Sample records for yeast one-hybrid screen

  1. Potential Direct Regulators of the Drosophila yellow Gene Identified by Yeast One-Hybrid and RNAi Screens

    PubMed Central

    Kalay, Gizem; Lusk, Richard; Dome, Mackenzie; Hens, Korneel; Deplancke, Bart; Wittkopp, Patricia J.

    2016-01-01

    The regulation of gene expression controls development, and changes in this regulation often contribute to phenotypic evolution. Drosophila pigmentation is a model system for studying evolutionary changes in gene regulation, with differences in expression of pigmentation genes such as yellow that correlate with divergent pigment patterns among species shown to be caused by changes in cis- and trans-regulation. Currently, much more is known about the cis-regulatory component of divergent yellow expression than the trans-regulatory component, in part because very few trans-acting regulators of yellow expression have been identified. This study aims to improve our understanding of the trans-acting control of yellow expression by combining yeast-one-hybrid and RNAi screens for transcription factors binding to yellow cis-regulatory sequences and affecting abdominal pigmentation in adults, respectively. Of the 670 transcription factors included in the yeast-one-hybrid screen, 45 showed evidence of binding to one or more sequence fragments tested from the 5′ intergenic and intronic yellow sequences from D. melanogaster, D. pseudoobscura, and D. willistoni, suggesting that they might be direct regulators of yellow expression. Of the 670 transcription factors included in the yeast-one-hybrid screen, plus another TF previously shown to be genetically upstream of yellow, 125 were also tested using RNAi, and 32 showed altered abdominal pigmentation. Nine transcription factors were identified in both screens, including four nuclear receptors related to ecdysone signaling (Hr78, Hr38, Hr46, and Eip78C). This finding suggests that yellow expression might be directly controlled by nuclear receptors influenced by ecdysone during early pupal development when adult pigmentation is forming. PMID:27527791

  2. Yeast Two-Hybrid and One-Hybrid Screenings Identify Regulators of hsp70 Gene Expression.

    PubMed

    Saito, Youhei; Nakagawa, Takanobu; Kakihana, Ayana; Nakamura, Yoshia; Nabika, Tomomi; Kasai, Michihiro; Takamori, Mai; Yamagishi, Nobuyuki; Kuga, Takahisa; Hatayama, Takumi; Nakayama, Yuji

    2016-09-01

    The mammalian stress protein Hsp105β, which is specifically expressed during mild heat shock and localizes to the nucleus, induces the major stress protein Hsp70. In the present study, we performed yeast two-hybrid and one-hybrid screenings to identify the regulators of Hsp105β-mediated hsp70 gene expression. Six and two proteins were detected as Hsp105β- and hsp70 promoter-binding proteins, respectively. A luciferase reporter gene assay revealed that hsp70 promoter activation is enhanced by the transcriptional co-activator AF9 and splicing mediator SNRPE, but suppressed by the coiled-coil domain-containing protein CCDC127. Of these proteins, the knockdown of SNRPE suppressed the expression of Hsp70 irrespective of the presence of Hsp105β, indicating that SNRPE essentially functions as a transcriptional activator of hsp70 gene expression. The overexpression of HSP70 in tumor cells has been associated with cell survival and drug resistance. We here identified novel regulators of Hsp70 expression in stress signaling and also provided important insights into Hsp70-targeted anti-cancer therapy. J. Cell. Biochem. 117: 2109-2117, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Yeast One-Hybrid Gγ Recruitment System for Identification of Protein Lipidation Motifs

    PubMed Central

    Fukuda, Nobuo; Doi, Motomichi; Honda, Shinya

    2013-01-01

    Fatty acids and isoprenoids can be covalently attached to a variety of proteins. These lipid modifications regulate protein structure, localization and function. Here, we describe a yeast one-hybrid approach based on the Gγ recruitment system that is useful for identifying sequence motifs those influence lipid modification to recruit proteins to the plasma membrane. Our approach facilitates the isolation of yeast cells expressing lipid-modified proteins via a simple and easy growth selection assay utilizing G-protein signaling that induces diploid formation. In the current study, we selected the N-terminal sequence of Gα subunits as a model case to investigate dual lipid modification, i.e., myristoylation and palmitoylation, a modification that is widely conserved from yeast to higher eukaryotes. Our results suggest that both lipid modifications are required for restoration of G-protein signaling. Although we could not differentiate between myristoylation and palmitoylation, N-terminal position 7 and 8 play some critical role. Moreover, we tested the preference for specific amino-acid residues at position 7 and 8 using library-based screening. This new approach will be useful to explore protein-lipid associations and to determine the corresponding sequence motifs. PMID:23922919

  4. Identification of novel transcriptional regulators of Zat12 using comprehensive yeast one-hybrid screens.

    PubMed

    Ben Daniel, Bat-Hen; Cattan, Esther; Wachtel, Chaim; Avrahami, Dorit; Glick, Yair; Malichy, Asaf; Gerber, Doron; Miller, Gad

    2016-08-01

    To appropriately acclimate to environmental stresses, plants have to rapidly activate a specific transcriptional program. Yet, the identity and function of many of the transcriptional regulators that mediate early responses to abiotic stress stimuli is still unknown. In this work we employed the promoter of the multi-stress-responsive zinc-finger protein Zat12 in yeast one-hybrid (Y1H) screens to identify early abiotic stress-responsive transcriptional regulators. Analysis of Zat12 promoter fragments fused to luciferase underlined an approximately 200 bp fragment responsive to NaCl and to reactive oxygen species (ROS). Using these segments and others as baits against Y1H control or stress Arabidopsis prey libraries, we identified 15 potential Zat12 transcriptional regulators. Among the prominent proteins identified were known transcription factors including bZIP29 and ANAC91 as well as unknown function proteins such as a homolog of the human USB1, a U6 small nuclear RNA (snRNA) processing protein, and dormancy/auxin-associated family protein 2 (DRM2). Altered expression of Zat12 during high light stress in the knockout mutants further indicated the involvement of these proteins in the regulation of Zat12. Using a state of the art microfluidic approach we showed that AtUSB1 and DRM2 can specifically bind dsDNA and were able to identify the preferred DNA-binding motif of all four proteins. Overall, the proteins identified in this work provide an important start point for charting the earliest signaling network of Zat12 and of other genes required for acclimation to abiotic stresses. © 2016 Scandinavian Plant Physiology Society.

  5. Novel brewing yeast hybrids: creation and application.

    PubMed

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2017-01-01

    The natural interspecies Saccharomyces cerevisiae × Saccharomyces eubayanus hybrid yeast is responsible for global lager beer production and is one of the most important industrial microorganisms. Its success in the lager brewing environment is due to a combination of traits not commonly found in pure yeast species, principally low-temperature tolerance, and maltotriose utilization. Parental transgression is typical of hybrid organisms and has been exploited previously for, e.g., the production of wine yeast with beneficial properties. The parental strain S. eubayanus has only been discovered recently and newly created lager yeast strains have not yet been applied industrially. A number of reports attest to the feasibility of this approach and artificially created hybrids are likely to have a significant impact on the future of lager brewing. De novo S. cerevisiae × S. eubayanus hybrids outperform their parent strains in a number of respects, including, but not restricted to, fermentation rate, sugar utilization, stress tolerance, and aroma formation. Hybrid genome function and stability, as well as different techniques for generating hybrids and their relative merits are discussed. Hybridization not only offers the possibility of generating novel non-GM brewing yeast strains with unique properties, but is expected to aid in unraveling the complex evolutionary history of industrial lager yeast.

  6. The yeast two hybrid system in a screen for proteins interacting with axolotl (Ambystoma mexicanum) Msx1 during early limb regeneration.

    PubMed

    Abuqarn, Mehtap; Allmeling, Christina; Amshoff, Inga; Menger, Bjoern; Nasser, Inas; Vogt, Peter M; Reimers, Kerstin

    2011-07-01

    Urodele amphibians are exceptional in their ability to regenerate complex body structures such as limbs. Limb regeneration depends on a process called dedifferentiation. Under an inductive wound epidermis terminally differentiated cells transform to pluripotent progenitor cells that coordinately proliferate and eventually redifferentiate to form the new appendage. Recent studies have developed molecular models integrating a set of genes that might have important functions in the control of regenerative cellular plasticity. Among them is Msx1, which induced dedifferentiation in mammalian myotubes in vitro. Herein, we screened for interaction partners of axolotl Msx1 using a yeast two hybrid system. A two hybrid cDNA library of 5-day-old wound epidermis and underlying tissue containing more than 2×10⁶ cDNAs was constructed and used in the screen. 34 resulting cDNA clones were isolated and sequenced. We then compared sequences of the isolated clones to annotated EST contigs of the Salamander EST database (BLASTn) to identify presumptive orthologs. We subsequently searched all no-hit clone sequences against non redundant NCBI sequence databases using BLASTx. It is the first time, that the yeast two hybrid system was adapted to the axolotl animal model and successfully used in a screen for proteins interacting with Msx1 in the context of amphibian limb regeneration. 2011 Elsevier B.V. All rights reserved.

  7. Screening of binding proteins that interact with Chinese sacbrood virus VP3 capsid protein in Apis cerana larvae cDNA library by the yeast two-hybrid method.

    PubMed

    Fei, Dongliang; Wei, Dong; Yu, Xiaolei; Yue, Jinjin; Li, Ming; Sun, Li; Jiang, Lili; Li, Yijing; Diao, Qingyun; Ma, Mingxiao

    2018-03-15

    Chinese sacbrood virus (CSBV) causes larval death and apiary collapse of Apis cerana. VP3 is a capsid protein of CSBV but its function is poorly understood. To determine the function of VP3 and screen for novel binding proteins that interact with VP3, we conducted yeast two-hybrid screening, glutathione S-transferase pull-down, and co-immunoprecipitation assays. Galectin (GAL) is a protein involved in immune regulation and host-pathogen interactions. The yeast two-hybrid screen implicated GAL as a major VP3-binding candidate. The assays showed that the VP3 interacted with GAL. Identification of these cellular targets and clarifying their contributions to the host-pathogen interaction may be useful for the development of novel therapeutic and prevention strategies against CSBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  9. Adding biological meaning to human protein-protein interactions identified by yeast two-hybrid screenings: A guide through bioinformatics tools.

    PubMed

    Felgueiras, Juliana; Silva, Joana Vieira; Fardilha, Margarida

    2018-01-16

    "A man is known by the company he keeps" is a popular expression that perfectly fits proteins. A common approach to characterize the function of a target protein is to identify its interacting partners and thus infer its roles based on the known functions of the interactors. Protein-protein interaction networks (PPINs) have been created for several organisms, including humans, primarily as results of high-throughput screenings, such as yeast two-hybrid (Y2H). Their unequivocal use to understand events underlying human pathophysiology is promising in identifying genes and proteins associated with diseases. Therefore, numerous opportunities have emerged for PPINs as tools for clinical management of diseases: network-based disease classification systems, discovery of biomarkers and identification of therapeutic targets. Despite the great advantages of PPINs, their use is still unrecognised by several researchers who generate high-throughput data to generally characterize interactions in a certain model or to select an interaction to study in detail. We strongly believe that both approaches are not exclusive and that we can use PPINs as a complementary methodology and rich-source of information to the initial study proposal. Here, we suggest a pipeline to deal with Y2H results using bioinformatics tools freely available for academics. Yeast two-hybrid is widely-used to identify protein-protein interactions. Conventionally, the positive clones that result from a yeast two-hybrid screening are sequenced to identify the interactors of the protein of interest (also known as bait protein), and few interactions, thought as potentially relevant for the model in study, are selected for further validation using biochemical methods (e.g. co-immunoprecipitation and co-localization). The huge amount of data that is potentially lost during this conservative approach motivated us to write this tutorial-like review, so that researchers feel encouraged to take advantage of

  10. New lager yeast strains generated by interspecific hybridization.

    PubMed

    Krogerus, Kristoffer; Magalhães, Frederico; Vidgren, Virve; Gibson, Brian

    2015-05-01

    The interspecific hybrid Saccharomyces pastorianus is the most commonly used yeast in brewery fermentations worldwide. Here, we generated de novo lager yeast hybrids by mating a domesticated and strongly flocculent Saccharomyces cerevisiae ale strain with the Saccharomyces eubayanus type strain. The hybrids were characterized with respect to the parent strains in a wort fermentation performed at temperatures typical for lager brewing (12 °C). The resulting beers were analysed for sugar and aroma compounds, while the yeasts were tested for their flocculation ability and α-glucoside transport capability. These hybrids inherited beneficial properties from both parent strains (cryotolerance, maltotriose utilization and strong flocculation) and showed apparent hybrid vigour, fermenting faster and producing beer with higher alcohol content (5.6 vs 4.5 % ABV) than the parents. Results suggest that interspecific hybridization is suitable for production of novel non-GM lager yeast strains with unique properties and will help in elucidating the evolutionary history of industrial lager yeast.

  11. Yeast one-hybrid screening the potential regulator of CYP6B6 overexpression of Helicoverpa armigera under 2-tridecanone stress.

    PubMed

    Zhao, J; Liu, X N; Li, F; Zhuang, S Z; Huang, L N; Ma, J; Gao, X W

    2016-04-01

    In insect, the cytochrome P450 plays a pivotal role in detoxification to toxic allelochemicals. Helicoverpa armigera can tolerate and survive in 2-tridecanone treatment owing to the CYP6B6 responsive expression, which is controlled by some regulatory DNA sequences and transcription regulators. Therefore, the 2-tridecanone responsive region and transcription regulators of the CYP6B6 are responsible for detoxification of cotton bollworm. In this study, we used yeast one-hybrid to screen two potential transcription regulators of the CYP6B6 from H. armigera that respond to the plant secondary toxicant 2-tridecanone, which were named Prey1 and Prey2, respectively. According to the NCBI database blast, Prey1 is the homology with FK506 binding protein (FKBP) of Manduca sexta and Bombyx mori that belongs to the FKBP-C superfamily, while Prey2 may be a homology of an unknown protein of Papilio or the fcaL24 protein homology of B. mori. The electrophoretic mobility shift assays revealed that the FKBP of prokaryotic expression could specifically bind to the active region of the CYP6B6 promoter. After the 6th instar larvae of H. armigera reared on 2-tridecanone artificial diet, we found there were similar patterns of CYP6B6 and FKBP expression of the cotton bollworm treated with 10 mg g-1 2-tridecanone for 48 h, which correlation coefficient was the highest (0.923). Thus, the FKBP is identified as a strong candidate for regulation of the CYP6B6 expression, when the cotton bollworm is treated with 2-tridecanone. This may lead us to a better understanding of transcriptional mechanism of CYP6B6 and provide very useful information for the pest control.

  12. Precision and recall estimates for two-hybrid screens

    PubMed Central

    Huang, Hailiang; Bader, Joel S.

    2009-01-01

    Motivation: Yeast two-hybrid screens are an important method to map pairwise protein interactions. This method can generate spurious interactions (false discoveries), and true interactions can be missed (false negatives). Previously, we reported a capture–recapture estimator for bait-specific precision and recall. Here, we present an improved method that better accounts for heterogeneity in bait-specific error rates. Result: For yeast, worm and fly screens, we estimate the overall false discovery rates (FDRs) to be 9.9%, 13.2% and 17.0% and the false negative rates (FNRs) to be 51%, 42% and 28%. Bait-specific FDRs and the estimated protein degrees are then used to identify protein categories that yield more (or fewer) false positive interactions and more (or fewer) interaction partners. While membrane proteins have been suggested to have elevated FDRs, the current analysis suggests that intrinsic membrane proteins may actually have reduced FDRs. Hydrophobicity is positively correlated with decreased error rates and fewer interaction partners. These methods will be useful for future two-hybrid screens, which could use ultra-high-throughput sequencing for deeper sampling of interacting bait–prey pairs. Availability: All software (C source) and datasets are available as supplemental files and at http://www.baderzone.org under the Lesser GPL v. 3 license. Contact: joel.bader@jhu.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19091773

  13. Mapping protein-protein interactions using yeast two-hybrid assays.

    PubMed

    Mehla, Jitender; Caufield, J Harry; Uetz, Peter

    2015-05-01

    Yeast two-hybrid (Y2H) screens are an efficient system for mapping protein-protein interactions and whole interactomes. The screens can be performed using random libraries or collections of defined open reading frames (ORFs) called ORFeomes. This protocol describes both library and array-based Y2H screening, with an emphasis on array-based assays. Array-based Y2H is commonly used to test a number of "prey" proteins for interactions with a single "bait" (target) protein or pool of proteins. The advantage of this approach is the direct identification of interacting protein pairs without further downstream experiments: The identity of the preys is known and does not require further confirmation. In contrast, constructing and screening a random prey library requires identification of individual prey clones and systematic retesting. Retesting is typically performed in an array format. © 2015 Cold Spring Harbor Laboratory Press.

  14. A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

    PubMed

    Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

    2018-05-01

    Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

  15. Genome sequence of the lager brewing yeast, an interspecies hybrid.

    PubMed

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-04-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production.

