker, J R; Briat, J F

    2000-01-01

    Nramp genes code for a widely distributed class of proteins involved in a variety of processes, ranging from the control of susceptibility to bacterial infection in mammalian cells and taste behaviour in Drosophila to manganese uptake in yeast. Some of the NRAMP proteins in mammals and in yeast are capable of transporting metal ions, including iron. In plants, iron transport was shown to require a reduction/Fe(II) transport system. In Arabidopsis thaliana this process involves the IRT1 and Fro2 genes. Here we report the sequence of five NRAMP proteins from A. thaliana. Sequence comparison suggests that there are two classes of NRAMP proteins in plants: A. thaliana (At) NRAMP1 and Oriza sativa (Os) NRAMP1 and 3 (two rice isologues) represent one class, and AtNRAMP2-5 and OsNRAMP2 the other. AtNramp1 and OsNramp1 are able to complement the fet3fet4 yeast mutant defective both in low- and high-affinity iron transports, whereas AtNramp2 and OsNramp2 fail to do so. In addition, AtNramp1 transcript, but not AtNramp2 transcript, accumulates in response to iron deficiency in roots but not in leaves. Finally, overexpression of AtNramp1 in transgenic A. thaliana plants leads to an increase in plant resistance to toxic iron concentration. Taken together, these results demonstrate that AtNramp1 participates in the control of iron homoeostasis in plants. PMID:10769179

  8. Yeast Identification During Fermentation of Turkish Gemlik Olives.

    PubMed

    Mujdeci, Gamze; Arévalo-Villena, María; Ozbas, Z Yesim; Briones Pérez, Ana

    2018-05-01

    Naturally fermented black table olives of the Gemlik variety are one of the most consumed fermented products in Turkey. The objective of this work was to identify yeast strains isolated during their natural fermentation by using Restriction Fragments Lengths Polymorphism-Polimerase Chain Reaction (RFLP-PCR) and DNA sequencing methods. The study also focused on determining the effect of regional differences on yeast microflora of naturally fermented Gemlik olives. A total of 47 yeast strains belonging to 12 different species which had been previously isolated from the natural brine of Akhisar and Iznik-Gemlik cv. olives were characterized by molecular methods. Forty-two of the tested strains could be identified by RFLP-PCR to species level. These yeast species were determined as Candida mycetangi, Candida hellenica, Candida membranaefaciens, Candida famata, Candida pelliculosa, Saccharomyces cerevisiae, and Zygosaccharomyces mrakii. Five strains were identified by DNA sequencing. These strains belonged to three different species: Aureobasidium pullulans, Kloeckera apiculate, and Cryptococcus saitoi. The most frequent species were C. famata and C. pelliculosa in both regions. This work studies the yeasts from Turkish table olives which could prove to be of importance to the food industry in that area. On the other hand, it compares identification by molecular and classical biochemical methods and offers an idea about the differences between the ecosystems of Gemlik olives in the Akhisar (AO) and Iznik (IO) regions. The study could be useful in characterizing a very important product and, in this way, could help to promote its marketing. © 2018 Institute of Food Technologists®.

  9. The Yeast Deletion Collection: A Decade of Functional Genomics

    PubMed Central

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  10. Genomic Evolution of the Ascomycete Yeasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riley, Robert; Haridas, Sajeet; Salamov, Asaf

    2015-03-16

    Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and amore » tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.« less

  11. Epidemiology and antifungal susceptibilities of yeast isolates causing invasive infections across urban Beijing, China.

    PubMed

    Guo, Li-Na; Xiao, Meng; Cao, Bin; Qu, Fen; Zhan, Yu-Liang; Hu, Yun-Jian; Wang, Xin-Ru; Liang, Guo-Wei; Gu, Hai-Tong; Qi, Jun; Yuan, Hui; Min, Rong; Wang, Fei-Yan; Liu, Lin-Juan; Wang, Hai-Bin; Jiang, Wei; Duan, Xue-Guang; Xu, Wen-Jian; Yu, Yan-Hua; Su, Jian-Rong; Zhang, Jian-Zhong; Nong, Jin-Qing; Liu, Shu-Mei; Li, Jun; Liu, Jun-Ting; Yue, Zhi-Gang; Yang, Duo; Guo, Jie; Zhao, Rui; Zhang, Ya-Nan; Yang, Xi-Ming; Liu, Xiao-Qing; Hsueh, Po-Ren; Xu, Ying-Chun

    2017-09-01

    To investigate the species distribution and antifungal susceptibility profiles of yeast isolates causing invasive infections across Beijing. A total of 1201 yeast isolates recovered from blood and other sterile body fluids were correctly identified by matrix-assisted laser desorption/ionization TOF MS supplemented by DNA sequencing. Antifungal susceptibility testing was performed according to the Clinical and Laboratory Standards Institute broth microdilution method. Candida (95.5%) remained the most common yeast species isolated; Candida albicans (38.8%) and Candida parapsilosis (22.6%) were the leading species of candidemia. Azole resistances were mainly observed in Candida glabrata and Candida tropicalis isolates. This study outlined the epidemiologic data of invasive yeast infections and highlighted the need for continuous monitoring of azole resistances among C. glabrata and C. tropicalis isolates in Beijing.

  12. A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

    PubMed

    Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

    2018-05-01

    Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

  13. Study of LEO-SAT microwave link for broad-band mobile satellite communication system

    NASA Technical Reports Server (NTRS)

    Fujise, Masayuki; Chujo, Wataru; Chiba, Isamu; Furuhama, Yoji; Kawabata, Kazuaki; Konishi, Yoshihiko

    1993-01-01

    In the field of mobile satellite communications, a system based on low-earth-orbit satellites (LEO-SAT's) such as the Iridium system has been proposed. The LEO-SAT system is able to offer mobile telecommunication services in high-latitude areas. Rain degradation, fading and shadowing are also expected to be decreased when the system is operated at a high elevation angle. Furthermore, the propagation delay generated in the LEO-SAT system is less pronounced than that in the geostationary orbit satellite (GEO-SAT) system and, in voice services, the effect of the delay is almost negligible. We proposed a concept of a broad-band mobile satellite communication system with LEO-SAT's and Optical ISL. In that system, a fixed L-band (1.6/1.5 GHz) multibeam is used to offer narrow band service to the mobile terminals in the entire area covered by a LEO-SAT and steerable Ka-band (30/20 GHz) spot beams are used for the wide band service. In this paper, we present results of a study of LEO-SAT microwave link between a satellite and a mobile terminal for a broad-band mobile satellite communication system. First, the results of link budget calculations are presented and the antennas mounted on satellites are shown. For a future mobile antenna technology, we also show digital beamforming (DBF) techniques. DBF, together with modulation and/or demodulation, is becoming a key technique for mobile antennas with advanced functions such as antenna pattern calibration, correction, and radio interference suppression. In this paper, efficient DBF techniques for transmitting and receiving are presented. Furthermore, an adaptive array antenna system suitable for this LEO-SAT is presented.

  14. ENU mutagenesis screening for dominant behavioral mutations based on normal control data obtained in home-cage activity, open-field, and passive avoidance tests.

    PubMed

    Wada, Yumiko; Furuse, Tamio; Yamada, Ikuko; Masuya, Hiroshi; Kushida, Tomoko; Shibukawa, Yoko; Nakai, Yuji; Kobayashi, Kimio; Kaneda, Hideki; Gondo, Yoichi; Noda, Tetsuo; Shiroishi, Toshihiko; Wakana, Shigeharu

    2010-01-01

    To establish the cutoff values for screening ENU-induced behavioral mutations, normal variations in mouse behavioral data were examined in home-cage activity (HA), open-field (OF), and passive-avoidance (PA) tests. We defined the normal range as one that included more than 95% of the normal control values. The cutoffs were defined to identify outliers yielding values that deviated from the normal by less than 5% for C57BL/6J, DBA/2J, DBF(1), and N(2) (DXDB) progenies. Cutoff values for G1-phenodeviant (DBF(1)) identification were defined based on values over +/- 3.0 SD from the mean of DBF(1) for all parameters assessed in the HA and OF tests. For the PA test, the cutoff values were defined based on whether the mice met the learning criterion during the 2nd (at a shock intensity of 0.3 mA) or the 3rd (at a shock intensity of 0.15 mA) retention test. For several parameters, the lower outliers were undetectable as the calculated cutoffs were negative values. Based on the cutoff criteria, we identified 275 behavioral phenodeviants among 2,646 G1 progeny. Of these, 64 were crossed with wild-type DBA/2J individuals, and the phenotype transmission was examined in the G2 progeny using the cutoffs defined for N(2) mice. In the G2 mice, we identified 15 novel dominant mutants exhibiting behavioral abnormalities, including hyperactivity in the HA or OF tests, hypoactivity in the OF test, and PA deficits. Genetic and detailed behavioral analysis of these ENU-induced mutants will provide novel insights into the molecular mechanisms underlying behavior.

  15. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchetti, Francesco; Marchetti, Francesco; Wryobek, Andrew J

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-inducedmore » heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7- 1 dbf). Analysis of chromosomalaberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.« less

  16. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchetti, Francesco; Marchetti, Francesco; Wyrobek, Andrew J.

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-inducedmore » heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7-1 dbf). Analysis of chromosomal aberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.« less

  17. β-1,3-Glucanase from Delftia tsuruhatensis Strain MV01 and Its Potential Application in Vinification ▿ † §

    PubMed Central

    Blättel, V.; Larisika, M.; Pfeiffer, P.; Nowak, C.; Eich, A.; Eckelt, J.; König, H.

    2011-01-01

    During vinification microbial activities can spoil wine quality. As the wine-related lactic acid bacterium Pediococcus parvulus is able to produce slimes consisting of a β-1,3-glucan, must and wine filtration can be difficult or impossible. In addition, the metabolic activities of several wild-type yeasts can also negatively affect wine quality. Therefore, there is a need for measures to degrade the exopolysaccharide from Pediococcus parvulus and to inhibit the growth of certain yeasts. We examined an extracellular β-1,3-glucanase from Delftia tsuruhatensis strain MV01 with regard to its ability to hydrolyze both polymers, the β-1,3-glucan from Pediococcus and that from yeast cell walls. The 29-kDa glycolytic enzyme was purified to homogeneity. It exhibited an optimal activity at 50°C and pH 4.0. The sequencing of the N terminus revealed significant similarities to β-1,3-glucanases from different bacteria. In addition, the investigations indicated that this hydrolytic enzyme is still active under wine-relevant parameters such as elevated ethanol, sulfite, and phenol concentrations as well as at low pH values. Therefore, the characterized enzyme seems to be a useful tool to prevent slime production and undesirable yeast growth during vinification. PMID:21169426

  18. Beta-1,3-glucanase from Delftia tsuruhatensis strain MV01 and its potential application in vinification.

    PubMed

    Blättel, V; Larisika, M; Pfeiffer, P; Nowak, C; Eich, A; Eckelt, J; König, H

    2011-02-01

    During vinification microbial activities can spoil wine quality. As the wine-related lactic acid bacterium Pediococcus parvulus is able to produce slimes consisting of a β-1,3-glucan, must and wine filtration can be difficult or impossible. In addition, the metabolic activities of several wild-type yeasts can also negatively affect wine quality. Therefore, there is a need for measures to degrade the exopolysaccharide from Pediococcus parvulus and to inhibit the growth of certain yeasts. We examined an extracellular β-1,3-glucanase from Delftia tsuruhatensis strain MV01 with regard to its ability to hydrolyze both polymers, the β-1,3-glucan from Pediococcus and that from yeast cell walls. The 29-kDa glycolytic enzyme was purified to homogeneity. It exhibited an optimal activity at 50°C and pH 4.0. The sequencing of the N terminus revealed significant similarities to β-1,3-glucanases from different bacteria. In addition, the investigations indicated that this hydrolytic enzyme is still active under wine-relevant parameters such as elevated ethanol, sulfite, and phenol concentrations as well as at low pH values. Therefore, the characterized enzyme seems to be a useful tool to prevent slime production and undesirable yeast growth during vinification.

  19. Adaptation of yeasts Saccharomyces cerevisiae and Brettanomyces bruxellensis to winemaking conditions: a comparative study of stress genes expression.

    PubMed

    Nardi, Tiziana; Remize, Fabienne; Alexandre, Hervé

    2010-10-01

    Brettanomyces is the major microbial cause for wine spoilage worldwide and causes significant economic losses. Like Saccharomyces cerevisiae, it is well adapted to winemaking, but molecular pathways involved in this acclimatization are still unknown. In this work, we report a time-scale comparison between the two yeasts coping with alcoholic fermentation. Orthologs of some well-characterized stress genes of S. cerevisiae were searched by sequence alignment in the Dekkera/Brettanomyces partial genome; nine genes were finally selected on the basis on their similarity and involvement in adaptation to wine. Transcript analysis during a model grape juice fermentation indicates that a subset of genes (i.e., ATP1, ERG6, VPS34) shows peculiar expression patterns in Brettanomyces bruxellensis but also that some common regulations of stress response exist between the two yeasts, although with different timing (i.e., for MSN4, SNF1, HSP82, NTH1). This suggests that B. bruxellensis efficient survival in such challenging conditions is due to mechanisms unique to it, together with a conserved yeast stress response. This study, although limited by the poor genetic data available on B. bruxellensis, provides first insights into its gene expression remodeling in winemaking and opens new frames for further investigations.

  20. Self-fertilization is the main sexual reproduction mechanism in native wine yeast populations.

    PubMed

    Cubillos, Francisco A; Vásquez, Claudia; Faugeron, Sylvain; Ganga, Angélica; Martínez, Claudio

    2009-01-01

    Saccharomyces cerevisiae is a model eukaryotic organism for classical genetics and genomics, and yet its ecology is still largely unknown. In this work, a population genetic analysis was performed on five yeast populations isolated from wine-making areas with different enological practices using simple sequence repeats and restriction fragment length polymorphism of mitochondrial DNA as molecular markers on 292 strains. In accordance with other studies, genome size estimation suggests that native S. cerevisiae strains are mainly homothallic and diploids. Analysis of mtDNA data showed that yeast populations from nonindustrial areas have 40% higher genetic diversity than populations isolated from industrial areas, demonstrating that industrial enological practices are likely to affect native yeast populations negatively by reducing its biodiversity. On the other hand, genetic differentiation analysis based on their microsatellite showed no correlation between genetic and geographic distance and a nonsignificant value when a Mantel test was applied. Finally, in the five populations studied, positive inbreeding (F(is)) values from 0.4 to 0.75, a low but significant level of linkage disequilibrium and a high number of multilocus genotypes were detected. These results strongly advocate that sexual reproduction is frequent enough to erase clonal signature in natural populations and that self-fertilization is the main mating system.

  1. Nuclear scaffold attachment stimulates, but is not essential for ARS activity in Saccharomyces cerevisiae: analysis of the Drosophila ftz SAR.

    PubMed Central

    Amati, B; Pick, L; Laroche, T; Gasser, S M

    1990-01-01

    Nuclei isolated from eukaryotic cells can be depleted of histones and most soluble nuclear proteins to isolate a structural framework called the nuclear scaffold. This structure maintains specific interactions with genomic DNA at sites known as scaffold attached regions (SARs), which are thought to be the bases of DNA loops. In both Saccharomyces cerevisiae and Schizosaccharomyces pombe, genomic ARS elements are recovered as SARs. In addition, SARs from Drosophila melanogaster bind to yeast nuclear scaffolds in vitro and a subclass of these promotes autonomous replication of plasmids in yeast. In the present report, we present fine mapping studies of the Drosophila ftz SAR, which has both SAR and ARS activities in yeast. The data establish a close relationship between the sequences involved in ARS activity and scaffold binding: ARS elements that can bind the nuclear scaffold in vitro promote more efficient plasmid replication in vivo, but scaffold association is not a strict prerequisite for ARS function. Efficient interaction with nuclear scaffolds from both yeast and Drosophila requires a minimal length of SAR DNA that contains reiteration of a narrow minor groove structure of the double helix. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:2123454

  2. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  3. Evidence for a Pneumocystis carinii Flo8-like transcription factor: insights into organism adhesion.

    PubMed

    Kottom, Theodore J; Limper, Andrew H

    2016-02-01

    Pneumocystis carinii (Pc) adhesion to alveolar epithelial cells is well established and is thought to be a prerequisite for the initiation of Pneumocystis pneumonia. Pc binding events occur in part through the major Pc surface glycoprotein Msg, as well as an integrin-like molecule termed PcInt1. Recent data from the Pc sequencing project also demonstrate DNA sequences homologous to other genes important in Candida spp. binding to mammalian host cells, as well as organism binding to polystyrene surfaces and in biofilm formation. One of these genes, flo8, a transcription factor needed for downstream cAMP/PKA-pathway-mediated activation of the major adhesion/flocculin Flo11 in yeast, was cloned from a Pc cDNA library utilizing a partial sequence available in the Pc genome database. A CHEF blot of Pc genomic DNA yielded a single band providing evidence this gene is present in the organism. BLASTP analysis of the predicted protein demonstrated 41 % homology to the Saccharomyces cerevisiae Flo8. Northern blotting demonstrated greatest expression at pH 6.0-8.0, pH comparable to reported fungal biofilm milieu. Western blot and immunoprecipitation assays of PcFlo8 protein in isolated cyst and tropic life forms confirmed the presence of the cognate protein in these Pc life forms. Heterologous expression of Pcflo8 cDNA in flo8Δ-deficient yeast strains demonstrated that the Pcflo8 was able to restore yeast binding to polystyrene and invasive growth of yeast flo8Δ cells. Furthermore, Pcflo8 promoted yeast binding to HEK293 human epithelial cells, strengthening its functional classification as a Flo8 transcription factor. Taken together, these data suggest that PcFlo8 is expressed by Pc and may exert activity in organism adhesion and biofilm formation.

  4. Evidence for a Pneumocystis carinii Flo8-like Transcription Factor: Insights into Organism Adhesion

    PubMed Central

    Kottom, Theodore J.; Limper, Andrew H.

    2015-01-01

    Pneumocystis carinii (Pc) adhesion to alveolar epithelial cells is well established and is thought to be a prerequisite for initiation of Pneumocystis pneumonia. Pc binding events occur in part through the major Pc surface glycoprotein Msg, as well as an integrin-like molecule termed PcInt1. Recent data from the Pc sequencing project also demonstrate DNA sequences homologous to other genes important in Candida spp. binding to mammalian host cells, as well as organism binding to polystyrene surfaces and in biofilm formation. One of these genes, flo8, a transcription factor needed for downstream cAMP/PKA-pathway-mediated activation of the major adhesin/flocculin Flo11 in yeast, was cloned from a Pc cDNA library utilizing a partial sequence available in the Pc genome database. A CHEF blot of Pc genomic DNA yielded a single band providing evidence this gene is present in the organism. BLASTP analysis of the predicted protein demonstrated 41% homology to the Saccharomyces cerevisiae Flo8. Northern blotting demonstrated greatest expression at pH 6.0–8.0, pH comparable to reported fungal biofilm milieu. Western blot and immunoprecipitation assays of PcFlo8 protein in isolated cyst and tropic life forms confirmed the presence of the cognate protein in these Pc life forms. Heterologous expression of Pcflo8 cDNA in flo8Δ (deficient) yeast strains demonstrated the Pcflo8 was able to restore yeast binding to polystyrene and invasive growth of yeast flo8Δ cells. Furthermore, Pcflo8 promoted yeast binding to HEK293 human epithelial cells, strengthening its functional classification as a Flo8 transcription factor. Taken together these data suggests that PcFlo8 is expressed by Pc and may exert activity in organism adhesion and biofilm formation. PMID:26215665

  5. Functional characterization of an alpha-factor-like Sordaria macrospora peptide pheromone and analysis of its interaction with its cognate receptor in Saccharomyces cerevisiae.

