Science.gov

Sample records for yeast identification system

  1. Evaluation of Automated Yeast Identification System

    NASA Technical Reports Server (NTRS)

    McGinnis, M. R.

    1996-01-01

    One hundred and nine teleomorphic and anamorphic yeast isolates representing approximately 30 taxa were used to evaluate the accuracy of the Biolog yeast identification system. Isolates derived from nomenclatural types, environmental, and clinica isolates of known identity were tested in the Biolog system. Of the isolates tested, 81 were in the Biolog database. The system correctly identified 40, incorrectly identified 29, and was unable to identify 12. Of the 28 isolates not in the database, 18 were given names, whereas 10 were not. The Biolog yeast identification system is inadequate for the identification of yeasts originating from the environment during space program activities.

  2. Evaluation of Fungichrom 1: a new yeast identification system.

    PubMed

    Umabala, P; Satheeshkumar, T; Lakshmi, V

    2002-01-01

    Advances in anti-fungal therapy necessitate the need for accurate identification of fungi especially yeasts to their species level for more effective management. Unlike the time consuming conventional methods of yeast identification using fermentation and assimilation patterns of various carbohydrates, the new commercialized yeast identification systems are simpler, rapid and are particularly easy to interpret. In our study, a new colorimetric yeast identification system-Fungichrom 1(International microbio, Signes, France) was evaluated against the conventional method to identify 50 clinical isolates of yeasts belonging to the genera -Candida, Cryptococcus, Geotrichum. 96% agreement was found between the two methods.

  3. Rapid identification of Candida dubliniensis with commercial yeast identification systems.

    PubMed

    Pincus, D H; Coleman, D C; Pruitt, W R; Padhye, A A; Salkin, I F; Geimer, M; Bassel, A; Sullivan, D J; Clarke, M; Hearn, V

    1999-11-01

    Candida dubliniensis is a newly described species that is closely related phylogenetically to Candida albicans and that is commonly associated with oral candidiasis in human immunodeficiency virus-positive patients. Several recent studies have attempted to elucidate phenotypic and genotypic characteristics of use in separating the two species. However, results obtained with simple phenotypic tests were too variable and tests that provided more definitive data were too complex for routine use in the clinical laboratory setting. The objective of this study was to determine if reproducible identification of C. dubliniensis could be obtained with commercial identification kits. The substrate reactivity profiles of 80 C. dubliniensis isolates were obtained by using the API 20C AUX, ID 32 C, RapID Yeast Plus, VITEK YBC, and VITEK 2 ID-YST systems. The percentages of C. dubliniensis isolates capable of assimilating or hydrolyzing each substrate were compared with the percentages from the C. albicans profiles in each kit's database, and the results were expressed as percent C. dubliniensis and percent C. albicans. Any substrate that showed >50% difference in reactivity was considered useful in differentiating the species. In addition, assimilation of methyl-alpha-D-glucoside (MDG), D-trehalose (TRE), and D-xylose (XYL) by the same isolates was investigated by the traditional procedure of Wickerham and Burton (L. J. Wickerham and K. A. Burton, J. Bacteriol. 56:363-371, 1948). At 48 h (the time recommended by the manufacturer for its new database), we found that the assimilation of four carbohydrates in the API 20C AUX system could be used to distinguish the species, i.e., glycerol (GLY; 88 and 14%), XYL (0 and 88%), MDG (0 and 85%), and TRE (15 and 97%). Similarly, results with the ID 32 C system at 48 h showed that XYL (0 and 98%), MDG (0 and 98%), lactate (LAT; 0 and 96%), and TRE (30 and 96%) could be used to separate the two species. Phosphatase (PHS; 9 and 76%) and

  4. Evaluation of the VITEK 2 System for Rapid Identification of Yeasts and Yeast-Like Organisms

    PubMed Central

    Graf, Barbara; Adam, Thomas; Zill, Edith; Göbel, Ulf B.

    2000-01-01

    The new VITEK 2 system is a fully automated system dedicated to the identification and susceptibility testing of microorganisms. In conjunction with the VITEK ID-YST card the VITEK 2 system allows the identification of clinically important yeasts and yeast-like organisms in 15 h due to a sensitive fluorescence-based technology. The ID-YST card consists of 47 biochemical reactions. The database comprises 51 taxa, including newly described species. In this study we evaluated the reliability of the VITEK ID-YST card for the identification of yeasts and yeast-like organisms encountered in a clinical microbiology laboratory. A total of 241 strains representing 21 species were studied. The strains were isolated from clinical samples within a period of 60 days prior to the identification. The tests were performed using 24-h to 55-h subcultures on Sabouraud-gentamicin-chloramphenicol agar. Each strain was tested in parallel using the ID 32C strip as a comparison method combined with microscopic morphology and an agglutination test for C. krusei. Overall, 222 strains (92.1%) were unequivocally identified including 11 isolates (4.6%) identified with low discrimination resolved by simple additional tests. Ten strains (4.1%) for which results were given with low discrimination could not be unequivocally identified with supplemental tests, 4 strains (1.7%) were misidentified and 5 strains (2.1%) could not be identified. In conclusion, we found that the VITEK 2 system is a rapid and accurate method for the identification of medically important yeasts and yeast-like organisms. PMID:10790099

  5. Comparative Evaluation of the BD Phoenix Yeast ID Panel and Remel RapID Yeast Plus System for Yeast Identification.

    PubMed

    Grant, Michelle L; Parajuli, Shobha; Deleon-Gonsalves, Raquel; Potula, Raghava; Truant, Allan L

    2016-01-01

    Becton Dickinson Phoenix Yeast ID Panel was compared to the Remel RapID Yeast Plus System using 150 recent clinical yeast isolates and the API 20C AUX system to resolve discrepant results. The concordance rate between the Yeast ID Panel and the RapID Yeast Plus System (without arbitration) was 93.3% with 97.3% (146/150) and 95.3% (143/150) of the isolates correctly identified by the Becton Dickinson Phoenix and the Remel RapID, respectively, with arbitration.

  6. Comparative Evaluation of the BD Phoenix Yeast ID Panel and Remel RapID Yeast Plus System for Yeast Identification

    PubMed Central

    Grant, Michelle L.; Parajuli, Shobha; Deleon-Gonsalves, Raquel; Potula, Raghava; Truant, Allan L.

    2016-01-01

    Becton Dickinson Phoenix Yeast ID Panel was compared to the Remel RapID Yeast Plus System using 150 recent clinical yeast isolates and the API 20C AUX system to resolve discrepant results. The concordance rate between the Yeast ID Panel and the RapID Yeast Plus System (without arbitration) was 93.3% with 97.3% (146/150) and 95.3% (143/150) of the isolates correctly identified by the Becton Dickinson Phoenix and the Remel RapID, respectively, with arbitration. PMID:27366167

  7. Evaluation of the Biolog system for the identification of food and beverage yeasts.

    PubMed

    Praphailong, W; Van Gestel, M; Fleet, G H; Heard, G M

    1997-06-01

    The inconvenience of conventional yeast identification methods has resulted in the development of rapid, commercial systems, mainly for clinical yeast species. The Biolog system (Biolog Inc., Hayward, CA, USA) is a new semi-automated, computer-linked technology for rapid identification of clinical and non-clinical yeasts. The system is based around a microtitre tray and includes assimilation and oxidation tests. This paper evaluates the Biolog system for the identification of 21 species (72 strains) of yeasts of food and wine origin. Species correctly identified included Saccharomyces cerevisiae, Debaryomyces hansenii, Yarrowia lipolytica, Kluyveromyces marxianus, Kloeckera apiculata, Dekkera bruxellensis and Schizosaccharomyces pombe. Zygosaccharomyces bailii and Zygosaccharomyces rouxii were identified correctly 50% of the time and Pichia membranaefaciens 20% of the time.

  8. Clinical evaluation of the Uni-Yeast-Tek system for rapid presumptive identification of medically important yeasts.

    PubMed

    Cooper, B H; Johnson, J B; Thaxton, E S

    1978-04-01

    The results of over 400 tests for identification of clinical yeast isolates as to species using the Uni-Yeast-Tek (UYT) system in comparison with a more conventional system are reported. The conventional system utilized a total of 23 individual tests, including both fermentation and assimilation tests, whereas the UYT system included only 11 separate tests. In the initial phase of the study, coded unknown isolates were evaluated by each of two technologists using both methods independently. After this initial evaluation, the two methods were used in parallel for routine testing of yeast isolates as they were obtained from clinical specimens. A further evaluation of the UYT system was carried out by retrospectively analyzing the species reported from a clinical mycology laboratory during two separate time periods in which different approaches to yeast identification were employed. A total of 92% of the isolates tested with the UYT system were correctly reported within 72 h, 96% were correctly named after 1 week of incubation, and 97% were correctly reported after 2 weeks of incubation of UYT plates at 30 degrees C when results of the two phases of the study were analyzed together. With the conventional system, 88% of the isolates were correctly reported at 72 h, 96% at 1 week, and 98% after 2 weeks of incubation of biochemical tests. Retrospective analysis of laboratory records revealed no major changes in species reported after adoption of the UYT system for routine testing of clinical isolates. The data presented in this report suggest that the UYT system can be expected to yield rapid presumptive identification of clinical yeast isolates with reasonable confidence when certain minor limitations that are discussed in the text are taken into account.

  9. Comparison of RapID Yeast Plus System with API 20C System for Identification of Common, New, and Emerging Yeast Pathogens

    PubMed Central

    Espinel-Ingroff, A.; Stockman, L.; Roberts, G.; Pincus, D.; Pollack, J.; Marler, J.

    1998-01-01

    The ability to identify yeast isolates by the new enzymatic RapID Yeast Plus System was compared to the ability to identify yeast isolates by the API 20C system. A total of 447 yeast isolates representing Blastoschizomyces capitatus, 17 Candida spp., 5 Cryptococcus spp., Geotrichum spp., 2 Hanseniaspora spp., Hansenula anomala, Hansenula wingei, 3 Rhodotorula spp., Saccharomyces cerevisiae, Sporobolomyces salmonicolor, Trichosporon beigelii, and 2 Prototheca spp. were evaluated. Also, five quality control strains (Candida spp. and Cryptococcus laurentii) with well-documented reactivities by the RapID Yeast Plus System were used. Each isolate was evaluated by both methods with a 48-h culture grown at 30°C on Sabouraud dextrose agar (Emmons modification) by following the recommendations of the manufacturers. The RapID Yeast Plus System enzymatic reactions were read after 4 h of incubation, and the API 20C carbohydrate assimilation identification profiles were obtained after 72 h of incubation. There was good (95.7%) agreement between the identifications obtained by the two methods with the eight common Candida spp. and with Cryptococcus neoformans. The agreement was lower when the emerging Candida spp. and other yeast-like pathogens were tested (79.1 and 75.2%, respectively). These preliminary data suggest the potential utility of the RapID Yeast Plus System for use in the clinical laboratory for the rapid identification of common yeast pathogens as well as certain new and emerging species. PMID:9542903

  10. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens.

    PubMed

    Espinel-Ingroff, A; Stockman, L; Roberts, G; Pincus, D; Pollack, J; Marler, J

    1998-04-01

    The ability to identify yeast isolates by the new enzymatic RapID Yeast Plus System was compared to the ability to identify yeast isolates by the API 20C system. A total of 447 yeast isolates representing Blastoschizomyces capitatus, 17 Candida spp., 5 Cryptococcus spp., Geotrichum spp., 2 Hanseniaspora spp., Hansenula anomala, Hansenula wingei, 3 Rhodotorula spp., Saccharomyces cerevisiae, Sporobolomyces salmonicolor, Trichosporon beigelii, and 2 Prototheca spp. were evaluated. Also, five quality control strains (Candida spp. and Cryptococcus laurentii) with well-documented reactivities by the RapID Yeast Plus System were used. Each isolate was evaluated by both methods with a 48-h culture grown at 30 degrees C on Sabouraud dextrose agar (Emmons modification) by following the recommendations of the manufacturers. The RapID Yeast Plus System enzymatic reactions were read after 4 h of incubation, and the API 20C carbohydrate assimilation identification profiles were obtained after 72 h of incubation. There was good (95.7%) agreement between the identifications obtained by the two methods with the eight common Candida spp. and with Cryptococcus neoformans. The agreement was lower when the emerging Candida spp. and other yeast-like pathogens were tested (79.1 and 75.2%, respectively). These preliminary data suggest the potential utility of the RapID Yeast Plus System for use in the clinical laboratory for the rapid identification of common yeast pathogens as well as certain new and emerging species.

  11. Comparison of Enzymatic Method Rapid Yeast Plus System with RFLP-PCR for Identification of Isolated Yeast from Vulvovaginal Candidiasis

    PubMed Central

    Hossein, Moallaei; Mirhendi, Seied Hossein; Brandão, João; Mirdashti, Reza; Rosado, Laura

    2011-01-01

    Objective(s) To compare two identification methods, i.e., restriction fragment length polymorphism (RFLP)-PCR analysis and enzymatic method Rapid TM Yeast Plus System to identify different species causing vulvovaginal candidiasis (VVC). Materials and Methods Vaginal discharges of women who had attended the gynecology outpatient clinic of Mobini Hospital in Sabzevar, Iran were collected using cotton swabs and were cultured on Sabouraud dextrose agar. Isolated yeasts were identified by germ-tube testing and Rapid TM Yeast Plus System (Remel USA). For molecular identification, the isolated DNA was amplified with ITS1 and ITS4 universal primers and PCR products digested with the enzyme HpaІІ followed by agarose gel electrophoresis. Epidemiological and clinical features of women with respect to identified species were also evaluated. Results Out of 231 subjects enrolled, 62 VVC cases were detected. The isolated species were identified as follows: Candida albicans, 24 (38.7%), C. glabrata, 15 (24.2%), C. kefyr, 13 (21.0%) C. krusei, 9 (14.5%), and Saccharomyces cerevisiae, 1 (1.6%) by RFLP-PCR method; whereas findings by Rapid TM Yeast Plus System were C. albicans, 24 (38.7%), C. glabrata, 5 (8%), C. kefyr, 11 (17.7%) C. krusei, 2 (3.2%), S. cerevisiae, 9 (14.5%), and C. tropicalis, 6 (9.6%) as well as other nonpathogenic yeasts, 4 (6.9%). Conclusion Statistical comparison showed that there is no significant difference in identification of C. albicans by the two methods; although, in this study, it was not true about other species of yeasts. A correlation between clinical and laboratory findings is important as it enables us to administer an appropriate treatment on time. PMID:23493663

  12. Evaluation of a new system for the rapid identification of clinically important yeasts.

    PubMed Central

    Segal, E; Ajello, L

    1976-01-01

    The rapid system developed by Huppert et al. (1975) for the identification of yeasts based on assimilation and fermentation patterns and on germ tube and pseudohyphal production was evaluated in a comparative study with conventional procedures. The 95 test cultures were members of the genera Candida, Cryptococcus, Rhodotorula, Saccharomyces, Torulopsis, and Trichosporon. The study revealed that approximately 94% of the isolates were correctly identified by the rapid method in comparison with the standard method. With the rapid method identification was accomplished in 72h, and with the conventional procedures identification was completed in 2 weeks. Although it was difficult with some isolates to obtain definitive speciation by the rapid method, this method promises to be especially useful in clinical laboratories for the identification of yeasts of medical importance. Modifications were made in the procedure of Huppert et al. (1975) to improve the reading of reactions. Commercial media and a disk dispenser to make the method more useful were also investigated. PMID:965478

  13. [Identification of yeast-like fungi: evaluation of 4 commercial systems].

    PubMed

    Russolo, S; Sala, A; Crotti, D

    1984-12-01

    Four different commercial systems were compared to identify 110 medically important yeast-like fungi found out in as many pathologic materials in three Medical Centers. The systems were: a) API 20C Aux (Ayerst), which represented the reference method in conjunction with the germ-tube test, aggregates 19 carbohydrate substrates for assimilation reactions; b) Uni-Yeast Tek (Flow) and Mycotube (Roche) were used to indicate assimilation and fermentation of 7 carbohydrate substrates and to determine other biochemical tests; c) Candida-Check (Poli) was based on agglutination reaction by specific antisera. Comparative testing of the methods provided correct identifications for 99.1% by API 20C Aux, 95.4% by Candida-Check, 89.1% by Mycotube, 88.2% by Uni-Yeast Tek. The good concordance of the methods and their optimal manuality, rapidity, and economy suggest a wider diffusion in microbiological laboratories.

  14. Evaluation of the Biolog MicroStation system for yeast identification

    NASA Technical Reports Server (NTRS)

    McGinnis, M. R.; Molina, T. C.; Pierson, D. L.; Mishra, S. K.

    1996-01-01

    One hundred and fifty-nine isolates representing 16 genera and 53 species of yeasts were processed with the Biolog MicroStation System for yeast identification. Thirteen genera and 38 species were included in the Biolog database. For these 129 isolates, correct identifications to the species level were 13.2, 39.5 and 48.8% after 24, 48 and 72 hours incubation at 30 degrees C, respectively. Three genera and 15 species which were not included in the Biolog database were also tested. Of the 30 isolates studied, 16.7, 53.3 and 56.7% of the isolates were given incorrect names from the system's database after 24,48 and 72 h incubation at 30 degrees C, respectively. The remaining isolates of this group were not identified.

  15. Comparison of the rapid yeast plus panel with the API20C yeast system for identification of clinically significant isolates of Candida species.

    PubMed

    Heelan, J S; Sotomayor, E; Coon, K; D'Arezzo, J B

    1998-05-01

    The RapID Yeast Plus system (Innovative Diagnostic Systems, Norcross, Ga.) is a qualitative micromethod employing conventional tests and single-substrate chromogenic tests and having a 4-h incubation period. This system was compared with the API20C (bioMerieux Vitek, Hazelwood, Mo.) system, a 24- to 72-h carbohydrate assimilation method. One hundred thirty-three clinical yeast isolates, including 57 of Candida albicans, 26 of Candida tropicalis, 23 of Candida glabrata, and 27 of other yeasts, were tested by both methods. When discrepancies occurred, isolates were further tested by the Automated Yeast Biochemical Card (bioMerieux Vitek). Germ tube production and microscopic morphology were used as needed to definitively identify yeast isolates. The RapID Yeast Plus system correctly identified 125 yeast isolates, with an overall accuracy of 94% (125 of 133). Excellent correlation was found in the recognition of the three yeasts most commonly isolated from human sources. The test was 99% (105 of 106 isolates) accurate with C. albicans, C. tropicalis, and C. glabrata. The RapID Yeast Plus system compares favorably with the API20C system and provides a simple, accurate alternative to conventional assimilation methods for the rapid identification of the most commonly encountered isolates of Candida species.

  16. Comparison of the Rapid Yeast Plus Panel with the API20C Yeast System for Identification of Clinically Significant Isolates of Candida Species

    PubMed Central

    Heelan, Judith S.; Sotomayor, Edgar; Coon, Kimberly; D’Arezzo, Julia B.

    1998-01-01

    The RapID Yeast Plus system (Innovative Diagnostic Systems, Norcross, Ga.) is a qualitative micromethod employing conventional tests and single-substrate chromogenic tests and having a 4-h incubation period. This system was compared with the API20C (bioMerieux Vitek, Hazelwood, Mo.) system, a 24- to 72-h carbohydrate assimilation method. One hundred thirty-three clinical yeast isolates, including 57 of Candida albicans, 26 of Candida tropicalis, 23 of Candida glabrata, and 27 of other yeasts, were tested by both methods. When discrepancies occurred, isolates were further tested by the Automated Yeast Biochemical Card (bioMerieux Vitek). Germ tube production and microscopic morphology were used as needed to definitively identify yeast isolates. The RapID Yeast Plus system correctly identified 125 yeast isolates, with an overall accuracy of 94% (125 of 133). Excellent correlation was found in the recognition of the three yeasts most commonly isolated from human sources. The test was 99% (105 of 106 isolates) accurate with C. albicans, C. tropicalis, and C. glabrata. The RapID Yeast Plus system compares favorably with the API20C system and provides a simple, accurate alternative to conventional assimilation methods for the rapid identification of the most commonly encountered isolates of Candida species. PMID:9574727

  17. Evaluation of the API 20C yeast identification system for the differentiation of some dematiaceous fungi.

    PubMed Central

    Espinel-Ingroff, A; McGinnis, M R; Pincus, D H; Goldson, P R; Kerkering, T M

    1989-01-01

    Ninety-seven isolates of Cladosporium spp., Exophiala spp., Fonsecaea spp., Lecythophora hoffmannii, Phaeoannellomyces werneckii, Phialophora spp., Wangiella dermatitidis, and Xylohypha bantiana were used to evaluate the API 20C Yeast Identification System for the differentiation of dematiaceous fungi. Using the API 20C system, we were able to distinguish most species of Phialophora and Cladosporium and to separate L. hoffmannii from the species of Phialophora tested; X. bantiana from C. carrionii, C. resinae, and C. sphaerospermum; and W. dermatitidis from Exophiala jeanselmei and Exophiala spinifera. Ninety-two (60.1%) of 153 possible species-pair combinations were separated. PMID:2808678

  18. Comparative performance of Fungichrom I, Candifast and API 20C Aux systems in the identification of clinically significant yeasts.

    PubMed

    Gündeş, S G; Gulenc, S; Bingol, R

    2001-12-01

    To compare the performance of current chromogenic yeast identification methods, three commercial systems (API 20C Aux, Fungichrom I and Candifast) were evaluated in parallel, along with conventional tests to identify yeasts commonly isolated in this clinical microbiology laboratory. In all, 116 clinical isolates, (68 Candida albicans, 12 C. parapsilosis, 12 C. glabrata and 24 other yeasts) were tested. Germ-tube production, microscopical morphology and other conventional methods were used as standards to definitively identify yeast isolates. The percentage of isolates identified correctly varied between 82.7% and 95.6%. Overall, the performance obtained with Fungichrom I was highest with 95.6% identification (111 of 116 isolates). The performance of API 20C Aux was higher with 87% (101 of 116 isolates) than that of Candifast with 82.7% (96 of 116). The Fungichrom I method was found to be rapid, as 90% of strains were identified after incubation for 24 h at 30 degrees C. Both of the chromogenic yeast identification systems provided a simple, accurate alternative to API 20C Aux and conventional assimilation methods for the rapid identification of most commonly encountered isolates of Candida spp. Fungichrom seemed to be the most appropriate system for use in a clinical microbiology laboratory, due to its good performance with regard to sensitivity, ease of use and reading, rapidity and the cost per test.

  19. Auxacolor, a new commercial system for yeast identification: evaluation of 182 strains comparatively with ID 32C.

    PubMed

    Fricker-Hidalgo, H; Lebeau, B; Kervroedan, P; Faure, O; Ambroise-Thomas, P; Grillot, R

    1995-01-01

    The incidence of deep candidiasis, particularly in immunocompromised patients, and the emergence of less sensitive yeast species to new antifungal agents explain the interest of their rapid identification. A new identification system, Auxacolor (Sanofi Diagnostics Pasteur), has been evaluated, comparatively to ID 32C strip taken in reference (bioMérieux SA). These systems include respectively 13 and 29 carbohydrate assimilation tests. One hundred and sixty-nine strains belonging to 17 common yeast species isolated from biological specimens were identified. Moreover, 13 strains belonging to seven species rarely isolated and not included in the Auxacolor data base were tested. Correct biochemical profiles were obtained with 95.2% of the strains from the first panel. These profiles alone permit correct identification of 62.7% of them (n = 106). The remainders (Candida glabrata, Candida krusei, Candida guilliermondii, Candida inconspicua and Candida lipolytica) require time consuming additional morphological observations for a definitive identification. However, the time needed to obtain the biochemical profiles of these 106 strains was shorter when using Auxacolor: 77.4% of the strains were identified at 24 h with Auxacolor and 47.1% were identified at 24 h with ID 32C. Species from the second panel were not identified (seven strains) or incorrectly identified (six strains). The Auxacolor system was found to be reliable when performed in conjunction with morphological tests and easy to use for the identification of most medically important yeasts.

  20. Identification of yeasts present in sour fermented foods and fodders.

    PubMed

    Middelhoven, Wouter J

    2002-07-01

    This paper deals with rapid methods for identification of 50 yeast species frequently isolated from foods and fodders that underwent a lactic acid fermentation. However, many yeast species present in olive brine, alpechin, and other olive products were not treated. The methods required for identification include light microscopy, physiological growth tests (ID32C system of BioMérieux), assimilation of nitrate and of ethylamine as sole nitrogen sources, vitamin requirement, and maximum growth temperature. An identification key to treated yeast species is provided. In another table characteristics of all yeast species treated are listed.

  1. [Evaluation of common commercial systems for the identification of yeast isolates in microbiology laboratories: a multicenter study].

    PubMed

    Karabıçak, Nilgün; Uludağ Altun, Hatice; Karatuna, Onur; Hazırolan, Gülşen; Aksu, Neriman; Adiloğlu, Ali; Akyar, Işın

    2015-04-01

    Accurate and rapid identification of yeast isolates have become important in recent years for not only antifungal susceptibility testing due to the species-specific clinical resistance breakpoints but also early initiation of appropriate antifungal therapy. In clinical microbiology laboratories species identification of yeasts is often performed with several commercial systems based on biochemical properties and rarely according to the physiological and morphological characteristics. The aim of this study was to compare the two common commercial systems, VITEK 2 YST ID Card (Vitek; bioMérieux, France) and API 20C AUX (API; bioMérieux, France) with conventional mycological methods. A total of 473 clinical yeast strains isolated from clinical specimens in different university and training/research hospitals and identified by Vitek system were included in the study. The isolates were re-identified with API and conventional methods including morphological identification in the Mycology Reference Laboratory of the Public Health Institute of Turkey. Candida dubliniensis MYA 583, Candida krusei ATCC 6258, Candida parapsilosis ATCC 22019, Candida albicans ATCC 10231 and Cryptococcus neoformans ATCC 32268 were used as quality control strains and those standard strains were studied consecutively 10 days with both of the methods. The results of identification by Vitek and API were compared with the results of conventional methods for those 473 yeast isolates [6 genus (Candida, Cryptococcus, Blastoshizomyces, Rhodotorula, Saccharomyces, Trichosporon), 17 species (5 common and 12 rarely isolated)]. The performances of the systems were better (Vitek: 95%; API: 96%) for the commonly detected species (C.albicans, C.parapsilosis, C.glabrata, C.tropicalis and C.krusei) than those for rarely detected species (Vitek: 78.4%; API: 71.6%) (p= 0.155). Misidentification or unidentification were mostly detected for C.parapsilosis (Vitek: 6/87; API: 7/87) and C.glabrata (Vitek: 9/104; API

  2. Comparative study on the identification of food-borne yeasts.

    PubMed Central

    Török, T; King, A D

    1991-01-01

    Morphologically distinct yeast colonies from partially and fully processed fruits and vegetables were isolated over a 3-year period. Identification of 239 strains was achieved by using standard methods, commercial identification kits (API 20C and API YEAST-IDENT), and a simplified system for food-borne yeasts. The identified strains of fruit origin represented 36 species belonging to 19 genera. Among strains of vegetable origin, 34 species representing 17 genera were identified. The simplified identification system and the conventional method provided the same results in 80% of the cases. The commercial identification kits were easy to use but were not appropriate for food-borne yeast species. Computer-assisted identification was helpful. PMID:2059042

  3. Yeast identification in the clinical microbiology laboratory: phenotypical methods.

    PubMed

    Freydiere, A M; Guinet, R; Boiron, P

    2001-02-01

    Emerging yeast pathogens are favoured by increasing numbers of immunocompromised patients and by certain current medical practices. These yeasts differ in their antifungal drug susceptibilities, and rapid species identification is imperative. A large variety of methods have been developed with the aim of facilitating rapid, accurate yeast identification. Significant recent commercial introductions have included species-specific direct enzymatic colour tests, differential chromogenic isolation plates, direct immunological tests, and enhanced manual and automated biochemical and enzymatic panels. Chromogenic isolation media demonstrate better detection rates of yeasts in mixed cultures than traditional media, and allow the direct identification of Candida albicans by means of colony colour. Comparative evaluation of rapid methods for C. albicans identification, including the germ tube test, shows that chromogenic media may be economically advantageous. Accurate tests for single species include the Bichrolatex Albicans and Krusei Color tests, both immunologically based, as well as the Remel Rapid Trehalose Assimilation Broth for C. glabrata. Among broad-spectrum tests, the RapID Yeast Plus system gives same-day identification of clinical yeasts, but performance depends on inoculum density and geographic isolate source. The API 20 C AUX system is considered a reference method, but newer systems such as Auxacolor and Fungichrom are as accurate and are more convenient. Among automated systems, the ID 32 C strip, the Vitek Yeast Biochemical Card and the Vitek 2 ID-YST system correctly identify >93% of common yeasts, but the ID-YST is the most accurate with uncommon yeasts, including C. dubliniensis. Spectroscopic methods such as Fourier transformed-infrared spectroscopy offer potential advantages for the future. Overall, the advantages of rapid yeast identification methods include relative simplicity and low cost. For all rapid methods, meticulous, standardized

  4. [Comparison of Phoenix™ Yeast ID Panel and API® ID 32C commercial systems for the identification of Candida species isolated from clinical samples].

    PubMed

    Gayibova, Ülkü; Dalyan Cılo, Burcu; Ağca, Harun; Ener, Beyza

    2014-07-01

    Opportunistic fungal pathogens are one of the important causes of nosocomial infections, and several different types of yeasts, especially Candida species are increasingly recovered from immunocompromised patients. Since many of the yeasts are resistant to the commonly used antifungal agents, the introduction of appropriate therapy depends on rapid and accurate identification. The aims of this study were to compare the commercial identification systems namely API® ID 32C (bioMerieux, France) and Phoenix™ Yeast ID Panel (Becton Dickinson Diagnostics, USA) for the identification of Candida species and to evaluate the effect of morphological findings in the identification process. A total of 211 yeast strains isolated from different clinical samples (111 urine, 34 blood/vascular catheter, 27 upper/lower respiratory tract, 16 abscess/pus, 13 throat/vagina swabs and 10 sterile body fluids) of 137 patients hospitalized in Uludag University Health and Research Center between October 2013 to January 2014, were included in the study. Samples were cultured on blood agar, chromogenic agar (CHROMagar Candida, BD, USA) and Saboraud's dextrose agar (SDA), and isolated yeast colonies were evaluated with germ tube test and morphological examination by microscopy on cornmeal/Tween-80 agar. The isolates were identified as well by two commercial systems according to the manufacturers' recommendations. Discrepant results between the systems were tried to be resolved by using morphological characteristics of the yeasts. Of the isolates 159 were identified identical by both of the systems, and the concordance between those systems were estimated as 75.4%. According to the concordant identification, the most frequently isolated species was C.albicans (44.1%) followed by C.tropicalis (9.9%), C.glabrata (9.5%), C.parapsilosis (8.5%) and C.kefyr (8.1%). The concordance rate was 81.7% in identification of frequently isolated species (C.albicans, C.tropicalis, C.parapsilosis, C.glabrata, C

  5. Identification of Novel ErbB3-Interacting Factors Using the Split-Ubiquitin Membrane Yeast Two-Hybrid System

    PubMed Central

    Thaminy, Safia; Auerbach, Daniel; Arnoldo, Anthony; Stagljar, Igor

    2003-01-01

    Analysis of membrane protein interactions is difficult because of the hydrophobic nature of these proteins, which often renders conventional biochemical and genetic assays fruitless. This is a substantial problem because proteins that are integral or associated with membranes represent approximately one-third of all proteins in a typical eukaryotic cell. We have shown previously that the modified split-ubiquitin system can be used as a genetic assay for the in vivo detection of interactions between the two characterized yeast transmembrane proteins, Ost1p and Wbp1p. This so-called split-ubiquitin membrane yeast two-hybrid (YTH) system uses the split-ubiquitin approach in which reconstitution of two ubiquitin halves is mediated by a protein–protein interaction. Here we converted the split-ubiquitin membrane YTH system into a generally applicable in vivo screening approach to identify interacting partners of a particular mammalian transmembrane protein. We have demonstrated the effectiveness of this approach by using the mammalian ErbB3 receptor as bait and have identified three previously unknown ErbB3-interacting proteins. In addition, we have confirmed one of the newly found interactions between ErbB3 and the membrane-associated RGS4 protein by coimmunoprecipitating the two proteins from human cells. We expect the split-ubiquitin membrane YTH technology to be valuable for the identification of potential interacting partners of integral membrane proteins from many model organisms. PMID:12840049

  6. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    PubMed

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  7. Yeast killer systems.

    PubMed Central

    Magliani, W; Conti, S; Gerloni, M; Bertolotti, D; Polonelli, L

    1997-01-01

    The killer phenomenon in yeasts has been revealed to be a multicentric model for molecular biologists, virologists, phytopathologists, epidemiologists, industrial and medical microbiologists, mycologists, and pharmacologists. The surprisingly widespread occurrence of the killer phenomenon among taxonomically unrelated microorganisms, including prokaryotic and eukaryotic pathogens, has engendered a new interest in its biological significance as well as its theoretical and practical applications. The search for therapeutic opportunities by using yeast killer systems has conceptually opened new avenues for the prevention and control of life-threatening fungal diseases through the idiotypic network that is apparently exploited by the immune system in the course of natural infections. In this review, the biology, ecology, epidemiology, therapeutics, serology, and idiotypy of yeast killer systems are discussed. PMID:9227858

  8. Evaluation of the BD Phoenix system for identification of a wide spectrum of clinically important yeast species: a comparison with Vitek 2-YST.

    PubMed

    Won, Eun Jeong; Shin, Jong Hee; Kim, Mi-Na; Choi, Min Ji; Joo, Min Young; Kee, Seung Jung; Shin, Myung Geun; Suh, Soon Pal; Ryang, Dong Wook

    2014-08-01

    The Phoenix Yeast ID and Vitek 2-YST panels were compared using 351 molecularly identified yeast isolates. The Phoenix showed a comparable rate of correct identification for 4 common (Phoenix, 98%; Vitek, 94%) and 45 uncommon species (Phoenix, 70%; Vitek, 64%) and had a shorter mean identification time (6-7 h).

  9. Establishment of a transgenic yeast screening system for estrogenicity and identification of the anti-estrogenic activity of malachite green.

    PubMed

    Jiao, Baowei; Yeung, Eric K C; Chan, Chi Bun; Cheng, Christopher H K

    2008-12-15

    Endocrine disruptors refer to chemical compounds in the environment which interfere with the endocrine systems of organisms. Among them, environmental estrogens pose serious problems to aquatic organisms, in particular fish. It is therefore important and necessary to have a fast and low-cost system to screen the large number of different chemical compounds in the aquatic environment for their potential endocrine disrupting actions. In this study, a screening platform was developed to detect xenoestrogens in the aquatic environment using the fission yeast Schizosaccharomyces pombe, and applied for compound screening. The aim was to demonstrate any significant potential differences between the fish screening system and the human screening system. To this end, a yeast expression vector harboring a fish estrogen receptor alpha and a reporter vector containing the estrogen responsive element fused with the Escherichia coli LacZ gene were constructed. After transformation with these two vectors, the transformed yeast clones were confirmed by Western blotting and selected on the basis of the beta-galactosidase activity. In this transgenic yeast system, the natural estrogen (estradiol) and other known xenoestrogens such as diethylstilbestrol, bisphenol A, genistein and dichloro-diphenyl-trichloroethane exhibited dose-dependent activities. Using this system, more than 40 putative endocrine disruptors including phytoestrogens, pesticides, herbicides, industrial dyes and other industrial chemicals were screened. Ten of them were demonstrated to exhibit estrogenic actions. Industrial dyes such as malachite green (MG) that disrupt thyroid hormone synthesis are extensively used and are widely distributed in the aquatic environment. Using this system, MG did not show any estrogenic action, but was demonstrated to exhibit anti-estrogenic activity.

  10. Further modifications of the auxanographic method for identification of yeasts.

    PubMed Central

    Mickelsen, P A; McCarthy, L R; Propst, M A

    1977-01-01

    A modified auxanographic carbohydrate assimilation procedure for the identification of medically important yeasts is described. This method employs a heavy inoculum of unstarved yeasts, autoclaved yeast assimilation medium, pour plates of shallow depth, and commercially available carbohydrate-impregnated disks. The accuracy of this procedure was established in a comparison with the Wickerham broth method. PMID:853120

  11. Further modifications of the auxanographic method for identification of yeasts.

    PubMed

    Mickelsen, P A; McCarthy, L R; Propst, M A

    1977-03-01

    A modified auxanographic carbohydrate assimilation procedure for the identification of medically important yeasts is described. This method employs a heavy inoculum of unstarved yeasts, autoclaved yeast assimilation medium, pour plates of shallow depth, and commercially available carbohydrate-impregnated disks. The accuracy of this procedure was established in a comparison with the Wickerham broth method.

  12. Evaluation of the new Micronaut-Candida system compared to the API ID32C method for yeast identification.

    PubMed

    Szabó, Z; Tóth, B; Kovács, M; Kardos, G; Maráz, A; Rozgonyi, F; Majoros, L

    2008-05-01

    A new system, Micronaut-Candida, was compared to API ID32C to identify 264 yeast (Candida albicans, C. parapsilosis, C. tropicalis, C. krusei, C. inconspicua, C. norvegensis, C. lusitaniae, C. guilliermondii, C. dubliniensis, C. pulcherrima, C. famata, C. rugosa, C. glabrata, C. kefyr, C. lipolytica, C. catenulata, C. neoformans, Geotrichum and Trichosporon species, Rhodotorula glutinis, and Saccharomyces cerevisiae) clinical isolates. Results were in concordance in 244 cases. Eighteen out of the 20 of discordant results were correctly identified by Micronaut-Candida but not by API ID32C, as confirmed by PCR ribotyping.

  13. Identification of amelotin- and ODAM-interacting enamel matrix proteins using the yeast two-hybrid system.

    PubMed

    Holcroft, James; Ganss, Bernhard

    2011-12-01

    The formation of dental enamel is a prototype of functional tissue development through biomineralization. Amelotin (AMTN) is a recently discovered secreted enamel protein predominantly expressed during the maturation stage of enamel formation. It accumulates in a basal lamina-like structure at the interface between ameloblasts and enamel mineral and it co-localizes with another recently described enamel protein, odontogenic ameloblast-associated protein (ODAM). The purpose of this study was to determine whether AMTN and ODAM bind to each other and/or to other well-established enamel matrix proteins. The coding sequences of all enamel proteins were cloned into appropriate vectors of the GAL4-based Matchmaker Gold Yeast Two-Hybrid System. The growth of yeast cells on selective media and color induction were used as indicators for reporter gene expression through protein-protein interactions in combinations of prey and bait constructs. We found that AMTN interacts with itself and with ODAM, but not with amelogenin (AMEL), ameloblastin (AMBN), or enamelin (ENAM). Using ODAM as bait, the interaction with AMTN was confirmed. Furthermore, ODAM was found to bind to itself and to AMBN, as well as weakly to AMEL but not to ENAM. We propose a model where the distinct expression of AMTN and ODAM and their interaction are involved in defining the enamel microstructure at the enamel surface.

  14. Yeast metabolic state identification using micro-fiber optics spectroscopy

    NASA Astrophysics Data System (ADS)

    Silva, J. S.; Castro, C. C.; Vicente, A. A.; Tafulo, P.; Jorge, P. A. S.; Martins, R. C.

    2011-05-01

    Saccharomyces cerevisiae morphology is known to be dependent on the cell physiological state and environmental conditions. On their environment, wild yeasts tend to form complex colonies architectures, such as stress response and pseudohyphal filaments morphologies, far away from the ones found inside bioreactors, where the regular cell cycle is observed under controlled conditions (e.g. budding and flocculating colonies). In this work we explore the feasibility of using micro-fiber optics spectroscopy to classify Saccharomyces cerevisiae S288C colony structures in YPD media, under different growth conditions, such as: i) no alcohol; ii) 1 % (v/v) Ethanol; iii) 1 % (v/v) 1-butanol; iv) 1 % (v/v) Isopropanol; v) 1 % (v/v) Tert-Amyl alcohol (2 Methyl-2-butanol); vi) 0,2 % (v/v) 2-Furaldehyde; vii) 5 % (w/v) 5 (Hydroxymethyl)-furfural; and viii) 1 % (w/v) (-)-Adenosine3', 5'cyclic monophosphate. The microscopy system includes a hyperspectral camera apparatus and a micro fiber (sustained by micro manipulator) optics system for spectroscopy. Results show that micro fiber optics system spectroscopy has the potential for yeasts metabolic state identification once the spectral signatures of colonies differs from each others. This technique associated with others physico-chemical information can benefit the creation of an information system capable of providing extremely detailed information about yeast metabolic state that will aid both scientists and engineers to study and develop new biotechnological products.

  15. Molecular identification of yeasts associated with traditional Egyptian dairy products.

    PubMed

    El-Sharoud, W M; Belloch, C; Peris, D; Querol, A

    2009-09-01

    This study aimed to examine the diversity and ecology of yeasts associated with traditional Egyptian dairy products employing molecular techniques in yeast identification. A total of 120 samples of fresh and stored Domiati cheese, kariesh cheese, and "Matared" cream were collected from local markets and examined. Forty yeast isolates were cultured from these samples and identified using the restriction-fragment length polymorphism (RFLPs) of 5.8S-ITS rDNA region and sequencing of the domains D1 and D2 of the 26S rRNA gene. Yeasts were identified as Issatchenkia orientalis (13 isolates), Candida albicans (4 isolates), Clavispora lusitaniae (Candida lusitaniae) (9 isolates), Kodamaea ohmeri (Pichia ohmeri) (1 isolate), Kluyveromyces marxianus (6 isolates), and Candida catenulata (7 isolates). With the exception of C. lusitaniae, the D1/D2 26S rRNA gene sequences were 100% identical for the yeast isolates within the same species. Phylogenetic reconstruction of C. lusitaniae isolates grouped them into 3 distinguished clusters. Kariesh cheese was found to be the most diverse in its yeast floras and contained the highest total yeast count compared with other examined dairy products. This was linked to the acidic pH and lower salt content of this cheese, which favor the growth and survival of yeasts in foodstuffs. Stored Domiati cheese also contained diverse yeast species involving isolates of the pathogenic yeast C. albicans. This raises the possibility of dairy products being vehicles of transmission of pathogenic yeasts.

  16. Evaluation of Vitek 2 for identification of yeasts in the clinical laboratory.

    PubMed

    Meurman, O; Koskensalo, A; Rantakokko-Jalava, K

    2006-06-01

    The Vitek 2 system was compared with conventional assimilation, fermentation and morphological methods for its ability to identify yeast isolates from among 151 clinical specimens and 16 known type culture or quality control strains. An unequivocal identification was obtained for 155 (92.8%) isolates, with low discrimination for nine (5.4%) and false identification for three (1.8%) isolates. All isolates of Candida albicans, Candida glabrata and Candida krusei were identified correctly. It was concluded that the Vitek 2 system offers an excellent alternative for the identification of yeasts in a clinical laboratory.

  17. Nuclear Magnetic Resonance Spectroscopy-Based Identification of Yeast.

    PubMed

    Himmelreich, Uwe; Sorrell, Tania C; Daniel, Heide-Marie

    2017-01-01

    Rapid and robust high-throughput identification of environmental, industrial, or clinical yeast isolates is important whenever relatively large numbers of samples need to be processed in a cost-efficient way. Nuclear magnetic resonance (NMR) spectroscopy generates complex data based on metabolite profiles, chemical composition and possibly on medium consumption, which can not only be used for the assessment of metabolic pathways but also for accurate identification of yeast down to the subspecies level. Initial results on NMR based yeast identification where comparable with conventional and DNA-based identification. Potential advantages of NMR spectroscopy in mycological laboratories include not only accurate identification but also the potential of automated sample delivery, automated analysis using computer-based methods, rapid turnaround time, high throughput, and low running costs.We describe here the sample preparation, data acquisition and analysis for NMR-based yeast identification. In addition, a roadmap for the development of classification strategies is given that will result in the acquisition of a database and analysis algorithms for yeast identification in different environments.

  18. YeastIP: a database for identification and phylogeny of Saccharomycotina yeasts.

    PubMed

    Weiss, Stéphanie; Samson, Franck; Navarro, David; Casaregola, Serge

    2013-02-01

    With the advances in sequencing techniques, identification of ascomycetous yeasts to the species level and phylogeny reconstruction increasingly require curated and updated taxonomic information. A specific database with nucleotide sequences of the most common markers used for yeast taxonomy and phylogeny and a user-friendly interface allowing identification, taxonomy and phylogeny of yeasts species was developed. By 1 September 2012, the YeastIP database contained all the described Saccharomycotina species for which sequences used for taxonomy and phylogeny, such as D1/D2 rDNA and ITS, are available. The database interface was developed to provide a maximum of relevant information and data mining tools, including the following features: (1) the blast n program for the sequences of the YeastIP database; (2) easy retrieval of selected sequences; (3) display of the available markers for each selected group of species; and (4) a tool to concatenate marker sequences, including those provided by the user. The concatenation tool allows phylogeny reconstruction through a direct link to the Phylogeny.fr platform. YeastIP is thus a unique database in that it provides taxonomic information and guides users in their taxonomic analyses. YeastIP facilitates multigenic analysis to encourage good practice in ascomycetous yeast phylogeny (URL: http://genome.jouy.inra.fr/yeastip.).

  19. Microfermentation Test For Identification Of Yeast

    NASA Technical Reports Server (NTRS)

    Pierson, D. L.; Mishra, S. K.; Molina, Thomas C.

    1995-01-01

    Microfermentation test developed as supplementary method for use in identifying yeasts, especially in clinical and environmental studies. In comparison with traditional fermentation tests, simpler and easier, and requiries less equipment, material, and laboratory space. Results obtained in days instead of weeks.

  20. Identification of Protein Components of Yeast Telomerase

    DTIC Science & Technology

    2000-09-01

    for forming telomeres at sites with stretches of telomere- like DNA. The pifl mutants also exhibit increased loss and decreased recombination of...like DNA. The pifl mutants also exhibit increased loss 6 and decreased recombination of mitochondrial DNA and thus have a high fraction of...the fission yeast Schizosaccharomyces pombe that was predicted to encode a 805 amino acid protein. The S. pombe gene was called rphl+ (RRM3/PIF1

  1. [Evaluation of Vitek 2 for the identification of Candida yeasts].

    PubMed

    Ochiuzzi, María E; Cataldi, Silvana; Guelfand, Liliana; Maldonado, Ivana; Arechavala, Alicia

    2014-01-01

    The aim of this investigation was to evaluate the performance of Vitek 2 YST cards (bioMérieux, Inc., Hazelwood, MO, USA) for the identification of yeasts of the genus Candida. A total of 168 isolates were analyzed and the results were compared to those of the API 20 C AUX (24%) o API ID 32 C (76%) kits (bioMérieux, Marcy L'Etoile, France). Each isolate was grown in chromogenic agar and in corn meal agar (Oxoid, UK) to observe its micromorphology. C. albicans and C. dublininesis were identified by additional biochemical and molecular tests. The agreement observed was 98.3%. Only three isolates were incorrectly identified by Vitek 2: one strain of C .tropicalis and one strain of C. krusei were identified as C. parapsilosis by YST while one strain of C. krusei was identified with low discrimination. The average time for obtaining results was 18.25 h. Vitek 2 is a simple, safe and useful system for the identification of significant Candida species.

  2. [Yeasts in domestic animals: species identification and susceptibility to antifungals].

    PubMed

    Hamal, Petr; Koukalová, Dagmar

    2010-02-01

    Yeasts frequently colonize various kinds of domestic animals, but may also cause serious diseases. The aim of this study was to identify yeast isolates collected from dogs, cows and pigs, and to determine their in vitro antifungal susceptibility. Fifty-six yeast isolates from dogs (n = 24), cows (n = 20), and pigs (n = 12) were investigated. Appearance of colonies grown on Sabouraud agar, micromorphology on rice agar, as well as assimilation and fermentation of various carbon and nitrogen sources were evaluated. Susceptibility to six antifungals (flucytosine, amphotericin B, miconazole, ketoconazole, itraconazole and fluconazole) was determined semiquantitatively using the commercially available Fungitest kit (Bio-Rad Laboratories). Ten yeast species were identified in dogs with relatively even distribution. On the other hand, cow and pig were clearly dominated by Candida krusei (from 7 species) and Candida rugosa (from 5 species), respectively. Further, most of yeast isolates exhibited good susceptibility to the antifungals tested particularly to amphotericin B, ketoconazole and itraconazole. Based on results, it can be concluded that significant differences in the species spectrum and distribution were documented between groups of yeasts from dogs, cows and pigs. This is probably due to different environmental conditions and the endogenous origin of the yeast isolates. Mostly good susceptibility to systemic antifungals should positively influence the therapy of diseases caused by yeasts in veterinary medicine.

  3. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    NASA Astrophysics Data System (ADS)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  4. Identification of GIT1/Cat-1 as a substrate molecule of protein tyrosine phosphatase zeta /beta by the yeast substrate-trapping system.

    PubMed

    Kawachi, H; Fujikawa, A; Maeda, N; Noda, M

    2001-06-05

    We used a genetic method, the yeast substrate-trapping system, to identify substrates for protein tyrosine phosphatases zeta (PTPzeta/RPTPbeta). This method is based on the yeast two-hybrid system, with two essential modifications: conditional expression of protein tyrosine kinase v-src (active src) to tyrosine-phosphorylate the prey proteins and screening by using a substrate-trap mutant of PTPzeta (PTPzeta-D1902A) as bait. By using this system, several substrate candidates for PTPzeta were isolated. Among them, GIT1/Cat-1 (G protein-coupled receptor kinase-interactor 1/Cool-associated, tyrosine-phosphorylated 1) was examined further. GIT1/Cat-1 bound to PTPzeta-D1902A dependent on the substrate tyrosine phosphorylation. Tyrosine-phosphorylated GIT1/Cat-1 was dephosphorylated by PTPzeta in vitro. Immunoprecipitation experiments indicated that PTPzeta-D1902A and GIT1/Cat-1 form a stable complex also in mammalian cells. Immunohistochemical analyses revealed that PTPzeta and GIT1/Cat-1 were colocalized in the processes of pyramidal cells in the hippocampus and neocortex in rat brain. Subcellular colocalization was further verified in the growth cones of mossy fibers from pontine explants and in the ruffling membranes and processes of B103 neuroblastoma cells. Moreover, pleiotrophin, a ligand for PTPzeta, increased tyrosine phosphorylation of GIT1/Cat-1 in B103 cells. All these results indicate that GIT1/Cat-1 is a substrate molecule of PTPzeta.

  5. Yeast on-target lysis (YOTL), a procedure for making auxiliary mass spectrum data sets for clinical routine identification of yeasts.

    PubMed

    Bernhard, Mareike; Weig, Michael; Zautner, Andreas E; Groß, Uwe; Bader, Oliver

    2014-12-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS)-based species identification has become a reliable and fast tool for use in clinical diagnostics, including in mycology. To identify yeasts in the MALDI Biotyper system, a multistep extraction protocol, which is also used to generate the reference spectra, is recommended. Sample preparation by on-target lysis (OTL) requires significantly less hands-on time and is therefore highly desirable, but it results in too-low MALDI Biotyper log score values to allow automated species identification. To overcome this problem, we developed a procedure for generating and validating an OTL spectrum data set for the most relevant and frequently occurring yeast species in clinical specimens. The performance was evaluated against a set of OTL spectra derived during clinical routine procedures and from a set of closely related yeasts. In the diagnostic setting, the OTL procedure significantly decreased the workload but allowed species identification with high specificity and sensitivity. False identifications were not observed. The use of in-house-generated OTL reference spectra can highly accelerate MALDI-TOF MS-based yeast species identification using the MALDI Biotyper.

  6. Rapid Identification of Yeast Isolates from Clinical Specimens in Critically Ill Trauma ICU Patients

    PubMed Central

    Jain, Neetu; Mathur, Purva; Misra, Mahesh Chandra; Behera, Bijayini; Xess, Immaculata; Sharma, Satya Priya

    2012-01-01

    Purpose: The purpose was to evaluate the performance of a commercially available chromogenic Candida speciation media and the Vitek 2 ID system for the identification of medically important yeasts and yeast-like organisms in a routine clinical microbiology laboratory. Materials and Methods: A total of 429 non duplicate, consecutive yeast strains were included during the 3.5-year study period. The performance of the Vitek 2 ID system and a chromogenic agar medium was evaluated against the gold standard conventional phenotypic and biochemical identification method for speciation of yeast isolates from trauma patients. Results: Candida tropicalis (64%) was the most common Candida species, followed by Candida albicans (14%), Candida rugosa (7%), and Candida parapsilosis (6.5%). Of the 429 isolates, 183 could be identified to species level by all the three methods. Agreement between the chromogenic agar method and conventional methods was 80% for Candida tropicalis, 100% for Candida rugosa, 89% for Candida albicans, and 77% for Candida parapsilosis. Vitek 2 had lower sensitivity, with agreement of 49% for Candida tropicalis, 100% for Candida rugosa, 39% for Candida albicans, and 31% for Candida parapsilosis. Conclusion: Thus, in long-term ICU patients, an increasing trend of isolating nonalbicans Candida spp. continues. The chromogenic agar medium is a convenient and economic method to identify commonly isolated species in busy clinical microbiology laboratories. PMID:22923919

  7. Comparative performance of the RapID Yeast Plus System and the API 20C AUX Clinical Yeast System.

    PubMed

    Smith, M B; Dunklee, D; Vu, H; Woods, G L

    1999-08-01

    The performance of the RapID Yeast Plus System (Innovative Diagnostic Systems, Norcross, Ga.), a 4-h micropanel using single-substrate enzymatic test reactions, was compared with that of the API 20C AUX Clinical Yeast System (bioMerieux Vitek, Hazelwood, Mo.), a 48- to 72-h carbohydrate assimilation panel. Two hundred twenty-five yeasts, yeast-like fungi, and algae, comprising 28 species and including 30 isolates of Cryptococcus neoformans, an important pathogen not tested in appreciable numbers in other comparisons, were tested by both methods. On initial testing, 196 (87.1%) and 215 (95.6%) isolates were correctly identified by the RapID and API systems, respectively. Upon repeat testing, the number of correctly identified isolates increased to 220 (97.8%) for the RapID system and 223 (99.1%) for the API system. Reducing the turbidity of the test inoculum to that of a no. 3 McFarland turbidity standard, which is below that recommended by the manufacturer, resulted in the correct identification of most of the isolates initially misidentified by the RapID system, including 10 of 30 C. neoformans isolates. Concordance between the RapID and API results after repeat testing was 97.3%.

  8. Human heart cell proteins interacting with a C-terminally truncated 2A protein of coxsackie B3 virus: identification by the yeast two-hybrid system.

    PubMed

    Zhao, Tiansheng; Huang, Xiaotian; Xia, Yanhua

    2016-04-01

    Protein 2A is a non-structural protein of coxsackievirus B3 (CVB3), an important human pathogen that can cause a variety of human diseases. Protein 2A not only participates in viral life cycle, but also regulates host cell functions; however, the underlying mechanisms remain poorly understood. In order to better understand the molecular mechanisms of CVB3 2A's function, the yeast two-hybrid (Y2H) system was adopted to screen for CVB3 2A interactive proteins in the human heart cDNA library. Full-length 2A shows strong transcriptional activity in yeast cells, which interferes with the application of Y2H system; therefore, a series of 2A deletion mutants were constructed. Analysis of transcriptional self-activation revealed that 2A lost its transcriptional activity after truncation of 60 amino acids (aa) at the N-terminus or deletion of 17 aa at the C-terminus. Choosing the 2A mutant with 17 aa deletion at the C-terminus as the bait protein, four interactive cellular proteins were identified, including TIMP4, MYL2, COX7C, and ENO1. These proteins are mostly related to protein degradation and metabolism. Although the interactions detected by the Y2H system should be considered as preliminary results, the finding of proteins translated from a human heart cDNA library that interacts with the CVB3 2A will stimulate experiments testing the reactivity of a translational mixture derived from that library with full-length 2A protein, followed by co-immunoprecipitation studies.

  9. Internal Transcribed Spacer Sequencing versus Biochemical Profiling for Identification of Medically Important Yeasts

    PubMed Central

    Ciardo, D. E.; Schär, G.; Böttger, E. C.; Altwegg, M.; Bosshard, P. P.

    2006-01-01

    In this study, we established an in-house database of yeast internal transcribed spacer (ITS) sequences. This database includes medically important as well as colonizing yeasts that frequently occur in the diagnostic laboratory. In a prospective study, we compared molecular identification with phenotypic identification by using the ID32C system (bioMérieux) for yeast strains that could not be identified by a combination of CHROMagar Candida and morphology on rice agar. In total, 113 yeast strains were included in the study. By sequence analysis, 98% of all strains were identified correctly to the species level. With the ID32C, 87% of all strains were identified correctly to the species or genus level, 7% of the isolates could not be identified, and 6% of the isolates were misidentified, most of them as Candida rugosa or Candida utilis. For a diagnostic algorithm, we suggest a three-step procedure which integrates morphological criteria, biochemical investigation, and sequence analysis of the ITS region. PMID:16390952

  10. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    PubMed Central

    Yücesoy, Mine; Marol, Serhat

    2003-01-01

    Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar. PMID:14613587

  11. Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

    PubMed Central

    Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

    2007-01-01

    Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

  12. Prospective evaluation of a matrix-assisted laser desorption ionization-time of flight mass spectrometry system in a hospital clinical microbiology laboratory for identification of bacteria and yeasts: a bench-by-bench study for assessing the impact on time to identification and cost-effectiveness.

    PubMed

    Tan, K E; Ellis, B C; Lee, R; Stamper, P D; Zhang, S X; Carroll, K C

    2012-10-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has been found to be an accurate, rapid, and inexpensive method for the identification of bacteria and yeasts. Previous evaluations have compared the accuracy, time to identification, and costs of the MALDI-TOF MS method against standard identification systems or commercial panels. In this prospective study, we compared a protocol incorporating MALDI-TOF MS (MALDI protocol) with the current standard identification protocols (standard protocol) to determine the performance in actual practice using a specimen-based, bench-by-bench approach. The potential impact on time to identification (TTI) and costs had MALDI-TOF MS been the first-line identification method was quantitated. The MALDI protocol includes supplementary tests, notably for Streptococcus pneumoniae and Shigella, and indications for repeat MALDI-TOF MS attempts, often not measured in previous studies. A total of 952 isolates (824 bacterial isolates and 128 yeast isolates) recovered from 2,214 specimens were assessed using the MALDI protocol. Compared with standard protocols, the MALDI protocol provided identifications 1.45 days earlier on average (P < 0.001). In our laboratory, we anticipate that the incorporation of the MALDI protocol can reduce reagent and labor costs of identification by $102,424 or 56.9% within 12 months. The model included the fixed annual costs of the MALDI-TOF MS, such as the cost of protein standards and instrument maintenance, and the annual prevalence of organisms encountered in our laboratory. This comprehensive cost analysis model can be generalized to other moderate- to high-volume laboratories.

  13. Yeast Species Associated with Orange Juice: Evaluation of Different Identification Methods†

    PubMed Central

    Arias, Covadonga R.; Burns, Jacqueline K.; Friedrich, Lorrie M.; Goodrich, Renee M.; Parish, Mickey E.

    2002-01-01

    Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice. PMID:11916718

  14. [Novel bioconversion systems using a yeast molecular display system].

    PubMed

    Shibasaki, Seiji

    2010-11-01

    The budding yeast Saccharomyces cerevisiae has been used for the process of fermentation as well as for studies in biochemistry and molecular biology as a eukaryotic model cell or tool for the analysis of gene functions. Thus, yeast is essential in industries and researches. Yeast cells have a cell wall, which is one characteristic that helps distinguish yeast cells from other eukaryotic cells such as mammalian cells. We have developed a molecular display system using the protein of the yeast cell wall as an anchor for foreign proteins. Yeast cells have been designed for use in sensing and metal adsorption, and have been used in vaccines and for screening novel proteins. Currently, yeast is used not only as a tool for analyzing gene or protein function but also in molecular display technology. The phage display system, which is at the forefront of molecular display technologies, is a powerful tool for screening ligands bound to a target molecule and for analyzing protein-protein interactions; however, in some cases, eukaryotic proteins are not easily expressed by this system. On the other hand, yeast cells have the ability to express eukaryotic proteins and proliferate; thus, these cells display various proteins. Yeast cells are more appropriate for white biotechnology. In this review, displays of enzymes that are important in bioconversion, such as lipases and β-glucosidases, are going to be introduced.

  15. A switchable yeast display/secretion system

    PubMed Central

    Van Deventer, James A.; Kelly, Ryan L.; Rajan, Saravanan; Wittrup, K. Dane; Sidhu, Sachdev S.

    2015-01-01

    Display technologies such as yeast and phage display offer powerful alternatives to traditional immunization-based antibody discovery, but require conversion of displayed proteins into soluble form prior to downstream characterization. Here we utilize amber suppression to implement a yeast-based switchable display/secretion system that enables the immediate production of soluble, antibody-like reagents at the end of screening efforts. Model selections in the switchable format remain efficient, and library screening in the switchable format yields renewable sources of affinity reagents exhibiting nanomolar binding affinities. These results confirm that this system provides a seamless link between display-based screening and the production and evaluation of soluble forms of candidate binding proteins. Switchable display/secretion libraries provide a cloning-free, accessible approach to affinity reagent generation. PMID:26333274

  16. A switchable yeast display/secretion system.

    PubMed

    Van Deventer, James A; Kelly, Ryan L; Rajan, Saravanan; Wittrup, K Dane; Sidhu, Sachdev S

    2015-10-01

    Display technologies such as yeast and phage display offer powerful alternatives to traditional immunization-based antibody discovery, but require conversion of displayed proteins into soluble form prior to downstream characterization. Here we utilize amber suppression to implement a yeast-based switchable display/secretion system that enables the immediate production of soluble, antibody-like reagents at the end of screening efforts. Model selections in the switchable format remain efficient, and library screening in the switchable format yields renewable sources of affinity reagents exhibiting nanomolar binding affinities. These results confirm that this system provides a seamless link between display-based screening and the production and evaluation of soluble forms of candidate binding proteins. Switchable display/secretion libraries provide a cloning-free, accessible approach to affinity reagent generation.

  17. Evaluation and Reliability of a Simplified Method for Identification of Food-Borne Yeasts

    PubMed Central

    Rohm, Harald; Lechner, Frieda

    1990-01-01

    A simplified identification key described by Deak and Beuchat (T. Deak and L. R. Beuchat, J. Food Prot. 50:243-264, 1987) and the computer method of Barnett et al. (J. A. Barnett, R. W. Payne, and D. Yarrow, Yeast Identification Program, 1985) were used to identify 12 reference strains and 382 yeasts isolated from cultured milk products. Because the simplified key failed to account for species variability with regard to physiological, morphological, and sexual reproduction characteristics, poor agreement of the identification results was obtained. A reevaluation of the basic theoretical assumptions of the simplified key only confirmed the practical results and indicates that this identification method is unsatisfactory PMID:16348183

  18. A Comprehensive Evaluation of the Bruker Biotyper MS and Vitek MS Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry Systems for Identification of Yeasts, Part of the National China Hospital Invasive Fungal Surveillance Net (CHIF-NET) Study, 2012 to 2013

    PubMed Central

    Wang, He; Fan, Yan-Yan; Kudinha, Timothy; Xu, Zhi-Peng; Xiao, Meng; Zhang, Li; Fan, Xin; Kong, Fanrong

    2016-01-01

    Among the 2,683 yeast isolates representing 41 different species (25 Candida and Candida-related species and 16 non-Candida yeast species) collected in the National China Hospital Invasive Fungal Surveillance Net (CHIF-NET) program (2012 to 2013), the Bruker Biotyper MS matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) system exhibited significantly higher accuracy rates than the Vitek MS system for identification of all yeast isolates (98.8% versus 95.4%, P <0.001 by Pearson's chi-square test) and for all Candida and Candida-related species isolates (99.4% versus 95.5%, P < 0.001). PMID:26912761

  19. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    PubMed

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of

  20. Comparative Evaluation of the Bruker Biotyper and Vitek MS Matrix-Assisted Laser Desorption Ionization–Time Of Flight (MALDI-TOF) Mass Spectrometry Systems for Identification of Yeasts of Medical Importance

    PubMed Central

    De Carolis, Elena; Infurnari, Laura; Vella, Antonietta; Clementi, Nicola; Vaccaro, Luisa; Ruggeri, Alberto; Posteraro, Brunella; Burioni, Roberto; Clementi, Massimo; Sanguinetti, Maurizio

    2013-01-01

    We report the first comparative evaluation between the Bruker Biotyper MS (BMS) and the Vitek MS (VMS) for the identification of yeasts. The rate of correct identifications at the species level was comparable using the commercial databases (89.8% versus 84.3%; P = 0.712), but higher for BMS using an in-house-extended database (100% versus 84.3%; P = 0.245). Importantly, the rate of misidentification was significantly higher for VMS (1% versus 12.1%; P < 0.0001), including the rate of major errors (0% versus 4.5%; P = 0.0036). PMID:23678071

  1. Detection and identification of wild yeasts in lager breweries.

    PubMed

    van der Aa Kühle, A; Jespersen, L

    1998-09-08

    Wild yeasts were detected in 41 out of 101 brewery yeast samples investigated using six different selective principles. Malt extract, yeast extract, glucose, peptone (MYGP) agar supplemented with 195 ppm CuSO4 was found to be the most effective selective principle, detecting wild yeasts in 80% of the contaminated samples. Both Saccharomyces and non-Saccharomyces wild yeasts were detected on this medium. Lysine medium, crystal violet medium and incubation of non-selective media at 37 degrees C detected wild yeasts in 46-56% of the contaminated samples. On using actidione medium, only 20% of the wild yeasts were detected. The combined use of MYGP supplemented with 195 ppm CuSO4 and one of the other selective principles did not improve the recovery of the wild yeasts. The wild yeasts found consisted of Saccharomyces cerevisiae (57%), Pichia spp. (28%) and Candida spp. (15%). Using the API ID 32 C kit, 35 different assimilation profiles were obtained for the 124 wild yeast isolates investigated. All isolates were capable of glucose assimilation, whereas only 79% of the isolates assimilated saccharose, 75% maltose, 70% galactose, 65% raffinose and 65% lactate. Lactose, inositol, rhamnose and glucuronate were not assimilated by any of the isolates. The differences in assimilation pattern did not reflect any differences in recovery by the selective principles investigated. The majority of the wild yeast isolates investigated were capable of growth in wort and beer, indicating their possible role as spoilage organisms. The Sacch. cerevisiae isolates were found to be the most hazardous, with some isolates being capable of extensive growth in bottled beer within seventeen days at ambient temperature.