  16. Genome Sequence of the Lager Brewing Yeast, an Interspecies Hybrid

    PubMed Central

    Nakao, Yoshihiro; Kanamori, Takeshi; Itoh, Takehiko; Kodama, Yukiko; Rainieri, Sandra; Nakamura, Norihisa; Shimonaga, Tomoko; Hattori, Masahira; Ashikari, Toshihiko

    2009-01-01

    This work presents the genome sequencing of the lager brewing yeast (Saccharomyces pastorianus) Weihenstephan 34/70, a strain widely used in lager beer brewing. The 25 Mb genome comprises two nuclear sub-genomes originating from Saccharomyces cerevisiae and Saccharomyces bayanus and one circular mitochondrial genome originating from S. bayanus. Thirty-six different types of chromosomes were found including eight chromosomes with translocations between the two sub-genomes, whose breakpoints are within the orthologous open reading frames. Several gene loci responsible for typical lager brewing yeast characteristics such as maltotriose uptake and sulfite production have been increased in number by chromosomal rearrangements. Despite an overall high degree of conservation of the synteny with S. cerevisiae and S. bayanus, the syntenies were not well conserved in the sub-telomeric regions that contain lager brewing yeast characteristic and specific genes. Deletion of larger chromosomal regions, a massive unilateral decrease of the ribosomal DNA cluster and bilateral truncations of over 60 genes reflect a post-hybridization evolution process. Truncations and deletions of less efficient maltose and maltotriose uptake genes may indicate the result of adaptation to brewing. The genome sequence of this interspecies hybrid yeast provides a new tool for better understanding of lager brewing yeast behavior in industrial beer production. PMID:19261625

  17. Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system.

    PubMed

    Yang, Fang; Lei, Yingying; Zhou, Meiling; Yao, Qili; Han, Yichao; Wu, Xiang; Zhong, Wanshun; Zhu, Chenghang; Xu, Weize; Tao, Ran; Chen, Xi; Lin, Da; Rahman, Khaista; Tyagi, Rohit; Habib, Zeshan; Xiao, Shaobo; Wang, Dang; Yu, Yang; Chen, Huanchun; Fu, Zhenfang; Cao, Gang

    2018-02-16

    Protein-protein interaction (PPI) network maintains proper function of all organisms. Simple high-throughput technologies are desperately needed to delineate the landscape of PPI networks. While recent state-of-the-art yeast two-hybrid (Y2H) systems improved screening efficiency, either individual colony isolation, library preparation arrays, gene barcoding or massive sequencing are still required. Here, we developed a recombination-based 'library vs library' Y2H system (RLL-Y2H), by which multi-library screening can be accomplished in a single pool without any individual treatment. This system is based on the phiC31 integrase-mediated integration between bait and prey plasmids. The integrated fragments were digested by MmeI and subjected to deep sequencing to decode the interaction matrix. We applied this system to decipher the trans-kingdom interactome between Mycobacterium tuberculosis and host cells and further identified Rv2427c interfering with the phagosome-lysosome fusion. This concept can also be applied to other systems to screen protein-RNA and protein-DNA interactions and delineate signaling landscape in cells.

  18. A yeast 2-hybrid analysis of human GTP cyclohydrolase I protein interactions

    PubMed Central

    Swick, Lance; Kapatos, Gregory

    2008-01-01

    The yeast 2-hybrid system was used to identify protein domains involved in the oligomerization of human guanosine 5′-triphosphate (GTP) Cyclohydrolase I (GCH1) and the interaction of GCH1 with its regulatory partner, GCH1 feedback regulatory protein (GFRP). When interpreted within the structural framework derived from crystallography, our results indicate that the GCH1 N-terminal α-helices are not the only domains involved in the formation of dimers from monomers and also suggest an important role for the C-terminal α-helix in the assembly of dimers to form decamers. Moreover, a previously unknown role of the extended N-terminal α–helix in the interaction of GCH1 and GFRP was revealed. To discover novel GCH1 protein binding partners, we used the yeast 2-hybrid system to screen a human brain library with GCH1 N-terminal amino acids 1–96 as prey. This protruding extension of GCH1 contains two canonical Type-I Src homology-3 (SH3) ligand domains located within amino acids 1–42. Our screen yielded seven unique clones that were subsequently shown to require amino acids 1–42 for binding to GCH1. The interaction of one of these clones, Activator of Heat Shock 90 kDa Protein (Aha1), with GCH1 was validated by glutathione-s-transferase (GST) pull-down assay. Although the physiological relevance of the Aha1–GCH1 interaction requires further study, Aha1 may recruit GCH1 into the endothelial nitric oxide synthase/heat shock protein (eNOS/Hsp90) complex to support changes in endothelial nitric oxide production through the local synthesis of BH4. PMID:16696853

  19. Evolutionary Role of Interspecies Hybridization and Genetic Exchanges in Yeasts

    PubMed Central

    Dujon, Bernard

    2012-01-01

    Summary: Forced interspecific hybridization has been used in yeasts for many years to study speciation or to construct artificial strains with novel fermentative and metabolic properties. Recent genome analyses indicate that natural hybrids are also generated spontaneously between yeasts belonging to distinct species, creating lineages with novel phenotypes, varied genetic stability, or altered virulence in the case of pathogens. Large segmental introgressions from evolutionarily distant species are also visible in some yeast genomes, suggesting that interspecific genetic exchanges occur during evolution. The origin of this phenomenon remains unclear, but it is likely based on weak prezygotic barriers, limited Dobzhansky-Muller (DM) incompatibilities, and rapid clonal expansions. Newly formed interspecies hybrids suffer rapid changes in the genetic contribution of each parent, including chromosome loss or aneuploidy, translocations, and loss of heterozygosity, that, except in a few recently studied cases, remain to be characterized more precisely at the genomic level by use of modern technologies. We review here known cases of natural or artificially formed interspecies hybrids between yeasts and discuss their potential importance in terms of genome evolution. Problems of meiotic fertility, ploidy constraint, gene and gene product compatibility, and nucleomitochondrial interactions are discussed and placed in the context of other known mechanisms of yeast genome evolution as a model for eukaryotes. PMID:23204364

  20. A strategy for rapid production and screening of yeast artificial chromosome libraries.

    PubMed

    Strauss, W M; Jaenisch, E; Jaenisch, R

    1992-01-01

    We describe methods for rapid production and screening of yeast artificial chromosome (YAC) libraries. Utilizing complete restriction digests of mouse genomic DNA for ligations in agarose, a 32,000-clone library was produced and screened in seven weeks. Screening was accomplished by subdividing primary transformation plates into pools of approximately 100 clones which were transferred into a master glycerol stock. These master stocks were used to inoculate liquid cultures to produce culture "pools," and ten pools of 100 clones were then combined to yield superpools of 1,000 clones. Both pool and superpool DNA was screened by polymerase chain reaction (PCR) and positive pools representing 100 clones were then plated on selective medium and screened by in situ hybridization. Screening by the two tiered PCR assay and by in situ hybridization was completed in 4-5 days. Utilizing this methodology we have isolated a 150 kb clone spanning the alpha 1(I) collagen (Col1a1) gene as well as 40 kb clones from the Hox-2 locus. To characterize the representation of the YAC library, the size distribution of genomic Sal I fragments was compared to that of clones picked at random from the library. The results demonstrate significant biasing of the cloned fragment distribution, resulting in a loss of representation for larger fragments.

  1. Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system.

    PubMed

    Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

    2006-01-01

    To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease.

  2. Quality parameters and RAPD-PCR differentiation of commercial baker's yeast and hybrid strains.

    PubMed

    El-Fiky, Zaki A; Hassan, Gamal M; Emam, Ahmed M

    2012-06-01

    Baker's yeast, Saccharomyces cerevisiae, is a key component in bread baking. Total of 12 commercial baker's yeast and 2 hybrid strains were compared using traditional quality parameters. Total of 5 strains with high leavening power and the 2 hybrid strains were selected and evaluated for their alpha-amylase, maltase, glucoamylase enzymes, and compared using random amplified polymorphic DNA (RAPD). The results revealed that all selected yeast strains have a low level of alpha-amylase and a high level of maltase and glucoamylase enzymes. Meanwhile, the Egyptian yeast strain (EY) had the highest content of alpha-amylase and maltase enzymes followed by the hybrid YH strain. The EY and YH strains have the highest content of glucoamylase enzyme almost with the same level. The RAPD banding patterns showed a wide variation among commercial yeast and hybrid strains. The closely related Egyptian yeast strains (EY and AL) demonstrated close similarity of their genotypes. The 2 hybrid strains were clustered to Turkish and European strains in 1 group. The authors conclude that the identification of strains and hybrids using RAPD technique was useful in determining their genetic relationship. These results can be useful not only for the basic research, but also for the quality control in baking factories. © 2012 Institute of Food Technologists®

  3. Flavivirus NS3 and NS5 proteins interaction network: a high-throughput yeast two-hybrid screen

    PubMed Central

    2011-01-01

    Background The genus Flavivirus encompasses more than 50 distinct species of arthropod-borne viruses, including several major human pathogens, such as West Nile virus, yellow fever virus, Japanese encephalitis virus and the four serotypes of dengue viruses (DENV type 1-4). Each year, flaviviruses cause more than 100 million infections worldwide, some of which lead to life-threatening conditions such as encephalitis or haemorrhagic fever. Among the viral proteins, NS3 and NS5 proteins constitute the major enzymatic components of the viral replication complex and are essential to the flavivirus life cycle. Results We report here the results of a high-throughput yeast two-hybrid screen to identify the interactions between human host proteins and the flavivirus NS3 and NS5 proteins. Using our screen results and literature curation, we performed a global analysis of the NS3 and NS5 cellular targets based on functional annotation with the Gene Ontology features. We finally created the first flavivirus NS3 and NS5 proteins interaction network and analysed the topological features of this network. Our proteome mapping screen identified 108 human proteins interacting with NS3 or NS5 proteins or both. The global analysis of the cellular targets revealed the enrichment of host proteins involved in RNA binding, transcription regulation, vesicular transport or innate immune response regulation. Conclusions We proposed that the selective disruption of these newly identified host/virus interactions could represent a novel and attractive therapeutic strategy in treating flavivirus infections. Our virus-host interaction map provides a basis to unravel fundamental processes about flavivirus subversion of the host replication machinery and/or immune defence strategy. PMID:22014111

  4. Flavivirus NS3 and NS5 proteins interaction network: a high-throughput yeast two-hybrid screen.

    PubMed

    Le Breton, Marc; Meyniel-Schicklin, Laurène; Deloire, Alexandre; Coutard, Bruno; Canard, Bruno; de Lamballerie, Xavier; Andre, Patrice; Rabourdin-Combe, Chantal; Lotteau, Vincent; Davoust, Nathalie

    2011-10-20

    The genus Flavivirus encompasses more than 50 distinct species of arthropod-borne viruses, including several major human pathogens, such as West Nile virus, yellow fever virus, Japanese encephalitis virus and the four serotypes of dengue viruses (DENV type 1-4). Each year, flaviviruses cause more than 100 million infections worldwide, some of which lead to life-threatening conditions such as encephalitis or haemorrhagic fever. Among the viral proteins, NS3 and NS5 proteins constitute the major enzymatic components of the viral replication complex and are essential to the flavivirus life cycle. We report here the results of a high-throughput yeast two-hybrid screen to identify the interactions between human host proteins and the flavivirus NS3 and NS5 proteins. Using our screen results and literature curation, we performed a global analysis of the NS3 and NS5 cellular targets based on functional annotation with the Gene Ontology features. We finally created the first flavivirus NS3 and NS5 proteins interaction network and analysed the topological features of this network. Our proteome mapping screen identified 108 human proteins interacting with NS3 or NS5 proteins or both. The global analysis of the cellular targets revealed the enrichment of host proteins involved in RNA binding, transcription regulation, vesicular transport or innate immune response regulation. We proposed that the selective disruption of these newly identified host/virus interactions could represent a novel and attractive therapeutic strategy in treating flavivirus infections. Our virus-host interaction map provides a basis to unravel fundamental processes about flavivirus subversion of the host replication machinery and/or immune defence strategy.

  5. Cloning of a newly identified heart-specific troponin I isoform, which lacks the troponin T binding portion, using the yeast hybrid system

    PubMed Central

    Suzuki, Hideaki; Arakawa, Yasuhiro; Ito, Masaki; Yamada, Hisashi; Horiguchi-Yamada, Junko

    2006-01-01

    OBJECTIVE To elucidate the molecular pathogenesis behind increased levels of laminin in cardiac muscle cells in cardiomyopathy by using a yeast hybrid screen. The present study reports the cloning of a newly identified heart-specific troponin I isoform, which is putatively linked to laminin. Future studies will explore the functional significance of this connection. METHODS Yeast two-hybrid screen analysis was performed using MLF1-interacting protein (amino acids 1 to 318) as bait. The human heart complementary DNA library was screened by using the yeast-mating method for overnight culture. RESULTS Two final positive clones from the heart library were isolated. These two clones encoded the same protein, a short isoform of human cardiac troponin I (TnI) that lacked TnI exons 5 and 6. The TnI isoform has a heart-specific expression pattern and it shares several sequence features with human cardiac TnI; however, it lacks the troponin T binding portion. CONCLUSION The heart-specific segment of the human cardiac TnI isoform shares several sequence features with human cardiac TnI, but it lacks the troponin T binding portion. These results suggest that the heart-specific TnI isoform may be involved in cardiac development and disease. PMID:18651010

  6. Yeast Two-Hybrid: State of the Art

    PubMed Central

    Beyaert, Rudi

    1999-01-01

    Genome projects are approaching completion and are saturating sequence databases. This paper discusses the role of the two-hybrid system as a generator of hypotheses. Apart from this rather exhaustive, financially and labour intensive procedure, more refined functional studies can be undertaken. Indeed, by making hybrids of two-hybrid systems, customised approaches can be developed in order to attack specific function-related problems. For example, one could set-up a "differential" screen by combining a forward and a reverse approach in a three-hybrid set-up. Another very interesting project is the use of peptide libraries in two-hybrid approaches. This could enable the identification of peptides with very high specificity comparable to "real" antibodies. With the technology available, the only limitation is imagination. PMID:12734586

  7. A modified reverse one-hybrid screen identifies transcriptional activation in Phyochrome-Interacting Factor 3

    USDA-ARS?s Scientific Manuscript database

    Transcriptional activation domains (TAD) are difficult to predict and identify, since they are not conserved and have little consensus. Here, we describe a yeast-based screening method that is able to identify individual amino acid residues involved in transcriptional activation in a high throughput...

  8. [Identification of C(2)M interacting proteins by yeast two-hybrid screening].

    PubMed

    Yue, Shan-shan; Xia, Lai-xin

    2015-11-01

    The synaptonemal complex (SC) is a huge structure which assembles between the homologous chromosomes during meiotic prophase I. Drosophila germ cell-specific nucleoprotein C(2)M clustering at chromosomes can induce SC formation. To further study the molecular function and mechanism of C(2)M in meiosis, we constructed a bait vector for C(2)M and used the yeast two-hybrid system to identify C(2)M interacting proteins. Forty interacting proteins were obtained, including many DNA and histone binding proteins, ATP synthases and transcription factors. Gene silencing assays in Drosophila showed that two genes, wech and Psf1, may delay the disappearance of SC. These results indicate that Wech and Psf1 may form a complex with C(2)M to participate in the formation or stabilization of the SC complex.

  9. Loss of Heterozygosity Drives Adaptation in Hybrid Yeast.

    PubMed

    Smukowski Heil, Caiti S; DeSevo, Christopher G; Pai, Dave A; Tucker, Cheryl M; Hoang, Margaret L; Dunham, Maitreya J

    2017-07-01

    Hybridization is often considered maladaptive, but sometimes hybrids can invade new ecological niches and adapt to novel or stressful environments better than their parents. The genomic changes that occur following hybridization that facilitate genome resolution and/or adaptation are not well understood. Here, we examine hybrid genome evolution using experimental evolution of de novo interspecific hybrid yeast Saccharomyces cerevisiae × Saccharomyces uvarum and their parentals. We evolved these strains in nutrient-limited conditions for hundreds of generations and sequenced the resulting cultures identifying numerous point mutations, copy number changes, and loss of heterozygosity (LOH) events, including species-biased amplification of nutrient transporters. We focused on a particularly interesting example, in which we saw repeated LOH at the high-affinity phosphate transporter gene PHO84 in both intra- and interspecific hybrids. Using allele replacement methods, we tested the fitness of different alleles in hybrid and S. cerevisiae strain backgrounds and found that the LOH is indeed the result of selection on one allele over the other in both S. cerevisiae and the hybrids. This is an example where hybrid genome resolution is driven by positive selection on existing heterozygosity and demonstrates that even infrequent outcrossing may have lasting impacts on adaptation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Newly generated interspecific wine yeast hybrids introduce flavour and aroma diversity to wines.

    PubMed

    Bellon, Jennifer R; Eglinton, Jeffery M; Siebert, Tracey E; Pollnitz, Alan P; Rose, Louisa; de Barros Lopes, Miguel; Chambers, Paul J

    2011-08-01

    Increasingly, winemakers are looking for ways to introduce aroma and flavour diversity to their wines as a means of improving style and increasing product differentiation. While currently available commercial yeast strains produce consistently sound fermentations, there are indications that sensory complexity and improved palate structure are obtained when other species of yeast are active during fermentation. In this study, we explore a strategy to increase the impact of non-Saccharomyces cerevisiae inputs without the risks associated with spontaneous fermentations, through generating interspecific hybrids between a S. cerevisiae wine strain and a second species. For our experiments, we used rare mating to produce hybrids between S. cerevisiae and other closely related yeast of the Saccharomyces sensu stricto complex. These hybrid yeast strains display desirable properties of both parents and produce wines with concentrations of aromatic fermentation products that are different to what is found in wine made using the commercial wine yeast parent. Our results demonstrate, for the first time, that the introduction of genetic material from a non-S. cerevisiae parent into a wine yeast background can impact favourably on the wine flavour and aroma profile of a commercial S. cerevisiae wine yeast.