    PubMed

    Mayrhofer, Severine; Pöggeler, Stefanie

    2005-04-01

    The homothallic filamentous ascomycete Sordaria macrospora possesses genes which are thought to encode two pheromone precursors and two seven-transmembrane pheromone receptors. The pheromone precursor genes are termed ppg1 and ppg2. The putative products derived from the gene sequence show structural similarity to the alpha-factor precursors and a-factor precursors of the yeast Saccharomyces cerevisiae. Likewise, sequence similarity has been found between the putative products of the pheromone receptor genes pre2 and pre1 and the S. cerevisiae Ste2p alpha-factor receptor and Ste3p a-factor receptor, respectively. To investigate whether the alpha-factor-like pheromone-receptor pair of S. macrospora is functional, a heterologous yeast assay was used. Our results show that the S. macrospora alpha-factor-like pheromone precursor PPG1 is processed into an active pheromone by yeast MATalpha cells. The S. macrospora PRE2 protein was demonstrated to be a peptide pheromone receptor. In yeast MATa cells lacking the endogenous Ste2p receptor, the S. macrospora PRE2 receptor facilitated all aspects of the pheromone response. Using a synthetic peptide, we can now predict the sequence of one active form of the S. macrospora peptide pheromone. We proved that S. macrospora wild-type strains secrete an active pheromone into the culture medium and that disruption of the ppg1 gene in S. macrospora prevents pheromone production. However, loss of the ppg1 gene does not affect vegetative growth or fertility. Finally, we established the yeast assay as an easy and useful system for analyzing pheromone production in developmental mutants of S. macrospora.

  6. Purification and Characterization of Enzymes from Yeast: An Extended Undergraduate Laboratory Sequence for Large Classes

    ERIC Educational Resources Information Center

    Johanson, Kelly E.; Watt, Terry J.; McIntyre, Neil R.; Thompson, Marleesa

    2013-01-01

    Providing a project-based experience in an undergraduate biochemistry laboratory class can be complex with large class sizes and limited resources. We have designed a 6-week curriculum during which students purify and characterize the enzymes invertase and phosphatase from bakers yeast. Purification is performed in two stages via ethanol…

  7. Isolation of the alkane inducible cytochrome P450 (P450alk) gene from the yeast Candida tropicalis

    EPA Science Inventory

    The gene for the alkane-inducible cytochrome P450, P450alk, has been isolated from the yeast Candida tropicalis by immunoscreening a λgt11 library. Isolation of the gene has been identified on the basis of its inducibility and partial DNA sequence. Transcripts of this gene were i...

  8. Genome Sequence of the Thermotolerant Yeast Kluyveromyces marxianus var. marxianus KCTC 17555

    PubMed Central

    Jeong, Haeyoung; Lee, Dae-Hee; Kim, Sun Hong; Kim, Hyun-Jin; Lee, Kyusang; Song, Ju Yeon; Kim, Byung Kwon; Sung, Bong Hyun; Sohn, Jung Hoon; Koo, Hyun Min

    2012-01-01

    Kluyveromyces marxianus is a thermotolerant yeast that has been explored for potential use in biotechnological applications, such as production of biofuels, single-cell proteins, enzymes, and other heterologous proteins. Here, we present the high-quality draft of the 10.9-Mb genome of K. marxianus var. marxianus KCTC 17555 (= CBS 6556 = ATCC 26548). PMID:23193140

  9. Engineering Rhodosporidium toruloides for increased lipid production.

    PubMed

    Zhang, Shuyan; Skerker, Jeffrey M; Rutter, Charles D; Maurer, Matthew J; Arkin, Adam P; Rao, Christopher V

    2016-05-01

    Oleaginous yeast are promising organisms for the production of lipid-based chemicals and fuels from simple sugars. In this work, we explored Rhodosporidium toruloides for the production of lipid-based products. This oleaginous yeast natively produces lipids at high titers and can grow on glucose and xylose. As a first step, we sequenced the genomes of two strains, IFO0880, and IFO0559, and generated draft assemblies and annotations. We then used this information to engineer two R. toruloides strains for increased lipid production by over-expressing the native acetyl-CoA carboxylase and diacylglycerol acyltransferase genes using Agrobacterium tumefaciens mediated transformation. Our best strain, derived from IFO0880, was able to produce 16.4 ± 1.1 g/L lipid from 70 g/L glucose and 9.5 ± 1.3 g/L lipid from 70 g/L xylose in shake-flask experiments. This work represents one of the first examples of metabolic engineering in R. toruloides and establishes this yeast as a new platform for production of fatty-acid derived products. © 2015 Wiley Periodicals, Inc.

  10. Extensive Copy Number Variation in Fermentation-Related Genes Among Saccharomyces cerevisiae Wine Strains.

    PubMed

    Steenwyk, Jacob; Rokas, Antonis

    2017-05-05

    Due to the importance of Saccharomyces cerevisiae in wine-making, the genomic variation of wine yeast strains has been extensively studied. One of the major insights stemming from these studies is that wine yeast strains harbor low levels of genetic diversity in the form of single nucleotide polymorphisms (SNPs). Genomic structural variants, such as copy number (CN) variants, are another major type of variation segregating in natural populations. To test whether genetic diversity in CN variation is also low across wine yeast strains, we examined genome-wide levels of CN variation in 132 whole-genome sequences of S. cerevisiae wine strains. We found an average of 97.8 CN variable regions (CNVRs) affecting ∼4% of the genome per strain. Using two different measures of CN diversity, we found that gene families involved in fermentation-related processes such as copper resistance ( CUP ), flocculation ( FLO ), and glucose metabolism ( HXT ), as well as the SNO gene family whose members are expressed before or during the diauxic shift, showed substantial CN diversity across the 132 strains examined. Importantly, these same gene families have been shown, through comparative transcriptomic and functional assays, to be associated with adaptation to the wine fermentation environment. Our results suggest that CN variation is a substantial contributor to the genomic diversity of wine yeast strains, and identify several candidate loci whose levels of CN variation may affect the adaptation and performance of wine yeast strains during fermentation. Copyright © 2017 Steenwyk and Rokas.

  11. The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

    PubMed Central

    Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

    2013-01-01

    Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

  12. Assessing Genetic Diversity among Brettanomyces Yeasts by DNA Fingerprinting and Whole-Genome Sequencing

    PubMed Central

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A.

    2014-01-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. PMID:24814796

  13. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    PubMed

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. AGAPE (Automated Genome Analysis PipelinE) for Pan-Genome Analysis of Saccharomyces cerevisiae

    PubMed Central

    Song, Giltae; Dickins, Benjamin J. A.; Demeter, Janos; Engel, Stacia; Dunn, Barbara; Cherry, J. Michael

    2015-01-01

    The characterization and public release of genome sequences from thousands of organisms is expanding the scope for genetic variation studies. However, understanding the phenotypic consequences of genetic variation remains a challenge in eukaryotes due to the complexity of the genotype-phenotype map. One approach to this is the intensive study of model systems for which diverse sources of information can be accumulated and integrated. Saccharomyces cerevisiae is an extensively studied model organism, with well-known protein functions and thoroughly curated phenotype data. To develop and expand the available resources linking genomic variation with function in yeast, we aim to model the pan-genome of S. cerevisiae. To initiate the yeast pan-genome, we newly sequenced or re-sequenced the genomes of 25 strains that are commonly used in the yeast research community using advanced sequencing technology at high quality. We also developed a pipeline for automated pan-genome analysis, which integrates the steps of assembly, annotation, and variation calling. To assign strain-specific functional annotations, we identified genes that were not present in the reference genome. We classified these according to their presence or absence across strains and characterized each group of genes with known functional and phenotypic features. The functional roles of novel genes not found in the reference genome and associated with strains or groups of strains appear to be consistent with anticipated adaptations in specific lineages. As more S. cerevisiae strain genomes are released, our analysis can be used to collate genome data and relate it to lineage-specific patterns of genome evolution. Our new tool set will enhance our understanding of genomic and functional evolution in S. cerevisiae, and will be available to the yeast genetics and molecular biology community. PMID:25781462

  15. Cell cycle-dependent transcription factors control the expression of yeast telomerase RNA.

    PubMed

    Dionne, Isabelle; Larose, Stéphanie; Dandjinou, Alain T; Abou Elela, Sherif; Wellinger, Raymund J

    2013-07-01

    Telomerase is a specialized ribonucleoprotein that adds repeated DNA sequences to the ends of eukaryotic chromosomes to preserve genome integrity. Some secondary structure features of the telomerase RNA are very well conserved, and it serves as a central scaffold for the binding of associated proteins. The Saccharomyces cerevisiae telomerase RNA, TLC1, is found in very low copy number in the cell and is the limiting component of the known telomerase holoenzyme constituents. The reasons for this low abundance are unclear, but given that the RNA is very stable, transcriptional control mechanisms must be extremely important. Here we define the sequences forming the TLC1 promoter and identify the elements required for its low expression level, including enhancer and repressor elements. Within an enhancer element, we found consensus sites for Mbp1/Swi4 association, and chromatin immunoprecipitation (ChIP) assays confirmed the binding of Mbp1 and Swi4 to these sites of the TLC1 promoter. Furthermore, the enhancer element conferred cell cycle-dependent regulation to a reporter gene, and mutations in the Mbp1/Swi4 binding sites affected the levels of telomerase RNA and telomere length. Finally, ChIP experiments using a TLC1 RNA-binding protein as target showed cell cycle-dependent transcription of the TLC1 gene. These results indicate that the budding yeast TLC1 RNA is transcribed in a cell cycle-dependent fashion late in G1 and may be part of the S phase-regulated group of genes involved in DNA replication.

  16. Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

    PubMed

    Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

    2016-03-18

    Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

  17. Increased Cdc7 expression is a marker of oral squamous cell carcinoma and overexpression of Cdc7 contributes to the resistance to DNA-damaging agents.

    PubMed

    Cheng, An Ning; Jiang, Shih Sheng; Fan, Chi-Chen; Lo, Yu-Kang; Kuo, Chan-Yen; Chen, Chung-Hsing; Liu, Ying-Lan; Lee, Chun-Chung; Chen, Wei-Shone; Huang, Tze-Sing; Wang, Tao-Yeuan; Lee, Alan Yueh-Luen

    2013-09-01

    Cdc7-Dbf4 kinase (Dbf4-dependent kinase, DDK) is an essential factor of DNA replication and DNA damage response (DDR), which is associated with tumorigenesis. However, Cdc7 expression has never been associated to the outcome of oral squamous cell carcinoma (OSCC) patients, and the mechanism underlying cancer cell survival mediated by Cdc7 remains unclear. The Cdc7 protein expression of 105 OSCC tumor and 30 benign tissues was examined by immunohistochemistry assay. Overall survival rates of 80 OSCC patients were measured using Kaplan-Meier estimates and the log-rank tests. Cdc7 overexpression by adenovirus system was used to scrutinize the underlying mechanism contributed to cancer cell survival upon DDR. In silico analysis showed that increased Cdc7 is a common feature of cancer. Cdc7 overexpression was found in 96 of 105 (91.4%) studied cases of OSCC patients. Patients with higher Cdc7 expression, either categorized into two groups: Cdc7 high expression (2+ to 3+) versus Cdc7 low expression (0 to 1+) [hazard ratios (HR)=2.6; 95% confidence interval (CI)=1.28-5.43; P=0.0087] or four groups (0 to 3+) [HR=1.71; 95% CI=1.20-2.44; P=0.0032], exhibited a poorer outcome. Multivariate analysis showed that Cdc7 is an independent marker for survival prediction. Overexpressed Cdc7 inhibits genotoxin-induced apoptosis to increase the survival of cancer cells. In summary, Cdc7 expression, which is universally upregulated in cancer, is an independent prognostic marker of OSCC. Cdc7 inhibits genotoxin-induced apoptosis and increases survival in cancer cells upon DDR, suggesting that high expression of Cdc7 enhances the resistance to chemotherapy. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.

    PubMed

    Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A

    2017-02-01

    Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    PubMed

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing that the only abundant bias pattern is for asparagine bias with subsidiary serine bias. We anticipate that this database will be a useful experimental aid and reference resource. It is freely available at: http://libaio.biol.mcgill.ca/prion.

  20. PrionHome: A Database of Prions and Other Sequences Relevant to Prion Phenomena

    PubMed Central

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M. A.; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M.

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing that the only abundant bias pattern is for asparagine bias with subsidiary serine bias. We anticipate that this database will be a useful experimental aid and reference resource. It is freely available at: http://libaio.biol.mcgill.ca/prion. PMID:22363733

  1. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

    PubMed Central

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-01-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

  2. Extensive Horizontal Transfer and Homologous Recombination Generate Highly Chimeric Mitochondrial Genomes in Yeast.

    PubMed

    Wu, Baojun; Buljic, Adnan; Hao, Weilong

    2015-10-01

    The frequency of horizontal gene transfer (HGT) in mitochondrial DNA varies substantially. In plants, HGT is relatively common, whereas in animals it appears to be quite rare. It is of considerable importance to understand mitochondrial HGT across the major groups of eukaryotes at a genome-wide level, but so far this has been well studied only in plants. In this study, we generated ten new mitochondrial genome sequences and analyzed 40 mitochondrial genomes from the Saccharomycetaceae to assess the magnitude and nature of mitochondrial HGT in yeasts. We provide evidence for extensive, homologous-recombination-mediated, mitochondrial-to-mitochondrial HGT occurring throughout yeast mitochondrial genomes, leading to genomes that are highly chimeric evolutionarily. This HGT has led to substantial intraspecific polymorphism in both sequence content and sequence divergence, which to our knowledge has not been previously documented in any mitochondrial genome. The unexpectedly high frequency of mitochondrial HGT in yeast may be driven by frequent mitochondrial fusion, relatively low mitochondrial substitution rates and pseudohyphal fusion to produce heterokaryons. These findings suggest that mitochondrial HGT may play an important role in genome evolution of a much broader spectrum of eukaryotes than previously appreciated and that there is a critical need to systematically study the frequency, extent, and importance of mitochondrial HGT across eukaryotes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Identification of yeasts isolated from raffia wine (Raphia hookeri) produced in Côte d'Ivoire and genotyping of Saccharomyces cerevisiae strains by PCR inter-delta.

    PubMed

    Tra Bi, Charles Y; N'guessan, Florent K; Kouakou, Clémentine A; Jacques, Noemie; Casaregola, Serge; Djè, Marcellin K

    2016-08-01

    Raffia wine is a traditional alcoholic beverage produced in several African countries where it plays a significant role in traditional customs and population diet. Alcoholic fermentation of this beverage is ensured by a complex natural yeast flora which plays a decisive role in the quality of the final product. This present study aims to evaluate the distribution and the diversity of the yeast strains isolated in raffia wine from four sampling areas (Abengourou, Alépé, Grand-Lahou and Adzopé) in Côte d'Ivoire. Based on the D1/D2 domain of the LSU rDNA sequence analysis, nine species belonging to six genera were distinguished. With a percentage of 69.5 % out of 171 yeast isolates, Saccharomyces cerevisiae was the predominant species in the raffia wine, followed by Kodamaea ohmeri (20.4 %). The other species isolated were Candida haemulonii (4.1 %), Candida phangngensis (1.8 %), Pichia kudriavzevii (1.2 %), Hanseniaspora jakobsenii (1.2 %), Candida silvae (0.6 %), Hanseniaspora guilliermondii (0.6 %) and Meyerozyma caribbica (0.6 %). The molecular characterization of S. cerevisiae isolates at the strain level using the PCR-interdelta method revealed the presence of 21 profiles (named I to XXI) within 115 isolates. Only four profiles (I, III, V and XI) were shared by the four areas under study. Phenotypic characterization of K. ohmeri strains showed two subgroups for sugar fermentation and no diversity for the nitrogen compound assimilations and the growth at different temperatures.

  4. Genomic and transcriptome analyses reveal that MAPK- and phosphatidylinositol-signaling pathways mediate tolerance to 5-hydroxymethyl-2-furaldehyde for industrial yeast Saccharomyces cerevisiae

    PubMed Central

    Zhou, Qian; Liu, Z. Lewis; Ning, Kang; Wang, Anhui; Zeng, Xiaowei; Xu, Jian

    2014-01-01

    The industrial yeast Saccharomyces cerevisiae is a traditional ethanologenic agent and a promising biocatalyst for advanced biofuels production using lignocellulose mateials. Here we present the genomic background of type strain NRRL Y-12632 and its transcriptomic response to 5-hydroxymethyl-2-furaldehyde (HMF), a commonly encountered toxic compound liberated from lignocellulosic-biomass pretreatment, in dissecting the genomic mechanisms of yeast tolerance. Compared with the genome of laboratory model strain S288C, we identified more than 32,000 SNPs in Y-12632 with 23,000 missense and nonsense SNPs. Enriched sequence mutations occurred for genes involved in MAPK- and phosphatidylinositol (PI)- signaling pathways in strain Y-12632, with 41 and 13 genes containing non-synonymous SNPs, respectively. Many of these mutated genes displayed consistent up-regulated signature expressions in response to challenges of 30 mM HMF. Analogous single-gene deletion mutations of these genes showed significantly sensitive growth response on a synthetic medium containing 20 mM HMF. Our results suggest at least three MAPK-signaling pathways, especially for the cell-wall integrity pathway, and PI-signaling pathways to be involved in mediation of yeast tolerance against HMF in industrial yeast Saccharomyces cerevisiae. Higher levels of sequence variations were also observed for genes involved in purine and pyrimidine metabolism pathways. PMID:25296911

  5. Dynamic study of yeast species and Saccharomyces cerevisiae strains during the spontaneous fermentations of Muscat blanc in Jingyang, China.