  2. Identification of superior lipid producing Lipomyces and Myxozyma yeasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Oleaginous yeasts are of interest for production of single cell oils from sugars. Here 17 members of the Lipomyces and Myxozyma clade were screened for lipid production when cultured on glucose. The highest ranking yeasts included L. tetrasporus (21 g/l), L. kononenkoae (19.6 g/l), and L. lipofer (1...

  3. Control Oriented System Identification

    DTIC Science & Technology

    1993-08-01

    The research goals for this grant were to obtain algorithms for control oriented system identification is to construct dynamical models of systems...and measured information. Algorithms for this type of nonlinear system identification have been given that produce models suitable for gain scheduled

  4. Detection of anabolic steroid abuse using a yeast transactivation system.

    PubMed

    Zierau, Oliver; Lehmann, Sylvi; Vollmer, Günter; Schänzer, Willhelm; Diel, Patrick

    2008-10-01

    The classical analytical method for detection of anabolic steroid abuse is gas chromatography followed by mass spectrometry (GC/MS). However, even molecules with a chemical structure typical for this class of substances, are sometimes not identified in routine screening by GC/MS when their precise chemical structure is still unknown. A supplementary approach to identify anabolic steroid abuse could be a structure-independent identification of anabolic steroids based on their biological activity. To test the suitability of such a system, we have analyzed the yeast androgen receptor (AR) reporter gene system to identify anabolic steroids in human urine samples. Analysis of different anabolic steroids dissolved in buffer demonstrated that the yeast reporter gene system is able to detect a variety of different anabolic steroids and their metabolites with high specificity, including the so-called 'designer steroid' tetrahydrogestrinone. In contrast, other non-androgenic steroids, like glucocordicoids, progestins, mineralocordicoids and estrogens had a low potency to stimulate transactivation. To test whether the system would also allow the detection of androgens in urine, experiments with spiked urine samples were performed. The androgen reporter gene in yeast responds very sensitive to 5alpha-dihydrotestosterone (DHT), even at high urine concentrations. To examine whether the test system would also be able to detect anabolic steroids in the urine of anabolic steroid abusers, anonymous urine samples previously characterized by GCMS were analyzed with the reporter gene assay. Even when the concentration of the anabolic metabolites was comparatively low in some positive samples it was possible to identify the majority of positive samples by their biological activity. In conclusion, our results demonstrate that the yeast reporter gene system detects anabolic steroids and corresponding metabolites with high sensitivity even in urine of anabolic steroid abusing athletes

  5. Prospective evaluation of the VITEK MS for the routine identification of bacteria and yeast in the clinical microbiology laboratory: assessment of accuracy of identification and turnaround time.

    PubMed

    Charnot-Katsikas, Angella; Tesic, Vera; Boonlayangoor, Sue; Bethel, Cindy; Frank, Karen M

    2014-02-01

    This study assessed the accuracy of bacterial and yeast identification using the VITEK MS, and the time to reporting of isolates before and after its implementation in routine clinical practice. Three hundred and sixty-two isolates of bacteria and yeast, consisting of a variety of clinical isolates and American Type Culture Collection strains, were tested. Results were compared with reference identifications from the VITEK 2 system and with 16S rRNA sequence analysis. The VITEK MS provided an acceptable identification to species level for 283 (78 %) isolates. Considering organisms for which genus-level identification is acceptable for routine clinical care, 315 isolates (87 %) had an acceptable identification. Six isolates (2 %) were identified incorrectly, five of which were Shigella species. Finally, the time for reporting the identifications was decreased significantly after implementation of the VITEK MS for a total mean reduction in time of 10.52 h (P<0.0001). Overall, accuracy of the VITEK MS was comparable or superior to that from the VITEK 2. The findings were also comparable to other studies examining the accuracy of the VITEK MS, although differences exist, depending on the diversity of species represented as well as on the versions of the databases used. The VITEK MS can be incorporated effectively into routine use in a clinical microbiology laboratory and future expansion of the database should provide improved accuracy for the identification of micro-organisms.

  6. Advantages of Using Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry as a Rapid Diagnostic Tool for Identification of Yeasts and Mycobacteria in the Clinical Microbiological Laboratory

    PubMed Central

    Chen, Jonathan H. K.; Yam, Wing-Cheong; Ngan, Antonio H. Y.; Fung, Ami M. Y.; Woo, Wai-Lan; Yan, Mei-Kum; Choi, Garnet K. Y.; Ho, Pak-Leung; Cheng, Vincent C. C.

    2013-01-01

    Yeast and mycobacteria can cause infections in immunocompromised patients and normal hosts. The rapid identification of these organisms can significantly improve patient care. There has been an increasing number of studies on using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) for rapid yeast and mycobacterial identifications. However, studies on direct comparisons between the Bruker Biotyper and bioMérieux Vitek MS systems for the identification of yeast and mycobacteria have been limited. This study compared the performance of the two systems in their identification of 98 yeast and 102 mycobacteria isolates. Among the 98 yeast isolates, both systems generated species-level identifications in >70% of the specimens, of which Candida albicans was the most commonly cultured species. At a genus-level identification, the Biotyper system identified more isolates than the Vitek MS system for Candida (75/78 [96.2%]versus 68/78 [87.2%], respectively; P = 0.0426) and non-Candida yeasts (18/20 [90.0%]versus 7/20 [35.0%], respectively; P = 0.0008). For mycobacterial identification, the Biotyper system generated reliable identifications for 89 (87.3%) and 64 (62.8%) clinical isolates at the genus and species levels, respectively, from solid culture media, whereas the Vitek MS system did not generate any reliable identification. The MS method differentiated 12/21 clinical species, despite the fact that no differentiation between Mycobacterium abscessus and Mycobacterium chelonae was found by using 16S rRNA gene sequencing. In summary, the MALDI-TOF MS method provides short turnaround times and a standardized working protocol for the identification of yeast and mycobacteria. Our study demonstrates that MALDI-TOF MS is suitable as a first-line test for the identification of yeast and mycobacteria in clinical laboratories. PMID:24048537

  7. Rapid and Reliable Identification of Food-Borne Yeasts by Fourier-Transform Infrared Spectroscopy

    PubMed Central

    Kümmerle, Michael; Scherer, Siegfried; Seiler, Herbert

    1998-01-01

    Computer-based Fourier-transform infrared spectroscopy (FT-IR) was used to identify food-borne, predominantly fermentative yeasts. Dried yeast suspensions provided the films suitable for FT-IR measurement. Informative windows in the spectrum were selected and combined to achieve optimal results. A reference spectrum library was assembled, based on 332 defined yeast strains from international yeast collections and our own isolates. All strains were identified with conventional methods using physiological and morphological characteristics. In order to assess identification quality, another 722 unknown yeast isolates not included in the reference spectrum library were identified both by classical methods and by comparison of their FT-IR spectra with those of the reference spectrum library. Ninety-seven and one-half percent of these isolates were identified correctly by FT-IR. Easy handling, rapid identification within 24 h when starting from a single colony, and a high differentiation capacity thus render FT-IR technology clearly superior to other routine methods for the identification of yeasts. PMID:9603836

  8. Comparative analysis of Gram's stain, PNA-FISH and Sepsityper with MALDI-TOF MS for the identification of yeast direct from positive blood cultures.

    PubMed

    Gorton, Rebecca L; Ramnarain, P; Barker, K; Stone, N; Rattenbury, S; McHugh, T D; Kibbler, C C

    2014-10-01

    Fungaemia diagnosis could be improved by reducing the time to identification of yeast from blood cultures. This study aimed to evaluate three rapid methods for the identification of yeast direct from blood cultures; Gram's stain analysis, the AdvanDX Peptide Nucleic Acid in Situ Hybridisation Yeast Traffic Light system (PNA-FISH YTL) and Bruker Sepsityper alongside matrix-assisted laser desorption ionisation time of flight mass spectrometry (MALDI-TOF MS). Fifty blood cultures spiked with a known single yeast strain were analysed by blinded operators experienced in each method. Identifications were compared with MALDI-TOF MS CHROMagar Candida culture and ITS rRNA sequence-based identifications. On first attempt, success rates of 96% (48/50) and 76% (36/50) were achieved using PNA-FISH YTL and Gram's stain respectively. MALDI-TOF MS demonstrated a success rate of 56% (28/50) when applying manufacturer's species log score thresholds and 76% (38/50) using in-house parameters, including lowering the species log score threshold to >1.5. In conclusion, PNA-FISH YTL demonstrated a high success rate successfully identifying yeast commonly encountered in fungaemia. Sepsityper(™) with MALDI-TOF MS was accurate but increased sensitivity is required. Due to the misidentification of commonly encountered yeast Gram's stain analysis demonstrated limited utility in this setting.

  9. Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

    PubMed

    Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

    2016-06-01

    The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

  10. [Evaluation of mass spectrometry: MALDI-TOF MS for fast and reliable yeast identification].

    PubMed

    Relloso, María S; Nievas, Jimena; Fares Taie, Santiago; Farquharson, Victoria; Mujica, María T; Romano, Vanesa; Zarate, Mariela S; Smayevsky, Jorgelina

    2015-01-01

    The matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique known as MALDI-TOF MS is a tool used for the identification of clinical pathogens by generating a protein spectrum that is unique for a given species. In this study we assessed the identification of clinical yeast isolates by MALDI-TOF MS in a university hospital from Argentina and compared two procedures for protein extraction: a rapid method and a procedure based on the manufacturer's recommendations. A short protein extraction procedure was applied in 100 isolates and the rate of correct identification at genus and species level was 98.0%. In addition, we analyzed 201 isolates, previously identified by conventional methods, using the methodology recommended by the manufacturer and there was 95.38% coincidence in the identification at species level. MALDI TOF MS showed to be a fast, simple and reliable tool for yeast identification.

  11. A systems-level approach for metabolic engineering of yeast cell factories.

    PubMed

    Kim, Il-Kwon; Roldão, António; Siewers, Verena; Nielsen, Jens

    2012-03-01

    The generation of novel yeast cell factories for production of high-value industrial biotechnological products relies on three metabolic engineering principles: design, construction, and analysis. In the last two decades, strong efforts have been put on developing faster and more efficient strategies and/or technologies for each one of these principles. For design and construction, three major strategies are described in this review: (1) rational metabolic engineering; (2) inverse metabolic engineering; and (3) evolutionary strategies. Independent of the selected strategy, the process of designing yeast strains involves five decision points: (1) choice of product, (2) choice of chassis, (3) identification of target genes, (4) regulating the expression level of target genes, and (5) network balancing of the target genes. At the construction level, several molecular biology tools have been developed through the concept of synthetic biology and applied for the generation of novel, engineered yeast strains. For comprehensive and quantitative analysis of constructed strains, systems biology tools are commonly used and using a multi-omics approach. Key information about the biological system can be revealed, for example, identification of genetic regulatory mechanisms and competitive pathways, thereby assisting the in silico design of metabolic engineering strategies for improving strain performance. Examples on how systems and synthetic biology brought yeast metabolic engineering closer to industrial biotechnology are described in this review, and these examples should demonstrate the potential of a systems-level approach for fast and efficient generation of yeast cell factories.

  12. Author Identification Systems

    ERIC Educational Resources Information Center

    Wagner, A. Ben

    2009-01-01

    Many efforts are currently underway to disambiguate author names and assign unique identification numbers so that publications by a given scholar can be reliably grouped together. This paper reviews a number of operational and in-development services. Some systems like ResearcherId.Com depend on self-registration and self-identification of a…

  13. Comparison and optimization of two MALDI-TOF MS platforms for the identification of medically relevant yeast species.

    PubMed

    Pence, M A; McElvania TeKippe, E; Wallace, M A; Burnham, C-A D

    2014-10-01

    The rapid identification of yeast is essential for the optimization of antifungal therapy. The objective of our study was to evaluate two matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) platforms, the bioMérieux VITEK MS (IVD Knowledgebase v.2.0) and Bruker Biotyper (software version 3.1), for the rapid identification of medically relevant yeast. One hundred and seventeen isolates, representing six genera and 18 species, were analyzed using multiple direct smear methods to optimize identification. Sequence analysis was the gold standard for comparison. Isolates were analyzed with VITEK MS using the direct smear method +/- a 25 % formic acid on-plate extraction. For Biotyper, isolates were analyzed using direct smear without formic acid, and with 25 % and 100 % formic acid on-plate extractions. When all methods were included, VITEK MS correctly identified 113 (96.6 %) isolates after 24 h with one misidentification, and Biotyper correctly identified 77 (65.8 %) isolates using a threshold of ≥2.0 with no misidentifications. Using a revised threshold of ≥1.7, Biotyper correctly identified 103 (88.0 %) isolates, with 3 (2.6 %) misidentifications. For both platforms, the number of identifications was significantly increased using a formic acid overlay (VITEK MS, p < 0.01; Biotyper, p < 0.001), and reducing the Biotyper threshold from ≥2.0 to ≥1.7 significantly increased the rate of identification (p < 0.001). The data in this study demonstrate that the direct smear method with on-plate formic acid extraction can be used for yeast identification on both MS platforms, and more isolates are identified using the VITEK MS system (p < 0.01).

  14. Identification of Posttranslational Modification-Dependent Protein Interactions Using Yeast Surface Displayed Human Proteome Libraries.

    PubMed

    Bidlingmaier, Scott; Liu, Bin

    2015-01-01

    The identification of proteins that interact specifically with posttranslational modifications such as phosphorylation is often necessary to understand cellular signaling pathways. Numerous methods for identifying proteins that interact with posttranslational modifications have been utilized, including affinity-based purification and analysis, protein microarrays, phage display, and tethered catalysis. Although these techniques have been used successfully, each has limitations. Recently, yeast surface-displayed human proteome libraries have been utilized to identify protein fragments with affinity for various target molecules, including phosphorylated peptides. When coupled with fluorescently activated cell sorting and high throughput methods for the analysis of selection outputs, yeast surface-displayed human proteome libraries can rapidly and efficiently identify protein fragments with affinity for any soluble ligand that can be fluorescently detected, including posttranslational modifications. In this review we compare the use of yeast surface display libraries to other methods for the identification of interactions between proteins and posttranslational modifications and discuss future applications of the technology.

  15. Quantum system identification.

    PubMed

    Burgarth, Daniel; Yuasa, Kazuya

    2012-02-24

    The aim of quantum system identification is to estimate the ingredients inside a black box, in which some quantum-mechanical unitary process takes place, by just looking at its input-output behavior. Here we establish a basic and general framework for quantum system identification, that allows us to classify how much knowledge about the quantum system is attainable, in principle, from a given experimental setup. We show that controllable closed quantum systems can be estimated up to unitary conjugation. Prior knowledge on some elements of the black box helps the system identification. We present an example in which a Bell measurement is more efficient to identify the system. When the topology of the system is known, the framework enables us to establish a general criterion for the estimability of the coupling constants in its Hamiltonian.

  16. Identification and characterization of antimicrobial activity in two yeast genera.

    PubMed Central

    Bilinski, C A; Innamorato, G; Stewart, G G

    1985-01-01

    A general screening test for the expression of antibacterial activity was performed on over 400 cultures belonging to 31 yeast genera. Of these cultures, only two, Kluyveromyces thermotolerans and Kloeckera apiculata, were found to produce zones of inhibition of bacterial growth on Diagnostic Sensitivity Test Agar medium supplemented with 0.002% methylene blue. Of nine bacteria used as test organisms, only Lactobacillus plantarum and Bacillus megaterium were inhibited. No antibacterial activity was evident against four gram-negative bacteria used in this study. Optimal activities were found to be expressed after yeasts were grown at pH 6. A requirement for cultivation in the presence of methylene blue added to culture media for the expression of apparent antibacterial activity was demonstrated. Images PMID:3937494

  17. Identification of budding yeast using a fiber-optic imaging bundle

    NASA Astrophysics Data System (ADS)

    Koschwanez, John; Holl, Mark; Marquardt, Brian; Dragavon, Joe; Burgess, Lloyd; Meldrum, Deirdre

    2004-05-01

    A successful imaging system has been designed and built for yeast pedigree analysis. The system uses a fiber-optic imaging bundle to recognize single yeast cells. Image processing software has been developed to accurately classify the cells as either budding or not budding a daughter cell. This system is intended to replace the body of a microscope for the detection of budding in a microfluidic system.

  18. Identification of Medically Important Yeast Species by Sequence Analysis of the Internal Transcribed Spacer Regions

    PubMed Central

    Leaw, Shiang Ning; Chang, Hsien Chang; Sun, Hsiao Fang; Barton, Richard; Bouchara, Jean-Philippe; Chang, Tsung Chain

    2006-01-01

    Infections caused by yeasts have increased in previous decades due primarily to the increasing population of immunocompromised patients. In addition, infections caused by less common species such as Pichia, Rhodotorula, Trichosporon, and Saccharomyces spp. have been widely reported. This study extensively evaluated the feasibility of sequence analysis of the rRNA gene internal transcribed spacer (ITS) regions for the identification of yeasts of clinical relevance. Both the ITS1 and ITS2 regions of 373 strains (86 species), including 299 reference strains and 74 clinical isolates, were amplified by PCR and sequenced. The sequences were compared to reference data available at the GenBank database by using BLAST (basic local alignment search tool) to determine if species identification was possible by ITS sequencing. Since the GenBank database currently lacks ITS sequence entries for some yeasts, the ITS sequences of type (or reference) strains of 15 species were submitted to GenBank to facilitate identification of these species. Strains producing discrepant identifications between the conventional methods and ITS sequence analysis were further analyzed by sequencing of the D1-D2 domain of the large-subunit rRNA gene for species clarification. The rates of correct identification by ITS1 and ITS2 sequence analysis were 96.8% (361/373) and 99.7% (372/373), respectively. Of the 373 strains tested, only 1 strain (Rhodotorula glutinis BCRC 20576) could not be identified by ITS2 sequence analysis. In conclusion, identification of medically important yeasts by ITS sequencing, especially using the ITS2 region, is reliable and can be used as an accurate alternative to conventional identification methods. PMID:16517841

  19. Optimized System Identification

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan; Longman, Richard W.

    1999-01-01

    In system identification, one usually cares most about finding a model whose outputs are as close as possible to the true system outputs when the same input is applied to both. However, most system identification algorithms do not minimize this output error. Often they minimize model equation error instead, as in typical least-squares fits using a finite-difference model, and it is seen here that this distinction is significant. Here, we develop a set of system identification algorithms that minimize output error for multi-input/multi-output and multi-input/single-output systems. This is done with sequential quadratic programming iterations on the nonlinear least-squares problems, with an eigendecomposition to handle indefinite second partials. This optimization minimizes a nonlinear function of many variables, and hence can converge to local minima. To handle this problem, we start the iterations from the OKID (Observer/Kalman Identification) algorithm result. Not only has OKID proved very effective in practice, it minimizes an output error of an observer which has the property that as the data set gets large, it converges to minimizing the criterion of interest here. Hence, it is a particularly good starting point for the nonlinear iterations here. Examples show that the methods developed here eliminate the bias that is often observed using any system identification methods of either over-estimating or under-estimating the damping of vibration modes in lightly damped structures.

  20. Identification of indigenous yeast flora isolated from the five winegrape varieties harvested in Xiangning, China.

    PubMed

    Sun, Yue; Guo, Jingjing; Liu, Fubing; Liu, Yanlin

    2014-03-01

    Inoculated fermentation by selected indigenous yeast strains from a specific location could provide the wine with unique regional sensory characteristics. The identification and differentiation of local yeasts are the first step to understand the function of yeasts and develop a better strain-selection program for winemaking. The indigenous yeasts in five grape varieties, Chardonnay, Cabernet Franc, Cabernet Sauvignon, Marselan, and Merlot cultivated in Xiangning, Shanxi, China were investigated. Eight species of seven genera including Aureobasidium pullulans, Candida zemplinina, Hanseniaspora uvarum, Hanseniaspora occidentalis, Issatchenkia terricola, Metschnikowia pulcherrima, Pichia kluyveri, and Saccharomyces cerevisiae were identified using Wallerstein Laboratory Nutrient medium with sequencing of the 26S rDNA D1/D2 domain. H. uvarum and S. cerevisiae were the predominant species, while most non-Saccharomyces species were present in the whole fermentation process at different levels among the grape varieties. The genotypes of S. cerevisiae from each microvinification were determined by using interdelta sequence analysis. The 102 isolates showed eight different genotypes, and genotype III was the predominant genotype found. The distribution of S. cerevisiae strains during the fermentation of Marselan was also studied. Six genotypes were observed among the 92 strains with different genotypes of competitiveness at different sampling stages. Genotype V demonstrated the potential for organizing starter strains and avoiding inefficient fermentation. In general, this study explored the yeast species in the grapes grown in Xiangning County and provided important information of relationship of local yeast diversity and its regional wine sensory characteristics.

  1. [Identification of the functional groups of yeast thiamine pyrophosphokinase].

    PubMed

    Voskoboev, A I; Grinevich, V P

    1978-10-01

    The content of free sulfhydril groups in yeast thiamine pyrophosphokinase (EC 2.7.6.2) was studied. Their blocking was found not to affect considerably the enzyme activity. N-bromsuccinimide developes the inhibitory effect only if taken in excessive concentrations, which indicates that tryptophane has no key position for the enzyme-substrate complex formation. On account of high speed of photoinactivation with Rose bengale and methilene blue, sigmoid dependence of activity loss on pH under irradiation, characteristic narrowing of the modified enzyme absorption spectrum, it is suggested that imidazole residue of the histidine is one of the functional groups of thiamine pyrophosphokinase.

  2. Optimal Inputs for System Identification.

    DTIC Science & Technology

    1995-09-01

    The derivation of the power spectral density of the optimal input for system identification is addressed in this research. Optimality is defined in...identification potential of general System Identification algorithms, a new and efficient System Identification algorithm that employs Iterated Weighted Least

  3. [The gas-liquid cromatography with mass spectrometry for the identification of yeasts].

    PubMed

    Paredes-Salido, F; Mira-Gutiérrez, J; Sasián-Macías, P; García-Martos, P

    2001-03-01

    Methods based on gas chromatography, have been used for identification of the yeasts. In order to know the value of the patterns obtained by this method, we have used this technique and mass spectrometry on 44 strains belonging to 16 genus and 21 species of collection yeasts, identifying the corresponding peaks to 22 fatty acids methyl esters by means of the reaction times of the corresponding standards and the confirmation of molecular weigh by mass spectrometry. The correlation coefficient was of 0.848965. The chromatographic technique seems of great utility for the determination of lipidotypes.

  4. The combined rapid detection and species-level identification of yeasts in simulated blood culture using a colorimetric sensor array

    PubMed Central

    Lim, Sung H.; Wilson, Deborah A.; SalasVargas, Ana Victoria; Churi, Yair S.; Rhodes, Paul A.; Mazzone, Peter J.; Procop, Gary W.

    2017-01-01

    Background A colorimetric sensor array (CSA) has been demonstrated to rapidly detect and identify bacteria growing in blood cultures by obtaining a species-specific “fingerprint” of the volatile organic compounds (VOCs) produced during growth. This capability has been demonstrated in prokaryotes, but has not been reported for eukaryotic cells growing in culture. The purpose of this study was to explore if a disposable CSA could differentially identify 7 species of pathogenic yeasts growing in blood culture. Methods Culture trials of whole blood inoculated with a panel of clinically important pathogenic yeasts at four different microorganism loads were performed. Cultures were done in both standard BacT/Alert and CSA-embedded bottles, after adding 10 mL of spiked blood to each bottle. Color changes in the CSA were captured as images by an optical scanner at defined time intervals. The captured images were analyzed to identify the yeast species. Time to detection by the CSA was compared to that in the BacT/Alert system. Results One hundred sixty-two yeast culture trials were performed, including strains of several species of Candida (Ca. albicans, Ca. glabrata, Ca. parapsilosis, and Ca. tropicalis), Clavispora (synonym Candida) lusitaniae, Pichia kudriavzevii (synonym Candida krusei) and Cryptococcus neoformans, at loads of 8.2 × 105, 8.3 × 103, 8.5 × 101, and 1.7 CFU/mL. In addition, 8 negative trials (no yeast) were conducted. All negative trials were correctly identified as negative, and all positive trials were detected. Colorimetric responses were species-specific and did not vary by inoculum load over the 500000-fold range of loads tested, allowing for accurate species-level identification. The mean sensitivity for species-level identification by CSA was 74% at detection, and increased with time, reaching almost 95% at 4 hours after detection. At an inoculum load of 1.7 CFU/mL, mean time to detection with the CSA was 6.8 hours (17%) less than with the

  5. Systematic identification of cell size regulators in budding yeast

    PubMed Central

    Soifer, Ilya; Barkai, Naama

    2014-01-01

    Cell size is determined by a complex interplay between growth and division, involving multiple cellular pathways. To identify systematically processes affecting size control in G1 in budding yeast, we imaged and analyzed the cell cycle of millions of individual cells representing 591 mutants implicated in size control. Quantitative metric distinguished mutants affecting the mechanism of size control from the majority of mutants that have a perturbed size due to indirect effects modulating cell growth. Overall, we identified 17 negative and dozens positive size control regulators, with the negative regulators forming a small network centered on elements of mitotic exit network. Some elements of the translation machinery affected size control with a notable distinction between the deletions of parts of small and large ribosomal subunit: parts of small ribosomal subunit tended to regulate size control, while parts of the large subunit affected cell growth. Analysis of small cells revealed additional size control mechanism that functions in G2/M, complementing the primary size control in G1. Our study provides new insights about size control mechanisms in budding yeast. PMID:25411401

  6. Performance of mass spectrometric identification of bacteria and yeasts routinely isolated in a clinical microbiology laboratory using MALDI-TOF MS

    PubMed Central

    Wang, Weiping; Xi, Haiyan; Huang, Mei; Wang, Jie; Fan, Ming; Chen, Yong; Shao, Haifeng

    2014-01-01

    Background Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is an emerging technology newly applied to identifying bacterial and yeast strains. The aim of this study was to evaluate the clinical performance of the VITEK® MS system in the identification of bacteria and yeast strains routinely isolated from clinical samples. Methods We prospectively analyzed routine MALDI-TOF mass spectrometry identification in parallel with conventional phenotypic identification of bacteria and yeasts regardless of phylum or source of isolation. Discordant results were resolved with 16S rDNA or internal transcribed spacer (ITS) gene sequencing. Colonies (a single deposit on a MALDI disposable target without any prior extraction step) were analyzed using the VITEK® MS system. Peptide spectra acquired by the system were compared with the VITEK® MS IVD database Version 2.0, and the identification scores were recorded. Results Of the 1,181 isolates (1,061 bacterial isolates and 120 yeast isolates) analyzed, 99.5% were correctly identified by MALDI-TOF mass spectrometry; 95.7% identified to the species level, 3.6% identified to the genus level, and 0.3% identified within a range of species belonging to different genera. Conversely, 0.1% of isolates were misidentified and 0.4% were unidentified, partly because the species were not included in the database. Re-testing using a second deposit provided a successful identification for 0.5% of isolates unidentified with the first deposit. Our results show that the VITEK® MS system has exceptional performance in identifying bacteria and yeast by comparing acquired peptide spectra to those contained in its database. Conclusions MALDI-TOF mass spectrometry is a rapid, accurate, and relatively inexpensive method for bacterial and yeast identification. Our results demonstrate that the VITEK® MS system is a fast and reliable technique, and has the potential to replace conventional phenotypic

  7. Identification of Yeast and Human 5-Aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAr) Transporters*

    PubMed Central

    Ceschin, Johanna; Saint-Marc, Christelle; Laporte, Jean; Labriet, Adrien; Philippe, Chloé; Moenner, Michel; Daignan-Fornier, Bertrand; Pinson, Benoît

    2014-01-01

    5-Aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAr) is the precursor of the active monophosphate form (AICAR), a small molecule with potent anti-proliferative and low energy mimetic properties. The molecular bases for AICAR toxicity at the cellular level are poorly understood. Here, we report the isolation and characterization of several yeast AICAr-hypersensitive mutants. Identification of the cognate genes allowed us to establish that thiamine transporters Thi7 and Thi72 can efficiently take up AICAr under conditions where they are overexpressed. We establish that, under standard growth conditions, Nrt1, the nicotinamide riboside carrier, is the major AICAr transporter in yeast. A study of AICAR accumulation in human cells revealed substantial disparities among cell lines and confirmed that AICAr enters cells via purine nucleoside transporters. Together, our results point to significant differences between yeast and human cells for both AICAr uptake and AICAR accumulation. PMID:24778186

  8. Technical note: use of internal transcribed spacer for ruminal yeast identification in dairy cows.

    PubMed

    Vargas-Bello-Pérez, E; Cancino-Padilla, N; Romero, J

    2016-12-01

    Molecular techniques are important tools for microbiological studies in different habitats, and the internal transcribed spacer (ITS) has been proved to be useful for analyzing fungal diversity. The aim of this study was to use the ITS region to generate ruminal yeast profile and to identify ruminal yeast. DNA from ruminal digesta was extracted to amplify the ribosomal ITS region. The profile from the PCR products was visualized and the excised bands from the profile were identified as the genera Millerozyma, Pichia, Rhizomucor and Hyphopichia. Overall, the ITS resulted to be a simple, fast and sensitive approach that allowed profiling and identification of ruminal yeast that have not been previously described (Millerozyma and Hyphopichia) in the rumen microbial community.

  9. [Presumptive identification of Candida spp. and other clinically important yeasts: usefulness of Brilliance Candida Agar].

    PubMed

    Alfonso, Claudia; López, Mónica; Arechavala, Alicia; Perrone, María Del Carmen; Guelfand, Liliana; Bianchi, Mario

    2010-06-30

    Fungal infections caused by yeasts have increased during the last decades and invasive forms represent a serious problem for human health. Candida albicans is the species most frequently isolated from clinical samples. However, other emerging yeast pathogens are increasingly responsible for mycotic infections, and some of them are resistant to some antifungal drugs. Consequently, it is necessary to have methods that can provide a rapid presumptive identification at species level. Numerous chromogenic agar media have been shown to be of value as diagnostic tools. We have compared a chromogenic medium, Brilliance Candida Agar, with CHROMagar Candida, the chromogenic medium most used in our country. A multicentre study was conducted in 16 Hospitals belonging to the Mycology Net of Buenos Aires City Government. A total of 240 yeast isolates were included in this research. The new chromogenic agar showed results very similar to those obtained with CHROMagar Candida.

  10. Identification of food and beverage spoilage yeasts from DNA sequence analyses.

    PubMed

    Kurtzman, Cletus P

    2015-11-20

    Detection, identification and classification of yeasts have undergone major changes in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of the nuclear large subunit rRNA gene and from ITS now permits many laboratories to identify species quickly and accurately, thus replacing the laborious and often inaccurate phenotypic tests previously used. Phylogenetic analysis of gene sequences has resulted in a major revision of yeast systematics resulting in redefinition of nearly all genera. This new understanding of species relationships has prompted a change of rules for naming and classifying yeasts and other fungi, and these new rules are presented in the recently implemented International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). The use of molecular methods for species identification and the impact of Code changes on classification will be discussed, especially in the context of food and beverage spoilage yeasts.

  11. Accurate identification of centromere locations in yeast genomes using Hi-C.

    PubMed

    Varoquaux, Nelle; Liachko, Ivan; Ay, Ferhat; Burton, Joshua N; Shendure, Jay; Dunham, Maitreya J; Vert, Jean-Philippe; Noble, William S

    2015-06-23

    Centromeres are essential for proper chromosome segregation. Despite extensive research, centromere locations in yeast genomes remain difficult to infer, and in most species they are still unknown. Recently, the chromatin conformation capture assay, Hi-C, has been re-purposed for diverse applications, including de novo genome assembly, deconvolution of metagenomic samples and inference of centromere locations. We describe a method, Centurion, that jointly infers the locations of all centromeres in a single genome from Hi-C data by exploiting the centromeres' tendency to cluster in three-dimensional space. We first demonstrate the accuracy of Centurion in identifying known centromere locations from high coverage Hi-C data of budding yeast and a human malaria parasite. We then use Centurion to infer centromere locations in 14 yeast species. Across all microbes that we consider, Centurion predicts 89% of centromeres within 5 kb of their known locations. We also demonstrate the robustness of the approach in datasets with low sequencing depth. Finally, we predict centromere coordinates for six yeast species that currently lack centromere annotations. These results show that Centurion can be used for centromere identification for diverse species of yeast and possibly other microorganisms.

  12. Rapid Identification of Candida Species and Other Clinically Important Yeast Species by Flow Cytometry†

    PubMed Central

    Page, Brent T.; Kurtzman, Cletus P.

    2005-01-01

    Two rapid diagnostic assays, utilizing two different Luminex flow cytometry methods, were developed for identification of clinically important ascomycetous yeast species. Direct hybridization and allele-specific primer extension methods were both successful in establishing a DNA-based assay that can rapidly and accurately identify Candida albicans, Candida krusei, Candida parapsilosis, Candida glabrata, and Candida tropicalis as well as other clinical species. The direct hybridization assay was designed to identify a total of 19 ascomycetous yeast species, and the allele-specific primer extension assay was designed to identify a total of 34 species. Probes were validated against 438 strains representing 303 species. From culture to identification, the allele-specific primer extension method takes 8 h and the direct hybridization method takes less than 5 h to complete. These assays represent comprehensive, rapid tests that are well suited for the clinical laboratory. PMID:16145099

  13. Rapid identification of moulds and arthroconidial yeasts from positive blood cultures by MALDI-TOF mass spectrometry.

    PubMed

    de Almeida, João N; Sztajnbok, Jaques; da Silva, Afonso Rafael; Vieira, Vinicius Adriano; Galastri, Anne Layze; Bissoli, Leandro; Litvinov, Nadia; Del Negro, Gilda Maria Barbaro; Motta, Adriana Lopes; Rossi, Flávia; Benard, Gil

    2016-11-01

    Moulds and arthroconidial yeasts are potential life-threatening agents of fungemia in immunocompromised patients. Fast and accurate identification (ID) of these pathogens hastens initiation of targeted antifungal therapy, thereby improving the patients' prognosis. We describe a new strategy that enabled the identification of moulds and arthroconidial yeasts directly from positive blood cultures by MALDI-TOF mass spectrometry (MS). Positive blood cultures (BCs) with Gram staining showing hyphae and/or arthroconidia were prospectively selected and submitted to an in-house protein extraction protocol. Mass spectra were obtained by Vitek MS™ system, and identifications were carried out with in the research use only (RUO) mode with an extended database (SARAMIS™ [v.4.12] plus in-house database). Fusarium solani, Fusarium verticillioides, Exophiala dermatitidis, Saprochaete clavata, and Trichosporon asahii had correct species ID by MALDI-TOF MS analysis of positive BCs. All cases were related to critically ill patients with high mortality fungemia and direct ID from positive BCs was helpful for rapid administration of targeted antifungal therapy.

  14. Immobilized yeast bioreactor systems for continuous beer fermentation

    PubMed

    Tata; Bower; Bromberg; Duncombe; Fehring; Lau; Ryder; Stassi

    1999-01-01

    Two different types of immobilized yeast bioreactors were examined for continuous fermentation of high-gravity worts. One of these is a fluidized bed reactor (FBR) that employs porous glass beads for yeast immobilization. The second system is a loop reactor containing a porous silicon carbide cartridge (SCCR) for immobilizing the yeast cells. Although there was some residual fermentable sugar in the SCCR system product, nearly complete attenuation of the wort sugars was achieved in either of the systems when operated as a two-stage process. Fermentation could be completed in these systems in only half the time required for a conventional batch process. Both the systems showed similar kinetics of extract consumption, and therefore similar volumetric productivity. As compared to the batch fermentation, total fusel alcohols were lower; total esters, while variable, were generally higher. The yeast biomass production was similar to that in a conventional fermentation process. As would be expected in an accelerated fermentation system, the levels of vicinal diketones (VDKs) were higher. To remove the VDKs, the young beer was heat-treated to convert the VDK precursors and processed through a packed bed immobilized yeast bioreactor for VDK assimilation. The finished product from the FBR system was found to be quite acceptable from a flavor perspective, albeit different from the product from a conventional batch process. Significantly shortened fermentation times demonstrate the feasibility of this technology for beer production.

  15. In vitro reconstruction of the mitochondrial translation system of yeast.

    PubMed Central

    Pfisterer, J; Buetow, D E

    1981-01-01

    We have isolated the translation system from yeast mitochondria and have reconstructed it in vitro. This submitochondrial system, composed of mitochondrial ribosomes, tRNA, pH 5 fraction and mRNA, is maximally active at 10 mM Mg2+ and 100 mM KCl or NH4Cl. NH4+ is more stimulatory than K+. Added Escherichia coli tRNA gives less than half the activity obtained with added mitochondrial tRNA. Activity is enhanced with protease inhibitors but not with Ca2+, spermine, or spermidine. In contrast to heterologous translation systems, the present system produces products with molecular weights similar to those of products synthesized by yeast mitochondria in vivo and by intact yeast mitochondria in vitro. The results support the idea that the unique coding features of the mitochondrial genome require a unique translation system for accurate translation of mitochondrial mRNAs. Images PMID:6946437

  16. Identification of catalytically important residues in yeast transketolase.

    PubMed

    Wikner, C; Nilsson, U; Meshalkina, L; Udekwu, C; Lindqvist, Y; Schneider, G

    1997-12-16

    The possible roles of four histidine residues in the active site of yeast transketolase were examined by site-directed mutagenesis. Replacement of the invariant His69 with alanine yielded a mutant enzyme with 1.5% of the specific activity of the wild-type enzyme and with an increased KM for the donor. This residue is located at the bottom of the substrate cleft close to the C1 hydroxyl group of the donor substrate, and the side chain of His69 might be required for recognition of this hydroxyl group and possibly for maintenance of the proper orientation of the reaction intermediate, (alpha, beta-dihydroxyethyl)thiamin diphosphate. Amino acid replacements of His481 by alanine, serine, and glutamine resulted in mutant enzymes with significantly increased KM values for the donor substrate and specific activities of 4.4%, 1.9%, and 5.5% of the wild-type enzyme. The kinetic data suggest that this residue, although close to the C2 carbonyl oxygen of the substrate, is not absolutely required for stabilization of the negative charge that develops at this oxygen in the transition state. This points toward the 4'-NH2 group of the pyrimidine ring of thiamin diphosphate as the major source of charge stabilization. Mutations at positions His30 and His263 result in mutant enzymes severely impaired in catalytic activity (1.5% and less of the activity of wild-type transketolase). The KM value for the donor substrate was increased for the His30Ala mutant but remained unchanged in the His263Ala enzyme. The side chains of both residues interact with the C3 hydroxyl group of the donor substrate, and the results indicate that the two residues act in concert during proton abstraction of the C3 hydroxyl proton during catalysis.

  17. Polyphasic identification of yeasts isolated from bark of cork oak during the manufacturing process of cork stoppers.

    PubMed

    Villa-Carvajal, Mercedes; Coque, Juan José R; Alvarez-Rodríguez, María Luísa; Uruburu, Federico; Belloch, Carmela

    2004-05-01

    A two-step protocol was used for the identification of 52 yeasts isolated from bark of cork oak at initial stages of the manufacturing process of cork stoppers. The first step in the identification was the separation of the isolates into groups by their physiological properties and RFLPs of the ITS-5.8S rRNA gene. The second step was the sequencing of the D1/D2 domains of the 26S rRNA gene of selected isolates representing the different groups. The results revealed a predominance of basidiomycetous yeasts (11 species), while only two species represented the ascomycetous yeasts. Among the basidiomycetous yeasts, members representing the species Rhodosporidium kratochvilovae and Rhodotorula nothofagi, that have been previously isolated from plant material, were the most abundant. Yeasts pertaining to the species Debaryomyces hansenii var. fabryii, Rhodotorula mucilaginosa and Trichosporon mucoides were isolated in small numbers.

  18. Heat Transfer Parametric System Identification

    DTIC Science & Technology

    1993-06-01

    Transfer Parametric System Identification 6. AUTHOR(S Parker, Gregory K. 7. PERFORMING ORGANIZATION NAME(S) AND AOORESS(ES) 8. PERFORMING ORGANIZATION...distribution is unlimited. Heat Transfer Parametric System Identification by Gregory K. Parker Lieutenant, United States Navy BS., DeVry Institute of...Modeling Concept ........ ........... 3 2. Lumped Parameter Approach ...... ......... 4 3. Parametric System Identification ....... 4 B. BASIC MODELING

  19. Sloshing II - system identification.

    NASA Astrophysics Data System (ADS)

    Ishizaki, H.; Suzuki, S.; Mikami, Y.; Takahashi, R.; Matsuda, K.

    1995-11-01

    The forced oscillation of a liquid in a cylindrical vessel is investigated. The authors mean that system identification are determination of the model parameters for the system from measurement data. The system is a mercury basin to be used for calibrating the astronomical zenith for the Photoelectric Meridian Circle (PMC). The analytic model is the long wave with correction term for viscosity. The oscillation is transmitted from the pier of PMC to the mercury. The frequency response characteristics of the sloshing amplitude and phase were experimentally obtained by the cross spectrum method. The authors identified the frequency response as the transfer function of the analytical model.

  20. A shuttle mutagenesis system for tagging genes in the yeast Yarrowia lipolytica.

    PubMed

    Neuvéglise, C; Nicauda, J M; Ross-Macdonald, P; Gaillardin, C

    1998-06-15

    A shuttle mutagenesis system was developed for the dimorphic yeast Yarrowia lipolytica. This system combines transposon insertions generated in Escherichia coli with the transformation of yeast with the Tn-mutagenized DNA. The mini-transposon mTn-3xHA/GFP, used in Saccharomyces cerevisiae for producing stable insertions, was adapted for use in the yeast Y. lipolytica. The mTnYl1 transposon (for mini-Tn of Y. lipolytica) confers resistance to tetracycline in E. coli. It also contains the Y. lipolytica URA3 gene for selection of yeast transformants, and the coding sequence for the S65T mutant form of GFP. The rare cutter endonuclease, I-SceI, restriction site, which enables identification of the chromosomal localization of mutagenized genes, was also incorporated. mTnYl1 was first tested on the ACO1 gene, which encodes an Acyl CoA oxidase isozyme. The mutagenesis system was further validated on a Y. lipolytica genomic DNA library constructed in a pHSS6 derivative vector. Mutants with a particular morphology or defective for alkane, fatty acids and oil degradation were obtained.

  1. Yeasts identification in microfluidic devices using peptide nucleic acid fluorescence in situ hybridization (PNA-FISH).

    PubMed

    Ferreira, André M; Cruz-Moreira, Daniela; Cerqueira, Laura; Miranda, João M; Azevedo, Nuno F

    2017-03-01

    Peptide nucleic acid fluorescence in situ hybridization (PNA-FISH) is a highly specific molecular method widely used for microbial identification. Nonetheless, and due to the detection limit of this technique, a time-consuming pre-enrichment step is typically required before identification. In here we have developed a lab-on-a-chip device to concentrate cell suspensions and speed up the identification process in yeasts. The PNA-FISH protocol was optimized to target Saccharomyces cerevisiae, a common yeast that is very relevant for several types of food industries. Then, several coin-sized microfluidic devices with different geometries were developed. Using Computational fluid dynamics (CFD), we modeled the hydrodynamics inside the microchannels and selected the most promising options. SU-8 structures were fabricated based on the selected designs and used to produce polydimethylsiloxane-based microchips by soft lithography. As a result, an integrated approach combining microfluidics and PNA-FISH for the rapid identification of S. cerevisiae was achieved. To improve fluid flow inside microchannels and the PNA-FISH labeling, oxygen plasma treatment was applied to the microfluidic devices and a new methodology to introduce the cell suspension and solutions into the microchannels was devised. A strong PNA-FISH signal was observed in cells trapped inside the microchannels, proving that the proposed methodology works as intended. The microfluidic designs and PNA-FISH procedure described in here should be easily adaptable for detection of other microorganisms of similar size.

  2. High-throughput screening of improved protease inhibitors using a yeast cell surface display system and a yeast cell chip.

    PubMed

    Aoki, Wataru; Yoshino, Yuichi; Morisaka, Hironobu; Tsunetomo, Keiji; Koyo, Hirotaka; Kamiya, Shinji; Kawata, Noriyuki; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2011-01-01

    Protease-targeted inhibitors have been promising pharmaceuticals. Here, we combined a yeast cell surface display system with a yeast cell chip for the high-throughput screening of protease inhibitors, and succeeded in improving the activity of a protease inhibitor.

  3. Yeast Augmented Network Analysis (YANA): a new systems approach to identify therapeutic targets for human genetic diseases

    PubMed Central

    Wiley, David J.; Juan, Ilona; Le, Hao; Cai, Xiaodong; Baumbach, Lisa; Beattie, Christine; D'Urso, Gennaro

    2014-01-01

    Genetic interaction networks that underlie most human diseases are highly complex and poorly defined. Better-defined networks will allow identification of a greater number of therapeutic targets. Here we introduce our Yeast Augmented Network Analysis (YANA) approach and test it with the X-linked spinal muscular atrophy (SMA) disease gene UBA1. First, we express UBA1 and a mutant variant in fission yeast and use high-throughput methods to identify fission yeast genetic modifiers of UBA1. Second, we analyze available protein-protein interaction network databases in both fission yeast and human to construct UBA1 genetic networks. Third, from these networks we identified potential therapeutic targets for SMA. Finally, we validate one of these targets in a vertebrate (zebrafish) SMA model. This study demonstrates the power of combining synthetic and chemical genetics with a simple model system to identify human disease gene networks that can be exploited for treating human diseases. PMID:25075304

  4. Yeast Prions: Structure, Biology, and Prion-Handling Systems

    PubMed Central

    Shewmaker, Frank P.; Bateman, David A.; Edskes, Herman K.; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E.

    2015-01-01

    SUMMARY A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. PMID:25631286

  5. Yeast prions: structure, biology, and prion-handling systems.

    PubMed

    Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E

    2015-03-01

    A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants.

  6. Are the Conventional Commercial Yeast Identification Methods Still Helpful in the Era of New Clinical Microbiology Diagnostics? A Meta-Analysis of Their Accuracy.

    PubMed

    Posteraro, Brunella; Efremov, Ljupcho; Leoncini, Emanuele; Amore, Rosarita; Posteraro, Patrizia; Ricciardi, Walter; Sanguinetti, Maurizio

    2015-08-01

    Accurate identification of pathogenic species is important for early appropriate patient management, but growing diversity of infectious species/strains makes the identification of clinical yeasts increasingly difficult. Among conventional methods that are commercially available, the API ID32C, AuxaColor, and Vitek 2 systems are currently the most used systems in routine clinical microbiology. We performed a systematic review and meta-analysis to estimate and to compare the accuracy of the three systems, in order to assess whether they are still of value for the species-level identification of medically relevant yeasts. After adopting rigorous selection criteria, we included 26 published studies involving Candida and non-Candida yeasts that were tested with the API ID32C (674 isolates), AuxaColor (1,740 isolates), and Vitek 2 (2,853 isolates) systems. The random-effects pooled identification ratios at the species level were 0.89 (95% confidence interval [CI], 0.80 to 0.95) for the API ID32C system, 0.89 (95% CI, 0.83 to 0.93) for the AuxaColor system, and 0.93 (95% CI, 0.89 to 0.96) for the Vitek 2 system (P for heterogeneity, 0.255). Overall, the accuracy of studies using phenotypic analysis-based comparison methods was comparable to that of studies using molecular analysis-based comparison methods. Subanalysis of studies conducted on Candida yeasts showed that the Vitek 2 system was significantly more accurate (pooled ratio, 0.94 [95% CI, 0.85 to 0.99]) than the API ID32C system (pooled ratio, 0.84 [95% CI, 0.61 to 0.99]) and the AuxaColor system (pooled ratio, 0.76 [95% CI, 0.67 to 0.84]) with respect to uncommon species (P for heterogeneity, <0.05). Subanalysis of studies conducted on non-Candida yeasts (i.e., Cryptococcus, Rhodotorula, Saccharomyces, and Trichosporon) revealed pooled identification accuracies of ≥98% for the Vitek 2, API ID32C (excluding Cryptococcus), and AuxaColor (only Rhodotorula) systems, with significant low or null levels of

  7. Are the Conventional Commercial Yeast Identification Methods Still Helpful in the Era of New Clinical Microbiology Diagnostics? A Meta-Analysis of Their Accuracy

    PubMed Central

    Efremov, Ljupcho; Leoncini, Emanuele; Amore, Rosarita; Posteraro, Patrizia; Ricciardi, Walter

    2015-01-01

    Accurate identification of pathogenic species is important for early appropriate patient management, but growing diversity of infectious species/strains makes the identification of clinical yeasts increasingly difficult. Among conventional methods that are commercially available, the API ID32C, AuxaColor, and Vitek 2 systems are currently the most used systems in routine clinical microbiology. We performed a systematic review and meta-analysis to estimate and to compare the accuracy of the three systems, in order to assess whether they are still of value for the species-level identification of medically relevant yeasts. After adopting rigorous selection criteria, we included 26 published studies involving Candida and non-Candida yeasts that were tested with the API ID32C (674 isolates), AuxaColor (1,740 isolates), and Vitek 2 (2,853 isolates) systems. The random-effects pooled identification ratios at the species level were 0.89 (95% confidence interval [CI], 0.80 to 0.95) for the API ID32C system, 0.89 (95% CI, 0.83 to 0.93) for the AuxaColor system, and 0.93 (95% CI, 0.89 to 0.96) for the Vitek 2 system (P for heterogeneity, 0.255). Overall, the accuracy of studies using phenotypic analysis-based comparison methods was comparable to that of studies using molecular analysis-based comparison methods. Subanalysis of studies conducted on Candida yeasts showed that the Vitek 2 system was significantly more accurate (pooled ratio, 0.94 [95% CI, 0.85 to 0.99]) than the API ID32C system (pooled ratio, 0.84 [95% CI, 0.61 to 0.99]) and the AuxaColor system (pooled ratio, 0.76 [95% CI, 0.67 to 0.84]) with respect to uncommon species (P for heterogeneity, <0.05). Subanalysis of studies conducted on non-Candida yeasts (i.e., Cryptococcus, Rhodotorula, Saccharomyces, and Trichosporon) revealed pooled identification accuracies of ≥98% for the Vitek 2, API ID32C (excluding Cryptococcus), and AuxaColor (only Rhodotorula) systems, with significant low or null levels of

  8. High-Throughput Identification of Bacteria and Yeast by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry in Conventional Medical Microbiology Laboratories ▿

    PubMed Central

    van Veen, S. Q.; Claas, E. C. J.; Kuijper, Ed J.

    2010-01-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is suitable for high-throughput and rapid diagnostics at low costs and can be considered an alternative for conventional biochemical and molecular identification systems in a conventional microbiological laboratory. First, we evaluated MALDI-TOF MS using 327 clinical isolates previously cultured from patient materials and identified by conventional techniques (Vitek-II, API, and biochemical tests). Discrepancies were analyzed by molecular analysis of the 16S genes. Of 327 isolates, 95.1% were identified correctly to genus level, and 85.6% were identified to species level by MALDI-TOF MS. Second, we performed a prospective validation study, including 980 clinical isolates of bacteria and yeasts. Overall performance of MALDI-TOF MS was significantly better than conventional biochemical systems for correct species identification (92.2% and 83.1%, respectively) and produced fewer incorrect genus identifications (0.1% and 1.6%, respectively). Correct species identification by MALDI-TOF MS was observed in 97.7% of Enterobacteriaceae, 92% of nonfermentative Gram-negative bacteria, 94.3% of staphylococci, 84.8% of streptococci, 84% of a miscellaneous group (mainly Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella [HACEK]), and 85.2% of yeasts. MALDI-TOF MS had significantly better performance than conventional methods for species identification of staphylococci and genus identification of bacteria belonging to HACEK group. Misidentifications by MALDI-TOF MS were clearly associated with an absence of sufficient spectra from suitable reference strains in the MALDI-TOF MS database. We conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria (except for pneumococci and viridans streptococci) and yeasts in a medical microbiological laboratory. PMID:20053859

  9. High-throughput identification of bacteria and yeast by matrix-assisted laser desorption ionization-time of flight mass spectrometry in conventional medical microbiology laboratories.

    PubMed

    van Veen, S Q; Claas, E C J; Kuijper, Ed J

    2010-03-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is suitable for high-throughput and rapid diagnostics at low costs and can be considered an alternative for conventional biochemical and molecular identification systems in a conventional microbiological laboratory. First, we evaluated MALDI-TOF MS using 327 clinical isolates previously cultured from patient materials and identified by conventional techniques (Vitek-II, API, and biochemical tests). Discrepancies were analyzed by molecular analysis of the 16S genes. Of 327 isolates, 95.1% were identified correctly to genus level, and 85.6% were identified to species level by MALDI-TOF MS. Second, we performed a prospective validation study, including 980 clinical isolates of bacteria and yeasts. Overall performance of MALDI-TOF MS was significantly better than conventional biochemical systems for correct species identification (92.2% and 83.1%, respectively) and produced fewer incorrect genus identifications (0.1% and 1.6%, respectively). Correct species identification by MALDI-TOF MS was observed in 97.7% of Enterobacteriaceae, 92% of nonfermentative Gram-negative bacteria, 94.3% of staphylococci, 84.8% of streptococci, 84% of a miscellaneous group (mainly Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella [HACEK]), and 85.2% of yeasts. MALDI-TOF MS had significantly better performance than conventional methods for species identification of staphylococci and genus identification of bacteria belonging to HACEK group. Misidentifications by MALDI-TOF MS were clearly associated with an absence of sufficient spectra from suitable reference strains in the MALDI-TOF MS database. We conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria (except for pneumococci and viridans streptococci) and yeasts in a medical microbiological laboratory.

  10. Identification of predominant yeasts associated with artisan Mexican cocoa fermentations using culture-dependent and culture-independent approaches.

    PubMed

    Arana-Sánchez, A; Segura-García, L E; Kirchmayr, M; Orozco-Ávila, I; Lugo-Cervantes, E; Gschaedler-Mathis, A

    2015-02-01

    The process of cocoa fermentation is a very important step for the generation or aromatic compounds, which are attributable to the metabolism of the microorganisms involved. There are some reports about this process and the identification of microorganisms; however, there are no reports identifying the yeasts involved in a Mexican cocoa fermentation process using molecular biology techniques, including restricted fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE). The aim of this study was to identify the main yeast species associated with Mexican cocoa fermentations employing culture-dependent and -independent techniques achieving two samplings with a 1 year time difference at the same site. Isolation of the microorganisms was performed in situ. Molecular identification of yeast isolates was achieved by RFLP analysis and rDNA sequencing. Total DNA from the microorganisms on the cocoa beans was utilized for the DGGE analysis. Bands from the DGGE gels were excised and sequenced. Nineteen isolated yeasts were identified (al specie level), three of which had never before been associated with cocoa fermentations worldwide. The detected predominant yeast varied from one technique to another. Hanseniaspora sp. resulted dominant in DGGE however Saccharomyces cerevisiae was the principal isolated species. In conclusion, the culture-dependent and -independent techniques complement each other showing differences in the main yeasts involved in spontaneous cocoa fermentation, probably due to the physiological states of the viable but non culturable yeasts. Furthermore important differences between the species detected in the two samplings were detected.

  11. Molecular identification and osmotolerant profile of wine yeasts that ferment a high sugar grape must.

    PubMed

    Tofalo, Rosanna; Chaves-López, Clemencia; Di Fabio, Federico; Schirone, Maria; Felis, Giovanna E; Torriani, Sandra; Paparella, Antonello; Suzzi, Giovanna

    2009-04-15

    The objective of this study was to examine the Saccharomyces and non-Saccharomyces yeast populations involved in a spontaneous fermentation of a traditional high sugar must (Vino cotto) produced in central Italy. Molecular identification of a total of 78 isolates was achieved by a combination of PCR-RFLP of the 5.8S ITS rRNA region and sequencing of the D1/D2 domain of the 26S rRNA gene. In addition, the isolates were differentiated by RAPD-PCR. Only a restricted number of osmotolerant yeast species, i.e. Candida apicola, Candida zemplinina and Zygosaccharomyces bailii, were found throughout all the fermentation process, while Saccharomyces cerevisiae prevailed after 15 days of fermentation. A physiological characterization of isolates was performed in relation to the resistance to osmotic stress and ethanol concentration. The osmotolerant features of C. apicola, C. zemplinina and Z. bailii were confirmed, while S. cerevisiae strains showed three patterns of growth in response to different glucose concentrations (2%, 20%, 40% and 60% w/v). The ability of some C. apicola and C. zemplinina strains to grow at 14% v/v ethanol is noteworthy. The finding that some yeast biotypes with higher multiple stress tolerance can persist in the entire winemaking process suggests possible future candidates as starter for Vino cotto production.

  12. Comparison of the Accuracy of Two Conventional Phenotypic Methods and Two MALDI-TOF MS Systems with That of DNA Sequencing Analysis for Correctly Identifying Clinically Encountered Yeasts

    PubMed Central

    Chao, Qiao-Ting; Lee, Tai-Fen; Teng, Shih-Hua; Peng, Li-Yun; Chen, Ping-Hung; Teng, Lee-Jene; Hsueh, Po-Ren

    2014-01-01

    We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) systems (Bruker Biotyper and Vitek MS) and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID) with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex) levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database), Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar) systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis) were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD) system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD) system, 39 (43.8%), including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5%) by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati) isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii complex

  13. Impact of yeast systems biology on industrial biotechnology.

    PubMed

    Petranovic, Dina; Vemuri, Goutham N

    2009-11-01

    Systems biology is yet an emerging discipline that aims to quantitatively describe and predict the functioning of a biological system. This nascent discipline relies on the recent advances in the analytical technology (such as DNA microarrays, mass spectromety, etc.) to quantify cellular characteristics (such as gene expression, protein and metabolite abundance, etc.) and computational methods to integrate information from these measurements. The model eukaryote, Saccharomyces cerevisiae, has played a pivotal role in the development of many of these analytical and computational methods and consequently is the biological system of choice for testing new hypotheses. The knowledge gained from such studies in S. cerevisiae is proving to be extremely useful in designing metabolism that is targeted to specific industrial applications. As a result, the portfolio of products that are being produced using this yeast is expanding rapidly. We review the recent developments in yeast systems biology and how they relate to industrial biotechnology.

  14. Efficient Identification of Clinically Relevant Candida Yeast Species by Use of an Assay Combining Panfungal Loop-Mediated Isothermal DNA Amplification with Hybridization to Species-Specific Oligonucleotide Probes▿

    PubMed Central

    Inácio, João; Flores, Orfeu; Spencer-Martins, Isabel

    2008-01-01

    The occurrence of invasive mycoses has progressively increased in recent years. Yeasts of the genus Candida remain the leading etiologic agents of those infections. Early identification of opportunistic yeasts may contribute significantly to improved disease management and the selection of appropriate antifungal therapy. We developed a rapid and reliable molecular identification system for clinically relevant yeasts that makes use of nonspecific primers to amplify a region of the 26S rRNA gene, followed by reverse hybridization of the digoxigenin-labeled products to a panel of species-specific oligonucleotide probes arranged on a nylon membrane macroarray format. DNA amplification was achieved by the recently developed loop-mediated isothermal DNA amplification technology, a promising option for the development of improved laboratory diagnostic kits. The newly developed method was successful in distinguishing among the major clinically relevant yeasts associated with bloodstream infections by using simple, rapid, and cost-effective procedures and equipment. PMID:18077626

  15. Clinical evaluation of the FilmArray blood culture identification panel in identification of bacteria and yeasts from positive blood culture bottles.

    PubMed

    Altun, Osman; Almuhayawi, Mohammed; Ullberg, Måns; Ozenci, Volkan

    2013-12-01

    The FilmArray platform (FA; BioFire, Salt Lake City, UT) is a closed diagnostic system allowing high-order multiplex PCR analysis with automated readout of results directly from positive blood cultures in 1 h. In the present study, we evaluated the clinical performance of the FilmArray blood culture identification (BCID) panel, which includes 19 bacteria, five yeasts, and three antibiotic resistance genes. In total, 206 blood culture bottles were included in the study. The FilmArray could identify microorganisms in 153/167 (91.6%) samples with monomicrobial growth. Thirteen of the 167 (7.8%) microorganisms were not covered by the FilmArray BCID panel. In 6/167 (3.6%) samples, the FilmArray detected an additional microorganism compared to blood culture. When polymicrobial growth was analyzed, the FilmArray could detect all target microorganisms in 17/24 (71%) samples. Twelve blood culture bottles that yielded a positive signal but showed no growth were also negative by FilmArray. In 3/206 (1.5%) bottles, the FilmArray results were invalid. The results of the FilmArray were reproducible, as demonstrated by the testing and retesting of five bottles in the same day and a longitudinal follow-up of five other blood cultures up to 4 weeks. The present study shows that the FilmArray is a rapid identification method with high performance in direct identification of bacteria and yeasts from positive blood culture bottles.

  16. Identification of genes whose expressions are enhanced or reduced in baker's yeast during fed-batch culture process using molasses medium by DNA microarray analysis.

    PubMed

    Shima, Jun; Kuwazaki, Seigo; Tanaka, Fumiko; Watanabe, Hajime; Yamamoto, Hideki; Nakajima, Ryoichi; Tokashiki, Tadaaki; Tamura, Hiromi

    2005-06-25

    Genes whose expression levels are enhanced or reduced during the cultivation process that uses cane molasses in baker's yeast production were identified in this study. The results showed that baker's yeast grown in molasses medium had higher fermentation ability and stress tolerance compared with baker's yeast grown in synthetic medium. Molasses apparently provided not only sugar as a carbon source but also provided functional components that enhanced or reduced expression of genes involved in fermentation ability and stress tolerance. To identify the genes whose expression is enhanced or reduced during cultivation in molasses medium, DNA microarray analysis was then used to compare the gene expression profile of cells grown in molasses with that of cells grown in synthetic medium. To simulate the commercial baker's yeast production process, cells were cultivated using a fed-batch culture system. In molasses medium, genes involved in the synthesis or uptake of vitamins (e.g., biotin, pyridoxine and thiamine) showed enhanced expression, suggesting that vitamin concentrations in molasses medium were lower than those in synthetic medium. Genes involved in formate dehydrogenase and maltose assimilation showed enhanced expression in molasses medium. In contrast, genes involved in iron utilization (e.g., siderophore, iron transporter and ferroxidase) showed enhanced expression in synthetic medium, suggesting that iron starvation occurred. The genes involved in the metabolism of amino acids also showed enhanced expression in synthetic medium. This identification of genes provides information that will help improve the baker's yeast production process.

  17. Mapping the interactions of dengue virus NS1 protein with human liver proteins using a yeast two-hybrid system: identification of C1q as an interacting partner.

    PubMed

    Silva, Emiliana M; Conde, Jonas N; Allonso, Diego; Nogueira, Mauricio L; Mohana-Borges, Ronaldo

    2013-01-01

    Dengue constitutes a global health concern. The clinical manifestation of this disease varies from mild febrile illness to severe hemorrhage and/or fatal hypovolemic shock. Flavivirus nonstructural protein 1 (NS1) is a secreted glycoprotein that is displayed on the surface of infected cells but is absent in viral particles. NS1 accumulates at high levels in the plasma of dengue virus (DENV)-infected patients, and previous reports highlight its involvement in immune evasion, dengue severity, liver dysfunction and pathogenesis. In the present study, we performed a yeast two-hybrid screen to search for DENV2 NS1-interacting partners using a human liver cDNA library. We identified fifty genes, including human complement component 1 (C1q), which was confirmed by coimmunoprecipitation, ELISA and immunofluorescence assays, revealing for the first time the direct binding of this protein to NS1. Furthermore, the majority of the identified genes encode proteins that are secreted into the plasma of patients, and most of these proteins are classified as acute-phase proteins (APPs), such as plasminogen, haptoglobin, hemopexin, α-2-HS-glycoprotein, retinol binding protein 4, transferrin, and C4. The results presented here confirm the direct interaction of DENV NS1 with a key protein of the complement system and suggest a role for this complement protein in the pathogenesis of DENV infection.

  18. A yeast screen system for aromatase inhibitors and ligands for androgen receptor: yeast cells transformed with aromatase and androgen receptor.

    PubMed

    Mak, P; Cruz, F D; Chen, S

    1999-11-01

    Endocrine disruptors are hormone mimics that modify hormonal action in humans and animals. It is thought that some endocrine disruptors modify estrogen and androgen action in humans and animals by suppressing aromatase activity. Aromatase cytochrome P450 is the key enzyme that converts C19 androgens to aromatic C18 estrogenic steroids. We have developed a novel aromatase inhibitor screening method that allows us to identify antiaromatase activity of various environmental chemicals. The screen was developed by coexpressing the human aromatase and the mouse androgen receptor in yeast cells, which carry the androgen-responsive ss-galactosidase reporter plasmid. Functional expression of aromatase in yeast has been demonstrated using the [3H]-water release assay with intact cells as well as with yeast microsomes. The aromatase activity could be blocked by known aromatase inhibitors such as aminoglutethimide (AG). Yeast-produced androgen receptors were able to transactivate a yeast basal promoter linked to an androgen-responsive element in response to androgens. The resultant triple yeast transformant responded to the treatment of testosterone, androstenedione, or 5 alpha-dihydrotestosterone (5 alpha-DHT). In the absence of the aromatase inhibitor AG, transcriptional activation was observed only for the nonaromatizable androgen 5 alpha-DHT. However, the two aromatizable androgens (testosterone and androstenedione) induced the reporter activity in the presence of AG. Using this yeast-based assay, we confirmed that two flavones, chrysin and alpha-naphtholflavone, are inhibitors of aromatase. Thus, this yeast system allows us to develop a high-throughput screening method, without using radioactive substrate, to identify aromatase inhibitors as well as new ligands (nonaromatizable androgen mimics) for the androgen receptors. In addition, this screening method also allows us to distinguish nonandrogenic aromatase inhibitors from inhibitors with androgenic activity. This yeast

  19. Killer systems of the yeast Saccharomyces cerevisiae

    SciTech Connect

    Nesterova, G.F.