  11. Yeast three-hybrid screen identifies TgBRADIN/GRA24 as a negative regulator of Toxoplasma gondii bradyzoite differentiation.

    PubMed

    Odell, Anahi V; Tran, Fanny; Foderaro, Jenna E; Poupart, Séverine; Pathak, Ravi; Westwood, Nicholas J; Ward, Gary E

    2015-01-01

    Differentiation of the protozoan parasite Toxoplasma gondii into its latent bradyzoite stage is a key event in the parasite's life cycle. Compound 2 is an imidazopyridine that was previously shown to inhibit the parasite lytic cycle, in part through inhibition of parasite cGMP-dependent protein kinase. We show here that Compound 2 can also enhance parasite differentiation, and we use yeast three-hybrid analysis to identify TgBRADIN/GRA24 as a parasite protein that interacts directly or indirectly with the compound. Disruption of the TgBRADIN/GRA24 gene leads to enhanced differentiation of the parasite, and the TgBRADIN/GRA24 knockout parasites show decreased susceptibility to the differentiation-enhancing effects of Compound 2. This study represents the first use of yeast three-hybrid analysis to study small-molecule mechanism of action in any pathogenic microorganism, and it identifies a previously unrecognized inhibitor of differentiation in T. gondii. A better understanding of the proteins and mechanisms regulating T. gondii differentiation will enable new approaches to preventing the establishment of chronic infection in this important human pathogen.

  12. T-screen and yeast assay for the detection of the thyroid-disrupting activities of cadmium, mercury, and zinc.

    PubMed

    Li, Jian; Liu, Yun; Kong, Dongdong; Ren, Shujuan; Li, Na

    2016-05-01

    In the present study, a two-hybrid yeast bioassay and a T-screen were used to screen for the thyroid receptor (TR)-disrupting activity of select metallic compounds (CdCl2, ZnCl2, HgCl2, CuSO4, MnSO4, and MgSO4). The results reveal that none of the tested metallic compounds showed TR-agonistic activity, whereas ZnCl2, HgCl2, and CdCl2 demonstrated TR antagonism. For the yeast assay, the dose-response relationship of these metallic compounds was established, and the concentrations producing 20 % of the maximum effect of ZnCl2, HgCl2, and CdCl2 were 9.1 × 10(-5), 3.2 × 10(-6), and 1.2 × 10(-6) mol/L, respectively. The T-screen also supported the finding that ZnCl2, HgCl2, and CdCl2 decreased the cell proliferation at concentrations ranging from 10(-6) to 10(-4) mol/L. Furthermore, the thyroid-disrupting activity of metallic compounds in environmental water samples collected from the Guanting Reservoir, Beijing, China was evaluated. Solid-phase extraction was used to separate the organic extracts, and a modified two-hybrid yeast bioassay revealed that the metallic compounds in the water samples could affect thyroid hormone-induced signaling by decreasing the binding of the thyroid hormone. The addition of ethylenediaminetetraacetic acid (30 mg/L) could eliminate the effects. Thus, the cause(s) of the thyroid toxicity in the water samples appeared to be partly related to the metallic compounds.

  13. Introducing a new breed of wine yeast: interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast and Saccharomyces mikatae.

    PubMed

    Bellon, Jennifer R; Schmid, Frank; Capone, Dimitra L; Dunn, Barbara L; Chambers, Paul J

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment.

  14. Development and application of a DNA microarray-based yeast two-hybrid system

    PubMed Central

    Suter, Bernhard; Fontaine, Jean-Fred; Yildirimman, Reha; Raskó, Tamás; Schaefer, Martin H.; Rasche, Axel; Porras, Pablo; Vázquez-Álvarez, Blanca M.; Russ, Jenny; Rau, Kirstin; Foulle, Raphaele; Zenkner, Martina; Saar, Kathrin; Herwig, Ralf; Andrade-Navarro, Miguel A.; Wanker, Erich E.

    2013-01-01

    The yeast two-hybrid (Y2H) system is the most widely applied methodology for systematic protein–protein interaction (PPI) screening and the generation of comprehensive interaction networks. We developed a novel Y2H interaction screening procedure using DNA microarrays for high-throughput quantitative PPI detection. Applying a global pooling and selection scheme to a large collection of human open reading frames, proof-of-principle Y2H interaction screens were performed for the human neurodegenerative disease proteins huntingtin and ataxin-1. Using systematic controls for unspecific Y2H results and quantitative benchmarking, we identified and scored a large number of known and novel partner proteins for both huntingtin and ataxin-1. Moreover, we show that this parallelized screening procedure and the global inspection of Y2H interaction data are uniquely suited to define specific PPI patterns and their alteration by disease-causing mutations in huntingtin and ataxin-1. This approach takes advantage of the specificity and flexibility of DNA microarrays and of the existence of solid-related statistical methods for the analysis of DNA microarray data, and allows a quantitative approach toward interaction screens in human and in model organisms. PMID:23275563

  15. Characterization of diverse internal binding specificities of PDZ domains by yeast two-hybrid screening of a special peptide library.

    PubMed

    Mu, Yi; Cai, Pengfei; Hu, Siqi; Ma, Sucan; Gao, Youhe

    2014-01-01

    Protein-protein interactions (PPIs) are essential events to play important roles in a series of biological processes. There are probably more ways of PPIs than we currently realized. Structural and functional investigations of weak PPIs have lagged behind those of strong PPIs due to technical difficulties. Weak PPIs are often short-lived, which may result in more dynamic signals with important biological roles within and/or between cells. For example, the characteristics of PSD-95/Dlg/ZO-1 (PDZ) domain binding to internal sequences, which are primarily weak interactions, have not yet been systematically explored. In the present study, we constructed a nearly random octapeptide yeast two-hybrid library. A total of 24 PDZ domains were used as baits for screening the library. Fourteen of these domains were able to bind internal PDZ-domain binding motifs (PBMs), and PBMs screened for nine PDZ domains exhibited strong preferences. Among 11 PDZ domains that have not been reported their internal PBM binding ability, six were confirmed to bind internal PBMs. The first PDZ domain of LNX2, which has not been reported to bind C-terminal PBMs, was found to bind internal PBMs. These results suggest that the internal PBMs binding ability of PDZ domains may have been underestimated. The data provided diverse internal binding properties for several PDZ domains that may help identify their novel binding partners.

  16. Saccharomyces interspecies hybrids as model organisms for studying yeast adaptation to stressful environments.

    PubMed

    Lopandic, Ksenija

    2018-01-01

    The strong development of molecular biology techniques and next-generation sequencing technologies in the last two decades has significantly improved our understanding of the evolutionary history of Saccharomyces yeasts. It has been shown that many strains isolated from man-made environments are not pure genetic lines, but contain genetic materials from different species that substantially increase their genome complexity. A number of strains have been described as interspecies hybrids, implying different yeast species that under specific circumstances exchange and recombine their genomes. Such fusing usually results in a wide variety of alterations at the genetic and chromosomal levels. The observed changes have suggested a high genome plasticity and a significant role of interspecies hybridization in the adaptation of yeasts to environmental stresses and industrial processes. There is a high probability that harsh wine and beer fermentation environments, from which the majority of interspecies hybrids have been isolated so far, influence their selection and stabilization as well as their genomic and phenotypic heterogeneity. The lessons we have learned about geno- and phenotype plasticity and the diversity of natural and commercial yeast hybrids have already had a strong impact on the development of artificial hybrids that can be successfully used in the fermentation-based food and beverage industry. The creation of artificial hybrids through the crossing of strains with desired attributes is a possibility to obtain a vast variety of new, but not genetically modified yeasts with a range of improved and beneficial traits. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  17. Speciation driven by hybridization and chromosomal plasticity in a wild yeast.

    PubMed

    Leducq, Jean-Baptiste; Nielly-Thibault, Lou; Charron, Guillaume; Eberlein, Chris; Verta, Jukka-Pekka; Samani, Pedram; Sylvester, Kayla; Hittinger, Chris Todd; Bell, Graham; Landry, Christian R

    2016-01-11

    Hybridization is recognized as a powerful mechanism of speciation and a driving force in generating biodiversity. However, only few multicellular species, limited to a handful of plants and animals, have been shown to fulfil all the criteria of homoploid hybrid speciation. This lack of evidence could lead to the interpretation that speciation by hybridization has a limited role in eukaryotes, particularly in single-celled organisms. Laboratory experiments have revealed that fungi such as budding yeasts can rapidly develop reproductive isolation and novel phenotypes through hybridization, showing that in principle homoploid speciation could occur in nature. Here, we report a case of homoploid hybrid speciation in natural populations of the budding yeast Saccharomyces paradoxus inhabiting the North American forests. We show that the rapid evolution of chromosome architecture and an ecological context that led to secondary contact between nascent species drove the formation of an incipient hybrid species with a potentially unique ecological niche.

  18. Use of The Yeast Two-Hybrid System to Identify Targets of Fungal Effectors

    USDA-ARS?s Scientific Manuscript database

    The yeast-two hybrid (Y2H) system is a binary method widely used to determine direct interactions between paired proteins. Although having certain limitations, this method has become one of the two main systemic tools (along with affinity purification/mass spectrometry) for interactome mapping in mo...

  19. Genome rearrangements and pervasive meiotic drive cause hybrid infertility in fission yeast

    PubMed Central

    Zanders, Sarah E; Eickbush, Michael T; Yu, Jonathan S; Kang, Ji-Won; Fowler, Kyle R; Smith, Gerald R; Malik, Harmit Singh

    2014-01-01

    Hybrid sterility is one of the earliest postzygotic isolating mechanisms to evolve between two recently diverged species. Here we identify causes underlying hybrid infertility of two recently diverged fission yeast species Schizosaccharomyces pombe and S. kambucha, which mate to form viable hybrid diploids that efficiently complete meiosis, but generate few viable gametes. We find that chromosomal rearrangements and related recombination defects are major but not sole causes of hybrid infertility. At least three distinct meiotic drive alleles, one on each S. kambucha chromosome, independently contribute to hybrid infertility by causing nonrandom spore death. Two of these driving loci are linked by a chromosomal translocation and thus constitute a novel type of paired meiotic drive complex. Our study reveals how quickly multiple barriers to fertility can arise. In addition, it provides further support for models in which genetic conflicts, such as those caused by meiotic drive alleles, can drive speciation. DOI: http://dx.doi.org/10.7554/eLife.02630.001 PMID:24963140

  20. Genome rearrangements and pervasive meiotic drive cause hybrid infertility in fission yeast.

    PubMed

    Zanders, Sarah E; Eickbush, Michael T; Yu, Jonathan S; Kang, Ji-Won; Fowler, Kyle R; Smith, Gerald R; Malik, Harmit Singh

    2014-06-24

    Hybrid sterility is one of the earliest postzygotic isolating mechanisms to evolve between two recently diverged species. Here we identify causes underlying hybrid infertility of two recently diverged fission yeast species Schizosaccharomyces pombe and S. kambucha, which mate to form viable hybrid diploids that efficiently complete meiosis, but generate few viable gametes. We find that chromosomal rearrangements and related recombination defects are major but not sole causes of hybrid infertility. At least three distinct meiotic drive alleles, one on each S. kambucha chromosome, independently contribute to hybrid infertility by causing nonrandom spore death. Two of these driving loci are linked by a chromosomal translocation and thus constitute a novel type of paired meiotic drive complex. Our study reveals how quickly multiple barriers to fertility can arise. In addition, it provides further support for models in which genetic conflicts, such as those caused by meiotic drive alleles, can drive speciation.DOI: http://dx.doi.org/10.7554/eLife.02630.001. Copyright © 2014, Zanders et al.

  1. Identification of proteins interacting with Toxoplasma SRCAP by yeast two-hybrid screening.

    PubMed

    Nallani, Karuna C; Sullivan, William J

    2005-03-01

    Toxoplasma gondii is an opportunistic protozoan parasite that differentiates into latent cysts (bradyzoite) that can be reactivated during immunosuppression. TgSRCAP (Toxoplasma gondii Snf2-related CBP activator protein) is a SWI2/SNF2 family chromatin remodeler whose expression increases during cyst development. Identifying the proteins associating with TgSRCAP during the pre-cyst stage (tachyzoite) will increase our understanding of how parasite differentiation is initiated. We employed the yeast two-hybrid system to identify proteins that may interact directly with TgSRCAP. A stretch of 1,060 amino acids between ATPase subdomains IV and V of TgSRCAP was chosen as "bait" since the corresponding region in human SRCAP interacts with other proteins, including CREB binding protein. We have identified several novel parasite-specific transcription factors predicted to be in the T. gondii genome. Metabolic enzymes that may participate in cyst development were also identified as interacting with TgSRCAP.

  2. Introducing a New Breed of Wine Yeast: Interspecific Hybridisation between a Commercial Saccharomyces cerevisiae Wine Yeast and Saccharomyces mikatae

    PubMed Central

    Bellon, Jennifer R.; Schmid, Frank; Capone, Dimitra L.; Dunn, Barbara L.; Chambers, Paul J.

    2013-01-01

    Interspecific hybrids are commonplace in agriculture and horticulture; bread wheat and grapefruit are but two examples. The benefits derived from interspecific hybridisation include the potential of generating advantageous transgressive phenotypes. This paper describes the generation of a new breed of wine yeast by interspecific hybridisation between a commercial Saccharomyces cerevisiae wine yeast strain and Saccharomyces mikatae, a species hitherto not associated with industrial fermentation environs. While commercially available wine yeast strains provide consistent and reliable fermentations, wines produced using single inocula are thought to lack the sensory complexity and rounded palate structure obtained from spontaneous fermentations. In contrast, interspecific yeast hybrids have the potential to deliver increased complexity to wine sensory properties and alternative wine styles through the formation of novel, and wider ranging, yeast volatile fermentation metabolite profiles, whilst maintaining the robustness of the wine yeast parent. Screening of newly generated hybrids from a cross between a S. cerevisiae wine yeast and S. mikatae (closely-related but ecologically distant members of the Saccharomyces sensu stricto clade), has identified progeny with robust fermentation properties and winemaking potential. Chemical analysis showed that, relative to the S. cerevisiae wine yeast parent, hybrids produced wines with different concentrations of volatile metabolites that are known to contribute to wine flavour and aroma, including flavour compounds associated with non-Saccharomyces species. The new S. cerevisiae x S. mikatae hybrids have the potential to produce complex wines akin to products of spontaneous fermentation while giving winemakers the safeguard of an inoculated ferment. PMID:23614011

  3. Novel Interactome of Saccharomyces cerevisiae Myosin Type II Identified by a Modified Integrated Membrane Yeast Two-Hybrid (iMYTH) Screen.

    PubMed

    Santiago, Ednalise; Akamine, Pearl; Snider, Jamie; Wong, Victoria; Jessulat, Matthew; Deineko, Viktor; Gagarinova, Alla; Aoki, Hiroyuki; Minic, Zoran; Phanse, Sadhna; San Antonio, Andrea; Cubano, Luis A; Rymond, Brian C; Babu, Mohan; Stagljar, Igor; Rodriguez-Medina, Jose R

    2016-05-03

    Nonmuscle myosin type II (Myo1p) is required for cytokinesis in the budding yeast Saccharomyces cerevisiae Loss of Myo1p activity has been associated with growth abnormalities and enhanced sensitivity to osmotic stress, making it an appealing antifungal therapeutic target. The Myo1p tail-only domain was previously reported to have functional activity equivalent to the full-length Myo1p whereas the head-only domain did not. Since Myo1p tail-only constructs are biologically active, the tail domain must have additional functions beyond its previously described role in myosin dimerization or trimerization. The identification of new Myo1p-interacting proteins may shed light on the other functions of the Myo1p tail domain. To identify novel Myo1p-interacting proteins, and determine if Myo1p can serve as a scaffold to recruit proteins to the bud neck during cytokinesis, we used the integrated split-ubiquitin membrane yeast two-hybrid (iMYTH) system. Myo1p was iMYTH-tagged at its C-terminus, and screened against both cDNA and genomic prey libraries to identify interacting proteins. Control experiments showed that the Myo1p-bait construct was appropriately expressed, and that the protein colocalized to the yeast bud neck. Thirty novel Myo1p-interacting proteins were identified by iMYTH. Eight proteins were confirmed by coprecipitation (Ape2, Bzz1, Fba1, Pdi1, Rpl5, Tah11, and Trx2) or mass spectrometry (AP-MS) (Abp1). The novel Myo1p-interacting proteins identified come from a range of different processes, including cellular organization and protein synthesis. Actin assembly/disassembly factors such as the SH3 domain protein Bzz1 and the actin-binding protein Abp1 represent likely Myo1p interactions during cytokinesis. Copyright © 2016 Santiago et al.

  4. Synthesis of a beta-estradiol-biotin chimera that potently heterodimerizes estrogen receptor and streptavidin proteins in a yeast three-hybrid system.