    PubMed

    Wang, Chunxiao; Liu, Yanlin

    2013-04-01

    The evolution of yeast species and Saccharomyces cerevisiae genotypes during spontaneous fermentations of Muscat blanc planted in 1957 in Jingyang region of China was followed in this study. Using a combination of colony morphology on Wallerstein Nutrient (WLN) medium, sequence analysis of the 26S rDNA D1/D2 domain and 5.8S-ITS-RFLP analysis, a total of 686 isolates were identified at the species level. The six species identified were S. cerevisiae, Hanseniaspora uvarum, Hanseniaspora opuntiae, Issatchenkia terricola, Pichia kudriavzevii (Issatchenkia orientalis) and Trichosporon coremiiforme. This is the first report of T. coremiiforme as an inhabitant of grape must. Three new colony morphologies on WLN medium and one new 5.8S-ITS-RFLP profile are described. Species of non-Saccharomyces, predominantly H. opuntiae, were found in early stages of fermentation. Subsequently, S. cerevisiae prevailed followed by large numbers of P. kudriavzevii that dominated at the end of fermentations. Six native genotypes of S. cerevisiae were determined by interdelta sequence analysis. Genotypes III and IV were predominant. As a first step in exploring untapped yeast resources of the region, this study is important for monitoring the yeast ecology in native fermentations and screening indigenous yeasts that will produce wines with regional characteristics. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. BioSentinel: Biosensors for Deep-Space Radiation Study

    NASA Technical Reports Server (NTRS)

    Lokugamage, Melissa P.; Santa Maria, Sergio R.; Marina, Diana B.; Bhattacharya, Sharmila

    2016-01-01

    The BioSentinel mission will be deployed on NASA's Exploration Mission 1 (EM-1) in 2018. We will use the budding yeast, Saccharomyces cerevisiae, as a biosensor to study the effect of deep-space radiation on living cells. The BioSentinel mission will be the first investigation of a biological response to space radiation outside Low Earth Orbit (LEO) in over 40 years. Radiation can cause damage such as double stand breaks (DSBs) on DNA. The yeast cell was chosen for this mission because it is genetically controllable, shares homology with human cells in its DNA repair pathways, and can be stored in a desiccated state for long durations. Three yeast strains will be stored dry in multiple microfluidic cards: a wild type control strain, a mutant defective strain that cannot repair DSBs, and a biosensor strain that can only grow if it gets DSB-and-repair events occurring near a specific gene. Growth and metabolic activity of each strain will be measured by a 3-color LED optical detection system. Parallel experiments will be done on the International Space Station and on Earth so that we can compare the results to that of deep space. One of our main objectives is to characterize the microfluidic card activation sequence before the mission. To increase the sensitivity of yeast cells as biosensors, desiccated yeast in each card will be resuspended in a rehydration buffer. After several weeks, the rehydration buffer will be exchanged with a growth medium in order to measure yeast growth and metabolic activity. We are currently working on a time-course experiment to better understand the effects of the rehydration buffer on the response to ionizing radiation. We will resuspend the dried yeast in our rehydration medium over a period of time; then each week, we will measure the viability and ionizing radiation sensitivity of different yeast strains taken from this rehydration buffer. The data obtained in this study will be useful in finalizing the card activation sequence for this mission.

  7. Relationships among genera of the Saccharomycotina from multigene sequence analysis

    USDA-ARS?s Scientific Manuscript database

    Most known species of the subphylum Saccharomycotina (budding ascomycetous yeasts) have now been placed in phylogenetically defined clades following multigene sequence analysis. Terminal clades, which are usually well supported from bootstrap analysis, are viewed as phylogenetically circumscribed ge...

  8. Human mitochondrial pyrophosphatase: cDNA cloning and analysis of the gene in patients with mtDNA depletion syndromes.

    PubMed

    Curbo, Sophie; Lagier-Tourenne, Clotilde; Carrozzo, Rosalba; Palenzuela, Lluis; Lucioli, Simona; Hirano, Michio; Santorelli, Filippo; Arenas, Joaquin; Karlsson, Anna; Johansson, Magnus

    2006-03-01

    Pyrophosphatases (PPases) catalyze the hydrolysis of inorganic pyrophosphate generated in several cellular enzymatic reactions. A novel human pyrophosphatase cDNA encoding a 334-amino-acid protein approximately 60% identical to the previously identified human cytosolic PPase was cloned and characterized. The novel enzyme, named PPase-2, was enzymatically active and catalyzed hydrolysis of pyrophosphate at a rate similar to that of the previously identified PPase-1. A functional mitochondrial import signal sequence was identified in the N-terminus of PPase-2, which targeted the enzyme to the mitochondrial matrix. The human pyrophosphatase 2 gene (PPase-2) was mapped to chromosome 4q25 and the 1.4-kb mRNA was ubiquitously expressed in human tissues, with highest levels in muscle, liver, and kidney. The yeast homologue of the mitochondrial PPase-2 is required for mitochondrial DNA maintenance and yeast cells lacking the enzyme exhibit mitochondrial DNA depletion. We sequenced the PPA2 gene in 13 patients with mitochondrial DNA depletion syndromes (MDS) of unknown cause to determine if mutations in the PPA2 gene of these patients were associated with this disease. No pathogenic mutations were identified in the PPA2 gene of these patients and we found no evidence that PPA2 gene mutations are a common cause of MDS in humans.

  9. Molecular genetic diversity of the Saccharomyces yeasts in Taiwan: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii.

    PubMed

    Naumov, Gennadi I; Lee, Ching-Fu; Naumova, Elena S

    2013-01-01

    Genetic hybridization, sequence and karyotypic analyses of natural Saccharomyces yeasts isolated in different regions of Taiwan revealed three biological species: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii. Intraspecies variability of the D1/D2 and ITS1 rDNA sequences was detected among S. cerevisiae and S. kudriavzevii isolates. According to molecular and genetic analyses, the cosmopolitan species S. cerevisiae and S. kudriavzevii contain local divergent populations in Taiwan, Malaysia and Japan. Six of the seven known Saccharomyces species are documented in East Asia: S. arboricola, S. bayanus, S. cerevisiae, S. kudriavzevii, S. mikatae, and S. paradoxus.

  10. Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

    PubMed

    Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

    2014-02-01

    Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

  11. Stepwise synthesis of oligonucleotides. XXII. The synthesis of Tpsi-loop fragments of yeast tRNAIVal and their analogs.

    PubMed Central

    Zhenodarova, S M; Klyagina, V P; Smolyaninova, O A; Khabarova, M I; Antonovich, E G; Prokof'yev, M A

    1977-01-01

    The method of the combined use of nucleolytic enzymes was used for the synthesis of Tpsi-loop fragments of yeast valine tRNA and their analogs. Dinucleoside monophosphates, trinucleoside diphosphates and tetranucleoside triphosphates having the sequences of fragments 54-57 and 59-62 or their analogs were synthesized. PMID:896487

  12. Molecular cloning and expression in Saccharomyces cerevisiae of two Aspergillus nidulans xylanase genes.

    PubMed Central

    Pérez-Gonzalez, J A; De Graaff, L H; Visser, J; Ramón, D

    1996-01-01

    Two Aspergillus nidulans genes, xlnA and xlnB, encoding the X22 and X24 xylanases from this fungus, respectively, have been cloned and sequenced. Their cDNAs have been expressed in a laboratory Saccharomyces cerevisiae strain under the control of a constitutive yeast promoter, resulting in the construction of recombinant xylanolytic yeast strains. PMID:8787417

  13. CHARACTERIZATION OF THE ALKANE-INDUCIBLE CYTOCHROME P450 (P450ALK) GENE FROM THE YEAST CANDIDA TROPICALIS: IDENTIFICATION OF A NEW P450 FAMILY

    EPA Science Inventory

    The P450alk gene, which is inducible by the assimilation of alkane in Candida tropicalis, was sequenced and characterized. Structural features described in promoter and terminator regions of Saccharomyces yeast genes are present in the P450alk gene and some particular structures ...

  14. Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis

    Treesearch

    Thomas W. Jeffries; Igor V. Grigroriev; Jane Grimwood; Jose M. Laplaza; Andrea Aerts; Asaf Salamov; Jeremy Schmutz; Erika Lindquist; Paramvir Dehal; Harris Shapiro; Yong-Su Jin; Volkmar Passoth; Paul M. Richardson

    2007-01-01

    Xylose is a major constituent of plant lignocellulose, and its fermentation is important for the bioconversion of plant biomass to fuels and chemicals. Pichia stipitis is a well-studied, native xylose-fermenting yeast. The mechanism and regulation of xylose metabolism in P. stipitis have been characterized and genes from P. stipitis have been used to engineer xylose...

  15. Anniversary of the discovery/isolation of the yeast centromere by Clarke and Carbon.

    PubMed

    Bloom, Kerry

    2015-05-01

    The first centromere was isolated 35 years ago by Louise Clarke and John Carbon from budding yeast. They embarked on their journey with rudimentary molecular tools (by today's standards) and little knowledge of the structure of a chromosome, much less the nature of a centromere. Their discovery opened up a new field, as centromeres have now been isolated from fungi and numerous plants and animals, including mammals. Budding yeast and several other fungi have small centromeres with short, well-defined sequences, known as point centromeres, whereas regional centromeres span several kilobases up to megabases and do not seem to have DNA sequence specificity. Centromeres are at the heart of artificial chromosomes, and we have seen the birth of synthetic centromeres in budding and fission yeast and mammals. The diversity in centromeres throughout phylogeny belie conserved functions that are only beginning to be understood. © 2015 Bloom. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  16. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    PubMed

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Functional conservation of the yeast and Arabidopsis RAD54-like genes.

    PubMed

    Klutstein, Michael; Shaked, Hezi; Sherman, Amir; Avivi-Ragolsky, Naomi; Shema, Efrat; Zenvirth, Drora; Levy, Avraham A; Simchen, Giora

    2008-04-01

    The Saccharomyces cerevisiae RAD54 gene has critical roles in DNA double-strand break repair, homologous recombination, and gene targeting. Previous results show that the yeast gene enhances gene targeting when expressed in Arabidopsis thaliana. In this work we address the trans-species compatibility of Rad54 functions. We show that overexpression of yeast RAD54 in Arabidopsis enhances DNA damage resistance severalfold. Thus, the yeast gene is active in the Arabidopsis homologous-recombination repair system. Moreover, we have identified an A. thaliana ortholog of yeast RAD54, named AtRAD54. This gene, with close sequence similarity to RAD54, complements methylmethane sulfonate (MMS) sensitivity but not UV sensitivity or gene targeting defects of rad54Delta mutant yeast cells. Overexpression of AtRAD54 in Arabidopsis leads to enhanced resistance to DNA damage. This gene's assignment as a RAD54 ortholog is further supported by the interaction of AtRad54 with AtRad51 and the interactions between alien proteins (i.e., yeast Rad54 with AtRAD51 and yeast Rad51 with AtRad54) in a yeast two-hybrid experiment. These interactions hint at the molecular nature of this interkingdom complementation, although the stronger effect of the yeast Rad54 in plants than AtRad54 in yeast might be explained by an ability of the Rad54 protein to act alone, independently of its interaction with Rad51.

  18. XRN1 Is a Species-Specific Virus Restriction Factor in Yeasts

    PubMed Central

    Rowley, Paul A.; Ho, Brandon; Bushong, Sarah; Johnson, Arlen; Sawyer, Sara L.

    2016-01-01

    In eukaryotes, the degradation of cellular mRNAs is accomplished by Xrn1 and the cytoplasmic exosome. Because viral RNAs often lack canonical caps or poly-A tails, they can also be vulnerable to degradation by these host exonucleases. Yeast lack sophisticated mechanisms of innate and adaptive immunity, but do use RNA degradation as an antiviral defense mechanism. We find a highly refined, species-specific relationship between Xrn1p and the “L-A” totiviruses of different Saccharomyces yeast species. We show that the gene XRN1 has evolved rapidly under positive natural selection in Saccharomyces yeast, resulting in high levels of Xrn1p protein sequence divergence from one yeast species to the next. We also show that these sequence differences translate to differential interactions with the L-A virus, where Xrn1p from S. cerevisiae is most efficient at controlling the L-A virus that chronically infects S. cerevisiae, and Xrn1p from S. kudriavzevii is most efficient at controlling the L-A-like virus that we have discovered within S. kudriavzevii. All Xrn1p orthologs are equivalent in their interaction with another virus-like parasite, the Ty1 retrotransposon. Thus, Xrn1p appears to co-evolve with totiviruses to maintain its potent antiviral activity and limit viral propagation in Saccharomyces yeasts. We demonstrate that Xrn1p physically interacts with the Gag protein encoded by the L-A virus, suggesting a host-virus interaction that is more complicated than just Xrn1p-mediated nucleolytic digestion of viral RNAs. PMID:27711183

  19. Identification of yeasts during alcoholic fermentation of tchapalo, a traditional sorghum beer from Côte d'Ivoire.

    PubMed

    N'guessan, Kouadio Florent; Brou, Kouakou; Jacques, Noémie; Casaregola, Serge; Dje, Koffi Marcellin

    2011-05-01

    This study investigated the diversity and dynamics of yeasts involved in alcoholic fermentation of a traditional sorghum beer from Côte d'Ivoire, tchapalo. A total of 240 yeast strains were isolated from fermenting sorghum wort inoculated with dry yeast from two geographic regions of Côte d'Ivoire (Abidjan and Bondoukou). Initial molecular identification to the species level was carried out using RFLP of PCR-amplified internal transcribed spacers of rDNA (ITS1-5.8S-ITS2). Ten different profiles were obtained from the restriction of PCR products with the three endonucleases HaeIII, CfoI and HinfI. Sequence analysis of the D1/D2 domain of the 26S rDNA and the ACT1 gene allowed us to assign these groups to six different species: Saccharomyces cerevisiae-like, Candida tropicalis, Pichia kudriavzevii, Pichia kluyveri, Kodamaea ohmeri and Meyerozyma caribbica. The most frequent species associated with tchapalo fermentation was S. cerevisiae-like (87.36%), followed by C. tropicalis (5.45%) and M. caribbica (2.71%). S. cerevisiae-like strains were diploid heterozygotes and exhibited three to four nucleotides divergence from the type strain in the D1/D2 domain and several indels in the more discriminant sequence of the intron of the ACT1 gene. During the process, the yeast species isolated and their frequencies varied according to the geographic origin of the dry yeast. The occurrence of some species was sporadic and only two non-Saccharomyces species were found in the final product.

  20. Molecular Diagnostics of Arthroconidial Yeasts, Frequent Pulmonary Opportunists.

    PubMed

    Kaplan, Engin; Al-Hatmi, Abdullah M S; Ilkit, Macit; Gerrits van den Ende, A H G; Hagen, Ferry; Meis, Jacques F; de Hoog, G Sybren

    2018-01-01

    Magnusiomyces capitatus and Saprochaete clavata are members of the clade of arthroconidial yeasts that represent emerging opportunistic pulmonary pathogens in immunocompromised patients. Given that standard ribosomal DNA (rDNA) identification often provides confusing results, in this study, we analyzed 34 isolates with the goal of finding new genetic markers for classification using multilocus sequencing and amplified fragment length polymorphism (AFLP). The interspecific similarity obtained using rDNA markers (the internal transcribed spacer [ITS] and large subunit regions) was in the range of 96 to 99%, whereas that obtained using protein-coding loci ( Rbp2 , Act , and Tef1α ) was lower at 89.4 to 95.2%. Ultimately, Rbp2 was selected as the best marker for species distinction. On the basis of cloned ITS data, some strains proved to be misidentified in comparison with the identities obtained with phenotypic characters, protein sequences, and AFLP profiles, indicating that different copies of the ribosomal operon were present in a single species. Antifungal susceptibility testing revealed that voriconazole had the lowest MIC against M. capitatus , while amphotericin B had the lowest MIC against S. clavata Both species exhibited in vitro resistance to fluconazole and micafungin. Copyright © 2017 American Society for Microbiology.

  1. Insights into Hsp70 Chaperone Activity from a Crystal Structure of the Yeast Hsp110 Sse1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu,Q.; Hendrickson, W.

    2007-01-01

    Classic Hsp70 chaperones assist in diverse processes of protein folding and translocation, and Hsp110s had seemed by sequence to be distant relatives within an Hsp70 superfamily. The 2.4 Angstroms resolution structure of Sse1 with ATP shows that Hsp110s are indeed Hsp70 relatives, and it provides insight into allosteric coupling between sites for ATP and polypeptide-substrate binding in Hsp70s. Subdomain structures are similar in intact Sse1(ATP) and in the separate Hsp70 domains, but conformational dispositions are radically different. Interfaces between Sse1 domains are extensive, intimate, and conservative in sequence with Hsp70s. We propose that Sse1(ATP) may be an evolutionary vestige ofmore » the Hsp70(ATP) state, and an analysis of 64 mutant variants in Sse1 and three Hsp70 homologs supports this hypothesis. An atomic-level understanding of Hsp70 communication between ATP and substrate-binding domains follows. Requirements on Sse1 for yeast viability are in keeping with the distinct function of Hsp110s as nucleotide exchange factors.« less

  2. A sequence-specific transcription activator motif and powerful synthetic variants that bind Mediator using a fuzzy protein interface.

    PubMed

    Warfield, Linda; Tuttle, Lisa M; Pacheco, Derek; Klevit, Rachel E; Hahn, Steven

    2014-08-26

    Although many transcription activators contact the same set of coactivator complexes, the mechanism and specificity of these interactions have been unclear. For example, do intrinsically disordered transcription activation domains (ADs) use sequence-specific motifs, or do ADs of seemingly different sequence have common properties that encode activation function? We find that the central activation domain (cAD) of the yeast activator Gcn4 functions through a short, conserved sequence-specific motif. Optimizing the residues surrounding this short motif by inserting additional hydrophobic residues creates very powerful ADs that bind the Mediator subunit Gal11/Med15 with high affinity via a "fuzzy" protein interface. In contrast to Gcn4, the activity of these synthetic ADs is not strongly dependent on any one residue of the AD, and this redundancy is similar to that of some natural ADs in which few if any sequence-specific residues have been identified. The additional hydrophobic residues in the synthetic ADs likely allow multiple faces of the AD helix to interact with the Gal11 activator-binding domain, effectively forming a fuzzier interface than that of the wild-type cAD.

  3. The yeast two hybrid system in a screen for proteins interacting with axolotl (Ambystoma mexicanum) Msx1 during early limb regeneration.

    PubMed

    Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin

    2011-07-01

    Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.

  4. Whole-Genome Sequencing of Sake Yeast Saccharomyces cerevisiae Kyokai no. 7

    PubMed Central

    Akao, Takeshi; Yashiro, Isao; Hosoyama, Akira; Kitagaki, Hiroshi; Horikawa, Hiroshi; Watanabe, Daisuke; Akada, Rinji; Ando, Yoshinori; Harashima, Satoshi; Inoue, Toyohisa; Inoue, Yoshiharu; Kajiwara, Susumu; Kitamoto, Katsuhiko; Kitamoto, Noriyuki; Kobayashi, Osamu; Kuhara, Satoru; Masubuchi, Takashi; Mizoguchi, Haruhiko; Nakao, Yoshihiro; Nakazato, Atsumi; Namise, Masahiro; Oba, Takahiro; Ogata, Tomoo; Ohta, Akinori; Sato, Masahide; Shibasaki, Seiji; Takatsume, Yoshifumi; Tanimoto, Shota; Tsuboi, Hirokazu; Nishimura, Akira; Yoda, Koji; Ishikawa, Takeaki; Iwashita, Kazuhiro; Fujita, Nobuyuki; Shimoi, Hitoshi

    2011-01-01

    The term ‘sake yeast’ is generally used to indicate the Saccharomyces cerevisiae strains that possess characteristics distinct from others including the laboratory strain S288C and are well suited for sake brewery. Here, we report the draft whole-genome shotgun sequence of a commonly used diploid sake yeast strain, Kyokai no. 7 (K7). The assembled sequence of K7 was nearly identical to that of the S288C, except for several subtelomeric polymorphisms and two large inversions in K7. A survey of heterozygous bases between the homologous chromosomes revealed the presence of mosaic-like uneven distribution of heterozygosity in K7. The distribution patterns appeared to have resulted from repeated losses of heterozygosity in the ancestral lineage of K7. Analysis of genes revealed the presence of both K7-acquired and K7-lost genes, in addition to numerous others with segmentations and terminal discrepancies in comparison with those of S288C. The distribution of Ty element also largely differed in the two strains. Interestingly, two regions in chromosomes I and VII of S288C have apparently been replaced by Ty elements in K7. Sequence comparisons suggest that these gene conversions were caused by cDNA-mediated recombination of Ty elements. The present study advances our understanding of the functional and evolutionary genomics of the sake yeast. PMID:21900213

  5. Lindnera (Pichia) fabianii blood infection after mesenteric ischemia.

    PubMed

    Gabriel, Frederic; Noel, Thierry; Accoceberry, Isabelle

    2012-04-01

    Lindnera (Pichia) fabianii (teleomorph of Candida fabianii) is a yeast species rarely involved in human infections. This report describes the first known human case of a Lindnera fabianii blood infection after mesenteric ischemia. The 53-year-old patient was hospitalized in the intensive care unit after a suicide attempt and was suffering from a mesenteric ischemia and acute renal failure. Lindnera fabianii was recovered from an oropharyngeal swab, then isolated from stool and urine samples before the diagnosis of the blood infection. Caspofungin intravenous treatment was associated with a successful outcome. Final unequivocal identification of the strain was done by sequencing the internal transcribed spacer (ITS) region, and regions of 18S rDNA gene and of the translation elongation factor-1α gene. Until our work, the genomic databases did not contain the complete ITS region of L. fabianii as a single nucleotide sequence (encompassing ITS1, the 5.8S rDNA and ITS2), and misidentification with other yeast species, e.g., Lindnera (Pichia) mississippiensis, could have occurred. Our work demonstrates that the usual DNA barcoding method based on sequencing of the ITS region may fail to provide the correct identification of some taxa, and that partial sequencing of the EF1α gene may be much more effective for the accurate delineation and molecular identification of new emerging opportunistic yeast pathogens.