    1989-01-01

    The killer systems of Saccharomyces cerevisiae are an unusual class of cytoplasmic symbionts of primitive eukaryotes. The genetic material of these symbionts is double-stranded RNA. They are characterized by the linearity of the genome, its fragmentation into a major and a minor fraction, which replicate separately, and their ability to control the synthesis of secretory mycocin proteins possessing a toxic action on closely related strains. The secretion of mycocins at the same time ensures acquiring of resistance to them. Strains containing killer symbionts are toxigenic and resistant to the action of their own toxin, but strains that are free of killer double-stranded RNAs are sensitive to the action of mycocins. The killer systems of S. cerevisiae have retained features relating them to viruses and are apparently the result of evolution of infectious viruses. The occurrences of such systems among monocellular eukaryotic organisms is an example of complication of the genome by means of its assembly from virus-like components. We discuss the unusual features of replication and the expression of killer systems and their utilization in the construction of vector molecules.

  20. Development of a novel, simple and rapid molecular identification system for clinical Candida species.

    PubMed

    Deák, R; Bodai, L; Aarts, H J M; Maráz, A

    2004-08-01

    Identification of clinical yeast isolates causing candidiasis is routinely performed by commercial yeast identification systems based on biochemical, morphological and physiological tests. These systems require 3-5 days and the proportion of identifications that are incorrect is high. Our novel and rapid molecular identification system for clinical Candida species is based on the analysis of restriction patterns obtained from PCR-generated ribosomal DNA sequences using five restriction enzymes. A software package (CandID) was designed to include a database of restriction fragment length polymorphism (RFLP) patterns for 29 Candida species. For 'in-house' validation, 122 clinical isolates that had previously identified in clinical laboratories were typed by this system. These clinical isolates were also independently re-identified by the API 20C AUX system. The ribosomal DNA RFLP database in the context of supporting analytical software allowed simple and rapid (1 work day) identification.

  1. [Identification and susceptibility against fluconazole and albaconazole of 100 yeasts' strains isolated from vaginal discharge].

    PubMed

    Arechavala, Alicia I; Bianchi, Mario H; Robles, Ana María; Santiso, Gabriela; Negroni, Ricardo

    2007-12-31

    Vulvovaginal candidiasis is a condition that affects a great number of fertile women. It is considered the second cause of genital infection after vaginosis due to GAM complex. Candida albicans is the most frequent isolated species from vaginal discharge. However, sometimes more than one yeast species could be found in the same clinical sample that are more resistant to antifungal drugs. Nowadays, it is necessary to identify properly up to species level the isolated microorganism and to determine the antifungal susceptibility profile. One hundred strains obtained from vaginal discharge of 94 patients suffering acute vulvovaginal candidiasis were studied. The identification of the isolates showed: C. albicans 86%, Candida glabrata 6%, Candida inconspicua 3%, Candida krusei 2% and Candida intermedia, Candida holmii and Trichosporon asahii one case each. Minimal inhibitory concentrations (MIC) of all the yeasts against fluconazole and albaconazole were performed. C. glabrata, C. krusei and C. inconspicua were the most resistant against fluconazole, on the other hand albicans was susceptible to this drug. All the isolates presented MIC against albaconazole much lower than fluconazole.

  2. NADP Regulates the Yeast GAL Induction System

    SciTech Connect

    Kumar,P.; Yao, Y.; Sternglanz, R.; Johnston, S.; Joshua-Tor, L.

    2008-01-01

    Transcriptional regulation of the galactose-metabolizing genes in Saccharomyces cerevisiae depends on three core proteins: Gal4p, the transcriptional activator that binds to upstream activating DNA sequences (UASGAL); Gal80p, a repressor that binds to the carboxyl terminus of Gal4p and inhibits transcription; and Gal3p, a cytoplasmic transducer that, upon binding galactose and adenosine 5'-triphosphate, relieves Gal80p repression. The current model of induction relies on Gal3p sequestering Gal80p in the cytoplasm. However, the rapid induction of this system implies that there is a missing factor. Our structure of Gal80p in complex with a peptide from the carboxyl-terminal activation domain of Gal4p reveals the existence of a dinucleotide that mediates the interaction between the two. Biochemical and in vivo experiments suggests that nicotinamide adenine dinucleotide phosphate (NADP) plays a key role in the initial induction event.

  3. Yeast-hybrid based high-throughput assay for identification of anthrax lethal factor inhibitors.

    PubMed

    Kim, Joungmok; Park, Hae-Chul; Gedi, Vinayakumar; Park, Hye-Yeon; Roberts, Arthur G; Atkins, William M; Yoon, Moon-Young

    2011-01-07

    Inhibitors of anthrax lethal factor (LF) are currently being sought as effective therapeutics for the treatment of anthrax. Here we report a novel screening approach for inhibitors of LF, a yeast-hybrid-based assay system in which the expression of reporter genes from a Gal4 promoter is repressed by LF proteolytic activity. Yeast cells were co-transformed with LF and a chimeric transcription factor that contains an LF substrate sequence inserted between the DNA-binding and activation domains of Gal4. In the resulting yeast cells, LF cleaves the substrate, thus inactivating the chimeric Gal4 and resulting in lack of expression of reporter genes. Compounds that inhibit LF cleavage of its substrate are identified by changes in reporter gene activity. Relative to in vitro screens for inhibitors of LF proteolytic activity, this screen has the advantage of excluding compounds that are toxic or non-permeable to eukaryotic cells. Additionally, the screen has the advantage of being fast, easy and cheap because exogenous LF and substrate are not needed. An initial chemical library screen with this system has identified four candidate inhibitors which were confirmed to inhibit LF protease activity in an in vitro assay. Furthermore, FBS-00831, one of the compounds identified, protects Raw 264.7 macrophages from anthrax lethal toxin and the possible binding site on LF was also evaluated by molecular docking.

  4. Routine use of CHROMagar Candida medium for presumptive identification of Candida yeast species and detection of mixed fungal populations.

    PubMed

    Bouchara, Jean-Philippe; Declerck, Philippe; Cimon, Bernard; Planchenault, Claire; de Gentile, Ludovic; Chabasse, Dominique

    1996-02-01

    OBJECTIVE: To assess the value of the new differential culture medium CHROMagar Candida for routine investigation of clinical specimens. METHODS: During a whole year, 6150 clinical samples were plated on CHROMagar Candida medium. After incubation, the green colonies were considered to be Candida albicans. The colonies of other colors were identified using Bichrolatex-krusei, or by their assimilation pattern on ID 32C test strips and their morphology on rice cream-agar-Tween. RESULTS: Among the 6150 clinical samples, 1643 were positive for fungi. Aspergillus fumigatus and Geotrichum sp. were the predominant filamentous fungi isolated. Candida albicans was the most common species isolated (1274 of the positive samples; 77.5%), and Candida glabrata was the second most common yeast isolated (174 positive samples; 10.6%). Other yeast species were detected at lower frequencies, mainly Candida tropicalis (3.8%), Candida krusei (2.7%), Saccharomyces cerevisiae (2.7%) and Candida kefyr (2.3%), and 16 samples revealed a lipophilic species, Malassezia furfur. Mixed fungal populations accounted for 14.7% of the positive samples. Two or more yeast species were detected in 206 of the 242 specimens containing mixed fungal populations, and five yeast species were detected in one sample. Additionally, we did not observe significant differences in the isolation of yeasts or filamentous fungi from the 366 samples simultaneously plated on CHROMagar Candida and Sabouraud dextrose agar. Close agreement between the two culture media was observed for 89.9% of these samples. CONCLUSIONS: CHROMagar Candida medium was shown to be extremely helpful in a routine clinical mycology service, facilitating the detection of mixed cultures of yeasts and allowing direct identification of C. albicans, as well as rapid presumptive identification of the other yeasts: C. glabrata, C. tropicalis, C. krusei and S. cerevisiae. This chromogenic medium thus appears to be suitable as a primary culture medium

  5. Utilization of size polymorphism in ITS1 and ITS2 regions for identification of pathogenic yeast species.

    PubMed

    Khodadadi, Hossein; Karimi, Ladan; Jalali-Zand, Niloufar; Adin, Hassan; Mirhendi, Hossein

    2017-01-09

    Despite the existence of a variety of available yeast identification strategies, easier and more cost-effective methods are required for routine use in clinical laboratories. The internal transcribed spacer (ITS) regions of fungal rRNA genes exhibit variable sizes depending on the yeast species. In the present study, fragment size polymorphism (FSP) analysis of the ITS1 and ITS2 regions for identification of the clinically most important yeast species was assessed. The ITS1 and ITS2 regions of 190 strains, including isolates of 31 standard strains and 159 clinical isolates, were separately PCR-amplified with two primer sets: ITS1-ITS2 and ITS3-ITS4. PCR products were mixed and the two-band electrophoretic pattern of each sample was analysed according to the size of the ITS regions as predicted from the GenBank database. Using this method and avoiding expensive tools such as sequencing or capillary electrophoresis, we were able to differentiate nearly all pathogenic yeast species, including Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, Candida krusei, Candida guilliermondii, Candida kefyr, Candida lusitaniae, Candida rugosa, Cryptococcus neoformans, and Saccharomyces cerevisiae. The method showed limited discriminatory power to differentiate species of the Candida parapsilosis complex. Differentiation of C. albicans and C. tropicalis needs already identified controls. Nevertheless, the method benefits from advantages such as lower cost, higher speed and wider range of species than some commercial yeast-identification methods. We consider this method one of the easiest molecular approaches for identifying a wide range of human pathogenic yeast species, applicable to both diagnostic and epidemiological purposes.

  6. Influence of the farming system on the epiphytic yeasts and yeast-like fungi colonizing grape berries during the ripening process.

    PubMed

    Martins, Guilherme; Vallance, Jessica; Mercier, Anne; Albertin, Warren; Stamatopoulos, Panagiotis; Rey, Patrice; Lonvaud, Aline; Masneuf-Pomarède, Isabelle

    2014-05-02

    Grape berries are colonized by a wide array of epiphytic microorganisms such as yeast and filamentous fungi. This microbiota plays a major role in crop health and also interferes with the winemaking process. In this study, culture-dependent and -independent methods were used to investigate the dynamics and diversity of the yeast and yeast-like microorganisms on the grape berry surface during maturation and the influence of cropping systems in this microflora. The results showed a significant impact of both the farming system and the maturity stage on the epiphytic yeast and yeast-like community. A quantitative approach based on counting cultivable populations indicated an increase in the yeast and yeast-like population during the grape ripening process, reaching a maximum when the berries became overripe. The cultivable yeast and yeast-like population also varied significantly depending on the farming system. Microorganism counts were significantly higher for organically- than conventionally-farmed grapes. The yeast and yeast-like community structures were analysed by culture independent methods, using CE-SSCP. The results revealed changes in the genetic structure of the yeast and yeast-like community throughout the ripening process, as well as the impact of the farming system. Copper-based fungicide treatments were revealed as the main factor responsible for the differences in microbial population densities between samples of different farming systems. The results showed a negative correlation between copper levels and yeast and yeast-like populations, providing evidence that copper inhibited this epiphytic community. Taken together, our results showed that shifts in the microbial community were related to changes in the composition of the grape-berry surface, particularly sugar exudation and the occurrence of copper residues from pesticide treatments.

  7. Evaluation of MALDI-TOF mass spectrometry for identification of environmental yeasts and development of supplementary database.

    PubMed

    Agustini, Bruna Carla; Silva, Luciano Paulino; Bloch, Carlos; Bonfim, Tania M B; da Silva, Gildo Almeida

    2014-06-01

    Yeast identification using traditional methods which employ morphological, physiological, and biochemical characteristics can be considered a hard task as it requires experienced microbiologists and a rigorous control in culture conditions that could implicate in different outcomes. Considering clinical or industrial applications, the fast and accurate identification of microorganisms is a crescent demand. Hence, molecular biology approaches has been extensively used and, more recently, protein profiling using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has proved to be an even more efficient tool for taxonomic purposes. Nonetheless, concerning to mass spectrometry, data available for the differentiation of yeast species for industrial purpose is limited and reference databases commercially available comprise almost exclusively clinical microorganisms. In this context, studies focusing on environmental isolates are required to extend the existing databases. The development of a supplementary database and the assessment of a commercial database for taxonomic identifications of environmental yeast are the aims of this study. We challenge MALDI-TOF MS to create protein profiles for 845 yeast strains isolated from grape must and 67.7 % of the strains were successfully identified according to previously available manufacturer database. The remaining 32.3 % strains were not identified due to the absence of a reference spectrum. After matching the correct taxon for these strains by using molecular biology approaches, the spectra concerning the missing species were added in a supplementary database. This new library was able to accurately predict unidentified species at first instance by MALDI-TOF MS, proving it is a powerful tool for the identification of environmental yeasts.

  8. Assessment of Reproducibility of Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry for Bacterial and Yeast Identification.

    PubMed

    Westblade, Lars F; Garner, Omai B; MacDonald, Karen; Bradford, Constance; Pincus, David H; Mochon, A Brian; Jennemann, Rebecca; Manji, Ryhana; Bythrow, Maureen; Lewinski, Michael A; Burnham, Carey-Ann D; Ginocchio, Christine C

    2015-07-01

    Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) has revolutionized the identification of clinical bacterial and yeast isolates. However, data describing the reproducibility of MALDI-TOF MS for microbial identification are scarce. In this study, we show that MALDI-TOF MS-based microbial identification is highly reproducible and can tolerate numerous variables, including differences in testing environments, instruments, operators, reagent lots, and sample positioning patterns. Finally, we reveal that samples of bacterial and yeast isolates prepared for MALDI-TOF MS identification can be repeatedly analyzed without compromising organism identification.

  9. A yeast screen system for aromatase inhibitors and ligands for androgen receptor: yeast cells transformed with aromatase and androgen receptor.

    PubMed Central

    Mak, P; Cruz, F D; Chen, S

    1999-01-01

    Endocrine disruptors are hormone mimics that modify hormonal action in humans and animals. It is thought that some endocrine disruptors modify estrogen and androgen action in humans and animals by suppressing aromatase activity. Aromatase cytochrome P450 is the key enzyme that converts C19 androgens to aromatic C18 estrogenic steroids. We have developed a novel aromatase inhibitor screening method that allows us to identify antiaromatase activity of various environmental chemicals. The screen was developed by coexpressing the human aromatase and the mouse androgen receptor in yeast cells, which carry the androgen-responsive ss-galactosidase reporter plasmid. Functional expression of aromatase in yeast has been demonstrated using the [3H]-water release assay with intact cells as well as with yeast microsomes. The aromatase activity could be blocked by known aromatase inhibitors such as aminoglutethimide (AG). Yeast-produced androgen receptors were able to transactivate a yeast basal promoter linked to an androgen-responsive element in response to androgens. The resultant triple yeast transformant responded to the treatment of testosterone, androstenedione, or 5 alpha-dihydrotestosterone (5 alpha-DHT). In the absence of the aromatase inhibitor AG, transcriptional activation was observed only for the nonaromatizable androgen 5 alpha-DHT. However, the two aromatizable androgens (testosterone and androstenedione) induced the reporter activity in the presence of AG. Using this yeast-based assay, we confirmed that two flavones, chrysin and alpha-naphtholflavone, are inhibitors of aromatase. Thus, this yeast system allows us to develop a high-throughput screening method, without using radioactive substrate, to identify aromatase inhibitors as well as new ligands (nonaromatizable androgen mimics) for the androgen receptors. In addition, this screening method also allows us to distinguish nonandrogenic aromatase inhibitors from inhibitors with androgenic activity. This yeast

  10. A yeast pheromone-based inter-species communication system.

    PubMed

    Hennig, Stefan; Clemens, André; Rödel, Gerhard; Ostermann, Kai

    2015-02-01

    We report on a pheromone-based inter-species communication system, allowing for a controlled cell-cell communication between the two species Saccharomyces cerevisiae and Schizosaccharomyces pombe as a proof of principle. It exploits the mating response pathways of the two yeast species employing the pheromones, α- or P-factor, as signaling molecules. The authentic and chimeric pheromone-encoding genes were engineered to code for the P-factor in S. cerevisiae and the α-factor in S. pombe. Upon transformation of the respective constructs, cells were enabled to express the mating pheromone of the opposite species. The supernatant of cultures of S. pombe cells expressing α-factor were able to induce a G1 arrest in the cell cycle, a change in morphology to the typical shmoo effect and expression driven by the pheromone-responsive FIG1 promoter in S. cerevisiae. The supernatant of cultures of S. cerevisiae cells expressing P-factor similarly induced cell cycle arrest in G1, an alteration in morphology typical for mating as well as the activation of the pheromone-responsive promoters of the rep1 and sxa2 genes in a pheromone-hypersensitive reporter strain of S. pombe. Apparently, both heterologous pheromones were correctly processed and secreted in an active form by the cells of the other species. Our data clearly show that the species-specific pheromone systems of yeast species can be exploited for a controlled inter-species communication.

  11. Parametric Identification of Systems Via Linear Operators.

    DTIC Science & Technology

    1978-09-01

    A general parametric identification /approximation model is developed for the black box identification of linear time invariant systems in terms of... parametric identification techniques derive from the general model as special cases associated with a particular linear operator. Some possible

  12. Comparison of use of phenotypic and genotypic characteristics for identification of species of the anamorph genus Candida and related teleomorph yeast species.

    PubMed

    Latouche, G N; Daniel, H M; Lee, O C; Mitchell, T G; Sorrell, T C; Meyer, W

    1997-12-01

    A total of 49 type and neotype isolates and 32 clinical isolates of the anamorph genus Candida and related teleomorph genera were obtained from different culture collections and clinical laboratories. Isolates were subjected to two phenotypic methods of identification, Vitek yeast biochemical card (YBC) and API ID 32C, both based on carbohydrate assimilation, and one genotypic method, PCR fingerprinting, based on the detection of DNA polymorphisms between minisatellite-specific sequences with the primer M13 (5' GAGGGTGGCGGTTCT 3'). The correct identification of a strain at the Centraalbureau voor Schimmelcultures was used as the gold standard for the identification of an isolate. When the study was restricted to species included in the respective biochemical databases, the Vitek YBC and API ID 32C systems performed adequately with positive identification rates of 87.3 and 76.8%, respectively. When uncommon species were added to the study, several of which are not included in the databases, the identification efficiencies were 76.5 and 77.5%, respectively. By comparison, all isolates were correctly identified by PCR fingerprinting, with 63 reference species profiles in the databank. Sufficient polymorphisms among the total set of banding patterns were observed, with adequate similarity in the major patterns obtained from a given species, to allow each isolate to be assigned unambiguously to a particular species. In addition, variations in minor bands allowed for differentiation to the strain level. PCR fingerprinting was found to be rapid, reproducible, and more cost-effective than either biochemical approach. Our results provide reference laboratories with an improved identification method for yeasts based on genotypic rather than phenotypic markers.

  13. Comparison of use of phenotypic and genotypic characteristics for identification of species of the anamorph genus Candida and related teleomorph yeast species.

    PubMed Central

    Latouche, G N; Daniel, H M; Lee, O C; Mitchell, T G; Sorrell, T C; Meyer, W

    1997-01-01

    A total of 49 type and neotype isolates and 32 clinical isolates of the anamorph genus Candida and related teleomorph genera were obtained from different culture collections and clinical laboratories. Isolates were subjected to two phenotypic methods of identification, Vitek yeast biochemical card (YBC) and API ID 32C, both based on carbohydrate assimilation, and one genotypic method, PCR fingerprinting, based on the detection of DNA polymorphisms between minisatellite-specific sequences with the primer M13 (5' GAGGGTGGCGGTTCT 3'). The correct identification of a strain at the Centraalbureau voor Schimmelcultures was used as the gold standard for the identification of an isolate. When the study was restricted to species included in the respective biochemical databases, the Vitek YBC and API ID 32C systems performed adequately with positive identification rates of 87.3 and 76.8%, respectively. When uncommon species were added to the study, several of which are not included in the databases, the identification efficiencies were 76.5 and 77.5%, respectively. By comparison, all isolates were correctly identified by PCR fingerprinting, with 63 reference species profiles in the databank. Sufficient polymorphisms among the total set of banding patterns were observed, with adequate similarity in the major patterns obtained from a given species, to allow each isolate to be assigned unambiguously to a particular species. In addition, variations in minor bands allowed for differentiation to the strain level. PCR fingerprinting was found to be rapid, reproducible, and more cost-effective than either biochemical approach. Our results provide reference laboratories with an improved identification method for yeasts based on genotypic rather than phenotypic markers. PMID:9399515

  14. Systems identification - reprise and projections

    NASA Technical Reports Server (NTRS)

    Taylor, L. W., Jr.

    1974-01-01

    A state-of-the-arts review is given for the field of system identification. Progress in the field is traced from the early models of dynamic systems by Sir Isaac Newton up to the present day use of advanced techniques for numerous applications.

  15. Yeast as a model system for mammalian seven-transmembrane segment receptors

    SciTech Connect

    Jeansonne, N.E.

    1994-05-01

    Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomal location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.

  16. Identification of yeast proteins necessary for cell-surface function of a potassium channel.

    PubMed

    Haass, Friederike A; Jonikas, Martin; Walter, Peter; Weissman, Jonathan S; Jan, Yuh-Nung; Jan, Lily Y; Schuldiner, Maya

    2007-11-13

    Inwardly rectifying potassium (Kir) channels form gates in the cell membrane that regulate the flow of K(+) ions into and out of the cell, thereby influencing the membrane potential and electrical signaling of many cell types, including neurons and cardiomyocytes. Kir-channel function depends on other cellular proteins that aid in the folding of channel subunits, assembly into tetrameric complexes, trafficking of quality-controlled channels to the plasma membrane, and regulation of channel activity at the cell surface. We used the yeast Saccharomyces cerevisiae as a model system to identify proteins necessary for the functional expression of a mammalian Kir channel at the cell surface. A screen of 376 yeast strains, each lacking one nonessential protein localized to the early secretory pathway, identified seven deletion strains in which functional expression of the Kir channel at the plasma membrane was impaired. Six deletions were of genes with known functions in trafficking and lipid biosynthesis (sur4Delta, csg2Delta, erv14Delta, emp24Delta, erv25Delta, and bst1Delta), and one deletion was of an uncharacterized gene (yil039wDelta). We provide genetic and functional evidence that Yil039wp, a conserved, phosphoesterase domain-containing protein, which we named "trafficking of Emp24p/Erv25p-dependent cargo disrupted 1" (Ted1p), acts together with Emp24p/Erv25p in cargo exit from the endoplasmic reticulum (ER). The seven yeast proteins identified in our screen likely impact Kir-channel functional expression at the level of vesicle budding from the ER and/or the local lipid environment at the plasma membrane.

  17. Identification of bottom-fermenting yeast genes expressed during lager beer fermentation.

    PubMed

    Yoshida, Satoshi; Hashimoto, Kaori; Shimada, Emiko; Ishiguro, Tatsuji; Minato, Toshiko; Mizutani, Satoru; Yoshimoto, Hiroyuki; Tashiro, Kosuke; Kuhara, Satoru; Kobayashi, Osamu

    2007-07-01

    It has been proposed that bottom-fermenting yeast strains of Saccharomyces pastorianus possess at least two types of genomes. Sequences of genes of one genome [S. cerevisiae (Sc)-type] have been found to be highly homologous (more than 90% identity) to S. cerevisiae S288C sequences, while those of the other [Lager (Lg)-type] are less so. To identify and discriminate Lg-type from Sc-type genes expressed during lager beer fermentation, normalized cDNA libraries were constructed and analysed. From approximately 22 000 ESTs, 3892 Sc-type and 2695 Lg-type ORFs were identified. Expression patterns of Sc- and Lg-type genes did not correlate with particular cell functions in KEGG classification system. Moreover, 405 independent clones were isolated that have no significant homology with sequences in the S288C database, suggesting that they include the bottom-fermenting yeast-specific (BFY) genes. Most of BFY genes have significant homology with the S. bayanus genome.

  18. New and emerging yeast pathogens.

    PubMed Central

    Hazen, K C

    1995-01-01

    The most common yeast species that act as agents of human disease are Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis, and Cryptococcus neoformans. The incidence of infections by other yeasts has increased during the past decade. The most evident emerging pathogens are Malassezia furfur, Trichosporon beigelii, Rhodotorula species, Hansenula anomala, Candida lusitaniae, and Candida krusei. Organisms once considered environmental contaminants or only industrially important, such as Candida utilis and Candida lipolytica, have now been implicated as agents of fungemia, onychomycosis, and systemic disease. The unusual yeasts primarily infect immunocompromised patients, newborns, and the elderly. The role of central venous catheter removal and antifungal therapy in patient management is controversial. The antibiograms of the unusual yeasts range from resistant to the most recent azoles and amphotericin B to highly susceptible to all antifungal agents. Current routine methods for yeast identification may be insufficient to identify the unusual yeasts within 2 days after isolation. The recognition of unusual yeasts as agents of sometimes life-threatening infection and their unpredictable antifungal susceptibilities increase the burden on the clinical mycology laboratory to pursue complete species identification and MIC determinations. Given the current and evolving medical practices for management of seriously ill patients, further evaluations of the clinically important data about these yeasts are needed. PMID:8665465

  19. Ribosomal DNA spacer probes for yeast identification: studies in the genus Metschnikowia.

    PubMed

    Henriques, M; Sá-Nogueira, I; Giménez-Jurado, G; van Uden, N

    1991-02-01

    To test whether DNA probes derived from ribosomal DNA spacer sequences are suitable for rapid and species-specific yeast identification, a pilot study was undertaken. A 7.7 kb entire ribosomal DNA unit of the type strain of Metschnikowia reukaufii was isolated, cloned and mapped. A 0.65 kb BamHI-HpaI fragment containing non-transcribed spacer sequences was amplified and selected for testing as a 32P hybridization probe with total DNA from the type strains of M. reukaufii, M. pulcherrima, M. lunata, M. bicuspidata, M. australis, M. zobellii, M. krissii, five other strains identified as M. reukaufii and strains of Schizosaccharomyces pombe, Hansenula canadensis, Saccharomyces cerevisiae and Yarrowia lipolytica. The probe hybridized exclusively with DNA from the type strain and four other strains of M. reukaufii. DNA from one strain labelled M. reukaufii did not hybridize with the probe. Subsequent % G + C comparison and DNA-DNA reassociation with the type strain revealed that the non-hybridizing strain does not belong to the species M. reukaufii.

  20. Significance of molecular identification and antifungal susceptibility of clinically significant yeasts and moulds in a global antifungal surveillance programme.

    PubMed

    Pfaller, Michael A; Woosley, Leah N; Messer, Shawn A; Jones, Ronald N; Castanheira, Mariana

    2012-10-01

    The increasing diversity of opportunistic fungi causing serious invasive fungal infections (IFI) has been documented. Accurate identification (ID) is important in guiding therapy, determining prognosis for IFIs and in epidemiological surveys. We assessed the utility of PCR-based methods for the ID of yeasts and moulds that either were uncommon, failed conventional ID, or represented unusual biochemical or phenotypic profiles of common species. Among 1,790 viable fungal clinical isolates received during the SENTRY Program in 2010, 322 strains from 40 study sites had ID confirmed by molecular methods. Isolates were previously identified in participant institutions. Yeasts that were not confirmed by morphology on CHROMagar, growth at 45 °C (Candida albicans/dubliniensis), or assimilation of trehalose (C. glabrata) as well as non-Candida yeasts and all moulds were amplified and sequenced using primers amplifying one or more of the following genes: ITS, 28S, β-tubulin (Aspergillus spp.), TEF (Fusarium spp.), IGS (Trichosporon spp.). The isolates selected for molecular ID included 149 isolates of Candida species, 77 of Aspergillus species, 73 non-Candida yeasts, and 23 other moulds (a total of 41 different species). Overall, the ID determined by the submitting site was confirmed for 189 isolates (58.7 %): Aspergillus spp. (64.1 % correct); Candida spp. (60.1 % correct); non-Candida yeasts (58.9 % correct); non-Aspergillus moulds (30.4 % correct). Species with high levels of concordance between conventional and molecular ID included A. fumigatus (95.0  %), C. lusitaniae (100 %), C. dubliniensis (92.3 %), C. kefyr (100 %), and C. neoformans (90.2 %). Only 50.0 % of isolates of C. albicans and 59.1 % of C. glabrata selected due to unusual phenotypic or biochemical features were found to be correctly identified by the submitting site. Molecular methods for the identification of fungal pathogens are an important adjunct to the conventional identification of

  1. Automated drug identification system

    NASA Technical Reports Server (NTRS)

    Campen, C. F., Jr.

    1974-01-01

    System speeds up analysis of blood and urine and is capable of identifying 100 commonly abused drugs. System includes computer that controls entire analytical process by ordering various steps in specific sequences. Computer processes data output and has readout of identified drugs.

  2. QUASILINEARIZATION, SYSTEM IDENTIFICATION, AND PREDICTION

    DTIC Science & Technology

    regime in an effort to improve the quality of the control exerted. A mathematical formulation and computational solution of the problems of system ... identification and the determination of unmeasurable state variables on the basis of observations of a process, two topics of central importance in the

  3. [Performance evaluation of Rapid™ Yeast Plus (Remel) system from two different culture media].

    PubMed

    Romeo, Ana M; Snitman, Gabriela V; Marucco, Andrea P; Ponce, Graciela Del V; Cataldi, Silvana P; Guelfand, Liliana I; Arechavala, Alicia

    Within the genus Candida, Candida albicans is the most commonly isolated species from clinical samples. Due to the emergence of other species which can show a higher index of antifungal resistance, a fast identification of these species is necessary. The aim of this work was to evaluate the performance of the RapID Yeast Plus system from two different subculture media formulations: Sabouraud dextrose agar adjusted by Emmons (the medium is indicated in the equipment insert) and Sabouraud glucose agar, which is the most frequently used in Buenos Aires City laboratories. One hundred and sixty-six clinical sample strains coming from different hospitals belonging to the Mycology Network of Buenos Aires City were studied. From the obtained results, we conclude that the conditions and culture medium indicated by the manufacturer should be followed.

  4. Raman spectroscopy and chemometrics for identification and strain discrimination of the wine spoilage yeasts Saccharomyces cerevisiae, Zygosaccharomyces bailii, and Brettanomyces bruxellensis.

    PubMed

    Rodriguez, Susan B; Thornton, Mark A; Thornton, Roy J

    2013-10-01

    The yeasts Zygosaccharomyces bailii, Dekkera bruxellensis (anamorph, Brettanomyces bruxellensis), and Saccharomyces cerevisiae are the major spoilage agents of finished wine. A novel method using Raman spectroscopy in combination with a chemometric classification tool has been developed for the identification of these yeast species and for strain discrimination of these yeasts. Raman spectra were collected for six strains of each of the yeasts Z. bailii, B. bruxellensis, and S. cerevisiae. The yeasts were classified with high sensitivity at the species level: 93.8% for Z. bailii, 92.3% for B. bruxellensis, and 98.6% for S. cerevisiae. Furthermore, we have demonstrated that it is possible to discriminate between strains of these species. These yeasts were classified at the strain level with an overall accuracy of 81.8%.

  5. Raman Spectroscopy and Chemometrics for Identification and Strain Discrimination of the Wine Spoilage Yeasts Saccharomyces cerevisiae, Zygosaccharomyces bailii, and Brettanomyces bruxellensis

    PubMed Central

    Thornton, Mark A.; Thornton, Roy J.

    2013-01-01

    The yeasts Zygosaccharomyces bailii, Dekkera bruxellensis (anamorph, Brettanomyces bruxellensis), and Saccharomyces cerevisiae are the major spoilage agents of finished wine. A novel method using Raman spectroscopy in combination with a chemometric classification tool has been developed for the identification of these yeast species and for strain discrimination of these yeasts. Raman spectra were collected for six strains of each of the yeasts Z. bailii, B. bruxellensis, and S. cerevisiae. The yeasts were classified with high sensitivity at the species level: 93.8% for Z. bailii, 92.3% for B. bruxellensis, and 98.6% for S. cerevisiae. Furthermore, we have demonstrated that it is possible to discriminate between strains of these species. These yeasts were classified at the strain level with an overall accuracy of 81.8%. PMID:23913433

  6. Synthesis of a beta-estradiol-biotin chimera that potently heterodimerizes estrogen receptor and streptavidin proteins in a yeast three-hybrid system.

    PubMed

    Hussey, Stephen L; Muddana, Smita S; Peterson, Blake R

    2003-04-02

    Small molecules that dimerize proteins in living cells provide powerful probes of biological processes and have potential as tools for the identification of protein targets of natural products. We synthesized 7-alpha-substituted derivatives of beta-estradiol tethered to the natural product biotin to regulate heterodimerization of estrogen receptor (ER) and streptavidin (SA) proteins expressed as components of a yeast three-hybrid system. Addition of an estradiol-biotin chimera bearing a 19-atom linker to yeast expressing DNA-bound ER-alpha or ER-beta LexA fusion proteins and wild-type SA protein fused to the B42 activation domain activated reporter gene expression by as much as 450-fold in vivo (10 muM ligand). Comparative analysis of lower affinity Y43A (biotin Kd approximately 100 pM) and W120A (biotin Kd approximately 100 nM) mutants of SA indicated that moderate affinity interactions can be readily detected with this system. Comparison of a 7-alpha-substituted estradiol-biotin chimera with a structurally similar dexamethasone-biotin chimera revealed that yeast expressing ER proteins can detect cognate ligands with up to 5-fold greater potency and 70-fold higher activity than yeast expressing analogous glucocorticoid receptor (GR) proteins. This approach may facilitate the identification of protein targets of biologically active small molecules screened against genetically encoded libraries of proteins expressed in yeast three-hybrid systems.

  7. Rapid identification of ascomycetous yeasts from clinical specimens by a molecular method based on flow cytometry and comparison with identifications from phenotypic assays.

    PubMed

    Page, Brent T; Shields, Christine E; Merz, William G; Kurtzman, Cletus P

    2006-09-01

    This study was designed to compare the identification of ascomycetous yeasts recovered from clinical specimens by using phenotypic assays (PA) and a molecular flow cytometric (FC) method. Large-subunit rRNA domains 1 and 2 (D1/D2) gene sequence analysis was also performed and served as the reference for correct strain identification. A panel of 88 clinical isolates was tested that included representatives of nine commonly encountered species and six infrequently encountered species. The PA included germ tube production, fermentation of seven carbohydrates, morphology on corn meal agar, urease and phenoloxidase activities, and carbohydrate assimilation tests when needed. The FC method (Luminex) employed species-specific oligonucleotides attached to polystyrene beads, which were hybridized with D1/D2 amplicons from the unidentified isolates. The PA identified 81 of 88 strains correctly but misidentified 4 of Candida dubliniensis, 1 of C. bovina, 1 of C. palmioleophila, and 1 of C. bracarensis. The FC method correctly identified 79 of 88 strains and did not misidentify any isolate but did not identify nine isolates because oligonucleotide probes were not available in the current library. The FC assay takes approximately 5 h, whereas the PA takes from 2 h to 5 days for identification. In conclusion, PA did well with the commonly encountered species, was not accurate for uncommon species, and takes significantly longer than the FC method. These data strongly support the potential of FC technology for rapid and accurate identification of medically important yeasts. With the introduction of new antifungals, rapid, accurate identification of pathogenic yeasts is more important than ever for guiding antifungal chemotherapy.

  8. Identification and characterization of yeasts isolated from sedimentary rocks of Union Glacier at the Antarctica.

    PubMed

    Barahona, Salvador; Yuivar, Yassef; Socias, Gabriel; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-07-01

    The study of the yeasts that inhabit cold environments, such as Antarctica, is an active field of investigation oriented toward understanding their ecological roles in these ecosystems. In a great part, the interest in cold-adapted yeasts is due to several industrial and biotechnological applications that have been described for them. The aim of this work was to isolate and identify yeasts from sedimentary rock samples collected at the Union Glacier, Antarctica. Furthermore, the yeasts were physiologically characterized, including the production of metabolites of biotechnological interest. The yeasts isolated that were identified at the molecular level belonged to genera Collophora (1 isolate), Cryptococcus (2 isolates), Sporidiobolus (4 isolates), Sporobolomyces (1 isolate) and Torrubiella (2 isolates). The majority of yeasts were basidiomycetous and psychrotolerant. By cross-test assays for anti-yeast activity, it was determined that Collophora sp., Sporidiobolus salmonicolor, and Sporobolomyces roseus secreted a protein factor that kills Sporidiobolus metaroseus. The colored yeasts Sp. salmonicolor, Sp. metaroseus and Collophora sp. produced several carotenoid pigments that were identified as 2,3 dihydroxy-γ-carotene, -carotene, 4-ketotorulene, torulene β-cryptoxanthin and spirilloxanthin. Concerning analysis of mycosporines, these metabolites were only found in the yeasts Torrubiella sp. and Cryptococcus sp. T11-10-1. Furthermore, the yeasts were evaluated for the production of extracellular hydrolytic activities. Of the twelve activities analyzed, alkaline phosphatase, invertase, gelatinase, cellulase, amylase, and protease enzyme activities were detected. The yeasts Cryptococcus sp. T11-10-1 and Sporidiobolus metaroseus showed the highest number of different enzyme activities.

  9. MALDI-TOF MS Andromas strategy for the routine identification of bacteria, mycobacteria, yeasts, Aspergillus spp. and positive blood cultures.

    PubMed

    Bille, E; Dauphin, B; Leto, J; Bougnoux, M-E; Beretti, J-L; Lotz, A; Suarez, S; Meyer, J; Join-Lambert, O; Descamps, P; Grall, N; Mory, F; Dubreuil, L; Berche, P; Nassif, X; Ferroni, A

    2012-11-01

    All organisms usually isolated in our laboratory are now routinely identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) using the Andromas software. The aim of this study was to describe the use of this strategy in a routine clinical microbiology laboratory. The microorganisms identified included bacteria, mycobacteria, yeasts and Aspergillus spp. isolated on solid media or extracted directly from blood cultures. MALDI-TOF MS was performed on 2665 bacteria isolated on solid media, corresponding to all bacteria isolated during this period except Escherichia coli grown on chromogenic media. All acquisitions were performed without extraction. After a single acquisition, 93.1% of bacteria grown on solid media were correctly identified. When the first acquisition was not contributory, a second acquisition was performed either the same day or the next day. After two acquisitions, the rate of bacteria identified increased to 99.2%. The failures reported on 21 strains were due to an unknown profile attributed to new species (9) or an insufficient quality of the spectrum (12). MALDI-TOF MS has been applied to 162 positive blood cultures. The identification rate was 91.4%. All mycobacteria isolated during this period (22) were correctly identified by MALDI-TOF MS without any extraction. For 96.3% and 92.2% of yeasts and Aspergillus spp., respectively, the identification was obtained with a single acquisition. After a second acquisition, the overall identification rate was 98.8% for yeasts (160/162) and 98.4% (63/64) for Aspergillus spp. In conclusion, the MALDI-TOF MS strategy used in this work allows a rapid and efficient identification of all microorganisms isolated routinely.

  10. Structural Aspects of System Identification

    NASA Technical Reports Server (NTRS)

    Glover, Keith

    1973-01-01

    The problem of identifying linear dynamical systems is studied by considering structural and deterministic properties of linear systems that have an impact on stochastic identification algorithms. In particular considered is parametrization of linear systems so that there is a unique solution and all systems in appropriate class can be represented. It is assumed that a parametrization of system matrices has been established from a priori knowledge of the system, and the question is considered of when the unknown parameters of this system can be identified from input/output observations. It is assumed that the transfer function can be asymptotically identified, and the conditions are derived for the local, global and partial identifiability of the parametrization. Then it is shown that, with the right formulation, identifiability in the presence of feedback can be treated in the same way. Similarly the identifiability of parametrizations of systems driven by unobserved white noise is considered using the results from the theory of spectral factorization.

  11. In-Flight System Identification

    NASA Technical Reports Server (NTRS)

    Morelli, Eugene A.

    1998-01-01

    A method is proposed and studied whereby the system identification cycle consisting of experiment design and data analysis can be repeatedly implemented aboard a test aircraft in real time. This adaptive in-flight system identification scheme has many advantages, including increased flight test efficiency, adaptability to dynamic characteristics that are imperfectly known a priori, in-flight improvement of data quality through iterative input design, and immediate feedback of the quality of flight test results. The technique uses equation error in the frequency domain with a recursive Fourier transform for the real time data analysis, and simple design methods employing square wave input forms to design the test inputs in flight. Simulation examples are used to demonstrate that the technique produces increasingly accurate model parameter estimates resulting from sequentially designed and implemented flight test maneuvers. The method has reasonable computational requirements, and could be implemented aboard an aircraft in real time.

  12. On-Orbit System Identification

    NASA Technical Reports Server (NTRS)

    Mettler, E.; Milman, M. H.; Bayard, D.; Eldred, D. B.

    1987-01-01

    Information derived from accelerometer readings benefits important engineering and control functions. Report discusses methodology for detection, identification, and analysis of motions within space station. Techniques of vibration and rotation analyses, control theory, statistics, filter theory, and transform methods integrated to form system for generating models and model parameters that characterize total motion of complicated space station, with respect to both control-induced and random mechanical disturbances.

  13. Structural System Identification Technology Verification

    DTIC Science & Technology

    1981-11-01

    USAAVRADCOM-TR-81-D-28Q V󈧄 ADA1091 81 LEI STRUCTURAL SYSTEM IDENTIFICATION TECHNOLOGY VERIFICATION \\ N. Giansante, A. Berman, W. o. Flannelly, E...release; distribution unlimited. Prepared for APPLIED TECHNOLOGY LABORATORY U. S. ARMY RESEARCH AND TECHNOLOGY LABORATORIES (AVRADCOM) S Fort Eustis...Va. 23604 4-J" APPLI ED TECHNOLOGY LABORATORY POSITION STATEMENT The Applied Technology Laboratory has been involved in the development of the Struc

  14. Budding Yeast for Budding Geneticists: A Primer on the Saccharomyces cerevisiae Model System

    PubMed Central

    Duina, Andrea A.; Miller, Mary E.; Keeney, Jill B.

    2014-01-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans. PMID:24807111

  15. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    PubMed

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  16. Identification of yeasts during alcoholic fermentation of tchapalo, a traditional sorghum beer from Côte d'Ivoire.

    PubMed

    N'guessan, Kouadio Florent; Brou, Kouakou; Jacques, Noémie; Casaregola, Serge; Dje, Koffi Marcellin

    2011-05-01

    This study investigated the diversity and dynamics of yeasts involved in alcoholic fermentation of a traditional sorghum beer from Côte d'Ivoire, tchapalo. A total of 240 yeast strains were isolated from fermenting sorghum wort inoculated with dry yeast from two geographic regions of Côte d'Ivoire (Abidjan and Bondoukou). Initial molecular identification to the species level was carried out using RFLP of PCR-amplified internal transcribed spacers of rDNA (ITS1-5.8S-ITS2). Ten different profiles were obtained from the restriction of PCR products with the three endonucleases HaeIII, CfoI and HinfI. Sequence analysis of the D1/D2 domain of the 26S rDNA and the ACT1 gene allowed us to assign these groups to six different species: Saccharomyces cerevisiae-like, Candida tropicalis, Pichia kudriavzevii, Pichia kluyveri, Kodamaea ohmeri and Meyerozyma caribbica. The most frequent species associated with tchapalo fermentation was S. cerevisiae-like (87.36%), followed by C. tropicalis (5.45%) and M. caribbica (2.71%). S. cerevisiae-like strains were diploid heterozygotes and exhibited three to four nucleotides divergence from the type strain in the D1/D2 domain and several indels in the more discriminant sequence of the intron of the ACT1 gene. During the process, the yeast species isolated and their frequencies varied according to the geographic origin of the dry yeast. The occurrence of some species was sporadic and only two non-Saccharomyces species were found in the final product.

  17. System Identification Tools for Control Structure Interaction

    DTIC Science & Technology

    1990-01-01

    DT! FILE COPY AL-TR-89-054 AD: 00 Final Report System Identification Tools for O for the period - September 1988 to Control Structure Interaction May...Classification) System Identification Tools for Control Structure Interaction (U) 12. PERSONAL AUTHOR(S) Kosut, Robert L.; Kabuli, Guntekin M. 13a. TYPE OF...identification, dynamics, 22 01 system identification , robustness, dynamic modeling, robust 22 02 control design, control design procedure 19. ABSTRACT

  18. Automated systems for identification of microorganisms.

    PubMed Central

    Stager, C E; Davis, J R

    1992-01-01

    Automated instruments for the identification of microorganisms were introduced into clinical microbiology laboratories in the 1970s. During the past two decades, the capabilities and performance characteristics of automated identification systems have steadily progressed and improved. This article explores the development of the various automated identification systems available in the United States and reviews their performance for identification of microorganisms. Observations regarding deficiencies and suggested improvements for these systems are provided. PMID:1498768

  19. Occurrence and identification of yeast species in fermented liquid feed for piglets.

    PubMed

    Gori, Klaus; Bjørklund, Marina Kryger; Canibe, Nuria; Pedersen, Anni Øyan; Jespersen, Lene

    2011-01-01

    The major objective of the present study was to investigate the occurrence and identity of yeast species in fermented liquid feed (FLF) used for feeding piglets. In total, 40 different Danish farms were included in the analysis. The preparation and composition of FLF was found to be very heterogeneous with high variations in both yeast counts and yeast species composition. The yeast population varied between 6.0 × 10(3) and 4.2 × 10(7) cfug(-1) with an average yeast count of 8.7 × 10(6) ± 1.1 × 10(7) cfug(-1). A total of 766 yeasts were isolated and identified by conventional and/or molecular typing techniques. The predominant yeast species in the FLF samples were found to be Candida milleri (58.4%), Kazachstania exigua (17.5%), Candida pararugosa (6.40%) and Kazachstania bulderi (5.09%). No clear separation between isolates of C. milleri and Candida humilis could be obtained based on sequencing of the D1/D2 region of the 26S rRNA gene. The combined use of ITS-RFLP analysis and phenotypic criteria did meanwhile suggest a closer relationship with C. milleri than C. humilis.

  20. Yeast as a Heterologous Model System to Uncover Type III Effector Function

    PubMed Central

    Popa, Crina; Coll, Núria S.; Valls, Marc; Sessa, Guido

    2016-01-01

    Type III effectors (T3E) are key virulence proteins that are injected by bacterial pathogens inside the cells of their host to subvert cellular processes and contribute to disease. The budding yeast Saccharomyces cerevisiae represents an important heterologous system for the functional characterisation of T3E proteins in a eukaryotic environment. Importantly, yeast contains eukaryotic processes with low redundancy and are devoid of immunity mechanisms that counteract T3Es and mask their function. Expression in yeast of effectors from both plant and animal pathogens that perturb conserved cellular processes often resulted in robust phenotypes that were exploited to elucidate effector functions, biochemical properties, and host targets. The genetic tractability of yeast and its amenability for high-throughput functional studies contributed to the success of this system that, in recent years, has been used to study over 100 effectors. Here, we provide a critical view on this body of work and describe advantages and limitations inherent to the use of yeast in T3E research. “Favourite” targets of T3Es in yeast are cytoskeleton components and small GTPases of the Rho family. We describe how mitogen-activated protein kinase (MAPK) signalling, vesicle trafficking, membrane structures, and programmed cell death are also often altered by T3Es in yeast and how this reflects their function in the natural host. We describe how effector structure–function studies and analysis of candidate targeted processes or pathways can be carried out in yeast. We critically analyse technologies that have been used in yeast to assign biochemical functions to T3Es, including transcriptomics and proteomics, as well as suppressor, gain-of-function, or synthetic lethality screens. We also describe how yeast can be used to select for molecules that block T3E function in search of new antibacterial drugs with medical applications. Finally, we provide our opinion on the limitations of S

  1. Identification and characterization of yeast isolated from the elaboration of seasoned green table olives.

    PubMed

    Hernández, Alejandro; Martín, Alberto; Aranda, Emilio; Pérez-Nevado, Francisco; Córdoba, María G

    2007-06-01

    The purpose of this study was to investigate the yeast population during the processing of green table olives. In the fresh olives, yeast were found at concentrations of around 3.0 log cfu/g, with Cryptococcus spp. being predominant. In the brine, the yeast concentrations were greater than 4.9 log cfu/ml, with Pichia anomala, Kluyveromyces marxianus, and Saccharomyces cerevisiae being the predominant species. Unlike the yeast isolated from the fresh olives, the strains obtained from the olive brine mostly showed low pectolytic but high catalase activities. Some of these strains also exhibited other biochemical desirable properties for the fermentation of green table olives, including their lipolytic activities and their assimilation or production of organic acids in the brine. Seven strains in particular of P. anomala, K. marxianus, S. cerevisiae, and Candida maris showed the best properties for use in trials as starter culture in pilot fermenters.

  2. Continuous beer fermentation using immobilized yeast cell bioreactor systems.

    PubMed

    Brányik, Tomás; Vicente, António A; Dostálek, Pavel; Teixeira, José A

    2005-01-01

    Traditional beer fermentation and maturation processes use open fermentation and lager tanks. Although these vessels had previously been considered indispensable, during the past decades they were in many breweries replaced by large production units (cylindroconical tanks). These have proved to be successful, both providing operating advantages and ensuring the quality of the final beer. Another promising contemporary technology, namely, continuous beer fermentation using immobilized brewing yeast, by contrast, has found only a limited number of industrial applications. Continuous fermentation systems based on immobilized cell technology, albeit initially successful, were condemned to failure for several reasons. These include engineering problems (excess biomass and problems with CO(2) removal, optimization of operating conditions, clogging and channeling of the reactor), unbalanced beer flavor (altered cell physiology, cell aging), and unrealized cost advantages (carrier price, complex and unstable operation). However, recent development in reactor design and understanding of immobilized cell physiology, together with application of novel carrier materials, could provide a new stimulus to both research and application of this promising technology.

  3. Molecular Identification of Veterinary Yeast Isolates by Use of Sequence-Based Analysis of the D1/D2 Region of the Large Ribosomal Subunit▿

    PubMed Central

    Garner, Cherilyn D.; Starr, Jennifer K.; McDonough, Patrick L.; Altier, Craig

    2010-01-01

    Conventional methods of yeast identification are often time-consuming and difficult; however, recent studies of sequence-based identification methods have shown promise. Additionally, little is known about the diversity of yeasts identified from various animal species in veterinary diagnostic laboratories. Therefore, in this study, we examined three methods of identification by using 109 yeast samples isolated during a 1-year period from veterinary clinical samples. Comparison of the three methods—traditional substrate assimilation, fatty acid profile analysis, and sequence-based analysis of the region spanning the D1 and D2 regions (D1/D2) of the large ribosomal subunit—showed that sequence analysis provided the highest percent identification among the three. Sequence analysis identified 87% of isolates to the species level, whereas substrate assimilation and fatty acid profile analysis identified only 54% and 47%, respectively. Less-stringent criteria for identification increased the percentage of isolates identified to 98% for sequence analysis, 62% for substrate assimilation, and 55% for fatty acid profile analysis. We also found that sequence analysis of the internal transcribed spacer 2 (ITS2) region provided further identification for 36% of yeast not identified to the species level by D1/D2 sequence analysis. Additionally, we identified a large variety of yeast from animal sources, with at least 30 different species among the isolates tested, and with the majority not belonging to the common Candida spp., such as C. albicans, C. glabrata, C. tropicalis, and the C. parapsilosis group. Thus, we determined that sequence analysis of the D1/D2 region was the best method for identification of the variety of yeasts found in a veterinary population. PMID:20392917

  4. Molecular identification of veterinary yeast isolates by use of sequence-based analysis of the D1/D2 region of the large ribosomal subunit.

    PubMed

    Garner, Cherilyn D; Starr, Jennifer K; McDonough, Patrick L; Altier, Craig

    2010-06-01

    Conventional methods of yeast identification are often time-consuming and difficult; however, recent studies of sequence-based identification methods have shown promise. Additionally, little is known about the diversity of yeasts identified from various animal species in veterinary diagnostic laboratories. Therefore, in this study, we examined three methods of identification by using 109 yeast samples isolated during a 1-year period from veterinary clinical samples. Comparison of the three methods-traditional substrate assimilation, fatty acid profile analysis, and sequence-based analysis of the region spanning the D1 and D2 regions (D1/D2) of the large ribosomal subunit-showed that sequence analysis provided the highest percent identification among the three. Sequence analysis identified 87% of isolates to the species level, whereas substrate assimilation and fatty acid profile analysis identified only 54% and 47%, respectively. Less-stringent criteria for identification increased the percentage of isolates identified to 98% for sequence analysis, 62% for substrate assimilation, and 55% for fatty acid profile analysis. We also found that sequence analysis of the internal transcribed spacer 2 (ITS2) region provided further identification for 36% of yeast not identified to the species level by D1/D2 sequence analysis. Additionally, we identified a large variety of yeast from animal sources, with at least 30 different species among the isolates tested, and with the majority not belonging to the common Candida spp., such as C. albicans, C. glabrata, C. tropicalis, and the C. parapsilosis group. Thus, we determined that sequence analysis of the D1/D2 region was the best method for identification of the variety of yeasts found in a veterinary population.

  5. Identification and molecular analysis of pathogenic yeasts in droppings of domestic pigeons in Beijing, China.

    PubMed

    Wu, Yuan; Du, Peng-Cheng; Li, Wen-Ge; Lu, Jin-Xing

    2012-09-01

    Feral pigeons are known as reservoirs of pathogenic yeasts that cause opportunistic infections in human. In the outskirts of Beijing, China, pigeons are more frequently raised at homes than are encountered in public areas. Many studies have focused on the presence of pathogenic yeasts in the excreta (fresh or withered) of a variety kinds of birds, pigeon crop and cloacae. One hundred and forty-three samples of fresh droppings were collected from three suburban pigeon-raising homes in an area of northern Beijing, China. The internal transcribed sequences (ITS) of all strains (except for 8 strains of Rhodotorula sp. ) were sequenced and compared with those of the databases of the National Center for Biotechnology Information website ( http://www.ncbi.nlm.nih.gov ) using the Basic Local Alignment Search Tool (BLAST). Yeasts representing 8 genera, Cryptococcus, Filobasidium, Rhodotorula, Candida, Debaryomyces, Saccaromyces, Trichosporon and Sporidiobolus, were identified from 120 isolates. Cryptococcus was the most prolific genera represented by eight species. The populations of yeast species isolated from fresh pigeon droppings were different among homes. Although it is well established that Cryptococcus neoformans exists mainly in old pigeon guano, several C. neoformans strains were still isolated from fresh pigeon excreta, providing a clue that live cryptococcal cells could move through the gastrointestinal tract of the pigeons. Eight genera identified from fresh droppings of domestic pigeons further confirm that pigeons serve as reservoirs, carriers and even spreaders of Cryptococcus species and other medically significant yeasts. The proportion of pathogenic yeasts in all isolates is more than 90 %.

  6. Isolation and identification of yeast flora from genital tract in healthy female camels (Camelus dromedarius).

    PubMed

    Shokri, Hojjatollah; Khosravi, Alireza; Sharifzadeh, Aghil; Tootian, Zahra

    2010-07-29

    Yeasts are commensal organisms found in the skin, genital and gastrointestinal tracts, and other mucosal sites in mammalians. The purposes of this study were to identify yeast flora and to determine the number of colony forming units (CFUs) in genital tract of healthy female dromedary camels, establishing their connection in both mated and unmated conditions. The samples were taken from different parts of genital tract including vestibule, vagina, cervix, uterine body, and uterine horns of 50 camels using sterilized cotton swabs. They were cultured onto Sabouraud glucose agar containing chloramphenicol and incubated at 30 degrees C for 7-10 days. A total of 454 yeast colonies were obtained from genital tract. Yeast isolates belonged to 8 genera: Candida (73.1%), Trichosporon (10.1%), Geotrichum (7.5%), Kluyveromyces (3.5%), Rhodotorula (2.4%), Aureobasidium (1.4%), Cryptococcus (1.1%) and Prototheca (0.8%). Among different Candida species, C. zeylanoides was the most common isolated species, representing significant difference with other Candida species (P<0.05). The mean number of yeasts found in the vestibule (46%) was significantly higher than the results obtained from other parts (P<0.05). In addition, the mean value of CFUs from unmated females (71.1%) was significantly higher than mated females (P<0.05). The results showed that C. zeylanoides was a common component of healthy camel females' genital mycoflora and the number of yeasts varied between mated and unmated females.

  7. Evolutionary systems biology of amino acid biosynthetic cost in yeast.

    PubMed

    Barton, Michael D; Delneri, Daniela; Oliver, Stephen G; Rattray, Magnus; Bergman, Casey M

    2010-08-17

    Every protein has a biosynthetic cost to the cell based on the synthesis of its constituent amino acids. In order to optimise growth and reproduction, natural selection is expected, where possible, to favour the use of proteins whose constituents are cheaper to produce, as reduced biosynthetic cost may confer a fitness advantage to the organism. Quantifying the cost of amino acid biosynthesis presents challenges, since energetic requirements may change across different cellular and environmental conditions. We developed a systems biology approach to estimate the cost of amino acid synthesis based on genome-scale metabolic models and investigated the effects of the cost of amino acid synthesis on Saccharomyces cerevisiae gene expression and protein evolution. First, we used our two new and six previously reported measures of amino acid cost in conjunction with codon usage bias, tRNA gene number and atomic composition to identify which of these factors best predict transcript and protein levels. Second, we compared amino acid cost with rates of amino acid substitution across four species in the genus Saccharomyces. Regardless of which cost measure is used, amino acid biosynthetic cost is weakly associated with transcript and protein levels. In contrast, we find that biosynthetic cost and amino acid substitution rates show a negative correlation, but for only a subset of cost measures. In the economy of the yeast cell, we find that the cost of amino acid synthesis plays a limited role in shaping transcript and protein expression levels compared to that of translational optimisation. Biosynthetic cost does, however, appear to affect rates of amino acid evolution in Saccharomyces, suggesting that expensive amino acids may only be used when they have specific structural or functional roles in protein sequences. However, as there appears to be no single currency to compute the cost of amino acid synthesis across all cellular and environmental conditions, we conclude that

  8. Mammalian two-hybrid system: a complementary approach to the yeast two-hybrid system.

    PubMed

    Luo, Y; Batalao, A; Zhou, H; Zhu, L

    1997-02-01

    Here we demonstrate the use of a mammalian two-hybrid system to study protein-protein interactions. Like the yeast two-hybrid system, this is a genetic, in vivo assay based on the reconstitution of the function of a transcriptional activator. In this system, one protein of interest is expressed as a fusion to the Gal4 DNA-binding domain and another protein is expressed as a fusion to the activation domain of the VP16 protein of the herpes simplex virus. The vectors that express these fusion proteins are cotransfected with a reporter chloramphenicol acetyltransferase (CAT) vector into a mammalian cell line. The reporter plasmid contains a cat gene under the control of five consensus Gal4 binding sites. If the two fusion proteins interact, there will be a significant increase in expression of the cat reporter gene. Previously, it was reported that mouse p53 antitumor protein and simian virus 40 large T antigen interact in a yeast two-hybrid system. Using a mammalian two-hybrid system, we were able to independently confirm this interaction. The mammalian two-hybrid system can be used as a complementary approach to verify protein-protein interactions detected by a yeast two-hybrid system screening. In addition, the mammalian two-hybrid system has two main advantages: (i) Assay results can be obtained within 48 h of transfection, and (ii) protein interactions in mammalian cells may better mimic actual in vivo interactions.

  9. Direct identification and recognition of yeast species from clinical material by using albicans ID and CHROMagar Candida plates.

    PubMed Central

    Baumgartner, C; Freydiere, A M; Gille, Y

    1996-01-01

    Two chromogenic media, Albicans ID and CHROMagar Candida agar plates, were compared with a reference medium, Sabouraud-chloramphenicol agar, and standard methods for the identification of yeast species. This study involved 951 clinical specimens. The detection rates for the two chromogenic media for polymicrobial specimens were 20% higher than that for the Sabouraud-chloramphenicol agar plates. The rates of identification of Candida albicans for Albicans ID and CHROMagar Candida agar plates were, respectively, 37.0 and 6.0% after 24 h of incubation and 93.6 and 92.2% after 72 h of incubation, with specificities of 99.8 and 100%. Furthermore, CHROMagar Candida plates identified 13 of 14 Candida tropicalis and 9 of 12 Candida krusei strains after 48 h of incubation. PMID:8789038

  10. Molecular identification of yeast species associated with 'Hamei'--a traditional starter used for rice wine production in Manipur, India.

    PubMed

    Jeyaram, K; Singh, W Mohendro; Capece, Angela; Romano, Patrizia

    2008-05-31

    In Manipur state of North-Eastern India, wine from glutinous rice using traditional solid state starter called 'Hamei' is particularly interesting because of its unique flavour. A total of 163 yeast isolates were obtained from fifty four 'Hamei' samples collected from household rice wine preparations in tribal villages of Manipur. Molecular identification of yeast species was carried out by analysis of the restriction digestion pattern generated from PCR amplified internal transcribed spacer region along with 5.8S rRNA gene (ITS1-5.8S-ITS2). Seventeen different restriction profiles were obtained from the size of PCR products and the restriction analysis with three endonucleases (Hae III, Cfo I and Hinf I). Nine groups were identified as S. cerevisiae, Pichia anomala, Trichosporon sp., Candida tropicalis, Pichia guilliermondi, Candida parapsilosis, Torulaspora delbrueckii, Pichia fabianii and Candida montana by comparing this ITS-RFLP profile with type strains of common wine yeasts, published data and insilico analysis of ITS sequence data available in CBS yeast database. ITS-RFLP profile of eight groups was not matching with available database of 288 common wine yeast species. The most frequent yeast species associated with 'Hamei' were S. cerevisiae (32.5%), P. anomala (41.7%) and Trichosporon sp. (8%). The identity of major groups was confirmed by additional restriction digestion of ITS region with Hind III, EcoRI, Dde I and Msp I. The genetic diversity of industrially important S. cerevisiae group was investigated using Pulsed Field Gel Electrophoresis (PFGE). Although most of the 53 strains of S. cerevisiae examined were exhibited a common species specific pattern, a distinct degree of chromosomal length polymorphism and variable number of chromosomal DNA fragments were observed with in the species. Cluster analysis showed seven major karyotypes (K1-K7) with more than 83% similarity. The karyotype pattern K1 was the most frequent (67.9%) among the strains from

  11. [Fluorescein transport and antioxidant systems in the yeast Saccharomyces cerevisiae under acid stress].

    PubMed

    Abrat, O B; Semchyshyn, H M; Miedzobrodski, J; Lushchak, V I

    2008-01-01

    The influence of acetic acid induced stress on the activity of fluorescein extrusion system and cell survival in the yeast Saccharomyces cerevisiae has been studied. It was shown that acetic acid caused the inhibition of fluorescein efflux from the cells of both parental strain and its derivative defective in the transcriptional factor War1 which regulates the system of acetate efflux from the cell. The stress induced by 200 mM CH3COOH decreased almost 10 times the survival of strains deficient in the regulatory proteins War1 and Yap1 as compared with respective wild strains. However, pretreatment of the yeast by sublethal concentrations of hydrogen peroxide resulted in the increased resistance to acid stress. Thus it may be supposed that several systems exist which are responsible for acetate extrusion from the yeast cells. Regulatory proteins War1 and Yap1 are involved in the yeast adaptation to the stress induced by acetic acid.

  12. Personal identification credential system (PICS)

    NASA Astrophysics Data System (ADS)

    Pressley, Jackson R.; Cantrell, Thomas; Page, Lochlin; Cudlitz, Stephen; Higgins, Roy

    2005-03-01

    A pilot Personal Identification Credential System (PICS) has been developed and fielded. The PICS is a wireless biometric credential that interfaces with access control systems. The PICS consists of individual handheld Personal Identification Credentials (PIC), a PICS Reader located at a facility entry control point that interfaces with the facility entry control system, and a PICS Enrollment Station. In operation, an individual approaching a facility entry point in a vehicle picks up the PIC handheld unit and places a finger on its sensor. The PIC then authenticates the user and from within the vehicle initiates two-way, secure RF communication with the PICS Reader as the vehicle approaches the gate. The PICS Reader then verifies that the individual is authorized for admittance and notifies the facility gate entry control system, which informs the sentry that the request for access was successful or unsuccessful. If the request for access is unsuccessful, the gate entry control system automatically will close the gate. This sequence of events takes place while the car is moving through a normally open entry lane. The PIC is a small, handheld device which contains the biometric sensor (fingerprint sensor), wireless RF transceiver, processor, encryption and battery. The PIC may be used while traveling in a vehicle or may be used while on foot for access to a PICS controlled man gate or secure area access portal. The PIC is small enough to be carried in a shirt pocket, or it can be left in the user's vehicle. The PIC battery will power the PIC for months and is rechargeable. Up to 10 fingers may be stored in the PIC.

  13. Application of the FLP/FRT system for conditional gene deletion in yeast Saccharomyces cerevisiae.

    PubMed

    Park, Yang-Nim; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

    2011-09-01

    The yeast Saccharomyces cerevisiae has proved to be an excellent model organism to study the function of proteins. One of the many advantages of yeast is the many genetic tools available to manipulate gene expression, but there are still limitations. To complement the many methods used to control gene expression in yeast, we have established a conditional gene deletion system by using the FLP/FRT system on yeast vectors to conditionally delete specific yeast genes. Expression of Flp recombinase, which is under the control of the GAL1 promoter, was induced by galactose, which in turn excised FRT sites flanked genes. The efficacy of this system was examined using the FRT site-flanked genes HSP104, URA3 and GFP. The pre-excision frequency of this system, which might be caused by the basal activity of the GAL1 promoter or by spontaneous recombination between FRT sites, was detected ca. 2% under the non-selecting condition. After inducing expression of Flp recombinase, the deletion efficiency achieved ca. 96% of cells in a population within 9 h. After conditional deletion of the specific gene, protein degradation and cell division then diluted out protein that was expressed from this gene prior to its excision. Most importantly, the specific protein to be deleted could be expressed under its own promoter, so that endogenous levels of protein expression were maintained prior to excision by the Flp recombinase. Therefore, this system provides a useful tool for the conditional deletion of genes in yeast.

  14. System/observer/controller identification toolbox

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan; Horta, Lucas G.; Phan, Minh

    1992-01-01

    System Identification is the process of constructing a mathematical model from input and output data for a system under testing, and characterizing the system uncertainties and measurement noises. The mathematical model structure can take various forms depending upon the intended use. The SYSTEM/OBSERVER/CONTROLLER IDENTIFICATION TOOLBOX (SOCIT) is a collection of functions, written in MATLAB language and expressed in M-files, that implements a variety of modern system identification techniques. For an open loop system, the central features of the SOCIT are functions for identification of a system model and its corresponding forward and backward observers directly from input and output data. The system and observers are represented by a discrete model. The identified model and observers may be used for controller design of linear systems as well as identification of modal parameters such as dampings, frequencies, and mode shapes. For a closed-loop system, an observer and its corresponding controller gain directly from input and output data.