    PubMed

    Hussey, Stephen L; Muddana, Smita S; Peterson, Blake R

    2003-04-02

    Small molecules that dimerize proteins in living cells provide powerful probes of biological processes and have potential as tools for the identification of protein targets of natural products. We synthesized 7-alpha-substituted derivatives of beta-estradiol tethered to the natural product biotin to regulate heterodimerization of estrogen receptor (ER) and streptavidin (SA) proteins expressed as components of a yeast three-hybrid system. Addition of an estradiol-biotin chimera bearing a 19-atom linker to yeast expressing DNA-bound ER-alpha or ER-beta LexA fusion proteins and wild-type SA protein fused to the B42 activation domain activated reporter gene expression by as much as 450-fold in vivo (10 muM ligand). Comparative analysis of lower affinity Y43A (biotin Kd approximately 100 pM) and W120A (biotin Kd approximately 100 nM) mutants of SA indicated that moderate affinity interactions can be readily detected with this system. Comparison of a 7-alpha-substituted estradiol-biotin chimera with a structurally similar dexamethasone-biotin chimera revealed that yeast expressing ER proteins can detect cognate ligands with up to 5-fold greater potency and 70-fold higher activity than yeast expressing analogous glucocorticoid receptor (GR) proteins. This approach may facilitate the identification of protein targets of biologically active small molecules screened against genetically encoded libraries of proteins expressed in yeast three-hybrid systems.

  5. A New Method, "Reverse Yeast Two-Hybrid Array" (RYTHA), Identifies Mutants that Dissociate the Physical Interaction Between Elg1 and Slx5.

    PubMed

    Lev, Ifat; Shemesh, Keren; Volpe, Marina; Sau, Soumitra; Levinton, Nelly; Molco, Maya; Singh, Shivani; Liefshitz, Batia; Ben Aroya, Shay; Kupiec, Martin

    2017-07-01

    The vast majority of processes within the cell are carried out by proteins working in conjunction. The Yeast Two-Hybrid (Y2H) methodology allows the detection of physical interactions between any two interacting proteins. Here, we describe a novel systematic genetic methodology, "Reverse Yeast Two-Hybrid Array" (RYTHA), that allows the identification of proteins required for modulating the physical interaction between two given proteins. Our assay starts with a yeast strain in which the physical interaction of interest can be detected by growth on media lacking histidine, in the context of the Y2H methodology. By combining the synthetic genetic array technology, we can systematically screen mutant libraries of the yeast Saccharomyces cerevisiae to identify trans -acting mutations that disrupt the physical interaction of interest. We apply this novel method in a screen for mutants that disrupt the interaction between the N-terminus of Elg1 and the Slx5 protein. Elg1 is part of an alternative replication factor C-like complex that unloads PCNA during DNA replication and repair. Slx5 forms, together with Slx8, a SUMO-targeted ubiquitin ligase (STUbL) believed to send proteins to degradation. Our results show that the interaction requires both the STUbL activity and the PCNA unloading by Elg1, and identify topoisomerase I DNA-protein cross-links as a major factor in separating the two activities. Thus, we demonstrate that RYTHA can be applied to gain insights about particular pathways in yeast, by uncovering the connection between the proteasomal ubiquitin-dependent degradation pathway, DNA replication, and repair machinery, which can be separated by the topoisomerase-mediated cross-links to DNA. Copyright © 2017 by the Genetics Society of America.

  6. Screening for new brewing yeasts in the non-Saccharomyces sector with Torulaspora delbrueckii as model.

    PubMed

    Michel, Maximilian; Kopecká, Jana; Meier-Dörnberg, Tim; Zarnkow, Martin; Jacob, Fritz; Hutzler, Mathias

    2016-04-01

    This study describes a screening system for future brewing yeasts focusing on non-Saccharomyces yeasts. The aim was to find new yeast strains that can ferment beer wort into a respectable beer. Ten Torulaspora delbrueckii strains were put through the screening system, which included sugar utilization tests, hop resistance tests, ethanol resistance tests, polymerase chain reaction fingerprinting, propagation tests, amino acid catabolism and anabolism, phenolic off-flavour tests and trial fermentations. Trial fermentations were analysed for extract reduction, pH drop, yeast concentration in bulk fluid and fermentation by-products. All investigated strains were able to partly ferment wort sugars and showed high tolerance to hop compounds and ethanol. One of the investigated yeast strains fermented all the wort sugars and produced a respectable fruity flavour and a beer of average ethanol content with a high volatile flavour compound concentration. Two other strains could possibly be used for pre-fermentation as a bio-flavouring agent for beers that have been post-fermented by Saccharomyces strains as a consequence of their low sugar utilization but good flavour-forming properties. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Metabolomics-based prediction models of yeast strains for screening of metabolites contributing to ethanol stress tolerance

    NASA Astrophysics Data System (ADS)

    Hashim, Z.; Fukusaki, E.

    2016-06-01

    The increased demand for clean, sustainable and renewable energy resources has driven the development of various microbial systems to produce biofuels. One of such systems is the ethanol-producing yeast. Although yeast produces ethanol naturally using its native pathways, production yield is low and requires improvement for commercial biofuel production. Moreover, ethanol is toxic to yeast and thus ethanol tolerance should be improved to further enhance ethanol production. In this study, we employed metabolomics-based strategy using 30 single-gene deleted yeast strains to construct multivariate models for ethanol tolerance and screen metabolites that relate to ethanol sensitivity/tolerance. The information obtained from this study can be used as an input for strain improvement via metabolic engineering.

  8. Nutrient supplements boost yeast transformation efficiency

    PubMed Central

    Yu, Sheng-Chun; Dawson, Alexander; Henderson, Alyssa C.; Lockyer, Eloise J.; Read, Emily; Sritharan, Gayathri; Ryan, Marjah; Sgroi, Mara; Ngou, Pok M.; Woodruff, Rosie; Zhang, Ruifeng; Ren Teen Chia, Travis; Liu, Yu; Xiang, Yiyu; Spanu, Pietro D.

    2016-01-01

    Efficiency of yeast transformation is determined by the rate of yeast endocytosis. The aim of this study was to investigate the effect of introducing amino acids and other nutrients (inositol, adenine, or p-aminobenzoic acid) in the transformation medium to develop a highly efficient yeast transformation protocol. The target of rapamycin complex 1 (TORC1) kinase signalling complex influences the rate of yeast endocytosis. TORC signaling is induced by amino acids in the media. Here, we found that increasing the concentration of amino acids and other nutrients in the growth media lead to an increase yeast transformation efficiency up to 107 CFU per μg plasmid DNA and per 108 cells with a 13.8 kb plasmid DNA. This is over 130 times that of current published methods. This improvement may facilitate more efficient experimentation in which transformation efficiency is critical, such as yeast two-hybrid screening. PMID:27760994

  9. Detection of Protein Interactions in T3S Systems Using Yeast Two-Hybrid Analysis.

    PubMed

    Nilles, Matthew L

    2017-01-01

    Two-hybrid systems, sometimes termed interaction traps, are genetic systems designed to find and analyze interactions between proteins. The most common systems are yeast based (commonly Saccharomyces cerevisae) and rely on the functional reconstitution of the GAL4 transcriptional activator. Reporter genes, such as the lacZ gene of Escherichia coli (encodes β-galactosidase), are placed under GAL4-dependent transcriptional control to provide quick and reliable detection of protein interactions. In this method the use of a yeast-based two-hybrid system is described to study protein interactions between components of type III secretion systems.

  10. Identification of a novel interspecific hybrid yeast from a metagenomic spontaneously inoculated beer sample using Hi-C.

    PubMed

    Smukowski Heil, Caiti; Burton, Joshua N; Liachko, Ivan; Friedrich, Anne; Hanson, Noah A; Morris, Cody L; Schacherer, Joseph; Shendure, Jay; Thomas, James H; Dunham, Maitreya J

    2018-01-01

    Interspecific hybridization is a common mechanism enabling genetic diversification and adaptation; however, the detection of hybrid species has been quite difficult. The identification of microbial hybrids is made even more complicated, as most environmental microbes are resistant to culturing and must be studied in their native mixed communities. We have previously adapted the chromosome conformation capture method Hi-C to the assembly of genomes from mixed populations. Here, we show the method's application in assembling genomes directly from an uncultured, mixed population from a spontaneously inoculated beer sample. Our assembly method has enabled us to de-convolute four bacterial and four yeast genomes from this sample, including a putative yeast hybrid. Downstream isolation and analysis of this hybrid confirmed its genome to consist of Pichia membranifaciens and that of another related, but undescribed, yeast. Our work shows that Hi-C-based metagenomic methods can overcome the limitation of traditional sequencing methods in studying complex mixtures of genomes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Screening of a thiamine-auxotrophic yeast for alpha-ketoglutaric acid overproduction.

    PubMed

    Zhou, Jingwen; Zhou, Haiyan; Du, Guocheng; Liu, Liming; Chen, Jian

    2010-09-01

    To obtain a thiamine-auxotrophic yeast strain that overproduces alpha-ketoglutaric acid (alpha-KG) from glycerol and to investigate nutrient effects on alpha-KG production. Yeast strain WSH-Z06, a thiamine auxotroph that gave high yields of alpha-KG from glycerol, was obtained by screening for ampicillin/kanamycin resistance and thiamine auxotrophy. The strain was identified as Yarrowia lipolytica based on physiological, chemical, and phylogenetic analysis. The ability of the strain to convert glycerol to alpha-KG was analysed by investigating the effects of nutritional factors, including thiamine, riboflavin, nitrogen sources, and calcium ion. Thiamine and calcium ion concentration had the greatest effect on alpha-KG accumulation. Under optimal conditions, a yield of 39.2 g l(-1)alpha-KG was obtained from 100 g l(-1) glycerol, with 16.84 g l(-1) pyruvate as a by-product. The current work provides a method for screening for an alpha-KG overproducer. Nutrients have a significant impact on alpha-KG production in the yeast strain presented here. The alpha-KG-overproducing yeast strain Y. lipolytica WSH-Z06 is a promising parent strain for further metabolic engineering to lower by-product accumulation and accelerate glycerol utilization.

  12. Transcriptional Response to Lactic Acid Stress in the Hybrid Yeast Zygosaccharomyces parabailii

    PubMed Central

    2017-01-01

    ABSTRACT Lactic acid has a wide range of applications starting from its undissociated form, and its production using cell factories requires stress-tolerant microbial hosts. The interspecies hybrid yeast Zygosaccharomyces parabailii has great potential to be exploited as a novel host for lactic acid production, due to high organic acid tolerance at low pH and a fermentative metabolism with a high growth rate. Here we used mRNA sequencing (RNA-seq) to analyze Z. parabailii's transcriptional response to lactic acid added exogenously, and we explore the biological mechanisms involved in tolerance. Z. parabailii contains two homeologous copies of most genes. Under lactic acid stress, the two genes in each homeolog pair tend to diverge in expression to a significantly greater extent than under control conditions, indicating that stress tolerance is facilitated by interactions between the two gene sets in the hybrid. Lactic acid induces downregulation of genes related to cell wall and plasma membrane functions, possibly altering the rate of diffusion of lactic acid into cells. Genes related to iron transport and redox processes were upregulated, suggesting an important role for respiratory functions and oxidative stress defense. We found differences in the expression profiles of genes putatively regulated by Haa1 and Aft1/Aft2, previously described as lactic acid responsive in Saccharomyces cerevisiae. Furthermore, formate dehydrogenase (FDH) genes form a lactic acid-responsive gene family that has been specifically amplified in Z. parabailii in comparison to other closely related species. Our study provides a useful starting point for the engineering of Z. parabailii as a host for lactic acid production. IMPORTANCE Hybrid yeasts are important in biotechnology because of their tolerance to harsh industrial conditions. The molecular mechanisms of tolerance can be studied by analyzing differential gene expression under conditions of interest and relating gene expression

  13. Evaluation of a recombinant yeast cell estrogen screening assay.

    PubMed Central

    Coldham, N G; Dave, M; Sivapathasundaram, S; McDonnell, D P; Connor, C; Sauer, M J

    1997-01-01

    A wide range of chemicals with diverse structures derived from plant and environmental origins are reported to have hormonal activity. The potential for appreciable exposure of humans to such substances prompts the need to develop sensitive screening methods to quantitate and evaluate the risk to the public. Yeast cells transformed with plasmids encoding the human estrogen receptor and an estrogen responsive promoter linked to a reporter gene were evaluated for screening compounds for estrogenic activity. Relative sensitivity to estrogens was evaluated by reference to 17 beta-estradiol (E2) calibration curves derived using the recombinant yeast cells, MCF-7 human breast cancer cells, and a prepubertal mouse uterotrophic bioassay. The recombinant yeast cell bioassay (RCBA) was approximately two and five orders of magnitude more sensitive to E2 than MCF-7 cells and the uterotrophic assay, respectively. The estrogenic potency of 53 chemicals, including steroid hormones, synthetic estrogens, environmental pollutants, and phytoestrogens, was measured using the RCBA. Potency values produced with the RCBA relative to E2 (100) included estrone (9.6), diethylstilbestrol (74.3), tamoxifen (0.0047), alpha-zearalanol (1.3), equol (0.085), 4-nonylphenol (0.005), and butylbenzyl phathalate (0.0004), which were similar to literature values but generally higher than those produced by the uterotrophic assay. Exquisite sensitivity, absence of test compound biotransformation, ease of use, and the possibility of measuring antiestrogenic activity are important attributes that argue for the suitability of the RCBA in screening for potential xenoestrogens to evaluate risk to humans, wildlife, and the environment. Images Figure 1. Figure 2. Figure 3. Figure 4. PMID:9294720

  14. Identification of a small molecule yeast TORC1 inhibitor with a multiplex screen based on flow cytometry.

    PubMed

    Chen, Jun; Young, Susan M; Allen, Chris; Seeber, Andrew; Péli-Gulli, Marie-Pierre; Panchaud, Nicolas; Waller, Anna; Ursu, Oleg; Yao, Tuanli; Golden, Jennifer E; Strouse, J Jacob; Carter, Mark B; Kang, Huining; Bologa, Cristian G; Foutz, Terry D; Edwards, Bruce S; Peterson, Blake R; Aubé, Jeffrey; Werner-Washburne, Margaret; Loewith, Robbie J; De Virgilio, Claudio; Sklar, Larry A

    2012-04-20

    TOR (target of rapamycin) is a serine/threonine kinase, evolutionarily conserved from yeast to human, which functions as a fundamental controller of cell growth. The moderate clinical benefit of rapamycin in mTOR-based therapy of many cancers favors the development of new TOR inhibitors. Here we report a high-throughput flow cytometry multiplexed screen using five GFP-tagged yeast clones that represent the readouts of four branches of the TORC1 signaling pathway in budding yeast. Each GFP-tagged clone was differentially color-coded, and the GFP signal of each clone was measured simultaneously by flow cytometry, which allows rapid prioritization of compounds that likely act through direct modulation of TORC1 or proximal signaling components. A total of 255 compounds were confirmed in dose-response analysis to alter GFP expression in one or more clones. To validate the concept of the high-throughput screen, we have characterized CID 3528206, a small molecule most likely to act on TORC1 as it alters GFP expression in all five GFP clones in a manner analogous to that of rapamycin. We have shown that CID 3528206 inhibited yeast cell growth and that CID 3528206 inhibited TORC1 activity both in vitro and in vivo with EC(50)'s of 150 nM and 3.9 μM, respectively. The results of microarray analysis and yeast GFP collection screen further support the notion that CID 3528206 and rapamycin modulate similar cellular pathways. Together, these results indicate that the HTS has identified a potentially useful small molecule for further development of TOR inhibitors.

  15. Yeast-2-Hybrid data file showing progranulin interactions in human fetal brain and bone marrow libraries.

    PubMed

    Tegeder, Irmgard

    2016-12-01

    Progranulin deficiency in humans is associated with neurodegeneration. Its mechanisms are not yet fully understood. We performed a Yeast-2-Hybrid screen using human full-length progranulin as bait to assess the interactions of progranulin. Progranulin was screened against human fetal brain and human bone marrow libraries using the standard Matchmaker technology (Clontech). This article contains the full Y2H data table, including blast results and sequences, a sorted table according to selection criteria for likely positive, putatively positive, likely false and false preys, and tables showing the gene ontology terms associated with the likely and putative preys of the brain and bone marrow libraries. The interactions with autophagy proteins were confirmed and functionally analyzed in "Progranulin overexpression in sensory neurons attenuates neuropathic pain in mice: Role of autophagy" (C. Altmann, S. Hardt, C. Fischer, J. Heidler, H.Y. Lim, A. Haussler, B. Albuquerque, B. Zimmer, C. Moser, C. Behrends, F. Koentgen, I. Wittig, M.H. Schmidt, A.M. Clement, T. Deller, I. Tegeder, 2016) [1].