  6. A newly anti-Streptococcus suis bacteriocin producing strain from unweaned piglets fecal matter: isolation, preliminary identification, and optimization of medium composition for enhanced bacteriocin production.

    PubMed

    Zhang, Xiangmei; Chang, Xiaoyuan; Liu, Guorong; Wu, Pengpeng; Li, Pinglan

    2012-01-01

    A newly isolated anti-Streptococcus suis bacteriocin-producing strain LPL1-5 was obtained from healthy unweaned piglets' fecal matter, and was designated as Lactobacillus pentosus LPL1-5 based on morphology, biochemical properties, and 16S rDNA sequencing analysis. The medium composition for enhanced bacteriocin production by L. pentosus LPL1-5 was optimized by statistical methodology. Yeast extract, K(2)HPO(4)·3H(2)O, and MnSO(4)·H(2)O were identified as significant components influencing pentocin LPL1-5 production using the Plackett-Burman method. Response surface methodology was applied for further optimization. The concentrations of medium components for enhanced pentocin LPL1-5 production were as follows (g/L): lactose 20.00, tryptone 10.00, beef extract 10.00, yeast extract 14.00, MnSO(4)·H(2)O 0.84, K(2)HPO(4)·3H(2)O 4.92, triammonium citrate 2.00, Na-acetate 5.00, MgSO(4)·7H(2)O 0.58, Tween 80 1.00. Under the optimized condition, a value of 3154.65 ± 27.93 IU/mL bacteriocin activity was achieved, which was 4.2-fold that of the original medium.

  7. Effects of dietary supplementation of active dried yeast on fecal methanogenic archaea diversity in dairy cows.

    PubMed

    Jin, Dingxing; Kang, Kun; Wang, Hongze; Wang, Zhisheng; Xue, Bai; Wang, Lizhi; Xu, Feng; Peng, Quanhui

    2017-04-01

    This study aimed to investigate the effects of dietary supplementation of different dosages of active dried yeast (ADY) on the fecal methanogenic archaea community of dairy cattle. Twelve multiparous, healthy, mid-lactating Holstein dairy cows (body weight: 584 ± 23.2 kg, milk produced: 26.3 ± 1.22 kg/d) were randomly assigned to one of three treatments (control, ADY2, and ADY4) according to body weight with four replicates per treatment. Cows in the control group were fed conventional rations without ADY supplementation, while cows in the ADY2 and ADY4 group were fed rations supplemented with ADY at 2 or 4 g/d/head. Real-time PCR analysis showed the populations of total methanogens in the feces were significantly decreased (P < 0.05) in the ADY4 group compared with control. High-throughput sequencing technology was applied to examine the differences in methanogenic archaea diversity in the feces of the three treatment groups. A total of 155,609 sequences were recovered (a mean of 12,967 sequences per sample) from the twelve fecal samples, which consisted of a number of operational taxonomic units (OTUs) ranging from 1451 to 1,733, were assigned to two phyla, four classes, five orders, five families and six genera. Bioinformatic analyses illustrated that the natural fecal archaeal community of the control group was predominated by Methanobrevibacter (86.9% of the total sequence reads) and Methanocorpusculum (10.4%), while the relative abundance of the remaining four genera were below 1% with Methanosphaera comprising 0.8%, Thermoplasma composing 0.4%, and the relative abundance of Candidatus Nitrososphaera and Halalkalicoccus being close to zero. At the genus level, the relative abundances of Methanocorpusculum and Thermoplasma were increased (P < 0.05) with increasing dosage of ADY. Conversely, the predominant methanogen genus Methanobrevibacter was decreased with ADY dosage (P < 0.05). Dietary supplementation of ADY had no significant effect (P > 0.05) on the abundances of genera unclassified, Candidatus Nitrososphaera, and Halalkalicoccus. In conclusion, supplementation of ADY to the rations of dairy cattle could alter the population sizes and composition of fecal methanogenic archaea in the feces of dairy cattle. The decrease in Methanobrevibacter happened with a commensurate increase in the genera Methanocorpusculum and Thermoplasma. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. The Yeast Saccharomyces cerevisiae as a Model for Understanding RAS Proteins and Their Role in Human Tumorigenesis

    PubMed Central

    Cazzanelli, Giulia; Francisco, Rita; Azevedo, Luísa; Carvalho, Patrícia Dias; Almeida, Ana; Côrte-Real, Manuela; Oliveira, Maria José; Lucas, Cândida; Sousa, Maria João

    2018-01-01

    The exploitation of the yeast Saccharomyces cerevisiae as a biological model for the investigation of complex molecular processes conserved in multicellular organisms, such as humans, has allowed fundamental biological discoveries. When comparing yeast and human proteins, it is clear that both amino acid sequences and protein functions are often very well conserved. One example of the high degree of conservation between human and yeast proteins is highlighted by the members of the RAS family. Indeed, the study of the signaling pathways regulated by RAS in yeast cells led to the discovery of properties that were often found interchangeable with RAS proto-oncogenes in human pathways, and vice versa. In this work, we performed an updated critical literature review on human and yeast RAS pathways, specifically highlighting the similarities and differences between them. Moreover, we emphasized the contribution of studying yeast RAS pathways for the understanding of human RAS and how this model organism can contribute to unveil the roles of RAS oncoproteins in the regulation of mechanisms important in the tumorigenic process, like autophagy. PMID:29463063

  9. Genome Sequence of Saccharomyces cerevisiae Double-Stranded RNA Virus L-A-28.

    PubMed

    Konovalovas, Aleksandras; Serviené, Elena; Serva, Saulius

    2016-06-16

    We cloned and sequenced the complete genome of the L-A-28 virus from the Saccharomyces cerevisiae K28 killer strain. This sequence completes the set of currently identified L-A helper viruses required for expression of double-stranded RNA-originated killer phenotypes in baking yeast. Copyright © 2016 Konovalovas et al.

  10. The MIMIC Model as a Tool for Differential Bundle Functioning Detection

    ERIC Educational Resources Information Center

    Finch, W. Holmes

    2012-01-01

    Increasingly, researchers interested in identifying potentially biased test items are encouraged to use a confirmatory, rather than exploratory, approach. One such method for confirmatory testing is rooted in differential bundle functioning (DBF), where hypotheses regarding potential differential item functioning (DIF) for sets of items (bundles)…

  11. Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

    PubMed

    Repetto, B; Tzagoloff, A

    1989-06-01

    Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.

  12. Structural differences between yeast and mammalian microtubules revealed by cryo-EM

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Howes, Stuart C.; Geyer, Elisabeth A.; LaFrance, Benjamin

    Microtubules are polymers of αβ-tubulin heterodimers essential for all eukaryotes. Despite sequence conservation, there are significant structural differences between microtubules assembled in vitro from mammalian or budding yeast tubulin. Yeast MTs were not observed to undergo compaction at the interdimer interface as seen for mammalian microtubules upon GTP hydrolysis. Lack of compaction might reflect slower GTP hydrolysis or a different degree of allosteric coupling in the lattice. The microtubule plus end–tracking protein Bim1 binds yeast microtubules both between αβ-tubulin heterodimers, as seen for other organisms, and within tubulin dimers, but binds mammalian tubulin only at interdimer contacts. At the concentrationsmore » used in cryo-electron microscopy, Bim1 causes the compaction of yeast microtubules and induces their rapid disassembly. In conclusion, our studies demonstrate structural differences between yeast and mammalian microtubules that likely underlie their differing polymerization dynamics. These differences may reflect adaptations to the demands of different cell size or range of physiological growth temperatures.« less

  13. Influence of IgG Subclass on Human Antimannan Antibody-Mediated Resistance to Hematogenously Disseminated Candidiasis in Mice

    PubMed Central

    Nishiya, Casey T.; Boxx, Gayle M.; Robison, Kerry; Itatani, Carol; Kozel, Thomas R.

    2015-01-01

    Candida albicans is a yeast-like pathogen and can cause life-threatening systemic candidiasis. Its cell surface is enriched with mannan that is resistant to complement activation. Previously, we developed the recombinant human IgG1 antimannan antibody M1g1. M1g1 was found to promote complement activation and phagocytosis and protect mice from systemic candidiasis. Here, we evaluate the influence of IgG subclass on antimannan antibody-mediated protection. Three IgG subclass variants of M1g1 were constructed: M1g2, M1g3, and M1g4. The IgG subclass identity for each variant was confirmed with DNA sequence and subclass-specific antibodies. These variants contain identical M1 Fabs and exhibited similar binding affinities for C. albicans yeast and purified mannan. Yeast cells and hyphae recovered from the kidney of antibody-treated mice with systemic candidiasis showed uniform binding of each variant, indicating constitutive expression of the M1 epitope and antibody opsonization in the kidney. All variants promoted deposition of both murine and human C3 onto the yeast cell surface, with M1g4 showing delayed activation, as determined by flow cytometry and immunofluorescence microscopy. M1g4-mediated complement activation was found to be associated with its M1 Fab that activates the alternative pathway in an Fc-independent manner. Treatment with each subclass variant extended the survival of mice with systemic candidiasis (P < 0.001). However, treatment with M1g1, M1g3, or M1g4, but not with M1g2, also reduced the kidney fungal burden (P < 0.001). Thus, the role of human antimannan antibody in host resistance to systemic candidiasis is influenced by its IgG subclass. PMID:26573736

  14. Separation by hydrophobic interaction chromatography and structural determination by mass spectrometry of mannosylated glycoforms of a recombinant transferrin-exendin-4 fusion protein from yeast.

    PubMed

    Zolodz, Melissa D; Herberg, John T; Narepekha, Halyna E; Raleigh, Emily; Farber, Matthew R; Dufield, Robert L; Boyle, Denis M

    2010-01-08

    Obtaining sufficient amounts of pure glycoprotein variants to characterize their structures is an important goal in both functional biology and the biotechnology industry. We have developed preparative HIC conditions that resolve glycoform variants on the basis of overall carbohydrate content for a recombinant transferrin-exendin-4 fusion protein. The fusion protein was expressed from the yeast Saccharomyces cerevisiae from high density fermentation and is post-translationally modified with mannose sugars through O-glycosidic linkages. Overall hydrophobic behavior appeared to be dominated by the N-terminal 39 amino acids from the exendin-4 and linker peptide sequences as compared to the less hydrophobic behavior of human transferrin alone. In addition, using LC techniques that measure total glycans released from the pure protein combined with new high resolution technologies using mass spectrometry, we have determined the locations and chain lengths of mannose residues on specific peptides derived from tryptic maps of the transferrin-exendin-4 protein. Though the protein is large (80,488kDa) and contains 78 possible serine and threonine residues as potential sites for sugar addition, mannosylation was observed on only two tryptic peptides located within the first 55 amino acids of the N-terminus. These glycopeptides were highly heterogeneous and contained between 1 and 10 mannose residues scattered among the various serine and threonine sites which were identified by electron transfer dissociation mass spectrometry. Glycan sequences from 1 to 6 linear mannose residues were detected, but mannose chain lengths of 3 or 4 were more common and formed 80% of the total oligosaccharides. This work introduces new technological capabilities for the purification and characterization of glycosylated variants of therapeutic recombinant proteins. Copyright 2009 Elsevier B.V. All rights reserved.

  15. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    PubMed

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  16. The Genetics of Non-conventional Wine Yeasts: Current Knowledge and Future Challenges.

    PubMed

    Masneuf-Pomarede, Isabelle; Bely, Marina; Marullo, Philippe; Albertin, Warren

    2015-01-01

    Saccharomyces cerevisiae is by far the most widely used yeast in oenology. However, during the last decade, several other yeasts species has been purposed for winemaking as they could positively impact wine quality. Some of these non-conventional yeasts (Torulaspora delbrueckii, Metschnikowia pulcherrima, Pichia kluyveri, Lachancea thermotolerans, etc.) are now proposed as starters culture for winemakers in mixed fermentation with S. cerevisiae, and several others are the subject of various studies (Hanseniaspora uvarum, Starmerella bacillaris, etc.). Along with their biotechnological use, the knowledge of these non-conventional yeasts greatly increased these last 10 years. The aim of this review is to describe the last updates and the current state-of-art of the genetics of non-conventional yeasts (including S. uvarum, T. delbrueckii, S. bacillaris, etc.). We describe how genomics and genetics tools provide new data into the population structure and biodiversity of non-conventional yeasts in winemaking environments. Future challenges will lie on the development of selection programs and/or genetic improvement of these non-conventional species. We discuss how genetics, genomics and the advances in next-generation sequencing will help the wine industry to develop the biotechnological use of non-conventional yeasts to improve the quality and differentiation of wines.

  17. PCR Followed by Electrospray Ionization Mass Spectrometry for Broad-Range Identification of Fungal Pathogens

    PubMed Central

    Massire, Christian; Buelow, Daelynn R.; Zhang, Sean X.; Lovari, Robert; Matthews, Heather E.; Toleno, Donna M.; Ranken, Raymond R.; Hall, Thomas A.; Metzgar, David; Sampath, Rangarajan; Blyn, Lawrence B.; Ecker, David J.; Gu, Zhengming; Walsh, Thomas J.

    2013-01-01

    Invasive fungal infections are a significant cause of morbidity and mortality among immunocompromised patients. Early and accurate identification of these pathogens is central to direct therapy and to improve overall outcome. PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS) was evaluated as a novel means for identification of fungal pathogens. Using a database grounded by 60 ATCC reference strains, a total of 394 clinical fungal isolates (264 molds and 130 yeasts) were analyzed by PCR/ESI-MS; results were compared to phenotypic identification, and discrepant results were sequence confirmed. PCR/ESI-MS identified 81.4% of molds to either the genus or species level, with concordance rates of 89.7% and 87.4%, respectively, to phenotypic identification. Likewise, PCR/ESI-MS was able to identify 98.4% of yeasts to either the genus or species level, agreeing with 100% of phenotypic results at both the genus and species level. PCR/ESI-MS performed best with Aspergillus and Candida isolates, generating species-level identification in 94.4% and 99.2% of isolates, respectively. PCR/ESI-MS is a promising new technology for broad-range detection and identification of medically important fungal pathogens that cause invasive mycoses. PMID:23303501

  18. Molecular characterization of a nuclear topoisomerase II from Nicotiana tabacum that functionally complements a temperature-sensitive topoisomerase II yeast mutant.

    PubMed

    Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K

    2003-07-01

    We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.

  19. Two potato proteins, including a novel RING finger protein (HIP1), interact with the potyviral multifunctional protein HCpro.

    PubMed

    Guo, Deyin; Spetz, Carl; Saarma, Mart; Valkonen, Jari P T

    2003-05-01

    Potyviral helper-component proteinase (HCpro) is a multifunctional protein exerting its cellular functions in interaction with putative host proteins. In this study, cellular protein partners of the HCpro encoded by Potato virus A (PVA) (genus Potyvirus) were screened in a potato leaf cDNA library using a yeast two-hybrid system. Two cellular proteins were obtained that interact specifically with PVA HCpro in yeast and in the two in vitro binding assays used. Both proteins are encoded by single-copy genes in the potato genome. Analysis of the deduced amino acid sequences revealed that one (HIP1) of the two HCpro interactors is a novel RING finger protein. The sequence of the other protein (HIP2) showed no resemblance to the protein sequences available from databanks and has known biological functions.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Kun; Sun, Guoxun; Lv, Zhiyuan

    Research highlights: {yields} Invertebrates, for example amphioxus, do express uncoupling proteins. {yields} Both the sequence and the uncoupling activity of amphioxus UCP resemble UCP2. {yields} UCP1 is the only UCP that can form dimer on yeast mitochondria. -- Abstract: The present study describes the molecular cloning of a novel cDNA fragment from amphioxus (Branchiostoma belcheri) encoding a 343-amino acid protein that is highly homologous to human uncoupling proteins (UCP), this protein is therefore named amphioxus UCP. This amphioxus UCP shares more homology with and is phylogenetically more related to mammalian UCP2 as compared with UCP1. To further assess the functionalmore » similarity of amphioxus UCP to mammalian UCP1 and -2, the amphioxus UCP, rat UCP1, and human UCP2 were separately expressed in Saccharomyces cerevisiae, and the recombinant yeast mitochondria were isolated and assayed for the state 4 respiration rate and proton leak, using pYES2 empty vector as the control. UCP1 increased the state 4 respiration rate by 2.8-fold, and the uncoupling activity was strongly inhibited by GDP, while UCP2 and amphioxus UCP only increased the state 4 respiration rate by 1.5-fold and 1.7-fold in a GDP-insensitive manner, moreover, the proton leak kinetics of amphioxus UCP was very similar to UCP2, but much different from UCP1. In conclusion, the amphioxus UCP has a mild, unregulated uncoupling activity in the yeast system, which resembles mammalian UCP2, but not UCP1.« less

  1. Characterization of a new clinical yeast species, Candida tunisiensis sp. nov., isolated from a strain collection from Tunisian hospitals.

    PubMed

    Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed; Sanglard, Dominique

    2013-01-01

    From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches.

  2. Characterization of a New Clinical Yeast Species, Candida tunisiensis sp. nov., Isolated from a Strain Collection from Tunisian Hospitals

    PubMed Central

    Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed

    2013-01-01

    From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches. PMID:23077122

  3. Structure, replication efficiency and fragility of yeast ARS elements.

    PubMed

    Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana

    2012-05-01

    DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  4. Specialist nectar-yeasts decline with urbanization in Berlin

    NASA Astrophysics Data System (ADS)

    Wehner, Jeannine; Mittelbach, Moritz; Rillig, Matthias C.; Verbruggen, Erik

    2017-03-01

    Nectar yeasts are common inhabitants of insect-pollinated flowers but factors determining their distribution are not well understood. We studied the influence of host identity, environmental factors related to pollution/urbanization, and the distance to a target beehive on local distribution of nectar yeasts within Robinia pseudoacacia L. and Tilia tomentosa Moench in Berlin, Germany. Nectar samples of six individuals per species were collected at seven sites in a 2 km radius from each target beehive and plated on YM-Agar to visualise the different morphotypes, which were then identified by sequencing a section of the 26S rDNA gene. Multivariate linear models were used to analyze the effects of all investigated factors on yeast occurrence per tree. Yeast distribution was mainly driven by host identity. The influence of the environmental factors (NO2, height of construction, soil sealing) strongly depended on the radius around the tree, similar to the distance of the sampled beehive. Incidence of specialist nectar-borne yeast species decreased with increasing pollution/urbanization index. Given that specialist yeast species gave way to generalist yeasts that have a reduced dependency on pollinators for between-flower dispersal, our results indicate that increased urbanization may restrict the movement of nectar-specialized yeasts, via limitations of pollinator foraging behavior.