  15. [Identification of yeasts in pap smears: clinical characteristics associated with candidiasis].

    PubMed

    Llovera Suárez, Vilma; Perurena Lancha, Mayda Rosa

    2004-01-01

    A study of 404 women that attended the Microbiology Laboratory of Ramón Gonzalez Coro Gynecoobstetric Hospital, in Havana City, was conducted aimed at identifying species of yeasts isolated from Pap smears, registering the signs and clinical symptoms and determining the risk factors associated with infection. The isolated yeasts were identified by the filamentation tests in serum, production of chlamydoconidia and carbohydrate assimilation. It was found that 138 (34.16%) of women had yeasts in the vagina. 3 genera were identified: Candida (88.49%). Trichosporon (10.79%) and Rhodotorula (0.72%). Pruritus and heat showed statistical significance (p < 0.01). Pregnancy, the use of IUD and the antibacterial therapy proved to be the most common risk factors in relation to the presence of Candida in the vagina.

  16. Isolation and identification of yeasts and yeastlike organisms from clinical veterinary sources.

    PubMed Central

    Chengappa, M M; Maddux, R L; Greer, S C; Pincus, D H; Geist, L L

    1984-01-01

    A total of 229 isolates of yeasts and yeastlike organisms recovered from a variety of clinical specimens were identified by using the API 20C microsystem in conjunction with morphological characteristics and urea hydrolysis. Of the 229, 218 (95.1%) were from bovine, porcine, canine, and equine species and the remaining 11 (4.9%) were from feline and avian species. The gastrointestinal and reproductive tracts were the major sources of yeasts and yeastlike organisms, representing 60 (26.2%) and 28 (12.2%) isolates, respectively. PMID:6715511

  17. Parameter identification for nonlinear aerodynamic systems

    NASA Technical Reports Server (NTRS)

    Pearson, Allan E.

    1991-01-01

    Work continues on frequency analysis for transfer function identification, both with respect to the continued development of the underlying algorithms and in the identification study of two physical systems. Some new results of a theoretical nature were recently obtained that lend further insight into the frequency domain interpretation of the research. Progress in each of those areas is summarized. Although not related to the system identification problem, some new results were obtained on the feedback stabilization of linear time lag systems.

  18. Saccharomyces cerevisiae Produces a Yeast Substance that Exhibits Estrogenic Activity in Mammalian Systems

    NASA Astrophysics Data System (ADS)

    Feldman, David; Stathis, Peter A.; Hirst, Margaret A.; Price Stover, E.; Do, Yung S.; Kurz, Walter

    1984-06-01

    Partially purified lipid extracts of Saccharomyces cerevisiae contain a substance that displaces tritiated estradiol from rat uterine cytosol estrogen receptors. The yeast product induces estrogenic bioresponses in mammalian systems as measured by induction of progesterone receptors in cultured MCF-7 human breast cancer cells and by a uterotrophic response and progesterone receptor induction after administration to ovariectomized mice. The findings raise the possibility that bakers' yeast may be a source of environmental estrogens.

  19. Fieldable Nuclear Material Identification System

    SciTech Connect

    Radle, James E; Archer, Daniel E; Carter, Robert J; Mullens, James Allen; Mihalczo, John T; Britton Jr, Charles L; Lind, Randall F; Wright, Michael C

    2010-01-01

    The Fieldable Nuclear Material Identification System (FNMIS), funded by the NA-241 Office of Dismantlement and Transparency, provides information to determine the material attributes and identity of heavily shielded nuclear objects. This information will provide future treaty participants with verifiable information required by the treaty regime. The neutron interrogation technology uses a combination of information from induced fission neutron radiation and transmitted neutron imaging information to provide high confidence that the shielded item is consistent with the host's declaration. The combination of material identification information and the shape and configuration of the item are very difficult to spoof. When used at various points in the warhead dismantlement sequence, the information complimented by tags and seals can be used to track subassembly and piece part information as the disassembly occurs. The neutron transmission imaging has been developed during the last seven years and the signature analysis over the last several decades. The FNMIS is the culmination of the effort to put the technology in a usable configuration for potential treaty verification purposes.

  20. SYSTEM IDENTIFICATION OF SURFACE SHIP DYNAMICS.

    DTIC Science & Technology

    The feasibility of applying a Newtonian system identification technique to a nonlinear three degree of freedom system of equations describing the...steering and maneuvering of a surface ship is investigated. The input to the system identification program is provided by both analog and digital

  1. Identification of novel noncoding transcripts in telomerase-negative yeast using RNA-seq

    PubMed Central

    Niederer, Rachel O.; Papadopoulos, Nickolas; Zappulla, David C.

    2016-01-01

    Telomerase is a ribonucleoprotein that maintains the ends of linear chromosomes in most eukaryotes. Loss of telomerase activity results in shortening of telomeric DNA and eventually a specific G2/M cell-cycle arrest known as senescence. In humans, telomere shortening occurs during aging, while inappropriate activation of telomerase is associated with approximately 90% of cancers. Previous studies have identified several classes of noncoding RNAs (ncRNA) also associated with aging-related senescence and cancer, but whether ncRNAs are also involved in short-telomere-induced senescence in yeast is unknown. Here, we report 112 putative novel lncRNAs in the yeast Saccharomyces cerevisiae, 41 of which are only expressed in telomerase-negative yeast. Expression of approximately half of the lncRNAs is strongly correlated with that of adjacent genes, suggesting this subset may influence transcription of neighboring genes. Our results reveal a new potential mechanism governing adaptive changes in senescing and post-senescent survivor yeast cells. PMID:26786024

  2. Identification and characterisation of xylanolytic yeasts isolated from decaying wood and sugarcane bagasse in Brazil.

    PubMed

    Lara, Carla A; Santos, Renata O; Cadete, Raquel M; Ferreira, Carla; Marques, Susana; Gírio, Francisco; Oliveira, Evelyn S; Rosa, Carlos A; Fonseca, César

    2014-06-01

    In this study, yeasts associated with lignocellulosic materials in Brazil, including decaying wood and sugarcane bagasse, were isolated, and their ability to produce xylanolytic enzymes was investigated. A total of 358 yeast isolates were obtained, with 198 strains isolated from decaying wood and 160 strains isolated from decaying sugarcane bagasse samples. Seventy-five isolates possessed xylanase activity in solid medium and were identified as belonging to nine species: Candida intermedia, C. tropicalis, Meyerozyma guilliermondii, Scheffersomyces shehatae, Sugiyamaella smithiae, Cryptococcus diffluens, Cr. heveanensis, Cr. laurentii and Trichosporon mycotoxinivorans. Twenty-one isolates were further screened for total xylanase activity in liquid medium with xylan, and five xylanolytic yeasts were selected for further characterization, which included quantitative analysis of growth in xylan and xylose and xylanase and β-D-xylosidase activities. The yeasts showing the highest growth rate and cell density in xylan, Cr. laurentii UFMG-HB-48, Su. smithiae UFMG-HM-80.1 and Sc. shehatae UFMG-HM-9.1a, were, simultaneously, those exhibiting higher xylanase activity. Xylan induced the highest level of (extracellular) xylanase activity in Cr. laurentii UFMG-HB-48 and the highest level of (intracellular, extracellular and membrane-associated) β-D-xylosidase activity in Su. smithiae UFMG-HM-80.1. Also, significant β-D-xylosidase levels were detected in xylan-induced cultures of Cr. laurentii UFMG-HB-48 and Sc. shehatae UFMG-HM-9.1a, mainly in extracellular and intracellular spaces, respectively. Under xylose induction, Cr. laurentii UFMG-HB-48 showed the highest intracellular β-D-xylosidase activity among all the yeast tested. C. tropicalis UFMG-HB 93a showed its higher (intracellular) β-D-xylosidase activity under xylose induction and higher at 30 °C than at 50 °C. This study revealed different xylanolytic abilities and strategies in yeasts to metabolise xylan and

  3. Identification and Population Dynamics of Yeasts in Sourdough Fermentation Processes by PCR-Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Meroth, Christiane B.; Hammes, Walter P.; Hertel, Christian

    2003-01-01

    Four sourdoughs (A to D) were produced under practical conditions, using a starter obtained from a mixture of three commercially available sourdough starters and baker's yeast. The doughs were continuously propagated until the composition of the microbiota remained stable. A fungi-specific PCR-denaturing gradient gel electrophoresis (DGGE) system was established to monitor the development of the yeast biota. The analysis of the starter mixture revealed the presence of Candida humilis, Debaryomyces hansenii, Saccharomyces cerevisiae, and Saccharomyces uvarum. In sourdough A (traditional process with rye flour), C. humilis dominated under the prevailing fermentation conditions. In rye flour sourdoughs B and C, fermented at 30 and 40°C, respectively, S. cerevisiae became predominant in sourdough B, whereas in sourdough C the yeast counts decreased within a few propagation steps below the detection limit. In sourdough D, which corresponded to sourdough C in temperature but was produced with rye bran, Candida krusei became dominant. Isolates identified as C. humilis and S. cerevisiae were shown by randomly amplified polymorphic DNA-PCR analysis to originate from the commercial starters and the baker's yeast, respectively. The yeast species isolated from the sourdoughs were also detected by PCR-DGGE. However, in the gel, additional bands were visible. Because sequencing of these PCR fragments from the gel failed, cloning experiments with 28S rRNA amplicons obtained from rye flour were performed, which revealed Cladosporium sp., Saccharomyces servazii, S. uvarum, an unculturable ascomycete, Dekkera bruxellensis, Epicoccum nigrum, and S. cerevisiae. The last four species were also detected in sourdoughs A, B, and C. PMID:14660398

  4. Distribution and identification of red yeasts in deep-sea environments around the northwest Pacific Ocean.

    PubMed

    Nagahama, T; Hamamoto, M; Nakase, T; Takami, H; Horikoshi, K

    2001-10-01

    We isolated 99 yeast strains, including 40 red yeasts, from benthic animals and sediments collected from the deep-sea floor in various areas in the northwest Pacific Ocean. Comparing the yeast isolates from animals and sediments collected from shallow locations, the proportion of red yeasts differed considerably, comprising 81.5% and 10.6% of the isolates from animals and sediments, respectively. All of the red yeast isolates belonged to the genera Rhodotorula and Sporobolomyces. On the basis of morphological and physiological characteristics, the isolates were identified as R. aurantiaca, R. glutinis, R. minuta and R. mucilaginosa of the genus Rhodotorula, and S. salmonicolor and S. shibatanus of the genus Sporobolomyces. Only R. glutinis and R. mucilaginosa were isolated from sediments. All of the others were isolated from animal sources. Phylogenetic analyses based on internal transcribed spacer (ITS) regions and 5.8S rRNA gene sequences allowed us to establish the precise taxonomic placement of each of the isolates and thereby investigate the intraspecific relationships among the isolates. Twenty-two strains identified as members of R. glutinis, which showed a wide distribution in the deep-sea, and five isolates identified as R. minuta, which were isolated only from benthic animals, showed substantial heterogeneity within the species. The isolates phenotypically identified as Sporobolomyces species and R. mucilaginosa phylogenetically occupied the placements corresponding to these species. Some strains assigned to known species on the basis of phenotypic features should be regarded as new species as suggested by the results of molecular analysis.

  5. An eYFP reporter gene for the yeast two-hybrid system.

    PubMed

    Damon, Coralie; Boxus, Mathieu; Twizere, Jean-Claude; Portetelle, Daniel; Vandenbol, Micheline

    2013-02-01

    The yeast two-hybrid system is a powerful tool for detecting binary protein interactions, widely used in large-scale interactome mapping. We modified two yeast strains commonly used in yeast two-hybrid experiments by integrating into their genomes a new reporter gene encoding the enhanced yellow fluorescent protein eYFP. The suitability of this reporter gene for interaction screening was evaluated by fluorescence microscopy and fluorescence-activated cell sorting analysis. The gene shows good potential as a two-hybrid reporter gene for detecting strong interactions. Gal4 transcriptional activation gives rise to sufficient fluorescence for detection with a flow cytometer, but the eYFP reporter is not sensitive enough for detecting weak or moderate interactions. This study highlights the advantages of a fluorescent reporter gene in yeast two-hybrid screening.

  6. Structural system identification of a composite shell

    SciTech Connect

    Red-Horse, J.R.; Carne, T.G.; James, G.H.; Witkowski, W.R.

    1991-01-01

    Structural system identification is undergoing a period of renewed interest. Probabilistic approaches to physical parameter identification in analysis finite element models make uncertainty in test results an important issue. In this paper, we investigate this issue with a simple, though in many ways representative, structural system. The results of two modal parameter identification techniques are compared and uncertainty estimates, both through bias and random errors, are quantified. The importance of the interaction between test and analysis is also highlighted. 25 refs.

  7. Structural system identification of a composite shell

    SciTech Connect

    Red-Horse, J.R.; Carne, T.G.; James, G.H.; Witkowski, W.R.

    1991-12-31

    Structural system identification is undergoing a period of renewed interest. Probabilistic approaches to physical parameter identification in analysis finite element models make uncertainty in test results an important issue. In this paper, we investigate this issue with a simple, though in many ways representative, structural system. The results of two modal parameter identification techniques are compared and uncertainty estimates, both through bias and random errors, are quantified. The importance of the interaction between test and analysis is also highlighted. 25 refs.

  8. Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods.

    PubMed

    Santos, M C; Golt, C; Joerger, R D; Mechor, G D; Mourão, Gerson B; Kung, L

    2017-02-01

    The objective of this study was to identify species of yeasts in samples of high moisture corn (HMC) and corn silage (CS) collected from farms throughout the United States. Samples were plated and colonies were isolated for identification using DNA analysis. Randomly selected colonies were also identified by fatty acid methyl esters (FAME) and by physiological substrate profiling (ID 32C). For CS, Candida ethanolica, Saccharomyces bulderi, Pichia anomala, Kazachstania unispora, and Saccharomyces cerevisiae were the predominant yeasts. Pichia anomala, Issatchenkia orientalis, S. cerevisiae, and Pichia fermentans were the prevalent species in HMC. The 3 identification methods were in agreement at the species level for 16.6% of the isolates and showed no agreement for 25.7%. Agreement in species identification between ID 32C and DNA analysis, FAME and ID 32C, and FAME and DNA analysis was 41.1, 14.4, and 2.2%, respectively. Pichia anomala and I. orientalis were able to grow on lactic acid, whereas S. cerevisiae metabolized sugars (galactose, sucrose, and glucose) but failed to use lactic acid. The yeast diversity in CS and HMC varied due to type of feed and location. Differences in species assignments were seen among methods, but identification using substrate profiling generally corresponded with that based on DNA analysis. These findings provide information about the species that may be expected in silages, and this knowledge may lead to interventions that control unwanted yeasts.

  9. Comparative Study of the New Colorimetric VITEK 2 Yeast Identification Card versus the Older Fluorometric Card and of CHROMagar Candida as a Source Medium with the New Card

    PubMed Central

    Aubertine, C. L.; Rivera, M.; Rohan, S. M.; Larone, D. H.

    2006-01-01

    The new VITEK 2 colorimetric card was compared to the previous fluorometric card for identification of yeast. API 20C was considered the “gold standard.” The new card consistently performed better than the older card. Isolates from CHROMagar Candida plates were identified equally as well as those from Sabouraud dextrose agar. PMID:16390976

  10. Sequencer-Based Capillary Gel Electrophoresis (SCGE) Targeting the rDNA Internal Transcribed Spacer (ITS) Regions for Accurate Identification of Clinically Important Yeast Species

    PubMed Central

    Chen, Sharon C.-A.; Wang, He; Zhang, Li; Fan, Xin; Xu, Zhi-Peng; Cheng, Jing-Wei; Kong, Fanrong; Zhao, Yu-Pei; Xu, Ying-Chun

    2016-01-01

    Accurate species identification of Candida, Cryptococcus, Trichosporon and other yeast pathogens is important for clinical management. In the present study, we developed and evaluated a yeast species identification scheme by determining the rDNA internal transcribed spacer (ITS) region length types (LTs) using a sequencer-based capillary gel electrophoresis (SCGE) approach. A total of 156 yeast isolates encompassing 32 species were first used to establish a reference SCGE ITS LT database. Evaluation of the ITS LT database was then performed on (i) a separate set of (n = 97) clinical isolates by SCGE, and (ii) 41 isolates of 41 additional yeast species from GenBank by in silico analysis. Of 156 isolates used to build the reference database, 41 ITS LTs were identified, which correctly identified 29 of the 32 (90.6%) species, with the exception of Trichosporon asahii, Trichosporon japonicum and Trichosporon asteroides. In addition, eight of the 32 species revealed different electropherograms and were subtyped into 2–3 different ITS LTs each. Of the 97 test isolates used to evaluate the ITS LT scheme, 96 (99.0%) were correctly identified to species level, with the remaining isolate having a novel ITS LT. Of the additional 41 isolates for in silico analysis, none was misidentified by the ITS LT database except for Trichosporon mucoides whose ITS LT profile was identical to that of Trichosporon dermatis. In conclusion, yeast identification by the present SCGE ITS LT assay is a fast, reproducible and accurate alternative for the identification of clinically important yeasts with the exception of Trichosporon species. PMID:27105313

  11. CONTROL SYSTEM IDENTIFICATION THROUGH MODEL MODULATION METHODS

    DTIC Science & Technology

    identification has been achieved by using model modulation techniques to drive dynamic models into correspondence with operating control systems. The system ... identification then proceeded from examination of the model and the adaptive loop. The model modulation techniques applied to adaptive control

  12. Genome engineering in the yeast pathogen Candida glabrata using the CRISPR-Cas9 system

    PubMed Central

    Enkler, Ludovic; Richer, Delphine; Marchand, Anthony L.; Ferrandon, Dominique; Jossinet, Fabrice

    2016-01-01

    Among Candida species, the opportunistic fungal pathogen Candida glabrata has become the second most common causative agent of candidiasis in the world and a major public health concern. Yet, few molecular tools and resources are available to explore the biology of C. glabrata and to better understand its virulence during infection. In this study, we describe a robust experimental strategy to generate loss-of-function mutants in C. glabrata. The procedure is based on the development of three main tools: (i) a recombinant strain of C. glabrata constitutively expressing the CRISPR-Cas9 system, (ii) an online program facilitating the selection of the most efficient guide RNAs for a given C. glabrata gene, and (iii) the identification of mutant strains by the Surveyor technique and sequencing. As a proof-of-concept, we have tested the virulence of some mutants in vivo in a Drosophila melanogaster infection model. Our results suggest that yps11 and a previously uncharacterized serine/threonine kinase are involved, directly or indirectly, in the ability of the pathogenic yeast to infect this model host organism. PMID:27767081

  13. Identification and characterization of a gene and protein required for glycosylation in the yeast Golgi.

    PubMed

    Devlin, C; Ballou, C E

    1990-11-01

    The MNN2 gene of Saccharomyces cerevisiae has been cloned by complementation of the mnn2 mutant phenotype scored by a change in cell surface carbohydrate structure resulting from a lack of alpha 1----2-mannose branching in the outer chain. The gene was subcloned as a 3 kb DNA fragment that integrated at the MNN2 locus, and a gene disruption yielded the mnn2 phenotype. A lacZ-MNN2 gene fusion protein, produced in Escherichia coli, was used to raise a specific antiserum that recognized a 65 kD wild-type yeast protein. This MNN2 gene product lacks N-linked carbohydrate but appears to be an integral membrane protein. Overproduction of MNN2p does not enhance the alpha 1----2-mannosyltransferase activity of yeast cells. The results suggest that MNN2p is a Golgi-associated protein that is involved in mannoprotein sorting rather than glycosylation.

  14. Stochastic system identification in structural dynamics

    USGS Publications Warehouse

    Safak, Erdal

    1988-01-01

    Recently, new identification methods have been developed by using the concept of optimal-recursive filtering and stochastic approximation. These methods, known as stochastic identification, are based on the statistical properties of the signal and noise, and do not require the assumptions of current methods. The criterion for stochastic system identification is that the difference between the recorded output and the output from the identified system (i.e., the residual of the identification) should be equal to white noise. In this paper, first a brief review of the theory is given. Then, an application of the method is presented by using ambient vibration data from a nine-story building.

  15. Evaluation of Albicans ID2 and Biggy agar for the isolation and direct identification of vaginal yeast isolates.

    PubMed

    Ilkit, Macit; Hilmioglu, Suleyha; Tasbakan, Meltem; Aydemir, Sohret

    2007-06-01

    In this study, 250 vaginal samples from patients with vulvovaginal candidosis were inoculated onto two chromogenic media, Albicans ID(2) and Biggy agar, as well as onto Sabouraud chloramphenicol agar, yielding a total of 63 yeast (25.2 %) on all three media. These strains were identified as Candida glabrata in 20 (31.8 %) samples, Candida albicans in 15 samples (23.8 %), Candida tropicalis in 10 samples (15.9 %), Candida krusei in five samples (7.9 %), Candida kefyr in five samples (7.9 %), Candida dubliniensis in four samples (6.3 %), Candida parapsilosis in two samples (3.2 %) and Candida guilliermondii in two samples (3.2 %). Mixed fungal cultures and bacterial growth or filamentous fungi were not detected on any of the selected media. The sensitivity and specificity of the Albicans ID(2) and Biggy agar with regard to the identification of C. albicans were 80.0 and 64.6 %, and 86.7 and 56.3 %, respectively. This study showed these two chromogenic media to be as effective as Sabouraud chloramphenicol agar with respect to fungal detection. However, neither Albicans ID(2) nor Biggy agar was sufficient for reliable differentiation of yeasts to the species level.

  16. Dictyostelium discoideum as a Novel Host System to Study the Interaction between Phagocytes and Yeasts

    PubMed Central

    Koller, Barbara; Schramm, Christin; Siebert, Susann; Triebel, János; Deland, Eric; Pfefferkorn, Anna M.; Rickerts, Volker; Thewes, Sascha

    2016-01-01

    The social amoeba Dictyostelium discoideum is a well-established model organism to study the interaction between bacteria and phagocytes. In contrast, research using D. discoideum as a host model for fungi is rare. We describe a comprehensive study, which uses D. discoideum as a host model system to investigate the interaction with apathogenic (Saccharomyces cerevisiae) and pathogenic (Candida sp.) yeast. We show that Dictyostelium can be co-cultivated with yeasts on solid media, offering a convenient test to study the interaction between fungi and phagocytes. We demonstrate that a number of D. discoideum mutants increase (atg1−, kil1−, kil2−) or decrease (atg6−) the ability of the amoebae to predate yeast cells. On the yeast side, growth characteristics, reduced phagocytosis rate, as well as known virulence factors of C. albicans (EFG1, CPH1, HGC1, ICL1) contribute to the resistance of yeast cells against predation by the amoebae. Investigating haploid C. albicans strains, we suggest using the amoebae plate test for screening purposes after random mutagenesis. Finally, we discuss the potential of our adapted amoebae plate test to use D. discoideum for risk assessment of yeast strains. PMID:27818653

  17. Coated whey protein/alginate microparticles as oral controlled delivery systems for probiotic yeast.

    PubMed

    Hébrard, Géraldine; Hoffart, Valérie; Beyssac, Eric; Cardot, Jean-Michel; Alric, Monique; Subirade, Muriel

    2010-01-01

    Viable Saccharomyces boulardii, used as a biotherapeutic agent, was encapsulated in food-grade whey protein isolate (WP) and alginate (ALG) microparticles, in order to protect and vehicle them in gastrointestinal environment. Yeast-loaded microparticles with a WP/ALG ratio of 62/38 were produced with high encapsulation efficiency (95%) using an extrusion/cold gelation method and coated with ALG or WP by a simple immersion method. Swelling, yeast survival, WP loss and yeast release in simulated gastric and intestinal fluids (SGF and SIF, pH 1.2 and 7.5) with and without their respective digestive enzymes (pepsin and pancreatin) were investigated. In SGF, ALG network shrinkage limited enzyme diffusion into the WP/ALG matrix. Coated and uncoated WP/ALG microparticles were resistant in SGF even with pepsin. Survival of yeast cells in microparticles was 40% compared to 10% for free yeast cells and was improved to 60% by coating. In SIF, yeast cell release followed coated microparticle swelling with a desirable delay. Coated WP/ALG microparticles appear to have potential as oral delivery systems for Saccharomyces boulardii or as encapsulation means for probiotic cells in pharmaceutical or food processing applications.

  18. Identification of a human cDNA with high homology to yeast omnipotent suppressor 45.

    PubMed

    Grenett, H E; Bounelis, P; Fuller, G M

    1992-01-15

    Omnipotent suppression is a well-established phenomenon in yeast and bacteria in which nonsense mutations are misread. Wild-type (wt) suppressors are presumed to be involved in ensuring the fidelity of translation. We report a human homolog to wt yeast omnipotent suppressor 45 which shares 63% identity at the nucleotide level in the area of open reading frame (ORF) and 73% similarity at the amino acid (aa) level. The aa sequence of the human protein was deduced from a 2.3-kb cDNA (TB3-1) isolated from an adenocarcinoma T84 cell line cDNA library. The cDNA contains an ORF of 1284 bp which encodes a 47.8-kDa protein. Two transcripts for the clone were identified (2.6 and 4.0 kb) in a variety of human cell types. The strong structural similarity to yeast omnipotent suppressor 45, and its widespread expression suggest that this cDNA may play a role in the accurate recognition of nonsense codons in mammalian cells.

  19. Identification of a Functional Homolog of the Yeast Copper Homeostasis Gene ATX1 from Arabidopsis1

    PubMed Central

    Himelblau, Edward; Mira, Helena; Lin, Su-Ju; Cizewski Culotta, Valeria; Peñarrubia, Lola; Amasino, Richard M.

    1998-01-01

    A cDNA clone encoding a homolog of the yeast (Saccharomyces cerevisiae) gene Anti-oxidant 1 (ATX1) has been identified from Arabidopsis. This gene, referred to as Copper CHaperone (CCH), encodes a protein that is 36% identical to the amino acid sequence of ATX1 and has a 48-amino acid extension at the C-terminal end, which is absent from ATX1 homologs identified in animals. ATX1-deficient yeast (atx1) displayed a loss of high-affinity iron uptake. Expression of CCH in the atx1 strain restored high-affinity iron uptake, demonstrating that CCH is a functional homolog of ATX1. When overexpressed in yeast lacking the superoxide dismutase gene SOD1, both ATX1 and CCH protected the cell from the reactive oxygen toxicity that results from superoxide dismutase deficiency. CCH was unable to rescue the sod1 phenotype in the absence of copper, indicating that CCH function is copper dependent. In Arabidopsis CCH mRNA is present in the root, leaf, and inflorescence and is up-regulated 7-fold in leaves undergoing senescence. In plants treated with 800 nL/L ozone for 30 min, CCH mRNA levels increased by 30%. In excised leaves and whole plants treated with high levels of exogenous CuSO4, CCH mRNA levels decreased, indicating that CCH is regulated differently than characterized metallothionein proteins in Arabidopsis. PMID:9701579

  20. Identification of a functional homolog of the yeast copper homeostasis gene ATX1 from Arabidopsis

    SciTech Connect

    Himelblau, E.; Amasino, R.M.; Mira, H.; Penarrubia, L.; Lin, S.J.; Culotta, V.C.

    1998-08-01

    A cDNA clone encoding a homolog of the yeast (Saccharomyces cerevisiae) gene Anti-oxidant 1 (ATX1) has been identified from Arabidopsis. This gene, referred to as Copper CHaperone (CCH), encodes a protein that is 36% identical to the amino acid sequence of ATX1 and has a 48-amino acid extension at the C-terminal end, which is absent from ATX1 homologs identified in animals. ATX1-deficient yeast (atx1) displayed a loss of high-affinity iron uptake. Expression of CCH in the atx1 strain restored high-affinity iron uptake, demonstrating that CCH is a functional homolog of ATX1. When overexpressed in yeast lacking the superoxide dismutase gene SOD1, both ATX1 and CCH protected the cell from the reactive oxygen toxicity that results from superoxide dismutase deficiency. CCH was unable to rescue the sod1 phenotype in the absence of copper, indicating that CCH function is copper dependent. In Arabidopsis CCH mRNA is present in the root, leaf, and in fluorescence and is up-regulated 7-fold in leaves undergoing senescence. In plants treated with 800 nL/L ozone for 30 min, CCH mRNA levels increased by 30%. In excised leaves and whole plants treated with high levels of exogenous CuSO{sub 4}, CCH mRNA levels decreased, indicating that CCH is regulated differently than characterized metallothionein proteins in Arabidopsis.

  1. Identification of yeast strains isolated from marcha in Sikkim, a microbial starter for amylolytic fermentation.

    PubMed

    Tsuyoshi, Naoko; Fudou, Ryosuke; Yamanaka, Shigeru; Kozaki, Michio; Tamang, Namrata; Thapa, Saroj; Tamang, Jyoti P

    2005-03-15

    Marcha or murcha is a traditional amylolytic starter used to produce sweet-sour alcoholic drinks, commonly called jaanr in the Himalayan regions of India, Nepal, Bhutan, and Tibet (China). The aim of this study was to examine the microflora of marcha collected from Sikkim in India, focusing on yeast flora and their roles. Twenty yeast strains were isolated from six samples of marcha and identified by genetic and phenotypic methods. They were first classified into four groups (Group I, II, III, and IV) based on physiological features using an API test. Phylogenetic, morphological, and physiological characterization identified the isolates as Saccharomyces bayanus (Group I); Candida glabrata (Group II); Pichia anomala (Group III); and Saccharomycopsis fibuligera, Saccharomycopsis capsularis, and Pichia burtonii (Group IV). Among them, the Group I, II, and III strains produced ethanol. The isolates of Group IV had high amylolytic activity. Because all marcha samples tested contained both starch degraders and ethanol producers, it was hypothesized that all four groups of yeast (Group I, II, III, and IV) contribute to starch-based alcohol fermentation.

  2. Optimal Sensor Locations for System Identification

    DTIC Science & Technology

    1988-03-01

    Element Model . 19 3. A METHODOLOGY FOR OPTIMAL SENSOR LOCATIONS FOR PARAMETRIC IDENTIFICATION ................. 37 3.1. Introduction... parametric identification of structural systems depends on the location at which sensors are placed and data gathered, very little by way of a...picture on optimal sensor locations for parametric identification in a noisy measurement 6 z, -. -" environment. Section IV deals with an important aspect

  3. Systems Level Analysis of the Yeast Osmo-Stat

    PubMed Central

    Talemi, Soheil Rastgou; Tiger, Carl-Fredrik; Andersson, Mikael; Babazadeh, Roja; Welkenhuysen, Niek; Klipp, Edda; Hohmann, Stefan; Schaber, Jörg

    2016-01-01

    Adaptation is an important property of living organisms enabling them to cope with environmental stress and maintaining homeostasis. Adaptation is mediated by signaling pathways responding to different stimuli. Those signaling pathways might communicate in order to orchestrate the cellular response to multiple simultaneous stimuli, a phenomenon called crosstalk. Here, we investigate possible mechanisms of crosstalk between the High Osmolarity Glycerol (HOG) and the Cell Wall Integrity (CWI) pathways in yeast, which mediate adaptation to hyper- and hypo-osmotic challenges, respectively. We combine ensemble modeling with experimental investigations to test in quantitative terms different hypotheses about the crosstalk of the HOG and the CWI pathways. Our analyses indicate that for the conditions studied i) the CWI pathway activation employs an adaptive mechanism with a variable volume-dependent threshold, in contrast to the HOG pathway, whose activation relies on a fixed volume-dependent threshold, ii) there is no or little direct crosstalk between the HOG and CWI pathways, and iii) its mainly the HOG alone mediating adaptation of cellular osmotic pressure for both hyper- as well as hypo-osmotic stress. Thus, by iteratively combining mathematical modeling with experimentation we achieved a better understanding of regulatory mechanisms of yeast osmo-homeostasis and formulated new hypotheses about osmo-sensing. PMID:27515486

  4. Identification of Telomerase RNAs from Filamentous Fungi Reveals Conservation with Vertebrates and Yeasts

    PubMed Central

    Kuprys, Paulius V.; Davis, Shaun M.; Hauer, Tyler M.; Meltser, Max; Tzfati, Yehuda; Kirk, Karen E.

    2013-01-01

    Telomeres are the nucleoprotein complexes at eukaryotic chromosomal ends. Telomeric DNA is synthesized by the ribonucleoprotein telomerase, which comprises a telomerase reverse transcriptase (TERT) and a telomerase RNA (TER). TER contains a template for telomeric DNA synthesis. Filamentous fungi possess extremely short and tightly regulated telomeres. Although TERT is well conserved between most organisms, TER is highly divergent and thus difficult to identify. In order to identify the TER sequence, we used the unusually long telomeric repeat sequence of Aspergillus oryzae together with reverse-transcription-PCR and identified a transcribed sequence that contains the potential template within a region predicted to be single stranded. We report the discovery of TERs from twelve other related filamentous fungi using comparative genomic analysis. These TERs exhibited strong conservation with the vertebrate template sequence, and two of these potentially use the identical template as humans. We demonstrate the existence of important processing elements required for the maturation of yeast TERs such as an Sm site, a 5′ splice site and a branch point, within the newly identified TER sequences. RNA folding programs applied to the TER sequences show the presence of secondary structures necessary for telomerase activity, such as a yeast-like template boundary, pseudoknot, and a vertebrate-like three-way junction. These telomerase RNAs identified from filamentous fungi display conserved structural elements from both yeast and vertebrate TERs. These findings not only provide insights into the structure and evolution of a complex RNA but also provide molecular tools to further study telomere dynamics in filamentous fungi. PMID:23555591

  5. Dental orthopantomogram biometrics system for human identification.

    PubMed

    Singh, Sandeep; Bhargava, Darpan; Deshpande, Ashwini

    2013-07-01

    Fingerprinting is the most widely accepted method of identification of people. But in cases of disfigured, decomposed, burnt or fragmented bodies, it is of limited value. Teeth and dental restorations on the other hand are extremely resistant to destruction by fire. They retain a number of their original characteristics, which are often unique and hence offer a possibility of rather accurate and legally acceptable identification of such remains. This study was undertaken to evaluate the utility of orthopantomography for human identification and propose a coding system for orthopantomogram (OPG), which can be utilized as an identification tool in forensic sciences.

  6. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A

    1981-01-01

    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  7. Identification of Malassezia yeast species isolated from patients with pityriasis versicolor.

    PubMed

    Petry, Vanessa; Tanhausen, Fernanda; Weiss, Luciana; Milan, Thais; Mezzari, Adelina; Weber, Magda Blessmann

    2011-01-01

    Pityriasis versicolor (PV) is a disease with worldwide distribution. Twelve different species of Malassezia yeast have been described. The objective of this study was to determine which species of Malassezia are more prevalent in patients with pityriasis versicolor. Samples were collected by scraping the lesions of 87 patients with a clinical suspicion of pityriasis versicolor. The samples were then submitted to fungal microscopy and culture to identify the species. The species found were: Malassezia sympodialis (30%), Malassezia furfur (25.7%), Malassezia globosa (22.7%), Malassezia restricta (12.1%), Malassezia obtusa (7.6%) and Malassezia slooffiae (1.5%).

  8. Big data mining powers fungal research: recent advances in fission yeast systems biology approaches.

    PubMed

    Wang, Zhe

    2016-10-11

    Biology research has entered into big data era. Systems biology approaches therefore become the powerful tools to obtain the whole landscape of how cell separate, grow, and resist the stresses. Fission yeast Schizosaccharomyces pombe is wonderful unicellular eukaryote model, especially studying its division and metabolism can facilitate to understanding the molecular mechanism of cancer and discovering anticancer agents. In this perspective, we discuss the recent advanced fission yeast systems biology tools, mainly focus on metabolomics profiling and metabolic modeling, protein-protein interactome and genetic interaction network, DNA sequencing and applications, and high-throughput phenotypic screening. We therefore hope this review can be useful for interested fungal researchers as well as bioformaticians.

  9. System identification as an application of optimization

    NASA Astrophysics Data System (ADS)

    Brasio, Ana S. R.; Romanenko, Andrey; Fernandes, Natercia C. P.

    2012-09-01

    The work concerns the system identification of industrial processes via the Sequential Quadratic Programming algorithm. The proposed approach, testing scenarios, and the system identification results are discussed. The tool is tested with two datasets, the first one collected in loco from an industrial process and the second one generated with a plant simulator of a continuous stirred tank reactor, a system widely used in industry. In both cases, the resulting models capture well the process dynamics.

  10. Misidentification of clinical yeast isolates by using the updated Vitek Yeast Biochemical Card.

    PubMed Central

    Dooley, D P; Beckius, M L; Jeffrey, B S

    1994-01-01

    The Vitek Yeast Biochemical Card (YBC) is widely used as a rapid identification (RI) (within 48 h) system for clinical yeast isolates. We compared the RI results obtained by the YBC technique with matched results obtained with the API 20C system. The RI of germ tube-negative yeasts isolated from 222 clinical specimens was performed with the YBC system, and the results were compared with those of standard identifications obtained by using the API 20C system and morphology, with additional biochemical reactions performed as required. Commonly isolated yeasts (Candida albicans [n = 29], Candida tropicalis [n = 40], Torulopsis [Candida] glabrata [n = 28], Candida parapsilosis [n = 12], and Cryptococcus neoformans [n = 14]) were generally well identified (115 of 123 [93%] identified correctly, with only C. albicans, C. tropicalis, and C. neoformans mis- or unidentified more than once). The RI of less commonly isolated yeasts included in the YBC database, however, was less successful (54 of 99 [55%] correct). The YBC card failed to identify 42% (10 of 24) of Candida krusei isolates, 80% (4 of 5) of Candida lambica isolates, 88% (7 of 8) of Trichosporon beigelii isolates, and 83% (10 of 12) of Cryptococcus isolates (non-C. neoformans species). For most identification failures (79%; 42 of 53) there was no identification by the end of 48 h; the other identification failures (21%; 11 of 53) gave definite but incorrect identifications. Of eight rare clinical yeast isolates not included in the Vitek database, six were correctly, not identified, while two (25%) were falsely assigned a definite RI (one Hansenula fabianii isolate was identified as Rhodotorula glutinis, and one Hansenula isolate [non-Hansenula anomala] was identified as Hansenula anomala). While the Vitek YBC rapidly and adequately identifies common yeast isolates, it fails in the RI of more unusual organisms. PMID:7883873

  11. Information, Consistent Estimation and Dynamic System Identification.

    DTIC Science & Technology

    1976-11-01

    Data fnfetd) --t 90gg- I .No-ýnber 1976 Report ESL-R-718 INFORMATION, CONSISTENT ESTIMATION AND DYNAMIC SYSTEM IDENTIFICATION by Yoram Bara W This report...8217 • L .. +• " -’ .... .. .... .. .. ’• ’• "- ’"l ’"ll ~ll~ 2 l 1NFURMAT10N~, CUNSISTENT LST1IMATION JaN DYiNAMIC SYSTEM IDENTIFICATION byI Yoramn...one? 1. particular problem of considerable practical significance is that qI -3-3 of dynamic system identification . The situation described above, and

  12. Isolation, Identification and Characterization of Yeasts from Fermented Goat Milk of the Yaghnob Valley in Tajikistan.

    PubMed

    Qvirist, Linnea A; De Filippo, Carlotta; Strati, Francesco; Stefanini, Irene; Sordo, Maddalena; Andlid, Thomas; Felis, Giovanna E; Mattarelli, Paola; Cavalieri, Duccio

    2016-01-01

    The geographically isolated region of the Yaghnob Valley, Tajikistan, has allowed its inhabitants to maintain a unique culture and lifestyle. Their fermented goat milk constitutes one of the staple foods for the Yaghnob population, and is produced by backslopping, i.e., using the previous fermentation batch to inoculate the new one. This study addresses the yeast composition of the fermented milk, assessing genotypic, and phenotypic properties. The 52 isolates included in this study revealed small species diversity, belonging to Kluyveromyces marxianus, Pichia fermentans, Saccharomyces cerevisiae, and one Kazachstania unispora. The K. marxianus strains showed two different genotypes, one of which never described previously. The two genetically different groups also differed significantly in several phenotypic characteristics, such as tolerance toward high temperatures, low pH, and presence of acid. Microsatellite analysis of the S. cerevisiae strains from this study, compared to 350 previously described strains, attributed the Yaghnobi S. cerevisiae to two different ancestry origins, both distinct from the wine and beer strains, and similar to strains isolated from human and insects feces, suggesting a peculiar origin of these strains, and the existence of a gut reservoir for S. cerevisiae. Our work constitutes a foundation for strain selection for future applications as starter cultures in food fermentations. This work is the first ever on yeast diversity from fermented milk of the previously unexplored area of the Yaghnob Valley.

  13. Identification of Arabidopsis Transcriptional Regulators by Yeast One-Hybrid Screens Using a Transcription Factor ORFeome.

    PubMed

    Breton, Ghislain; Kay, Steve A; Pruneda-Paz, José L

    2016-01-01

    Genetic and molecular approaches revealed that the circadian clock network structure is comprised of several interlocked positive and negative transcriptional feedback loops. The network evolved to sense and integrate inputs from environmental cues to adjust daily rhythms in physiological processes. Compiling evidence indicates that part of this regulation happens at the transcriptional level through subtle adjustments in the expression of core clock genes. Thus, to better understand the network and identify the molecular mechanisms of clock input pathways, it is imperative to determine how core clock genes are regulated. For this purpose we developed reagents for an unbiased approach to identify transcription factors (TFs) interacting with the promoters of core clock genes. At the center of this approach lies the yeast one-hybrid (Y1H) assay in which a pool of proteins fused to the GAL4 transcriptional activation domain are tested for their ability to interact with a selected promoter fragment in yeast cells. Taking advantage of the fact that Arabidopsis TF genes are well annotated, we generated a comprehensive TF clone collection (TF ORFeome) and used it to replace the standard cDNA pool strategy traditionally used in Y1H screens. The use of this TF clone collection substantially accelerates the comprehensive discovery of promoter-specific DNA binding activities among all Arabidopsis TFs. Considering that this strategy can be extended to the study of the promoter interactome of any Arabidopsis gene, we developed a low throughput protocol that can be universally implemented to screen the ~2000 TF clone library.

  14. Isolation, identification and characterization of Cystobasidium oligophagum JRC1: A cellulase and lipase producing oleaginous yeast.

    PubMed

    Vyas, Sachin; Chhabra, Meenu

    2016-10-15

    Oleaginous yeast closely related to Cystobasidium oligophagum was isolated from soil rich in cellulosic waste. The yeast was isolated based on its ability to accumulate intracellular lipid, grow on carboxymethylcellulose (CMC) and produce lipase. It could accumulate up to 39.44% lipid in a glucose medium (12.45±0.97g/l biomass production). It was able to grow and accumulate lipids (36.46%) in the medium containing CMC as the sole carbon source. The specific enzyme activities obtained for endoglucanase, exoglucanase, and β-glucosidase were 2.27, 1.26, and 0.98IU/mg respectively. The specific enzyme activities obtained for intracellular and extracellular lipase were 2.16 and 2.88IU/mg respectively. It could grow and accumulate lipids in substrates including glycerol (42.04%), starch (41.54%), xylose (36.24%), maltose (26.31%), fructose (24.29%), lactose (21.91%) and sucrose (21.72%). The lipid profile of the organism was suitable for obtaining biodiesel with desirable fuel properties.

  15. Isolation, Identification and Characterization of Yeasts from Fermented Goat Milk of the Yaghnob Valley in Tajikistan

    PubMed Central

    Qvirist, Linnea A.; De Filippo, Carlotta; Strati, Francesco; Stefanini, Irene; Sordo, Maddalena; Andlid, Thomas; Felis, Giovanna E.; Mattarelli, Paola; Cavalieri, Duccio

    2016-01-01

    The geographically isolated region of the Yaghnob Valley, Tajikistan, has allowed its inhabitants to maintain a unique culture and lifestyle. Their fermented goat milk constitutes one of the staple foods for the Yaghnob population, and is produced by backslopping, i.e., using the previous fermentation batch to inoculate the new one. This study addresses the yeast composition of the fermented milk, assessing genotypic, and phenotypic properties. The 52 isolates included in this study revealed small species diversity, belonging to Kluyveromyces marxianus, Pichia fermentans, Saccharomyces cerevisiae, and one Kazachstania unispora. The K. marxianus strains showed two different genotypes, one of which never described previously. The two genetically different groups also differed significantly in several phenotypic characteristics, such as tolerance toward high temperatures, low pH, and presence of acid. Microsatellite analysis of the S. cerevisiae strains from this study, compared to 350 previously described strains, attributed the Yaghnobi S. cerevisiae to two different ancestry origins, both distinct from the wine and beer strains, and similar to strains isolated from human and insects feces, suggesting a peculiar origin of these strains, and the existence of a gut reservoir for S. cerevisiae. Our work constitutes a foundation for strain selection for future applications as starter cultures in food fermentations. This work is the first ever on yeast diversity from fermented milk of the previously unexplored area of the Yaghnob Valley. PMID:27857705

  16. Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast

    PubMed Central

    Libkind, Diego; Hittinger, Chris Todd; Valério, Elisabete; Gonçalves, Carla; Dover, Jim; Johnston, Mark; Gonçalves, Paula; Sampaio, José Paulo

    2011-01-01

    Domestication of plants and animals promoted humanity's transition from nomadic to sedentary lifestyles, demographic expansion, and the emergence of civilizations. In contrast to the well-documented successes of crop and livestock breeding, processes of microbe domestication remain obscure, despite the importance of microbes to the production of food, beverages, and biofuels. Lager-beer, first brewed in the 15th century, employs an allotetraploid hybrid yeast, Saccharomyces pastorianus (syn. Saccharomyces carlsbergensis), a domesticated species created by the fusion of a Saccharomyces cerevisiae ale-yeast with an unknown cryotolerant Saccharomyces species. We report the isolation of that species and designate it Saccharomyces eubayanus sp. nov. because of its resemblance to Saccharomyces bayanus (a complex hybrid of S. eubayanus, Saccharomyces uvarum, and S. cerevisiae found only in the brewing environment). Individuals from populations of S. eubayanus and its sister species, S. uvarum, exist in apparent sympatry in Nothofagus (Southern beech) forests in Patagonia, but are isolated genetically through intrinsic postzygotic barriers, and ecologically through host-preference. The draft genome sequence of S. eubayanus is 99.5% identical to the non-S. cerevisiae portion of the S. pastorianus genome sequence and suggests specific changes in sugar and sulfite metabolism that were crucial for domestication in the lager-brewing environment. This study shows that combining microbial ecology with comparative genomics facilitates the discovery and preservation of wild genetic stocks of domesticated microbes to trace their history, identify genetic changes, and suggest paths to further industrial improvement. PMID:21873232

  17. A New System for Comparative Functional Genomics of Saccharomyces Yeasts

    PubMed Central

    Caudy, Amy A.; Guan, Yuanfang; Jia, Yue; Hansen, Christina; DeSevo, Chris; Hayes, Alicia P.; Agee, Joy; Alvarez-Dominguez, Juan R.; Arellano, Hugo; Barrett, Daniel; Bauerle, Cynthia; Bisaria, Namita; Bradley, Patrick H.; Breunig, J. Scott; Bush, Erin; Cappel, David; Capra, Emily; Chen, Walter; Clore, John; Combs, Peter A.; Doucette, Christopher; Demuren, Olukunle; Fellowes, Peter; Freeman, Sam; Frenkel, Evgeni; Gadala-Maria, Daniel; Gawande, Richa; Glass, David; Grossberg, Samuel; Gupta, Anita; Hammonds-Odie, Latanya; Hoisos, Aaron; Hsi, Jenny; Hsu, Yu-Han Huang; Inukai, Sachi; Karczewski, Konrad J.; Ke, Xiaobo; Kojima, Mina; Leachman, Samuel; Lieber, Danny; Liebowitz, Anna; Liu, Julia; Liu, Yufei; Martin, Trevor; Mena, Jose; Mendoza, Rosa; Myhrvold, Cameron; Millian, Christian; Pfau, Sarah; Raj, Sandeep; Rich, Matt; Rokicki, Joe; Rounds, William; Salazar, Michael; Salesi, Matthew; Sharma, Rajani; Silverman, Sanford; Singer, Cara; Sinha, Sandhya; Staller, Max; Stern, Philip; Tang, Hanlin; Weeks, Sharon; Weidmann, Maxwell; Wolf, Ashley; Young, Carmen; Yuan, Jie; Crutchfield, Christopher; McClean, Megan; Murphy, Coleen T.; Llinás, Manuel; Botstein, David; Troyanskaya, Olga G.; Dunham, Maitreya J.

    2013-01-01

    Whole-genome sequencing, particularly in fungi, has progressed at a tremendous rate. More difficult, however, is experimental testing of the inferences about gene function that can be drawn from comparative sequence analysis alone. We present a genome-wide functional characterization of a sequenced but experimentally understudied budding yeast, Saccharomyces bayanus var. uvarum (henceforth referred to as S. bayanus), allowing us to map changes over the 20 million years that separate this organism from S. cerevisiae. We first created a suite of genetic tools to facilitate work in S. bayanus. Next, we measured the gene-expression response of S. bayanus to a diverse set of perturbations optimized using a computational approach to cover a diverse array of functionally relevant biological responses. The resulting data set reveals that gene-expression patterns are largely conserved, but significant changes may exist in regulatory networks such as carbohydrate utilization and meiosis. In addition to regulatory changes, our approach identified gene functions that have diverged. The functions of genes in core pathways are highly conserved, but we observed many changes in which genes are involved in osmotic stress, peroxisome biogenesis, and autophagy. A surprising number of genes specific to S. bayanus respond to oxidative stress, suggesting the organism may have evolved under different selection pressures than S. cerevisiae. This work expands the scope of genome-scale evolutionary studies from sequence-based analysis to rapid experimental characterization and could be adopted for functional mapping in any lineage of interest. Furthermore, our detailed characterization of S. bayanus provides a valuable resource for comparative functional genomics studies in yeast. PMID:23852385

  18. A new system for comparative functional genomics of Saccharomyces yeasts.

    PubMed

    Caudy, Amy A; Guan, Yuanfang; Jia, Yue; Hansen, Christina; DeSevo, Chris; Hayes, Alicia P; Agee, Joy; Alvarez-Dominguez, Juan R; Arellano, Hugo; Barrett, Daniel; Bauerle, Cynthia; Bisaria, Namita; Bradley, Patrick H; Breunig, J Scott; Bush, Erin; Cappel, David; Capra, Emily; Chen, Walter; Clore, John; Combs, Peter A; Doucette, Christopher; Demuren, Olukunle; Fellowes, Peter; Freeman, Sam; Frenkel, Evgeni; Gadala-Maria, Daniel; Gawande, Richa; Glass, David; Grossberg, Samuel; Gupta, Anita; Hammonds-Odie, Latanya; Hoisos, Aaron; Hsi, Jenny; Hsu, Yu-Han Huang; Inukai, Sachi; Karczewski, Konrad J; Ke, Xiaobo; Kojima, Mina; Leachman, Samuel; Lieber, Danny; Liebowitz, Anna; Liu, Julia; Liu, Yufei; Martin, Trevor; Mena, Jose; Mendoza, Rosa; Myhrvold, Cameron; Millian, Christian; Pfau, Sarah; Raj, Sandeep; Rich, Matt; Rokicki, Joe; Rounds, William; Salazar, Michael; Salesi, Matthew; Sharma, Rajani; Silverman, Sanford; Singer, Cara; Sinha, Sandhya; Staller, Max; Stern, Philip; Tang, Hanlin; Weeks, Sharon; Weidmann, Maxwell; Wolf, Ashley; Young, Carmen; Yuan, Jie; Crutchfield, Christopher; McClean, Megan; Murphy, Coleen T; Llinás, Manuel; Botstein, David; Troyanskaya, Olga G; Dunham, Maitreya J

    2013-09-01

    Whole-genome sequencing, particularly in fungi, has progressed at a tremendous rate. More difficult, however, is experimental testing of the inferences about gene function that can be drawn from comparative sequence analysis alone. We present a genome-wide functional characterization of a sequenced but experimentally understudied budding yeast, Saccharomyces bayanus var. uvarum (henceforth referred to as S. bayanus), allowing us to map changes over the 20 million years that separate this organism from S. cerevisiae. We first created a suite of genetic tools to facilitate work in S. bayanus. Next, we measured the gene-expression response of S. bayanus to a diverse set of perturbations optimized using a computational approach to cover a diverse array of functionally relevant biological responses. The resulting data set reveals that gene-expression patterns are largely conserved, but significant changes may exist in regulatory networks such as carbohydrate utilization and meiosis. In addition to regulatory changes, our approach identified gene functions that have diverged. The functions of genes in core pathways are highly conserved, but we observed many changes in which genes are involved in osmotic stress, peroxisome biogenesis, and autophagy. A surprising number of genes specific to S. bayanus respond to oxidative stress, suggesting the organism may have evolved under different selection pressures than S. cerevisiae. This work expands the scope of genome-scale evolutionary studies from sequence-based analysis to rapid experimental characterization and could be adopted for functional mapping in any lineage of interest. Furthermore, our detailed characterization of S. bayanus provides a valuable resource for comparative functional genomics studies in yeast.

  19. Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.

    PubMed

    Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E

    2016-01-01

    Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far.

  20. Extracellular enzyme production and phylogenetic distribution of yeasts in wastewater treatment systems.

    PubMed

    Yang, Qingxiang; Zhang, Hao; Li, Xueling; Wang, Zhe; Xu, Ying; Ren, Siwei; Chen, Xuanyu; Xu, Yuanyuan; Hao, Hongxin; Wang, Hailei

    2013-02-01

    The abilities of yeasts to produce different extracellular enzymes and their distribution characteristics were studied in municipal, inosine fermentation, papermaking, antibiotic fermentation, and printing and dyeing wastewater treatment systems. The results indicated that of the 257 yeasts, 16, 14, 55, and 11 produced lipase, protease, manganese dependant peroxidase (MnP), and lignin peroxidase (LiP), respectively. They were distributed in 12 identified and four unidentified genera, in which Candida rugosa (AA-M17) and an unidentified Saccharomycetales (AA-Y5), Pseudozyma sp. (PH-M15), Candida sp. (MO-Y11), and Trichosporon montevideense (MO-M16) were shown to have the highest activity of lipase, protease, Mnp, and LiP, respectively. No yeast had amylase, cellulose, phytase, or laccase activity. Although only 60 isolates produced ligninolytic enzymes, 249 of the 257 yeasts could decolorize different dyes through the mechanism of biodegradation (222 isolates) or bio-sorption. The types of extracellular enzymes that the yeasts produced were significantly shaped by the types of wastewater treated.

  1. Global identification of new substrates for the yeast endoribonuclease, RNase mitochondrial RNA processing (MRP).

    PubMed

    Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E

    2012-10-26

    RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27(Kip1), SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease.

  2. [Isolation, identification and serotyping of yeasts obtained from the vaginal fluid in patients with clinical vaginitis].

    PubMed

    Mendoza, M; González, I; Bellorin, E J; Salazar, W; Mendoza, L; Zambrano, E A; de Albornoz, M C

    1999-03-01

    A study was carried out to determine the presence of Candida in 105 patients with clinical vaginitis who consulted in the Infectious Disease Unit of the Vargas Hospital after referral from Gynecology Service. Yeasts were detected in 23 cases (24%), and identified as C. albicans (12), C. tropicalis (5), C. guilliermondii (3), C. glabrata (2) and C. parapsilosis (1). The presence of hyphae was observed in 50% of the direct examinations, in which the isolated species was C. albicans. These structures were not observed in infections with other species of Candida. In this study, there was relatively little difference between the percentages of serotypes A and B, 58 % and 42, respectively. This is in contrast with previous studies reported in clinical material from Venezuela and other countries, in which serotype A presented a greater incidence than serotype B. Our observations suggest an increase in serotype B C. albicans in vaginal candidiasis.

  3. The odontology victim identification skill assessment system.

    PubMed

    Zohn, Harry K; Dashkow, Sheila; Aschheim, Kenneth W; Dobrin, Lawrence A; Glazer, Howard S; Kirschbaum, Mitchell; Levitt, Daniel; Feldman, Cecile A

    2010-05-01

    Mass fatality identification efforts involving forensic odontology can involve hundreds of dental volunteers. A literature review was conducted and forensic odontologists and dental educators consulted to identify lessons learned from past mass fatality identification efforts. As a result, the authors propose a skill assessment system, the Odontology Victim Identification Skill Assessment System (OVID-SAS), which details qualifications required to participate on the Antemortem, Postmortem, Ante/Postmortem Comparison, Field, and Shift Leader/Initial Response Teams. For each qualification, specific skills have been identified along with suggested educational pedagogy and skill assessment methods. Courses and assessments can be developed by dental schools, professional associations, or forensic organizations to teach and test for the skills required for dental volunteers to participate on each team. By implementing a system, such as OVID-SAS, forensic odontologists responsible for organizing and managing a forensic odontology mass fatality identification effort will be able to optimally utilize individuals presenting with proven skills.

  4. Identification of medically relevant species of arthroconidial yeasts by use of matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    PubMed

    Kolecka, Anna; Khayhan, Kantarawee; Groenewald, Marizeth; Theelen, Bart; Arabatzis, Michael; Velegraki, Aristea; Kostrzewa, Markus; Mares, Mihai; Taj-Aldeen, Saad J; Boekhout, Teun

    2013-08-01

    Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was used for an extensive identification study of arthroconidial yeasts, using 85 reference strains from the CBS-KNAW yeast collection and 134 clinical isolates collected from medical centers in Qatar, Greece, and Romania. The test set included 72 strains of ascomycetous yeasts (Galactomyces, Geotrichum, Saprochaete, and Magnusiomyces spp.) and 147 strains of basidiomycetous yeasts (Trichosporon and Guehomyces spp.). With minimal preparation time, MALDI-TOF MS proved to be an excellent diagnostic tool that provided reliable identification of most (98%) of the tested strains to the species level, with good discriminatory power. The majority of strains were correctly identified at the species level with good scores (>2.0) and seven of the tested strains with log score values between 1.7 and 2.0. The MALDI-TOF MS results obtained were consistent with validated internal transcribed spacer (ITS) and/or large subunit (LSU) ribosomal DNA sequencing results. Expanding the mass spectrum database by increasing the number of reference strains for closely related species, including those of nonclinical origin, should enhance the usefulness of MALDI-TOF MS-based diagnostic analysis of these arthroconidial fungi in medical and other laboratories.

  5. Choosing Between Yeast and Bacterial Expression Systems: Yield Dependent

    NASA Technical Reports Server (NTRS)

    Miller, Rebecca S.; Malone, Christine C.; Moore, Blake P.; Burk, Melissa; Crawford, Lisa; Karr, Laurel J.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    Green fluorescent protein (GFP) is a naturally occurring fluorescent protein isolated from the jellyfish Aequorea victoria. The intrinsic fluorescence of the protein is due to a chromophore located in the center of the molecule. Its usefulness has been established as a marker for gene expression and localization of gene products. GFP has recently been utilized as a model protein for crystallization studies at NASA/MSFC, both in earth-based and in microgravity experiments. Because large quantities of purified protein were needed, the cDNA of GFP was cloned into the Pichia pastoris pPICZ(alpha) C strain, with very little protein secreted into the media. Microscopic analysis prior to harvest showed gigantic green fluorescent yeast, but upon harvesting most protein was degraded. Trial fermentations of GFP cloned into pPICZ A for intracellular expression provided unsatisfactory yield. GFP cloned into E, coli was overexpressed at greater than 150 mg/liter, with purification yields at greater than 100mg/liter.

  6. Nuclear Materials Identification System Operational Manual

    SciTech Connect

    Chiang, L.G.

    2001-04-10

    This report describes the operation and setup of the Nuclear Materials Identification System (NMIS) with a {sup 252}Cf neutron source at the Oak Ridge Y-12 Plant. The components of the system are described with a description of the setup of the system along with an overview of the NMIS measurements for scanning, calibration, and confirmation of inventory items.

  7. Biological identification systems: genetic markers.

    PubMed

    Cunningham, E P; Meghen, C M

    2001-08-01

    Individual animals differ from each other on a number of biological levels. At the most basic level, the deoxyribonucleic acid (DNA) of each animal is different, and transcription of the DNA code yields variations at the protein level, which in turn give rise to individual diversity at the physical level. In recent years, accessing the primary genetic code of individual animals has become straightforward. The authors briefly review the development of biological identification technologies and then consider in more detail the application of current DNA testing technologies to issues of traceability of live animals and derived products. Although largely focused on cattle and beef traceability, the principles described are relevant to ovine, porcine and equine traceability. The accelerating pace of innovation and development within the field of molecular genetics suggests that the technologies described may soon be superseded. However, the principles of genetic identification will remain unchanged.

  8. [Isolation and primary identification of methylotrophic yeast Hansenula polymorpha mutants for peroxisome biogenesis].

    PubMed

    Kurbatova, E M; Dutova, T A; Serkova, N N; Rabinovich, Ia M; Trotsenko, Iu A

    2004-05-01

    After exposure of cells of the methylotrophic yeast Hansenula polymorpha HF246 leu1-1 to N-nitro-N-nitrosoguanidine, a collection of 227 mutants unable to grow on methanol at elevated temperature (45 degrees C) was obtained. Ninety four ts mutants (35% of the total number of mutants), which were unable to grow on methanol only at 45 degrees C but could grow at optimal temperature (37 degrees C), were isolated. Complementation analysis of mutants using 12 deletion mutants for genes of peroxisome biogenesis (PEX) (available in this yeast species by the beginning of our work) allowed to assign 51 mutants (including 16 ts) to the separate group of mutants unable to complement deletion mutants with defects in eight PEX genes. These mutants were classified into three groups: group 1 contained 10 pex10 mutants (4 ts mutants among them); group 2 included 19 mutants that failed to complement other pex testers: 1 pex1; 2 pex4 (1 ts); 6 pex5 (5 ts); 3 pex8; 6 (3ts)- pex19; group 3 contained 22 "multiple" mutants. In mutants of group 3, hybrids with several testers do not grow on methanol. All mutants (51) carried recessive mutations, except for mutant 108, in which the mutation was dominant only at 30 degrees C, which suggests that it is ts-dominant. Recombination analysis of mutants belonging to group 2 revealed that only five mutants (two pex5 and three pex8) carried mutations for the corresponding PEX genes. The remaining 14 mutants yielded methanol-utilizing segregants in an arbitrarily chosen sample of hybrids with the pex tester, which indicates mutation location in other genes. In 19 mutants, random analysis of ascospores from hybrids obtained upon crossing mutants of group 3 with a strain lacking peroxisomal disorders (ade11) revealed a single mutation causing the appearance of a multiple phenotype. A more detailed study of two mutants from this group allowed the localization of this mutation in the only PEX gene (PEX or PEX2). The revealed disorder of complementation

  9. Identification of yeast genes that confer resistance to chitosan oligosaccharide (COS) using chemogenomics

    PubMed Central

    2012-01-01

    Background Chitosan oligosaccharide (COS), a deacetylated derivative of chitin, is an abundant, and renewable natural polymer. COS has higher antimicrobial properties than chitosan and is presumed to act by disrupting/permeabilizing the cell membranes of bacteria, yeast and fungi. COS is relatively non-toxic to mammals. By identifying the molecular and genetic targets of COS, we hope to gain a better understanding of the antifungal mode of action of COS. Results Three different chemogenomic fitness assays, haploinsufficiency (HIP), homozygous deletion (HOP), and multicopy suppression (MSP) profiling were combined with a transcriptomic analysis to gain insight in to the mode of action and mechanisms of resistance to chitosan oligosaccharides. The fitness assays identified 39 yeast deletion strains sensitive to COS and 21 suppressors of COS sensitivity. The genes identified are involved in processes such as RNA biology (transcription, translation and regulatory mechanisms), membrane functions (e.g. signalling, transport and targeting), membrane structural components, cell division, and proteasome processes. The transcriptomes of control wild type and 5 suppressor strains overexpressing ARL1, BCK2, ERG24, MSG5, or RBA50, were analyzed in the presence and absence of COS. Some of the up-regulated transcripts in the suppressor overexpressing strains exposed to COS included genes involved in transcription, cell cycle, stress response and the Ras signal transduction pathway. Down-regulated transcripts included those encoding protein folding components and respiratory chain proteins. The COS-induced transcriptional response is distinct from previously described environmental stress responses (i.e. thermal, salt, osmotic and oxidative stress) and pre-treatment with these well characterized environmental stressors provided little or any resistance to COS. Conclusions Overexpression of the ARL1 gene, a member of the Ras superfamily that regulates membrane trafficking, provides

  10. Multi-level RF identification system

    DOEpatents

    Steele, Kerry D.; Anderson, Gordon A.; Gilbert, Ronald W.

    2004-07-20

    A radio frequency identification system having a radio frequency transceiver for generating a continuous wave RF interrogation signal that impinges upon an RF identification tag. An oscillation circuit in the RF identification tag modulates the interrogation signal with a subcarrier of a predetermined frequency and modulates the frequency-modulated signal back to the transmitting interrogator. The interrogator recovers and analyzes the subcarrier signal and determines its frequency. The interrogator generates an output indicative of the frequency of the subcarrier frequency, thereby identifying the responding RFID tag as one of a "class" of RFID tags configured to respond with a subcarrier signal of a predetermined frequency.

  11. Modeling, system identification, and control of ASTREX

    NASA Technical Reports Server (NTRS)

    Abhyankar, Nandu S.; Ramakrishnan, J.; Byun, K. W.; Das, A.; Cossey, Derek F.; Berg, J.

    1993-01-01

    The modeling, system identification and controller design aspects of the ASTREX precision space structure are presented in this work. Modeling of ASTREX is performed using NASTRAN, TREETOPS and I-DEAS. The models generated range from simple linear time-invariant models to nonlinear models used for large angle simulations. Identification in both the time and frequency domains are presented. The experimental set up and the results from the identification experiments are included. Finally, controller design for ASTREX is presented. Simulation results using this optimal controller demonstrate the controller performance. Finally the future directions and plans for the facility are addressed.

  12. Protein expression-yeast.

    PubMed

    Nielsen, Klaus H

    2014-01-01

    Yeast is an excellent system for the expression of recombinant eukaryotic proteins. Both endogenous and heterologous proteins can be overexpressed in yeast (Phan et al., 2001; Ton and Rao, 2004). Because yeast is easy to manipulate genetically, a strain can be optimized for the expression of a specific protein. Many eukaryotic proteins contain posttranslational modifications that can be performed in yeast but not in bacterial expression systems. In comparison with mammalian cell culture expression systems, growing yeast is both faster and less expensive, and large-scale cultures can be performed using fermentation. While several different yeast expression systems exist, this chapter focuses on the budding yeast Saccharomyces cerevisiae and will briefly describe some options to consider when selecting vectors and tags to be used for protein expression. Throughout this chapter, the expression and purification of yeast eIF3 is shown as an example alongside a general scheme outline.