  16. Transcriptional Response to Lactic Acid Stress in the Hybrid Yeast Zygosaccharomyces parabailii.

    PubMed

    Ortiz-Merino, Raúl A; Kuanyshev, Nurzhan; Byrne, Kevin P; Varela, Javier A; Morrissey, John P; Porro, Danilo; Wolfe, Kenneth H; Branduardi, Paola

    2018-03-01

    Lactic acid has a wide range of applications starting from its undissociated form, and its production using cell factories requires stress-tolerant microbial hosts. The interspecies hybrid yeast Zygosaccharomyces parabailii has great potential to be exploited as a novel host for lactic acid production, due to high organic acid tolerance at low pH and a fermentative metabolism with a high growth rate. Here we used mRNA sequencing (RNA-seq) to analyze Z. parabailii 's transcriptional response to lactic acid added exogenously, and we explore the biological mechanisms involved in tolerance. Z. parabailii contains two homeologous copies of most genes. Under lactic acid stress, the two genes in each homeolog pair tend to diverge in expression to a significantly greater extent than under control conditions, indicating that stress tolerance is facilitated by interactions between the two gene sets in the hybrid. Lactic acid induces downregulation of genes related to cell wall and plasma membrane functions, possibly altering the rate of diffusion of lactic acid into cells. Genes related to iron transport and redox processes were upregulated, suggesting an important role for respiratory functions and oxidative stress defense. We found differences in the expression profiles of genes putatively regulated by Haa1 and Aft1/Aft2, previously described as lactic acid responsive in Saccharomyces cerevisiae Furthermore, formate dehydrogenase ( FDH ) genes form a lactic acid-responsive gene family that has been specifically amplified in Z. parabailii in comparison to other closely related species. Our study provides a useful starting point for the engineering of Z. parabailii as a host for lactic acid production. IMPORTANCE Hybrid yeasts are important in biotechnology because of their tolerance to harsh industrial conditions. The molecular mechanisms of tolerance can be studied by analyzing differential gene expression under conditions of interest and relating gene expression patterns

  17. Characterization of single chain antibody targets through yeast two hybrid

    PubMed Central

    2010-01-01

    Background Due to their unique ability to bind their targets with high fidelity, antibodies are used widely not only in biomedical research, but also in many clinical applications. Recombinant antibodies, including single chain variable fragments (scFv), are gaining momentum because they allow powerful in vitro selection and manipulation without loss of function. Regardless of the ultimate application or type of antibody used, precise understanding of the interaction between the antibody's binding site and its specific target epitope(s) is of great importance. However, such data is frequently difficult to obtain. Results We describe an approach that allows detailed characterization of a given antibody's target(s) using the yeast two-hybrid system. Several recombinant scFv were used as bait and screened against highly complex cDNA libraries. Systematic sequencing of all retained clones and statistical analysis allowed efficient ranking of the prey fragments. Multiple alignment of the obtained cDNA fragments provided a selected interacting domain (SID), efficiently narrowing the epitope-containing region. Interactions between antibodies and their respective targets were characterized for several scFv. For AA2 and ROF7, two conformation-specific sensors that exclusively bind the activated forms of the small GTPases Rab6 and Rab1 respectively, only fragments expressing the entire target protein's core region were retained. This strongly suggested interaction with a non-linear epitope. For two other scFv, TA10 and SF9, which recognize the large proteins giantin and non-muscle myosin IIA, respectively, precise antibody-binding regions within the target were defined. Finally, for some antibodies, secondary targets within and across species could be revealed. Conclusions Our method, utilizing the yeast two-hybrid technology and scFv as bait, is a simple yet powerful approach for the detailed characterization of antibody targets. It allows precise domain mapping for linear

  18. Combined zebrafish-yeast chemical-genetic screens reveal gene-copper-nutrition interactions that modulate melanocyte pigmentation.

    PubMed

    Ishizaki, Hironori; Spitzer, Michaela; Wildenhain, Jan; Anastasaki, Corina; Zeng, Zhiqiang; Dolma, Sonam; Shaw, Michael; Madsen, Erik; Gitlin, Jonathan; Marais, Richard; Tyers, Mike; Patton, E Elizabeth

    2010-01-01

    Hypopigmentation is a feature of copper deficiency in humans, as caused by mutation of the copper (Cu(2+)) transporter ATP7A in Menkes disease, or an inability to absorb copper after gastric surgery. However, many causes of copper deficiency are unknown, and genetic polymorphisms might underlie sensitivity to suboptimal environmental copper conditions. Here, we combined phenotypic screens in zebrafish for compounds that affect copper metabolism with yeast chemical-genetic profiles to identify pathways that are sensitive to copper depletion. Yeast chemical-genetic interactions revealed that defects in intracellular trafficking pathways cause sensitivity to low-copper conditions; partial knockdown of the analogous Ap3s1 and Ap1s1 trafficking components in zebrafish sensitized developing melanocytes to hypopigmentation in low-copper environmental conditions. Because trafficking pathways are essential for copper loading into cuproproteins, our results suggest that hypomorphic alleles of trafficking components might underlie sensitivity to reduced-copper nutrient conditions. In addition, we used zebrafish-yeast screening to identify a novel target pathway in copper metabolism for the small-molecule MEK kinase inhibitor U0126. The zebrafish-yeast screening method combines the power of zebrafish as a disease model with facile genome-scale identification of chemical-genetic interactions in yeast to enable the discovery and dissection of complex multigenic interactions in disease-gene networks.

  19. High-throughput analysis of the protein sequence-stability landscape using a quantitative "yeast surface two-hybrid" system and fragment reconstitution

    PubMed Central

    Dutta, Sanjib; Koide, Akiko; Koide, Shohei

    2008-01-01

    Stability evaluation of many mutants can lead to a better understanding of the sequence determinants of a structural motif and of factors governing protein stability and protein evolution. The traditional biophysical analysis of protein stability is low throughput, limiting our ability to widely explore the sequence space in a quantitative manner. In this study, we have developed a high-throughput library screening method for quantifying stability changes, which is based on protein fragment reconstitution and yeast surface display. Our method exploits the thermodynamic linkage between protein stability and fragment reconstitution and the ability of the yeast surface display technique to quantitatively evaluate protein-protein interactions. The method was applied to a fibronectin type III (FN3) domain. Characterization of fragment reconstitution was facilitated by the co-expression of two FN3 fragments, thus establishing a "yeast surface two-hybrid" method. Importantly, our method does not rely on competition between clones and thus eliminates a common limitation of high-throughput selection methods in which the most stable variants are predominantly recovered. Thus, it allows for the isolation of sequences that exhibits a desired level of stability. We identified over one hundred unique sequences for a β-bulge motif, which was significantly more informative than natural sequences of the FN3 family in revealing the sequence determinants for the β-bulge. Our method provides a powerful means to rapidly assess stability of many variants, to systematically assess contribution of different factors to protein stability and to enhance protein stability. PMID:18674545

  20. Database for High Throughput Screening Hits (dHITS): a simple tool to retrieve gene specific phenotypes from systematic screens done in yeast.

    PubMed

    Chuartzman, Silvia G; Schuldiner, Maya

    2018-03-25

    In the last decade several collections of Saccharomyces cerevisiae yeast strains have been created. In these collections every gene is modified in a similar manner such as by a deletion or the addition of a protein tag. Such libraries have enabled a diversity of systematic screens, giving rise to large amounts of information regarding gene functions. However, often papers describing such screens focus on a single gene or a small set of genes and all other loci affecting the phenotype of choice ('hits') are only mentioned in tables that are provided as supplementary material and are often hard to retrieve or search. To help unify and make such data accessible, we have created a Database of High Throughput Screening Hits (dHITS). The dHITS database enables information to be obtained about screens in which genes of interest were found as well as the other genes that came up in that screen - all in a readily accessible and downloadable format. The ability to query large lists of genes at the same time provides a platform to easily analyse hits obtained from transcriptional analyses or other screens. We hope that this platform will serve as a tool to facilitate investigation of protein functions to the yeast community. © 2018 The Authors Yeast Published by John Wiley & Sons Ltd.

  1. Combinatorial Screening for Transgenic Yeasts with High Cellulase Activities in Combination with a Tunable Expression System

    PubMed Central

    Ito, Yoichiro; Yamanishi, Mamoru; Ikeuchi, Akinori; Imamura, Chie; Matsuyama, Takashi

    2015-01-01

    Combinatorial screening used together with a broad library of gene expression cassettes is expected to produce a powerful tool for the optimization of the simultaneous expression of multiple enzymes. Recently, we proposed a highly tunable protein expression system that utilized multiple genome-integrated target genes to fine-tune enzyme expression in yeast cells. This tunable system included a library of expression cassettes each composed of three gene-expression control elements that in different combinations produced a wide range of protein expression levels. In this study, four gene expression cassettes with graded protein expression levels were applied to the expression of three cellulases: cellobiohydrolase 1, cellobiohydrolase 2, and endoglucanase 2. After combinatorial screening for transgenic yeasts simultaneously secreting these three cellulases, we obtained strains with higher cellulase expressions than a strain harboring three cellulase-expression constructs within one high-performance gene expression cassette. These results show that our method will be of broad use throughout the field of metabolic engineering. PMID:26692026

  2. Lager Yeast Comes of Age

    PubMed Central

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  3. Protein–protein interactions and selection: yeast-based approaches that exploit guanine nucleotide-binding protein signaling.

    PubMed

    Ishii, Jun; Fukuda, Nobuo; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

    2010-05-01

    For elucidating protein–protein interactions, many methodologies have been developed during the past two decades. For investigation of interactions inside cells under physiological conditions, yeast is an attractive organism with which to quickly screen for hopeful candidates using versatile genetic technologies, and various types of approaches are now available.Among them, a variety of unique systems using the guanine nucleotide-binding protein (G-protein) signaling pathway in yeast have been established to investigate the interactions of proteins for biological study and pharmaceutical research. G-proteins involved in various cellular processes are mainly divided into two groups: small monomeric G-proteins,and heterotrimeric G-proteins. In this minireview, we summarize the basic principles and applications of yeast-based screening systems, using these two types of G-protein, which are typically used for elucidating biological protein interactions but are differentiated from traditional yeast two-hybrid systems.

  4. Male Yeast Infection: How Can I Tell if I Have One?

    MedlinePlus

    ... tell if I have one? Can men get yeast infections? What are the signs and symptoms of a male yeast infection? Answers from James M. Steckelberg, M.D. Yes, men can get yeast infections, too, which can lead to a condition ...

  5. Exploring the potential of Saccharomyces eubayanus as a parent for new interspecies hybrid strains in winemaking.

    PubMed

    Magalhães, Frederico; Krogerus, Kristoffer; Castillo, Sandra; Ortiz-Julien, Anne; Dequin, Sylvie; Gibson, Brian

    2017-08-01

    Yeast cryotolerance brings some advantages for wine fermentations, including the improved aromatic complexity of white wines. Naturally cold-tolerant strains are generally less adept at wine fermentation but fermentative fitness can potentially be improved through hybridization. Here we studied the potential of using hybrids involving Saccharomyces eubayanus and a S. cerevisiae wine strain for low-temperature winemaking. Through screening the performance in response to variable concentrations of sugar, nitrogen and temperature, we isolated one hybrid strain that exhibited the superior performance. This hybrid strain was propagated and dried in pilot scale and tested for the fermentation of Macabeu and Sauvignon blanc grape musts. We obtained highly viable active dry yeast, which was able to efficiently ferment the grape musts with superior production of aroma active volatiles, in particular, 2-phenylethanol. The genome sequences of the hybrid strains revealed variable chromosome inheritance among hybrids, particularly within the S. cerevisiae subgenome. With the present paper, we expand the knowledge on the potentialities of using S. eubayanus hybrids in industrial fermentation at beverages other than lager beer. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

  7. New yeasts-new brews: modern approaches to brewing yeast design and development.

    PubMed

    Gibson, B; Geertman, J-M A; Hittinger, C T; Krogerus, K; Libkind, D; Louis, E J; Magalhães, F; Sampaio, J P

    2017-06-01

    The brewing industry is experiencing a period of change and experimentation largely driven by customer demand for product diversity. This has coincided with a greater appreciation of the role of yeast in determining the character of beer and the widespread availability of powerful tools for yeast research. Genome analysis in particular has helped clarify the processes leading to domestication of brewing yeast and has identified domestication signatures that may be exploited for further yeast development. The functional properties of non-conventional yeast (both Saccharomyces and non-Saccharomyces) are being assessed with a view to creating beers with new flavours as well as producing flavoursome non-alcoholic beers. The discovery of the psychrotolerant S. eubayanus has stimulated research on de novo S. cerevisiae × S. eubayanus hybrids for low-temperature lager brewing and has led to renewed interest in the functional importance of hybrid organisms and the mechanisms that determine hybrid genome function and stability. The greater diversity of yeast that can be applied in brewing, along with an improved understanding of yeasts' evolutionary history and biology, is expected to have a significant and direct impact on the brewing industry, with potential for improved brewing efficiency, product diversity and, above all, customer satisfaction. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Overexpression screens identify conserved dosage chromosome instability genes in yeast and human cancer

    PubMed Central

    Duffy, Supipi; Fam, Hok Khim; Wang, Yi Kan; Styles, Erin B.; Kim, Jung-Hyun; Ang, J. Sidney; Singh, Tejomayee; Larionov, Vladimir; Shah, Sohrab P.; Andrews, Brenda; Boerkoel, Cornelius F.; Hieter, Philip

    2016-01-01

    Somatic copy number amplification and gene overexpression are common features of many cancers. To determine the role of gene overexpression on chromosome instability (CIN), we performed genome-wide screens in the budding yeast for yeast genes that cause CIN when overexpressed, a phenotype we refer to as dosage CIN (dCIN), and identified 245 dCIN genes. This catalog of genes reveals human orthologs known to be recurrently overexpressed and/or amplified in tumors. We show that two genes, TDP1, a tyrosyl-DNA-phosphdiesterase, and TAF12, an RNA polymerase II TATA-box binding factor, cause CIN when overexpressed in human cells. Rhabdomyosarcoma lines with elevated human Tdp1 levels also exhibit CIN that can be partially rescued by siRNA-mediated knockdown of TDP1. Overexpression of dCIN genes represents a genetic vulnerability that could be leveraged for selective killing of cancer cells through targeting of an unlinked synthetic dosage lethal (SDL) partner. Using SDL screens in yeast, we identified a set of genes that when deleted specifically kill cells with high levels of Tdp1. One gene was the histone deacetylase RPD3, for which there are known inhibitors. Both HT1080 cells overexpressing hTDP1 and rhabdomyosarcoma cells with elevated levels of hTdp1 were more sensitive to histone deacetylase inhibitors valproic acid (VPA) and trichostatin A (TSA), recapitulating the SDL interaction in human cells and suggesting VPA and TSA as potential therapeutic agents for tumors with elevated levels of hTdp1. The catalog of dCIN genes presented here provides a candidate list to identify genes that cause CIN when overexpressed in cancer, which can then be leveraged through SDL to selectively target tumors. PMID:27551064

  9. Interaction of CSFV E2 Protein with Swine Host Factors as Detected by Yeast Two-Hybrid System

    PubMed Central

    Gladue, Douglas P.; Baker-Bransetter, Ryan; Holinka, Lauren G.; Fernandez-Sainz, Ignacio J.; O’Donnell, Vivian; Fletcher, Paige; Lu, Zhiqiang; Borca, Manuel V.

    2014-01-01

    E2 is one of the envelope glycoproteins of pestiviruses, including classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV). E2 is involved in several critical functions, including virus entry into target cells, induction of a protective immune response and virulence in swine. However, there is no information regarding any host binding partners for the E2 proteins. Here, we utilized the yeast two-hybrid system and identified fifty-seven host proteins as positive binding partners which bound E2 from both CSFV and BVDV with the exception of two proteins that were found to be positive for binding only to CSFV E2. Alanine scanning of CSFV E2 demonstrated that the binding sites for these cellular proteins on E2 are likely non-linear binding sites. The possible roles of the identified host proteins are discussed as the results presented here will be important for future studies to elucidate mechanisms of host protein-virus interactions during pestivirus infection. However, due to the limitations of the yeast two hybrid system, the proteins identified is not exhaustive and each interaction identified needs to be confirmed by independent experimental approaches in the context of virus-infected cells before any definitive conclusion can be drawn on relevance for the virus life cycle. PMID:24416391

  10. Identification of inhibitors of yeast-to-hyphae transition in Candida albicans by a reporter screening assay.

    PubMed

    Heintz-Buschart, Anna; Eickhoff, Holger; Hohn, Erwin; Bilitewski, Ursula

    2013-03-10

    Candida albicans is one of the most common opportunistic fungal pathogens, causing life-threatening disease in immunocompromised patients. As it is not primarily a pathogen, but can exist in a commensal state, we aimed at the identification of new anti-infective compounds which do not eradicate the fungus, but primarily disable a virulence determinant. The yeast–hyphae-dimorphism of C. albicans is considered a major contributor to fungal disease, as mutants locked into either yeast or hyphal state have been shown to be less virulent in the mouse-model. We devised a high-throughput screening procedure which allows us to find inhibitors of the induction of hyphae. Hyphae-formation was induced by nitrogen starvation at 37 °C and neutral pH in a reporter strain, which couples promoter activity of the hyphae-specific HWP1 to β-galactosidase expression. In a pilot screening of 720 novel synthetic compounds, we identified substances which inhibited the outgrowth of germ tubes. They belonged to chemical classes not yet known for antimycotic properties, namely methyl aryl-oxazoline carboxylates, dihydrobenzo[d]isoxazolones and thiazolo[4,5-e]benzoisoxazoles. In conclusion we developed a novel screening assay, which addresses the morphological switch from the yeast form of C. albicans to its hyphal form and identified novel chemical structures with activity against C. albicans. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Microfluidic screening and whole-genome sequencing identifies mutations associated with improved protein secretion by yeast.

    PubMed

    Huang, Mingtao; Bai, Yunpeng; Sjostrom, Staffan L; Hallström, Björn M; Liu, Zihe; Petranovic, Dina; Uhlén, Mathias; Joensson, Haakan N; Andersson-Svahn, Helene; Nielsen, Jens

    2015-08-25

    There is an increasing demand for biotech-based production of recombinant proteins for use as pharmaceuticals in the food and feed industry and in industrial applications. Yeast Saccharomyces cerevisiae is among preferred cell factories for recombinant protein production, and there is increasing interest in improving its protein secretion capacity. Due to the complexity of the secretory machinery in eukaryotic cells, it is difficult to apply rational engineering for construction of improved strains. Here we used high-throughput microfluidics for the screening of yeast libraries, generated by UV mutagenesis. Several screening and sorting rounds resulted in the selection of eight yeast clones with significantly improved secretion of recombinant α-amylase. Efficient secretion was genetically stable in the selected clones. We performed whole-genome sequencing of the eight clones and identified 330 mutations in total. Gene ontology analysis of mutated genes revealed many biological processes, including some that have not been identified before in the context of protein secretion. Mutated genes identified in this study can be potentially used for reverse metabolic engineering, with the objective to construct efficient cell factories for protein secretion. The combined use of microfluidics screening and whole-genome sequencing to map the mutations associated with the improved phenotype can easily be adapted for other products and cell types to identify novel engineering targets, and this approach could broadly facilitate design of novel cell factories.