  5. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    PubMed

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  6. Recovery of soil unicellular eukaryotes: an efficiency and activity analysis on the single cell level.

    PubMed

    Lentendu, Guillaume; Hübschmann, Thomas; Müller, Susann; Dunker, Susanne; Buscot, François; Wilhelm, Christian

    2013-12-01

    Eukaryotic unicellular organisms are an important part of the soil microbial community, but they are often neglected in soil functional microbial diversity analysis, principally due to the absence of specific investigation methods in the special soil environment. In this study we used a method based on high-density centrifugation to specifically isolate intact algal and yeast cells, with the aim to analyze them with flow cytometry and sort them for further molecular analysis such as deep sequencing. Recovery efficiency was tested at low abundance levels that fit those in natural environments (10(4) to 10(6) cells per g soil). Five algae and five yeast morphospecies isolated from soil were used for the testing. Recovery efficiency was between 1.5 to 43.16% and 2 to 30.2%, respectively, and was dependent on soil type for three of the algae. Control treatments without soil showed that the majority of cells were lost due to the method itself (58% and 55.8% respectively). However, the cell extraction technique did not much compromise cell vitality because a fluorescein di-acetate assay indicated high viability percentages (73.3% and 97.2% of cells, respectively). The low abundant algae and yeast morphospecies recovered from soil were cytometrically analyzed and sorted. Following, their DNA was isolated and amplified using specific primers. The developed workflow enables isolation and enrichment of intact autotrophic and heterotrophic soil unicellular eukaryotes from natural environments for subsequent application of deep sequencing technologies. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. The CENP-A N-Tail Confers Epigenetic Stability to Centromeres via the CENP-T Branch of the CCAN in Fission Yeast

    PubMed Central

    Folco, H. Diego; Campbell, Christopher S.; May, Karen M.; Espinoza, Celso A.; Oegema, Karen; Hardwick, Kevin G.; Grewal, Shiv I. S.; Desai, Arshad

    2014-01-01

    Summary In most eukaryotes, centromeres are defined epigenetically by presence of the histone H3 variant CENP-A [1-3]. CENP-A containing chromatin recruits the constitutive centromere-associated network (CCAN) of proteins, which in turn directs assembly of the outer kinetochore to form microtubule attachments and ensure chromosome segregation fidelity [4-6]. While the mechanisms that load CENP-A at centromeres are being elucidated, the functions of its divergent N-terminal tail remain enigmatic [7-12]. Here, we employ the well-studied fission yeast centromere [13-16] to investigate the function of the CENP-A (Cnp1) N-tail. We show that alteration of the N-tail did not affect Cnp1 loading at centromeres, outer kinetochore formation, or spindle checkpoint signaling, but nevertheless elevated chromosome loss. N-Tail mutants exhibited synthetic lethality with an altered centromeric DNA sequence, with rare survivors harboring chromosomal fusions in which the altered centromere was epigenetically inactivated. Elevated centromere inactivation was also observed for N-tail mutants with unaltered centromeric DNA sequences. N-tail mutants specifically reduced localization of the CCAN proteins Cnp20/CENP-T and Mis6/CENP-I, but not Cnp3/CENP-C. Overexpression of Cnp20/CENP-T suppressed defects in an N-tail mutant, suggesting a link between reduced CENP-T recruitment and the observed centromere inactivation phenotype. Thus, the Cnp1 N-tail promotes epigenetic stability of centromeres in fission yeast, at least in part via recruitment of the CENP-T branch of the CCAN. PMID:25619765

  8. Budding yeast chromatin is dispersed in a crowded nucleoplasm in vivo

    PubMed Central

    Chen, Chen; Lim, Hong Hwa; Shi, Jian; Tamura, Sachiko; Maeshima, Kazuhiro; Surana, Uttam; Gan, Lu

    2016-01-01

    Chromatin organization has an important role in the regulation of eukaryotic systems. Although recent studies have refined the three-dimensional models of chromatin organization with high resolution at the genome sequence level, little is known about how the most fundamental units of chromatin—nucleosomes—are positioned in three dimensions in vivo. Here we use electron cryotomography to study chromatin organization in the budding yeast Saccharomyces cerevisiae. Direct visualization of yeast nuclear densities shows no evidence of 30-nm fibers. Aside from preribosomes and spindle microtubules, few nuclear structures are larger than a tetranucleosome. Yeast chromatin does not form compact structures in interphase or mitosis and is consistent with being in an “open” configuration that is conducive to high levels of transcription. From our study and those of others, we propose that yeast can regulate its transcription using local nucleosome–nucleosome associations. PMID:27605704

  9. Integrated analysis, transcriptome-lipidome, reveals the effects of INO-level (INO2 and INO4) on lipid metabolism in yeast.

    PubMed

    Chumnanpuen, Pramote; Nookaew, Intawat; Nielsen, Jens

    2013-10-16

    In the yeast Saccharomyces cerevisiae, genes containing UASINO sequences are regulated by the Ino2/Ino4 and Opi1 transcription factors, and this regulation controls lipid biosynthesis. The expression level of INO2 and INO4 genes (INO-level) at different nutrient limited conditions might lead to various responses in yeast lipid metabolism. In this study, we undertook a global study on how INO-levels (transcription level of INO2 and INO4) affect lipid metabolism in yeast and we also studied the effects of single and double deletions of the two INO-genes (deficient effect). Using 2 types of nutrient limitations (carbon and nitrogen) in chemostat cultures operated at a fixed specific growth rate of 0.1 h-1 and strains having different INO-level, we were able to see the effect on expression level of the genes involved in lipid biosynthesis and the fluxes towards the different lipid components. Through combined measurements of the transcriptome, metabolome, and lipidome it was possible to obtain a large dataset that could be used to identify how the INO-level controls lipid metabolism and also establish correlations between the different components. In this study, we undertook a global study on how INO-levels (transcription level of INO2 and INO4) affect lipid metabolism in yeast and we also studied the effects of single and double deletions of the two INO-genes (deficient effect). Using 2 types of nutrient limitations (carbon and nitrogen) in chemostat cultures operated at a fixed specific growth rate of 0.1 h-1 and strains having different INO-level, we were able to see the effect on expression level of the genes involved in lipid biosynthesis and the fluxes towards the different lipid components. Through combined measurements of the transcriptome, metabolome, and lipidome it was possible to obtain a large dataset that could be used to identify how the INO-level controls lipid metabolism and also establish correlations between the different components. Our analysis showed the strength of using a combination of transcriptome and lipidome analysis to illustrate the effect of INO-levels on phospholipid metabolism and based on our analysis we established a global regulatory map.

  10. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    PubMed

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  11. The SUD1 gene encodes a putative E3 ubiquitin ligase and is a positive regulator of 3-hydroxy-3-methylglutaryl coenzyme a reductase activity in Arabidopsis.

    PubMed

    Doblas, Verónica G; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M; Botella, Miguel A

    2013-02-01

    The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum-associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals.

  12. Bandoniozyma gen. nov., a Genus of Fermentative and Non-Fermentative Tremellaceous Yeast Species

    PubMed Central

    Landell, Melissa Fontes; Crestani, Juliana; Pagnocca, Fernando Carlos; Sette, Lara Durães; Passarini, Michel Rodrigo Zambrano; Rosa, Carlos Augusto; Brandão, Luciana R.; Pimenta, Raphael S.; Ribeiro, José Roberto; Garcia, Karina Marques; Lee, Ching-Fu; Suh, Sung-Oui; Péter, Gábor; Dlauchy, Dénes; Fell, Jack W.; Scorzetti, Gloria; Theelen, Bart; Vainstein, Marilene H.

    2012-01-01

    Background Independent surveys across the globe led to the proposal of a new basidiomycetous yeast genus within the Bulleromyces clade of the Tremellales, Bandoniozyma gen. nov., with seven new species. Methodology/Principal Findings The species were characterized by multiple methods, including the analysis of D1/D2 and ITS nucleotide sequences, and morphological and physiological/biochemical traits. Most species can ferment glucose, which is an unusual trait among basidiomycetous yeasts. Conclusions/Significance In this study we propose the new yeast genus Bandoniozyma, with seven species Bandoniozyma noutii sp. nov. (type species of genus; CBS 8364T  =  DBVPG 4489T), Bandoniozyma aquatica sp. nov. (UFMG-DH4.20T  =  CBS 12527T  =  ATCC MYA-4876T), Bandoniozyma complexa sp. nov. (CBS 11570T  =  ATCC MYA-4603T  =  MA28aT), Bandoniozyma fermentans sp. nov. (CBS 12399T  =  NU7M71T  =  BCRC 23267T), Bandoniozyma glucofermentans sp. nov. (CBS 10381T  =  NRRL Y-48076T  =  ATCC MYA-4760T  =  BG 02-7-15-015A-1-1T), Bandoniozyma tunnelae sp. nov. (CBS 8024T  =  DBVPG 7000T), and Bandoniozyma visegradensis sp. nov. (CBS 12505T  =  NRRL Y-48783T  =  NCAIM Y.01952T). PMID:23056233

  13. The SUD1 Gene Encodes a Putative E3 Ubiquitin Ligase and Is a Positive Regulator of 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase Activity in Arabidopsis[C][W

    PubMed Central

    Doblas, Verónica G.; Amorim-Silva, Vítor; Posé, David; Rosado, Abel; Esteban, Alicia; Arró, Montserrat; Azevedo, Herlander; Bombarely, Aureliano; Borsani, Omar; Valpuesta, Victoriano; Ferrer, Albert; Tavares, Rui M.; Botella, Miguel A.

    2013-01-01

    The 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) enzyme catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. In contrast with our extensive knowledge of the regulation of HMGR in yeast and animals, little is known about this process in plants. To identify regulatory components of the MVA pathway in plants, we performed a genetic screen for second-site suppressor mutations of the Arabidopsis thaliana highly drought-sensitive drought hypersensitive2 (dry2) mutant that shows decreased squalene epoxidase activity. We show that mutations in SUPPRESSOR OF DRY2 DEFECTS1 (SUD1) gene recover most developmental defects in dry2 through changes in HMGR activity. SUD1 encodes a putative E3 ubiquitin ligase that shows sequence and structural similarity to yeast Degradation of α factor (Doα10) and human TEB4, components of the endoplasmic reticulum–associated degradation C (ERAD-C) pathway. While in yeast and animals, the alternative ERAD-L/ERAD-M pathway regulates HMGR activity by controlling protein stability, SUD1 regulates HMGR activity without apparent changes in protein content. These results highlight similarities, as well as important mechanistic differences, among the components involved in HMGR regulation in plants, yeast, and animals. PMID:23404890

  14. Water quality and antifungal susceptibility of opportunistic yeast pathogens from rivers.

    PubMed

    Monapathi, M E; Bezuidenhout, C C; Rhode, O H J

    2017-03-01

    Yeasts from water sources have been associated with diseases ranging from superficial mucosal infections to life threatening diseases. The aim of this study was to determine the water quality as well as diversity and antifungal susceptibility of yeasts from two rivers. Yeast levels and physico-chemical parameter data were analyzed by principal component analysis to determine correlations between physico-chemical data and yeast levels. Yeast morphotypes were identified by biochemical tests and 26S rRNA gene sequencing. Disk diffusion antifungal susceptibility tests were conducted. Physico-chemical parameters of the water were within target water quality range (TWQR) for livestock farming. For irrigational use, total dissolved solids and nitrates were not within the TWQR. Yeast levels ranged between 27 ± 10 and 2,573 ± 306 cfu/L. Only non-pigmented, ascomycetous yeasts were isolated. Saccharomyces cerevisiae and Candida glabrata were most frequently isolated. Several other opportunistic pathogens were also isolated. A large number of isolates were resistant to azoles, especially fluconazole, but also to other antifungal classes. Candida species were resistant to almost all the antifungal classes. These water sources are used for recreation and religious as well as for watering livestock and irrigation. Of particular concern is the direct contact of individuals with opportunistic yeast, especially the immune-compromised. Resistance of these yeast species to antifungal agents is a further health concern.

  15. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  16. Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.

    PubMed

    James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

    2013-01-01

    In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain.

  17. Strain conformation controls the specificity of cross-species prion transmission in the yeast model.

    PubMed

    Grizel, Anastasia V; Rubel, Aleksandr A; Chernoff, Yury O

    2016-07-03

    Transmissible self-assembled fibrous cross-β polymer infectious proteins (prions) cause neurodegenerative diseases in mammals and control non-Mendelian heritable traits in yeast. Cross-species prion transmission is frequently impaired, due to sequence differences in prion-forming proteins. Recent studies of prion species barrier on the model of closely related yeast species show that colocalization of divergent proteins is not sufficient for the cross-species prion transmission, and that an identity of specific amino acid sequences and a type of prion conformational variant (strain) play a major role in the control of transmission specificity. In contrast, chemical compounds primarily influence transmission specificity via favoring certain strain conformations, while the species origin of the host cell has only a relatively minor input. Strain alterations may occur during cross-species prion conversion in some combinations. The model is discussed which suggests that different recipient proteins can acquire different spectra of prion strain conformations, which could be either compatible or incompatible with a particular donor strain.

  18. A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.

    PubMed Central

    Diffley, J F; Stillman, B

    1991-01-01

    ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919

  19. Candida utilis and Cyberlindnera (Pichia) jadinii: yeast relatives with expanding applications.

    PubMed

    Buerth, Christoph; Tielker, Denis; Ernst, Joachim F

    2016-08-01

    The yeast Candida utilis is used as a food additive and as a host for heterologous gene expression to produce various metabolites and proteins. Reliable protocols for intracellular production of recombinant proteins are available for C. utilis and have now been expanded to secrete proteins into the growth medium or to achieve surface display by linkage to a cell wall protein. A recombinant C. utilis strain was recently shown to induce oral tolerance in a mouse model of multiple sclerosis suggesting future applications in autoimmune therapy. Whole genome sequencing of C. utilis and its presumed parent Cyberlindnera (Pichia) jadinii demonstrated different ploidy but high sequence identity, consistent with identical recombinant technologies for both yeasts. C. jadinii was recently described as an antagonist to the important human fungal pathogen Candida albicans suggesting its use as a probiotic agent. The review summarizes the status of recombinant protein production in C. utilis, as well as current and future biotechnological and medical applications of C. utilis and C. jadinii.

  20. Isolation of Cryptococcus gattii from a Castanopsis argyrophylla tree hollow (Mai-Kaw), Chiang Mai, Thailand.

    PubMed

    Khayhan, Kantarawee; Hagen, Ferry; Norkaew, Treepradab; Puengchan, Tanpalang; Boekhout, Teun; Sriburee, Pojana

    2017-04-01

    The pathogenic yeast Cryptococcus gattii was isolated from a tree hollow of a Castanopsis argyrophylla King ex Hook.f. (Fagaceae) in Chiang Mai, Thailand. Molecular characterization with amplified fragment length polymorphism analysis and multi-locus sequence typing showed that this isolate belonged to genotype AFLP4/VGI representing C. gattii sensu stricto. Subsequent comparison of the environmental isolate with those from clinical samples from Thailand showed that they grouped closely together in a single cluster.

  1. Characterization of a novel yeast species Metschnikowia persimmonesis KCTC 12991BP (KIOM G15050 type strain) isolated from a medicinal plant, Korean persimmon calyx (Diospyros kaki Thumb).

    PubMed

    Kang, Young Min; Choi, Ji Eun; Komakech, Richard; Park, Jeong Hwan; Kim, Dae Wook; Cho, Kye Man; Kang, Seung Mi; Choi, Sang Haeng; Song, Kun Chul; Ryu, Chung Min; Lee, Keun Chul; Lee, Jung-Sook

    2017-11-10

    The yeast strain Metschnikowia persimmonesis Kang and Choi et al., sp. nov. [type strain KIOM_G15050 = Korean Collection for Type Cultures (KCTC) 12991BP] was isolated from the stalk of native persimmon cultivars (Diospyros kaki Thumb) obtained from different regions of South Korea and was characterized phenotypically, genetically, and physiologically. The isolate grew between 4 and 40 °C (optimum temperature: 24-28 °C), pH 3-8 (pH optimum = 6.0), and in 0-4% NaCl solution (with optimal growth in absence of NaCl). It also exhibited strong antibiotic and antimicrobial activities. Morphologically, cells were characterized by the presence of long, needle-shaped ascospores. Based on 18S ribosomal DNA gene sequence analysis, the new species was found to belong to the genus Metschnikowia as a sister clade of Metschnikowia fructicola. We therefore conclude that this yeast isolate from D. kaki is a new member of the genus Metschnikowia and propose the name M. persimmonesis sp. nov. This strain has been deposited in the KCTC for future reference. This discovery provides a basis for future research on M. persimmonesis sp. nov., including its possible contribution to the medicinal properties of the host persimmon plant.

  2. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  3. Indigenous Georgian Wine-Associated Yeasts and Grape Cultivars to Edit the Wine Quality in a Precision Oenology Perspective.

    PubMed

    Vigentini, Ileana; Maghradze, David; Petrozziello, Maurizio; Bonello, Federica; Mezzapelle, Vito; Valdetara, Federica; Failla, Osvaldo; Foschino, Roberto

    2016-01-01

    In Georgia, one of the most ancient vine-growing environment, the homemade production of wine is still very popular in every rural family and spontaneous fermentation of must, without addition of chemical preservatives, is the norm. The present work investigated the yeast biodiversity in five Georgian areas (Guria, Imereti, Kakheti, Kartli, Ratcha-Lechkhumi) sampling grapes and wines from 22 different native cultivars, in 26 vineyards and 19 family cellars. One hundred and eighty-two isolates were ascribed to 15 different species by PCR-ITS and RFLP, and partial sequencing of D1/D2 domain 26S rDNA gene. Metschnikowia pulcherrima (F' = 0.56, I' = 0.32), Hanseniaspora guilliermondii (F' = 0.49, I' = 0.27), and Cryptococcus flavescens (F' = 0.31, I' = 0.11) were the dominant yeasts found on grapes, whereas Saccharomyces cerevisiae showed the highest prevalence into wine samples. Seventy four isolates with fermentative potential were screened for oenological traits such as ethanol production, resistance to SO2, and acetic acid, glycerol and H2S production. Three yeast strains (Kluyveromyces marxianus UMY207, S. cerevisiae UMY255, Torulaspora delbrueckii UMY196) were selected and separately inoculated in vinifications experiments at a Georgian cellar. Musts were prepared from healthy grapes of local varieties, Goruli Mtsvane (white berry cultivar) and Saperavi (black berry cultivar). Physical (°Brix) and microbial analyses (plate counts) were performed to monitor the fermentative process. The isolation of indigenous S. cerevisiae yeasts beyond the inoculated strains indicated that a co-presence occurred during the vinification tests. Results from quantitative GC-FID analysis of volatile compounds revealed that the highest amount of fermentation flavors, such as 4-ethoxy-4-oxobutanoic acid (monoethyl succinate), 2-methylpropan-1-ol, ethyl 2-hydroxypropanoate, and 2-phenylethanol, were significantly more produced in fermentation conducted in Saperavi variety inoculated with K. marxianus, whereas other aromatic compounds like 3-methylbutyl acetate, ethyl hexanoate and dihydrofuran-2(3H)-one (γ- butyrolactone) showed a higher content in Goruli Mtsvane variety samples fermented by S. cerevisiae. The selected yeast strains have proved to be promising for enhancing the flavor potential in low aromatic Georgian cultivars. This work intends to be a knowledge contribution for a precision oenology toward the strategic concept of "one grape variety-one yeast".