  13. On Markov parameters in system identification

    NASA Technical Reports Server (NTRS)

    Phan, Minh; Juang, Jer-Nan; Longman, Richard W.

    1991-01-01

    A detailed discussion of Markov parameters in system identification is given. Different forms of input-output representation of linear discrete-time systems are reviewed and discussed. Interpretation of sampled response data as Markov parameters is presented. Relations between the state-space model and particular linear difference models via the Markov parameters are formulated. A generalization of Markov parameters to observer and Kalman filter Markov parameters for system identification is explained. These extended Markov parameters play an important role in providing not only a state-space realization, but also an observer/Kalman filter for the system of interest.

  14. Identification of Yeast V-ATPase Mutants by Western Blots Analysis of Whole Cell Lysates

    NASA Astrophysics Data System (ADS)

    Parra-Belky, Karlett

    2002-11-01

    A biochemistry laboratory was designed for an undergraduate course to help students better understand the link between molecular engineering and biochemistry. Students identified unknown yeast strains with high specificity using SDS-PAGE and Western blot analysis of whole cell lysates. This problem-solving exercise is a common application of biochemistry in biotechnology research. Three different strains were used: a wild-type and two mutants for the proton pump vacuolar ATPase (V-ATPase). V-ATPases are multisubunit enzymes and the mutants used were deletion mutants; each lacked one structural gene of the complex. After three, three-hour labs, mutant strains were easily identified by the students and distinguished from wild-type cells analyzing the pattern of SDS-PAGE distribution of proteins. Identifying different subunits of one multimeric protein allowed for discussion of the structure and function of this metabolic enzyme, which captured the interest of the students. The experiment can be adapted to other multimeric protein complexes and shows improvement of the described methodology over previous reports, perhaps because the problem and its solution are representative of the type of techniques currently used in research labs.

  15. Identification and characterization of bioemulsifier-producing yeasts isolated from effluents of a dairy industry.

    PubMed

    Monteiro, A S; Bonfim, M R Q; Domingues, V S; Corrêa, A; Siqueira, E P; Zani, C L; Santos, V L

    2010-07-01

    New bioemulsifier-producing yeasts were isolated from the biological wastewater treatment plant of a dairy industry. Of the 31 bioemulsifier-producing strains, 12 showed emulsifying activity after 2months of incubation, with E(24) values ranging from 7% to 78%. However, only Trichosporon loubieri CLV20, Geotrichum sp. CLOA40, and T. montevideense CLOA70 exhibited high emulsion-stabilizing capacity, with E(24) values of 78%, 67%, and 66%, respectively. These isolates were shown to induce a strong emulsion stabilizing activity rather than the reduction of the interfacial tension. These strains exhibited similar growth rates in the exponential growth phase, with a clear acceleration after 24h and stabilization of the activity after 144h. Emulsification and stability properties of the bioemulsifiers were compared to those of commercial surfactants after the addition of NaCl and exposure to temperature of 100 degrees C. The compounds produced by the isolates appeared to be lipid-polysaccharide complexes. Gas chromatograph analysis of the lipidic fraction of the bioemulsifiers from CLV20, CLOA40, and CLOA70 shows the prevalence of (9Z,12Z)-octadeca-9,12-dienoic acid, in concentrations of 42.8%, 25.9%, and 49.8%, respectively. The carbohydrate composition, as determined by GC-MS of their alditol acetate derivatives, showed a predominance of mannose, galactose, xylose and arabinose.

  16. Global Identification of New Substrates for the Yeast Endoribonuclease, RNase Mitochondrial RNA Processing (MRP)*

    PubMed Central

    Aulds, Jason; Wierzbicki, Sara; McNairn, Adrian; Schmitt, Mark E.

    2012-01-01

    RNase mitochondrial RNA processing (MRP) is an essential, evolutionarily conserved endoribonuclease composed of 10 different protein subunits and a single RNA. RNase MRP has established roles in multiple pathways including ribosome biogenesis, cell cycle regulation, and mitochondrial DNA replication. Although each of these functions is important to cell growth, additional functions may exist given the essential nature of the complex. To identify novel RNase MRP substrates, we utilized RNA immunoprecipitation and microarray chip analysis to identify RNA that physically associates with RNase MRP. We identified several new potential substrates for RNase MRP including a cell cycle-regulated transcript, CTS1; the yeast homolog of the mammalian p27Kip1, SIC1; and the U2 RNA component of the spliceosome. In addition, we found RNase MRP to be involved in the regulation of the Ty1 transposon RNA. These results reinforce and broaden the role of RNase MRP in cell cycle regulation and help to identify new roles of this endoribonuclease. PMID:22977255

  17. Generation of an isogenic collection of yeast actin mutants and identification of three interrelated phenotypes.

    PubMed Central

    Whitacre, J; Davis, D; Toenjes, K; Brower, S; Adams, A

    2001-01-01

    A large collection of yeast actin mutations has been previously isolated and used in numerous studies of actin cytoskeletal function. However, the various mutations have been in congenic, rather than isogenic, backgrounds, making it difficult to compare the subtle phenotypes that are characteristic of these mutants. We have therefore placed 27 mutations in an isogenic background. We used a subset of these mutants to compare the degree to which different actin alleles are defective in sporulation, endocytosis, and growth on NaCl-containing media. We found that the three phenotypes are highly correlated. The correlations are specific and not merely a reflection of general growth defects, because the phenotypes are not correlated with growth rates under normal conditions. Significantly, those actin mutants exhibiting the most severe phenotypes in all three processes have altered residues that cluster to a small region of the actin crystal structure previously defined as the fimbrin (Sac6p)-binding site. We examined the relationship between endocytosis and growth on salt and found that shifting wild-type or actin mutant cells to high salt reduces the rate of alpha-factor internalization. These results suggest that actin mutants may be unable to grow on salt because of additive endocytic defects (due to mutation and salt). PMID:11156976

  18. Yeast as a system for modeling mitochondrial disease mechanisms and discovering therapies

    PubMed Central

    Lasserre, Jean-Paul; Dautant, Alain; Aiyar, Raeka S.; Kucharczyk, Roza; Glatigny, Annie; Tribouillard-Tanvier, Déborah; Rytka, Joanna; Blondel, Marc; Skoczen, Natalia; Reynier, Pascal; Pitayu, Laras; Rötig, Agnès; Delahodde, Agnès; Steinmetz, Lars M.; Dujardin, Geneviève; Procaccio, Vincent; di Rago, Jean-Paul

    2015-01-01

    ABSTRACT Mitochondrial diseases are severe and largely untreatable. Owing to the many essential processes carried out by mitochondria and the complex cellular systems that support these processes, these diseases are diverse, pleiotropic, and challenging to study. Much of our current understanding of mitochondrial function and dysfunction comes from studies in the baker's yeast Saccharomyces cerevisiae. Because of its good fermenting capacity, S. cerevisiae can survive mutations that inactivate oxidative phosphorylation, has the ability to tolerate the complete loss of mitochondrial DNA (a property referred to as ‘petite-positivity’), and is amenable to mitochondrial and nuclear genome manipulation. These attributes make it an excellent model system for studying and resolving the molecular basis of numerous mitochondrial diseases. Here, we review the invaluable insights this model organism has yielded about diseases caused by mitochondrial dysfunction, which ranges from primary defects in oxidative phosphorylation to metabolic disorders, as well as dysfunctions in maintaining the genome or in the dynamics of mitochondria. Owing to the high level of functional conservation between yeast and human mitochondrial genes, several yeast species have been instrumental in revealing the molecular mechanisms of pathogenic human mitochondrial gene mutations. Importantly, such insights have pointed to potential therapeutic targets, as have genetic and chemical screens using yeast. PMID:26035862

  19. Potassium uptake system Trk2 is crucial for yeast cell viability during anhydrobiosis.

    PubMed

    Borovikova, Diana; Herynkova, Pavla; Rapoport, Alexander; Sychrova, Hana

    2014-01-01

    Yeasts grow at very different potassium concentrations, adapting their intracellular cation levels to changes in the external environment. Potassium homeostasis is maintained with the help of several transporters mediating the uptake and efflux of potassium with various affinities and mechanisms. In the model yeast Saccharomyces cerevisiae, two uptake systems, Trk1 and Trk2, are responsible for the accumulation of a relatively high intracellular potassium content (200-300 mM) and the efflux of surplus potassium is mediated by the Tok1 channel and active exporters Ena ATPase and Nha1 cation/proton antiporter. Using a series of deletion mutants, we studied the role of individual potassium transporters in yeast cell resistance to dehydration. The Trk2 transporter (whose role in S. cerevisiae physiology was not clear) is important for cell viability in the stationary phase of growth and, moreover, it plays a crucial role in the yeast survival of dehydration/rehydration treatments. Mutants lacking the TRK2 gene accumulated significantly lower amounts of potassium ions in the stationary culture growth phase, and these lower amounts correlated with decreased resistance to dehydration/rehydration stress. Our results showed Trk2 to be the major potassium uptake system in stationary cells, and potassium content to be a crucial parameter for desiccation survival.

  20. Identification of the Transcription Factor Znc1p, which Regulates the Yeast-to-Hypha Transition in the Dimorphic Yeast Yarrowia lipolytica

    PubMed Central

    Martinez-Vazquez, Azul; Gonzalez-Hernandez, Angelica; Domínguez, Ángel; Rachubinski, Richard; Riquelme, Meritxell; Cuellar-Mata, Patricia; Guzman, Juan Carlos Torres

    2013-01-01

    The dimorphic yeast Yarrowia lipolytica is used as a model to study fungal differentiation because it grows as yeast-like cells or forms hyphal cells in response to changes in environmental conditions. Here, we report the isolation and characterization of a gene, ZNC1, involved in the dimorphic transition in Y. lipolytica. The ZNC1 gene encodes a 782 amino acid protein that contains a Zn(II)2C6 fungal-type zinc finger DNA-binding domain and a leucine zipper domain. ZNC1 transcription is elevated during yeast growth and decreases during the formation of mycelium. Cells in which ZNC1 has been deleted show increased hyphal cell formation. Znc1p-GFP localizes to the nucleus, but mutations within the leucine zipper domain of Znc1p, and to a lesser extent within the Zn(II)2C6 domain, result in a mislocalization of Znc1p to the cytoplasm. Microarrays comparing gene expression between znc1::URA3 and wild-type cells during both exponential growth and the induction of the yeast-to-hypha transition revealed 1,214 genes whose expression was changed by 2-fold or more under at least one of the conditions analyzed. Our results suggest that Znc1p acts as a transcription factor repressing hyphal cell formation and functions as part of a complex network regulating mycelial growth in Y. lipolytica. PMID:23826133

  1. Matrix-assisted laser desorption ionization-time of flight mass spectrometry for the identification of bacteria and yeasts in a clinical microbiological laboratory: a review.

    PubMed

    Steensels, D; Verhaegen, J; Lagrou, K

    2011-01-01

    Recently, MALDI-TOF MS devices designed for use in clinical laboratories have been commercially introduced in various large centres worldwide. All published studies conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria and yeasts in a clinical microbiological laboratory. Although all data show that MALDI-TOF MS correctly identifies the great majority of isolates processed routinely, it cannot yet identify every such isolate. Until today, MALDI-TOF MS is inappropriate for the identification of Shigella species, pneumococci and viridans streptococci. Database upgrades and sample enrichment are essential elements to refine the MALDI-TOF MS technique, allowing the method to increase its power. For the identification of a significant proportion of yeasts, an extraction method prior to analysis in the mass spectrometer is mandatory to obtain appropriate spectra. Because of the low marginal costs, and the extreme speed of MALDI-TOF MS, the technique can improve laboratory efficiency when used early in identification protocols. Lengthier, more labour-intensive, and costlier techniques can be reserved for the minority of isolates not identified with high confidence by MALDI-TOF MS. MALDI-TOF MS also has the potential to directly identify pathogens in biological fluids, such as urine samples and blood cultures. For this application however, further well-designed prospective studies are warranted. The potential for identification at the serotype or strain level, and antibiotic resistance profiling within minutes make MALDI-TOF mass spectrometry an ongoing revolution in the clinical microbiology laboratory.

  2. Trk1 and Trk2 Define the Major K+ Transport System in Fission Yeast

    PubMed Central

    Calero, Fernando; Gómez, Néstor; Ariño, Joaquín; Ramos, José

    2000-01-01

    The trk1+ gene has been proposed as a component of the K+ influx system in the fission yeast Schizosaccharomyces pombe. Previous work from our laboratories revealed that trk1 mutants do not show significantly altered content or influx of K+, although they are more sensitive to Na+. Genome database searches revealed that S. pombe encodes a putative gene (designated here trk2+) that shows significant identity to trk1+. We have analyzed the characteristics of potassium influx in S. pombe by using trk1 trk2 mutants. Unlike budding yeast, fission yeast displays a biphasic transport kinetics. trk2 mutants do not show altered K+ transport and exhibit only a slightly reduced Na+ tolerance. However, trk1 trk2 double mutants fail to grow at low K+ concentrations and show a dramatic decrease in Rb+ influx, as a result of loss of the high-affinity transport component. Furthermore, trk1 trk2 cells are very sensitive to Na+, as would be expected for a strain showing defective potassium transport. When trk1 trk2 cells are maintained in K+-free medium, the potassium content remains higher than that of the wild type or trk single mutants. In addition, the trk1 trk2 strain displays increased sensitivity to hygromycin B. These results are consistent with a hyperpolarized state of the plasma membrane. An additional phenotype of cells lacking both Trk components is a failure to grow at acidic pH. In conclusion, the Trk1 and Trk2 proteins define the major K+ transport system in fission yeast, and in contrast to what is known for budding yeast, the presence of any of these two proteins is sufficient to allow growth at normal potassium levels. PMID:10629185

  3. Examining protein–protein interactions using endogenously tagged yeast arrays: The Cross-and-Capture system

    PubMed Central

    Suter, Bernhard; Fetchko, Michael J.; Imhof, Ralph; Graham, Christopher I.; Stoffel-Studer, Ingrid; Zbinden, Caroline; Raghavan, Maanasa; Lopez, Lianet; Beneti, Lucija; Hort, Jacqueline; Fillingham, Jeffrey; Greenblatt, Jack F.; Giaever, Guri; Nislow, Corey; Stagljar, Igor

    2007-01-01

    Comprehensive approaches to detect protein–protein interactions (PPIs) have been most successful in the yeast model system. Here we present “Cross-and-Capture,” a novel assay for rapid, sensitive assessment of PPIs via pulldown of differently tagged yeast strain arrays. About 500 yeast genes that function in DNA replication, repair, and recombination and nuclear proteins of unknown function were chromosomally tagged with six histidine residues or triple VSV epitopes. We demonstrate that the assay can interrogate a wide range of previously known protein complexes with increased resolution and sensitivity. Furthermore, we use “Cross-and-Capture” to identify two novel protein complexes: Rtt101p–Mms1p and Sae2p–Mre11p. The Rtt101p–Mms1p interaction was subsequently characterized by genetic and functional analyses. Our studies establish the “Cross-and-Capture” assay as a novel, versatile tool that provides a valuable complement for the next generation of yeast proteomic studies. PMID:17989249

  4. A hypermedia system for parasite identification.

    PubMed

    Lalle, C

    1996-06-01

    In this paper a hypermedia system for parasite identification is described. The knowledge base is relative to the class of the Trematoda parasites and reports agent, vector, disease, related category of the International Classification of Diseases and geographic area. A graphic user-friendly human-machine interface has been realized for this system.

  5. Qualitative, semi-quantitative, and quantitative simulation of the osmoregulation system in yeast.

    PubMed

    Pang, Wei; Coghill, George M

    2015-05-01

    In this paper we demonstrate how Morven, a computational framework which can perform qualitative, semi-quantitative, and quantitative simulation of dynamical systems using the same model formalism, is applied to study the osmotic stress response pathway in yeast. First the Morven framework itself is briefly introduced in terms of the model formalism employed and output format. We then built a qualitative model for the biophysical process of the osmoregulation in yeast, and a global qualitative-level picture was obtained through qualitative simulation of this model. Furthermore, we constructed a Morven model based on existing quantitative model of the osmoregulation system. This model was then simulated qualitatively, semi-quantitatively, and quantitatively. The obtained simulation results are presented with an analysis. Finally the future development of the Morven framework for modelling the dynamic biological systems is discussed.

  6. System identification by video image processing

    NASA Astrophysics Data System (ADS)

    Shinozuka, Masanobu; Chung, Hung-Chi; Ichitsubo, Makoto; Liang, Jianwen

    2001-07-01

    Emerging image processing techniques demonstrate their potential applications in earthquake engineering, particularly in the area of system identification. In this respect, the objectives of this research are to demonstrate the underlying principle that permits system identification, non-intrusively and remotely, with the aid of video camera and, for the purpose of the proof-of-concept, to apply the principle to a system identification problem involving relative motion, on the basis of the images. In structural control, accelerations at different stories of a building are usually measured and fed back for processing and control. As an alternative, this study attempts to identify the relative motion between different stories of a building for the purpose of on-line structural control by digitizing the images taken by video camera. For this purpose, the video image of the vibration of a structure base-isolated by a friction device under shaking-table was used successfully to observe relative displacement between the isolated structure and the shaking-table. This proof-of-concept experiment demonstrates that the proposed identification method based on digital image processing can be used with appropriate modifications to identify many other engineering-wise significant quantities remotely. In addition to the system identification study in the structural dynamics mentioned above, a result of preliminary study is described involving the video imaging of state of crack damage of road and highway pavement.

  7. [Evaluation of a new chromogenic medium (Candida ID) for the isolation and presumptive identification of Candida albicans and other medically important yeasts].

    PubMed

    Quindós, G; Alonso-Vargas, R; Helou, S; Arechavala, A; Martín-Mazuelos, E; Negroni, R

    2001-03-01

    Candidiasis is a frequent human infection caused mainly by Candida albicans. However, other species are emerging as important pathogens, as Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida krusei or Candida guilliermondii. Rapid identification of clinical isolates could facilitate diagnosis and treatment. Candida ID (bioMerieux, Spain) is a new medium for the isolation and presumptive identification of yeasts: C. albicans grows as blue colonies, and C. tropicalis, C. guilliermondii, Candida kefyr and Candida lusitaniae as pink ones. The utility of Candida ID was evaluated with more than 700 clinical isolates and type culture collection strains from different genera including Candida, Cryptococcus, Saccharomyces, and Rhodotorula. Presumptive identification was confirmed by germ tube test, microscopic morphology and chlamydoconidia production on corn meal agar and carbohydrate assimilation on API-ATB ID 32C or Vitek (bioMerieux). Growth on Candida ID was rapid (18-24 h) for most of the yeast strains tested. Sensitivity and specificity of identification of C. albicans was significantly high (>98%), since a very low number of isolates were found to be false negative or false positive. A better result was obtained for species growing as pink colonies (>99.5%). Detection of different species of medical important yeasts was easy with Candida ID, as perfectly distinct colors and textures of colonies were observed on this medium. Candida ID allowed the discrimination between C. glabrata (creamy and smooth) and C. krusei (rough and white) colonies. Other species showed different colony textures and colours, white being the predominant colour. Candida ID was very useful for the presumptive identification C. albicans isolates.

  8. [A study of culture-based easy identification system for Malassezia].

    PubMed

    Kaneko, Takamasa

    2011-01-01

    Most species of this genus are lipid-dependent yeasts, which colonize the seborrheic part of the skin, and they have been reported to be associated with pityriasis versicolor, Malassezia folliculitis, seborrheic dermatitis, and atopic dermatitis. Malassezia have been re-classified into 7 species based on molecular biological analysis of nuclear ribosomal DNA/RNA and new Malassezia species were reported. As members of the genus Malassezia share similar morphological and biochemical characteristics, it was thought to be difficult to differentiate between them based on phenotypic features. While molecular biological techniques are the most reliable methods for identification of Malassezia, they are not available in most clinical laboratories. We studied ( i ) development of an efficient isolation media and culture based easy identification system, ( ii ) the incidence of atypical biochemical features in Malassezia species and propose a culture-based easy identification system for clinically important Malassezia species, M. globosa, M. restricta, and M. furfur.

  9. Identification and reconstitution of the yeast mitochondrial transporter for thiamine pyrophosphate.

    PubMed

    Marobbio, C M T; Vozza, A; Harding, M; Bisaccia, F; Palmieri, F; Walker, J E

    2002-11-01

    The genome of Saccharomyces cerevisiae contains 35 members of a family of transport proteins that, with a single exception, are found in the inner membranes of mitochondria. The transport functions of the 15 biochemically identified mitochondrial carriers are concerned with shuttling substrates, biosynthetic intermediates and cofactors across the inner membrane. Here the identification of the mitochondrial carrier for the essential cofactor thiamine pyrophosphate (ThPP) is described. The protein has been overexpressed in bacteria, reconstituted into phospholipid vesicles and identified by its transport properties. In confirmation of its identity, cells lacking the gene for this carrier had reduced levels of ThPP in their mitochondria, and decreased activity of acetolactate synthase, a ThPP-requiring enzyme found in the organellar matrix. They also required thiamine for growth on fermentative carbon sources.

  10. State Identification in Nonlinear Systems

    SciTech Connect

    Holloway, James Paul

    2005-02-06

    A state estimation method based on finding a system state that causes a model to match a set of system measurements is regularized by requiring that sudden changes in system state be avoided. The required optimization is accomplished by a pattern search algorithm. The method does not require derivative information or linearization of the model. Is has been applied to a 10 dimensional model of a fast reactor system.

  11. Use of whey protein beads as a new carrier system for recombinant yeasts in human digestive tract.

    PubMed

    Hébrard, Géraldine; Blanquet, Stéphanie; Beyssac, Eric; Remondetto, Gabriel; Subirade, Muriel; Alric, Monique

    2006-12-15

    A new immobilizing protocol using whey protein isolates was developed to entrap recombinant Saccharomyces cerevisiae. The model yeast strain expresses the heterologous P45073A1 that converts trans-cinnamic acid into p-coumaric acid. Beads resulted from a cold-induced gelation of a whey protein solution (10%) containing yeasts (7.5 x 10(7)cells ml(-1)) into 0.1M CaCl(2). The viability and growth capability of yeasts were not altered by our entrapment process. The release and activity of immobilized yeasts were studied in simulated human gastric conditions. During the first 60 min of digestion, 2.2+/-0.9% (n=3) of initial entrapped yeasts were recovered in the gastric medium suggesting that beads should cross the gastric barrier in human. The P45073A1 activity of entrapped yeasts remained significantly higher (p<0.05) than that of free ones throughout digestion (trans-cinnamic acid conversion rate of 63.4+/-1.6% versus 51.5+/-1.8% (n=3) at 120 min). The protein matrix seemed to create a microenvironment favoring the activity of yeasts in the stringent gastric conditions. These results open up new opportunities for the development of drug delivery system using recombinant yeasts entrapped in whey protein beads. The main potential medical applications include biodetoxication or the correction of digestive enzyme deficiencies.

  12. Structural and ultrastructural changes in yeast cells during autolysis in a model wine system and in sparkling wines.

    PubMed

    Martínez-Rodríguez, A J; Polo, M C; Carrascosa, A V

    2001-12-04

    This study shows the changes that occur during the autolysis of yeast in a model wine medium and in a sparkling wine after 12 months of aging, using Nomarsky Light Microscopy and Low Temperature Scanning Electron Microscopy (LTSEM). The size of the yeasts after 24 h of autolysis in a model medium is much smaller than when they are in the growth stage. With LTSEM. a large number of folds can be observed on the surface of the yeast and practically empty cells. Greater morphological changes, both structural and ultrastructural, can be observed in the yeast after 12 months of aging in wine than in the yeast after 24 h of induced autolysis. However, less of the cytoplasmic content of the yeast that has undergone autolysis in the wine was solubilized than that of the yeast after 24 h of autolysis in the model wine system. These findings indicate that autolysis of yeast in wine is a long-lasting process, which continues for at least 12 months.

  13. System Identification and Simulation of a Triaxial Shaker System,

    DTIC Science & Technology

    1996-01-01

    methods. Results of the system identification process are discussed. Certain methods are found to produce models that are in good agreement with measured response data from the actual shaker system....implemented in the simulation. The first is a physically-based model derived from a finite element analysis together with a model-updating system ... identification scheme; the second is a parametric model without direct physical significance. The advantages and disadvantages of each model for this

  14. The value of the D1/D2 and internal transcribed spacers (ITS) domains for the identification of yeast species belonging to the genus Yamadazyma.

    PubMed

    Groenewald, M; Robert, V; Smith, M Th

    2011-06-01

    In a taxonomic study of yeasts that have been isolated in French Guiana and Thailand, five yeast strains isolated from plants were found to belong to the Yamadazyma clade of Saccharomycotina. On the basis of morphology, physiology and the nucleotide divergence in the D1/D2 domain of the 26S nuclear ribosomal RNA (nrRNA) gene, as well as the internal transcribed spacers (ITS) domain of the nrRNA gene operon, these strains were identified to represent three novel species in this teleomorphic clade. An additional isolate, that is publicly available from the CBS yeast collection and isolated from Taiwan, was found to be similar to one of the novel species described from Thailand. Yeast species belonging to the Yamadazyma clade have previously been described as members of the Candida membranifaciens clade. These species are widely distributed and were isolated from diverse habitats, including water, plants, animals and guts of insects and termites. In the present study the ITS region is shown to be a valuable region for species identification within this clade, and the novel species proposed are Candida vaughaniae (ex-type strain CBS 8583), Candida khao-thaluensis (ex-type strain CBS 8535) and Candida tallmaniae (ex-type strain CBS 8575).

  15. Continuous-Time Bilinear System Identification

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan

    2003-01-01

    The objective of this paper is to describe a new method for identification of a continuous-time multi-input and multi-output bilinear system. The approach is to make judicious use of the linear-model properties of the bilinear system when subjected to a constant input. Two steps are required in the identification process. The first step is to use a set of pulse responses resulting from a constant input of one sample period to identify the state matrix, the output matrix, and the direct transmission matrix. The second step is to use another set of pulse responses with the same constant input over multiple sample periods to identify the input matrix and the coefficient matrices associated with the coupling terms between the state and the inputs. Numerical examples are given to illustrate the concept and the computational algorithm for the identification method.

  16. Application of System Identification in Engineering

    NASA Astrophysics Data System (ADS)

    Natke, H. G.

    System identification is a powerful tool in engineering. Its various methods in the frequency and in the time domain have been extensively discussed in earlier CISM courses. The aim of this course is to describe the state of the art in specific application areas, such as estimation of eigenquantities (in the aerospace industry, in civil engineering, in naval engineering etc.), noise source detection, fault detection by investigation of dynamic properties, such as machine sound characteristics, and the identification of the dynamic behaviour of flow induced systems (e.g. aerolastic problems). Geotechnical applications are also among the fields of interest. The lecture notes contain demonstrations of several methods and include a valuation by combining various kinds of experience. Such complex information includes not only theoretical aspects of identification but also advice on practical handling, for example concerning testing effort and data handling.

  17. Stabilization of the yeast desaturase system by low levels of oxygen

    NASA Technical Reports Server (NTRS)

    Volkmann, C. M.; Klein, H. P.

    1983-01-01

    The stability of particulate palmitoyl-CoA desaturase preparations from anaerobically grown yeast cells was increased by exposure to low levels of oxygen. The stabilizing effect of oxygen may be based upon the increased amounts of palmitoleic acid and ergosterol that become available to the cells. These results suggest the evolutinary appearance of this system at a time when atmospheric oxygen was at a low level.

  18. 75 FR 49869 - Changes to Standard Numbering System, Vessel Identification System, and Boating Accident Report...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-16

    ..., Vessel Identification System, and Boating Accident Report Database AGENCY: Coast Guard, DHS. ACTION..., Vessel Identification System, and Boating Accident Report Database. DATES: Comments and related material...) proposing changes in the Standard Numbering System, Vessel Identification System, and Boating...

  19. Identification of lethal cluster of genes in the yeast transcription network

    NASA Astrophysics Data System (ADS)

    Rho, K.; Jeong, H.; Kahng, B.

    2006-05-01

    Identification of essential or lethal genes would be one of the ultimate goals in drug designs. Here we introduce an in silico method to select the cluster with a high population of lethal genes, called lethal cluster, through microarray assay. We construct a gene transcription network based on the microarray expression level. Links are added one by one in the descending order of the Pearson correlation coefficients between two genes. As the link density p increases, two meaningful link densities pm and ps are observed. At pm, which is smaller than the percolation threshold, the number of disconnected clusters is maximum, and the lethal genes are highly concentrated in a certain cluster that needs to be identified. Thus the deletion of all genes in that cluster could efficiently lead to a lethal inviable mutant. This lethal cluster can be identified by an in silico method. As p increases further beyond the percolation threshold, the power law behavior in the degree distribution of a giant cluster appears at ps. We measure the degree of each gene at ps. With the information pertaining to the degrees of each gene at ps, we return to the point pm and calculate the mean degree of genes of each cluster. We find that the lethal cluster has the largest mean degree.

  20. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens.

  1. [Identification of new genes that affect [PSI^(+)] prion toxicity in Saccharomyces cerevisiae yeast].

    PubMed

    Matveenko, A G; Belousov, M V; Bondarev, S A; Moskalenko, S E; Zhouravleva, G A

    2016-01-01

    Translation termination is an important step in gene expression. Its correct processing is governed by eRF1 (Sup45) and eRF3 (Sup35) proteins. In Saccharomyces cerevisiae, mutations in the corresponding genes, as well as Sup35 aggregation in [PSI^(+)] cells that propagate the prion form of Sup35 lead to inaccurate stop codon recognition and, consequently, nonsense suppression. The presence of stronger prion variants results in the more efficient suppression of nonsense mutations. Previously, we proposed a synthetic lethality test that enables the identification of genes that may influence either translation termination factors or [PSI^(+)] manifestation. This is based on the fact that the combination of sup45 mutations with the strong [PSI^(+)] prion variant in diploids is lethal. In this work, a set of genes that were previously shown to enhance nonsense suppression was analyzed. It was found that ABF1, FKH2, and REB1 overexpression decreased the growth of strains in a prion-dependent manner and, thus, might influence [PSI^(+)] prion toxicity. It was also shown that the synthetic lethality of [PSI^(+)] and sup45 mutations increased with the overexpression of GLN3 and MOT3 that encode Q/N-rich transcription factors. An analysis of the effects of their expression on the transcription of the release factors genes revealed an increase in SUP35 transcription in both cases. Since SUP35 overexpression is known to be toxic in [PSI^(+)] strains, these genes apparently enhance [PSI^(+)] toxicity via the regulation of SUP35 transcription.

  2. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  3. Molecular comparisons for identification of food spoilage yeasts and prediction of species that may develop in different food products

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Spoilage of foods and beverages by yeasts is often characterized by objectionable odors, appearance, taste, texture or build-up of gas in packaging containers, resulting in loss of the product. Seldom is human health compromised by products spoiled by yeasts even though some spoilage is caused by sp...

  4. Parametric uncertain identification of a robotic system

    NASA Astrophysics Data System (ADS)

    Angel, L.; Viola, J.; Hernández, C.

    2016-07-01

    This paper presents the parametric uncertainties identification of a robotic system of one degree of freedom. A MSC-ADAMS / MATLAB co-simulation model was built to simulate the uncertainties that affect the robotic system. For a desired trajectory, a set of dynamic models of the system was identified in presence of variations in the mass, length and friction of the system employing least squares method. Using the input-output linearization technique a linearized model plant was defined. Finally, the maximum multiplicative uncertainty of the system was modelled giving the controller desired design conditions to achieve a robust stability and performance of the closed loop system.

  5. Optical disk uses in criminal identification systems

    NASA Astrophysics Data System (ADS)

    Sypherd, Allen D.

    1990-08-01

    A significant advancement in law enforcement tools has been made possible by the rapid and innovative development of electronic imaging for criminal identification systems. In particular, development of optical disks capable of high-capacity and random-access storage has provided a unique marriage of application and technology. Fast random access to any record, non-destructive reading of stored images, electronic sorting and transmission of images and an accepted legal basis for evidence are a few of the advantages derived from optical disk technology. This paper discusses the application of optical disk technology to both Automated Fingerprint Identification Systems (AFIS) and Automated Mugshot Retrieval Systems (AMRS). The following topics are addressed in light of AFIS and AMRS user requirements and system capabilities: Write once vs. rewritable, gray level and storage requirements, multi-volume library systems, data organization and capacity trends.

  6. Rotorcraft System Identification (Identification des Systemes de Voilures Tournantes)

    DTIC Science & Technology

    1991-10-01

    139, 1985. DuVal, R.W., Wang , .C. and Demiroz, M.Y.: A Practtcal Approach to Rotorcraft Systems Padfield, G.D., Thorne, R., Murray-Smith, D...an experimentel verification of the Kalman filter iRA)YOUG, PETER, (AB)PATTOn, ROALD J implementation, sod an experimental evaluation of filter...The estimation of the measurements wlth the RSRA compound helicopter parameter values in this model (the stability and control derivatives) (AA) WANG

  7. 78 FR 58785 - Unique Device Identification System

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-24

    ... September 24, 2013 Part V Department of Health and Human Service Food and Drug Administration 21 CFR Parts... SERVICES Food and Drug Administration 21 CFR Parts 16, 801, 803, 806, 810, 814, 820, 821, 822, and 830 RIN 0910-AG31 Unique Device Identification System AGENCY: Food and Drug Administration, HHS. ACTION:...

  8. Improved system identification with Renormalization Group.

    PubMed

    Wang, Qing-Guo; Yu, Chao; Zhang, Yong

    2014-09-01

    This paper proposes an improved system identification method with Renormalization Group. Renormalization Group is applied to a fine data set to obtain a coarse data set. The least squares algorithm is performed on the coarse data set. The theoretical analysis under certain conditions shows that the parameter estimation error could be reduced. The proposed method is illustrated with examples.

  9. 49 CFR 1542.211 - Identification systems.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 9 2014-10-01 2014-10-01 false Identification systems. 1542.211 Section 1542.211 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.211...

  10. 49 CFR 1542.211 - Identification systems.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 9 2012-10-01 2012-10-01 false Identification systems. 1542.211 Section 1542.211 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.211...

  11. 49 CFR 1542.211 - Identification systems.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Identification systems. 1542.211 Section 1542.211 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.211...

  12. 49 CFR 1542.211 - Identification systems.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 9 2013-10-01 2013-10-01 false Identification systems. 1542.211 Section 1542.211 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.211...

  13. 49 CFR 1542.211 - Identification systems.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 9 2011-10-01 2011-10-01 false Identification systems. 1542.211 Section 1542.211 Transportation Other Regulations Relating to Transportation (Continued) TRANSPORTATION SECURITY ADMINISTRATION, DEPARTMENT OF HOMELAND SECURITY CIVIL AVIATION SECURITY AIRPORT SECURITY Operations § 1542.211...

  14. Yeast as a model system to study metabolic impact of selenium compounds

    PubMed Central

    Herrero, Enrique; Wellinger, Ralf E.

    2015-01-01

    Inorganic Se forms such as selenate or selenite (the two more abundant forms in nature) can be toxic in Saccharomyces cerevisiae cells, which constitute an adequate model to study such toxicity at the molecular level and the functions participating in protection against Se compounds. Those Se forms enter the yeast cell through other oxyanion transporters. Once inside the cell, inorganic Se forms may be converted into selenide through a reductive pathway that in physiological conditions involves reduced glutathione with its consequent oxidation into diglutathione and alteration of the cellular redox buffering capacity. Selenide can subsequently be converted by molecular oxygen into elemental Se, with production of superoxide anions and other reactive oxygen species. Overall, these events result in DNA damage and dose-dependent reversible or irreversible protein oxidation, although additional oxidation of other cellular macromolecules cannot be discarded. Stress-adaptation pathways are essential for efficient Se detoxification, while activation of DNA damage checkpoint and repair pathways protects against Se-mediated genotoxicity. We propose that yeast may be used to improve our knowledge on the impact of Se on metal homeostasis, the identification of Se-targets at the DNA and protein levels, and to gain more insights into the mechanism of Se-mediated apoptosis. PMID:28357286

  15. Microbial exopolymers link predator and prey in a model yeast biofilm system.

    PubMed

    Joubert, L-M; Wolfaardt, G M; Botha, A

    2006-08-01

    Protistan grazing on biofilms is potentially an important conduit enabling energy flow between microbial trophic levels. Contrary to the widely held assumption that protistan feeding primarily involves ingestion of biofilm cells, with negative consequences for the biofilm, this study demonstrated preferential grazing on the noncellular biofilm matrix by a ciliate, with selective ingestion of yeast and bacterial cells of planktonic origin over attached and biofilm-derived planktonic cells. Introducing a ciliate to two biofilm-forming Cryptococcus species, as well as two bacterial species in a model biofilm system, fluorescent probes were applied to determine ingestion of cellular and noncellular biofilm fractions. Fluoromicroscopy, as well as photometric quantification, confirmed that protistan grazing enhanced yeast biofilm metabolism, and an increase in biofilm biomass and viability. We propose that the extracellular polymeric matrix of biofilms may act as an interface regulating interaction between predator and prey, while serving as source of nutrients and energy for protists.

  16. Characteristics of an immobilized yeast cell system using very high gravity for the fermentation of ethanol.

    PubMed

    Ji, Hairui; Yu, Jianliang; Zhang, Xu; Tan, Tianwei

    2012-09-01

    The characteristics of ethanol production by immobilized yeast cells were investigated for both repeated batch fermentation and continuous fermentation. With an initial sugar concentration of 280 g/L during the repeated batch fermentation, more than 98% of total sugar was consumed in 65 h with an average ethanol concentration and ethanol yield of 130.12 g/L and 0.477 g ethanol/g consumed sugar, respectively. The immobilized yeast cell system was reliable for at least 10 batches and for a period of 28 days without accompanying the regeneration of Saccharomyces cerevisiae inside the carriers. The multistage continuous fermentation was carried out in a five-stage column bioreactor with a total working volume of 3.75 L. The bioreactor was operated for 26 days at a dilution rate of 0.015 h(-1). The ethanol concentration of the effluent reached 130.77 g/L ethanol while an average 8.18 g/L residual sugar remained. Due to the high osmotic pressure and toxic ethanol, considerable yeast cells died without regeneration, especially in the last two stages, which led to the breakdown of the whole system of multistage continuous fermentation.

  17. Development of a new yeast surface display system based on Spi1 as an anchor protein.

    PubMed

    Andreu, Cecilia; Del Olmo, Marcel Lí

    2017-01-01

    Yeast surface display is a powerful tool widely used for many biotechnological and biomedical applications. It consists in exposing peptides and proteins of interest on the surface of Saccharomyces cerevisiae and other yeasts. These molecules are fused to the amino or carboxy terminus of an appropriate cell wall protein, usually bound by glycosylphosphatidylinositol. Several systems for this purpose have been reported to date. In this work, we describe a new yeast surface display strategy based on cell wall protein Spi1 as an anchor, which is expressed in centromeric and episomal plasmids under the control of its own promoter or that corresponding to the PGK1 glycolytic gene. Exposure efficiency was demonstrated by western blot, flow cytometry analyses, and fluorescence microscopy by taking advantage of including the V5 epitope. We also demonstrated the ability of this new strategy for the exposure of several peptides and proteins of different sizes. The regulation of the SPI1 promoter by the stationary phase and other stress conditions reveals interesting potential applications of systems based on it for industrial and biotechnological processes.

  18. Identification of Metabolic Pathway Systems

    PubMed Central

    Dolatshahi, Sepideh; Voit, Eberhard O.

    2016-01-01

    The estimation of parameters in even moderately large biological systems is a significant challenge. This challenge is greatly exacerbated if the mathematical formats of appropriate process descriptions are unknown. To address this challenge, the method of dynamic flux estimation (DFE) was proposed for the analysis of metabolic time series data. Under ideal conditions, the first phase of DFE yields numerical representations of all fluxes within a metabolic pathway system, either as values at each time point or as plots against their substrates and modulators. However, this numerical result does not reveal the mathematical format of each flux. Thus, the second phase of DFE selects functional formats that are consistent with the numerical trends obtained from the first phase. While greatly facilitating metabolic data analysis, DFE is only directly applicable if the pathway system contains as many dependent variables as fluxes. Because most actual systems contain more fluxes than metabolite pools, this requirement is seldom satisfied. Auxiliary methods have been proposed to alleviate this issue, but they are not general. Here we propose strategies that extend DFE toward general, slightly underdetermined pathway systems. PMID:26904095

  19. An efficient automatic firearm identification system

    NASA Astrophysics Data System (ADS)

    Chuan, Zun Liang; Liong, Choong-Yeun; Jemain, Abdul Aziz; Ghani, Nor Azura Md.

    2014-06-01

    Automatic firearm identification system (AFIS) is highly demanded in forensic ballistics to replace the traditional approach which uses comparison microscope and is relatively complex and time consuming. Thus, several AFIS have been developed for commercial and testing purposes. However, those AFIS are still unable to overcome some of the drawbacks of the traditional firearm identification approach. The goal of this study is to introduce another efficient and effective AFIS. A total of 747 firing pin impression images captured from five different pistols of same make and model are used to evaluate the proposed AFIS. It was demonstrated that the proposed AFIS is capable of producing firearm identification accuracy rate of over 95.0% with an execution time of less than 0.35 seconds per image.

  20. Mg-chelatase of tobacco: identification of a Chl D cDNA sequence encoding a third subunit, analysis of the interaction of the three subunits with the yeast two-hybrid system, and reconstitution of the enzyme activity by co-expression of recombinant CHL D, CHL H and CHL I.

    PubMed

    Papenbrock, J; Gräfe, S; Kruse, E; Hänel, F; Grimm, B

    1997-11-01

    Mg-protoporphyrin IX chelatase catalyzes insertion of the magnesium ion into protoporphyrin IX, the last common intermediate precursor in chlorophyll and heme biosynthesis, to form Mg-protoporphyrin IX. In Rhodobacter sphaeroides, and Synechocystis, the three open reading frames bchD/chID, bchH/chIH and bchI/chII encode proteins which are required for in vitro Mg-chelatase activity. In higher plants also, three proteins are necessary for the Mg chelation, and genes homologous to bchH and bchI have been isolated previously. In this study, a novel tobacco cDNA sequence homologous to bchD is isolated and initially characterized. Together with the tobacco clones encoding the other two subunits, full-length cDNAs are now available for the first time for all three subunits of one plant species. The CHL D polypeptide deduced from the open reading frame encodes a protein of 758 aa (82.9 kDa) with an amino terminal extension that resembles a plastid transit peptide. Sequence comparison of tobacco CHL D revealed similarities to the D subunit of Rhodobacter and Synechocystis of 44% and 75%. The amino terminal half of CHL D shows significant similarity (46%) to the entire CHL I peptide sequence, indicating a gene duplication from an ancestral gene. The carboxy terminal half seemed to be unique. Both parts of CHL D are linked with a glutamine/asparagine/proline-rich region flanked by a highly acid-rich segment. Protein-protein interaction among the three subunits CHL D, H and I was studied using the yeast two-hybrid system. Physical interaction was demonstrated between CHL D and CHL I indicating that CHL D is part of the Mg-chelatase. Heterodimer formation of CHL H with CHL I or CHL D could not be demonstrated by transactivation of the lacZ reporter gene. Homodimerization of the CHL D subunit was indicated in the more sensitive assay on X-Gal-containing agar plates. In vitro Mg2+ insertion into protoporphyrin IX was demonstrated in protein extracts of yeast strains expressing

  1. 33 CFR 401.20 - Automatic Identification System.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...' maritime Differential Global Positioning System radiobeacon services; or (7) The use of a temporary unit... 33 Navigation and Navigable Waters 3 2013-07-01 2013-07-01 false Automatic Identification System... Identification System. (a) Each of the following vessels must use an Automatic Identification System...

  2. 33 CFR 401.20 - Automatic Identification System.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...' maritime Differential Global Positioning System radiobeacon services; or (7) The use of a temporary unit... 33 Navigation and Navigable Waters 3 2012-07-01 2012-07-01 false Automatic Identification System... Identification System. (a) Each of the following vessels must use an Automatic Identification System...

  3. 33 CFR 401.20 - Automatic Identification System.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...' maritime Differential Global Positioning System radiobeacon services; or (7) The use of a temporary unit... 33 Navigation and Navigable Waters 3 2011-07-01 2011-07-01 false Automatic Identification System... Identification System. (a) Each of the following vessels must use an Automatic Identification System...

  4. 33 CFR 401.20 - Automatic Identification System.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...' maritime Differential Global Positioning System radiobeacon services; or (7) The use of a temporary unit... 33 Navigation and Navigable Waters 3 2014-07-01 2014-07-01 false Automatic Identification System... Identification System. (a) Each of the following vessels must use an Automatic Identification System...

  5. 33 CFR 401.20 - Automatic Identification System.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...' maritime Differential Global Positioning System radiobeacon services; or (7) The use of a temporary unit... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Automatic Identification System... Identification System. (a) Each of the following vessels must use an Automatic Identification System...

  6. An Investigation of System Identification Techniques for Simulation Model Abstraction

    DTIC Science & Technology

    2000-02-01

    This report summarizes research into the application of system identification techniques to simulation model abstraction. System identification produces...34Mission Simulation," a simulation of a squadron of aircraft performing battlefield air interdiction. The system identification techniques were...simplified mathematical models that approximate the dynamic behaviors of the underlying stochastic simulations. Four state-space system

  7. A Heritable Recombination system for synthetic Darwinian evolution in yeast.

    PubMed

    Romanini, Dante W; Peralta-Yahya, Pamela; Mondol, Vanessa; Cornish, Virginia W

    2012-12-21

    Genetic recombination is central to the generation of molecular diversity and enhancement of evolutionary fitness in living systems. Methods such as DNA shuffling that recapitulate this diversity mechanism in vitro are powerful tools for engineering biomolecules with useful new functions by directed evolution. Synthetic biology now brings demand for analogous technologies that enable the controlled recombination of beneficial mutations in living cells. Thus, here we create a Heritable Recombination system centered around a library cassette plasmid that enables inducible mutagenesis via homologous recombination and subsequent combination of beneficial mutations through sexual reproduction in Saccharomyces cerevisiae. Using repair of nonsense codons in auxotrophic markers as a model, Heritable Recombination was optimized to give mutagenesis efficiencies of up to 6% and to allow successive repair of different markers through two cycles of sexual reproduction and recombination. Finally, Heritable Recombination was employed to change the substrate specificity of a biosynthetic enzyme, with beneficial mutations in three different active site loops crossed over three continuous rounds of mutation and selection to cover a total sequence diversity of 10(13). Heritable Recombination, while at an early stage of development, breaks the transformation barrier to library size and can be immediately applied to combinatorial crossing of beneficial mutations for cell engineering, adding important features to the growing arsenal of next generation molecular biology tools for synthetic biology.

  8. Identification of Wild Yeast Strains and Analysis of Their β-Glucan and Glutathione Levels for Use in Makgeolli Brewing

    PubMed Central

    Kang, Sun Hee; Kim, Hye Ryun; Kim, Jae Ho; Ahn, Byung Hak; Kim, Tae Wan

    2014-01-01

    Makgeolli, also known as Takju, is a non-filtered traditional Korean alcoholic beverage that contains various floating matter, including yeast cells, which contributes to its high physiological functionality. In the present study, we assessed the levels of β-glucan and glutathione in various yeast strains isolated from traditional Korean Nuruk and selected a β-glucan- and glutathione-rich yeast strain to add value to Makgeolli by enhancing its physiological functionality through increased levels of these compounds. Yeast β-glucan levels ranged from 6.26% to 32.69% (dry basis) and were strongly species-dependent. Dried Saccharomyces cerevisiae isolated from Nuruk contained 25.53 µg/mg glutathione, 0.70 µg/mg oxidized glutathione, and 11.69 µg/g and 47.85 µg/g spermidine and L-ornithine monohydrochloride, respectively. To produce functional Makgeolli, a β-glucan- and glutathione-rich yeast strain was selected in a screening analysis. Makgeolli fermented with the selected yeast strain contained higher β-glucan and glutathione levels than commercial Makgeolli. Using the selected yeast strain to produce Makgeolli with high β-glucan and glutathione content may enable the production of functional Makgeolli. PMID:25606008

  9. Structural system identification: Structural dynamics model validation

    SciTech Connect

    Red-Horse, J.R.

    1997-04-01

    Structural system identification is concerned with the development of systematic procedures and tools for developing predictive analytical models based on a physical structure`s dynamic response characteristics. It is a multidisciplinary process that involves the ability (1) to define high fidelity physics-based analysis models, (2) to acquire accurate test-derived information for physical specimens using diagnostic experiments, (3) to validate the numerical simulation model by reconciling differences that inevitably exist between the analysis model and the experimental data, and (4) to quantify uncertainties in the final system models and subsequent numerical simulations. The goal of this project was to develop structural system identification techniques and software suitable for both research and production applications in code and model validation.

  10. Parameter identification for nonlinear aerodynamic systems

    NASA Technical Reports Server (NTRS)

    Pearson, Allan E.

    1990-01-01

    Parameter identification for nonlinear aerodynamic systems is examined. It is presumed that the underlying model can be arranged into an input/output (I/O) differential operator equation of a generic form. The algorithm estimation is especially efficient since the equation error can be integrated exactly given any I/O pair to obtain an algebraic function of the parameters. The algorithm for parameter identification was extended to the order determination problem for linear differential system. The degeneracy in a least squares estimate caused by feedback was addressed. A method of frequency analysis for determining the transfer function G(j omega) from transient I/O data was formulated using complex valued Fourier based modulating functions in contrast with the trigonometric modulating functions for the parameter estimation problem. A simulation result of applying the algorithm is given under noise-free conditions for a system with a low pass transfer function.

  11. Construction of a beta-glucosidase expression system using the multistress-tolerant yeast Issatchenkia orientalis.

    PubMed

    Kitagawa, Takao; Tokuhiro, Kenro; Sugiyama, Hidehiko; Kohda, Katsuhiro; Isono, Naoto; Hisamatsu, Makoto; Takahashi, Haruo; Imaeda, Takao

    2010-08-01

    We demonstrate the value of the thermotolerant yeast Issatchenkia orientalis as a candidate microorganism for bioethanol production from lignocellulosic biomass with the goal of consolidated bioprocessing. The I. orientalis MF-121 strain is acid tolerant, ethanol tolerant, and thermotolerant, and is thus a multistress-tolerant yeast. To express heterologous proteins in I. orientalis, we constructed a transformation system for the MF-121 strain and then isolated the promoters of TDH1 and PGK1, two genes that were found to be strongly expressed during ethanol fermentation. As a result, expression of beta-glucosidase from Aspergillus aculeatus could be achieved with I. orientalis, demonstrating successful heterologous gene expression in I. orientalis for the first time. The transformant could convert cellobiose to ethanol under acidic conditions and at high temperature. Simultaneous saccharification and fermentation (SSF) was performed with the transformant, which produced 29 g l(-1) of ethanol in 72 h at 40 degrees C even without addition of beta-glucosidase when SSF was carried out in medium containing 100 g l(-1) of microcrystalline cellulose and a commercial cellulase preparation. These results suggest that using a genetically engineered thermotolerant yeast such as I. orientalis in SSF could lead to cost reduction because less saccharification enzymes are required.

  12. Comparison of enzymatic antioxidant defence systems in different metabolic types of yeasts.

    PubMed

    Koleva, Dafinka I; Petrova, Ventsislava Y; Kujumdzieva, Anna V

    2008-11-01

    The enzymatic defence system in the 2 yeasts Kluyveromyces marxianus and Rhodotorula glutinis, differing in their mode of oxygen uptake and energy generation, was characterized and compared with the well-studied facultatively fermentative Crabtree-positive Saccharomyces cerevisiae strain. Twofold higher superoxide dismutase (SOD) and catalase activities were detected in K. marxianus and R. glutinis when cells were cultured on glucose. Further increases of 10%-15% in SOD activity and 30%-50% in catalase were measured in all studied yeasts strains after transfer to media containing ethanol. An evaluation of the ratio of Cu/Zn SOD / Mn SOD was performed as a measure of the oxidative metabolism. A 20% decrease was observed when the respiratory source of energy was ethanol, with the lowest ratio being observed for the oxidative type of K. marxianus yeasts. Electrophoretic analysis revealed that all tested strains possess active Cu/Zn and Mn SODs. A reverse electrophoretic mobility pattern of K. marxianus and R. glutinis SOD enzymes was observed in comparison with the same couple in S. cerevisiae. The investigation of electrophoretic profile of catalase enzymes showed that alongside their different taxonomic status and fermentative capacity, all tested strains possess 2 separate catalases. The role of antioxidant enzymes in preventing oxidant-induced cytotoxicity (treatment with hydrogen peroxide, paraquat, and menadione) was shown.

  13. Model Identification and Validation for a Heating System using MATLAB System Identification Toolbox

    NASA Astrophysics Data System (ADS)

    Junaid Rabbani, Muhammad; Hussain, Kashan; khan, Asim-ur-Rehman; Ali, Abdullah

    2013-12-01

    This paper proposed a systematic approach to select a mathematical model for an industrial heating system by adopting system identification techniques with the aim of fulfilling the design requirement for the controller. The model identification process will begin by collecting real measurement data samples with the aid of MATLAB system identification toolbox. The criteria for selecting the model that could validate model output with actual data will based upon: parametric identification technique, picking the best model structure with low order among ARX, ARMAX and BJ, and then applying model estimation and validation tests. Simulated results have shown that the BJ model has been best in providing good estimation and validation based upon performance criteria such as: final prediction error, loss function, best percentage of model fit, and co-relation analysis of residual for output.

  14. Nonlinear vibrating system identification via Hilbert decomposition

    NASA Astrophysics Data System (ADS)

    Feldman, Michael; Braun, Simon

    2017-02-01

    This paper deals with the identification of nonlinear vibration systems, based on measured signals for free and forced vibration regimes. Two categories of time domain signal are analyzed, one of a fast inter-modulation signal and a second as composed of several mono-components. To some extent, this attempts to imitate analytic studies of such systems, with its two major analysis groups - the perturbation and the harmonic balance methods. Two appropriate signal processing methods are then investigated, one based on demodulation and the other on signal decomposition. The Hilbert Transform (HT) has been shown to enable effective and simple methods of analysis. We show that precise identification of the nonlinear parameters can be obtained, contrary to other average HT based methods where only approximation parameters are obtained. The effectiveness of the proposed methods is demonstrated for the precise nonlinear system identification, using both the signal demodulation and the signal decomposition methods. Following the exposition of the tools used, both the signal demodulation as well as decomposition are applied to classical examples of nonlinear systems. Cases of nonlinear stiffness and damping forces are analyzed. These include, among other, an asymmetric Helmholtz oscillator, a backlash with nonlinear turbulent square friction, and a Duffing oscillator with dry friction.

  15. Multiclient Identification System Using Adaptive Probabilistic Model

    NASA Astrophysics Data System (ADS)

    Lin, Chin-Teng; Siana, Linda; Shou, Yu-Wen; Yang, Chien-Ting

    2010-12-01

    This paper aims at integrating detection and identification of human faces in a more practical and real-time face recognition system. The proposed face detection system is based on the cascade Adaboost method to improve the precision and robustness toward unstable surrounding lightings. Our Adaboost method innovates to adjust the environmental lighting conditions by histogram lighting normalization and to accurately locate the face regions by a region-based-clustering process as well. We also address on the problem of multi-scale faces in this paper by using 12 different scales of searching windows and 5 different orientations for each client in pursuit of the multi-view independent face identification. There are majorly two methodological parts in our face identification system, including PCA (principal component analysis) facial feature extraction and adaptive probabilistic model (APM). The structure of our implemented APM with a weighted combination of simple probabilistic functions constructs the likelihood functions by the probabilistic constraint in the similarity measures. In addition, our proposed method can online add a new client and update the information of registered clients due to the constructed APM. The experimental results eventually show the superior performance of our proposed system for both offline and real-time online testing.

  16. Identification of oleaginous yeast strains able to accumulate high intracellular lipids when cultivated in alkaline pretreated corn stover

    PubMed Central

    Sitepu, Irnayuli R.; Jin, Mingjie; Fernandez, J. Enrique; da Costa Sousa, Leonardo; Balan, Venkatesh; Boundy-Mills, Kyria L.

    2015-01-01

    Microbial oil is a potential alternative to food/plant-derived biodiesel fuel. Our previous screening studies identified a wide range of oleaginous yeast species, using a defined laboratory medium known to stimulate lipid accumulation. In this study, the ability of these yeasts to grow and accumulate lipids was further investigated in synthetic hydrolysate (SynH) and authentic ammonia fiber expansion (AFEX™)-pretreated corn stover hydrolysate (ACSH). Most yeast strains tested were able to accumulate lipids in SynH, but only a few were able to grow and accumulate lipids in ACSH medium. Cryptococcus humicola UCDFST 10-1004 was able to accumulate as high as 15.5 g/L lipids, out of a total of 36 g/L cellular biomass when grown in ACSH, with a cellular lipid content of 40% of cell dry weight. This lipid production is among the highest reported values for oleaginous yeasts grown in authentic hydrolysate. Pre-culturing in SynH media with xylose as sole carbon source enabled yeasts to assimilate both glucose and xylose more efficiently in the subsequent hydrolysate medium. This study demonstrates that ACSH is a suitable medium for certain oleaginous yeasts to convert lignocellullosic sugars to triacylglycerols for production of biodiesel and other valuable oleochemicals. PMID:25052467

  17. Unique device identification system. Final rule.

    PubMed

    2013-09-24

    The Food and Drug Administration (FDA) is issuing a final rule to establish a system to adequately identify devices through distribution and use. This rule requires the label of medical devices to include a unique device identifier (UDI), except where the rule provides for an exception or alternative placement. The labeler must submit product information concerning devices to FDA's Global Unique Device Identification Database (GUDID), unless subject to an exception or alternative. The system established by this rule requires the label and device package of each medical device to include a UDI and requires that each UDI be provided in a plain-text version and in a form that uses automatic identification and data capture (AIDC) technology. The UDI will be required to be directly marked on the device itself if the device is intended to be used more than once and intended to be reprocessed before each use.

  18. Evaluation of a Short, On-Plate Formic Acid Extraction Method for Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Identification of Clinically Relevant Yeast Isolates

    PubMed Central

    Seaton, Shila; Ramnarain, Purnima; McHugh, Timothy D.; Kibbler, Christopher C.

    2014-01-01

    This report describes a short, on-plate formic acid (FA) extraction method for the identification of clinical yeast isolates using matrix-assisted laser desorption ionization–time-of-flight mass spectrometry (MALDI-TOF MS). A total of 41.1% (78/190) and 63.7% (121/190) of yeasts were identified using species log score thresholds of >2.0 and >1.9, respectively. Overall, 97.4% (185/190) of yeasts were identified in combination with conventional FA extraction. PMID:24478407

  19. Design and evaluation of a microfluidic system for inhibition studies of yeast cell signaling

    NASA Astrophysics Data System (ADS)

    Hamngren, Charlotte; Dinér, Peter; Grøtli, Morten; Goksör, Mattias; Adiels, Caroline B.

    2012-10-01

    In cell signaling, different perturbations lead to different responses and using traditional biological techniques that result in averaged data may obscure important cell-to-cell variations. The aim of this study was to develop and evaluate a four-inlet microfluidic system that enables single-cell analysis by investigating the effect on Hog1 localization post a selective Hog1 inhibitor treatment during osmotic stress. Optical tweezers was used to position yeast cells in an array of desired size and density inside the microfluidic system. By changing the flow rates through the inlet channels, controlled and rapid introduction of two different perturbations over the cell array was enabled. The placement of the cells was determined by diffusion rates flow simulations. The system was evaluated by monitoring the subcellular localization of a fluorescently tagged kinase of the yeast "High Osmolarity Glycerol" (HOG) pathway, Hog1-GFP. By sequential treatment of the yeast cells with a selective Hog1 kinase inhibitor and sorbitol, the subcellular localization of Hog1-GFP was analysed on a single-cell level. The results showed impaired Hog1-GFP nuclear localization, providing evidence of a congenial design. The setup made it possible to remove and add an agent within 2 seconds, which is valuable for investigating the dynamic signal transduction pathways and cannot be done using traditional methods. We are confident that the features of the four-inlet microfluidic system will be a valuable tool and hence contribute significantly to unravel the mechanisms of the HOG pathway and similar dynamic signal transduction pathways.

  20. Ladder Forms in Estimation and System Identification.

    DTIC Science & Technology

    1977-01-01

    system identification . Many record applications, such as in geophysical signal processing, high resolution (’maximum entropy’) spectral estimation and speech encoding, justify the interest in these forms. They appear in many contexts, such as scattering and network theory and the theory of orthogonal polynomials. The state-space model ladder realizations are very closely related in (block) Schwarz matrix canonical forms, which generally appear in the context of stability analysis. In fact they are the natural ’stability canonical form’ for

  1. 77 FR 40735 - Unique Device Identification System

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-10

    ...The Food and Drug Administration (FDA) is proposing to establish a unique device identification system to implement the requirement added to the Federal Food, Drug, and Cosmetic Act (FD&C Act) by section 226 of the Food and Drug Administration Amendments Act of 2007 (FDAAA), Section 226 of FDAAA amended the FD&C Act to add new section 519(f), which directs FDA to promulgate regulations......

  2. Identification of dynamic systems, theory and formulation

    NASA Technical Reports Server (NTRS)

    Maine, R. E.; Iliff, K. W.

    1985-01-01

    The problem of estimating parameters of dynamic systems is addressed in order to present the theoretical basis of system identification and parameter estimation in a manner that is complete and rigorous, yet understandable with minimal prerequisites. Maximum likelihood and related estimators are highlighted. The approach used requires familiarity with calculus, linear algebra, and probability, but does not require knowledge of stochastic processes or functional analysis. The treatment emphasizes unification of the various areas in estimation in dynamic systems is treated as a direct outgrowth of the static system theory. Topics covered include basic concepts and definitions; numerical optimization methods; probability; statistical estimators; estimation in static systems; stochastic processes; state estimation in dynamic systems; output error, filter error, and equation error methods of parameter estimation in dynamic systems, and the accuracy of the estimates.

  3. The osmotolerant fructophilic yeast Zygosaccharomyces rouxii employs two plasma-membrane fructose uptake systems belonging to a new family of yeast sugar transporters.

    PubMed

    Leandro, Maria José; Sychrová, Hana; Prista, Catarina; Loureiro-Dias, Maria C

    2011-02-01

    Owing to its high resistance to weak-acid preservatives and extreme osmotolerance, Zygosaccharomyces rouxii is one of the main spoilage yeasts of sweet foods and beverages. In contrast with Saccharomyces cerevisiae, Z. rouxii is a fructophilic yeast; it consumes fructose faster than glucose. So far, to our knowledge, no specific Z. rouxii proteins responsible for this fructophilic behaviour have been characterized. We have identified two genes encoding putative fructose transporters in the Z. rouxii CBS 732 genome. Heterologous expression of these two Z. rouxii ORFs in a S. cerevisiae strain lacking its own hexose transporters (hxt-null) and subsequent kinetic analysis of sugar transport showed that both proteins are functionally expressed at the plasma membrane: ZrFfz1 is a high-capacity fructose-specific facilitator (K(m)∼400 mM and V(max)∼13 mmol h(-1) g(-1)) and ZrFfz2 is a facilitator transporting glucose and fructose with similar capacity and affinity (K(m)∼200 mM and V(max)∼4 mmol h(-1) g(-1)). These two proteins together with the Zygosaccharomyces bailii Ffz1 fructose-specific transporter belong to a new family of sugar transport systems mediating the uptake of hexoses via the facilitated diffusion mechanism, and are more homologous to drug/H(+) antiporters (regarding their primary protein structure) than to other yeast sugar transporters of the Sugar Porter family.

  4. Identification of a CAP (adenylyl-cyclase-associated protein) homologous gene in Lentinus edodes and its functional complementation of yeast CAP mutants.

    PubMed

    Zhou, G L; Miyazaki, Y; Nakagawa, T; Tanaka, K; Shishido, K; Matsuda, H; Kawamukai, M

    1998-04-01

    The adenylyl-cyclase-associated protein, CAP, was originally identified in yeasts as a protein that functions in both signal transduction and cytoskeletal organization. This paper reports the identification of a cDNA and genomic DNA that encodes a CAP homologue from the mushroom Lentinus edodes. The L. edodes cap gene contains eight introns and an ORF encoding a 518 amino acid protein. The L. edodes CAP is 35.5% and 40.9% identical at the amino acid level with Saccharomyces cerevisiae CAP and Schizosaccharomyces pombe CAP, respectively. The C-terminal domain shows greater homology (39-46% identity) with yeast CAPs than does the N-terminal domain (27-35% identity). Southern blotting and Northern blotting results suggest that L. edodes cap is a single-copy gene and uniformly expressed. Expression of the L. edodes CAP in both Schiz. pombe and Sacch. cerevisiae complemented defects associated with the loss of the C-terminal domain function of the endogenous CAP. By using a yeast two-hybrid assay, an interaction was demonstrated between the L. edodes CAP and Schiz. pombe actin. This result and the functional complementation test indicate that CAP from L. edodes has a conserved C-terminal domain function.

  5. System identification of Drosophila olfactory sensory neurons.

    PubMed

    Kim, Anmo J; Lazar, Aurel A; Slutskiy, Yevgeniy B

    2011-02-01

    The lack of a deeper understanding of how olfactory sensory neurons (OSNs) encode odors has hindered the progress in understanding the olfactory signal processing in higher brain centers. Here we employ methods of system identification to investigate the encoding of time-varying odor stimuli and their representation for further processing in the spike domain by Drosophila OSNs. In order to apply system identification techniques, we built a novel low-turbulence odor delivery system that allowed us to deliver airborne stimuli in a precise and reproducible fashion. The system provides a 1% tolerance in stimulus reproducibility and an exact control of odor concentration and concentration gradient on a millisecond time scale. Using this novel setup, we recorded and analyzed the in-vivo response of OSNs to a wide range of time-varying odor waveforms. We report for the first time that across trials the response of OR59b OSNs is very precise and reproducible. Further, we empirically show that the response of an OSN depends not only on the concentration, but also on the rate of change of the odor concentration. Moreover, we demonstrate that a two-dimensional (2D) Encoding Manifold in a concentration-concentration gradient space provides a quantitative description of the neuron's response. We then use the white noise system identification methodology to construct one-dimensional (1D) and two-dimensional (2D) Linear-Nonlinear-Poisson (LNP) cascade models of the sensory neuron for a fixed mean odor concentration and fixed contrast. We show that in terms of predicting the intensity rate of the spike train, the 2D LNP model performs on par with the 1D LNP model, with a root mean-square error (RMSE) increase of about 5 to 10%. Surprisingly, we find that for a fixed contrast of the white noise odor waveforms, the nonlinear block of each of the two models changes with the mean input concentration. The shape of the nonlinearities of both the 1D and the 2D LNP model appears to be

  6. Realization-Based System Identification with Applications

    NASA Astrophysics Data System (ADS)

    Miller, Daniel N.