  12. Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

    PubMed

    Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

    2016-10-24

    Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Complex Ancestries of Lager-Brewing Hybrids Were Shaped by Standing Variation in the Wild Yeast Saccharomyces eubayanus.

    PubMed

    Peris, David; Langdon, Quinn K; Moriarty, Ryan V; Sylvester, Kayla; Bontrager, Martin; Charron, Guillaume; Leducq, Jean-Baptiste; Landry, Christian R; Libkind, Diego; Hittinger, Chris Todd

    2016-07-01

    Lager-style beers constitute the vast majority of the beer market, and yet, the genetic origin of the yeast strains that brew them has been shrouded in mystery and controversy. Unlike ale-style beers, which are generally brewed with Saccharomyces cerevisiae, lagers are brewed at colder temperatures with allopolyploid hybrids of Saccharomyces eubayanus x S. cerevisiae. Since the discovery of S. eubayanus in 2011, additional strains have been isolated from South America, North America, Australasia, and Asia, but only interspecies hybrids have been isolated in Europe. Here, using genome sequence data, we examine the relationships of these wild S. eubayanus strains to each other and to domesticated lager strains. Our results support the existence of a relatively low-diversity (π = 0.00197) lineage of S. eubayanus whose distribution stretches across the Holarctic ecozone and includes wild isolates from Tibet, new wild isolates from North America, and the S. eubayanus parents of lager yeasts. This Holarctic lineage is closely related to a population with higher diversity (π = 0.00275) that has been found primarily in South America but includes some widely distributed isolates. A second diverse South American population (π = 0.00354) and two early-diverging Asian subspecies are more distantly related. We further show that no single wild strain from the Holarctic lineage is the sole closest relative of lager yeasts. Instead, different parts of the genome portray different phylogenetic signals and ancestry, likely due to outcrossing and incomplete lineage sorting. Indeed, standing genetic variation within this wild Holarctic lineage of S. eubayanus is responsible for genetic variation still segregating among modern lager-brewing hybrids. We conclude that the relationships among wild strains of S. eubayanus and their domesticated hybrids reflect complex biogeographical and genetic processes.

  14. Complex ancestries of lager-brewing hybrids were shaped by standing variation in the wild yeast Saccharomyces eubayanus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peris, David; Langdon, Quinn K.; Moriarty, Ryan V.

    Lager-style beers constitute the vast majority of the beer market, and yet, the genetic origin of the yeast strains that brew them has been shrouded in mystery and controversy. Unlike alestyle beers, which are generally brewed with Saccharomyces cerevisiae, lagers are brewed at colder temperatures with allopolyploid hybrids of Saccharomyces eubayanus x S. cerevisiae. Since the discovery of S. eubayanus in 2011, additional strains have been isolated from South America, North America, Australasia, and Asia, but only interspecies hybrids have been isolated in Europe. Here, using genome sequence data, we examine the relationships of these wild S. eubayanus strains tomore » each other and to domesticated lager strains. Our results support the existence of a relatively low-diversity (π = 0.00197) lineage of S. eubayanus whose distribution stretches across the Holarctic ecozone and includes wild isolates from Tibet, new wild isolates from North America, and the S. eubayanus parents of lager yeasts. This Holarctic lineage is closely related to a population with higher diversity (π = 0.00275) that has been found primarily in South America but includes some widely distributed isolates. A second diverse South American population (π = 0.00354) and two early-diverging Asian subspecies are more distantly related. We further show that no single wild strain from the Holarctic lineage is the sole closest relative of lager yeasts. Instead, different parts of the genome portray different phylogenetic signals and ancestry, likely due to outcrossing and incomplete lineage sorting. Indeed, standing genetic variation within this wild Holarctic lineage of S. eubayanus is responsible for genetic variation still segregating among modern lager-brewing hybrids. Furthermore, we conclude that the relationships among wild strains of S. eubayanus and their domesticated hybrids reflect complex biogeographical and genetic processes.« less

  15. Complex Ancestries of Lager-Brewing Hybrids Were Shaped by Standing Variation in the Wild Yeast Saccharomyces eubayanus

    PubMed Central

    Sylvester, Kayla; Charron, Guillaume; Leducq, Jean-Baptiste; Landry, Christian R.; Libkind, Diego; Hittinger, Chris Todd

    2016-01-01

    Lager-style beers constitute the vast majority of the beer market, and yet, the genetic origin of the yeast strains that brew them has been shrouded in mystery and controversy. Unlike ale-style beers, which are generally brewed with Saccharomyces cerevisiae, lagers are brewed at colder temperatures with allopolyploid hybrids of Saccharomyces eubayanus x S. cerevisiae. Since the discovery of S. eubayanus in 2011, additional strains have been isolated from South America, North America, Australasia, and Asia, but only interspecies hybrids have been isolated in Europe. Here, using genome sequence data, we examine the relationships of these wild S. eubayanus strains to each other and to domesticated lager strains. Our results support the existence of a relatively low-diversity (π = 0.00197) lineage of S. eubayanus whose distribution stretches across the Holarctic ecozone and includes wild isolates from Tibet, new wild isolates from North America, and the S. eubayanus parents of lager yeasts. This Holarctic lineage is closely related to a population with higher diversity (π = 0.00275) that has been found primarily in South America but includes some widely distributed isolates. A second diverse South American population (π = 0.00354) and two early-diverging Asian subspecies are more distantly related. We further show that no single wild strain from the Holarctic lineage is the sole closest relative of lager yeasts. Instead, different parts of the genome portray different phylogenetic signals and ancestry, likely due to outcrossing and incomplete lineage sorting. Indeed, standing genetic variation within this wild Holarctic lineage of S. eubayanus is responsible for genetic variation still segregating among modern lager-brewing hybrids. We conclude that the relationships among wild strains of S. eubayanus and their domesticated hybrids reflect complex biogeographical and genetic processes. PMID:27385107

  16. Complex ancestries of lager-brewing hybrids were shaped by standing variation in the wild yeast Saccharomyces eubayanus

    DOE PAGES

    Peris, David; Langdon, Quinn K.; Moriarty, Ryan V.; ...

    2016-07-06

    Lager-style beers constitute the vast majority of the beer market, and yet, the genetic origin of the yeast strains that brew them has been shrouded in mystery and controversy. Unlike alestyle beers, which are generally brewed with Saccharomyces cerevisiae, lagers are brewed at colder temperatures with allopolyploid hybrids of Saccharomyces eubayanus x S. cerevisiae. Since the discovery of S. eubayanus in 2011, additional strains have been isolated from South America, North America, Australasia, and Asia, but only interspecies hybrids have been isolated in Europe. Here, using genome sequence data, we examine the relationships of these wild S. eubayanus strains tomore » each other and to domesticated lager strains. Our results support the existence of a relatively low-diversity (π = 0.00197) lineage of S. eubayanus whose distribution stretches across the Holarctic ecozone and includes wild isolates from Tibet, new wild isolates from North America, and the S. eubayanus parents of lager yeasts. This Holarctic lineage is closely related to a population with higher diversity (π = 0.00275) that has been found primarily in South America but includes some widely distributed isolates. A second diverse South American population (π = 0.00354) and two early-diverging Asian subspecies are more distantly related. We further show that no single wild strain from the Holarctic lineage is the sole closest relative of lager yeasts. Instead, different parts of the genome portray different phylogenetic signals and ancestry, likely due to outcrossing and incomplete lineage sorting. Indeed, standing genetic variation within this wild Holarctic lineage of S. eubayanus is responsible for genetic variation still segregating among modern lager-brewing hybrids. Furthermore, we conclude that the relationships among wild strains of S. eubayanus and their domesticated hybrids reflect complex biogeographical and genetic processes.« less

  17. Screening and evaluation of the glucoside hydrolase activity in Saccharomyces and Brettanomyces brewing yeasts.

    PubMed

    Daenen, L; Saison, D; Sterckx, F; Delvaux, F R; Verachtert, H; Derdelinckx, G

    2008-02-01

    The aim of this study was to select and examine Saccharomyces and Brettanomyces brewing yeasts for hydrolase activity towards glycosidically bound volatile compounds. A screening for glucoside hydrolase activity of 58 brewing yeasts belonging to the genera Saccharomyces and Brettanomyces was performed. The studied Saccharomyces brewing yeasts did not show 1,4-beta-glucosidase activity, but a strain dependent beta-glucanase activity was observed. Some Brettanomyces species did show 1,4-beta-glucosidase activity. The highest constitutive activity was found in Brettanomyces custersii. For the most interesting strains the substrate specificity was studied and their activity was evaluated in fermentation experiments with added hop glycosides. Fermentations with Br. custersii led to the highest release of aglycones. Pronounced exo-beta-glucanase activity in Saccharomyces brewing yeasts leads to a higher release of certain aglycones. Certain Brettanomyces brewing yeasts, however, are more interesting for hydrolysis of glycosidically bound volatiles of hops. The release of flavour active compounds from hop glycosides opens perspectives for the bioflavouring and product diversification of beverages like beer. The release can be enhanced by using Saccharomyces strains with high exo-beta-glucanase activity. Higher activities can be found in Brettanomyces species with beta-glucosidase activity.

  18. A Large Set of Newly Created Interspecific Saccharomyces Hybrids Increases Aromatic Diversity in Lager Beers

    PubMed Central

    Mertens, Stijn; Steensels, Jan; Saels, Veerle; De Rouck, Gert; Aerts, Guido

    2015-01-01

    Lager beer is the most consumed alcoholic beverage in the world. Its production process is marked by a fermentation conducted at low (8 to 15°C) temperatures and by the use of Saccharomyces pastorianus, an interspecific hybrid between Saccharomyces cerevisiae and the cold-tolerant Saccharomyces eubayanus. Recent whole-genome-sequencing efforts revealed that the currently available lager yeasts belong to one of only two archetypes, “Saaz” and “Frohberg.” This limited genetic variation likely reflects that all lager yeasts descend from only two separate interspecific hybridization events, which may also explain the relatively limited aromatic diversity between the available lager beer yeasts compared to, for example, wine and ale beer yeasts. In this study, 31 novel interspecific yeast hybrids were developed, resulting from large-scale robot-assisted selection and breeding between carefully selected strains of S. cerevisiae (six strains) and S. eubayanus (two strains). Interestingly, many of the resulting hybrids showed a broader temperature tolerance than their parental strains and reference S. pastorianus yeasts. Moreover, they combined a high fermentation capacity with a desirable aroma profile in laboratory-scale lager beer fermentations, thereby successfully enriching the currently available lager yeast biodiversity. Pilot-scale trials further confirmed the industrial potential of these hybrids and identified one strain, hybrid H29, which combines a fast fermentation, high attenuation, and the production of a complex, desirable fruity aroma. PMID:26407881

  19. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    PubMed

    Servienė, Elena; Lukša, Juliana; Orentaitė, Irma; Lafontaine, Denis L J; Urbonavičius, Jaunius

    2012-01-01

    Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  20. High-throughput crystal-optimization strategies in the South Paris Yeast Structural Genomics Project: one size fits all?

    PubMed

    Leulliot, Nicolas; Trésaugues, Lionel; Bremang, Michael; Sorel, Isabelle; Ulryck, Nathalie; Graille, Marc; Aboulfath, Ilham; Poupon, Anne; Liger, Dominique; Quevillon-Cheruel, Sophie; Janin, Joël; van Tilbeurgh, Herman

    2005-06-01

    Crystallization has long been regarded as one of the major bottlenecks in high-throughput structural determination by X-ray crystallography. Structural genomics projects have addressed this issue by using robots to set up automated crystal screens using nanodrop technology. This has moved the bottleneck from obtaining the first crystal hit to obtaining diffraction-quality crystals, as crystal optimization is a notoriously slow process that is difficult to automatize. This article describes the high-throughput optimization strategies used in the Yeast Structural Genomics project, with selected successful examples.

  1. Screening wild yeast strains for alcohol fermentation from various fruits.

    PubMed

    Lee, Yeon-Ju; Choi, Yu-Ri; Lee, So-Young; Park, Jong-Tae; Shim, Jae-Hoon; Park, Kwan-Hwa; Kim, Jung-Wan

    2011-03-01

    Wild yeasts on the surface of various fruits including grapes were surveyed to obtain yeast strains suitable for fermenting a novel wine with higher alcohol content and supplemented with rice starch. We considered selected characteristics, such as tolerance to alcohol and osmotic pressure, capability of utilizing maltose, and starch hydrolysis. Among 637 putative yeast isolates, 115 strains exhibiting better growth in yeast-peptone-dextrose broth containing 30% dextrose, 7% alcohol, or 2% maltose were selected, as well as five α-amylase producers. Nucleotide sequence analysis of the 26S rDNA gene classified the strains into 13 species belonging to five genera; Pichia anomala was the most prevalent (41.7%), followed by Wickerhamomyces anomalus (19.2%), P. guilliermondii (15%), Candida spp. (5.8%), Kodamaea ohmeri (2.5%), and Metschnikowia spp. (2.5%). All of the α-amylase producers were Aureobasidium pullulans. Only one isolate (NK28) was identified as Saccharomyces cerevisiae. NK28 had all of the desired properties for the purpose of this study, except α-amylase production, and fermented alcohol better than commercial wine yeasts.

  2. Discovery of a diaminoquinoxaline benzenesulfonamide antagonist of HIV-1 Nef function using a yeast-based phenotypic screen

    PubMed Central

    2013-01-01

    Background HIV-1 Nef is a viral accessory protein critical for AIDS progression. Nef lacks intrinsic catalytic activity and binds multiple host cell signaling proteins, including Hck and other Src-family tyrosine kinases. Nef binding induces constitutive Hck activation that may contribute to HIV pathogenesis by promoting viral infectivity, replication and downregulation of cell-surface MHC-I molecules. In this study, we developed a yeast-based phenotypic screen to identify small molecules that inhibit the Nef-Hck complex. Results Nef-Hck interaction was faithfully reconstituted in yeast cells, resulting in kinase activation and growth arrest. Yeast cells expressing the Nef-Hck complex were used to screen a library of small heterocyclic compounds for their ability to rescue growth inhibition. The screen identified a dihydrobenzo-1,4-dioxin-substituted analog of 2-quinoxalinyl-3-aminobenzene-sulfonamide (DQBS) as a potent inhibitor of Nef-dependent HIV-1 replication and MHC-I downregulation in T-cells. Docking studies predicted direct binding of DQBS to Nef which was confirmed in differential scanning fluorimetry assays with recombinant purified Nef protein. DQBS also potently inhibited the replication of HIV-1 NL4-3 chimeras expressing Nef alleles representative of all M-group HIV-1 clades. Conclusions Our findings demonstrate the utility of a yeast-based growth reversion assay for the identification of small molecule Nef antagonists. Inhibitors of Nef function discovered with this assay, such as DQBS, may complement the activity of current antiretroviral therapies by enabling immune recognition of HIV-infected cells through the rescue of cell surface MHC-I. PMID:24229420

  3. A large set of newly created interspecific Saccharomyces hybrids increases aromatic diversity in lager beers.

    PubMed

    Mertens, Stijn; Steensels, Jan; Saels, Veerle; De Rouck, Gert; Aerts, Guido; Verstrepen, Kevin J

    2015-12-01

    Lager beer is the most consumed alcoholic beverage in the world. Its production process is marked by a fermentation conducted at low (8 to 15°C) temperatures and by the use of Saccharomyces pastorianus, an interspecific hybrid between Saccharomyces cerevisiae and the cold-tolerant Saccharomyces eubayanus. Recent whole-genome-sequencing efforts revealed that the currently available lager yeasts belong to one of only two archetypes, "Saaz" and "Frohberg." This limited genetic variation likely reflects that all lager yeasts descend from only two separate interspecific hybridization events, which may also explain the relatively limited aromatic diversity between the available lager beer yeasts compared to, for example, wine and ale beer yeasts. In this study, 31 novel interspecific yeast hybrids were developed, resulting from large-scale robot-assisted selection and breeding between carefully selected strains of S. cerevisiae (six strains) and S. eubayanus (two strains). Interestingly, many of the resulting hybrids showed a broader temperature tolerance than their parental strains and reference S. pastorianus yeasts. Moreover, they combined a high fermentation capacity with a desirable aroma profile in laboratory-scale lager beer fermentations, thereby successfully enriching the currently available lager yeast biodiversity. Pilot-scale trials further confirmed the industrial potential of these hybrids and identified one strain, hybrid H29, which combines a fast fermentation, high attenuation, and the production of a complex, desirable fruity aroma. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Screening of intact yeasts and cell extracts to reduce Scrapie prions during biotransformation of food waste.