  4. Potentiality of yeast Candida sp. SMN04 for degradation of cefdinir, a cephalosporin antibiotic: kinetics, enzyme analysis and biodegradation pathway.

    PubMed

    Selvi, A; Das, Devlina; Das, Nilanjana

    2015-01-01

    A new yeast strain isolated from the pharmaceutical wastewater was capable of utilizing cefdinir as a sole carbon source for their growth in mineral medium. The yeast was identified and named as Candida sp. SMN04 based on morphology and 18S-ITS-D1/D2/D3 rRNA sequence analysis. The interaction between factors pH (3.0-9.0), inoculum dosage (1-7%), time (1-11 day) and cefdinir concentration (50-450 mg/L) was studied using a Box-Behnken design. The factors were studied as a result of their effect on cell dry weight (R1; g/L), extended spectrum β-lactamase (ESBL) assay (R2; mm), P450 activity (R3; U/mL) and degradation (R4; %). Maximum values of R1, R2, R3 and R4 were obtained at central values of all the parameters. The isolated yeast strain efficiently degraded 84% of 250 mg L⁻¹ of cefdinir within 6 days with a half-life of 2.97 days and degradation rate constant of 0.2335 per day. Pseudo-first-order model efficiently described the process. Among the various enzymes tested, the order of activity at the end of Day 4 was noted to be: cytochrome P450 (1.76 ± 0.03) > NADPH reductase (1.51 ± 0.20) > manganese peroxidase and amylase (0.66 ± 0.15; 0.66 ± 0.70). Intermediates were successfully characterized by liquid chromatography-mass spectrometry. The opening of the β-lactam ring involving ESBL activity was considered as one of the major steps in the cefdinir degradation process. Fourier transform-infrared spectroscopy analysis showed the absence of spectral vibrations between 1766 and 1519 cm⁻¹ confirming the complete removal of lactam ring during cefdinir degradation. The results of the present study are promising for the use of isolated yeast Candida sp. SMN04 as a potential bioremediation agent.

  5. Crystal structure of yeast allantoicase reveals a repeated jelly roll motif.

    PubMed

    Leulliot, Nicolas; Quevillon-Cheruel, Sophie; Sorel, Isabelle; Graille, Marc; Meyer, Philippe; Liger, Dominique; Blondeau, Karine; Janin, Joël; van Tilbeurgh, Herman

    2004-05-28

    Allantoicase (EC 3.5.3.4) catalyzes the conversion of allantoate into ureidoglycolate and urea, one of the final steps in the degradation of purines to urea. The mechanism of most enzymes involved in this pathway, which has been known for a long time, is unknown. In this paper we describe the three-dimensional crystal structure of the yeast allantoicase determined at a resolution of 2.6 A by single anomalous diffraction. This constitutes the first structure for an enzyme of this pathway. The structure reveals a repeated jelly roll beta-sheet motif, also present in proteins of unrelated biochemical function. Allantoicase has a hexameric arrangement in the crystal (dimer of trimers). Analysis of the protein sequence against the structural data reveals the presence of two totally conserved surface patches, one on each jelly roll motif. The hexameric packing concentrates these patches into conserved pockets that probably constitute the active site.

  6. Yeast as a model system for mammalian seven-transmembrane segment receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jeansonne, N.E.

    1994-05-01

    Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomalmore » location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.« less

  7. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes.

    PubMed

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-07-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including "codon capture," "genome streamlining," and "ambiguous intermediate" theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNA(Ala) containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. © 2016 Mühlhausen et al.; Published by Cold Spring Harbor Laboratory Press.

  8. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    PubMed Central

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  9. Natranaerobaculum magadiense gen. nov., sp. nov., an anaerobic, alkalithermophilic bacterium from soda lake sediment.

    PubMed

    Zavarzina, Daria G; Zhilina, Tatyana N; Kuznetsov, Boris B; Kolganova, Tatyana V; Osipov, Georgy A; Kotelev, Mikhail S; Zavarzin, Georgy A

    2013-12-01

    An obligately alkaliphilic, anaerobic, thermo- and halotolerant, spore-forming bacterium was isolated from sediments of soda lake Magadi (Kenya) and designated strain Z-1001(T). Cells of strain Z-1001(T) were straight, Gram-positive rods, slowly motile. Strain Z-1001(T) was found to be an obligate anaerobe. It grew within a pH range from 7.5 to 10.7 with an optimum at 9.25-9.5 (at 40 °C), a temperature range from 20 to 57 °C with an optimum at 45-50 °C, and a NaCl concentration range from 0 to 1.55 M with an optimum at 1.2-1.4 M. Peptides, such as meat and yeast extracts, peptone and tryptone, were fermented by Z-1001(T). Carbohydrates did not support growth. With yeast extract as an electron donor, strain Z-1001(T) reduced S(2)O(3)(2-), NO(-)(3), AsO(3-)(4), Fe(III) citrate and anthraquinone-2,6-disulfonate (AQDS) as electron acceptors. The isolate was able to grow oligotrophically with a very small amount of yeast extract: 0.03 g l(-1). The main fatty acids were C16 : 0, C16 : 1ω7c, C18 : 0 and C18 : 1ω9. The DNA G+C content of the isolate was 35.6 mol%. 16S rRNA gene sequence analysis showed that strain Z-1001(T) is a member of family Natranaerobiaceae, clustering with the type strain of Natranaerobius thermophilus (95.8-96.0 % sequence similarity). On the basis of physiological and phylogenetic data it is proposed that strain Z-1001(T) ( = DSM 24923(T) = VKM B-2666(T)) represents a novel genus and species, Natranaerobaculum magadiense gen. nov., sp. nov.

  10. Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

    PubMed

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

  11. Microbial Diversity of a Camembert-Type Cheese Using Freeze-Dried Tibetan Kefir Coculture as Starter Culture by Culture-Dependent and Culture-Independent Methods

    PubMed Central

    Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

    2014-01-01

    The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese. PMID:25360757

  12. Multi-gene phylogenetic analysis reveals that shochu-fermenting Saccharomyces cerevisiae strains form a distinct sub-clade of the Japanese sake cluster.

    PubMed

    Futagami, Taiki; Kadooka, Chihiro; Ando, Yoshinori; Okutsu, Kayu; Yoshizaki, Yumiko; Setoguchi, Shinji; Takamine, Kazunori; Kawai, Mikihiko; Tamaki, Hisanori

    2017-10-01

    Shochu is a traditional Japanese distilled spirit. The formation of the distinguishing flavour of shochu produced in individual distilleries is attributed to putative indigenous yeast strains. In this study, we performed the first (to our knowledge) phylogenetic classification of shochu strains based on nucleotide gene sequences. We performed phylogenetic classification of 21 putative indigenous shochu yeast strains isolated from 11 distilleries. All of these strains were shown or confirmed to be Saccharomyces cerevisiae, sharing species identification with 34 known S. cerevisiae strains (including commonly used shochu, sake, ale, whisky, bakery, bioethanol and laboratory yeast strains and clinical isolate) that were tested in parallel. Our analysis used five genes that reflect genome-level phylogeny for the strain-level classification. In a first step, we demonstrated that partial regions of the ZAP1, THI7, PXL1, YRR1 and GLG1 genes were sufficient to reproduce previous sub-species classifications. In a second step, these five analysed regions from each of 25 strains (four commonly used shochu strains and the 21 putative indigenous shochu strains) were concatenated and used to generate a phylogenetic tree. Further analysis revealed that the putative indigenous shochu yeast strains form a monophyletic group that includes both the shochu yeasts and a subset of the sake group strains; this cluster is a sister group to other sake yeast strains, together comprising a sake-shochu group. Differences among shochu strains were small, suggesting that it may be possible to correlate subtle phenotypic differences among shochu flavours with specific differences in genome sequences. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  13. Diversity and adaptive evolution of Saccharomyces wine yeast: a review

    PubMed Central

    Marsit, Souhir; Dequin, Sylvie

    2015-01-01

    Saccharomyces cerevisiae and related species, the main workhorses of wine fermentation, have been exposed to stressful conditions for millennia, potentially resulting in adaptive differentiation. As a result, wine yeasts have recently attracted considerable interest for studying the evolutionary effects of domestication. The widespread use of whole-genome sequencing during the last decade has provided new insights into the biodiversity, population structure, phylogeography and evolutionary history of wine yeasts. Comparisons between S. cerevisiae isolates from various origins have indicated that a variety of mechanisms, including heterozygosity, nucleotide and structural variations, introgressions, horizontal gene transfer and hybridization, contribute to the genetic and phenotypic diversity of S. cerevisiae. This review will summarize the current knowledge on the diversity and evolutionary history of wine yeasts, focusing on the domestication fingerprints identified in these strains. PMID:26205244

  14. Repellency to ticks (Acari: Ixodidae) of extracts of nigella sativa L.(Ranunculaceae) and the anti-inflammatory DogsBestFriend™

    USDA-ARS?s Scientific Manuscript database

    Motivated by observations that the canine anti-inflammatory cream DogsBestFriend™ (DBF) appeared to deter flies, mosquitoes, and ticks from treated animals, repellent efficacy bioassays using four species of ticks were conducted with three extracts of Nigella sativa L. (Ranunculaceae), a constituent...

  15. Exploring Differential Bundle Functioning in Mathematics by Gender: The Effect of Hierarchical Modelling

    ERIC Educational Resources Information Center

    Ong, Yoke Mooi; Williams, Julian; Lamprianou, Iasonas

    2013-01-01

    Researchers interested in exploring substantive group differences are increasingly attending to bundles of items (or testlets): the aim is to understand how gender differences, for instance, are explained by differential performances on different types or bundles of items, hence differential bundle functioning (DBF). Some previous work has…

  16. The presence of a mycangium in European Sinodendron cylindricum (Coleoptera: Lucanidae) and the associated yeast symbionts

    PubMed Central

    Tanahashi, Masahiko; Hawes, Colin J.

    2016-01-01

    Part of the exoskeleton of some wood-inhabiting insects is modified to form a mycangium, which is a specialized organ used to convey fungal spores or yeasts to their offspring. Although most stag beetles (Coleoptera: Lucanidae) are known to have female-specific mycangia and associated yeast symbionts, the evolutionary origin of the mycangium in this group remains unresolved. Here, we report the presence of a mycangium and associated yeast symbionts in the European horned stag beetle Sinodendron cylindricum (L.), which belongs to an ancestral clade of the Lucanidae. The mycangium of S. cylindricum is shown to be female-specific and have the same developmental origin as that of other stag beetles. A total of five yeast strains were isolated from adult mycangia and larval gut of S. cylindricum. Of these, we suggest that SICYAM1 is an undescribed yeast with taxonomic novelty, and have identified SICYLG3 as the xylose-fermenting yeast Scheffersomyces insectosa using nuclear ribosomal RNA and ITS sequences. The remaining three yeast strains, SICYAM2, SICYLG1, and SICYLG2, were assigned to the genus Sugiyamaella. Yeast density in the adult mycangium was lower than that of the more evolutionarily advanced stag beetles, the European Lucanus cervus (L.) and Dorcus parallelipipedus (L.), which were also examined in this study. No living yeasts were isolated from the adult guts. However, a third instar larva of S. cylindricum harbored 104–106 living yeasts in each gut region, which suggests that gut yeasts play an important role in these wood-feeding larvae. PMID:27432353

  17. Aim44p regulates phosphorylation of Hof1p to promote contractile ring closure during cytokinesis in budding yeast

    PubMed Central

    Wolken, Dana M. Alessi; McInnes, Joseph; Pon, Liza A.

    2014-01-01

    Whereas actomyosin and septin ring organization and function in cytokinesis are thoroughly described, little is known regarding the mechanisms by which the actomyosin ring interacts with septins and associated proteins to coordinate cell division. Here we show that the protein product of YPL158C, Aim44p, undergoes septin-dependent recruitment to the site of cell division. Aim44p colocalizes with Myo1p, the type II myosin of the contractile ring, throughout most of the cell cycle. The Aim44p ring does not contract when the actomyosin ring closes. Instead, it forms a double ring that associates with septin rings on mother and daughter cells after cell separation. Deletion of AIM44 results in defects in contractile ring closure. Aim44p coimmunoprecipitates with Hof1p, a conserved F-BAR protein that binds both septins and type II myosins and promotes contractile ring closure. Deletion of AIM44 results in a delay in Hof1p phosphorylation and altered Hof1p localization. Finally, overexpression of Dbf2p, a kinase that phosphorylates Hof1p and is required for relocalization of Hof1p from septin rings to the contractile ring and for Hof1p-triggered contractile ring closure, rescues the cytokinesis defect observed in aim44∆ cells. Our studies reveal a novel role for Aim44p in regulating contractile ring closure through effects on Hof1p. PMID:24451263

  18. Genetic basis of priority effects: insights from nectar yeast

    PubMed Central

    Hartwig, Thomas

    2016-01-01

    Priority effects, in which the order of species arrival dictates community assembly, can have a major influence on species diversity, but the genetic basis of priority effects remains unknown. Here, we suggest that nitrogen scavenging genes previously considered responsible for starvation avoidance may drive priority effects by causing rapid resource depletion. Using single-molecule sequencing, we de novo assembled the genome of the nectar-colonizing yeast, Metschnikowia reukaufii, across eight scaffolds and complete mitochondrion, with gap-free coverage over gene spaces. We found a high rate of tandem gene duplication in this genome, enriched for nitrogen metabolism and transport. Both high-capacity amino acid importers, GAP1 and PUT4, present as tandem gene arrays, were highly expressed in synthetic nectar and regulated by the availability and quality of amino acids. In experiments with competitive nectar yeast, Candida rancensis, amino acid addition alleviated suppression of C. rancensis by early arrival of M. reukaufii, corroborating that amino acid scavenging may contribute to priority effects. Because niche pre-emption via rapid resource depletion may underlie priority effects in a broad range of microbial, plant and animal communities, nutrient scavenging genes like the ones we considered here may be broadly relevant to understanding priority effects. PMID:27708148

  19. Candida middelhoveniana sp. nov., a new yeast species found on the rhizoplane of organically cultivated sugarcane.

    PubMed

    Ribeiro, José R de A; Carvalho, Patrícia M B de; Cabral, Anderson de S; Macrae, Andrew; Mendonça-Hagler, Leda C S; Berbara, Ricardo L L; Hagler, Allen N

    2011-10-01

    A novel yeast species within the Metschnikowiaceae is described based on a strain from the sugarcane (Saccharum sp.) rhizoplane of an organically managed farm in Rio de Janeiro, Brazil. The D1/D2 domain of the large subunit ribosomal RNA gene sequence analysis showed that the closest related species were Candida tsuchiyae with 86.2% and Candida thailandica with 86.7% of sequence identity. All three are anamorphs in the Clavispora opuntiae clade. The name Candida middelhoveniana sp. nov. is proposed to accommodate this highly divergent organism with the type strain Instituto de Microbiologia, Universidade Federal do Rio de Janeiro (IMUFRJ) 51965(T) (=Centraalbureau voor Schimmelcultures (CBS) 12306(T), Universidade Federal de Minas Gerais (UFMG)-70(T), DBVPG 8031(T)) and the GenBank/EMBL/DDBJ accession number for the D1/D2 domain LSU rDNA sequence is FN428871. The Mycobank deposit number is MB 519801.

  20. Characterization of Zea mays endosperm C-24 sterol methyltransferase: one of two types of sterol methyltransferase in higher plants.

    PubMed

    Grebenok, R J; Galbraith, D W; Penna, D D

    1997-08-01

    We report the characterization of a higher-plant C-24 sterol methyltransferase by yeast complementation. A Zea mays endosperm expressed sequence tag (EST) was identified which, upon complete sequencing, showed 46% identity to the yeast C-24 methyltransferase gene (ERG6) and 75% and 37% amino acid identity to recently isolated higher-plant sterol methyltransferases from soybean and Arabidopsis, respectively. When placed under GALA regulation, the Z. mays cDNA functionally complemented the erg6 mutation, restoring ergosterol production and conferring resistance to cycloheximide. Complementation was both plasmid-dependent and galactose-inducible. The Z. mays cDNA clone contains an open reading frame encoding a 40 kDa protein containing motifs common to a large number of S-adenosyl-L-methionine methyltransferases (SMTs). Sequence comparisons and functional studies of the maize, soybean and Arabidopsis cDNAs indicates two types of C-24 SMTs exist in higher plants.

  1. Dual control by Cdk1 phosphorylation of the budding yeast APC/C ubiquitin ligase activator Cdh1.

    PubMed

    Höckner, Sebastian; Neumann-Arnold, Lea; Seufert, Wolfgang

    2016-07-15

    The antagonism between cyclin-dependent kinases (Cdks) and the ubiquitin ligase APC/C-Cdh1 is central to eukaryotic cell cycle control. APC/C-Cdh1 targets cyclin B and other regulatory proteins for degradation, whereas Cdks disable APC/C-Cdh1 through phosphorylation of the Cdh1 activator protein at multiple sites. Budding yeast Cdh1 carries nine Cdk phosphorylation sites in its N-terminal regulatory domain, most or all of which contribute to inhibition. However, the precise role of individual sites has remained unclear. Here, we report that the Cdk phosphorylation sites of yeast Cdh1 are organized into autonomous subgroups and act through separate mechanisms. Cdk sites 1-3 had no direct effect on the APC/C binding of Cdh1 but inactivated a bipartite nuclear localization sequence (NLS) and thereby controlled the partitioning of Cdh1 between cytoplasm and nucleus. In contrast, Cdk sites 4-9 did not influence the cell cycle-regulated localization of Cdh1 but prevented its binding to the APC/C. Cdk sites 4-9 reside near two recently identified APC/C interaction motifs in a pattern conserved with the human Cdh1 orthologue. Thus a Cdk-inhibited NLS goes along with Cdk-inhibited APC/C binding sites in yeast Cdh1 to relay the negative control by Cdk1 phosphorylation of the ubiquitin ligase APC/C-Cdh1. © 2016 Höckner et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  2. Aldehyde dehydrogenase, Ald4p, is a major component of mitochondrial fluorescent inclusion bodies in the yeast Saccharomyces cerevisiae

    PubMed Central

    Misonou, Yoshiko; Kikuchi, Maiko; Sato, Hiroshi; Inai, Tomomi; Kuroiwa, Tsuneyoshi; Tanaka, Kenji; Miyakawa, Isamu

    2014-01-01

    ABSTRACT When Saccharomyces cerevisiae strain 3626 was cultured to the stationary phase in a medium that contained glucose, needle-like structures that emitted autofluorescence were observed in almost all cells by fluorescence microscopy under UV excitation. The needle-like structures completely overlapped with the profile of straight elongated mitochondria. Therefore, these structures were designated as mitochondrial fluorescent inclusion bodies (MFIBs). The MFIB-enriched mitochondrial fractions were successfully isolated and 2D-gel electrophoresis revealed that a protein of 54 kDa was only highly concentrated in the fractions. Determination of the N-terminal amino acid sequence of the 54-kDa protein identified it as a mitochondrial aldehyde dehydrogenase, Ald4p. Immunofluorescence microscopy showed that anti-Ald4p antibody specifically stained MFIBs. Freeze-substitution electron microscopy demonstrated that cells that retained MFIBs had electron-dense filamentous structures with a diameter of 10 nm in straight elongated mitochondria. Immunoelectron microscopy showed that Ald4p was localized to the electron-dense filamentous structures in mitochondria. These results together showed that a major component of MFIBs is Ald4p. In addition, we demonstrate that MFIBs are common features that appear in mitochondria of many species of yeast. PMID:24771619

  3. The Effects of a Probiotic Yeast on the Bacterial Diversity and Population Structure in the Rumen of Cattle

    PubMed Central

    Pinloche, Eric; McEwan, Neil; Marden, Jean-Philippe; Bayourthe, Corinne; Auclair, Eric; Newbold, C. Jamie

    2013-01-01

    It has been suggested that the ability of live yeast to improve milk yield and weight gain in cattle is because the yeast stimulates bacterial activity within the rumen. However it remains unclear if this is a general stimulation of all species or a specific stimulation of certain species. Here we characterised the change in the bacterial population within the rumen of cattle fed supplemental live yeast. Three cannulated lactating cows received a daily ration (24 kg/d) of corn silage (61% of DM), concentrates (30% of DM), dehydrated alfalfa (9% of DM) and a minerals and vitamins mix (1% of DM). The effect of yeast (BIOSAF SC 47, Lesaffre Feed Additives, France; 0.5 or 5 g/d) was compared to a control (no additive) in a 3×3 Latin square design. The variation in the rumen bacterial community between treatments was assessed using Serial Analysis of V1 Ribosomal Sequence Tag (SARST-V1) and 454 pyrosequencing based on analysis of the 16S rRNA gene. Compared to the control diet supplementation of probiotic yeast maintained a healthy fermentation in the rumen of lactating cattle (higher VFA concentration [high yeast dose only], higher rumen pH, and lower Eh and lactate). These improvements were accompanied with a shift in the main fibrolytic group (Fibrobacter and Ruminococcus) and lactate utilising bacteria (Megasphaera and Selenomonas). In addition we have shown that the analysis of short V1 region of 16s rRNA gene (50–60 bp) could give as much phylogenetic information as a longer read (454 pyrosequencing of 250 bp). This study also highlights the difficulty of drawing conclusions on composition and diversity of complex microbiota because of the variation caused by the use of different methods (sequencing technology and/or analysis). PMID:23844101

  4. Global investigation of protein-protein interactions in yeast Saccharomyces cerevisiae using re-occurring short polypeptide sequences.