    The identification of dynamic system behavior from experimentally measured or computationally simulated data is fundamental to the fields of control system design, modal analysis, and defect detection. In this dissertation, methods for system identification are developed based on classical linear system realization theory. The common methods of state-space realization from a measured, discrete-time impulse response are generalized to the following additional types of experiments: measured step responses, arbitrary sets of input-output data, and estimated cross-covariance functions of input-output data. The methods are particularly well suited to systems with large input and/or output dimension, for which classical system identification methods based on maximum likelihood estimation may fail due to their reliance on non-convex optimizations. The realization-based methods by themselves require a finite number of linear algebraic operations. Because these methods implicitly optimize cost functions that are linear in state-space parameters, they may be augmented with convex constraints to form convex optimization problems. Several common behavioral constraints are translated into eigenvalue constraints stated as linear matrix inequalities, and the realization-based methods are converted into semidefinite programming problems. Some additional constraints on transient and steady-state behavior are derived and incorporated into a quadratic program, which is solved following the semidefinite program. The newly developed realization-based methods are applied to two experiments: the aeroelastic response of a fighter aircraft and the transient thermal behavior of a light-emitting diode. The algorithms for each experiment are implemented in two freely available software packages.

  7. Power system identification toolbox: Phase two progress

    SciTech Connect

    Trudnowski, D.J.

    1994-08-01

    This report describes current progress on a project funded by the Bonneville Power Administration (BPA) to develop a set of state-of-the-art analysis software (termed the Power System Identification [PSI] Toolbox) for fitting dynamic models to measured data. The project is being conducted as a three-phase effort. The first phase, completed in late 1992, involved investigating the characteristics of the analysis techniques by evaluating existing software and developing guidelines for best use. Phase Two includes extending current software, developing new analysis algorithms and software, and demonstrating and developing applications. The final phase will focus on reorganizing the software into a modular collection of documented computer programs and developing user manuals with instruction and application guidelines. Phase Two is approximately 50% complete; progress to date and a vision for the final product of the PSI Toolbox are described. The needs of the power industry for specialized system identification methods are particularly acute. The industry is currently pushing to operate transmission systems much closer to theoretical limits by using real-time, large-scale control systems to dictate power flows and maintain dynamic stability. Reliably maintaining stability requires extensive system-dynamic modeling and analysis capability, including measurement-based methods. To serve this need, the BPA has developed specialized system-identification computer codes through in-house efforts and university contract research over the last several years. To make full integrated use of the codes, as well as other techniques, the BPA has commissioned Pacific Northwest Laboratory (PNL) to further develop the codes and techniques into the PSI Toolbox.

  8. Intellectual system of identification of Arabic graphics

    NASA Astrophysics Data System (ADS)

    Abdoullayeva, Gulchin G.; Aliyev, Telman A.; Gurbanova, Nazakat G.

    2001-08-01

    The studies made by using the domain of graphic images allowed creating facilities of the artificial intelligence for letters, letter combinations etc. for various graphics and prints. The work proposes a system of recognition and identification of symbols of the Arabic graphics, which has its own specificity as compared to Latin and Cyrillic ones. The starting stage of the recognition and the identification is coding with further entry of information into a computer. Here the problem of entry is one of the essentials. For entry of a large volume of information in the unit of time a scanner is usually employed. Along with the scanner the authors suggest their elaboration of technical facilities for effective input and coding of the information. For refinement of symbols not identified from the scanner mostly for a small bulk of information the developed coding devices are used directly in the process of writing. The functional design of the software is elaborated on the basis of the heuristic model of the creative activity of a researcher and experts in the description and estimation of states of the weakly formalizable systems on the strength of the methods of identification and of selection of geometric features.

  9. Injectable electronic identification, monitoring, and stimulation systems.

    PubMed

    Troyk, P R

    1999-01-01

    Historically, electronic devices such as pacemakers and neuromuscular stimulators have been surgically implanted into animals and humans. A new class of implants made possible by advances in monolithic electronic design and implant packaging is small enough to be implanted by percutaneous injection through large-gauge hypodermic needles and does not require surgical implantation. Among these, commercially available implants, known as radio frequency identification (RFID) tags, are used for livestock, pet, laboratory animal, and endangered-species identification. The RFID tag is a subminiature glass capsule containing a solenoidal coil and an integrated circuit. Acting as the implanted half of a transcutaneous magnetic link, the RFID tag is powered by and communicates with an extracorporeal magnetic reader. The tag transmits a unique identification code that serves the function of identifying the animal. Millions of RFID tags have been sold since the early 1980s. Based on the success of the RFID tags, research laboratories have developed injectable medical implants, known as micromodules. One type of micromodule, the microstimulator, is designed for use in functional-neuromuscular stimulation. Each microstimulator is uniquely addressable and could comprise one channel of a multichannel functional-neuromuscular stimulation system. Using bidirectional telemetry and commands, from a single extracorporeal transmitter, as many as 256 microstimulators could form the hardware basis for a complex functional-neuromuscular stimulation feedback-control system. Uses include stimulation of paralyzed muscle, therapeutic functional-neuromuscular stimulation, and neuromodulatory functions such as laryngeal stimulation and sleep apnea.

  10. Identification of two hydrophilins that contribute to the desiccation and freezing tolerance of yeast (Saccharomyces cerevisiae) cells.

    PubMed

    Dang, Nghiem X; Hincha, Dirk K

    2011-06-01

    Hydrophilins are a group of proteins that are present in all organisms and that have been defined as being highly hydrophilic and rich in glycine. They are assumed to play important roles in cellular dehydration tolerance. There are 12 genes in the yeast Saccharomyces cerevisiae that encode hydrophilins and most of these genes are stress responsive. However, the functional role of yeast hydrophilins, especially in desiccation and freezing tolerance, is largely unknown. Here, we selected six candidate hydrophilins for further analysis. All six proteins were predicted to be intrinsically disordered, i.e. to have no stable structure in solution. The contribution of these proteins to the desiccation and freezing tolerance of yeast was investigated in the respective knock-out strains. Only the disruption of the genes YJL144W and YMR175W (SIP18) resulted in significantly reduced desiccation tolerance, while none of the strains was affected in its freezing tolerance under our experimental conditions. Complementation experiments showed that yeast cells overexpressing these two genes were both more desiccation and freezing tolerant, confirming the role of these two hydrophilins in yeast dehydration stress tolerance.

  11. Biodiversity of yeast mycobiota in "sucuk," a traditional Turkish fermented dry sausage: phenotypic and genotypic identification, functional and technological properties.

    PubMed

    Ozturk, Ismet; Sagdic, Osman

    2014-11-01

    In this study, yeasts from Turkish fermented sucuks were identified and their functional and technological properties were evaluated. Two hundred fifty-five yeast isolates were obtained from 35 different sucuk samples from different regions of Turkey. The yeast isolates were determined as genotypic using 2 different polymerase chain reaction (PCR) methods (rep-PCR and RAPD-PCR). Functional and technological properties of including proteolytic, lipolytic, and catalase activities, tolerance to NaCl and bile, as well as growing rates at different temperature and pH conditions selected yeast strains were also evaluated. Candida zeylanoides and Debaryomyces hansenii were dominant strains in sucuk samples. All C. zeylanoides and D. hansenii tested could grow at the condition of 15% NaCl and 0.3% bile salt. However, none of the strains were able to grow at 37 °C, even though catalase activity, weak proteolytic and lipolytic activities was still observed. D. hansenii were able to grow only at pH 3, while some of C. zeylanoides could grow at lower pH levels (pH 2). Three and 4 strains of C. zeylanoides showed β-hemolysis activity and nitrate reduction ability to nitrite, respectively. D. hansenii did not have properties, which are β-hemolysis, nitrate reduction, or hydrogen sulfide production. Overall, diverse yeast mycobiota present in Turkish fermented sucuk and their functional and technological properties were revealed with this study.

  12. Validation of a Flour-Free Model Dough System for Throughput Studies of Baker's Yeast

    PubMed Central

    Panadero, Joaquin; Randez-Gil, Francisca; Prieto, Jose Antonio

    2005-01-01

    Evaluation of gene expression in baker's yeast requires the extraction and collection of pure samples of RNA. However, in bread dough this task is difficult due to the complex composition of the system. We found that a liquid model system can be used to analyze the transcriptional response of industrial strains in dough with a high sugar content. The production levels of CO2 and glycerol by two commercial strains in liquid and flour-based doughs were correlated. We extracted total RNA from both a liquid and a flour-based dough. We used Northern blotting to analyze mRNA levels of three stress marker genes, HSP26, GPD1, and ENA1, and 10 genes in different metabolic subcategories. All 13 genes had the same transcriptional profile in both systems. Hence, the model appears to effectively mimic the environment encountered by baker's yeast in high-sugar dough. The liquid dough can be used to help understand the connections between technological traits and biological functions and to facilitate studies of gene expression under commercially important, but experimentally intractable, conditions. PMID:15746311

  13. Beta-lactamase reporter system for selecting high-producing yeast clones.

    PubMed

    Hribar, Gorazd; Smilović, Vanja; Zupan, Ana Lenassi; Gaberc-Porekar, Vladka

    2008-04-01

    In modern production of protein biopharmaceuticals, a good screening and selection method of high-producing clones can dramatically influence the whole production process and lead to lower production costs. We have created a rapid, simple, and inexpensive method for selecting high-producing clones in the yeast Pichia pastoris that is based on the beta-lactamase reporter system. By integrating the reporter gene and the gene of interest into the same genome locus, it was possible to use beta-lactamase activity as a measure of the expression level of the protein of interest. A novel expression vector with two independent expression cassettes was designed and tested using green fluorescent protein (GFP) as a model. The first cassette contained the GFP gene under the control of a strong, inducible AOX1 promoter, while the second cassette consisted of the beta-lactamase reporter gene under the control of a weak constitutive YPT1 promotor. High-producing GFP clones were selected directly on the plates based on the color change after hydrolysis of the beta-lactamase substrate added to the medium. beta-lactamase activity was found to positively correlate with GFP fluorescence. The reporter system described is widely applicable-it can be easily applied to other, also pharmaceutically relevant proteins and to other yeast expression systems, such as Saccharomyces cerevisiae and Hansenula polymorpha.

  14. Short communication: Identification and technological characterization of yeast strains isolated from samples of water buffalo Mozzarella cheese.

    PubMed

    Aponte, M; Pepe, O; Blaiotta, G

    2010-06-01

    Sixty yeast cultures were isolated from samples of water buffalo Mozzarella, a popular "pasta filata" cheese, originating on 16 farms located in the provinces of Salerno, Caserta, and Frosinone (Italy). Strains were identified by means of 5.8S internal transcribed spacer rDNA PCR-RFLP combined with 26S rRNA gene partial sequencing and characterized for their ability to exert biochemical properties of technological interest. The recorded dominance of fermenting yeasts such as the lactose-fermenting Kluyveromyces marxianus (38.3% of the total isolates) and the galactose-fermenting Saccharomyces cerevisiae (21.6% of the total isolates) suggests that these yeasts contribute to the organoleptic definition of the water buffalo Mozzarella. The speciographic analysis revealed the presence of 7 other species rarely or never reported in a dairy environment belonging to the genera Pichia and Candida, whose role in Mozzarella cheese organoleptic properties need to be further investigated.

  15. Genomics and the making of yeast biodiversity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces ...

  16. Automated Firearms Identification System (AFIDS), phase 1

    NASA Technical Reports Server (NTRS)

    Blackwell, R. J.; Framan, E. P.

    1974-01-01

    Items critical to the future development of an automated firearms identification system (AFIDS) have been examined, with the following specific results: (1) Types of objective data, that can be utilized to help establish a more factual basis for determining identity and nonidentity between pairs of fired bullets, have been identified. (2) A simulation study has indicated that randomly produced lines, similar in nature to the individual striations on a fired bullet, can be modeled and that random sequences, when compared to each other, have predictable relationships. (3) A schematic diagram of the general concept for AFIDS has been developed and individual elements of this system have been briefly tested for feasibility. Future implementation of such a proposed system will depend on such factors as speed, utility, projected total cost and user requirements for growth. The success of the proposed system, when operational, would depend heavily on existing firearms examiners.

  17. An Efficient Genome-Wide Fusion Partner Screening System for Secretion of Recombinant Proteins in Yeast

    PubMed Central

    Bae, Jung-Hoon; Hyun Sung, Bong; Kim, Hyun-Jin; Park, Soon-Ho; Lim, Kwang-Mook; Kim, Mi-Jin; Lee, Cho-Ryong; Sohn, Jung-Hoon

    2015-01-01

    To produce rarely secreted recombinant proteins in the yeast Saccharomyces cerevisiae, we developed a novel genome-wide optimal translational fusion partner (TFP) screening system that involves recruitment of an optimal secretion signal and fusion partner. A TFP library was constructed from a genomic and truncated cDNA library by using the invertase-based signal sequence trap technique. The efficiency of the system was demonstrated using two rarely secreted proteins, human interleukin (hIL)-2 and hIL-32. Optimal TFPs for secretion of hIL-2 and hIL-32 were easily selected, yielding secretion of these proteins up to hundreds of mg/L. Moreover, numerous uncovered yeast secretion signals and fusion partners were identified, leading to efficient secretion of various recombinant proteins. Selected TFPs were found to be useful for the hypersecretion of other recombinant proteins at yields of up to several g/L. This screening technique could provide new methods for the production of various types of difficult-to-express proteins. PMID:26195161

  18. Combinatorial Screening for Transgenic Yeasts with High Cellulase Activities in Combination with a Tunable Expression System

    PubMed Central

    Ito, Yoichiro; Yamanishi, Mamoru; Ikeuchi, Akinori; Imamura, Chie; Matsuyama, Takashi

    2015-01-01

    Combinatorial screening used together with a broad library of gene expression cassettes is expected to produce a powerful tool for the optimization of the simultaneous expression of multiple enzymes. Recently, we proposed a highly tunable protein expression system that utilized multiple genome-integrated target genes to fine-tune enzyme expression in yeast cells. This tunable system included a library of expression cassettes each composed of three gene-expression control elements that in different combinations produced a wide range of protein expression levels. In this study, four gene expression cassettes with graded protein expression levels were applied to the expression of three cellulases: cellobiohydrolase 1, cellobiohydrolase 2, and endoglucanase 2. After combinatorial screening for transgenic yeasts simultaneously secreting these three cellulases, we obtained strains with higher cellulase expressions than a strain harboring three cellulase-expression constructs within one high-performance gene expression cassette. These results show that our method will be of broad use throughout the field of metabolic engineering. PMID:26692026

  19. Two novel gene expression systems based on the yeasts Schwanniomyces occidentalis and Pichia stipitis.

    PubMed

    Piontek, M; Hagedorn, J; Hollenberg, C P; Gellissen, G; Strasser, A W

    1998-09-01

    Two non-Saccharomyces yeasts have been developed as hosts for heterologous gene expression. The celD gene from Clostridium thermocellum, encoding a heat-stable cellulase, served as the test sequence. The first system is based on the amylolytic species Schwanniomyces occidentalis, the second on the xylolytic species Pichia stipitis. The systems comprise auxotrophic host strains (trp5 in the case of S. occidentalis; trp5-10, his3 in the case of P. stipitis) and suitable transformation vectors. Vector components consist of an S. occidentalis-derived autonomously replicating sequence (SwARS) and the Saccharomyces cerevisiae-derived TRP5 sequence for plasmid propagation and selection in the yeast hosts, an ori and an ampicillin-resistance sequence for propagation and selection in a bacterial host. A range of vectors has been engineered employing different promoter elements for heterologous gene expression control in both species. Homologous elements derived from highly expressed genes of the respective hosts appeared to be of superior quality: in the case of S. occidentalis that of the GAM1 gene, in the case of P. stipitis that of the XYL1 gene. Further elements tested are the S. cerevisiae-derived ADH1 and PDC1 promoter sequences.

  20. Systematic identification of genes involved in metabolic acid stress resistance in yeast and their potential as cancer targets

    PubMed Central

    Shin, John J.; Aftab, Qurratulain; Austin, Pamela; McQueen, Jennifer A.; Poon, Tak; Li, Shu Chen; Young, Barry P.; Roskelley, Calvin D.

    2016-01-01

    ABSTRACT A hallmark of all primary and metastatic tumours is their high rate of glucose uptake and glycolysis. A consequence of the glycolytic phenotype is the accumulation of metabolic acid; hence, tumour cells experience considerable intracellular acid stress. To compensate, tumour cells upregulate acid pumps, which expel the metabolic acid into the surrounding tumour environment, resulting in alkalization of intracellular pH and acidification of the tumour microenvironment. Nevertheless, we have only a limited understanding of the consequences of altered intracellular pH on cell physiology, or of the genes and pathways that respond to metabolic acid stress. We have used yeast as a genetic model for metabolic acid stress with the rationale that the metabolic changes that occur in cancer that lead to intracellular acid stress are likely fundamental. Using a quantitative systems biology approach we identified 129 genes required for optimal growth under conditions of metabolic acid stress. We identified six highly conserved protein complexes with functions related to oxidative phosphorylation (mitochondrial respiratory chain complex III and IV), mitochondrial tRNA biosynthesis [glutamyl-tRNA(Gln) amidotransferase complex], histone methylation (Set1C–COMPASS), lysosome biogenesis (AP-3 adapter complex), and mRNA processing and P-body formation (PAN complex). We tested roles for two of these, AP-3 adapter complex and PAN deadenylase complex, in resistance to acid stress using a myeloid leukaemia-derived human cell line that we determined to be acid stress resistant. Loss of either complex inhibited growth of Hap1 cells at neutral pH and caused sensitivity to acid stress, indicating that AP-3 and PAN complexes are promising new targets in the treatment of cancer. Additionally, our data suggests that tumours may be genetically sensitized to acid stress and hence susceptible to acid stress-directed therapies, as many tumours accumulate mutations in mitochondrial

  1. Using Multi-Instance Hierarchical Clustering Learning System to Predict Yeast Gene Function

    PubMed Central

    Liao, Bo; Li, Yun; Jiang, Yan; Cai, Lijun

    2014-01-01

    Time-course gene expression datasets, which record continuous biological processes of genes, have recently been used to predict gene function. However, only few positive genes can be obtained from annotation databases, such as gene ontology (GO). To obtain more useful information and effectively predict gene function, gene annotations are clustered together to form a learnable and effective learning system. In this paper, we propose a novel multi-instance hierarchical clustering (MIHC) method to establish a learning system by clustering GO and compare this method with other learning system establishment methods. Multi-label support vector machine classifier and multi-label K-nearest neighbor classifier are used to verify these methods in four yeast time-course gene expression datasets. The MIHC method shows good performance, which serves as a guide to annotators or refines the annotation in detail. PMID:24621610

  2. Parameter identification for nonlinear aerodynamic systems

    NASA Technical Reports Server (NTRS)

    Pearson, Allan E.

    1993-01-01

    This final technical report covers a three and one-half year period preceding February 28, 1993 during which support was provided under NASA Grant NAG-1-1065. Following a general description of the system identification problem and a brief survey of methods to attack it, the basic ideas behind the approach taken in this research effort are presented. The results obtained are described with reference to the published work, including the five semiannual progress reports previously submitted and two interim technical reports.

  3. Identification and Antifungal Susceptibility Profiles of Candida nivariensis and Candida bracarensis in a Multi-Center Chinese Collection of Yeasts

    PubMed Central

    Hou, Xin; Xiao, Meng; Chen, Sharon C.-A.; Wang, He; Yu, Shu-Ying; Fan, Xin; Kong, Fanrong; Xu, Ying-Chun

    2017-01-01

    Candida nivariensis and C. bracarensis are two emerging cryptic species within the C. glabrata complex. Thirteen of these isolates from 10 hospitals in China were studied for their species identification and antifungal susceptibilities. Phenotypic and molecular [rDNA ITS sequencing, D1/D2 sequencing and ITS sequencer-based capillary gel electrophoresis (SCGE)] and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) MS identification methods were compared for their performance in species identification. Twelve of 13 (92.3%) isolates were identified as C. nivariensis and one as C. bracarensis using ITS sequencing as the reference method. Results obtained by D1/D2 sequencing and ITS SCGE were concordant with ITS sequencing results for all (100%) isolates. SCGE was able to subtype 12 C. nivariensis into four ITS SCGE length types. All isolates failed to be identified by the Vitek MALDI-TOF MS system (bioMérieux), whilst the Bruker MS system (Bruker Daltoniks) correctly identified all C. nivariensis isolates but using a lowered (≥1.700) cut-off score for species assignment; the C. bracarensis isolate was identified but with score <1.700. The Vitek 2 Compact system could not identify 11 C. nivariensis and one C. bracarensis isolate and misidentified the remaining C. nivarensis strain as “C. glabrata.” All isolates were susceptible-dose dependent to fluconazole [minimum inhibitory concentration (MIC) range 0.5–4 μg/mL] and were classed as susceptible to echinocandins (MICs ≤ 0.06 μg/mL). All 13 isolates had low MICs for other azoles (MICs ≤ 0.5 μg/mL), amphotericin B (MICs ≤ 2 μg/mL) and 5-flucytosine (MICs ≤ 0.25 μg/mL). Our results reinforce the need for molecular differentiation of species of C. nivarensis and C. bracarensis. The performance of MALDI-TOF may be improved by adding mass spectral profiles (MSPs) into the current databases. The antifungal susceptibility profile of isolates should be monitored. PMID:28154553

  4. High-throughput fluorescence screening assay for the identification and comparison of antimicrobial peptides' activity on various yeast species.

    PubMed

    Kodedová, Marie; Sychrová, Hana

    2016-09-10

    New antifungal compounds that circumvent the resistance of the pathogen by directly damaging yeast cell surface structures are promising agents for the treatment of fungal infections, due to their different mechanism of action from current clinically used antifungal drugs. We present here a rapid and cost-effective fluorescence method suitable for identifying new potent drugs that directly target yeast cell surface structures, causing cell permeabilization and thus bypassing the multidrug resistance mechanisms of pathogens. The fluorescence assay enabled us to detect with high sensitivity damage to the Candida plasma membrane (its hyperpolarization and permeabilization) as a result of short-term exposure to the antifungal compounds. Results can be obtained in 1-2h with minimal effort and consumption of the tested compounds, also 96 samples can be analysed simultaneously. We used this method to study antimicrobial peptides isolated from the venom of bees and their synthetic analogs, compare the potency of the peptides and determine their minimal effective concentrations. The antimicrobial peptides were able to kill yeast cells at low concentrations within a 15-min treatment, the LL-III peptide exhibited a broad spectrum of antifungal activity on various Saccharomyces, pathogenic Candida and osmotolerant yeast species.

  5. Identification of a novel pathway involving a GATA transcription factor in yeast and possibly plant Zn uptake and homeostasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To gain a better understanding of the regulation of Zn homeostasis in plants and the degree of conservation of Zn homeostasis between plants and yeast, a cDNA library from the Zn/Cd hyperaccumulating plant species, Nocceae caerulescens, was screened for its ability to restore growth under Zn limitin...

  6. Model Structure Determination and Identifiability Problems in System Identification.

    DTIC Science & Technology

    System identification has become one of the most active areas in system theory and its applications. In many engineering applications where the...estimation. As the authors extend the concept of system identification to those classes of problems where prior knowledge on structure is limited, some...basic problems other than parameter estimation become important. System identification consists of three basic sub-problems: (1) pre-estimation

  7. Autonomous Frequency-Domain System-Identification Program

    NASA Technical Reports Server (NTRS)

    Yam, Yeung; Mettler, Edward; Bayard, David S.; Hadaegh, Fred Y.; Milman, Mark H.; Scheid, Robert E.

    1993-01-01

    Autonomous Frequency Domain Identification (AU-FREDI) computer program implements system of methods, algorithms, and software developed for identification of parameters of mathematical models of dynamics of flexible structures and characterization, by use of system transfer functions, of such models, dynamics, and structures regarded as systems. Software considered collection of routines modified and reassembled to suit system-identification and control experiments on large flexible structures.

  8. Modulating the potency of an activator in a yeast in vitro transcription system.

    PubMed Central

    Ohashi, Y; Brickman, J M; Furman, E; Middleton, B; Carey, M

    1994-01-01

    The intrinsic stimulatory potential or potency of a eukaryotic gene activator is controlled by the interaction between the activation domain and the transcriptional machinery. To further understand this interaction, we undertook a biochemical study to identify parameters that could be used to modulate activator potency. We considered how varying the number of activation domains, their flexibility, and the number of promoter sites affects potency in a yeast nuclear extract. The effects of GAL4 derivatives bearing either one, two, or four herpes simplex virus VP16 activation domains (amino acids 413 to 454) were measured on DNA templates containing one or two GAL4 sites in a Saccharomyces cerevisiae nuclear extract. We found that multimerized VP16 activation domains acted synergistically to increase the potency of the activators. The spacing between the activation domains was critical, such that the increased flexibility imparted by a protein linker contributed to increased activator potency. With highly potent activators, the levels of transcription stimulated on a single site were saturating, whereas the stimulatory effect of weaker activators increased with the number of sites. We discuss how these biochemical studies relate to the mechanism of gene activation and synergy in a yeast in vitro system. Images PMID:8139572

  9. Multi-Output System Identification Using Evolutionary Programming

    DTIC Science & Technology

    1991-11-04

    Evolutionary programming (EP) has been demonstrated to be an effective method of system identification of single-input-single-output (SISO) systems...This paper investigates the use of EP in system identification of single-input-multioutput (SIMO) systems. EP is used to identify parameters of a

  10. Industrial systems biology and its impact on synthetic biology of yeast cell factories.

    PubMed

    Fletcher, Eugene; Krivoruchko, Anastasia; Nielsen, Jens

    2016-06-01

    Engineering industrial cell factories to effectively yield a desired product while dealing with industrially relevant stresses is usually the most challenging step in the development of industrial production of chemicals using microbial fermentation processes. Using synthetic biology tools, microbial cell factories such as Saccharomyces cerevisiae can be engineered to express synthetic pathways for the production of fuels, biopharmaceuticals, fragrances, and food flavors. However, directing fluxes through these synthetic pathways towards the desired product can be demanding due to complex regulation or poor gene expression. Systems biology, which applies computational tools and mathematical modeling to understand complex biological networks, can be used to guide synthetic biology design. Here, we present our perspective on how systems biology can impact synthetic biology towards the goal of developing improved yeast cell factories. Biotechnol. Bioeng. 2016;113: 1164-1170. © 2015 Wiley Periodicals, Inc.

  11. Systems biology of monovalent cation homeostasis in yeast: the translucent contribution.

    PubMed

    Ariño, Joaquín; Aydar, Ebru; Drulhe, Samuel; Ganser, Daniel; Jorrín, Jesús; Kahm, Matthias; Krause, Falko; Petrezsélyová, Silvia; Yenush, Lynne; Zimmermannová, Olga; van Heusden, G Paul H; Kschischo, Maik; Ludwig, Jost; Palmer, Chris; Ramos, José; Sychrová, Hana

    2014-01-01

    Maintenance of monovalent cation homeostasis (mainly K(+) and Na(+)) is vital for cell survival, and cation toxicity is at the basis of a myriad of relevant phenomena, such as salt stress in crops and diverse human diseases. Full understanding of the importance of monovalent cations in the biology of the cell can only be achieved from a systemic perspective. Translucent is a multinational project developed within the context of the SysMO (System Biology of Microorganisms) initiative and focussed in the study of cation homeostasis using the well-known yeast Saccharomyces cerevisiae as a model. The present review summarize how the combination of biochemical, genetic, genomic and computational approaches has boosted our knowledge in this field, providing the basis for a more comprehensive and coherent vision of the role of monovalent cations in the biology of the cell.

  12. An In-House Assay Is Superior to Sepsityper for Direct Matrix-Assisted Laser Desorption Ionization–Time of Flight (MALDI-TOF) Mass Spectrometry Identification of Yeast Species in Blood Cultures

    PubMed Central

    Bidart, Marie; Bonnet, Isabelle; Hennebique, Aurélie; Kherraf, Zine Eddine; Pelloux, Hervé; Berger, François; Cornet, Muriel; Bailly, Sébastien

    2015-01-01

    We developed an in-house assay for the direct identification, by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry, of yeasts in blood culture. Sixty-one representative strains from 12 species were analyzed in spiked blood cultures. Our assay accurately identified 95 of 107 (88.8%) positive blood cultures and outperformed the commercial Sepsityper kit (81.7% identification). PMID:25762771

  13. System Identification of X-33 Neural Network

    NASA Technical Reports Server (NTRS)

    Aggarwal, Shiv

    2003-01-01

    Modern flight control research has improved spacecraft survivability as its goal. To this end we need to have a failure detection system on board. In case the spacecraft is performing imperfectly, reconfiguration of control is needed. For that purpose we need to have parameter identification of spacecraft dynamics. Parameter identification of a system is called system identification. We treat the system as a black box which receives some inputs that lead to some outputs. The question is: what kind of parameters for a particular black box can correlate the observed inputs and outputs? Can these parameters help us to predict the outputs for a new given set of inputs? This is the basic problem of system identification. The X33 was supposed to have the onboard capability of evaluating the current performance and if needed to take the corrective measures to adapt to desired performance. The X33 is comprised of both rocket and aircraft vehicle design characteristics and requires, in general, analytical methods for evaluating its flight performance. Its flight consists of four phases: ascent, transition, entry and TAEM (Terminal Area Energy Management). It spends about 200 seconds in ascent phase, reaching an altitude of about 180,000 feet and a speed of about 10 to 15 Mach. During the transition phase which lasts only about 30 seconds, its altitude may increase to about 190,000 feet but its speed is reduced to about 9 Mach. At the beginning of this phase, the Main Engine is Cut Off (MECO) and the control is reconfigured with the help of aerosurfaces (four elevons, two flaps and two rudders) and reaction control system (RCS). The entry phase brings down the altitude of X33 to about 90,000 feet and its speed to about Mach 3. It spends about 250 seconds in this phase. Main engine is still cut off and the vehicle is controlled by complex maneuvers of aerosurfaces. The last phase TAEM lasts for about 450 seconds and the altitude and speed, both are reduced to zero. The

  14. System Identification of a Vortex Lattice Aerodynamic Model

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan; Kholodar, Denis; Dowell, Earl H.

    2001-01-01

    The state-space presentation of an aerodynamic vortex model is considered from a classical and system identification perspective. Using an aerodynamic vortex model as a numerical simulator of a wing tunnel experiment, both full state and limited state data or measurements are considered. Two possible approaches for system identification are presented and modal controllability and observability are also considered. The theory then is applied to the system identification of a flow over an aerodynamic delta wing and typical results are presented.

  15. Purification and characterization of bovine adrenal cytochrome b561 expressed in insect and yeast cell systems.

    PubMed

    Liu, Wen; Kamensky, Yury; Kakkar, Reva; Foley, Erin; Kulmacz, Richard J; Palmer, Graham

    2005-04-01

    Bovine adrenal chromaffin granule cytochrome (cyt) b561 is a transmembrane hemoprotein that plays a key role in transporting reducing equivalents from ascorbate to dopamine-beta-hydroxylase for catecholamine synthesis. We have developed procedures for expression and purification of functional bovine adrenal cyt b561 in insect and yeast cell systems. The bovine cyt b561 coding sequence, with or without a hexahistidine-tag sequence at the C-terminus, was cloned into the pVL1392 transfer vector under the control of the polyhedrin promoter to generate recombinant baculovirus for protein expression in Sf9 insect cells (approximately 0.5 mg detergent-solubilized cyt b561/L culture). For the yeast system, the cyt b561 cDNA was modified with a hexahistidine-tag sequence at the C-terminus, and inserted into the pPICZB vector under the control of the alcohol oxidase promoter. The recombinant plasmid was transformed into Pichia pastoris GS115 competent cells to give methanol-inducible cyt b561 expression (approximately 0.7 mg detergent-solubilized cyt b561/L culture). Recombinant His-tagged cyt b561 expressed in Sf9 or Pichia cells was readily solubilized from membrane fractions with dodecyl maltoside and purified to electrophoretic homogeneity by one-step chromatography on Ni-NTA affinity resin. The purified recombinant cytochrome from both systems had a heme to protein ratio close to two and was fully functional, as judged by comparison with the spectroscopic and kinetic parameters of the endogenous cytochrome from chromaffin granules. A novel procedure for isolation of chromaffin granule membranes was developed to utilize frozen adrenal glands instead of fresh tissue.

  16. Low- and high-affinity transport systems for citric acid in the yeast Candida utilis.

    PubMed Central

    Cássio, F; Leáo, C

    1991-01-01

    Citric acid-grown cells of the yeast Candida utilis induced two transport systems for citric acid, presumably a proton symport and a facilitated diffusion system for the charged and the undissociated forms of the acid, respectively. Both systems could be observed simultaneously when the transport was measured at 25 degrees C with labelled citric acid at pH 3.5 with the following kinetic parameters: for the low-affinity system, Vmax, 1.14 nmol of undissociated citric acid s-1 mg (dry weight) of cells-1, and Km, 0.59 mM undissociated acid; for the high-affinity system, Vmax, 0.38 nmol of citrate s-1 mg (dry weight) of cells-1, and Km, 0.056 mM citrate. At high pH values (above 5.0), the low-affinity system was absent or not measurable. The two transport systems exhibited different substrate specificities. Isocitric acid was a competitive inhibitor of citric acid for the high-affinity system, suggesting that these tricarboxylic acids used the same transport system, while aconitic, tricarballylic, trimesic, and hemimellitic acids were not competitive inhibitors. With respect to the low-affinity system, isocitric acid, L-lactic acid, and L-malic acid were competitive inhibitors, suggesting that all of these mono-, di-, and tricarboxylic acids used the same low-affinity transport system. The two transport systems were repressed by glucose, and as a consequence diauxic growth was observed. Both systems were inducible, and not only citric acid but also lactic acid and malic acid may induce those transport systems. The induction of both systems was not dependent on the relative concentration of the anionic form(s) and of undissociated citric acid in the culture medium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1664712

  17. In-silico identification and characterization of organic and inorganic chemical stress responding genes in yeast (Saccharomyces cerevisiae).

    PubMed

    Barozai, Muhammad Younas Khan; Bashir, Farrukh; Muzaffar, Shafia; Afzal, Saba; Behlil, Farida; Khan, Muzaffar

    2014-10-15

    To study the life processes of all eukaryotes, yeast (Saccharomyces cerevisiae) is a significant model organism. It is also one of the best models to study the responses of genes at transcriptional level. In a living organism, gene expression is changed by chemical stresses. The genes that give response to chemical stresses will provide good source for the strategies in engineering and formulating mechanisms which are chemical stress resistant in the eukaryotic organisms. The data available through microarray under the chemical stresses like lithium chloride, lactic acid, weak organic acids and tomatidine were studied by using computational tools. Out of 9335 yeast genes, 388 chemical stress responding genes were identified and characterized under different chemical stresses. Some of these are: Enolases 1 and 2, heat shock protein-82, Yeast Elongation Factor 3, Beta Glucanase Protein, Histone H2A1 and Histone H2A2 Proteins, Benign Prostatic Hyperplasia, ras GTPase activating protein, Establishes Silent Chromatin protein, Mei5 Protein, Nondisjunction Protein and Specific Mitogen Activated Protein Kinase. Characterization of these genes was also made on the basis of their molecular functions, biological processes and cellular components.

  18. Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein

    PubMed Central

    1988-01-01

    We have produced monoclonal antibodies against purified nuclei from the yeast Saccharomyces cerevisiae and have characterized three different antibodies that recognize a protein with an apparent molecular weight of 38,000, termed p38. Subcellular fractionation shows that virtually all of p38 occurs in the nuclear fraction. High concentrations of salt (1 M) or urea (6 M) effectively solubilize p38 from a nuclear envelope fraction prepared by digestion of nuclei with DNase. Indirect immunofluorescence demonstrates a crescent shaped distribution of p38 at the inner periphery of the nucleus, with p38 extending between dividing pairs of cells during (closed) mitosis. Postembedding immunogold electron microscopy shows decoration of the densely stained "crescent" region of the yeast nucleus, confirming the localization of p38 to the nucleolus. One of the monoclonals, D77, cross reacts on immunoblots with a single protein of molecular weight 37,000 from purified rat liver nuclei. Indirect immunofluorescence localizes this protein to the nucleolus, and shows that it is dispersed throughout the cell during mitosis. The yeast and rat liver nucleolar proteins behave similarly when electrophoresed in two dimensions, and appear to have basic pI values. Analysis of immunological cross-reactivity using D77, and antibodies specific for nucleolar proteins from other sources, suggests that the rat liver protein is fibrillarin, and demonstrates that p38 shares epitopes with fibrillarin, as well as with other vertebrate nucleolar proteins. PMID:3292539

  19. Fractional System Identification: An Approach Using Continuous Order-Distributions

    NASA Technical Reports Server (NTRS)

    Hartley, Tom T.; Lorenzo, Carl F.

    1999-01-01

    This paper discusses the identification of fractional- and integer-order systems using the concept of continuous order-distribution. Based on the ability to define systems using continuous order-distributions, it is shown that frequency domain system identification can be performed using least squares techniques after discretizing the order-distribution.

  20. Culture medium optimization for osmotolerant yeasts by use of a parallel fermenter system and rapid microbiological testing.

    PubMed

    Pfannebecker, Jens; Schiffer-Hetz, Claudia; Fröhlich, Jürgen; Becker, Barbara

    2016-11-01

    In the present study, a culture medium for qualitative detection of osmotolerant yeasts, named OM, was developed. For the development, culture media with different concentrations of glucose, fructose, potassium chloride and glycerin were analyzed in a Biolumix™ test incubator. Selectivity for osmotolerant yeasts was guaranteed by a water activity (aw)-value of 0.91. The best results regarding fast growth of Zygosaccharomyces rouxii (WH 1002) were achieved in a culture medium consisting of 45% glucose, 5% fructose and 0.5% yeast extract and in a medium with 30% glucose, 10% glycerin, 5% potassium chloride and 0.5% yeast extract. Substances to stimulate yeast fermentation rates were analyzed in a RAMOS(®) parallel fermenter system, enabling online measurement of the carbon dioxide transfer rate (CTR) in shaking flasks. Significant increases of the CTR was achieved by adding especially 0.1-0.2% ammonium salts ((NH4)2HPO4, (NH4)2SO4 or NH4NO3), 0.5% meat peptone and 1% malt extract. Detection times and the CTR of 23 food-borne yeast strains of the genera Zygosaccharomyces, Torulaspora, Schizosaccharomyces, Candida and Wickerhamomyces were analyzed in OM bouillon in comparison to the selective culture media YEG50, MYG50 and DG18 in the parallel fermenter system. The OM culture medium enabled the detection of 10(2)CFU/g within a time period of 2-3days, depending on the analyzed yeast species. Compared with YEG50 and MYG50 the detection times could be reduced. As an example, W. anomalus (WH 1021) was detected after 124h in YEG50, 95.5h in MYG50 and 55h in OM bouillon. Compared to YEG50 the maximum CO2 transfer rates for Z. rouxii (WH 1001), T. delbrueckii (DSM 70526), S. pombe (DSM 70576) and W. anomalus (WH 1016) increased by a factor ≥2.6. Furthermore, enrichment cultures of inoculated high-sugar products in OM culture medium were analyzed in the Biolumix™ system. The results proved that detection times of 3days for Z. rouxii and T. delbrueckii can be realized by

  1. Probing Signal Design for Power System Identification

    SciTech Connect

    Pierre, John W.; Zhou, Ning; Tuffner, Francis K.; Hauer, John F.; Trudnowski, Daniel J.; Mittelstadt, William

    2010-05-31

    This paper investigates the design of effective input signals for low-level probing of power systems. In 2005, 2006, and 2008 the Western Electricity Coordinating Council (WECC) conducted four large-scale system wide tests of the western interconnected power system where probing signals were injected by modulating the control signal at the Celilo end of the Pacific DC intertie. A major objective of these tests is the accurate estimation of the inter-area electromechanical modes. A key aspect of any such test is the design of an effective probing signal that leads to measured outputs rich in information about the modes. This paper specifically studies low-level probing signal design for power-system identification. The paper describes the design methodology and the advantages of this new probing signal which was successfully applied during these tests. This probing input is a multi-sine signal with its frequency content focused in the range of the inter-area modes. The period of the signal is over two minutes providing high-frequency resolution. Up to 15 cycles of the signal are injected resulting in a processing gain of 15. The resulting system response is studied in the time and frequency domains. Because of the new probing signal characteristics, these results show significant improvement in the output SNR compared to previous tests.

  2. The yin and yang of yeast: biodiversity research and systems biology as complementary forces driving innovation in biotechnology.

    PubMed

    Roberts, Ian N; Oliver, Stephen G

    2011-03-01

    The aim of this article is to review how yeast has contributed to contemporary biotechnology and to seek underlying principles relevant to its future exploitation for human benefit. Recent advances in systems biology combined with new knowledge of genome diversity promise to make yeast the eukaryotic workhorse of choice for production of everything from probiotics and pharmaceuticals to fuels and chemicals. The ability to engineer new capabilities through introduction of controlled diversity based on a complete understanding of genome complexity and metabolic flux is key. Here, we briefly summarise the history that has led to these apparently simple organisms being employed in such a broad range of commercial applications. Subsequently, we discuss the likely consequences of current yeast research for the future of biotechnological innovation.

  3. A Microfluidic System for Studying Ageing and Dynamic Single-Cell Responses in Budding Yeast

    PubMed Central

    Bakker, Elco; Smith, Stewart; Swain, Peter S.

    2014-01-01

    Recognition of the importance of cell-to-cell variability in cellular decision-making and a growing interest in stochastic modeling of cellular processes has led to an increased demand for high density, reproducible, single-cell measurements in time-varying surroundings. We present ALCATRAS (A Long-term Culturing And TRApping System), a microfluidic device that can quantitatively monitor up to 1000 cells of budding yeast in a well-defined and controlled environment. Daughter cells are removed by fluid flow to avoid crowding allowing experiments to run for over 60 hours, and the extracellular media may be changed repeatedly and in seconds. We illustrate use of the device by measuring ageing through replicative life span curves, following the dynamics of the cell cycle, and examining history-dependent behaviour in the general stress response. PMID:24950344

  4. Long-term detection of methyltestosterone (ab-) use by a yeast transactivation system.

    PubMed

    Wolf, Sylvi; Diel, Patrick; Parr, Maria Kristina; Rataj, Felicitas; Schänzer, Willhelm; Vollmer, Günter; Zierau, Oliver

    2011-04-01

    The routinely used analytical method for detecting the abuse of anabolic steroids only allows the detection of molecules with known analytical properties. In our supplementary approach to structure-independent detection, substances are identified by their biological activity. In the present study, urines excreted after oral methyltestosterone (MT) administration were analyzed by a yeast androgen screen (YAS). The aim was to trace the excretion of MT or its metabolites in human urine samples and to compare the results with those from the established analytical method. MT and its two major metabolites were tested as pure compounds in the YAS. In a second step, the ability of the YAS to detect MT and its metabolites in urine samples was analyzed. For this purpose, a human volunteer ingested of a single dose of 5 mg methyltestosterone. Urine samples were collected after different time intervals (0-307 h) and were analyzed in the YAS and in parallel by GC/MS. Whereas the YAS was able to trace MT in urine samples at least for 14 days, the detection limits of the GC/MS method allowed follow-up until day six. In conclusion, our results demonstrate that the yeast reporter gene system could detect the activity of anabolic steroids like methyltestosterone with high sensitivity even in urine. Furthermore, the YAS was able to detect MT abuse for a longer period of time than classical GC/MS. Obviously, the system responds to long-lasting metabolites yet unidentified. Therefore, the YAS can be a powerful (pre-) screening tool with the potential that to be used to identify persistent or late screening metabolites of anabolic steroids, which could be used for an enhancement of the sensitivity of GC/MS detection techniques.

  5. Identification of Mating Type Genes in the Bipolar Basidiomycetous Yeast Rhodosporidium toruloides: First Insight into the MAT Locus Structure of the Sporidiobolales▿ †

    PubMed Central

    Coelho, Marco A.; Rosa, André; Rodrigues, Nádia; Fonseca, Álvaro; Gonçalves, Paula

    2008-01-01

    Rhodosporidium toruloides is a heterothallic, bipolar, red yeast that belongs to the Sporidiobolales, an order within a major lineage of basidiomycetes, the Pucciniomycotina. In contrast to other basidiomycetes, considerably less is known about the nature of the mating type (MAT) loci that control sexual reproduction in this lineage. Three genes (RHA1, RHA2, and RHA3) encoding precursors of the MAT A1 pheromone (rhodotorucine A) were previously identified and formed the basis for a genome walking approach that led to the identification of additional MAT genes in complementary mating strains of R. toruloides. Two mating type-specific alleles encoding a p21-activated kinase (PAK; Ste20 homolog) were found between the RHA2 and RHA3 genes, and identification in MAT A2 strains of a gene encoding a presumptive pheromone precursor enabled prediction of the structure of rhodotorucine a. In addition, a putative pheromone receptor gene (STE3 homolog) was identified upstream of RHA1. Analyses of genomic data from two closely related species, Sporobolomyces roseus and Sporidiobolus salmonicolor, identified syntenic regions that contain homologs of all the above-mentioned genes. Notably, six novel pheromone precursor genes were uncovered, which encoded, similarly to the RHA genes, multiple tandem copies of the peptide moiety. This suggests that this structure, which is unique among fungal lipopeptide pheromones, seems to be prevalent in red yeasts. Species comparisons provided evidence for a large, multigenic MAT locus structure in the Sporidiobolales, but no putative homeodomain transcription factor genes (which are present in all basidiomycetous MAT loci characterized thus far) could be found in any of the three species in the vicinity of the MAT genes identified. PMID:18408057

  6. System identification of physiological systems using short data segments.

    PubMed

    Ludvig, Daniel; Perreault, Eric J

    2012-12-01

    System identification of physiological systems poses unique challenges, especially when the structure of the system under study is uncertain. Nonparametric techniques can be useful for identifying system structure, but these typically assume stationarity and require large amounts of data. Both of these requirements are often not easily obtained in the study of physiological systems. Ensemble methods for time-varying nonparametric estimation have been developed to address the issue of stationarity, but these require an amount of data that can be prohibitive for many experimental systems. To address this issue, we developed a novel algorithm that uses multiple short data segments. Using simulation studies, we showed that this algorithm produces system estimates with lower variability than previous methods when limited data are present. Furthermore, we showed that the new algorithm generates time-varying system estimates with lower total error than an ensemble method. Thus, this algorithm is well suited for the identification of physiological systems that vary with time or from which only short segments of stationary data can be collected.

  7. System Identification of Physiological Systems Using Short Data Segments

    PubMed Central

    Perreault, Eric J.

    2013-01-01

    System identification of physiological systems poses unique challenges, especially when the structure of the system under study is uncertain. Non-parametric techniques can be useful for identifying system structure, but these typically assume stationarity, and require large amounts of data. Both of these requirements are often not easily obtained in the study of physiological systems. Ensemble methods for time-varying, non-parametric estimation have been developed to address the issue of stationarity, but these require an amount of data that can be prohibitive for many experimental systems. To address this issue, we developed a novel algorithm that uses multiple short data segments. Using simulation studies, we showed that this algorithm produces system estimates with lower variability than previous methods when limited data are present. Furthermore we showed that the new algorithm generates time-varying system estimates with lower total error than an ensemble method. Thus, this algorithm is well suited for the identification of physiological systems that vary with time or from which only short segments of stationary data can be collected. PMID:23033429

  8. Thermal Signature Identification System (TheSIS)

    NASA Technical Reports Server (NTRS)

    Merritt, Scott; Bean, Brian

    2015-01-01

    We characterize both nonlinear and high order linear responses of fiber-optic and optoelectronic components using spread spectrum temperature cycling methods. This Thermal Signature Identification System (TheSIS) provides much more detail than conventional narrowband or quasi-static temperature profiling methods. This detail allows us to match components more thoroughly, detect subtle reversible shifts in performance, and investigate the cause of instabilities or irreversible changes. In particular, we create parameterized models of athermal fiber Bragg gratings (FBGs), delay line interferometers (DLIs), and distributed feedback (DFB) lasers, then subject the alternative models to selection via the Akaike Information Criterion (AIC). Detailed pairing of components, e.g. FBGs, is accomplished by means of weighted distance metrics or norms, rather than on the basis of a single parameter, such as center wavelength.

  9. Yeast DNA plasmids.

    PubMed

    Gunge, N

    1983-01-01

    The study of yeast DNA plasmids has been initiated with the discovery of the 2-micron DNA in Saccharomyces cerevisiae. This multiple copy plasmid, organized into chromatin structure in vivo, probably exists in the nucleus and provides a good system to obtain information on eukaryotic DNA replication. Yeast transformation with the 2-micron DNA or artificially constructed chimeric plasmids had contributed significantly to the study of the molecular biology of yeast and eukaryotes, allowing the isolation and characterization of various genes, ars, centromeres, and telomeres, and also serving as a tool to study the expression of various heterologous genes. Encouraged by these fruitful results, new yeast plasmids have been screened among phylogenetically distant yeasts. The linear DNA plasmids (pGKl1 and pGKl2) from Kluyveromyces lactis are the first case of yeast plasmids associated with biological function (killer phenotype). This plasmid system would be ideal as a model to study the structure and function of eukaryotic linear chromosomes. The extracellular secretion of protein toxin suggests the plasmids to be an excellent candidate for a secretion vector. The importance of yeasts as suitable materials for the study of eukaryotic cell biology would be much enhanced by the advent of new transformation systems with diverse host yeasts of genetically and phylogenetically distinct properties.

  10. An overview of recent advances in system identification

    NASA Astrophysics Data System (ADS)

    Juang, Jer-Nan

    1994-06-01

    This paper presents an overview of the recent advances in system identification for modal testing and control of large flexible structures. Several techniques are discussed including the Observer/Kalman Filter Identification, the Observer/Controller Identification, and the State-Space System Identification in the Frequency Domain. The System/Observer/Controller Toolbox developed at NASA Langley Research Center is used to show the applications of these techniques to real aerospace structures such as the Hubble spacecraft telescope and the active flexible aircraft wing.

  11. An overview of recent advances in system identification

    NASA Technical Reports Server (NTRS)

    Juang, Jer-Nan

    1994-01-01

    This paper presents an overview of the recent advances in system identification for modal testing and control of large flexible structures. Several techniques are discussed including the Observer/Kalman Filter Identification, the Observer/Controller Identification, and the State-Space System Identification in the Frequency Domain. The System/Observer/Controller Toolbox developed at NASA Langley Research Center is used to show the applications of these techniques to real aerospace structures such as the Hubble spacecraft telescope and the active flexible aircraft wing.

  12. Identification of auxotrophic mutants of the yeast Kluyveromyces marxianus by non-homologous end joining-mediated integrative transformation with genes from Saccharomyces cerevisiae.

    PubMed

    Yarimizu, Tohru; Nonklang, Sanom; Nakamura, Junpei; Tokuda, Shuya; Nakagawa, Takaaki; Lorreungsil, Sasithorn; Sutthikhumpha, Surasit; Pukahuta, Charida; Kitagawa, Takao; Nakamura, Mikiko; Cha-Aim, Kamonchai; Limtong, Savitree; Hoshida, Hisashi; Akada, Rinji

    2013-12-01

    The isolation and application of auxotrophic mutants for gene manipulations, such as genetic transformation, mating selection and tetrad analysis, form the basis of yeast genetics. For the development of these genetic methods in the thermotolerant fermentative yeast Kluyveromyces marxianus, we isolated a series of auxotrophic mutants with defects in amino acid or nucleic acid metabolism. To identify the mutated genes, linear DNA fragments of nutrient biosynthetic pathway genes were amplified from Saccharomyces cerevisiae chromosomal DNA and used to directly transform the K. marxianus auxotrophic mutants by random integration into chromosomes through non-homologous end joining (NHEJ). The appearance of transformant colonies indicated that the specific S. cerevisiae gene complemented the K. marxianus mutant. Using this interspecific complementation approach with linear PCR-amplified DNA, we identified auxotrophic mutations of ADE2, ADE5,7, ADE6, HIS2, HIS3, HIS4, HIS5, HIS6, HIS7, LYS1, LYS2, LYS4, LYS9, LEU1, LEU2, MET2, MET6, MET17, TRP3, TRP4 and TRP5 without the labour-intensive requirement of plasmid construction. Mating, sporulation and tetrad analysis techniques for K. marxianus were also established. With the identified auxotrophic mutant strains and S. cerevisiae genes as selective markers, NHEJ-mediated integrative transformation with PCR-amplified DNA is an attractive system for facilitating genetic analyses in the yeast K. marxianus.

  13. Lightweight autonomous chemical identification system (LACIS)

    NASA Astrophysics Data System (ADS)

    Lozos, George; Lin, Hai; Burch, Timothy

    2012-06-01

    Smiths Detection and Intelligent Optical Systems have developed prototypes for the Lightweight Autonomous Chemical Identification System (LACIS) for the US Department of Homeland Security. LACIS is to be a handheld detection system for Chemical Warfare Agents (CWAs) and Toxic Industrial Chemicals (TICs). LACIS is designed to have a low limit of detection and rapid response time for use by emergency responders and could allow determination of areas having dangerous concentration levels and if protective garments will be required. Procedures for protection of responders from hazardous materials incidents require the use of protective equipment until such time as the hazard can be assessed. Such accurate analysis can accelerate operations and increase effectiveness. LACIS is to be an improved point detector employing novel CBRNE detection modalities that includes a militaryproven ruggedized ion mobility spectrometer (IMS) with an array of electro-resistive sensors to extend the range of chemical threats detected in a single device. It uses a novel sensor data fusion and threat classification architecture to interpret the independent sensor responses and provide robust detection at low levels in complex backgrounds with minimal false alarms. The performance of LACIS prototypes have been characterized in independent third party laboratory tests at the Battelle Memorial Institute (BMI, Columbus, OH) and indoor and outdoor field tests at the Nevada National Security Site (NNSS). LACIS prototypes will be entering operational assessment by key government emergency response groups to determine its capabilities versus requirements.

  14. Characterization of the Probiotic Yeast Saccharomyces boulardii in the Healthy Mucosal Immune System.

    PubMed

    Hudson, Lauren E; McDermott, Courtney D; Stewart, Taryn P; Hudson, William H; Rios, Daniel; Fasken, Milo B; Corbett, Anita H; Lamb, Tracey J

    2016-01-01

    The probiotic yeast Saccharomyces boulardii has been shown to ameliorate disease severity in the context of many infectious and inflammatory conditions. However, use of S. boulardii as a prophylactic agent or therapeutic delivery vector would require delivery of S. boulardii to a healthy, uninflamed intestine. In contrast to inflamed mucosal tissue, the diverse microbiota, intact epithelial barrier, and fewer inflammatory immune cells within the healthy intestine may all limit the degree to which S. boulardii contacts and influences the host mucosal immune system. Understanding the nature of these interactions is crucial for application of S. boulardii as a prophylactic agent or therapeutic delivery vehicle. In this study, we explore both intrinsic and immunomodulatory properties of S. boulardii in the healthy mucosal immune system. Genomic sequencing and morphological analysis of S. boulardii reveals changes in cell wall components compared to non-probiotic S. cerevisiae that may partially account for probiotic functions of S. boulardii. Flow cytometry and immunohistochemistry demonstrate limited S. boulardii association with murine Peyer's patches. We also show that although S. boulardii induces a systemic humoral immune response, this response is small in magnitude and not directed against S. boulardii itself. RNA-seq of the draining mesenteric lymph nodes indicates that even repeated administration of S. boulardii induces few transcriptional changes in the healthy intestine. Together these data strongly suggest that interaction between S. boulardii and the mucosal immune system in the healthy intestine is limited, with important implications for future work examining S. boulardii as a prophylactic agent and therapeutic delivery vehicle.

  15. Discriminative power of fatty acid methyl ester (FAME) analysis using the microbial identification system (MIS) for Candida (Torulopsis) glabrata and Saccharomyces cerevisiae.

    PubMed

    Peltroche-Llacsahuanga, H; Schmidt, S; Lütticken, R; Haase, G

    2000-12-01

    Candida (Torulopsis) glabrata is frequently isolated in cases of fungal infection and commonly shows acquired or innate fluconazole resistance. Saccharomyces cerevisiae, an emerging opportunistic yeast pathogen, causes serious systemic infections in immunocompromised, and vaginitis and superficial infections in immunocompetent patients. For both species reliable identification in the routine laboratory is mandatory, but species identification of strains, e.g. trehalose-negative C. glabrata, may be difficult. Therefore, gas-liquid chromatography (GLC) of whole cell fatty acid methyl ester (FAME) profiles, that is independent of assimilation profiles of strains and suitable for reliable and rapid identification of clinically important yeasts, was applied. However, frequent misidentification of C. glabrata as S. cerevisiae has been reported when using the Yeast Clinical Database of MIS. Accuracy of MIS identification may be strongly influenced by the amounts of cell mass analyzed. Therefore, the present study compared the MIS results of these two yeasts achieved with different cell masses. Primarily we optimized, especially with respect to cost-effectiveness, the recommended streaking technique yielding a maximal recovery of 90-130 mg of cell mass from one plate, enabling testing of poor growing strains of C. glabrata. For all C. glabrata strains tested (n = 10) the highest identification scores (SI [Similarity Index] range 0.525-0.963, median 0.832) were achieved with 30 to 45 mg of cell mass. Only 5 of 10 S. cerevisiae strains revealed good library comparisons (SI > or = 0.5) when using 30 mg of cell mass, whereas with 45 mg all strains but two revealed this SI-level. For S. cerevisiae a higher amount of cell mass processed (up to 90 mg) was correlated with better identification scores (SI range using 90 mg: 0.464-0.870, median, 0.737). Several passages prior to FAME analysis of C. glabrata strains on recommended media revealed narrowing of SI ranges, but

  16. System identification techniques for helicopter higher harmonic control

    NASA Technical Reports Server (NTRS)

    Jacklin, S. A.

    1986-01-01

    This paper presents and compares several system identification techniques proposed for use with higher harmonic control algorithms designed to alleviate helicopter vibration. All method for actively controlling helicopter vibration require the knowledge of how the vibration outputs are related to the control inputs. Off-line or batch identification methods for obtaining this knowledge are presented first. Then the more advanced, adaptive identification techniques proposed to track the helicopter model parameters in flight are discussed. Considerations regarding system identifiability, identification algorithm stability, and computer implementation are also discussed.

  17. Identification of yeast and acetic acid bacteria isolated from the fermentation and acetification of persimmon (Diospyros kaki).

    PubMed

    Hidalgo, C; Mateo, E; Mas, A; Torija, M J

    2012-05-01

    Persimmon (Diospyros kaki) is a seasonal fruit with important health benefits. In this study, persimmon use in wine and condiment production was investigated using molecular methods to identify the yeast and acetic acid bacteria (AAB) isolated from the alcoholic fermentation and acetification of the fruit. Alcoholic fermentation was allowed to occur either spontaneously, or by inoculation with a commercial Saccharomyces cerevisiae wine strain, while acetification was always spontaneous; all these processes were performed in triplicates. Non-Saccharomyces yeast species were particularly abundant during the initial and mid-alcoholic fermentation stages, but S. cerevisiae became dominant toward the end of these processes. During spontaneous fermentation, S. cerevisiae Sc1 was the predominant strain isolated throughout, while the commercial strain of S. cerevisiae was the most common strain isolated from the inoculated fermentations. The main non-Saccharomyces strains isolated included Pichia guilliermondii, Hanseniaspora uvarum, Zygosaccharomyces florentinus and Cryptococcus sp. A distinct succession of AAB was observed during the acetification process. Acetobacter malorun was abundant during the initial and mid-stages, while Gluconacetobacter saccharivorans was the main species during the final stages of these acetifications. Four additional AAB species, Acetobacter pasteurianus, Acetobacter syzygii, Gluconacetobacter intermedius and Gluconacetobacter europaeus, were also detected. We observed 28 different AAB genotypes, though only 6 of these were present in high numbers (between 25%-60%), resulting in a high biodiversity index.

  18. Identification of S-phase DNA damage-response targets in fission yeast reveals conservation of damage-response networks

    PubMed Central

    Willis, Nicholas A.; Zhou, Chunshui; Elia, Andrew E. H.; Murray, Johanne M.; Carr, Antony M.; Elledge, Stephen J.; Rhind, Nicholas

    2016-01-01

    The cellular response to DNA damage during S-phase regulates a complicated network of processes, including cell-cycle progression, gene expression, DNA replication kinetics, and DNA repair. In fission yeast, this S-phase DNA damage response (DDR) is coordinated by two protein kinases: Rad3, the ortholog of mammalian ATR, and Cds1, the ortholog of mammalian Chk2. Although several critical downstream targets of Rad3 and Cds1 have been identified, most of their presumed targets are unknown, including the targets responsible for regulating replication kinetics and coordinating replication and repair. To characterize targets of the S-phase DDR, we identified proteins phosphorylated in response to methyl methanesulfonate (MMS)-induced S-phase DNA damage in wild-type, rad3∆, and cds1∆ cells by proteome-wide mass spectrometry. We found a broad range of S-phase–specific DDR targets involved in gene expression, stress response, regulation of mitosis and cytokinesis, and DNA replication and repair. These targets are highly enriched for proteins required for viability in response to MMS, indicating their biological significance. Furthermore, the regulation of these proteins is similar in fission and budding yeast, across 300 My of evolution, demonstrating a deep conservation of S-phase DDR targets and suggesting that these targets may be critical for maintaining genome stability in response to S-phase DNA damage across eukaryotes. PMID:27298342

  19. Comprehensive Identification of Cell Cycle–regulated Genes of the Yeast Saccharomyces cerevisiae by Microarray HybridizationD⃞

    PubMed Central

    Spellman, Paul T.; Sherlock, Gavin; Zhang, Michael Q.; Iyer, Vishwanath R.; Anders, Kirk; Eisen, Michael B.; Brown, Patrick O.; Botstein, David; Futcher, Bruce

    1998-01-01

    We sought to create a comprehensive catalog of yeast genes whose transcript levels vary periodically within the cell cycle. To this end, we used DNA microarrays and samples from yeast cultures synchronized by three independent methods: α factor arrest, elutriation, and arrest of a cdc15 temperature-sensitive mutant. Using periodicity and correlation algorithms, we identified 800 genes that meet an objective minimum criterion for cell cycle regulation. In separate experiments, designed to examine the effects of inducing either the G1 cyclin Cln3p or the B-type cyclin Clb2p, we found that the mRNA levels of more than half of these 800 genes respond to one or both of these cyclins. Furthermore, we analyzed our set of cell cycle–regulated genes for known and new promoter elements and show that several known elements (or variations thereof) contain information predictive of cell cycle regulation. A full description and complete data sets are available at http://cellcycle-www.stanford.edu PMID:9843569

  20. Identification of the Yeast R-SNARE Nyv1p as a Novel Longin Domain-containing Protein

    PubMed Central

    Wen, Wenyu; Chen, Lu; Wu, Hao; Sun, Xin; Zhang, Mingjie

    2006-01-01

    Using nuclear magnetic resonance spectroscopy, we establish that the N-terminal domain of the yeast vacuolar R-SNARE Nyv1p adopts a longin-like fold similar to those of Sec22b and Ykt6p. Nyv1p is sorted to the limiting membrane of the vacuole via the adaptor protein (AP)3 adaptin pathway, and we show that its longin domain is sufficient to direct transport to this location. In contrast, we found that the longin domains of Sec22p and Ykt6p were not sufficient to direct their localization. A YXXΦ-like adaptin-dependent sorting signal (Y31GTI34) unique to the longin domain of Nyv1p mediates interactions with the AP3 complex in vivo and in vitro. We show that amino acid substitutions to Y31GTI34 (Y31Q;I34Q) resulted in mislocalization of Nyv1p as well as reduced binding of the mutant protein to the AP3 complex. Although the sorting of Nyv1p to the limiting membrane of the vacuole is dependent upon the Y31GTI34 motif, and Y31 in particular, our findings with structure-based amino acid substitutions in the mu chain (Apm3p) of yeast AP3 suggest a mechanistically distinct role for this subunit in the recognition of YXXΦ-like sorting signals. PMID:16855025

  1. Emergent system identification using particle swarm optimization

    NASA Astrophysics Data System (ADS)

    Voss, Mark S.; Feng, Xin

    2001-10-01

    Complex Adaptive Structures can be viewed as a combination of Complex Adaptive Systems and fully integrated autonomous Smart Structures. Traditionally when designing a structure, one combines rules of thumb with theoretical results to develop an acceptable solution. This methodology will have to be extended for Complex Adaptive Structures, since they, by definition, will participate in their own design. In this paper we introduce a new methodology for Emergent System Identification that is concerned with combining the methodologies of self-organizing functional networks (GMDH - Alexy G. Ivakhnenko), Particle Swarm Optimization (PSO - James Kennedy and Russell C. Eberhart) and Genetic Programming (GP - John Koza). This paper will concentrate on the utilization of Particle Swarm Optimization in this effort and discuss how Particle Swarm Optimization relates to our ultimate goal of emergent self-organizing functional networks that can be used to identify overlapping internal structural models. The ability for Complex Adaptive Structures to identify emerging internal models will be a key component for their success.

  2. Molecular structure of yeast RNA polymerase III: demonstration of the tripartite transcriptive system in lower eukaryotes.