    PubMed

    Huyben, David; Boqvist, Sofia; Passoth, Volkmar; Renström, Lena; Allard Bengtsson, Ulrika; Andréoletti, Olivier; Kiessling, Anders; Lundh, Torbjörn; Vågsholm, Ivar

    2018-02-08

    Yeasts can be used to convert organic food wastes to protein-rich animal feed in order to recapture nutrients. However, the reuse of animal-derived waste poses a risk for the transmission of infectious prions that can cause neurodegeneration and fatality in humans and animals. The aim of this study was to investigate the ability of yeasts to reduce prion activity during the biotransformation of waste substrates-thereby becoming a biosafety hurdle in such a circular food system. During pre-screening, 30 yeast isolates were spiked with Classical Scrapie prions and incubated for 72 h in casein substrate, as a waste substitute. Based on reduced Scrapie seeding activity, waste biotransformation and protease activities, intact cells and cell extracts of 10 yeasts were further tested. Prion analysis showed that five yeast species reduced Scrapie seeding activity by approximately 1 log10 or 90%. Cryptococcus laurentii showed the most potential to reduce prion activity since both intact and extracted cells reduced Scrapie by 1 log10 and achieved the highest protease activity. These results show that select forms of yeast can act as a prion hurdle during the biotransformation of waste. However, the limited ability of yeasts to reduce prion activity warrants caution as a sole barrier to transmission as higher log reductions are needed before using waste-cultured yeast in circular food systems.

  5. Chemical genetic screen identifies lithocholic acid as an anti-aging compound that extends yeast chronological life span in a TOR-independent manner, by modulating housekeeping longevity assurance processes.

    PubMed

    Goldberg, Alexander A; Richard, Vincent R; Kyryakov, Pavlo; Bourque, Simon D; Beach, Adam; Burstein, Michelle T; Glebov, Anastasia; Koupaki, Olivia; Boukh-Viner, Tatiana; Gregg, Christopher; Juneau, Mylène; English, Ann M; Thomas, David Y; Titorenko, Vladimir I

    2010-07-01

    In chronologically aging yeast, longevity can be extended by administering a caloric restriction (CR) diet or some small molecules. These life-extending interventions target the adaptable target of rapamycin (TOR) and cAMP/protein kinase A (cAMP/PKA) signaling pathways that are under the stringent control of calorie availability. We designed a chemical genetic screen for small molecules that increase the chronological life span of yeast under CR by targeting lipid metabolism and modulating housekeeping longevity pathways that regulate longevity irrespective of the number of available calories. Our screen identifies lithocholic acid (LCA) as one of such molecules. We reveal two mechanisms underlying the life-extending effect of LCA in chronologically aging yeast. One mechanism operates in a calorie availability-independent fashion and involves the LCA-governed modulation of housekeeping longevity assurance pathways that do not overlap with the adaptable TOR and cAMP/PKA pathways. The other mechanism extends yeast longevity under non-CR conditions and consists in LCA-driven unmasking of the previously unknown anti-aging potential of PKA. We provide evidence that LCA modulates housekeeping longevity assurance pathways by suppressing lipid-induced necrosis, attenuating mitochondrial fragmentation, altering oxidation-reduction processes in mitochondria, enhancing resistance to oxidative and thermal stresses, suppressing mitochondria-controlled apoptosis, and enhancing stability of nuclear and mitochondrial DNA.

  6. Potyvirus helper component-proteinase self-interaction in the yeast two-hybrid system and delineation of the interaction domain involved.

    PubMed

    Urcuqui-Inchima, S; Walter, J; Drugeon, G; German-Retana, S; Haenni, A L; Candresse, T; Bernardi, F; Le Gall, O

    1999-05-25

    Using the yeast two-hybrid system, a screen was performed for possible interactions between the proteins encoded by the 5' region of potyviral genomes [P1, helper component-proteinase (HC-Pro), and P3]. A positive self-interaction involving HC-Pro was detected with lettuce mosaic virus (LMV) and potato virus Y (PVY). The possibility of heterologous interaction between the HC-Pro of LMV and of PVY was also demonstrated. No interaction involving either the P1 or the P3 proteins was detected. A series of ordered deletions from either the N- or C-terminal end of the LMV HC-Pro was used to map the domain involved in interaction to the 72 N-terminal amino acids of the protein, a region known to be dispensable for virus viability but necessary for aphid transmission. A similar but less detailed analysis mapped the interacting domain to the N-terminal half of the PVY HC-Pro. Copyright 1999 Academic Press.

  7. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  8. Search for protein partners of mitochondrial single-stranded DNA-binding protein Rim1p using a yeast two-hybrid system.

    PubMed

    Kucejová, B; Foury, F

    2003-01-01

    RIM1 is a nuclear gene of the yeast Saccharomyces cerevisiae coding for a protein with single-stranded DNA-binding activity that is essential for mitochondrial genome maintenance. No protein partners of Rim1p have been described so far in yeast. To better understand the role of this protein in mitochondrial DNA replication and recombination, a search for protein interactors by the yeast two-hybrid system was performed. This approach led to the identification of several candidates, including a putative transcription factor, Azf1p, and Mph1p, a protein with an RNA helicase domain which is known to influence the mutation rate of nuclear and mitochondrial genomes.

  9. Screening the Budding Yeast Genome Reveals Unique Factors Affecting K2 Toxin Susceptibility

    PubMed Central

    Servienė, Elena; Lukša, Juliana; Orentaitė, Irma

    2012-01-01

    Background Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. Principal Findings We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. Significance Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action. PMID:23227207

  10. Low-frequency chimeric yeast artificial chromosome libraries from flow-sorted human chromosomes 16 and 21.

    PubMed Central

    McCormick, M K; Campbell, E; Deaven, L; Moyzis, R

    1993-01-01

    Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075

  11. Screened hybrid density functionals for solid-state chemistry and physics.

    PubMed

    Janesko, Benjamin G; Henderson, Thomas M; Scuseria, Gustavo E

    2009-01-21

    Density functional theory incorporating hybrid exchange-correlation functionals has been extraordinarily successful in providing accurate, computationally tractable treatments of molecular properties. However, conventional hybrid functionals can be problematic for solids. Their nonlocal, Hartree-Fock-like exchange term decays slowly and incorporates unphysical features in metals and narrow-bandgap semiconductors. This article provides an overview of our group's work on designing hybrid functionals for solids. We focus on the Heyd-Scuseria-Ernzerhof screened hybrid functional [J. Chem. Phys. 2003, 118, 8207], its applications to the chemistry and physics of solids and surfaces, and our efforts to build upon its successes.

  12. Strong FANCA/FANCG but weak FANCA/FANCC interaction in the yeast 2-hybrid system.

    PubMed

    Reuter, T; Herterich, S; Bernhard, O; Hoehn, H; Gross, H J

    2000-01-15

    Three of at least 8 Fanconi anemia (FA) genes have been cloned (FANCA, FANCC, FANCG), but their functions remain unknown. Using the yeast 2-hybrid system and full-length cDNA, the authors found a strong interaction between FANCA and FANCG proteins. They also obtained evidence for a weak interaction between FANCA and FANCC. Neither FANCA nor FANCC was found to interact with itself. These results support the notion of a functional association between the FA gene products. (Blood. 2000;95:719-720)

  13. Multiple Origins of the Pathogenic Yeast Candida orthopsilosis by Separate Hybridizations between Two Parental Species.

    PubMed

    Schröder, Markus S; Martinez de San Vicente, Kontxi; Prandini, Tâmara H R; Hammel, Stephen; Higgins, Desmond G; Bagagli, Eduardo; Wolfe, Kenneth H; Butler, Geraldine

    2016-11-01

    Mating between different species produces hybrids that are usually asexual and stuck as diploids, but can also lead to the formation of new species. Here, we report the genome sequences of 27 isolates of the pathogenic yeast Candida orthopsilosis. We find that most isolates are diploid hybrids, products of mating between two unknown parental species (A and B) that are 5% divergent in sequence. Isolates vary greatly in the extent of homogenization between A and B, making their genomes a mosaic of highly heterozygous regions interspersed with homozygous regions. Separate phylogenetic analyses of SNPs in the A- and B-derived portions of the genome produces almost identical trees of the isolates with four major clades. However, the presence of two mutually exclusive genotype combinations at the mating type locus, and recombinant mitochondrial genomes diagnostic of inter-clade mating, shows that the species C. orthopsilosis does not have a single evolutionary origin but was created at least four times by separate interspecies hybridizations between parents A and B. Older hybrids have lost more heterozygosity. We also identify two isolates with homozygous genomes derived exclusively from parent A, which are pure non-hybrid strains. The parallel emergence of the same hybrid species from multiple independent hybridization events is common in plant evolution, but is much less documented in pathogenic fungi.

  14. N-Screen Aware Multicriteria Hybrid Recommender System Using Weight Based Subspace Clustering

    PubMed Central

    Ullah, Farman; Lee, Sungchang

    2014-01-01

    This paper presents a recommender system for N-screen services in which users have multiple devices with different capabilities. In N-screen services, a user can use various devices in different locations and time and can change a device while the service is running. N-screen aware recommendation seeks to improve the user experience with recommended content by considering the user N-screen device attributes such as screen resolution, media codec, remaining battery time, and access network and the user temporal usage pattern information that are not considered in existing recommender systems. For N-screen aware recommendation support, this work introduces a user device profile collaboration agent, manager, and N-screen control server to acquire and manage the user N-screen devices profile. Furthermore, a multicriteria hybrid framework is suggested that incorporates the N-screen devices information with user preferences and demographics. In addition, we propose an individual feature and subspace weight based clustering (IFSWC) to assign different weights to each subspace and each feature within a subspace in the hybrid framework. The proposed system improves the accuracy, precision, scalability, sparsity, and cold start issues. The simulation results demonstrate the effectiveness and prove the aforementioned statements. PMID:25152921

  15. Interactions between the bud emergence proteins Bem1p and Bem2p and Rho-type GTPases in yeast.

    PubMed

    Peterson, J; Zheng, Y; Bender, L; Myers, A; Cerione, R; Bender, A

    1994-12-01

    The SH3 domain-containing protein Bem1p is needed for normal bud emergence and mating projection formation, two processes that require asymmetric reorganizations of the cortical cytoskeleton in Saccharomyces cerevisiae. To identify proteins that functionally and/or physically interact with Bem1p, we screened for mutations that display synthetic lethality with a mutant allele of the BEM1 gene and for genes whose products display two-hybrid interactions with the Bem1 protein. CDC24, which is required for bud emergence and encodes a GEF (guanine-nucleotide exchange factor) for the essential Rho-type GTPase Cdc42p, was identified during both screens. The COOH-terminal 75 amino acids of Cdc24p, outside of the GEF domain, can interact with a portion of Bem1p that lacks both SH3 domains. Bacterially expressed Cdc24p and Bem1p bind to each other in vitro, indicating that no other yeast proteins are required for this interaction. The most frequently identified gene that arose from the bem1 synthetic-lethal screen was the bud-emergence gene BEM2 (Bender and Pringle. 1991. Mol. Cell Biol. 11:1295-1395), which is allelic with IPL2 (increase in ploidy; Chan and Botstein, 1993. Genetics. 135:677-691). Here we show that Bem2p contains a GAP (GTPase-activating protein) domain for Rho-type GTPases, and that this portion of Bem2p can stimulate in vitro the GTPase activity of Rho1p, a second essential yeast Rho-type GTPase. Cells deleted for BEM2 become large and multinucleate. These and other genetic, two-hybrid, biochemical, and phenotypic data suggest that multiple Rho-type GTPases control the reorganization of the cortical cytoskeleton in yeast and that the functions of these GTPases are tightly coupled. Also, these findings raise the possibility that Bem1p may regulate or be a target of action of one or more of these GTPases.

  16. Interactions between the bud emergence proteins Bem1p and Bem2p and Rho- type GTPases in yeast

    PubMed Central

    1994-01-01

    The SH3 domain-containing protein Bem1p is needed for normal bud emergence and mating projection formation, two processes that require asymmetric reorganizations of the cortical cytoskeleton in Saccharomyces cerevisiae. To identify proteins that functionally and/or physically interact with Bem1p, we screened for mutations that display synthetic lethality with a mutant allele of the BEM1 gene and for genes whose products display two-hybrid interactions with the Bem1 protein. CDC24, which is required for bud emergence and encodes a GEF (guanine- nucleotide exchange factor) for the essential Rho-type GTPase Cdc42p, was identified during both screens. The COOH-terminal 75 amino acids of Cdc24p, outside of the GEF domain, can interact with a portion of Bem1p that lacks both SH3 domains. Bacterially expressed Cdc24p and Bem1p bind to each other in vitro, indicating that no other yeast proteins are required for this interaction. The most frequently identified gene that arose from the bem1 synthetic-lethal screen was the bud-emergence gene BEM2 (Bender and Pringle. 1991. Mol. Cell Biol. 11:1295-1395), which is allelic with IPL2 (increase in ploidy; Chan and Botstein, 1993. Genetics. 135:677-691). Here we show that Bem2p contains a GAP (GTPase-activating protein) domain for Rho-type GTPases, and that this portion of Bem2p can stimulate in vitro the GTPase activity of Rho1p, a second essential yeast Rho-type GTPase. Cells deleted for BEM2 become large and multinucleate. These and other genetic, two-hybrid, biochemical, and phenotypic data suggest that multiple Rho-type GTPases control the reorganization of the cortical cytoskeleton in yeast and that the functions of these GTPases are tightly coupled. Also, these findings raise the possibility that Bem1p may regulate or be a target of action of one or more of these GTPases. PMID:7962098

  17. Integrating high-throughput genetic interaction mapping and high-content screening to explore yeast spindle morphogenesis

    PubMed Central

    Vizeacoumar, Franco J.; van Dyk, Nydia; S.Vizeacoumar, Frederick; Cheung, Vincent; Li, Jingjing; Sydorskyy, Yaroslav; Case, Nicolle; Li, Zhijian; Datti, Alessandro; Nislow, Corey; Raught, Brian; Zhang, Zhaolei; Frey, Brendan; Bloom, Kerry

    2010-01-01

    We describe the application of a novel screening approach that combines automated yeast genetics, synthetic genetic array (SGA) analysis, and a high-content screening (HCS) system to examine mitotic spindle morphogenesis. We measured numerous spindle and cellular morphological parameters in thousands of single mutants and corresponding sensitized double mutants lacking genes known to be involved in spindle function. We focused on a subset of genes that appear to define a highly conserved mitotic spindle disassembly pathway, which is known to involve Ipl1p, the yeast aurora B kinase, as well as the cell cycle regulatory networks mitotic exit network (MEN) and fourteen early anaphase release (FEAR). We also dissected the function of the kinetochore protein Mcm21p, showing that sumoylation of Mcm21p regulates the enrichment of Ipl1p and other chromosomal passenger proteins to the spindle midzone to mediate spindle disassembly. Although we focused on spindle disassembly in a proof-of-principle study, our integrated HCS-SGA method can be applied to virtually any pathway, making it a powerful means for identifying specific cellular functions. PMID:20065090

  18. Investigating flavour characteristics of British ale yeasts: techniques, resources and opportunities for innovation

    PubMed Central

    Parker, Neva; James, Steve; Dicks, Jo; Bond, Chris; Nueno-Palop, Carmen; White, Chris; Roberts, Ian N

    2015-01-01

    Five British ale yeast strains were subjected to flavour profiling under brewery fermentation conditions in which all other brewing parameters were kept constant. Significant variation was observed in the timing and quantity of flavour-related chemicals produced. Genetic tests showed no evidence of hybrid origins in any of the strains, including one strain previously reported as a possible hybrid of Saccharomyces cerevisiae and S. bayanus. Variation maintained in historical S. cerevisiae ale yeast collections is highlighted as a potential source of novelty in innovative strain improvement for bioflavour production. Copyright © 2014 John Wiley & Sons, Ltd. PMID:25361168

  19. Breeding of lager yeast with Saccharomyces cerevisiae improves stress resistance and fermentation performance.

    PubMed

    Garcia Sanchez, Rosa; Solodovnikova, Natalia; Wendland, Jürgen

    2012-08-01

    Lager beer brewing relies on strains collectively known as Saccharomyces carlsbergensis, which are hybrids between S. cerevisiae and S. eubayanus-like strains. Lager yeasts are particularly adapted to low-temperature fermentations. Selection of new yeast strains for improved traits or fermentation performance is laborious, due to the allotetraploid nature of lager yeasts. Initially, we have generated new F1 hybrids by classical genetics, using spore clones of lager yeast and S. cerevisiae and complementation of auxotrophies of the single strains upon mating. These hybrids were improved on several parameters, including growth at elevated temperature and resistance against high osmolarity or high ethanol concentrations. Due to the uncertainty of chromosomal make-up of lager yeast spore clones, we introduced molecular markers to analyse mating-type composition by PCR. Based on these results, new hybrids between a lager and an ale yeast strain were isolated by micromanipulation. These hybrids were not subject to genetic modification. We generated and verified 13 hybrid strains. All of these hybrid strains showed improved stress resistance as seen in the ale parent, including improved survival at the end of fermentation. Importantly, some of the strains showed improved fermentation rates using 18° Plato at 18-25°C. Uniparental mitochondrial DNA inheritance was observed mostly from the S. cerevisiae parent. Copyright © 2012 John Wiley & Sons, Ltd.