    PubMed

    Pitre, S; North, C; Alamgir, M; Jessulat, M; Chan, A; Luo, X; Green, J R; Dumontier, M; Dehne, F; Golshani, A

    2008-08-01

    Protein-protein interaction (PPI) maps provide insight into cellular biology and have received considerable attention in the post-genomic era. While large-scale experimental approaches have generated large collections of experimentally determined PPIs, technical limitations preclude certain PPIs from detection. Recently, we demonstrated that yeast PPIs can be computationally predicted using re-occurring short polypeptide sequences between known interacting protein pairs. However, the computational requirements and low specificity made this method unsuitable for large-scale investigations. Here, we report an improved approach, which exhibits a specificity of approximately 99.95% and executes 16,000 times faster. Importantly, we report the first all-to-all sequence-based computational screen of PPIs in yeast, Saccharomyces cerevisiae in which we identify 29,589 high confidence interactions of approximately 2 x 10(7) possible pairs. Of these, 14,438 PPIs have not been previously reported and may represent novel interactions. In particular, these results reveal a richer set of membrane protein interactions, not readily amenable to experimental investigations. From the novel PPIs, a novel putative protein complex comprised largely of membrane proteins was revealed. In addition, two novel gene functions were predicted and experimentally confirmed to affect the efficiency of non-homologous end-joining, providing further support for the usefulness of the identified PPIs in biological investigations.

  5. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts

    PubMed Central

    Langkjær, R. B.; Casaregola, S.; Ussery, D. W.; Gaillardin, C.; Piškur, J.

    2003-01-01

    The complete sequences of mitochondrial DNA (mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S.cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S.cerevisiae mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S.servazzii contain, in total, five +1 frameshifts. mtDNAs of S.castellii, S.servazzii and S.cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order is very different. Several gene rearrangements have taken place upon separation of the Saccharomyces lineages, and even a part of the transcription units have not been preserved. It seems that the mechanism(s) involved in the generation of the rearrangements has had to ensure that all genes stayed encoded by the same DNA strand. PMID:12799436

  6. De Novo Assembly of Candida sojae and Candida boidinii Genomes, Unexplored Xylose-Consuming Yeasts with Potential for Renewable Biochemical Production

    PubMed Central

    Borelli, Guilherme; José, Juliana; Teixeira, Paulo José Pereira Lima; dos Santos, Leandro Vieira

    2016-01-01

    Candida boidinii and Candida sojae yeasts were isolated from energy cane bagasse and plague-insects. Both have fast xylose uptake rate and produce great amounts of xylitol, which are interesting features for food and 2G ethanol industries. Because they lack published genomes, we have sequenced and assembled them, offering new possibilities for gene prospection. PMID:26769937

  7. Yeast syntaxins Sso1p and Sso2p belong to a family of related membrane proteins that function in vesicular transport.

    PubMed Central

    Aalto, M K; Ronne, H; Keränen, S

    1993-01-01

    The yeast SEC1 gene encodes a hydrophilic protein that functions at the terminal stage in secretion. We have cloned two yeast genes, SSO1 and SSO2, which in high copy number can suppress sec1 mutations and also mutations in several other late acting SEC genes, such as SEC3, SEC5, SEC9 and SEC15. SSO1 and SSO2 encode small proteins with N-terminal hydrophilic domains and C-terminal hydrophobic tails. The two proteins are 72% identical in sequence and together perform an essential function late in secretion. Sso1p and Sso2p show significant sequence similarity to six other proteins. Two of these, Sed5p and Pep12p, are yeast proteins that function in transport from ER to Golgi and from Golgi to the vacuole, respectively. Also related to Sso1p and Sso2p are three mammalian proteins: epimorphin, syntaxin A/HPC-1 and syntaxin B. A nematode cDNA product also belongs to the new protein family. The new protein family is thus present in a wide variety of eukaryotic cells, where its members function at different stages in vesicular transport. Images PMID:8223426

  8. The evolutionary history of Saccharomyces species inferred from completed mitochondrial genomes and revision in the ‘yeast mitochondrial genetic code’

    PubMed Central

    Szabóová, Dana; Bielik, Peter; Poláková, Silvia; Šoltys, Katarína; Jatzová, Katarína; Szemes, Tomáš

    2017-01-01

    Abstract The yeast Saccharomyces are widely used to test ecological and evolutionary hypotheses. A large number of nuclear genomic DNA sequences are available, but mitochondrial genomic data are insufficient. We completed mitochondrial DNA (mtDNA) sequencing from Illumina MiSeq reads for all Saccharomyces species. All are circularly mapped molecules decreasing in size with phylogenetic distance from Saccharomyces cerevisiae but with similar gene content including regulatory and selfish elements like origins of replication, introns, free-standing open reading frames or GC clusters. Their most profound feature is species-specific alteration in gene order. The genetic code slightly differs from well-established yeast mitochondrial code as GUG is used rarely as the translation start and CGA and CGC code for arginine. The multilocus phylogeny, inferred from mtDNA, does not correlate with the trees derived from nuclear genes. mtDNA data demonstrate that Saccharomyces cariocanus should be assigned as a separate species and Saccharomyces bayanus CBS 380T should not be considered as a distinct species due to mtDNA nearly identical to Saccharomyces uvarum mtDNA. Apparently, comparison of mtDNAs should not be neglected in genomic studies as it is an important tool to understand the origin and evolutionary history of some yeast species. PMID:28992063

  9. Yeast communities associated with artisanal mezcal fermentations from Agave salmiana.

    PubMed

    Verdugo Valdez, A; Segura Garcia, L; Kirchmayr, M; Ramírez Rodríguez, P; González Esquinca, A; Coria, R; Gschaedler Mathis, A

    2011-11-01

    The aims of this work were to characterize the fermentation process of mezcal from San Luis Potosi, México and identify the yeasts present in the fermentation using molecular culture-dependent methods (RFLP of the 5.8S-ITS and sequencing of the D1/D2 domain) and also by using a culture-independent method (DGGE). The alcoholic fermentations of two separate musts obtained from Agave salmiana were analyzed. Sugar, ethanol and major volatile compounds concentrations were higher in the first fermentation, which shows the importance of having a quality standard for raw materials, particularly in the concentration of fructans, in order to produce fermented Agave salmiana must with similar characteristics. One hundred ninety-two (192) different yeast colonies were identified, from those present on WL agar plates, by RFLP analysis of the ITS1-5.8S- ITS2 from the rRNA gene, with restriction endonucleases, HhaI, HaeIII and HinfI. The identified yeasts were: Saccharomyces cerevisiae, Kluyveromyces marxianus, Pichia kluyveri, Zygosaccharomyces bailii, Clavispora lusitaniae, Torulaspora delbrueckii, Candida ethanolica and Saccharomyces exiguus. These identifications were confirmed by sequencing the D1-D2 region of the 26S rRNA gene. With the PCR-DGGE method, bands corresponding to S. cerevisiae, K. marxianus and T. delbrueckii were clearly detected, confirming the results obtained with classic techniques.

  10. Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system.

    PubMed

    Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

    2006-01-01

    To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.

  11. Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system

    PubMed Central

    Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

    2006-01-01

    OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010

  12. Production of recombinant streptokinase from Streptococcus pyogenes isolate and its potential for thrombolytic therapy.

    PubMed

    Assiri, Abdullah S; El-Gamal, Basiouny A; Hafez, Elsayed E; Haidara, Mohamed A

    2014-12-01

    To produce an effective recombinant streptokinase (rSK) from pathogenic Streptococcus pyogenes isolate in yeast, and evaluate its potential for thrombolytic therapy. This study was conducted from November 2012 to December 2013 at King Khalid University, Abha, Kingdom of Saudi Arabia (KSA). Throat swabs collected from 45 pharyngitis patients in Asser Central Hospital, Abha, KSA were used to isolate Streptococcus pyogenes. The bacterial DNA was used for amplification of the streptokinase gene (1200 bp). The gene was cloned and in vitro transcribed in an eukaryotic expression vector that was transformed into yeast Pichia pastoris SMD1168, and the rSK protein was purified and tested for its thrombolytic activity. The Streptococcus pyogenes strain was isolated and its DNA nucleotide sequence revealed similarity to other Streptococcus pyogenes in the Gene bank. Sequencing of the amplified gene based on DNA nucleotide sequence revealed a SK gene closely related to other SK genes in the Gene bank. However, based on deduced amino acids sequence, the gene formed a separate cluster different from clusters formed by other examined genes, suggesting a new bacterial isolate and accordingly a new gene. The purified protein showed 82% clot lysis compared to a commercial SK (81%) at an enzyme concentration of 2000 U/ml. The present yeast rSK showed similar thrombolytic activity in vitro as that of a commercial SK, suggesting its potential for thrombolytic therapy and large scale production. 

  13. Structures of yeast Apa2 reveal catalytic insights into a canonical AP₄A phosphorylase of the histidine triad superfamily.

    PubMed

    Hou, Wen-Tao; Li, Wen-Zhe; Chen, Yuxing; Jiang, Yong-Liang; Zhou, Cong-Zhao

    2013-08-09

    The homeostasis of intracellular diadenosine 5',5″'-P(1),P(4)-tetraphosphate (Ap4A) in the yeast Saccharomyces cerevisiae is maintained by two 60% sequence-identical paralogs of Ap4A phosphorylases (Apa1 and Apa2). Enzymatic assays show that, compared to Apa1, Apa2 has a relatively higher phosphorylase activity towards Ap3A (5',5″'-P(1),P(3)-tetraphosphate), Ap4A, and Ap5A (5',5″'-P(1),P(5)-tetraphosphate), and Ap4A is the favorable substrate for both enzymes. To decipher the catalytic insights, we determined the crystal structures of Apa2 in the apo-, AMP-, and Ap4A-complexed forms at 2.30, 2.80, and 2.70Å resolution, respectively. Apa2 is an α/β protein with a core domain of a twisted eight-stranded antiparallel β-sheet flanked by several α-helices, similar to the galactose-1-phosphate uridylyltransferase (GalT) members of the histidine triad (HIT) superfamily. However, a unique auxiliary domain enables an individual Apa2 monomer to possess an intact substrate-binding cleft, which is distinct from previously reported dimeric GalT proteins. This cleft is perfectly complementary to the favorable substrate Ap4A, the AMP and ATP moieties of which are perpendicular to each other, leaving the α-phosphate group exposed at the sharp turn against the catalytic residue His161. Structural comparisons combined with site-directed mutagenesis and activity assays enable us to define the key residues for catalysis. Furthermore, multiple-sequence alignment reveals that Apa2 and homologs represent canonical Ap4A phosphorylases, which could be grouped as a unique branch in the GalT family. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. The Genetics of Non-conventional Wine Yeasts: Current Knowledge and Future Challenges

    PubMed Central

    Masneuf-Pomarede, Isabelle; Bely, Marina; Marullo, Philippe; Albertin, Warren

    2016-01-01

    Saccharomyces cerevisiae is by far the most widely used yeast in oenology. However, during the last decade, several other yeasts species has been purposed for winemaking as they could positively impact wine quality. Some of these non-conventional yeasts (Torulaspora delbrueckii, Metschnikowia pulcherrima, Pichia kluyveri, Lachancea thermotolerans, etc.) are now proposed as starters culture for winemakers in mixed fermentation with S. cerevisiae, and several others are the subject of various studies (Hanseniaspora uvarum, Starmerella bacillaris, etc.). Along with their biotechnological use, the knowledge of these non-conventional yeasts greatly increased these last 10 years. The aim of this review is to describe the last updates and the current state-of-art of the genetics of non-conventional yeasts (including S. uvarum, T. delbrueckii, S. bacillaris, etc.). We describe how genomics and genetics tools provide new data into the population structure and biodiversity of non-conventional yeasts in winemaking environments. Future challenges will lie on the development of selection programs and/or genetic improvement of these non-conventional species. We discuss how genetics, genomics and the advances in next-generation sequencing will help the wine industry to develop the biotechnological use of non-conventional yeasts to improve the quality and differentiation of wines. PMID:26793188

  15. Lager Yeast Comes of Age

    PubMed Central

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  16. Construction of the yeast whole-cell Rhizopus oryzae lipase biocatalyst with high activity.

    PubMed

    Chen, Mei-ling; Guo, Qin; Wang, Rui-zhi; Xu, Juan; Zhou, Chen-wei; Ruan, Hui; He, Guo-qing

    2011-07-01

    Surface display is effectively utilized to construct a whole-cell biocatalyst. Codon optimization has been proven to be effective in maximizing production of heterologous proteins in yeast. Here, the cDNA sequence of Rhizopus oryzae lipase (ROL) was optimized and synthesized according to the codon bias of Saccharomyces cerevisiae, and based on the Saccharomyces cerevisiae cell surface display system with α-agglutinin as an anchor, recombinant yeast displaying fully codon-optimized ROL with high activity was successfully constructed. Compared with the wild-type ROL-displaying yeast, the activity of the codon-optimized ROL yeast whole-cell biocatalyst (25 U/g dried cells) was 12.8-fold higher in a hydrolysis reaction using p-nitrophenyl palmitate (pNPP) as the substrate. To our knowledge, this was the first attempt to combine the techniques of yeast surface display and codon optimization for whole-cell biocatalyst construction. Consequently, the yeast whole-cell ROL biocatalyst was constructed with high activity. The optimum pH and temperature for the yeast whole-cell ROL biocatalyst were pH 7.0 and 40 °C. Furthermore, this whole-cell biocatalyst was applied to the hydrolysis of tributyrin and the resulted conversion of butyric acid reached 96.91% after 144 h.

  17. Yeast diversity associated to sediments and water from two Colombian artificial lakes

    PubMed Central

    Silva-Bedoya, L.M.; Ramírez-Castrillón, M.; Osorio-Cadavid, E.

    2014-01-01

    In Colombia, knowledge of the yeast and yeast-like fungi community is limited because most studies have focused on species with clinical importance. Sediments and water represent important habitats for the study of yeast diversity, especially for yeast species with industrial, biotechnological, and bioremediation potential. The main purpose of this study was to identify and compare the diversity of yeast species associated with sediment and water samples from two artificial lakes in Universidad del Valle (Cali-Colombia). Yeast samplings were performed from fifteen sediment samples and ten water samples. Grouping of similar isolates was initially based on colony and cell morphology, which was then complemented by micro/mini satellite primed PCR banding pattern analysis by using GTG5 as single primer. A representative isolate for each group established was chosen for D1/D2 domain sequencing and identification. In general, the following yeast species were identified: Candida albicans, Candida diversa, Candida glabrata, Candida pseudolambica, Cryptococcus podzolicus, Cryptococcus rajasthanensis, Cryptococcus laurentii, Williopsis saturnus, Hanseniaspora thailandica, Hanseniaspora uvarum, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, Torulaspora delbrueckii, Torulaspora pretoriensis, Tricosporon jirovecii, Trichosporon laibachii and Yarrowia lypolitica. Two possible new species were also found, belonging to the Issatchenkia sp. and Bullera sp. genera. In conclusion, the lakes at the Universidad del Valle campus have significant differences in yeast diversity and species composition between them. PMID:24948924

  18. Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

    PubMed Central

    Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

    1999-01-01

    Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

  19. Enhancement of the Initial Rate of Ethanol Fermentation Due to Dysfunction of Yeast Stress Response Components Msn2p and/or Msn4p▿ †

    PubMed Central

    Watanabe, Daisuke; Wu, Hong; Noguchi, Chiemi; Zhou, Yan; Akao, Takeshi; Shimoi, Hitoshi

    2011-01-01

    Sake yeasts (strains of Saccharomyces cerevisiae) produce high concentrations of ethanol in sake fermentation. To investigate the molecular mechanisms underlying this brewing property, we compared gene expression of sake and laboratory yeasts in sake mash. DNA microarray and reporter gene analyses revealed defects of sake yeasts in environmental stress responses mediated by transcription factors Msn2p and/or Msn4p (Msn2/4p) and stress response elements (STRE). Furthermore, we found that dysfunction of MSN2 and/or MSN4 contributes to the higher initial rate of ethanol fermentation in both sake and laboratory yeasts. These results provide novel insights into yeast stress responses as major impediments of effective ethanol fermentation. PMID:21131516

  20. Rewriting the blueprint of life by synthetic genomics and genome engineering.

    PubMed

    Annaluru, Narayana; Ramalingam, Sivaprakash; Chandrasegaran, Srinivasan

    2015-06-16

    Advances in DNA synthesis and assembly methods over the past decade have made it possible to construct genome-size fragments from oligonucleotides. Early work focused on synthesis of small viral genomes, followed by hierarchical synthesis of wild-type bacterial genomes and subsequently on transplantation of synthesized bacterial genomes into closely related recipient strains. More recently, a synthetic designer version of yeast Saccharomyces cerevisiae chromosome III has been generated, with numerous changes from the wild-type sequence without having an impact on cell fitness and phenotype, suggesting plasticity of the yeast genome. A project to generate the first synthetic yeast genome--the Sc2.0 Project--is currently underway.

  1. The Yeast Saccharomyces cerevisiae: a versatile model system for the identification and characterization of bacterial virulence proteins.