    PubMed Central

    Valenzuela, P; Hager, G L; Weinberg, F; Rutter, W J

    1976-01-01

    Homogeneous RNA polymerase III (RNA nucleotidyltransferase III) has been obtained from yeast. The subunit composition of the enzyme was examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The enzyme is composed of 12 putative subunits with molecular weights 160,000, 128,000, 82,000, 41,000, 40,500, 37,000, 34,000, 28,000, 24,000, 20,000, 14,500, and 11,000. The high-molecular-weight subunits and several of the smaller subunits of yeast RNA polymerase III are clearly different from those of enzymes I and II, indicating a distinct molecular structure. However, the molecular weights of some of the small subunits (41,000, 28,000, 24,000, and 14,500) appear to be identical to those of polymerases I and II. Thus, it is possible that the three classes of enzymes in yeast have some common subunits. As in other eukaryotes, yeast polymerase II is inhibited by relatively low concentrations of alpha-amanitin; however, contrary to what has been found in higher eukaryotes, yeast polymerase III is resistant (up to 2 mg/ml) to alpha-amanitin, while yeast polymerase I is sensitive to high concentrations of the drug (50% inhibition at 0.3 mg/ml). These results establish the existence of RNA polymerase III in yeast and provide a structural basis for the discrimination of the three functional polymerases in eukaryotes. Images PMID:772675

  3. A deceptive pollination system targeting drosophilids through olfactory mimicry of yeast.

    PubMed

    Stökl, Johannes; Strutz, Antonia; Dafni, Amots; Svatos, Ales; Doubsky, Jan; Knaden, Markus; Sachse, Silke; Hansson, Bill S; Stensmyr, Marcus C

    2010-10-26

    In deceptive pollination, insects are bamboozled into performing nonrewarded pollination. A prerequisite for the evolutionary stability in such systems is that the plants manage to generate a perfect sensory impression of a desirable object in the insect nervous system [1]. The study of these plants can provide important insights into sensory preference of their visiting insects. Here, we present the first description of a deceptive pollination system that specifically targets drosophilid flies. We show that the examined plant (Arum palaestinum) accomplishes its deception through olfactory mimicry of fermentation, a strategy that represents a novel pollination syndrome. The lily odor is composed of volatiles characteristic of yeast, and produces in Drosophila melanogaster an antennal detection pattern similar to that elicited by a range of fermentation products. By functional imaging, we show that the lily odors target a specific subset of odorant receptors (ORs), which include the most conserved OR genes in the drosophilid olfactome. Furthermore, seven of eight visiting drosophilid species show a congruent olfactory response pattern to the lily, in spite of comprising species pairs separated by ∼40 million years [2], showing that the lily targets a basal function of the fly nose, shared by species with similar ecological preference.

  4. Entropy-based separation of yeast cells using a microfluidic system of conjoined spheres

    SciTech Connect

    Huang, Kai-Jian; Qin, S.-J. Bai, Zhong-Chen; Zhang, Xin; Mai, John D.

    2013-11-21

    A physical model is derived to create a biological cell separator that is based on controlling the entropy in a microfluidic system having conjoined spherical structures. A one-dimensional simplified model of this three-dimensional problem in terms of the corresponding effects of entropy on the Brownian motion of particles is presented. This dynamic mechanism is based on the Langevin equation from statistical thermodynamics and takes advantage of the characteristics of the Fokker-Planck equation. This mechanism can be applied to manipulate biological particles inside a microfluidic system with identical, conjoined, spherical compartments. This theoretical analysis is verified by performing a rapid and a simple technique for separating yeast cells in these conjoined, spherical microfluidic structures. The experimental results basically match with our theoretical model and we further analyze the parameters which can be used to control this separation mechanism. Both numerical simulations and experimental results show that the motion of the particles depends on the geometrical boundary conditions of the microfluidic system and the initial concentration of the diffusing material. This theoretical model can be implemented in future biophysics devices for the optimized design of passive cell sorters.

  5. Detecting Protein-Protein Interactions in Vesicular Stomatitis Virus Using a Cytoplasmic Yeast Two Hybrid System

    PubMed Central

    Moerdyk-Schauwecker, Megan; DeStephanis, Darla; Hastie, Eric; Grdzelishvili, Valery Z.

    2011-01-01

    Summary Protein-protein interactions play an important role in many virus-encoded functions and in virus-host interactions. While a “classical” yeast two-hybrid system (Y2H) is one of the most common techniques to detect such interactions, it has a number of limitations, including a requirement for the proteins of interest to be relocated to the nucleus. Modified Y2H, such as the Sos recruitment system (SRS), which detect interactions occurring in the cytoplasm rather than the nucleus, allow proteins from viruses replicating in the cytoplasm to be tested in a more natural context. In this study, a SRS was used to detect interactions involving proteins from vesicular stomatitis virus (VSV), a prototypic non-segmented negative strand RNA (NNS) virus. All five full-length VSV proteins, as well as several truncated proteins, were screened against each other. Using the SRS, most interactions demonstrated previously involving VSV phosphoprotein, nucleocapsid (N) and large polymerase proteins were confirmed independently, while difficulties were encountered using the membrane associated matrix and glycoproteins. A human cDNA library was also screened against VSV N protein and one cellular protein, SFRS18, was identified which interacted with N in this context. The system presented can be redesigned easily for studies in other less tractable NNS viruses. PMID:21320532

  6. The yeast Golgi apparatus.

    PubMed

    Suda, Yasuyuki; Nakano, Akihiko

    2012-04-01

    The Golgi apparatus is an organelle that has been extensively studied in the model eukaryote, yeast. Its morphology varies among yeast species; the Golgi exists as a system of dispersed cisternae in the case of the budding yeast Saccharomyces cerevisiae, whereas the Golgi cisternae in Pichia pastoris and Schizosaccharomyces pombe are organized into stacks. In spite of the different organization, the mechanism of trafficking through the Golgi apparatus is believed to be similar, involving cisternal maturation, in which the resident Golgi proteins are transported backwards while secretory cargo proteins can stay in the cisternae. Questions remain regarding the organization of the yeast Golgi, the regulatory mechanisms that underlie cisternal maturation of the Golgi and transport machinery of cargo proteins through this organelle. Studies using different yeast species have provided hints to these mechanisms.

  7. Linear system identification - The application of Lion's identification scheme to a third order system with noisy input-output measurements

    NASA Technical Reports Server (NTRS)

    Brown, C. M., Jr.; Monopoli, R. V.

    1974-01-01

    A linear system identification technique developed by Lion is adapted for use on a third-order system with six unknown parameters and noisy input-output measurements. A digital computer is employed so that rapid identification takes place with only two state variable filters. Bias in the parameter estimates is partially eliminated by a signal-to-noise ratio testing procedure.

  8. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  9. Nonlinear system identification based on internal recurrent neural networks.

    PubMed

    Puscasu, Gheorghe; Codres, Bogdan; Stancu, Alexandru; Murariu, Gabriel

    2009-04-01

    A novel approach for nonlinear complex system identification based on internal recurrent neural networks (IRNN) is proposed in this paper. The computational complexity of neural identification can be greatly reduced if the whole system is decomposed into several subsystems. This approach employs internal state estimation when no measurements coming from the sensors are available for the system states. A modified backpropagation algorithm is introduced in order to train the IRNN for nonlinear system identification. The performance of the proposed design approach is proven on a car simulator case study.

  10. Positive Feedback Genetic Circuit Incorporating a Constitutively Active Mutant Gal3 into Yeast GAL Induction System.

    PubMed

    Ryo, Shintaro; Ishii, Jun; Matsuno, Toshihide; Nakamura, Yasuyuki; Matsubara, Daiki; Tominaga, Masahiro; Kondo, Akihiko

    2017-03-27

    The GAL expression system is the most frequently used induction technique in the yeast Saccharomyces cerevisiae. Here we report a simple but powerful genetic circuit for use with the GAL induction system. Briefly, an artificial positive feedback circuit was incorporated into the GAL regulatory network. We selected green fluorescent protein (GFP) as a reporter of GAL1 induction, and designed a strain that expressed a constitutively active Gal3 mutant protein (Gal3(c)) under control of the GAL10 promoter. In the resulting strain, GAL1 and GAL10 promoters regulate the expression of GFP and GAL3(c), respectively. Because Gal3(c) sequesters the Gal80 repressor away from the Gal4 transcriptional activator in the same manner as the galactose-bound Gal3, the expressed Gal3(c) protein provokes further expression of GFP and Gal3(c), yielding further enhancement of GAL induction. Thus, this GAL3(c)-mediated positive feedback circuit permits substantially enriched induction of a target gene at extremely low concentrations, or even in the absence, of galactose, while maintaining the strict glucose-mediated repression of the target.

  11. Immobilization of yeast inulinase on chitosan beads for the hydrolysis of inulin in a batch system.

    PubMed

    Singh, R S; Singh, R P; Kennedy, J F

    2017-02-01

    An extracellular inulinase was partially purified by ethanol precipitation and gel exclusion chromatography from a cell free extract of Kluyveromyces marxianus. Partially purified inulinase exhibited 420 IU/mg specific activity and it was immobilized on chitosan beads. Activity yield of immobilized inulinase was optimized with glutaraldehyde concentration (1-5%), glutaraldehyde treatment time (30-240min), enzyme coupling-time (2-16h) and enzyme loading (5-30 IU) as functions. Under the optimized conditions maximum yield 65.5% of immobilized inulinase was obtained. Maximum hydrolysis of inulin 84.5% and 78.2% was observed at 125rpm after 4h by immobilized and free enzyme, respectively. A retention-time of 4h and 5h was found optimal for the hydrolysis of inulin under agitation (125rpm) by free and immobilized enzyme, respectively. The recycling of the developed immobilized biocatalyst was carried out after 5h of inulin hydrolysis in a batch system. The developed immobilized biocatalyst was successfully used for the hydrolysis of inulin for 14 batches. This is the first report on the immobilization of yeast inulinase on chitosan beads for the hydrolysis of inulin in a batch system.

  12. Decentralized system identification using stochastic subspace identification for wireless sensor networks.

    PubMed

    Cho, Soojin; Park, Jong-Woong; Sim, Sung-Han

    2015-04-08

    Wireless sensor networks (WSNs) facilitate a new paradigm to structural identification and monitoring for civil infrastructure. Conventional structural monitoring systems based on wired sensors and centralized data acquisition systems are costly for installation as well as maintenance. WSNs have emerged as a technology that can overcome such difficulties, making deployment of a dense array of sensors on large civil structures both feasible and economical. However, as opposed to wired sensor networks in which centralized data acquisition and processing is common practice, WSNs require decentralized computing algorithms to reduce data transmission due to the limitation associated with wireless communication. In this paper, the stochastic subspace identification (SSI) technique is selected for system identification, and SSI-based decentralized system identification (SDSI) is proposed to be implemented in a WSN composed of Imote2 wireless sensors that measure acceleration. The SDSI is tightly scheduled in the hierarchical WSN, and its performance is experimentally verified in a laboratory test using a 5-story shear building model.

  13. Rapid identification of bacteria and yeast: summary of a National Committee for Clinical Laboratory Standards proposed guideline.

    PubMed

    Baron, E J

    2001-07-15

    Using colony morphology on selected agars, Gram-stain morphology, and a number of 1-step biochemical or enzymatic tests, skilled microbiologists can identify the species of the majority of isolates seen routinely in a clinical laboratory. These results are often available more quickly than and are as accurate as those derived from conventional methods. The National Committee for Clinical Laboratory Standards has produced a guideline that describes tests that can be used to identify a number of aerobic gram-negative rods and gram-positive cocci, a number of commonly isolated anaerobes, and 3 species of yeast. An overview of the organisms included in the guideline, the tests that identify them, and the situations in which rapid testing is appropriate is presented here.

  14. Identification of glycolaldehyde as the key inhibitor of bioethanol fermentation by yeast and genome-wide analysis of its toxicity.

    PubMed

    Jayakody, Lahiru N; Hayashi, Nobuyuki; Kitagaki, Hiroshi

    2011-02-01

    Degradation of lignocellulose with pressurised hot water is an efficient method of bioethanol production. However, the resultant solution inhibits ethanol fermentation by Saccharomyces cerevisiae. Here, we first report that glycolaldehyde, which is formed when lignocellulose is treated with pressurised hot water, inhibits ethanol fermentation. The final concentration of glycolaldehyde formed by the treatment of lignocellulose with pressurised hot water ranges from 1 to 24 M, and 1-10 mM glycolaldehyde was sufficient to inhibit fermentation. This result indicates that glycolaldehyde is one of the main substances responsible for inhibiting fermentation after pressurised hot water degradation of lignocellulose. Genome-wide screening of S. cerevisiae revealed that genes encoding alcohol dehydrogenase, methylglyoxal reductase, polysomes, and the ubiquitin ligase complex are required for glycolaldehyde tolerance. These novel findings will provide new perspectives on breeding yeast for bioethanol production from biomass treated with pressurised hot water.

  15. Identification of Yeast Mutants Exhibiting Altered Sensitivity to Valinomycin and Nigericin Demonstrate Pleiotropic Effects of Ionophores on Cellular Processes

    PubMed Central

    Bhatia-Kissova, Ingrid; Valachovic, Martin; Klobucnikova, Vlasta; Zeiselova, Lucia; Griac, Peter; Nosek, Jozef

    2016-01-01

    Ionophores such as valinomycin and nigericin are potent tools for studying the impact of ion perturbance on cellular functions. To obtain a broader picture about molecular components involved in mediating the effects of these drugs on yeast cells under respiratory growth conditions, we performed a screening of the haploid deletion mutant library covering the Saccharomyces cerevisiae nonessential genes. We identified nearly 130 genes whose absence leads either to resistance or to hypersensitivity to valinomycin and/or nigericin. The processes affected by their protein products range from mitochondrial functions through ribosome biogenesis and telomere maintenance to vacuolar biogenesis and stress response. Comparison of the results with independent screenings performed by our and other laboratories demonstrates that although mitochondria might represent the main target for both ionophores, cellular response to the drugs is very complex and involves an intricate network of proteins connecting mitochondria, vacuoles, and other membrane compartments. PMID:27711131

  16. Neural system prediction and identification challenge

    PubMed Central

    Vlachos, Ioannis; Zaytsev, Yury V.; Spreizer, Sebastian; Aertsen, Ad; Kumar, Arvind

    2013-01-01

    Can we infer the function of a biological neural network (BNN) if we know the connectivity and activity of all its constituent neurons?This question is at the core of neuroscience and, accordingly, various methods have been developed to record the activity and connectivity of as many neurons as possible. Surprisingly, there is no theoretical or computational demonstration that neuronal activity and connectivity are indeed sufficient to infer the function of a BNN. Therefore, we pose the Neural Systems Identification and Prediction Challenge (nuSPIC). We provide the connectivity and activity of all neurons and invite participants (1) to infer the functions implemented (hard-wired) in spiking neural networks (SNNs) by stimulating and recording the activity of neurons and, (2) to implement predefined mathematical/biological functions using SNNs. The nuSPICs can be accessed via a web-interface to the NEST simulator and the user is not required to know any specific programming language. Furthermore, the nuSPICs can be used as a teaching tool. Finally, nuSPICs use the crowd-sourcing model to address scientific issues. With this computational approach we aim to identify which functions can be inferred by systematic recordings of neuronal activity and connectivity. In addition, nuSPICs will help the design and application of new experimental paradigms based on the structure of the SNN and the presumed function which is to be discovered. PMID:24399966

  17. UASIS: Universal Automatic SNP Identification System

    PubMed Central

    2011-01-01

    Background SNP (Single Nucleotide Polymorphism), the most common genetic variations between human beings, is believed to be a promising way towards personalized medicine. As more and more research on SNPs are being conducted, non-standard nomenclatures may generate potential problems. The most serious issue is that researchers cannot perform cross referencing among different SNP databases. This will result in more resources and time required to track SNPs. It could be detrimental to the entire academic community. Results UASIS (Universal Automated SNP Identification System) is a web-based server for SNP nomenclature standardization and translation at DNA level. Three utilities are available. They are UASIS Aligner, Universal SNP Name Generator and SNP Name Mapper. UASIS maps SNPs from different databases, including dbSNP, GWAS, HapMap and JSNP etc., into an uniform view efficiently using a proposed universal nomenclature and state-of-art alignment algorithms. UASIS is freely available at http://www.uasis.tk with no requirement of log-in. Conclusions UASIS is a helpful platform for SNP cross referencing and tracking. By providing an informative, unique and unambiguous nomenclature, which utilizes unique position of a SNP, we aim to resolve the ambiguity of SNP nomenclatures currently practised. Our universal nomenclature is a good complement to mainstream SNP notations such as rs# and HGVS guidelines. UASIS acts as a bridge to connect heterogeneous representations of SNPs. PMID:22369494

  18. Neural system prediction and identification challenge.

    PubMed

    Vlachos, Ioannis; Zaytsev, Yury V; Spreizer, Sebastian; Aertsen, Ad; Kumar, Arvind

    2013-01-01

    Can we infer the function of a biological neural network (BNN) if we know the connectivity and activity of all its constituent neurons?This question is at the core of neuroscience and, accordingly, various methods have been developed to record the activity and connectivity of as many neurons as possible. Surprisingly, there is no theoretical or computational demonstration that neuronal activity and connectivity are indeed sufficient to infer the function of a BNN. Therefore, we pose the Neural Systems Identification and Prediction Challenge (nuSPIC). We provide the connectivity and activity of all neurons and invite participants (1) to infer the functions implemented (hard-wired) in spiking neural networks (SNNs) by stimulating and recording the activity of neurons and, (2) to implement predefined mathematical/biological functions using SNNs. The nuSPICs can be accessed via a web-interface to the NEST simulator and the user is not required to know any specific programming language. Furthermore, the nuSPICs can be used as a teaching tool. Finally, nuSPICs use the crowd-sourcing model to address scientific issues. With this computational approach we aim to identify which functions can be inferred by systematic recordings of neuronal activity and connectivity. In addition, nuSPICs will help the design and application of new experimental paradigms based on the structure of the SNN and the presumed function which is to be discovered.

  19. Autonomous system for pathogen detection and identification

    SciTech Connect

    Belgrader, P.; Benett, W.; Bergman, W.; Langlois, R.; Mariella, R.; Milanovich, F.; Miles, R.; Venkateswaran, K.; Long, G.; Nelson, W.

    1998-09-24

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world' s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify simulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air.

  20. Yeast Proteome Analysis

    NASA Astrophysics Data System (ADS)

    Matros, Andrea; Mock, Hans-Peter

    Yeast organisms, and specifically Saccharomyces cerevisiae, have become model systems for many aspects in fundamental and applied research. Consistently, many papers have been published applying proteome techniques to study these organisms. The review will give an overview on the proteome research performed on yeast systems so far; however, due to the large number of publications, only selected reports can be cited neglecting many more interesting ones in the interest of space. The review will focus on research involving mass spectrom-etry as a basic proteome technique, although many more approaches are relevant for the functional characterization of proteins in the cell, e.g. the yeast two-hybrid system. We will provide an overview on yeasts as models in the context of pro-teome analysis, and explain the basic techniques currently applied in proteome approaches. The main part of the review will deal with a survey on the current status of proteomic studies in yeasts. In a first part of this chapter, we will deal with the currently available proteome maps of yeasts, and in the following part we will discuss studies dealing with fundamental aspects, but also mention proteome studies related to applied microbiology. Finally, we will envisage future perspectives of the proteome technology for studying yeasts, and draw major conclusion on the current status reached in this field of functional genomics.

  1. [An intron-free methyl jasmonate inducible geranylgeranyl diphosphate synthase gene from Taxus media and its functional identification in yeast].

    PubMed

    Liao, Zhihua; Gong, Yifu; Kai, Guoyin; Zuo, Kaijing; Chen, Min; Tan, Qiumin; Wei, Yamin; Guo, Liang; Tan, Feng; Sun, Xiaofen; Tang, Kexuan

    2005-01-01

    Geranylgeranyl diphosphate synthase (GGPPS, EC: 2.5.1.29) catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes including Taxol, one of the most potent antitumor drugs. In order to investigate the role of GGPP synthase in taxol biosynthesis, we cloned, characterized and functionally expressed the GGPP synthase gene from Taxus media. A 3743-bp genomic sequence of T. media was isolated by genome walking strategy which contained an 1182-bp open reading frame (ORF) encoding a 393-amino acid polypeptide that showed high similarity to other plant GGPPSs. Subsequently the full-length cDNA of the GGPPS gene of T. media (designated TmGGPPS) was amplified by RACE. Bioinformatic analysis showed that TmGGPPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the prenyltransferases. By constructing the phylogenetic tree of plant GGPPSs, it was found that plant-derived GGPPSs could be divided into two classes, angiosperm and gymnosperm classes, which might have evolved in parallel from the same ancestor. To our knowledge this was the first report that the geranylgeranyl diphosphate synthase genes were free of intron and evolved in parallel between angiosperms and gymnosperms. The coding sequence of TmGGPPS was expressed in yeast mutant (SFNY368) lacking of GGPP synthase activity through functional complementation, and the transgenic yeast showed to have activity of GGPP synthase. This was also the first time to use SFNY368 to identify the function of plant-derived GGPPSs. Furthermore, investigation of the impact of methyl jasmonate (MeJA) on the expression of TmGGPPS revealed that MeJA-treated T. media cultured cells had much higher expression of TmGGPPS than untreated cells.

  2. Identification of the genes affecting the regulation of riboflavin synthesis in the flavinogenic yeast Pichia guilliermondii using insertion mutagenesis

    PubMed Central

    Boretsky, Yuriy R.; Pynyaha, Yuriy V.; Boretsky, Volodymyr Y.; Fedorovych, Dariya V.; Fayura, Lyubov R.; Protchenko, Olha; Philpott, Caroline C.; Sibirny, Andriy A.

    2012-01-01

    Pichia guilliermondii is a representative of a group of so-called flavinogenic yeast species that overproduce riboflavin (vitamin B2) in response to iron limitation. Using insertion mutagenesis, we isolated P. guilliermondii mutants overproducing riboflavin. Analysis of nucleotide sequence of recombination sites revealed that insertion cassettes integrated into the genome disrupting P. guilliermondii genes similar to the VMA1 gene of Ashbya gossypii and Saccharomyces cerevisiae and FES1 and FRA1 genes of S. cerevisiae. The constructed P. guilliermondii Δvma1–17 mutant possessed five- to sevenfold elevated riboflavin production and twofold decreased iron cell content as compared with the parental strain. Pichia guilliermondii Δfra1–45 mutant accumulated 1.8–2.2-fold more iron in the cells and produced five- to sevenfold more riboflavin as compared with the parental strain. Both Δvma1–17 and Δfes1–77 knockout strains could not grow at 37 °C in contrast to the wild-type strain and the Δfra1–45 mutant. Increased riboflavin production by the wild-type strain was observed at 37 °C. Although the Δfes1–77 mutant did not overproduce riboflavin, it showed partial complementation when crossed with previously isolated P. guilliermondii riboflavin-overproducing mutant rib80–22. Complementation analysis revealed that Δvma1–17 and Δfra1–45 mutants are distinct from previously reported riboflavin-producing mutants hit1-1, rib80-22 and rib81-31 of this yeast. PMID:21261808

  3. Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae.

    PubMed

    Eid, Rawan; Boucher, Eric; Gharib, Nada; Khoury, Chamel; Arab, Nagla T T; Murray, Alistair; Young, Paul G; Mandato, Craig A; Greenwood, Michael T

    2016-03-01

    Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomyces cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress.

  4. An Ancient Yeast for Young Geneticists: A Primer on the Schizosaccharomyces pombe Model System

    PubMed Central

    Hoffman, Charles S.; Wood, Valerie; Fantes, Peter A.

    2015-01-01

    The fission yeast Schizosaccharomyces pombe is an important model organism for the study of eukaryotic molecular and cellular biology. Studies of S. pombe, together with studies of its distant cousin, Saccharomyces cerevisiae, have led to the discovery of genes involved in fundamental mechanisms of transcription, translation, DNA replication, cell cycle control, and signal transduction, to name but a few processes. However, since the divergence of the two species approximately 350 million years ago, S. pombe appears to have evolved less rapidly than S. cerevisiae so that it retains more characteristics of the common ancient yeast ancestor, causing it to share more features with metazoan cells. This Primer introduces S. pombe by describing the yeast itself, providing a brief description of the origins of fission yeast research, and illustrating some genetic and bioinformatics tools used to study protein function in fission yeast. In addition, a section on some key differences between S. pombe and S. cerevisiae is included for readers with some familiarity with budding yeast research but who may have an interest in developing research projects using S. pombe. PMID:26447128

  5. Scaffolded Antigens in Yeast Cell Particle Vaccines Provide Protection against Systemic Polyoma Virus Infection

    PubMed Central

    Tipper, Donald J.; Szomolanyi-Tsuda, Eva

    2016-01-01

    Background. U65, a self-aggregating peptide scaffold, traps fused protein antigens in yeast cells. Conversion to Yeast Cell Particle (YCP) vaccines by partial removal of surface mannoproteins exposes β-glucan, mediating efficient uptake by antigen-presenting cells (APCs). YCP vaccines are inexpensive, capable of rapid large-scale production and have potential for both parenteral and oral use. Results. YCP processing by alkaline hydrolysis exposes up to 20% of the glucan but converts scaffolded antigen and internal yeast proteins into a common aggregate, preventing selective yeast protein removal. For U65-green fluorescent protein (GFP) or U65-Apolipoprotein A1 (ApoA1) subcutaneous vaccines, maximal IgG responses in mice required 10% glucan exposure. IgG responses to yeast proteins were 5-fold lower. Proteolytic mannoprotein removal produced YCPs with only 6% glucan exposure, insufficiently porous for selective removal of even native yeast proteins. Vaccine efficacy was reduced 10-fold. Current YCP formulations, therefore, are not suitable for human use but have considerable potential for use in feed animal vaccines. Significantly, a YCP vaccine expressing a GFP fusion to VP1, the murine polyoma virus major capsid protein, after either oral or subcutaneous administration, protected mice against an intraperitoneal polyoma virus challenge, reducing viral DNA levels in spleen and liver by >98%. PMID:27213160

  6. An Ancient Yeast for Young Geneticists: A Primer on the Schizosaccharomyces pombe Model System.

    PubMed

    Hoffman, Charles S; Wood, Valerie; Fantes, Peter A

    2015-10-01

    The fission yeast Schizosaccharomyces pombe is an important model organism for the study of eukaryotic molecular and cellular biology. Studies of S. pombe, together with studies of its distant cousin, Saccharomyces cerevisiae, have led to the discovery of genes involved in fundamental mechanisms of transcription, translation, DNA replication, cell cycle control, and signal transduction, to name but a few processes. However, since the divergence of the two species approximately 350 million years ago, S. pombe appears to have evolved less rapidly than S. cerevisiae so that it retains more characteristics of the common ancient yeast ancestor, causing it to share more features with metazoan cells. This Primer introduces S. pombe by describing the yeast itself, providing a brief description of the origins of fission yeast research, and illustrating some genetic and bioinformatics tools used to study protein function in fission yeast. In addition, a section on some key differences between S. pombe and S. cerevisiae is included for readers with some familiarity with budding yeast research but who may have an interest in developing research projects using S. pombe.

  7. Non-linear system identification in flow-induced vibration

    SciTech Connect

    Spanos, P.D.; Zeldin, B.A.; Lu, R.

    1996-12-31

    The paper introduces a method of identification of non-linear systems encountered in marine engineering applications. The non-linearity is accounted for by a combination of linear subsystems and known zero-memory non-linear transformations; an equivalent linear multi-input-single-output (MISO) system is developed for the identification problem. The unknown transfer functions of the MISO system are identified by assembling a system of linear equations in the frequency domain. This system is solved by performing the Cholesky decomposition of a related matrix. It is shown that the proposed identification method can be interpreted as a {open_quotes}Gram-Schmidt{close_quotes} type of orthogonal decomposition of the input-output quantities of the equivalent MISO system. A numerical example involving the identification of unknown parameters of flow (ocean wave) induced forces on offshore structures elucidates the applicability of the proposed method.

  8. System Identification for the Clipper Liberty C96 Wind Turbine

    NASA Astrophysics Data System (ADS)

    Showers, Daniel

    System identification techniques are powerful tools that help improve modeling capabilities of real world dynamic systems. These techniques are well established and have been successfully used on countless systems in many areas. However, wind turbines provide a unique challenge for system identification because of the difficulty in measuring its primary input: wind. This thesis first motivates the problem by demonstrating the challenges with wind turbine system identification using both simulations and real data. It then suggests techniques toward successfully identifying a dynamic wind turbine model including the notion of an effective wind speed and how it might be measured. Various levels of simulation complexity are explored for insights into calculating an effective wind speed. In addition, measurements taken from the University of Minnesota's Clipper Liberty C96 research wind turbine are used for a preliminary investigation into the effective wind speed calculation and system identification of a real world wind turbine.

  9. Characterization of the Probiotic Yeast Saccharomyces boulardii in the Healthy Mucosal Immune System

    PubMed Central

    Hudson, Lauren E.; McDermott, Courtney D.; Stewart, Taryn P.; Hudson, William H.; Rios, Daniel; Fasken, Milo B.; Corbett, Anita H.; Lamb, Tracey J.

    2016-01-01

    The probiotic yeast Saccharomyces boulardii has been shown to ameliorate disease severity in the context of many infectious and inflammatory conditions. However, use of S. boulardii as a prophylactic agent or therapeutic delivery vector would require delivery of S. boulardii to a healthy, uninflamed intestine. In contrast to inflamed mucosal tissue, the diverse microbiota, intact epithelial barrier, and fewer inflammatory immune cells within the healthy intestine may all limit the degree to which S. boulardii contacts and influences the host mucosal immune system. Understanding the nature of these interactions is crucial for application of S. boulardii as a prophylactic agent or therapeutic delivery vehicle. In this study, we explore both intrinsic and immunomodulatory properties of S. boulardii in the healthy mucosal immune system. Genomic sequencing and morphological analysis of S. boulardii reveals changes in cell wall components compared to non-probiotic S. cerevisiae that may partially account for probiotic functions of S. boulardii. Flow cytometry and immunohistochemistry demonstrate limited S. boulardii association with murine Peyer’s patches. We also show that although S. boulardii induces a systemic humoral immune response, this response is small in magnitude and not directed against S. boulardii itself. RNA-seq of the draining mesenteric lymph nodes indicates that even repeated administration of S. boulardii induces few transcriptional changes in the healthy intestine. Together these data strongly suggest that interaction between S. boulardii and the mucosal immune system in the healthy intestine is limited, with important implications for future work examining S. boulardii as a prophylactic agent and therapeutic delivery vehicle. PMID:27064405

  10. Automated frequency domain system identification of a large space structure

    NASA Technical Reports Server (NTRS)

    Yam, Y.; Bayard, D. S.; Hadaegh, F. Y.; Mettler, E.; Milman, M. H.

    1989-01-01

    This paper presents the development and experimental results of an automated on-orbit system identification method for large flexible spacecraft that yields estimated quantities to support on-line design and tuning of robust high performance control systems. The procedure consists of applying an input to the plant, obtaining an output, and then conducting nonparametric identification to yield the spectral estimate of the system transfer function. A parametric model is determined by curve fitting the spectral estimate to a rational transfer function. The identification method has been demonstrated experimentally on the Large Spacecraft Control Laboratory in JPL.

  11. Substructure System Identification for Finite Element Model Updating

    NASA Technical Reports Server (NTRS)

    Craig, Roy R., Jr.; Blades, Eric L.

    1997-01-01

    This report summarizes research conducted under a NASA grant on the topic 'Substructure System Identification for Finite Element Model Updating.' The research concerns ongoing development of the Substructure System Identification Algorithm (SSID Algorithm), a system identification algorithm that can be used to obtain mathematical models of substructures, like Space Shuttle payloads. In the present study, particular attention was given to the following topics: making the algorithm robust to noisy test data, extending the algorithm to accept experimental FRF data that covers a broad frequency bandwidth, and developing a test analytical model (TAM) for use in relating test data to reduced-order finite element models.

  12. The use of Fenton's system in the yeast industry wastewater treatment.

    PubMed

    Zak, S

    2005-01-01

    The paper presents the results of the research conducted with the use of hydrogen peroxide and iron (II) sulfate or chloride in the chemical pretreatment of Saccharomyces cerevisae yeast industry wastewater. It was found that the use of Fenton's system permitted a high reduction of sugar-like substances and total decolorizing of non-sugar compounds. The level of COD reduction depended on the amount and mutual proportions of COD:Fe(II):H2O2, as well as a type of the applied salt Fe(II). For iron concentrations: 1000-4000 mg l(-1) with molar excess [H2O2]:[Fe(II)] - 2-14:1 and reaction pH - 3.1-3.4, very high reproducibility of results and the COD reduction exceeding 75% were obtained. For this range of the reagent concentrations, the distribution of COD reduction values correlated with the equation: COD = - Ax4 + Bx3 - Cx2 + Dx - E (where: x = [H2O2]:[Fe(II)]). Additional neutralization with the use of lime milk made the secondary reduction of CODr(CaO) value possible, which resulted in the reduction of the total CODT above 90%. The method enabled us to consider the possibility of the preliminary chemical elimination of the wastewater load, which might increase the effectiveness of working wastewater treatment plants, especially in cases of continuous and occasional overloads above the level assumed by the project.

  13. Parameter estimation techniques for LTP system identification

    NASA Astrophysics Data System (ADS)

    Nofrarias Serra, Miquel

    LISA Pathfinder (LPF) is the precursor mission of LISA (Laser Interferometer Space Antenna) and the first step towards gravitational waves detection in space. The main instrument onboard the mission is the LTP (LISA Technology Package) whose scientific goal is to test LISA's drag-free control loop by reaching a differential acceleration noise level between two masses in √ geodesic motion of 3 × 10-14 ms-2 / Hz in the milliHertz band. The mission is not only challenging in terms of technology readiness but also in terms of data analysis. As with any gravitational wave detector, attaining the instrument performance goals will require an extensive noise hunting campaign to measure all contributions with high accuracy. But, opposite to on-ground experiments, LTP characterisation will be only possible by setting parameters via telecommands and getting a selected amount of information through the available telemetry downlink. These two conditions, high accuracy and high reliability, are the main restrictions that the LTP data analysis must overcome. A dedicated object oriented Matlab Toolbox (LTPDA) has been set up by the LTP analysis team for this purpose. Among the different toolbox methods, an essential part for the mission are the parameter estimation tools that will be used for system identification during operations: Linear Least Squares, Non-linear Least Squares and Monte Carlo Markov Chain methods have been implemented as LTPDA methods. The data analysis team has been testing those methods with a series of mock data exercises with the following objectives: to cross-check parameter estimation methods and compare the achievable accuracy for each of them, and to develop the best strategies to describe the physics underlying a complex controlled experiment as the LTP. In this contribution we describe how these methods were tested with simulated LTP-like data to recover the parameters of the model and we report on the latest results of these mock data exercises.

  14. A systems biology approach to study glucose repression in the yeast Saccharomyces cerevisiae.

    PubMed

    Westergaard, Steen Lund; Oliveira, Ana Paula; Bro, Christoffer; Olsson, Lisbeth; Nielsen, Jens

    2007-01-01

    Glucose repression in the yeast Saccharomyces cerevisiae has evolved as a complex regulatory system involving several different pathways. There are two main pathways involved in signal transduction. One has a role in glucose sensing and regulation of glucose transport, while another takes part in repression of a wide range of genes involved in utilization of alternative carbon sources. In this work, we applied a systems biology approach to study the interaction between these two pathways. Through genome-wide transcription analysis of strains with disruption of HXK2, GRR1, MIG1, the combination of MIG1 and MIG2, and the parental strain, we identified 393 genes to have significantly changed expression levels. To identify co-regulation patterns in the different strains we applied principal component analysis. Disruption of either GRR1 or HXK2 were both found to have profound effects on transcription of genes related to TCA cycle and respiration, as well as ATP synthesis coupled proton transport, all displaying an increased expression. The hxk2Delta strain showed reduced overflow metabolism towards ethanol relative to the parental strain. We also used a genome-scale metabolic model to identify reporter metabolites, and found that there is a high degree of consistency between the identified reporter metabolites and the physiological effects observed in the different mutants. Our systems biology approach points to close interaction between the two pathways, and our metabolism driven analysis of transcription data may find a wider application for analysis of cross-talk between different pathways involved in regulation of metabolism.

  15. Comparison of the Vitek MS and Bruker Microflex LT MALDI-TOF MS platforms for routine identification of commonly isolated bacteria and yeast in the clinical microbiology laboratory.

    PubMed

    Deak, Eszter; Charlton, Carmen L; Bobenchik, April M; Miller, Shelley A; Pollett, Simon; McHardy, Ian H; Wu, Max T; Garner, Omai B

    2015-01-01

    This study compared the diagnostic performance of Bruker's Microflex LT and bioMérieux's Vitek MS matrix-assisted laser desorption ionization-time of flight mass spectrometry systems. A total of 477 isolates were tested on both instruments. Discrepant results were resolved by sequencing. Overall, there was no statistically significant difference between the proportion of isolates correctly identified, miscalled or not called by each instrument. Although both systems were good at identifying yeast (66/69 to species level), the confidence level was high only to genus level for 30% of the isolates on the Bruker. Both systems performed with high accuracy when evaluated solely on Food and Drug Administration-approved organisms for each database. A user-based assessment of the 2 instruments revealed an overall preference for the Vitek MS instrument.

  16. A Method of Visualizing Three-Dimensional Distribution of Yeast in Bread Dough

    NASA Astrophysics Data System (ADS)

    Maeda, Tatsurou; Do, Gab-Soo; Sugiyama, Junichi; Oguchi, Kosei; Shiraga, Seizaburou; Ueda, Mitsuyoshi; Takeya, Koji; Endo, Shigeru

    A novel technique was developed to monitor the change in three-dimensional (3D) distribution of yeast in frozen bread dough samples in accordance with the progress of mixing process. Application of a surface engineering technology allowed the identification of yeast in bread dough by bonding EGFP (Enhanced Green Fluorescent Protein) to the surface of yeast cells. The fluorescent yeast (a biomarker) was recognized as bright spots at the wavelength of 520 nm. A Micro-Slicer Image Processing System (MSIPS) with a fluorescence microscope was utilized to acquire cross-sectional images of frozen dough samples sliced at intervals of 1 μm. A set of successive two-dimensional images was reconstructed to analyze 3D distribution of yeast. Samples were taken from each of four normal mixing stages (i.e., pick up, clean up, development, and final stages) and also from over mixing stage. In the pick up stage yeast distribution was uneven with local areas of dense yeast. As the mixing progressed from clean up to final stages, the yeast became more evenly distributed throughout the dough sample. However, the uniformity in yeast distribution was lost in the over mixing stage possibly due to the breakdown of gluten structure within the dough sample.

  17. Identification of human protein interaction domains using an ORFeome-based yeast two-hybrid fragment library.

    PubMed

    Waaijers, Selma; Koorman, Thijs; Kerver, Jana; Boxem, Mike

    2013-07-05

    Physical interactions between proteins are essential for biological processes. Hence, there have been major efforts to elucidate the complete networks of protein-protein interactions, or "interactomes", of various organisms. Detailed descriptions of protein interaction networks should include information on the discrete domains that mediate these interactions, yet most large-scale efforts model interactions between whole proteins only. We previously developed a yeast two-hybrid-based strategy to systematically map interaction domains and generated a domain-based interactome network for 750 proteins involved in C. elegans early embryonic development. Here, we expand the concept of Y2H-based interaction domain mapping to the genome-wide level. We generated a human fragment library by randomly fragmenting the full-length open reading frames (ORFs) present in the human ORFeome collection. Screens using several proteins required for cell division or polarity establishment as baits demonstrate the ability to accurately identify interaction domains for human proteins using this approach, while the experimental quality of the Y2H data was independently verified in coaffinity purification assays. The library generation strategy can easily be adapted to generate libraries from full-length ORF collections of other organisms.

  18. Identification of a Sgo2-Dependent but Mad2-Independent Pathway Controlling Anaphase Onset in Fission Yeast.

    PubMed

    Meadows, John C; Lancaster, Theresa C; Buttrick, Graham J; Sochaj, Alicja M; Messin, Liam J; Del Mar Mora-Santos, Maria; Hardwick, Kevin G; Millar, Jonathan B A

    2017-02-07

    The onset of anaphase is triggered by activation of the anaphase-promoting complex/cyclosome (APC/C) following silencing of the spindle assembly checkpoint (SAC). APC/C triggers ubiquitination of Securin and Cyclin B, which leads to loss of sister chromatid cohesion and inactivation of Cyclin B/Cdk1, respectively. This promotes relocalization of Aurora B kinase and other components of the chromosome passenger complex (CPC) from centromeres to the spindle midzone. In fission yeast, this is mediated by Clp1 phosphatase-dependent interaction of CPC with Klp9/MKLP2 (kinesin-6). When this interaction is disrupted, kinetochores bi-orient normally, but APC/C activation is delayed via a mechanism that requires Sgo2 and some (Bub1, Mph1/Mps1, and Mad3), but not all (Mad1 and Mad2), components of the SAC and the first, but not second, lysine, glutamic acid, glutamine (KEN) box in Mad3. These data indicate that interaction of CPC with Klp9 terminates a Sgo2-dependent, but Mad2-independent, APC/C-inhibitory pathway that is distinct from the canonical SAC.

  19. Modeling of Biometric Identification System Using the Colored Petri Nets

    NASA Astrophysics Data System (ADS)

    Petrosyan, G. R.; Ter-Vardanyan, L. A.; Gaboutchian, A. V.

    2015-05-01

    In this paper we present a model of biometric identification system transformed into Petri Nets. Petri Nets, as a graphical and mathematical tool, provide a uniform environment for modelling, formal analysis, and design of discrete event systems. The main objective of this paper is to introduce the fundamental concepts of Petri Nets to the researchers and practitioners, both from identification systems, who are involved in the work in the areas of modelling and analysis of biometric identification types of systems, as well as those who may potentially be involved in these areas. In addition, the paper introduces high-level Petri Nets, as Colored Petri Nets (CPN). In this paper the model of Colored Petri Net describes the identification process much simpler.

  20. 47 CFR 25.281 - Automatic Transmitter Identification System (ATIS).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... (ATIS). 25.281 Section 25.281 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.281 Automatic Transmitter Identification System (ATIS). All satellite uplink transmissions carrying broadband video information shall...

  1. 47 CFR 25.281 - Automatic Transmitter Identification System (ATIS).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... (ATIS). 25.281 Section 25.281 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.281 Automatic Transmitter Identification System (ATIS). All satellite uplink transmissions carrying broadband video information shall...

  2. 47 CFR 25.281 - Automatic Transmitter Identification System (ATIS).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... (ATIS). 25.281 Section 25.281 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.281 Automatic Transmitter Identification System (ATIS). All satellite uplink transmissions carrying broadband video information shall...

  3. High-throughput analysis of yeast replicative aging using a microfluidic system

    PubMed Central

    Jo, Myeong Chan; Liu, Wei; Gu, Liang; Dang, Weiwei; Qin, Lidong

    2015-01-01

    Saccharomyces cerevisiae has been an important model for studying the molecular mechanisms of aging in eukaryotic cells. However, the laborious and low-throughput methods of current yeast replicative lifespan assays limit their usefulness as a broad genetic screening platform for research on aging. We address this limitation by developing an efficient, high-throughput microfluidic single-cell analysis chip in combination with high-resolution time-lapse microscopy. This innovative design enables, to our knowledge for the first time, the determination of the yeast replicative lifespan in a high-throughput manner. Morphological and phenotypical changes during aging can also be monitored automatically with a much higher throughput than previous microfluidic designs. We demonstrate highly efficient trapping and retention of mother cells, determination of the replicative lifespan, and tracking of yeast cells throughout their entire lifespan. Using the high-resolution and large-scale data generated from the high-throughput yeast aging analysis (HYAA) chips, we investigated particular longevity-related changes in cell morphology and characteristics, including critical cell size, terminal morphology, and protein subcellular localization. In addition, because of the significantly improved retention rate of yeast mother cell, the HYAA-Chip was capable of demonstrating replicative lifespan extension by calorie restriction. PMID:26170317

  4. High-throughput analysis of yeast replicative aging using a microfluidic system.

    PubMed

    Jo, Myeong Chan; Liu, Wei; Gu, Liang; Dang, Weiwei; Qin, Lidong

    2015-07-28

    Saccharomyces cerevisiae has been an important model for studying the molecular mechanisms of aging in eukaryotic cells. However, the laborious and low-throughput methods of current yeast replicative lifespan assays limit their usefulness as a broad genetic screening platform for research on aging. We address this limitation by developing an efficient, high-throughput microfluidic single-cell analysis chip in combination with high-resolution time-lapse microscopy. This innovative design enables, to our knowledge for the first time, the determination of the yeast replicative lifespan in a high-throughput manner. Morphological and phenotypical changes during aging can also be monitored automatically with a much higher throughput than previous microfluidic designs. We demonstrate highly efficient trapping and retention of mother cells, determination of the replicative lifespan, and tracking of yeast cells throughout their entire lifespan. Using the high-resolution and large-scale data generated from the high-throughput yeast aging analysis (HYAA) chips, we investigated particular longevity-related changes in cell morphology and characteristics, including critical cell size, terminal morphology, and protein subcellular localization. In addition, because of the significantly improved retention rate of yeast mother cell, the HYAA-Chip was capable of demonstrating replicative lifespan extension by calorie restriction.

  5. Characterization of the nitrogen compounds released during yeast autolysis in a model wine system.

    PubMed

    Martínez-Rodríguez, A J; Polo, M C

    2000-04-01

    The nitrogen composition of wines aged with yeast for a long period of time, as in the case of sparkling wines, depends on the composition of the base wine and on the compounds released by the yeast. In this paper, the release of the different classes of nitrogen compounds during autolysis of one of the strains of yeast used in the manufacture of sparkling wines has been studied. The yeast, Saccharomyces bayanus, was suspended in a model wine buffer, pH 3.0 and 10% ethanol, and incubated at 30 degrees C. Samples of the autolysate were taken after 4, 24, 48, 72, 168, and 360 h of autolysis. An electrophoretic and chromatographic study was conducted of the proteins, peptides with molecular weights higher and lower than 700 Da, and amino acids released during the autolysis. Using SDS-PAGE, it was observed that it was predominantly polypeptides with molecular weights lower than 10 000 that were released. Through HPLC of the fraction lower than 10 000 Da, it was observed that it is polypeptides with molecular weights of between 10 000 and 700 Da that are released first and that these later break up to give rise to peptides with molecular weights lower than 700 Da, which in turn break down into amino acids. This indicates that the nature of the nitrogen compounds present in wines aged with yeast depends on the aging time, being less polymerized as the aging time increases.

  6. Development of an Automatic Identification System Autonomous Positioning System.

    PubMed

    Hu, Qing; Jiang, Yi; Zhang, Jingbo; Sun, Xiaowen; Zhang, Shufang

    2015-11-11

    In order to overcome the vulnerability of the global navigation satellite system (GNSS) and provide robust position, navigation and time (PNT) information in marine navigation, the autonomous positioning system based on ranging-mode Automatic Identification System (AIS) is presented in the paper. The principle of the AIS autonomous positioning system (AAPS) is investigated, including the position algorithm, the signal measurement technique, the geometric dilution of precision, the time synchronization technique and the additional secondary factor correction technique. In order to validate the proposed AAPS, a verification system has been established in the Xinghai sea region of Dalian (China). Static and dynamic positioning experiments are performed. The original function of the AIS in the AAPS is not influenced. The experimental results show that the positioning precision of the AAPS is better than 10 m in the area with good geometric dilution of precision (GDOP) by the additional secondary factor correction technology. This is the most economical solution for a land-based positioning system to complement the GNSS for the navigation safety of vessels sailing along coasts.

  7. Development of an Automatic Identification System Autonomous Positioning System

    PubMed Central

    Hu, Qing; Jiang, Yi; Zhang, Jingbo; Sun, Xiaowen; Zhang, Shufang

    2015-01-01

    In order to overcome the vulnerability of the global navigation satellite system (GNSS) and provide robust position, navigation and time (PNT) information in marine navigation, the autonomous positioning system based on ranging-mode Automatic Identification System (AIS) is presented in the paper. The principle of the AIS autonomous positioning system (AAPS) is investigated, including the position algorithm, the signal measurement technique, the geometric dilution of precision, the time synchronization technique and the additional secondary factor correction technique. In order to validate the proposed AAPS, a verification system has been established in the Xinghai sea region of Dalian (China). Static and dynamic positioning experiments are performed. The original function of the AIS in the AAPS is not influenced. The experimental results show that the positioning precision of the AAPS is better than 10 m in the area with good geometric dilution of precision (GDOP) by the additional secondary factor correction technology. This is the most economical solution for a land-based positioning system to complement the GNSS for the navigation safety of vessels sailing along coasts. PMID:26569258

  8. Mapping yeast transcriptional networks.

    PubMed

    Hughes, Timothy R; de Boer, Carl G

    2013-09-01

    The term "transcriptional network" refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms.

  9. Biologically-motivated system identification: application to microbial growth modeling.

    PubMed

    Yan, Jinyao; Deller, J R

    2014-01-01

    This paper presents a new method for identification of system models that are linear in parametric structure, but arbitrarily nonlinear in signal operations. The strategy blends traditional system identification methods with three modeling strategies that are not commonly employed in signal processing: linear-time-invariant-in-parameters models, set-based parameter identification, and evolutionary selection of the model structure. This paper reports recent advances in the theoretical foundation of the methods, then focuses on the operation and performance of the approach, particularly the evolutionary model determination. The method is applied to the modeling of microbial growth by Monod Kinetics.

  10. Yeast screening system for the detection of mutation, recombination, and aneuploidy

    SciTech Connect

    Dixon, M.L.

    1983-09-01

    Two strains of the yeast Saccharomyces cerevisiae were constructed to detect genetic damage. Strain XD99 can detect chromosome loss, important in the induction of teratogenesis, aneuploidy, and possibly carcinogenesis. Two positive selection techniques were developed which select for the simultaneous loss of both arms of chromosome X. Confirmation of chromosome loss using a centromere-linked marker was found to be essential for distinguishing chromosome loss from coincident crossing-over. The high selectivity of strain XD99 allowed the development of a spot test for chromosome loss. Methyl benzimidazole-2-yl-carbamate and ethyl methanesulfonate induced chromosome loss in the spot test. The two carcinogens 4-nitroquinoline-N-oxide and N-methyl-N'-nitro-N-nitrosoguanidine also induced chromosome loss. Chromosome X monosomics were found to be unstable and were restored to euploidy. This restoration of euploidy may have important implications regarding chromosome loss as a mechanism of promotion. Strain XD83 can detect multiple genetic changes: nuclear frameshift and base pair substitution mutations, nuclear mitotic crossing-over and gene conversion and mitochondrial large deletions and forward point mutations. Ethyl methanesulfonate, ICR-170, N-methyl-N'-nitro-N-nitrosoguanidine, 4-nitroquinoline-N-oxide, ultraviolet light and ethidium bromide were tested. None of the carcinogens were specific in their induced spectrum of damage. Only ethidium bromide induced a highly specific spectrum of damage: petite induction. The variety of endpoints monitored here may allow the detection of certain carcinogens and other genetically toxic agents which have escaped detection in other systems. This system may be useful in the study of possible mechanisms of carcinogenesis and aneuploidy.

  11. Research of Uncertainty Reasoning in Pineapple Disease Identification System

    NASA Astrophysics Data System (ADS)

    Liu, Liqun; Fan, Haifeng

    In order to deal with the uncertainty of evidences mostly existing in pineapple disease identification system, a reasoning model based on evidence credibility factor was established. The uncertainty reasoning method is discussed,including: uncertain representation of knowledge, uncertain representation of rules, uncertain representation of multi-evidences and update of reasoning rules. The reasoning can fully reflect the uncertainty in disease identification and reduce the influence of subjective factors on the accuracy of the system.

  12. Identification and cloning in yeast artificial chromosomes of a region of elevated loss of heterozygosity on chromosome 1p31.1 in human breast cancer

    SciTech Connect

    Hoggard, N.; Hey, Y.; Brintnell, B.; James, L.

    1995-11-20

    We have mapped a region of high loss of heterozygosity in breast cancer to a 2-cM interval between the loci D1S430 and D1S465 on chromosome 1p31.1. This region shows allelic imbalance in around 60% of breast tumors. As part of a strategy to clone the target gene(s) within this interval, we have generated a yeast artificial chromosome contig spanning over 7 Mb. YACs from the CEPH and Zeneca (formerly ICI) libraries have been obtained by screening with PCR-based STSs from the region for both previously identified loci and newly isolated STSs. The YACs have been assembled into a contig by a combination of approaches, including analysis of their STS content, generation of new STSs from the ends of key YACs, and long-range restriction mapping. These YAC clones provide the basis for complete characterization of the region of high loss in breast cancer and for the ultimate identification of the target gene(s). 84 refs., 3 figs., 3 tabs.

  13. Toxicity identification fractionation of environmental estrogens in waste water and sludge using gas and liquid chromatography coupled to mass spectrometry and recombinant yeast assay.

    PubMed

    Fernandez, Marc P; Noguerol, Tania-Noelia; Lacorte, Silvia; Buchanan, Ian; Piña, Benjamin

    2009-02-01

    We developed a toxicity identification fractionation (TIF) procedure to determine estrogenic compounds in wastewaters and sludge. The procedure consisted in fractionation of samples through a C(18) solid-phase extraction cartridge, in which Fraction I contained nonylphenol (NP) and its mono (NPEO(1)) and diethoxylate (NPEO(2)) and the markers of faecal exposure, Fraction II contained bisphenol A (BPA) and synthetic and natural hormones, and Fraction III contained the hormone conjugates. These three fractions were analyzed in parallel using gas or liquid chromatography coupled to mass spectrometry and recombinant yeast assay (RYA). Water samples collected daily throughout a whole week contained from 0.45 to 7.22 microg L(-1) of NP > NPEO(1) > NPEO(2) and were responsible for the estrogenicity of these samples. Fractions II and III were not estrogenic and that was due to the low ng L(-1) level of hormones and hormone conjugates found, respectively. The biological treatment sewage treatment plant (STP) was capable to eliminate from 52 to 100% of the compounds, with bisphenol A being the least removed. Only alkylphenols were accumulated in sludge with concentrations from 8.69 to 26.3 mg kg(-1) dw of NPEO(1) > NPEO(2) > NP. The integrated procedure herein proposed can be used as a screening method to evaluate estrogenic compounds in STPs and to survey faecal elimination.

  14. Development of a yeast two-hybrid screen for selection of human Ras-Raf protein interaction inhibitors.

    PubMed

    Khazak, Vladimir; Golemis, Erica A; Weber, Lutz

    2005-01-01

    A yeast two-hybrid screening system was developed to screen for small molecules that inhibit the interaction of the Ras and the Raf proteins. Hyperpermeable yeast strains useful for high-throughput screening (HTS) for the two-hybrid system were created. Differential inhibition of the Ras-Raf vs the hsRPB4-hsRPB7 interaction allowed the identification of selective inhibitors.

  15. Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

    PubMed

    Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

    2014-05-16

    Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

  16. Studies of the expression of human poly(ADP-ribose) polymerase-1 in Saccharomyces cerevisiae and identification of PARP-1 substrates by yeast proteome microarray screening.

    PubMed

    Tao, Zhihua; Gao, Peng; Liu, Hung-Wen

    2009-12-15

    Poly(ADP-ribosyl)ation of various nuclear proteins catalyzed by a family of NAD(+)-dependent enzymes, poly(ADP-ribose) polymerases (PARPs), is an important posttranslational modification reaction. PARP activity has been demonstrated in all types of eukaryotic cells with the exception of yeast, in which the expression of human PARP-1 was shown to lead to retarded cell growth. We investigated the yeast growth inhibition caused by human PARP-1 expression in Saccharomyces cerevisiae. Flow cytometry analysis reveals that PARP-1-expressing yeast cells accumulate in the G(2)/M stage of the cell cycle. Confocal microscopy analysis shows that human PARP-1 is distributed throughout the nucleus of yeast cells but is enriched in the nucleolus. Utilizing yeast proteome microarray screening, we identified 33 putative PARP-1 substrates, six of which are known to be involved in ribosome biogenesis. The poly(ADP-ribosyl)ation of three of these yeast proteins, together with two human homologues, was confirmed by an in vitro PARP-1 assay. Finally, a polysome profile analysis using sucrose gradient ultracentrifugation demonstrated that the ribosome levels in yeast cells expressing PARP-1 are lower than those in control yeast cells. Overall, our data suggest that human PARP-1 may affect ribosome biogenesis by modifying certain nucleolar proteins in yeast. The artificial PARP-1 pathway in yeast may be used as a simple platform to identify substrates and verify function of this important enzyme.

  17. Probing the input-output behavior of biochemical and genetic systems system identification methods from control theory.

    PubMed

    Ang, Jordan; Ingalls, Brian; McMillen, David

    2011-01-01

    A key aspect of the behavior of any system is the timescale on which it operates: when inputs change, do responses take milliseconds, seconds, minutes, hours, days, months? Does the system respond preferentially to inputs at certain timescales? These questions are well addressed by the methods of frequency response analysis. In this review, we introduce these methods and outline a procedure for applying this analysis directly to experimental data. This procedure, known as system identification, is a well-established tool in engineering systems and control theory and allows the construction of a predictive dynamic model of a biological system in the absence of any mechanistic details. When studying biochemical and genetic systems, the required experiments are not standard laboratory practice, but with advances in both our ability to measure system outputs (e.g., using fluorescent reporters) and our ability to generate precise inputs (with microfluidic chambers capable of changing cells' environments rapidly and under fine control), these frequency response methods are now experimentally practical for a wide range of biological systems, as evidenced by a number of successful recent applications of these techniques. We use a yeast G-protein signaling cascade as a running example, illustrating both theoretical concepts and practical considerations while keeping mathematical details to a minimum. The review aims to provide the reader with the tools required to design frequency response experiments for their own biological system and the background required to analyze and interpret the resulting data.

  18. Parameter identification for nonlinear aerodynamic systems

    NASA Technical Reports Server (NTRS)

    Pearson, Allan E.

    1992-01-01

    Continuing work on frequency analysis for transfer function identification is discussed. A new study was initiated into a 'weighted' least squares algorithm within the context of the Fourier modulating function approach. The first phase of applying these techniques to the F-18 flight data is nearing completion, and these results are summarized.

  19. Identification of the nonlinear vibration system of power transformers

    NASA Astrophysics Data System (ADS)

    Jing, Zheng; Hai, Huang; Pan, Jie; Yanni, Zhang

    2017-01-01

    This paper focuses on the identification of the nonlinear vibration system of power transformers. A Hammerstein model is used to identify the system with electrical inputs and the vibration of the transformer tank as the output. The nonlinear property of the system is modelled using a Fourier neural network consisting of a nonlinear element and a linear dynamic block. The order and weights of the network are determined based on the Lipschitz criterion and the back-propagation algorithm. This system identification method is tested on several power transformers. Promising results for predicting the transformer vibration and extracting system parameters are presented and discussed.

  20. Development and Validation of an In-House Database for Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry-Based Yeast Identification Using a Fast Protein Extraction Procedure

    PubMed Central

    De Carolis, Elena; Vella, Antonietta; Vaccaro, Luisa; Torelli, Riccardo; Posteraro, Patrizia; Ricciardi, Walter; Posteraro, Brunella

    2014-01-01

    In recent studies evaluating the usefulness of the matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS)-based identification of yeasts for the routine diagnosis of fungal infections, preanalytical sample processing has emerged as a critical step for reliable MALDI-TOF MS outcomes, especially when the Bruker Daltonics Biotyper software was used. In addition, inadequate results often occurred due to discrepancies between the methods used for clinical testing and database construction. Therefore, we created an in-house MALDI-TOF MS library using the spectra from 156 reference and clinical yeast isolates (48 species in 11 genera), which were generated with a fast sample preparation procedure. After a retrospective validation study, our database was evaluated on 4,232 yeasts routinely isolated during a 6-month period and fast prepared for MALDI-TOF MS analysis. Thus, 4,209 (99.5%) of the isolates were successfully identified to the species level (with scores of ≥2.0), with 1,676 (39.6%) having scores of >2.3. For the remaining 23 (0.5%) isolates, no reliable identification (with scores of <1.7) was obtained. Interestingly, these isolates were almost always from species uniquely represented or not included in the database. As the MALDI-TOF MS results were, except for 23 isolates, validated without additional phenotypic or molecular tests, our proposed strategy can enhance the rapidity and accuracy of MALDI-TOF MS in identifying medically important yeast species. However, while continuous updating of our database will be necessary to enrich it with more strains/species of new and emerging yeasts, the present in-house MALDI-TOF MS library can be made publicly available for future multicenter studies. PMID:24554755

  1. System identification of the Arabidopsis plant circadian system

    NASA Astrophysics Data System (ADS)

    Foo, Mathias; Somers, David E.; Kim, Pan-Jun

    2015-02-01

    The circadian system generates an endogenous oscillatory rhythm that governs the daily activities of organisms in nature. It offers adaptive advantages to organisms through a coordination of their biological functions with the optimal time of day. In this paper, a model of the circadian system in the plant Arabidopsis (species thaliana) is built by using system identification techniques. Prior knowledge about the physical interactions of the genes and the proteins in the plant circadian system is incorporated in the model building exercise. The model is built by using primarily experimentally-verified direct interactions between the genes and the proteins with the available data on mRNA and protein abundances from the circadian system. Our analysis reveals a great performance of the model in predicting the dynamics of the plant circadian system through the effect of diverse internal and external perturbations (gene knockouts and day-length changes). Furthermore, we found that the circadian oscillatory rhythm is robust and does not vary much with the biochemical parameters except those of a light-sensitive protein P and a transcription factor TOC1. In other words, the circadian rhythmic profile is largely a consequence of the network's architecture rather than its particular parameters. Our work suggests that the current experimental knowledge of the gene-to-protein interactions in the plant Arabidopsis, without considering any additional hypothetical interactions, seems to suffice for system-level modeling of the circadian system of this plant and to present an exemplary platform for the control of network dynamics in complex living organisms.

  2. An extranuclear expression system for analysis of cytoplasmic promoters of yeast linear killer plasmids.

    PubMed

    Schründer, J; Meinhardt, F

    1995-03-01

    Based on the cytoplasmically localized killer plasmids pGKL1 and pGKL2 of Kluyveromyces lactis two new linear hybrid plasmids were constructed which consist of pGKL1, into which in addition to the previously developed cytoplasmically expressible LEU2* selectable marker a glucose dehydrogenase-encoding bacterial gene (gdh A) has been integrated. One of the hybrid plasmids carries the bacterial gene preceded by an arbitrarily placed cytoplasmic promoter (upstream conserved sequence) in front of the coding region (pRKL121). The other plasmid was constructed in such a way that the ATG start codon of the gdh A gene was fused in frame to the ATG start codon of the killer plasmid's open reading frame 5 (pRKL122). The structures of both linear hybrid plasmids were confirmed by restriction analysis, Southern hybridization, and sequencing of the junction sites. Yeast strains carrying either of the plasmids expressed the glucose dehydrogenase gene; however, expression of the in phase fused gene was 40-fold higher compared to the arbitrarily placed cytoplasmic promoter. In general, an in phase fusion was not required for expression, but efficiency is dramatically enhanced when the 5' noncoding sequences in front of the heterologous genes are the same as those found on the native killer plasmids. The developed system can serve as a reporter for determining the efficiency of the different cytoplasmic promoters present on both linear plasmids. Hybrid plasmids were stably maintained without selective pressure in K. lactis and they were transferred and expressed also in Saccharomyces cerevisiae.

  3. A yeast model system for functional analysis of β-catenin signaling

    PubMed Central

    Lee, Margaret S.; D'Amour, Karen A.; Papkoff, Jackie

    2002-01-01

    We have developed a novel Saccharomyces cerevisiae model system to dissect the molecular events of β-catenin (β-cat) signaling. Coexpression of mammalian β-cat with TCF4 or LEF1 results in nuclear accumulation of these proteins and a functional complex that activates reporter gene transcription from constructs containing leukocyte enhancer factor (LEF)/T cell factor (TCF) response elements. Reporter transcription is constitutive, requires expression of both β-cat and TCF4 or LEF1, and is not supported by mutated LEF/TCF binding elements or by TCF4 or LEF1 mutants. A cytoplasmic domain of E-cadherin or a functional fragment of adenomatous polyposis coli (APC) protein (APC-25) complexes with β-cat, reduces β-cat binding to TCF4, and leads to increased cytoplasmic localization of β-cat and a reduction in reporter activation. Systematic mutation of putative nuclear export signal sequences in APC-25 decreases APC-25 binding to β-cat and restores reporter gene transcription. Additional β-cat signaling components, Axin and glycogen synthase kinase 3β, form a multisubunit complex similar to that found in mammalian cells. Coexpression of the F-box protein β-transducin repeat-containing protein reduces the stability of β-cat and decreases reporter activation. Thus, we have reconstituted a functional β-cat signal transduction pathway in yeast and show that β-cat signaling can be regulated at multiple levels, including protein subcellular localization, protein complex formation, and protein stability. PMID:12235124

  4. A Portable System for Nuclear, Chemical Agent and Explosives Identification

    SciTech Connect

    Parker, W.E.; Buckley, W.M.; Kreek, S.A.; Caffrey, A.J.; Mauger, G.J.; Lavietes, A.D.; Dougan, A.D.

    2000-09-29

    The FRIS/PINS hybrid integrates the LLNL-developed Field Radionuclide Identification System (FRIS) with the INEEL-developed Portable Isotopic Neutron Spectroscopy (PINS) chemical assay system to yield a combined general radioisotope, special nuclear material, and chemical weapons/explosives detection and identification system. The PINS system uses a neutron source and a high-purity germanium {gamma}-ray detector. The FRIS system uses an electrochemically cooled germanium detector and its own analysis software to detect and identify special nuclear material and other radioisotopes. The FRIS/PINS combined system also uses the electromechanically-cooled germanium detector. There is no other currently available integrated technology that can combine an active neutron interrogation and analysis capability for CWE with a passive radioisotope measurement and identification capability for special nuclear material.

  5. Input-output identification of controlled discrete manufacturing systems

    NASA Astrophysics Data System (ADS)

    Estrada-Vargas, Ana Paula; López-Mellado, Ernesto; Lesage, Jean-Jacques

    2014-03-01

    The automated construction of discrete event models from observations of external system's behaviour is addressed. This problem, often referred to as system identification, allows obtaining models of ill-known (or even unknown) systems. In this article, an identification method for discrete event systems (DESs) controlled by a programmable logic controller is presented. The method allows processing a large quantity of observed long sequences of input/output signals generated by the controller and yields an interpreted Petri net model describing the closed-loop behaviour of the automated DESs. The proposed technique allows the identification of actual complex systems because it is sufficiently efficient and well adapted to cope with both the technological characteristics of industrial controllers and data collection requirements. Based on polynomial-time algorithms, the method is implemented as an efficient software tool which constructs and draws the model automatically; an overview of this tool is given through a case study dealing with an automated manufacturing system.