    PubMed

    Siggers, Keri A; Lesser, Cammie F

    2008-07-17

    Microbial pathogens utilize complex secretion systems to deliver proteins into host cells. These effector proteins target and usurp host cell processes to promote infection and cause disease. While secretion systems are conserved, each pathogen delivers its own unique set of effectors. The identification and characterization of these effector proteins has been difficult, often limited by the lack of detectable signal sequences and functional redundancy. Model systems including yeast, worms, flies, and fish are being used to circumvent these issues. This technical review details the versatility and utility of yeast Saccharomyces cerevisiae as a system to identify and characterize bacterial effectors.

  2. Mitochondrial Telomeres as Molecular Markers for Identification of the Opportunistic Yeast Pathogen Candida parapsilosis

    PubMed Central

    Nosek, Jozef; Tomáška, L'ubomír; Ryčovská, Adriana; Fukuhara, Hiroshi

    2002-01-01

    Recent studies have demonstrated that a large number of organisms carry linear mitochondrial DNA molecules possessing specialized telomeric structures at their ends. Based on this specific structural feature of linear mitochondrial genomes, we have developed an approach for identification of the opportunistic yeast pathogen Candida parapsilosis. The strategy for identification of C. parapsilosis strains is based on PCR amplification of specific DNA sequences derived from the mitochondrial telomere region. This assay is complemented by immunodetection of a protein component of mitochondrial telomeres. The results demonstrate that mitochondrial telomeres represent specific molecular markers with potential applications in yeast diagnostics and taxonomy. PMID:11923346

  3. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection

    PubMed Central

    Gelperin, Daniel M.; White, Michael A.; Wilkinson, Martha L.; Kon, Yoshiko; Kung, Li A.; Wise, Kevin J.; Lopez-Hoyo, Nelson; Jiang, Lixia; Piccirillo, Stacy; Yu, Haiyuan; Gerstein, Mark; Dumont, Mark E.; Phizicky, Eric M.; Snyder, Michael; Grayhack, Elizabeth J.

    2005-01-01

    Functional analysis of the proteome is an essential part of genomic research. To facilitate different proteomic approaches, a MORF (moveable ORF) library of 5854 yeast expression plasmids was constructed, each expressing a sequence-verified ORF as a C-terminal ORF fusion protein, under regulated control. Analysis of 5573 MORFs demonstrates that nearly all verified ORFs are expressed, suggests the authenticity of 48 ORFs characterized as dubious, and implicates specific processes including cytoskeletal organization and transcriptional control in growth inhibition caused by overexpression. Global analysis of glycosylated proteins identifies 109 new confirmed N-linked and 345 candidate glycoproteins, nearly doubling the known yeast glycome. PMID:16322557

  4. Molecular basis of CENP-C association with the CENP-A nucleosome at yeast centromeres

    PubMed Central

    Xiao, Hua; Wang, Feng; Wisniewski, Jan; Shaytan, Alexey K.; Ghirlando, Rodolfo; FitzGerald, Peter C.; Huang, Yingzi; Wei, Debbie; Li, Shipeng; Landsman, David; Panchenko, Anna R.; Wu, Carl

    2017-01-01

    Histone CENP-A-containing nucleosomes play an important role in nucleating kinetochores at centromeres for chromosome segregation. However, the molecular mechanisms by which CENP-A nucleosomes engage with kinetochore proteins are not well understood. Here, we report the finding of a new function for the budding yeast Cse4/CENP-A histone-fold domain interacting with inner kinetochore protein Mif2/CENP-C. Strikingly, we also discovered that AT-rich centromere DNA has an important role for Mif2 recruitment. Mif2 contacts one side of the nucleosome dyad, engaging with both Cse4 residues and AT-rich nucleosomal DNA. Both interactions are directed by a contiguous DNA- and histone-binding domain (DHBD) harboring the conserved CENP-C motif, an AT hook, and RK clusters (clusters enriched for arginine–lysine residues). Human CENP-C has two related DHBDs that bind preferentially to DNA sequences of higher AT content. Our findings suggest that a DNA composition-based mechanism together with residues characteristic for the CENP-A histone variant contribute to the specification of centromere identity. PMID:29074736

  5. Coupled Evolution of Transcription and mRNA Degradation

    PubMed Central

    Dori-Bachash, Mally; Shema, Efrat; Tirosh, Itay

    2011-01-01

    mRNA levels are determined by the balance between transcription and mRNA degradation, and while transcription has been extensively studied, very little is known regarding the regulation of mRNA degradation and its coordination with transcription. Here we examine the evolution of mRNA degradation rates between two closely related yeast species. Surprisingly, we find that around half of the evolutionary changes in mRNA degradation were coupled to transcriptional changes that exert opposite effects on mRNA levels. Analysis of mRNA degradation rates in an interspecific hybrid further suggests that opposite evolutionary changes in transcription and in mRNA degradation are mechanistically coupled and were generated by the same individual mutations. Coupled changes are associated with divergence of two complexes that were previously implicated both in transcription and in mRNA degradation (Rpb4/7 and Ccr4-Not), as well as with sequence divergence of transcription factor binding motifs. These results suggest that an opposite coupling between the regulation of transcription and that of mRNA degradation has shaped the evolution of gene regulation in yeast. PMID:21811398

  6. Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.

    PubMed

    Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A

    2018-01-01

    Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.

  7. Screening wild yeast strains for alcohol fermentation from various fruits.

    PubMed

    Lee, Yeon-Ju; Choi, Yu-Ri; Lee, So-Young; Park, Jong-Tae; Shim, Jae-Hoon; Park, Kwan-Hwa; Kim, Jung-Wan

    2011-03-01

    Wild yeasts on the surface of various fruits including grapes were surveyed to obtain yeast strains suitable for fermenting a novel wine with higher alcohol content and supplemented with rice starch. We considered selected characteristics, such as tolerance to alcohol and osmotic pressure, capability of utilizing maltose, and starch hydrolysis. Among 637 putative yeast isolates, 115 strains exhibiting better growth in yeast-peptone-dextrose broth containing 30% dextrose, 7% alcohol, or 2% maltose were selected, as well as five α-amylase producers. Nucleotide sequence analysis of the 26S rDNA gene classified the strains into 13 species belonging to five genera; Pichia anomala was the most prevalent (41.7%), followed by Wickerhamomyces anomalus (19.2%), P. guilliermondii (15%), Candida spp. (5.8%), Kodamaea ohmeri (2.5%), and Metschnikowia spp. (2.5%). All of the α-amylase producers were Aureobasidium pullulans. Only one isolate (NK28) was identified as Saccharomyces cerevisiae. NK28 had all of the desired properties for the purpose of this study, except α-amylase production, and fermented alcohol better than commercial wine yeasts.

  8. Candida uthaithanina sp. nov., an anamorphic yeast species in Nakaseomyces clade isolated in Thailand.

    PubMed

    Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Kaewwichian, Rungluk; Nitiyon, Sukanya; Yongmanitchai, Wichien; Nakase, Takashi

    2011-05-01

    Three yeast stains were isolated from two unknown fruits (strains DD2-22-1(T) and SK44) and moss (strain ST-449) in Thailand. Analysis of the D1/D2 domain of the large subunit (LSU) rRNA gene sequences of the three strains revealed that they belonged to the same species. In terms of pairwise sequence similarity, Candida cf. glabrata UWO(PS) 98-110.4 and Candida nivariensis were the closest undescribed and recognized taxa, but the levels of nucleotide substitutions were 1.7-1.9% and 2.0-2.2%, respectively. The levels of nucleotide substitutions were sufficient to justify the description of a separate species of Candida. In the phylogenetic tree based on the D1/D2 domain of the LSU rRNA gene the three strains were placed in a separate branch in the Nakaseomyces clade with C. cf. glabrata UWO(PS)98-110.4, C. nivariensis, Candida glabrata, Candida bracarensis, Candida kungkrabaensis and Nakaseomyces delphensis. Phenotypic characteristics of the three strains were similar which included proliferation by multilateral budding, absence of ascospores, arthrospores or ballistospores; negative for Diazonium blue B and urease tests. The major ubiquinone was Q-6. On the basis of the above findings, the three strains were assigned to a single novel species of Candida, for which the name Candida uthaithanina sp. nov is proposed. The type strain is DD2-22-1(T) (= BCC 29899(T) = NBRC 104876(T) = CBS 10932(T)).

  9. Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

    PubMed

    Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

    2018-05-24

    Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

  10. Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

    PubMed

    Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

    2003-07-04

    The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

  11. Distribution of tannin-'tolerant yeasts isolated from Miang, a traditional fermented tea leaf (Camellia sinensis var. assamica) in northern Thailand.

    PubMed

    Kanpiengjai, Apinun; Chui-Chai, Naradorn; Chaikaew, Siriporn; Khanongnuch, Chartchai

    2016-12-05

    Miang is a fermented food product prepared from the tea leaves of Camellia sinensis var. assamica, and is traditionally produced in mountainous areas of northern Thailand. Although Miang has a long history and reveals deep-rooted cultural involvement with local people in northern Thailand, little is known regarding its microbial diversity. Yeasts were isolated from 47 Miang samples collected from 28 sampling sites, including eight provinces in upper northern Thailand. A hundred and seven yeast isolates were recovered and identified within 14 species based on the comparison of the D1/D2 sequence of the large subunit (LSU) rRNA gene. Candida ethanolica was determined to be the dominant species that was frequently found in Miang together with minor resident yeast species. All yeast isolates demonstrated their tannin-tolerant capability when cultivated on yeast malt agar (YMA) containing 50g/l tannin, but nine isolates displayed clear zones forming around their colonies, e.g., Debaryomyces hansenii, Cyberlindnera rhodanensis, and Sporidiobolus ruineniae. The results obtained from a visual reading method of tannase revealed that all yeast isolates were positive for methyl gallate, indicating that they possess tannase activity. It is assumed that a tannin-tolerant ability is one of the most important factors for developing a yeast community in Miang. This research study is the first report to describe tannin-tolerant yeasts and yeast communities in traditionally fermented tea leaves. Copyright © 2016. Published by Elsevier B.V.

  12. The ecology of the Drosophila-yeast mutualism in wineries

    PubMed Central

    2018-01-01

    The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila. PMID:29768432

  13. The ecology of the Drosophila-yeast mutualism in wineries.

    PubMed

    Quan, Allison S; Eisen, Michael B

    2018-01-01

    The fruit fly, Drosophila melanogaster, is preferentially found on fermenting fruits. The yeasts that dominate the microbial communities of these substrates are the primary food source for developing D. melanogaster larvae, and adult flies manifest a strong olfactory system-mediated attraction for the volatile compounds produced by these yeasts during fermentation. Although most work on this interaction has focused on the standard laboratory yeast Saccharomyces cerevisiae, a wide variety of other yeasts naturally ferment fallen fruit. Here we address the open question of whether D. melanogaster preferentially associates with distinct yeasts in different, closely-related environments. We characterized the spatial and temporal dynamics of Drosophila-associated fungi in Northern California wineries that use organic grapes and natural fermentation using high-throughput, short-amplicon sequencing. We found that there is nonrandom structure in the fungal communities that are vectored by flies both between and within vineyards. Within wineries, the fungal communities associated with flies in cellars, fermentation tanks, and pomace piles are distinguished by varying abundances of a small number of yeast species. To investigate the origins of this structure, we assayed Drosophila attraction to, oviposition on, larval development in, and longevity when consuming the yeasts that distinguish vineyard microhabitats from each other. We found that wild fly lines did not respond differentially to the yeast species that distinguish winery habitats in habitat specific manner. Instead, this subset of yeast shares traits that make them attractive to and ensure their close association with Drosophila.

  14. Short peptides allowing preferential detection of Candida albicans hyphae.

    PubMed

    Kaba, Hani E J; Pölderl, Antonia; Bilitewski, Ursula

    2015-09-01

    Whereas the detection of pathogens via recognition of surface structures by specific antibodies and various types of antibody mimics is frequently described, the applicability of short linear peptides as sensor molecules or diagnostic tools is less well-known. We selected peptides which were previously reported to bind to recombinant S. cerevisiae cells, expressing members of the C. albicans Agglutinin-Like-Sequence (ALS) cell wall protein family. We slightly modified amino acid sequences to evaluate peptide sequence properties influencing binding to C. albicans cells. Among the selected peptides, decamer peptides with an "AP"-N-terminus were superior to shorter peptides. The new decamer peptide FBP4 stained viable C. albicans cells more efficiently in their mature hyphal form than in their yeast form. Moreover, it allowed distinction of C. albicans from other related Candida spp. and could thus be the basis for the development of a useful tool for the diagnosis of invasive candidiasis.

  15. Relationships between net primary productivity and stand age for several forest types and their influence on China's carbon balance.

    PubMed

    Wang, Shaoqiang; Zhou, Lei; Chen, Jingming; Ju, Weimin; Feng, Xianfeng; Wu, Weixing

    2011-06-01

    Affected by natural and anthropogenic disturbances such as forest fires, insect-induced mortality and harvesting, forest stand age plays an important role in determining the distribution of carbon pools and fluxes in a variety of forest ecosystems. An improved understanding of the relationship between net primary productivity (NPP) and stand age (i.e., age-related increase and decline in forest productivity) is essential for the simulation and prediction of the global carbon cycle at annual, decadal, centurial, or even longer temporal scales. In this paper, we developed functions describing the relationship between national mean NPP and stand age using stand age information derived from forest inventory data and NPP simulated by the BEPS (Boreal Ecosystem Productivity Simulator) model in 2001. Due to differences in ecobiophysical characteristics of different forest types, NPP-age equations were developed for five typical forest ecosystems in China (deciduous needleleaf forest (DNF), evergreen needleleaf forest in tropic and subtropical zones (ENF-S), deciduous broadleaf forest (DBF), evergreen broadleaf forest (EBF), and mixed broadleaf forest (MBF)). For DNF, ENF-S, EBF, and MBF, changes in NPP with age were well fitted with a common non-linear function, with R(2) values equal to 0.90, 0.75, 0.66, and 0.67, respectively. In contrast, a second order polynomial was best suitable for simulating the change of NPP for DBF, with an R(2) value of 0.79. The timing and magnitude of the maximum NPP varied with forest types. DNF, EBF, and MBF reached the peak NPP at the age of 54, 40, and 32 years, respectively, while the NPP of ENF-S maximizes at the age of 13 years. The highest NPP of DBF appeared at 122 years. NPP was generally lower in older stands with the exception of DBF, and this particular finding runs counter to the paradigm of age-related decline in forest growth. Evaluation based on measurements of NPP and stand age at the plot-level demonstrates the reliability and applicability of the fitted NPP-age relationships. These relationships were used to replace the normalized NPP-age relationship used in the original InTEC (Integrated Terrestrial Ecosystem Carbon) model, to improve the accuracy of estimated carbon balance for China's forest ecosystems. With the revised NPP-age relationship, the InTEC model simulated a larger carbon source from 1950-1980 and a larger carbon sink from 1985-2001 for China's forests than the original InTEC model did because of the modification to the age-related carbon dynamics in forests. This finding confirms the importance of considering the dynamics of NPP related to forest age in estimating regional and global terrestrial carbon budgets. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  17. Excess electron is trapped in a large single molecular cage C60F60.

    PubMed

    Wang, Yin-Feng; Li, Zhi-Ru; Wu, Di; Sun, Chia-Chung; Gu, Feng-Long

    2010-01-15

    A new kind of solvated electron systems, sphere-shaped e(-)@C60F60 (I(h)) and capsule-shaped e(-)@C60F60 (D6h), in contrast to the endohedral complex M@C60, is represented at the B3LYP/6-31G(d) + dBF (diffusive basis functions) density functional theory. It is proven, by examining the singly occupied molecular orbital (SOMO) and the spin density map of e(-)@C60F60, that the excess electron is indeed encapsulated inside the C60F60 cage. The shape of the electron cloud in SOMO matches with the shape of C60F60 cage. These cage-like single molecular solvated electrons have considerably large vertical electron detachment energies VDE of 4.95 (I(h)) and 4.67 eV (D6h) at B3LYP/6-31+G(3df) + dBF level compared to the VDE of 3.2 eV for an electron in bulk water (Coe et al., Int Rev Phys Chem 2001, 20, 33) and that of 3.66 eV for e(-)@C20F20 (Irikura, J Phys Chem A 2008, 112, 983), which shows their higher stability. The VDE of the sphere-shaped e(-)@C60F60 (I(h)) is greater than that of the capsule-shaped e(-)@C60F60 (D6h), indicating that the excess electron prefers to reside in the cage with the higher symmetry to form the more stable solvated electron. It is also noticed that the cage size [7.994 (I(h)), 5.714 and 9.978 A (D6h) in diameter] is much larger than that (2.826 A) of (H2O)20- dodecahedral cluster (Khan, Chem Phys Lett 2005, 401, 85). Copyright 2009 Wiley Periodicals, Inc.

  18. Characterization of aromatic residue-controlled protein retention in the endoplasmic reticulum of Saccharomyces cerevisiae.

    PubMed

    Mei, Meng; Zhai, Chao; Li, Xinzhi; Zhou, Yu; Peng, Wenfang; Ma, Lixin; Wang, Qinhong; Iverson, Brent L; Zhang, Guimin; Yi, Li

    2017-12-15

    An endoplasmic reticulum (ER) retention sequence (ERS) is a characteristic short sequence that mediates protein retention in the ER of eukaryotic cells. However, little is known about the detailed molecular mechanism involved in ERS-mediated protein ER retention. Using a new surface display-based fluorescence technique that effectively quantifies ERS-promoted protein ER retention within Saccharomyces cerevisiae cells, we performed comprehensive ERS analyses. We found that the length, type of amino acid residue, and additional residues at positions -5 and -6 of the C-terminal HDEL motif all determined the retention of ERS in the yeast ER. Moreover, the biochemical results guided by structure simulation revealed that aromatic residues (Phe-54, Trp-56, and other aromatic residues facing the ER lumen) in both the ERS (at positions -6 and -4) and its receptor, Erd2, jointly determined their interaction with each other. Our studies also revealed that this aromatic residue interaction might lead to the discriminative recognition of HDEL or KDEL as ERS in yeast or human cells, respectively. Our findings expand the understanding of ERS-mediated residence of proteins in the ER and may guide future research into protein folding, modification, and translocation affected by ER retention. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Description of Kuraishia piskuri f.a., sp. nov., a new methanol assimilating yeast and transfer of phylogenetically related Candida species to the genera Kuraishia and Nakazawaea as new combinations

    USDA-ARS?s Scientific Manuscript database

    The new anamorphic yeast Kuraishia piskuri, f.a., sp. nov. is described for three strains that were isolated from insect frass from trees growing in Florida, USA (type strain, NRRL YB-2544, CBS 13714). Species placement was based on phylogenetic analysis of nuclear gene sequences for the D1/D2 domai...

  20. De Novo Assembly of Candida sojae and Candida boidinii Genomes, Unexplored Xylose-Consuming Yeasts with Potential for Renewable Biochemical Production.

    PubMed

    Borelli, Guilherme; José, Juliana; Teixeira, Paulo José Pereira Lima; Dos Santos, Leandro Vieira; Pereira, Gonçalo Amarante Guimarães

    2016-01-14

    Candida boidinii and Candida sojae yeasts were isolated from energy cane bagasse and plague-insects. Both have fast xylose uptake rate and produce great amounts of xylitol, which are interesting features for food and 2G ethanol industries. Because they lack published genomes, we have sequenced and assembled them, offering new possibilities for gene prospection. Copyright © 2016 Borelli et al.

Top