  6. System identification methods for aircraft flight control development and validation

    NASA Technical Reports Server (NTRS)

    Tischler, Mark B.

    1995-01-01

    System-identification methods compose a mathematical model, or series of models, from measurements of inputs and outputs of dynamic systems. The extracted models allow the characterization of the response of the overall aircraft or component subsystem behavior, such as actuators and on-board signal processing algorithms. This paper discusses the use of frequency-domain system-identification methods for the development and integration of aircraft flight-control systems. The extraction and analysis of models of varying complexity from nonparametric frequency-responses to transfer-functions and high-order state-space representations is illustrated using the Comprehensive Identification from FrEquency Responses (CIFER) system-identification facility. Results are presented for test data of numerous flight and simulation programs at the Ames Research Center including rotorcraft, fixed-wing aircraft, advanced short takeoff and vertical landing (ASTOVL), vertical/short takeoff and landing (V/STOL), tiltrotor aircraft, and rotor experiments in the wind tunnel. Excellent system characterization and dynamic response prediction is achieved for this wide class of systems. Examples illustrate the role of system-identification technology in providing an integrated flow of dynamic response data around the entire life-cycle of aircraft development from initial specifications, through simulation and bench testing, and into flight-test optimization.

  7. A portable air jet actuator device for mechanical system identification

    NASA Astrophysics Data System (ADS)

    Belden, Jesse; Staats, Wayne L.; Mazumdar, Anirban; Hunter, Ian W.

    2011-03-01

    System identification of limb mechanics can help diagnose ailments and can aid in the optimization of robotic limb control parameters and designs. An interesting fluid phenomenon—the Coandă effect—is utilized in a portable actuator to provide a stochastic binary force disturbance to a limb system. The design of the actuator is approached with the goal of creating a portable device which could be deployed on human or robotic limbs for in situ mechanical system identification. The viability of the device is demonstrated by identifying the parameters of an underdamped elastic beam system with fixed inertia and stiffness and variable damping. The nonparametric compliance impulse response yielded from the system identification is modeled as a second-order system and the resultant parameters are found to be in excellent agreement with those found using more traditional system identification techniques. The current design could be further miniaturized and developed as a portable, wireless, unrestrained mechanical system identification instrument for less intrusive and more widespread use.

  8. A portable air jet actuator device for mechanical system identification.

    PubMed

    Belden, Jesse; Staats, Wayne L; Mazumdar, Anirban; Hunter, Ian W

    2011-03-01

    System identification of limb mechanics can help diagnose ailments and can aid in the optimization of robotic limb control parameters and designs. An interesting fluid phenomenon--the Coandă effect--is utilized in a portable actuator to provide a stochastic binary force disturbance to a limb system. The design of the actuator is approached with the goal of creating a portable device which could be deployed on human or robotic limbs for in situ mechanical system identification. The viability of the device is demonstrated by identifying the parameters of an underdamped elastic beam system with fixed inertia and stiffness and variable damping. The nonparametric compliance impulse response yielded from the system identification is modeled as a second-order system and the resultant parameters are found to be in excellent agreement with those found using more traditional system identification techniques. The current design could be further miniaturized and developed as a portable, wireless, unrestrained mechanical system identification instrument for less intrusive and more widespread use.

  9. Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System

    PubMed Central

    Verghese, Jacob; Abrams, Jennifer; Wang, Yanyu

    2012-01-01

    Summary: The eukaryotic heat shock response is an ancient and highly conserved transcriptional program that results in the immediate synthesis of a battery of cytoprotective genes in the presence of thermal and other environmental stresses. Many of these genes encode molecular chaperones, powerful protein remodelers with the capacity to shield, fold, or unfold substrates in a context-dependent manner. The budding yeast Saccharomyces cerevisiae continues to be an invaluable model for driving the discovery of regulatory features of this fundamental stress response. In addition, budding yeast has been an outstanding model system to elucidate the cell biology of protein chaperones and their organization into functional networks. In this review, we evaluate our understanding of the multifaceted response to heat shock. In addition, the chaperone complement of the cytosol is compared to those of mitochondria and the endoplasmic reticulum, organelles with their own unique protein homeostasis milieus. Finally, we examine recent advances in the understanding of the roles of protein chaperones and the heat shock response in pathogenic fungi, which is being accelerated by the wealth of information gained for budding yeast. PMID:22688810

  10. Molecular cloning of amphioxus uncoupling protein and assessment of its uncoupling activity using a yeast heterologous expression system

    SciTech Connect

    Chen, Kun; Sun, Guoxun; Lv, Zhiyuan; Wang, Chen; Jiang, Xueyuan; Li, Donghai; Zhang, Chenyu

    2010-10-01

    Research highlights: {yields} Invertebrates, for example amphioxus, do express uncoupling proteins. {yields} Both the sequence and the uncoupling activity of amphioxus UCP resemble UCP2. {yields} UCP1 is the only UCP that can form dimer on yeast mitochondria. -- Abstract: The present study describes the molecular cloning of a novel cDNA fragment from amphioxus (Branchiostoma belcheri) encoding a 343-amino acid protein that is highly homologous to human uncoupling proteins (UCP), this protein is therefore named amphioxus UCP. This amphioxus UCP shares more homology with and is phylogenetically more related to mammalian UCP2 as compared with UCP1. To further assess the functional similarity of amphioxus UCP to mammalian UCP1 and -2, the amphioxus UCP, rat UCP1, and human UCP2 were separately expressed in Saccharomyces cerevisiae, and the recombinant yeast mitochondria were isolated and assayed for the state 4 respiration rate and proton leak, using pYES2 empty vector as the control. UCP1 increased the state 4 respiration rate by 2.8-fold, and the uncoupling activity was strongly inhibited by GDP, while UCP2 and amphioxus UCP only increased the state 4 respiration rate by 1.5-fold and 1.7-fold in a GDP-insensitive manner, moreover, the proton leak kinetics of amphioxus UCP was very similar to UCP2, but much different from UCP1. In conclusion, the amphioxus UCP has a mild, unregulated uncoupling activity in the yeast system, which resembles mammalian UCP2, but not UCP1.

  11. 78 FR 6732 - Changes to Standard Numbering System, Vessel Identification System, and Boating Accident Report...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-31

    ... SECURITY Coast Guard 33 CFR Parts 173, 174, 181, and 187 RIN 1625-AB45 Changes to Standard Numbering System, Vessel Identification System, and Boating Accident Report Database AGENCY: Coast Guard, DHS. ACTION: Rule... Numbering System, Vessel Identification System, and Boating Accident Report Database rule became...

  12. Influence of the farming system and vine variety on yeast communities associated with grape berries.

    PubMed

    Cordero-Bueso, Gustavo; Arroyo, Teresa; Serrano, Ana; Tello, Javier; Aporta, Irene; Vélez, María Dolores; Valero, Eva

    2011-01-31

    Wine production in most countries is based on the use of commercial strains leading to the colonisation of the wineries by these strains with the consequent reduction of autochthonous biodiversity. This implies that wine styles could therefore become standardised. The vineyard could be an important source of native yeasts of oenological interest. For this reason the objective of this study was to compare two agronomic conditions with the aim of preserving yeast biodiversity in the vineyard. A three year sampling plan was designed to evaluate the influence of different agronomic parameters on the biodiversity of fermentative grape yeasts. Thus two vineyards, one organic and one conventional, with three different grape varieties (Shiraz, Grenache and Barbera) were chosen. In total, 27 samples were collected from both vineyards. Of these, 1080 colonies were isolated and a total of 9 species were identified. The strains identified as Saccharomyces cerevisiae were genotyped by microsatellite analysis obtaining nine different electrophoretic patterns. Classical ecology indexes were used to obtain the richness (S), the biodiversity (H') and the dominance (D) of the species studied. The results indicated a clear influence on grape associated yeast diversity of the phytosanitary treatment used in the vineyard. This is the first time that classical ecology indexes have been used to study the ecology of the spontaneous fermentation of grape musts and the species Candida sorbosa and Pichia toletana have been described in vineyards of the Madrid winegrowing region.

  13. A modular and hybrid connectionist system for speaker identification.

    PubMed

    Bennani, Y

    1995-07-01

    This paper presents and evaluates a modular/hybrid connectionist system for speaker identification. Modularity has emerged as a powerful technique for reducing the complexity of connectionist systems, and allowing a priori knowledge to be incorporated into their design. Text-independent speaker identification is an inherently complex task where the amount of training data is often limited. It thus provides an ideal domain to test the validity of the modular/hybrid connectionist approach. To achieve such identification, we develop, in this paper, an architecture based upon the cooperation of several connectionist modules, and a Hidden Markov Model module. When tested on a population of 102 speakers extracted from the DARPA-TIMIT database, perfect identification was obtained.

  14. MAC, A System for Automatically IPR Identification, Collection and Distribution

    NASA Astrophysics Data System (ADS)

    Serrão, Carlos

    Controlling Intellectual Property Rights (IPR) in the Digital World is a very hard challenge. The facility to create multiple bit-by-bit identical copies from original IPR works creates the opportunities for digital piracy. One of the most affected industries by this fact is the Music Industry. The Music Industry has supported huge losses during the last few years due to this fact. Moreover, this fact is also affecting the way that music rights collecting and distributing societies are operating to assure a correct music IPR identification, collection and distribution. In this article a system for automating this IPR identification, collection and distribution is presented and described. This system makes usage of advanced automatic audio identification system based on audio fingerprinting technology. This paper will present the details of the system and present a use-case scenario where this system is being used.

  15. Identification of a 14-3-3 protein from Lentinus edodes that interacts with CAP (adenylyl cyclase-associated protein), and conservation of this interaction in fission yeast.

    PubMed

    Zhou, G L; Yamamoto, T; Ozoe, F; Yano, D; Tanaka, K; Matsuda, H; Kawamukai, M

    2000-01-01

    We previously identified a gene encoding a CAP (adenylyl cyclase-associated protein) homologue from the edible Basidiomycete Lentinus edodes. To further discover the cellular functions of the CAP protein, we searched for CAP-interacting proteins using a yeast two-hybrid system. Among the candidates thus obtained, many clones encoded the C-terminal half of an L. edodes 14-3-3 homologue (designated cip3). Southern blot analysis indicated that L. edodes contains only one 14-3-3 gene. Overexpression of the L. edodes 14-3-3 protein in the fission yeast Schizosaccharomyces pombe rad24 null cells complemented the loss of endogenous 14-3-3 protein functions in cell morphology and UV sensitivity, suggesting functional conservation of 14-3-3 proteins between L. edodes and S. pombe. The interaction between L. edodes CAP and 14-3-3 protein was restricted to the N-terminal domain of CAP and was confirmed by in vitro co-precipitation. Results from both the two-hybrid system and in vivo co-precipitation experiments showed the conservation of this interaction in S. pombe. The observation that a 14-3-3 protein interacts with the N-terminal portion of CAP but not with full-length CAP in L. edodes and S. pombe suggests that the C-terminal region of CAP may have a negative effect on the interaction between CAP and 14-3-3 proteins, and 14-3-3 proteins may play a role in regulation of CAP function.

  16. Evaluation of risk factors in patients with vulvovaginal candidiasis and the value of chromID Candida agar versus CHROMagar Candida for recovery and presumptive identification of vaginal yeast species.

    PubMed

    Guzel, Ahmet Bariş; Ilkit, Macit; Akar, Tuba; Burgut, Refik; Demir, S Cansun

    2011-01-01

    Vulvovaginal candidiasis (VVC), particularly the recurrent form, remains an intractable problem for clinicians, microbiologists, and patients. It is essential to confirm the clinical diagnosis by mycological methods and avoid empirical therapy. The recovery of yeast in fungal culture, such as on Sabouraud dextrose agar, remains the gold standard for diagnosis. In this investigation, we examined 474 participants, including 122 (25.7%) with acute VVC cases, 249 (52.5%) who had recurrent VVC (RVVC) cases, and 103 (21.7%) healthy controls. We also administered a questionnaire to obtain information on patient lifestyle and medical, gynecological, and sexual history. In addition, we compared the performance of chromID Candida agar (CAN2) to CHROMagar Candida (CAC) and Sabouraud dextrose agar with gentamicin and chloramphenicol (SGC2). The yeasts were identified by conventional methods including the germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX system. We detected yeasts in 60 of 122 (49.2%) patients with acute VVC cases, 110 of 249 (44.2%) with RVVC cases, and in 35 of 103 (34%) healthy controls (P = 0.07). A total of 205 samples were found to be positive for fungi (43.2%), of which 176 (85.9%) were monofungal, and 29 (14.1%) were polyfungal. In addition, 198 of these samples (96.6%) were positive on CAN2, 195 (95.1%) on CAC, 189 (92.2%) on SGC2, and 183 (89.3%) samples on all three (P = 0.17). The 234 yeast isolates recovered were C. albicans (n = 118), C. glabrata (n = 82), C. kefyr (n = 11), C. krusei (n = 9), C. lipolytica (n = 3), C. colliculosa (n = 2), C. parapsilosis (n = 2), C. pelliculosa (n = 2), C. tropicalis (n = 2), and other species of Candida (n = 3). Of the 29 polyfungal populations, 28 (96.6%) were detected in CAN2, 25 in (86.2%) CAC, and 25 (86.2%) on both (P = 0.35). Notably, we detected the high predominance of C. albicans+C. glabrata (86.2%) in polyfungal populations. Briefly, the detection of C

  17. Evaluation of the Biolog automated microbial identification system

    NASA Technical Reports Server (NTRS)

    Klingler, J. M.; Stowe, R. P.; Obenhuber, D. C.; Groves, T. O.; Mishra, S. K.; Pierson, D. L.

    1992-01-01

    Biolog's identification system was used to identify 39 American Type Culture Collection reference taxa and 45 gram-negative isolates from water samples. Of the reference strains, 98% were identified to genus level and 76% to species level within 4 to 24 h. Identification of some authentic strains of Enterobacter, Klebsiella, and Serratia was unreliable. A total of 93% of the water isolates were identified.

  18. Some new results on system identification with dynamic neural networks.

    PubMed

    Yu, W; Li, X

    2001-01-01

    Nonlinear system online identification via dynamic neural networks is studied in this paper. The main contribution of the paper is that the passivity approach is applied to access several new stable properties of neuro identification. The conditions for passivity, stability, asymptotic stability, and input-to-state stability are established in certain senses. We conclude that the gradient descent algorithm for weight adjustment is stable in an L(infinity) sense and robust to any bounded uncertainties.

  19. Identification, Characterization, and Evaluation Criteria for Systems Engineering Agile Enablers

    DTIC Science & Technology

    2015-01-16

    monitoring communications in social media groups and websites (such as LinkedIn or Facebook groups associated with the Scaled Agile Framework, Lean... Identification , Characterization, and Evaluation Criteria for Systems Engineering Agile Enablers Technical Report SERC-2015-TR-049-1...currently valid OMB control number 1. REPORT DATE 16 JAN 2015 2. REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE Identification

  20. Redefinition of the yeast two-hybrid system in dialogue with changing priorities in biological research.

    PubMed

    Serebriiskii, I G; Khazak, V; Golemis, E A

    2001-03-01

    Examination of the pattern of reagent creation and application in the two-hybrid system since 1989 reveals the expansion of a simple core technology to address increasingly sophisticated problems in protein interaction. As the technology has matured, its clear suitability for large-scale proteomic projects has made a major focus of its application the generation of global organismal protein interaction networks. In an inversion of emphasis, the increasing availability of such information now provides a master plan with the potential to specify the most promising directions for biological investigations (i.e., by directing the physiological validation of predicted critical protein-protein interactions). Recent derivatives of the two-hybrid system enable the targeting of such key interactions by facilitating the identification of essential amino acids conferring protein interaction specificity and of small molecules that selectively disrupt defined interaction pairs. Finally, the creation of mammalian expression systems based on two-hybrid principles became a new tool to create and probe novel biological systems. Taken in sum, this trajectory emphasizes the point that the creation of tools and the evolution of the idea of what is an interesting biological problem are in intimate dialogue.

  1. Counting Yeast.

    ERIC Educational Resources Information Center

    Bealer, Jonathan; Welton, Briana

    1998-01-01

    Describes changes to a traditional study of population in yeast colonies. Changes to the procedures include: (1) only one culture per student team; (2) cultures are inoculated only once; and (3) the same tube is sampled daily. (DDR)

  2. Bright fluorescence monitoring system utilizing Zoanthus sp. green fluorescent protein (ZsGreen) for human G-protein-coupled receptor signaling in microbial yeast cells.

    PubMed

    Nakamura, Yasuyuki; Ishii, Jun; Kondo, Akihiko

    2013-01-01

    G-protein-coupled receptors (GPCRs) are currently the most important pharmaceutical targets for drug discovery because they regulate a wide variety of physiological processes. Consequently, simple and convenient detection systems for ligands that regulate the function of GPCR have attracted attention as powerful tools for new drug development. We previously developed a yeast-based fluorescence reporter ligand detection system using flow cytometry. However, using this conventional detection system, fluorescence from a cell expressing GFP and responding to a ligand is weak, making detection of these cells by fluorescence microscopy difficult. We here report improvements to the conventional yeast fluorescence reporter assay system resulting in the development of a new highly-sensitive fluorescence reporter assay system with extremely bright fluorescence and high signal-to-noise (S/N) ratio. This new system allowed the easy detection of GPCR signaling in yeast using fluorescence microscopy. Somatostatin receptor and neurotensin receptor (implicated in Alzheimer's disease and Parkinson's disease, respectively) were chosen as human GPCR(s). The facile detection of binding to these receptors by cognate peptide ligands was demonstrated. In addition, we established a highly sensitive ligand detection system using yeast cell surface display technology that is applicable to peptide screening, and demonstrate that the display of various peptide analogs of neurotensin can activate signaling through the neurotensin receptor in yeast cells. Our system could be useful for identifying lead peptides with agonistic activity towards targeted human GPCR(s).

  3. Nitrile Metabolizing Yeasts

    NASA Astrophysics Data System (ADS)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  4. Screening of randomly mutagenized glucagon-like peptide-1 library by using an integrated yeast-mammalian assay system.

    PubMed

    Shigemori, Tomohiro; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2015-09-10

    Glucagon-like peptide-1 (GLP1) is a 30-amino acid peptide hormone activating the GLP1 receptor (GLP1R), a class B G-protein coupled receptor (GPCR), and is considered to be effective for treating diabetes and other metabolic diseases. Phage display is the first innovative technology in order to prepare and screen a large polypeptide library including GLP1R agonists, but this methodology is not as effective in discovering functional peptides such as activators for GPCRs. Here, we report a novel functional screening system for GPCR-acting peptides, which integrates a yeast peptide secretion system into a biological detection system with GPCR-producing mammalian cells. Using this screening system, we found attractive GLP1R agonists with several substitutions from a random mutant GLP1 library which was secreted by yeast, Saccharomyces cerevisiae. This system established here not only enables peptides to be analyzed in the soluble form but also needs no chemical synthesis, purification, and condensation of peptides of interests, and therefore, can be widely applied to the discovery of novel bioactive peptides acting on GPCRs.

  5. Nonlinear system identification and control based on modular neural networks.

    PubMed

    Puscasu, Gheorghe; Codres, Bogdan

    2011-08-01

    A new approach for nonlinear system identification and control based on modular neural networks (MNN) is proposed in this paper. The computational complexity of neural identification can be greatly reduced if the whole system is decomposed into several subsystems. This is obtained using a partitioning algorithm. Each local nonlinear model is associated with a nonlinear controller. These are also implemented by neural networks. The switching between the neural controllers is done by a dynamical switcher, also implemented by neural networks, that tracks the different operating points. The proposed multiple modelling and control strategy has been successfully tested on simulated laboratory scale liquid-level system.

  6. Digital system identification and its application to digital flight control

    NASA Technical Reports Server (NTRS)

    Kotob, S.; Kaufman, H.

    1974-01-01

    On-line system identification of linear discrete systems for implementation in a digital adaptive flight controller is considered by the conventional extended Kalman filter and a decoupling process in which the linear state estimation problem and the linear parameter identification problem are each treated separately and alternately. Input requirements for parameter identifiability are established using the standard conditions of observability for a time variant system. Experimental results for simulated linearized lateral aircraft motion are included along with the effect of different initialization and updating procedures for the priming trajectory used by the filter.

  7. Identification of the sulphate ion as one of the key components of yeast spoilage of a sports drink through genome-wide expression analysis.

    PubMed

    Jayakody, Lahiru N; Tsuge, Keisuke; Suzuki, Akihiro; Shimoi, Hitoshi; Kitagaki, Hiroshi

    2013-01-01

    Because of the growing market for sports drinks, prevention of yeast contamination of these beverages is of significant concern. This research was performed to achieve insight into the physiology of yeast growing in sports drinks through a genome-wide approach to prevent microbial spoilage of sports drinks. The genome-wide gene expression profile of Saccharomyces cerevisiae growing in the representative sports drink was investigated. Genes that were relevant to sulphate ion starvation response were upregulated in the yeast cells growing in the drink. These results suggest that yeast cells are suffering from deficiency of extracellular sulphate ions during growth in the sports drink. Indeed, the concentration of sulphate ions was far lower in the sports drink than in a medium that allows the optimal growth of yeast. To prove the starvation of sulphate ions of yeast, several ions were added to the beverage and its effects were investigated. The addition of sulphate ions, but not chloride ions or sodium ions, to the beverage stimulated yeast growth in the beverage in a dose-dependent manner. Moreover, the addition of sulphate ions to the sports drink increased the biosynthesis of sulphur-containing amino acids in yeast cells and hydrogen sulphide in the beverage. These results indicate that sulphate ion concentration should be regulated to prevent microbial spoilage of sports drinks.

  8. Associations of UBE2I with RAD52, UBL1, p53, and RAD51 proteins in a yeast two-hybrid system

    SciTech Connect

    Shen, Zhiyuan; Pardington-Purtymun, P.E.; Comeaux, J.C.

    1996-10-15

    The yeast RAD52-dependent pathway is involved in DNA recombination and double-strand break repair. Yeast ubiquitin-conjugating enzyme UBC9 participates in S- and M-phase cyclin degradation and mitotic control. Using the human RAD52 protein as the bait in a yeast two-hybrid system, we have identified a human homolog of yeast UBC9, designated UBE2I, that interacts with RAD52, RAD51, p53, and a ubiquitin-like protein UBL1. These interactions are UBE2I-specific, since another DNA repair-related ubiquitin-conjugating enzyme, RAD6 (UBC2), does not interact with these proteins. The interaction of UBE2I with RAD52 is mediated by RAD52`s self-association region. These results suggest that the RAD52-dependent processes, cell cycle control, p53-mediated pathway(s), and ubiquitination interact through human UBE2I. 22 refs., 3 figs.

  9. Isolation and Identification of Pathogenic Filamentous Fungi and Yeasts From Adult House Fly (Diptera: Muscidae) Captured From the Hospital Environments in Ahvaz City, Southwestern Iran.

    PubMed

    Kassiri, Hamid; Zarrin, Majid; Veys-Behbahani, Rahele; Faramarzi, Sama; Kasiri, Ali

    2015-11-01

    Musca domestica L., 1758 is capable of transferring a number of pathogenic viruses, bacteria, fungi, and parasites to animals and humans. The objective of this study was to isolate and identify medically important filamentous fungi and yeasts from adult M. domestica collected from two wards of three hospital environments in Ahvaz city, Khuzestan Province, southwestern Iran. The common house flies were caught by a sterile net. These insects were washed in a solution of 1% sodium hypochlorite for 3 min and twice in sterile distilled water for 1 min. The flies were individually crushed with sterile swabs in sterile test tubes. Then 2 ml of sterile normal saline (0.85%) was added to each tube, and the tube was centrifuged for 5 min. The supernatant was then discarded, and the remaining sediment was inoculated with a sterile swab in the Sabouraud's dextrose agar medium containing chloramphenicol. Isolation and identification of fungi were made by standard mycological methods. In this research, totally 190 M. domestica from hospital environments were captured. In total, 28 fungal species were isolated. The main fungi isolated were Aspergillus spp. (67.4%), Penicillium sp. (11.6%), Mucorales sp. (11%), Candida spp. (10.5%), and Rhodotorula sp. (8.4%). Among the house flies caught at the hospitals, about 80% were found to carry one or more medically important species of fungi. This study has established that common house flies carry pathogenic fungi in the hospital environments of Ahvaz. The control of M. domestica in hospitals is essential in order to control the nosocomial fungal infections in patients.

  10. Identification of Infinite Dimensional Systems via Adaptive Wavelet Neural Networks

    DTIC Science & Technology

    1993-01-01

    We consider identification of distributed systems via adaptive wavelet neural networks (AWNNs). We take advantage of the multiresolution property of...wavelet systems and the computational structure of neural networks to approximate the unknown plant successively. A systematic approach is developed

  11. Decentralized System Identification Using Stochastic Subspace Identification for Wireless Sensor Networks

    PubMed Central

    Cho, Soojin; Park, Jong-Woong; Sim, Sung-Han

    2015-01-01

    Wireless sensor networks (WSNs) facilitate a new paradigm to structural identification and monitoring for civil infrastructure. Conventional structural monitoring systems based on wired sensors and centralized data acquisition systems are costly for installation as well as maintenance. WSNs have emerged as a technology that can overcome such difficulties, making deployment of a dense array of sensors on large civil structures both feasible and economical. However, as opposed to wired sensor networks in which centralized data acquisition and processing is common practice, WSNs require decentralized computing algorithms to reduce data transmission due to the limitation associated with wireless communication. In this paper, the stochastic subspace identification (SSI) technique is selected for system identification, and SSI-based decentralized system identification (SDSI) is proposed to be implemented in a WSN composed of Imote2 wireless sensors that measure acceleration. The SDSI is tightly scheduled in the hierarchical WSN, and its performance is experimentally verified in a laboratory test using a 5-story shear building model. PMID:25856325

  12. Yeast Mitochondria as a Model System to Study the Biogenesis of Bacterial β-Barrel Proteins.

    PubMed

    Ulrich, Thomas; Oberhettinger, Philipp; Autenrieth, Ingo B; Rapaport, Doron

    2015-01-01

    Beta-barrel proteins are found in the outer membrane of Gram-negative bacteria, mitochondria, and chloroplasts. The evolutionary conservation in the biogenesis of these proteins allows mitochondria to assemble bacterial β-barrel proteins in their functional form. In this chapter, we describe exemplarily how the capacity of yeast mitochondria to process the trimeric autotransporter YadA can be used to study the role of bacterial periplasmic chaperones in this process.

  13. Intensified fractionation of brewery yeast waste for the recovery of invertase using aqueous two-phase systems.

    PubMed

    De León-González, Grecia; González-Valdez, José; Mayolo-Deloisa, Karla; Rito-Palomares, Marco

    2016-11-01

    The potential recovery of high-value products from brewery yeast waste confers value to this industrial residue. Aqueous two-phase systems (ATPS) have demonstrated to be an attractive alternative for the primary recovery of biological products and are therefore suitable for the recovery of invertase from this residue. Sixteen different polyethylene glycol (PEG)-potassium phosphate ATPS were tested to evaluate the effects of PEG molecular weight (MW) and tie-line length (TLL) upon the partition behavior of invertase. Concentrations of crude extract from brewery yeast waste were then varied in the systems that presented the best behaviors to intensify the potential recovery of the enzyme. Results show that the use of a PEG MW 400 g mol(-1) system with a TLL of 45.0% (w/w) resulted in an invertase bottom phase recovery with a purification factor of 29.5 and a recovery yield of up to 66.2% after scaling the system to a total weight of 15.0 g. This represents 15.1 mg of invertase per mL of processed bottom phase. With these results, a single-stage ATPS process for the recovery of invertase is proposed.

  14. Use of one- and two-mediator systems for developing a BOD biosensor based on the yeast Debaryomyces hansenii.

    PubMed

    Zaitseva, A S; Arlyapov, V A; Yudina, N Yu; Alferov, S V; Reshetilov, A N

    2017-03-01

    We investigated the use of one- and two-mediator systems in amperometric BOD biosensors (BOD, biochemical oxygen demand) based on the yeast Debaryomyces hansenii. Screening of nine mediators potentially capable of electron transfer - ferrocene, 1,1'-dimethylferrocene, ferrocenecarboxaldehyde, ferroceneacetonitrile, neutral red, 2,6-dichlorophenolindophenol, thionine, methylene blue and potassium ferricyanide - showed only ferrocene and neutral red to be efficient electron carriers for the eukaryotes studied. Two-mediator systems based on combinations of the investigated compounds were used to increase the efficiency of electron transfer. The developed two-mediator biosensors exceeded their one-mediator analogs by their characteristics. The most preferable two-mediator system for developing a BOD biosensor was a ferrocene-methylene blue combination that ensured a satisfactory long-time stability (43 days), selectivity, sensitivity (the lower limit of the determined BOD5 concentrations, 2.5mg О2/dm(3)) and speed (assay time for one sample, not greater than 10min) of BOD determination. Analysis of water samples showed that the use of a ferrocene-methylene blue two-mediator system and the yeast D. hansenii enabled registration of data that highly correlated with the results of the standard method (R=0.9913).

  15. Evaluation of the New Micronaut-Candida System Compared to the API ID32C Method for Yeast Identification▿

    PubMed Central

    Szabó, Z.; Tóth, B.; Kovács, M.; Kardos, G.; Maráz, A.; Rozgonyi, F.; Majoros, L.

    2008-01-01

    A new system, Micronaut-Candida, was compared to API ID32C to identify 264 yeast (Candida albicans, C. parapsilosis, C. tropicalis, C. krusei, C. inconspicua, C. norvegensis, C. lusitaniae, C. guilliermondii, C. dubliniensis, C. pulcherrima, C. famata, C. rugosa, C. glabrata, C. kefyr, C. lipolytica, C. catenulata, C. neoformans, Geotrichum and Trichosporon species, Rhodotorula glutinis, and Saccharomyces cerevisiae) clinical isolates. Results were in concordance in 244 cases. Eighteen out of the 20 of discordant results were correctly identified by Micronaut-Candida but not by API ID32C, as confirmed by PCR ribotyping. PMID:18322057

  16. Identification of open quantum systems from observable time traces

    DOE PAGES

    Zhang, Jun; Sarovar, Mohan

    2015-05-27

    Estimating the parameters that dictate the dynamics of a quantum system is an important task for quantum information processing and quantum metrology, as well as fundamental physics. In our paper we develop a method for parameter estimation for Markovian open quantum systems using a temporal record of measurements on the system. Furthermore, the method is based on system realization theory and is a generalization of our previous work on identification of Hamiltonian parameters.

  17. Numerical studies of identification in nonlinear distributed parameter systems

    NASA Technical Reports Server (NTRS)

    Banks, H. T.; Lo, C. K.; Reich, Simeon; Rosen, I. G.

    1989-01-01

    An abstract approximation framework and convergence theory for the identification of first and second order nonlinear distributed parameter systems developed previously by the authors and reported on in detail elsewhere are summarized and discussed. The theory is based upon results for systems whose dynamics can be described by monotone operators in Hilbert space and an abstract approximation theorem for the resulting nonlinear evolution system. The application of the theory together with numerical evidence demonstrating the feasibility of the general approach are discussed in the context of the identification of a first order quasi-linear parabolic model for one dimensional heat conduction/mass transport and the identification of a nonlinear dissipation mechanism (i.e., damping) in a second order one dimensional wave equation. Computational and implementational considerations, in particular, with regard to supercomputing, are addressed.

  18. Yeast and Mammals Utilize Similar Cytosolic Components to Drive Protein Transport through the Golgi Complex

    NASA Astrophysics Data System (ADS)

    Dunphy, William G.; Pfeffer, Suzanne R.; Clary, Douglas O.; Wattenberg, Binks W.; Glick, Benjamin S.; Rothman, James E.

    1986-03-01

    Vesicular transport between successive compartments of the mammalian Golgi apparatus has recently been reconstituted in a cell-free system. In addition to ATP, transport requires both membrane-bound and cytosolic proteins. Here we report that the cytosol fraction from yeast will efficiently substitute for mammalian cytosol. Mammalian cytosol contains several distinct transport factors, which we have distinguished on the basis of gel filtration and ion-exchange chromatography. Yeast cytosol appears to contain the same collection of transport factors. Resolved cytosol factors from yeast and mammals complement each other in a synergistic manner. These findings suggest that the molecular mechanisms of intracellular protein transport have been conserved throughout evolution. Moreover, this hybrid cell-free system will enable the application of yeast genetics to the identification and isolation of cytosolic proteins that sustain intracellular protein transport.

  19. Modeling emotional content of music using system identification.

    PubMed

    Korhonen, Mark D; Clausi, David A; Jernigan, M Ed

    2006-06-01

    Research was conducted to develop a methodology to model the emotional content of music as a function of time and musical features. Emotion is quantified using the dimensions valence and arousal, and system-identification techniques are used to create the models. Results demonstrate that system identification provides a means to generalize the emotional content for a genre of music. The average R2 statistic of a valid linear model structure is 21.9% for valence and 78.4% for arousal. The proposed method of constructing models of emotional content generalizes previous time-series models and removes ambiguity from classifiers of emotion.

  20. System identification based approach to dynamic weighing revisited

    NASA Astrophysics Data System (ADS)

    Niedźwiecki, Maciej; Meller, Michał; Pietrzak, Przemysław

    2016-12-01

    Dynamic weighing, i.e., weighing of objects in motion, without stopping them on the weighing platform, allows one to increase the rate of operation of automatic weighing systems, used in industrial production processes, without compromising their accuracy. Since the classical identification-based approach to dynamic weighing, based on the second-order mass-spring-damper model of the weighing system, does not yield satisfactory results when applied to conveyor belt type checkweighers, several extensions of this technique are examined. Experiments confirm that when appropriately modified the identification-based approach becomes a reliable tool for dynamic mass measurement in checkweighers.

  1. Tris-sucrose buffer system: a new specially designed medium for extracellular invertase production by immobilized cells of isolated yeast Cryptococcus laurentii MT-61.

    PubMed

    Aydogan, Mehmet Nuri; Taskin, Mesut; Canli, Ozden; Arslan, Nazli Pinar; Ortucu, Serkan

    2014-01-01

    The aims of the present study were to isolate new yeasts with high extracellular (exo) invertase activity and to investigate the usability of buffer systems as invertase production media by immobilized yeast cells. Among 70 yeast isolates, Cryptococcus laurentii MT-61 had the highest exo-invertase activity. Immobilization of yeast cells was performed using sodium alginate. Higher exo-invertase activity for immobilized cells was achieved in tris-sucrose buffer system (TSBS) compared to sodium acetate buffer system and potassium phosphate buffer system. TSBS was prepared by dissolving 30 g of sucrose in 1 L of tris buffer solution. The optimum pH, temperature, and incubation time for invertase production with immobilized cells were determined as 8.0, 35 °C and 36 h in TSBS, respectively. Under optimized conditions, maximum exo-invertase activity was found to be 28.4 U/mL in sterile and nonsterile TSBS. Immobilized cells could be reused in 14 and 12 successive cycles in sterile and nonsterile TSBS without any loss in the maximum invertase activity, respectively. This is the first report which showed that immobilized microbial cells could be used as a biocatalyst for exo-invertase production in buffer system. As an additional contribution, a new yeast strain with high invertase activity was isolated.

  2. Modeling and Identification of a Large Gap Magnetic Suspension System

    NASA Technical Reports Server (NTRS)

    Cox, David E. (Editor); Groom, Nelson J. (Editor); Hsiao, Min-Hung; Huang, Jen-Kuang

    1996-01-01

    This paper presents the results of modeling and system identification efforts on the NASA Large-Angle Magnetic Suspension Test Fixture (LAMSTF). The LAMSTF consists of a cylindrical permanent magnet which is levitated above a planar array of five electromagnets mounted in a circular configuration. The analytical model is first developed and open-loop characteristics are described. The system is shown to be highly unstable and requires feedback control in order to apply system identification. Limitations on modeling accuracy due to the effect of eddy-currents on the system are discussed. An algorithm is derived to identify a state-space model for the system from input/output data acquired during closed-loop operation. The algorithm is tested on both the baseline system and a perturbed system which has an increased presence of eddy currents. It is found that for the baseline system the analytic model adequately captures the dynamics, although the identified model improves the simulation accuracy. For the system perturbed by additional unmodeled eddy-currents the analytic model is no longer adequate and a higher-order model, determined through system identification, is required to accurately predict the system's time response.

  3. Control and Identification of Time Varying Systems.

    DTIC Science & Technology

    1986-10-03

    distributed delay systems described by 0 0 i(t) = d o(O)x ( +O) + fJd P(c)u (t +’t) (5) where a(-) and P() are matrix valued functions of bounded ... variation and the integrals are of the Stieltjes type. This includes multiple point delayed systems akin to the system (1) as special cases. Some results

  4. Immune System Toxicity and Immunotoxicity Hazard Identification

    EPA Science Inventory

    Exposure to chemicals may alter immune system health, increasing the risk of infections, allergy and autoimmune diseases. The chapter provides a concise overview of the immune system, host factors that affect immune system heal, and the effects that xenobiotic exposure may have ...

  5. Effects of aging and heat treatment on whole yeast cells and yeast cell walls and on adsorption of ochratoxin A in a wine model system.

    PubMed

    Nunez, Y P; Pueyo, E; Carrascosa, A V; Martínez-Rodríguez, A J

    2008-07-01

    A wine model was evaluated to determine the influence of aging on the ability of whole yeast cells (WY) and yeast cell walls (YCW) to remove ochratoxin A (OTA). Aging and autolysis were monitored for 214 h in the model wine. The original concentration of OTA in the model wine was 10 microg/liter, and WY and YCW were added at a final concentration of 1 g/liter. YCW mannoproteins were involved in the removal of OTA from the model wine through adsorption mechanisms. Aging affected the capacity of WY to remove OTA, but YCW removal capacity remained constant during aging. A previous heat treatment (85 degrees C for 10 min) of WY and YCW increased their removal capacity and increased the efficiency of the decontamination process.

  6. Music Identification System Using MPEG-7 Audio Signature Descriptors

    PubMed Central

    You, Shingchern D.; Chen, Wei-Hwa; Chen, Woei-Kae

    2013-01-01

    This paper describes a multiresolution system based on MPEG-7 audio signature descriptors for music identification. Such an identification system may be used to detect illegally copied music circulated over the Internet. In the proposed system, low-resolution descriptors are used to search likely candidates, and then full-resolution descriptors are used to identify the unknown (query) audio. With this arrangement, the proposed system achieves both high speed and high accuracy. To deal with the problem that a piece of query audio may not be inside the system's database, we suggest two different methods to find the decision threshold. Simulation results show that the proposed method II can achieve an accuracy of 99.4% for query inputs both inside and outside the database. Overall, it is highly possible to use the proposed system for copyright control. PMID:23533359

  7. Identification of determinism in noisy neuronal systems.

    PubMed

    Slutzky, Marc W; Cvitanovic, Predrag; Mogul, David J

    2002-08-30

    Most neuronal ensembles are nonlinear excitable systems. Thus it is becoming common to apply principles derived from nonlinear dynamics to characterize neuronal systems. One important characterization is whether such systems contain deterministic behavior or are purely stochastic. Unfortunately, many methods used to make this distinction do not perform well when both determinism and high-amplitude noise are present which is often the case in physiological systems. Therefore, we propose two novel techniques for identifying determinism in experimental systems. The first, called short-time expansion analysis, examines the expansion rate of small groups of points in state space. The second, called state point forcing, derives from the technique of chaos control. The system state is forced onto a fixed point, and the subsequent behavior is analyzed. This technique can be used to verify the presence of fixed points (or unstable periodic orbits) and to assess stationarity. If these are present, it implies that the system contains determinism. We demonstrate the use and possible limitations of these two techniques in two systems: the Hénon map, a classic example of a chaotic system, and spontaneous epileptiform bursting in the rat hippocampal slice. Identifying the presence of determinism in a physiological system assists in the understanding of the system's dynamics and provides a mechanism for manipulating this behavior.

  8. Yeast two-hybrid screen.

    PubMed

    Makuch, Lauren

    2014-01-01

    Yeast two-hybrid is a method for screening large numbers of gene products (encoded by cDNA libraries) for their ability to interact with a protein of interest. This system can also be used for characterizing and manipulating candidate protein: protein interactions. Interactions between proteins are monitored by the growth of yeast plated on selective media.

  9. Vaginal Yeast Infections

    MedlinePlus

    ... Surgery? A Week of Healthy Breakfasts Shyness Vaginal Yeast Infections KidsHealth > For Teens > Vaginal Yeast Infections Print ... side effect of taking antibiotics. What Is a Yeast Infection? A yeast infection is a common infection ...

  10. Experimental on-line identification of an electromechanical system.

    PubMed

    Eker, Ilyas

    2004-01-01

    Identification of electromechanical systems operating in open-loop or closed-loop conditions has long been of prime interest in industrial applications. This paper presents experimental on-line identification of an electromechanical system represented by a digital input/output model. The paper also bridges the theory and practice gap for applied researchers. Studies are carried out by formulating the mathematical model using differential equations and experimental discrete-time identification using on-line plant input-output data. A recursive least-squares method is used to estimate the unknown parameters of the system. Discrete-time data for the parameter identification are obtained experimentally from a setup constructed in the laboratory. A root-mean-square error criterion is used for model validation. Results are presented which show variations in parameters of the electromechanical system. It is demonstrated that identified model output and actual system output match. All tests are performed with no previous results from finite element simulations.

  11. Modeling, Identification, and Control Design for a Flexible Pointing System with Embedded Smart Materials.

    DTIC Science & Technology

    2007-11-02

    The research effort emphasized system identification , decentralized control design, and their applications to smart structures and flexible pointing...systems. The research effort had both theoretical and experimental ingredients. On the theoretical side, new system identification techniques for

  12. Chaotic control and synchronization for system identification.

    PubMed

    Carroll, T L

    2004-04-01

    Research into applications of synchronized chaotic systems assumes that it will be necessary to build many different drive-response pairs, but little is known in general about designing higher dimensional chaotic flows. In this paper, I do not add any design techniques, but I show that it is possible to create multiple drive-response pairs from one chaotic system by applying chaos control techniques to the drive and response systems. If one can design one chaotic system with the desired properties, then many drive-response pairs can be built from this system, so that it is not necessary to solve the design problem more than once. I show both numerical simulations and experimental work with chaotic circuits. I also test the response systems for ability to overcome noise or other interference.

  13. Continuous immobilized yeast reactor system for complete beer fermentation using spent grains and corncobs as carrier materials.

    PubMed

    Brányik, Tomás; Silva, Daniel P; Vicente, António A; Lehnert, Radek; e Silva, João B Almeida; Dostálek, Pavel; Teixeira, José A

    2006-12-01

    Despite extensive research carried out in the last few decades, continuous beer fermentation has not yet managed to outperform the traditional batch technology. An industrial breakthrough in favour of continuous brewing using immobilized yeast could be expected only on achievement of the following process characteristics: simple design, low investment costs, flexible operation, effective process control and good product quality. The application of cheap carrier materials of by-product origin could significantly lower the investment costs of continuous fermentation systems. This work deals with a complete continuous beer fermentation system consisting of a main fermentation reactor (gas-lift) and a maturation reactor (packed-bed) containing yeast immobilized on spent grains and corncobs, respectively. The suitability of cheap carrier materials for long-term continuous brewing was proved. It was found that by fine tuning of process parameters (residence time, aeration) it was possible to adjust the flavour profile of the final product. Consumers considered the continuously fermented beer to be of a regular quality. Analytical and sensorial profiles of both continuously and batch fermented beers were compared.

  14. Agroforestry Systems In Poland A Preliminary Identification

    NASA Astrophysics Data System (ADS)

    Borek, Robert

    2015-01-01

    This paper seeks to use state-of-the-art knowledge to depict the foundations and prospects for agroforestry systems in Poland to develop, in line with political, legal, historical and environmental conditions pertaining in the country. The main legal provisions concerning the presence of trees in agriculture are presented prior to a first-ever defining of key traditional agroforestry systems in Poland.

  15. On neural networks in identification and control of dynamic systems

    NASA Technical Reports Server (NTRS)

    Phan, Minh; Juang, Jer-Nan; Hyland, David C.

    1993-01-01

    This paper presents a discussion of the applicability of neural networks in the identification and control of dynamic systems. Emphasis is placed on the understanding of how the neural networks handle linear systems and how the new approach is related to conventional system identification and control methods. Extensions of the approach to nonlinear systems are then made. The paper explains the fundamental concepts of neural networks in their simplest terms. Among the topics discussed are feed forward and recurrent networks in relation to the standard state-space and observer models, linear and nonlinear auto-regressive models, linear, predictors, one-step ahead control, and model reference adaptive control for linear and nonlinear systems. Numerical examples are presented to illustrate the application of these important concepts.

  16. 40 CFR 72.33 - Identification of dispatch system.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... (CONTINUED) PERMITS REGULATION Acid Rain Permit Applications § 72.33 Identification of dispatch system. (a... approval of the petition, all provisions of the Acid Rain Program applicable to an affected source or an... provision of the Acid Rain Program and shall not change the liability of the owners and operators of...

  17. 40 CFR 72.33 - Identification of dispatch system.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... (CONTINUED) PERMITS REGULATION Acid Rain Permit Applications § 72.33 Identification of dispatch system. (a... approval of the petition, all provisions of the Acid Rain Program applicable to an affected source or an... provision of the Acid Rain Program and shall not change the liability of the owners and operators of...

  18. 40 CFR 72.33 - Identification of dispatch system.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... (CONTINUED) PERMITS REGULATION Acid Rain Permit Applications § 72.33 Identification of dispatch system. (a... approval of the petition, all provisions of the Acid Rain Program applicable to an affected source or an... provision of the Acid Rain Program and shall not change the liability of the owners and operators of...

  19. 40 CFR 72.33 - Identification of dispatch system.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... (CONTINUED) PERMITS REGULATION Acid Rain Permit Applications § 72.33 Identification of dispatch system. (a... approval of the petition, all provisions of the Acid Rain Program applicable to an affected source or an... provision of the Acid Rain Program and shall not change the liability of the owners and operators of...

  20. 40 CFR 72.33 - Identification of dispatch system.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... (CONTINUED) PERMITS REGULATION Acid Rain Permit Applications § 72.33 Identification of dispatch system. (a... approval of the petition, all provisions of the Acid Rain Program applicable to an affected source or an... provision of the Acid Rain Program and shall not change the liability of the owners and operators of...

  1. 47 CFR 25.281 - Automatic Transmitter Identification System (ATIS).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.281 Automatic Transmitter Identification System (ATIS). All satellite uplink transmissions carrying broadband video information shall be... integrated into the uplink transmitter chain in a method that cannot easily be defeated. (c) The ATIS...

  2. Training Sessions Provide Working Knowledge of National Animal Identification System

    ERIC Educational Resources Information Center

    Glaze, J. Benton, Jr.; Ahola, Jason K.

    2010-01-01

    One in-service and two train-the-trainer workshops were conducted by University of Idaho Extension faculty, Idaho State Department of Agriculture personnel, and allied industry representatives to increase Extension educators' knowledge and awareness of the National Animal Identification System (NAIS) and related topics. Training sessions included…

  3. Screening of hepatocyte proteins binding with C-terminally truncated surface antigen middle protein of hepatitis B virus (MHBst167) by a yeast two-hybrid system

    PubMed Central

    LI, ZHI QUN; LINGHU, ENQIANG; JUN, WAN; CHENG, JUN

    2014-01-01

    The function of middle hepatitis B surface protein C-terminally truncated at amino acid position 167 (MHBst167) is not currently clear. This study aimed to screen and identify the proteins that interact with MHBst167 in hepatocytes using a yeast two-hybrid system, and to explore the effects of MHBst167 in the development of hepatocellular carcinoma and precancerous diseases of the liver. The MHBst167 gene was amplified by polymerase chain reaction (PCR) and cloned into a pGEM-T vector. The target region was sequenced and the constructed bait plasmid, pGBKT7-MHBst167, was transformed into AH109 yeast cells. The transformed AH109 cells were then mated with Y187 yeast cells containing the fetal liver cDNA library plasmid using a yeast two-hybrid system. The false positives were eliminated and the true positive clones were selected by PCR and sequencing analysis. The pGBKT7-MHBst167 bait plasmid was successfully constructed and 66 clones grew in the selective synthetic defined media lacking leucine, tryptophan, histidine and adenine. Fifty-two clones were identified following X-α-Gal selection and segregation analysis. Seven proteins were found to be expressed that could interact with MHBst167 in hepatocytes by the yeast two-hybrid system. These results have provided novel insights into the biological functions of MHBst167. PMID:24968805

  4. VopE, a Vibrio cholerae Type III Effector, Attenuates the Activation of CWI-MAPK Pathway in Yeast Model System

    PubMed Central

    Bankapalli, Leela K.; Mishra, Rahul C.; Raychaudhuri, Saumya

    2017-01-01

    VopE, a mitochondrial targeting T3SS effector protein of Vibrio cholerae, perturbs innate immunity by modulating mitochondrial dynamics. In the current study, ectopic expression of VopE was found to be toxic in a yeast model system and toxicity was further aggravated in the presence of various stressors. Interestingly, a VopE variant lacking predicted mitochondrial targeting sequence (MTS) also exhibited partial lethality in the yeast system. With the aid of yeast genetic tools and different stressors, we have demonstrated that VopE and its derivative VopEΔMTS modulate cell wall integrity (CWI-MAPK) signaling pathway and have identified several critical residues contributing to the lethality of VopE. Furthermore, co-expression of two effectors VopEΔMTS and VopX, interfering with the CWI-MAPK cellular pathway can partially suppress the VopX mediated yeast growth inhibition. Taken together, these results suggest that VopE alters signaling through the CWI-MAPK pathway, and demonstrates the usefulness of yeast model system to gain additional insights on the functionality of VopE. PMID:28373966

  5. Early identification systems for emerging foodborne hazards.

    PubMed

    Marvin, H J P; Kleter, G A; Prandini, A; Dekkers, S; Bolton, D J

    2009-05-01

    This paper provides a non-exhausting overview of early warning systems for emerging foodborne hazards that are operating in the various places in the world. Special attention is given to endpoint-focussed early warning systems (i.e. ECDC, ISIS and GPHIN) and hazard-focussed early warning systems (i.e. FVO, RASFF and OIE) and their merit to successfully identify a food safety problem in an early stage is discussed. Besides these early warning systems which are based on monitoring of either disease symptoms or hazards, also early warning systems and/or activities that intend to predict the occurrence of a food safety hazard in its very beginning of development or before that are described. Examples are trend analysis, horizon scanning, early warning systems for mycotoxins in maize and/or wheat and information exchange networks (e.g. OIE and GIEWS). Furthermore, recent initiatives that aim to develop predictive early warning systems based on the holistic principle are discussed. The assumption of the researchers applying this principle is that developments outside the food production chain that are either directly or indirectly related to the development of a particular food safety hazard may also provide valuable information to predict the development of this hazard.

  6. Intelligent dental identification system (IDIS) in forensic medicine.

    PubMed

    Chomdej, T; Pankaow, W; Choychumroon, S

    2006-04-20

    This study reports the design and development of the intelligent dental identification system (IDIS), including its efficiency and reliability. Five hundred patients were randomly selected from the Dental Department at Police General Hospital in Thailand to create a population of 3000 known subjects. From the original 500 patients, 100 were randomly selected to create a sample of 1000 unidentifiable subjects (400 subjects with completeness and possible alterations of dental information corresponding to natural occurrences and general dental treatments after the last clinical examination, such as missing teeth, dental caries, dental restorations, and dental prosthetics, 100 subjects with completeness and no alteration of dental information, 500 subjects with incompleteness and no alteration of dental information). Attempts were made to identify the unknown subjects utilizing IDIS. The use of IDIS advanced method resulted in consistent outstanding identification in the range of 82.61-100% with minimal error 0-1.19%. The results of this study indicate that IDIS can be used to support dental identification. It supports not only all types of dentitions: primary, mixed, and permanent but also for incomplete and altered dental information. IDIS is particularly useful in providing the huge quantity and redundancy of related documentation associated with forensic odontology. As a computerized system, IDIS can reduce the time required for identification and store dental digital images with many processing features. Furthermore, IDIS establishes enhancements of documental dental record with odontogram and identification codes, electrical dental record with dental database system, and identification methods and algorithms. IDIS was conceptualized based on the guidelines and standards of the American Board of Forensic Odontology (ABFO) and International Criminal Police Organization (INTERPOL).

  7. Yeast: A Research Organism for Teaching Genetics.

    ERIC Educational Resources Information Center

    Manney, Thomas R.; Manney, Monta L.

    1992-01-01

    Explains why laboratory strains of bakers yeast, Saccharomyces cerevisiae, are particularly suited for classroom science activities. Describes the sexual life cycle of yeast and the genetic system with visible mutations. Presents an overview of activities that can be done with yeast and gives a source for teachers to obtain more information. (PR)

  8. Bionic models for identification of biological systems

    NASA Astrophysics Data System (ADS)

    Gerget, O. M.

    2017-01-01

    This article proposes a clinical decision support system that processes biomedical data. For this purpose a bionic model has been designed based on neural networks, genetic algorithms and immune systems. The developed system has been tested on data from pregnant women. The paper focuses on the approach to enable selection of control actions that can minimize the risk of adverse outcome. The control actions (hyperparameters of a new type) are further used as an additional input signal. Its values are defined by a hyperparameter optimization method. A software developed with Python is briefly described.

  9. Real-time Algorithms for Sparse Neuronal System Identification.

    PubMed

    Sheikhattar, Alireza; Babadi, Behtash

    2016-08-01

    We consider the problem of sparse adaptive neuronal system identification, where the goal is to estimate the sparse time-varying neuronal model parameters in an online fashion from neural spiking observations. We develop two adaptive filters based on greedy estimation techniques and regularized log-likelihood maximization. We apply the proposed algorithms to simulated spiking data as well as experimentally recorded data from the ferret's primary auditory cortex during performance of auditory tasks. Our results reveal significant performance gains achieved by the proposed algorithms in terms of sparse identification and trackability, compared to existing algorithms.

  10. Biometric identification systems: the science of transaction facilitation

    NASA Astrophysics Data System (ADS)

    Rogers, Robert R.

    1994-10-01

    The future ofthe "secure transaction" and the success ofall undertakings that depend on absolute certainty that the individuals involved really are who and what they represent themselves to be is dependent upon the successful development of absolutely accurate, low-cost and easy-to-operate Biometric Identification Systems. Whether these transactions are political, military, financial or administrative (e.g. health cards, drivers licenses, welfare entitlement, national identification cards, credit card transactions, etc.), the need for such secure and positive identification has never been greater -and yet we are only at the beginning ofan era in which we will see the emergence and proliferation of Biometric Identification Systems in nearly every field ofhuman endeavor. Proper application ofthese systems will change the way the world operates, and that is precisely the goal ofComparator Systems Corporation. Just as with the photo-copier 40 years ago and the personal computer 20 years ago, the potential applications for positive personal identification are going to make the Biometric Identification System a commonplace component in the standard practice ofbusiness, and in interhuman relationships ofall kinds. The development of new and specific application hardware, as well as the necessary algorithms and related software required for integration into existing operating procedures and newly developed systems alike, has been a more-than-a-decade-long process at Comparator -and we are now on the verge of delivering these systems to the world markets so urgently in need of them. An individual could feel extremely confident and satisfied ifhe could present his credit, debit, or ATM card at any point of sale and, after inserting his card, could simply place his finger on a glass panel and in less than a second be positively accepted as being the person that the card purported him to be; not to mention the security and satisfaction of the vendor involved in knowing that

  11. System identification requirements for high-bandwidth rotorcraft flight control system design

    NASA Technical Reports Server (NTRS)

    Tischler, Mark B.

    1990-01-01

    The application of system identification methods to high-bandwidth rotorcraft flight control system design is examined. Flight test and modeling requirements are illustrated using flight test data from a BO-105 hingeless rotor helicopter. The proposed approach involves the identification of nonparametric frequency-response models followed by parametric (transfer funtion and state space) model identification. Results for the BO-105 show the need for including coupled body/rotor flapping and lead-lag dynamics in the identification model structure to allow the accurate prediction of control system bandwidth limitations. Lower-order models are useful for estimating nominal control system performance only when the flight data used for the identification are band-limited to be consistent with the frequency range of applicability of the model. The flight test results presented in this paper are consistent with theoretical studies by previous researchers.

  12. Nonlinear system identification with applications to space weather prediction

    NASA Astrophysics Data System (ADS)

    Palanthandalam-Madapusi, Harish J.

    2007-02-01

    System identification is the process of constructing empirical mathematical models of dynamcal systems using measured data. Since data represents a key link between mathematical principles and physical processes, system identification is an important research area that can benefit all disciplines. In this dissertation, we develop identification methods for Hammerstein-Wiener models, which are model structures based on the interconnection of linear dynamics and static nonlinearities. These identification methods identify models in state-space form and use known basis functions to represent the unknown nonlinear maps. Next, we use these methods to identify periodically- switching Hammerstein-Wiener models for predicting magnetic-field fluctuation on the surface of the Earth, 30 to 90 minutes into the future. These magnetic- field fluctuations caused by the solar wind (ejections of charged plasma from the surface of the Sun) can damage critical systems aboard satellites and drive currents in power grids that can overwhelm and damage transformers. By predicting magnetic-field fluctuations on the Earth, we obtain advance warning of future disturbances. Furthermore, to predict solar wind conditions 27 days in advance, we use solar wind measurements and image measurements to construct nonlinear time-series models. We propose a class of radial basis functions to represent the nonlinear maps, which have fewer parameters that need to be tuned by the user. Additionally, we develop an identification algorithm that simultaneously identifies the state space matrices of an unknown model and reconstructs the unknown input, using output measurements and known inputs. For this purpose, we formulate the concept of input and state observability, that is, conditions under which both the unknown input and initial state of a known model can be determined from output measurements. We provide necessary and sufficient conditions for input and state observability in discrete-time systems.

  13. Performance metrics for the evaluation of hyperspectral chemical identification systems

    NASA Astrophysics Data System (ADS)

    Truslow, Eric; Golowich, Steven; Manolakis, Dimitris; Ingle, Vinay

    2016-02-01

    Remote sensing of chemical vapor plumes is a difficult but important task for many military and civilian applications. Hyperspectral sensors operating in the long-wave infrared regime have well-demonstrated detection capabilities. However, the identification of a plume's chemical constituents, based on a chemical library, is a multiple hypothesis testing problem which standard detection metrics do not fully describe. We propose using an additional performance metric for identification based on the so-called Dice index. Our approach partitions and weights a confusion matrix to develop both the standard detection metrics and identification metric. Using the proposed metrics, we demonstrate that the intuitive system design of a detector bank followed by an identifier is indeed justified when incorporating performance information beyond the standard detection metrics.

  14. Glucose-dependent cell size is regulated by a G protein-coupled receptor system in yeast Saccharomyces cerevisiae.

    PubMed

    Tamaki, Hisanori; Yun, Cheol-Won; Mizutani, Tomohiro; Tsuzuki, Takahiro; Takagi, Yukinobu; Shinozaki, Makiko; Kodama, Yukiko; Shirahige, Katsuhiko; Kumagai, Hidehiko

    2005-03-01

    In the yeast, Saccharomyces cerevisiae, cell size is affected by the kind of carbon source in the medium. Here, we present evidence that the Gpr1 receptor and Gpa2 Galpha subunit are required for both maintenance and modulation of cell size in response to glucose. In the presence of glucose, mutants lacking GPR1 or GPA2 gene showed smaller cells than the wild-type strain. Physiological studies revealed that protein synthesis rate was reduced in the mutant strains indicating that reduced growth rate, while the level of mRNAs for CLN1, 2 and 3 was not affected in all strains. Gene chip analysis also revealed a down-regulation in the expression of genes related to biosynthesis of not only protein but also other cellular component in the mutant strains. We also show that GPR1 and GPA2 are required for a rapid increase in cell size in response to glucose. Wild-type cells grown in ethanol quickly increased in size by addition of glucose, while little change was observed in the mutant strains, in which glucose-dependent cell cycle arrest caused by CLN1 repression was somewhat alleviated. Our study indicates that the yeast G-protein coupled receptor system consisting of Gpr1 and Gpa2 regulates cell size by affecting both growth rate and cell division.

  15. Aromatic amino acid biosynthesis in the yeast Saccharomyces cerevisiae: a model system for the regulation of a eukaryotic biosynthetic pathway.

    PubMed Central

    Braus, G H

    1991-01-01

    This review focuses on the gene-enzyme relationships and the regulation of different levels of the aromatic amino acid biosynthetic pathway in a simple eukaryotic system, the unicellular yeast Saccharomyces cerevisiae. Most reactions of this branched pathway are common to all organisms which are able to synthesize tryptophan, phenylalanine, and tyrosine. The current knowledge about the two main control mechanisms of the yeast aromatic amino acid biosynthesis is reviewed. (i) At the transcriptional level, most structural genes are regulated by the transcriptional activator GCN4, the regulator of the general amino acid control network, which couples transcriptional derepression to amino acid starvation of numerous structural genes in multiple amino acid biosynthetic pathways. (ii) At the enzyme level, the carbon flow is controlled mainly by modulating the enzyme activities at the first step of the pathway and at the branch points by feedback action of the three aromatic amino acid end products. Implications of these findings for the relationship of S. cerevisiae to prokaryotic as well as to higher eukaryotic organisms and for general regulatory mechanisms occurring in a living cell such as initiation of transcription, enzyme regulation, and the regulation of a metabolic branch point are discussed. PMID:1943992

  16. Effects of distillation system and yeast strain on the aroma profile of Albariño (Vitis vinifera L.) grape pomace spirits.

    PubMed

    Arrieta-Garay, Y; Blanco, P; López-Vázquez, C; Rodríguez-Bencomo, J J; Pérez-Correa, J R; López, F; Orriols, I

    2014-10-29

    Orujo is a traditional alcoholic beverage produced in Galicia (northwest Spain) from distillation of grape pomace, a byproduct of the winemaking industry. In this study, the effect of the distillation system (copper charentais alembic versus packed column) and the yeast strain (native yeast L1 versus commercial yeast L2) on the chemical and sensory characteristics of orujo obtained from Albariño (Vitis vinifera L.) grape pomace has been analyzed. Principal component analysis, with two components explaining 74% of the variance, is able to clearly differentiate the distillates according to distillation system and yeast strain. Principal component 1, mainly defined by C6-C12 esters, isoamyl octanoate, and methanol, differentiates L1 from L2 distillates. In turn, principal component 2, mainly defined by linear alcohols, linalool, and 1-hexenol, differentiates alembic from packed column distillates. In addition, an aroma descriptive test reveals that the distillate obtained with a packed column from a pomace fermented with L1 presented the highest positive general impression, which is associated with the highest fruity and smallest solvent aroma scores. Moreover, chemical analysis shows that use of a packed column increases average ethanol recovery by 12%, increases the concentration of C6-C12 esters by 25%, and reduces the concentration of higher alcohols by 21%. In turn, L2 yeast obtained lower scores in the alembic distillates aroma profile. In addition, with L1, 9% higher ethanol yields were achieved, and L2 distillates contained 34%-40% more methanol than L1 distillates.

  17. Digital Control and Identification of Distributed Systems.

    DTIC Science & Technology

    1990-08-14

    for example, problems in which a Schrodinger equation is coupled with a diffusion equation . In this paper, we are particularly interested in second...control of systems represented by partial differential equations , and adaptive control and tracking problems for flexible structures and manipulators...and functional differential equations . The primary class of applications is large flexible space structures. Papers dealing mainly with approximation

  18. Parametric Identification of Nonlinear Dynamical Systems

    NASA Technical Reports Server (NTRS)

    Feeny, Brian

    2002-01-01

    In this project, we looked at the application of harmonic balancing as a tool for identifying parameters (HBID) in a nonlinear dynamical systems with chaotic responses. The main idea is to balance the harmonics of periodic orbits extracted from measurements of each coordinate during a chaotic response. The periodic orbits are taken to be approximate solutions to the differential equations that model the system, the form of the differential equations being known, but with unknown parameters to be identified. Below we summarize the main points addressed in this work. The details of the work are attached as drafts of papers, and a thesis, in the appendix. Our study involved the following three parts: (1) Application of the harmonic balance to a simulation case in which the differential equation model has known form for its nonlinear terms, in contrast to a differential equation model which has either power series or interpolating functions to represent the nonlinear terms. We chose a pendulum, which has sinusoidal nonlinearities; (2) Application of the harmonic balance to an experimental system with known nonlinear forms. We chose a double pendulum, for which chaotic response were easily generated. Thus we confronted a two-degree-of-freedom system, which brought forth challenging issues; (3) A study of alternative reconstruction methods. The reconstruction of the phase space is necessary for the extraction of periodic orbits from the chaotic responses, which is needed in this work. Also, characterization of a nonlinear system is done in the reconstructed phase space. Such characterizations are needed to compare models with experiments. Finally, some nonlinear prediction methods can be applied in the reconstructed phase space. We developed two reconstruction methods that may be considered if the common method (method of delays) is not applicable.

  19. Identification of protein interaction antagonists using the repressed transactivator two-hybrid system.

    PubMed

    Joshi, Phalgun B; Hirst, Martin; Malcolm, Tom; Parent, Jennifer; Mitchell, David; Lund, Karen; Sadowski, Ivan

    2007-05-01

    The repressed transactivator (RTA) yeast two-hybrid system was developed to enable genetic identification of interactions with transcriptional activator proteins. We have devised modifications of this system that enable its use in screening for inhibitors of protein interactions from small molecule compound libraries. We show that inhibition of protein interactions can be measured by monitoring growth in selective medium containing 3-aminotriazole (3-AT) and using this assay have identified inhibitors of four independent protein interactions in screens with a 23,000 small molecule compound library. Compounds found to inhibit one of the tested interactions between FKBP12 and the transforming growth factor beta receptor (TGFbeta-R) were validated in vivo and found to inhibit calcineurin-dependent signaling in T cells. One of these compounds was also found to cause elevated basal expression of a TGFbeta-R/SMAD-dependent reporter gene. These results demonstrate the capability of the RTA small molecule screening assay for discovery of potentially novel therapeutic compounds.

  20. Spacecraft structural system identification by modal test

    NASA Technical Reports Server (NTRS)

    Chen, J.-C.; Peretti, L. F.; Garba, J. A.

    1984-01-01

    A structural parameter estimation procedure using the measured natural frequencies and kinetic energy distribution as observers is proposed. The theoretical derivation of the estimation procedure is described and its constraints and limitations are explained. This procedure is applied to a large complex spacecraft structural system to identify the inertia matrix using modal test results. The inertia matrix is chosen after the stiffness matrix has been updated by the static test results.