  20. Use of one- and two-mediator systems for developing a BOD biosensor based on the yeast Debaryomyces hansenii.

    PubMed

    Zaitseva, A S; Arlyapov, V A; Yudina, N Yu; Alferov, S V; Reshetilov, A N

    2017-03-01

    We investigated the use of one- and two-mediator systems in amperometric BOD biosensors (BOD, biochemical oxygen demand) based on the yeast Debaryomyces hansenii. Screening of nine mediators potentially capable of electron transfer - ferrocene, 1,1'-dimethylferrocene, ferrocenecarboxaldehyde, ferroceneacetonitrile, neutral red, 2,6-dichlorophenolindophenol, thionine, methylene blue and potassium ferricyanide - showed only ferrocene and neutral red to be efficient electron carriers for the eukaryotes studied. Two-mediator systems based on combinations of the investigated compounds were used to increase the efficiency of electron transfer. The developed two-mediator biosensors exceeded their one-mediator analogs by their characteristics. The most preferable two-mediator system for developing a BOD biosensor was a ferrocene-methylene blue combination that ensured a satisfactory long-time stability (43 days), selectivity, sensitivity (the lower limit of the determined BOD 5 concentrations, 2.5mg О 2 /dm 3 ) and speed (assay time for one sample, not greater than 10min) of BOD determination. Analysis of water samples showed that the use of a ferrocene-methylene blue two-mediator system and the yeast D. hansenii enabled registration of data that highly correlated with the results of the standard method (R=0.9913). Copyright © 2017 Elsevier Inc. All rights reserved.

  1. One-Cell Doubling Evaluation by Living Arrays of Yeast, ODELAY!

    DOE PAGES

    Herricks, Thurston; Dilworth, David J.; Mast, Fred D.; ...

    2016-11-16

    Cell growth is a complex phenotype widely used in systems biology to gauge the impact of genetic and environmental perturbations. Due to the magnitude of genome-wide studies, resolution is often sacrificed in favor of throughput, creating a demand for scalable, time-resolved, quantitative methods of growth assessment. We present ODELAY (One-cell Doubling Evaluation by Living Arrays of Yeast), an automated and scalable growth analysis platform. High measurement density and single-cell resolution provide a powerful tool for large-scale multiparameter growth analysis based on the modeling of microcolony expansion on solid media. Pioneered in yeast but applicable to other colony forming organisms, ODELAYmore » extracts the three key growth parameters (lag time, doubling time, and carrying capacity) that define microcolony expansion from single cells, simultaneously permitting the assessment of population heterogeneity. The utility of ODELAY is illustrated using yeast mutants, revealing a spectrum of phenotypes arising from single and combinatorial growth parameter perturbations.« less

  2. One-Cell Doubling Evaluation by Living Arrays of Yeast, ODELAY!

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herricks, Thurston; Dilworth, David J.; Mast, Fred D.

    Cell growth is a complex phenotype widely used in systems biology to gauge the impact of genetic and environmental perturbations. Due to the magnitude of genome-wide studies, resolution is often sacrificed in favor of throughput, creating a demand for scalable, time-resolved, quantitative methods of growth assessment. We present ODELAY (One-cell Doubling Evaluation by Living Arrays of Yeast), an automated and scalable growth analysis platform. High measurement density and single-cell resolution provide a powerful tool for large-scale multiparameter growth analysis based on the modeling of microcolony expansion on solid media. Pioneered in yeast but applicable to other colony forming organisms, ODELAYmore » extracts the three key growth parameters (lag time, doubling time, and carrying capacity) that define microcolony expansion from single cells, simultaneously permitting the assessment of population heterogeneity. The utility of ODELAY is illustrated using yeast mutants, revealing a spectrum of phenotypes arising from single and combinatorial growth parameter perturbations.« less

  3. Screening of transporters to improve xylodextrin utilization in the yeast Saccharomyces cerevisiae.

    PubMed

    Zhang, Chenlu; Acosta-Sampson, Ligia; Yu, Vivian Yaci; Cate, Jamie H D

    2017-01-01

    The economic production of cellulosic biofuel requires efficient and full utilization of all abundant carbohydrates naturally released from plant biomass by enzyme cocktails. Recently, we reconstituted the Neurospora crassa xylodextrin transport and consumption system in Saccharomyces cerevisiae, enabling growth of yeast on xylodextrins aerobically. However, the consumption rate of xylodextrin requires improvement for industrial applications, including consumption in anaerobic conditions. As a first step in this improvement, we report analysis of orthologues of the N. crassa transporters CDT-1 and CDT-2. Transporter ST16 from Trichoderma virens enables faster aerobic growth of S. cerevisiae on xylodextrins compared to CDT-2. ST16 is a xylodextrin-specific transporter, and the xylobiose transport activity of ST16 is not inhibited by cellobiose. Other transporters identified in the screen also enable growth on xylodextrins including xylotriose. Taken together, these results indicate that multiple transporters might prove useful to improve xylodextrin utilization in S. cerevisiae. Efforts to use directed evolution to improve ST16 from a chromosomally-integrated copy were not successful, due to background growth of yeast on other carbon sources present in the selection medium. Future experiments will require increasing the baseline growth rate of the yeast population on xylodextrins, to ensure that the selective pressure exerted on xylodextrin transport can lead to isolation of improved xylodextrin transporters.

  4. Screening interspecific hybrids of Populus (P. ciliata x maximowiczii) using AFLP markers.

    PubMed

    Chauhan, N; Negi, M S; Sabharwal, V; Khurana, D K; Lakshmikumaran, M

    2004-03-01

    Hybrids of Populus ciliata x maximowiczii are very vigorous and outperform both the parents in growth performance and yield. Genetic evaluation of 24 of these interspecific hybrids along with the two mother trees ( Populus ciliata), and five male-parent ( Populus maximowiczii) genotypes was carried out using the AFLP marker assay. Eight AFLP primer combinations detected 428 markers, of which 280 (66%) were polymorphic. Genetic relationships within the samples were evaluated by generating the similarity matrix based on Jaccard's coefficient. The phenetic dendrograms, as well as the PCO plots, separated the hybrids and the two parent species into three distinct clusters. The hybrids grouped closer to the P. ciliata (female parent) cluster as compared to the P. maximowiczii (male parent) cluster. The hybrid cluster contained internal groupings, which correlated to some extent with growth performance. The four best performing hybrids (42m1, 65m1, 23m2, Cm2-5-20/91) formed a distinct sub-cluster. Data from a single primer combination was sufficient for distinguishing the hybrids from the parents and assigning paternity. The hybrids showed 22 markers that were absent in P. ciliata but were monomorphically present in all the hybrids, suggesting outcrossing and common paternity. Further, these 22 markers were found in all the P. maximowiczii genotypes confirming it as the male parent. These male-specific markers can be converted to SCAR markers and used for rapid screening of the P.ciliata x maximowiczii hybrids. The primer combination E-AAC x M-CAA was identified as most suitable for ascertaining true hybridity. AFLP proves to be a useful tool for screening of P. ciliata x maximowiczii hybrids at the early stages of development.

  5. Pathogen effector protein screening in yeast identifies Legionella factors that interfere with membrane trafficking.

    PubMed

    Shohdy, Nadim; Efe, Jem A; Emr, Scott D; Shuman, Howard A

    2005-03-29

    Legionella pneumophila invades and replicates intracellularly in human and protozoan hosts. The bacteria use the Icm/Dot type IVB secretion system to translocate effectors that inhibit phagosome maturation and modulate host vesicle trafficking pathways. To understand how L. pneumophila modulates organelle trafficking in host cells, we carried out pathogen effector protein screening in yeast, identifying L. pneumophila genes that produced membrane trafficking [vacuole protein sorting (VPS)] defects in yeast. We identified four L. pneumophila DNA fragments that perturb sorting of vacuolar proteins. Three encode ORFs of unknown function that are translocated via the Icm/Dot transporter from Legionella into macrophages. VPS inhibitor protein (Vip) A is a coiled-coil protein, VipD is a patatin domain-containing protein, and VipF contains an acetyltransferase domain. Processing studies in yeast indicate that VipA, VipD, and VipF inhibit lysosomal protein trafficking by different mechanisms; overexpressing VipA has an effect on carboxypeptidase Y trafficking, whereas VipD interferes with multivesicular body formation at the late endosome and endoplasmic reticulum-to-Golgi body transport. Such differences highlight the multiple strategies L. pneumophila effectors use to subvert host trafficking processes. Using yeast as an effector gene discovery tool allows for a powerful, genetic approach to both the identification of virulence factors and the study of their function.

  6. A Screened Hybrid DFT Study of Actinide Oxides, Nitrides, and Carbides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wen, Xiaodong; Martin, Richard L.; Scuseria, Gustavo E.

    2013-06-27

    A systematic study of the structural, electronic, and magnetic properties of actinide oxides, nitrides, and carbides (AnX1–2 with X = C, N, O) is performed using the Heyd–Scuseria–Ernzerhof (HSE) hybrid functional. Our computed results show that the screened hybrid HSE functional gives a good description of the electronic and structural properties of actinide dioxides (strongly correlated insulators) when compared with available experimental data. However, there are still some problems reproducing the electronic properties of actinide nitrides and carbides (strongly correlated metals). In addition, in order to compare with the results by HSE, the structures, electronic, and magnetic properties of thesemore » actinide compounds are also investigated in the PBE and PBE+U approximation. Interestingly, the density of states of UN obtained with PBE compares well with the experimental photoemission spectra, in contrast to the hybrid approximation. This is presumably related to the need of additional screening in the Hartree–Fock exchange term of the metallic phases.« less

  7. Screening of effective pharmacological treatments for MELAS syndrome using yeasts, fibroblasts and cybrid models of the disease.

    PubMed

    Garrido-Maraver, Juan; Cordero, Mario D; Moñino, Irene Domínguez; Pereira-Arenas, Sheila; Lechuga-Vieco, Ana V; Cotán, David; De la Mata, Mario; Oropesa-Ávila, Manuel; De Miguel, Manuel; Bautista Lorite, Juan; Rivas Infante, Eloy; Alvarez-Dolado, Manuel; Navas, Plácido; Jackson, Sandra; Francisci, Silvia; Sánchez-Alcázar, José A

    2012-11-01

    MELAS (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a mitochondrial disease most usually caused by point mutations in tRNA genes encoded by mitochondrial DNA (mtDNA). Approximately 80% of cases of MELAS syndrome are associated with a m.3243A > G mutation in the MT-TL1 gene, which encodes the mitochondrial tRNALeu (UUR). Currently, no effective treatments are available for this chronic progressive disorder. Treatment strategies in MELAS and other mitochondrial diseases consist of several drugs that diminish the deleterious effects of the abnormal respiratory chain function, reduce the presence of toxic agents or correct deficiencies in essential cofactors. We evaluated the effectiveness of some common pharmacological agents that have been utilized in the treatment of MELAS, in yeast, fibroblast and cybrid models of the disease. The yeast model harbouring the A14G mutation in the mitochondrial tRNALeu(UUR) gene, which is equivalent to the A3243G mutation in humans, was used in the initial screening. Next, the most effective drugs that were able to rescue the respiratory deficiency in MELAS yeast mutants were tested in fibroblasts and cybrid models of MELAS disease. According to our results, supplementation with riboflavin or coenzyme Q(10) effectively reversed the respiratory defect in MELAS yeast and improved the pathologic alterations in MELAS fibroblast and cybrid cell models. Our results indicate that cell models have great potential for screening and validating the effects of novel drug candidates for MELAS treatment and presumably also for other diseases with mitochondrial impairment. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

  8. Screening of effective pharmacological treatments for MELAS syndrome using yeasts, fibroblasts and cybrid models of the disease

    PubMed Central

    Garrido-Maraver, Juan; Cordero, Mario D; Moñino, Irene Domínguez; Pereira-Arenas, Sheila; Lechuga-Vieco, Ana V; Cotán, David; De la Mata, Mario; Oropesa-Ávila, Manuel; De Miguel, Manuel; Bautista Lorite, Juan; Rivas Infante, Eloy; Álvarez-Dolado, Manuel; Navas, Plácido; Jackson, Sandra; Francisci, Silvia; Sánchez-Alcázar, José A

    2012-01-01

    BACKGROUND AND PURPOSE MELAS (mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes) is a mitochondrial disease most usually caused by point mutations in tRNA genes encoded by mitochondrial DNA (mtDNA). Approximately 80% of cases of MELAS syndrome are associated with a m.3243A > G mutation in the MT-TL1 gene, which encodes the mitochondrial tRNALeu (UUR). Currently, no effective treatments are available for this chronic progressive disorder. Treatment strategies in MELAS and other mitochondrial diseases consist of several drugs that diminish the deleterious effects of the abnormal respiratory chain function, reduce the presence of toxic agents or correct deficiencies in essential cofactors. EXPERIMENTAL APPROACH We evaluated the effectiveness of some common pharmacological agents that have been utilized in the treatment of MELAS, in yeast, fibroblast and cybrid models of the disease. The yeast model harbouring the A14G mutation in the mitochondrial tRNALeu(UUR) gene, which is equivalent to the A3243G mutation in humans, was used in the initial screening. Next, the most effective drugs that were able to rescue the respiratory deficiency in MELAS yeast mutants were tested in fibroblasts and cybrid models of MELAS disease. KEY RESULTS According to our results, supplementation with riboflavin or coenzyme Q10 effectively reversed the respiratory defect in MELAS yeast and improved the pathologic alterations in MELAS fibroblast and cybrid cell models. CONCLUSIONS AND IMPLICATIONS Our results indicate that cell models have great potential for screening and validating the effects of novel drug candidates for MELAS treatment and presumably also for other diseases with mitochondrial impairment. PMID:22747838

  9. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    PubMed

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  10. Yeast as a tool to identify anti-aging compounds

    PubMed Central

    Zimmermann, Andreas; Hofer, Sebastian; Pendl, Tobias; Kainz, Katharina; Madeo, Frank; Carmona-Gutierrez, Didac

    2018-01-01

    Abstract In the search for interventions against aging and age-related diseases, biological screening platforms are indispensable tools to identify anti-aging compounds among large substance libraries. The budding yeast, Saccharomyces cerevisiae, has emerged as a powerful chemical and genetic screening platform, as it combines a rapid workflow with experimental amenability and the availability of a wide range of genetic mutant libraries. Given the amount of conserved genes and aging mechanisms between yeast and human, testing candidate anti-aging substances in yeast gene-deletion or overexpression collections, or de novo derived mutants, has proven highly successful in finding potential molecular targets. Yeast-based studies, for example, have led to the discovery of the polyphenol resveratrol and the natural polyamine spermidine as potential anti-aging agents. Here, we present strategies for pharmacological anti-aging screens in yeast, discuss common pitfalls and summarize studies that have used yeast for drug discovery and target identification. PMID:29905792

  11. Nanoliter microfluidic hybrid method for simultaneous screening and optimization validated with crystallization of membrane proteins

    PubMed Central

    Li, Liang; Mustafi, Debarshi; Fu, Qiang; Tereshko, Valentina; Chen, Delai L.; Tice, Joshua D.; Ismagilov, Rustem F.

    2006-01-01

    High-throughput screening and optimization experiments are critical to a number of fields, including chemistry and structural and molecular biology. The separation of these two steps may introduce false negatives and a time delay between initial screening and subsequent optimization. Although a hybrid method combining both steps may address these problems, miniaturization is required to minimize sample consumption. This article reports a “hybrid” droplet-based microfluidic approach that combines the steps of screening and optimization into one simple experiment and uses nanoliter-sized plugs to minimize sample consumption. Many distinct reagents were sequentially introduced as ≈140-nl plugs into a microfluidic device and combined with a substrate and a diluting buffer. Tests were conducted in ≈10-nl plugs containing different concentrations of a reagent. Methods were developed to form plugs of controlled concentrations, index concentrations, and incubate thousands of plugs inexpensively and without evaporation. To validate the hybrid method and demonstrate its applicability to challenging problems, crystallization of model membrane proteins and handling of solutions of detergents and viscous precipitants were demonstrated. By using 10 μl of protein solution, ≈1,300 crystallization trials were set up within 20 min by one researcher. This method was compatible with growth, manipulation, and extraction of high-quality crystals of membrane proteins, demonstrated by obtaining high-resolution diffraction images and solving a crystal structure. This robust method requires inexpensive equipment and supplies, should be especially suitable for use in individual laboratories, and could find applications in a number of areas that require chemical, biochemical, and biological screening and optimization. PMID:17159147

  12. Screening mechanisms in hybrid metric-Palatini gravity

    NASA Astrophysics Data System (ADS)

    Santos, Marcelo Vargas dos; Alcaniz, Jailson S.; Mota, David F.; Capozziello, Salvatore

    2018-05-01

    We investigate the efficiency of screening mechanisms in the hybrid metric-Palatini gravity. The value of the field is computed around spherical bodies embedded in a background of constant density. We find a thin shell condition for the field depending on the background field value. To quantify how the thin shell effect is relevant, we analyze how it behaves in the neighborhood of different astrophysical objects (planets, moons, or stars). We find that the condition is very well satisfied except only for some peculiar objects. Furthermore we establish bounds on the model using data from Solar System experiments such as the spectral deviation measured by the Cassini mission and the stability of the Earth-Moon system, which gives the best constraint to date on f (R ) theories. These bounds contribute to fix the range of viable hybrid gravity models.

  13. Modulation of molecular hybridization and charge screening in a carbon nanotube network channel using the electrical pulse method.

    PubMed

    Woo, Jun-Myung; Kim, Seok Hyang; Chun, Honnggu; Kim, Sung Jae; Ahn, Jinhong; Park, Young June

    2013-09-21

    In this paper, we investigate the effect of electrical pulse bias on DNA hybridization events in a biosensor platform, using a Carbon Nanotube Network (CNN) and Gold Nano Particles (GNP) as an electrical channel. The scheme provides both hybridization rate enhancement of bio molecules, and electrical measurement in a transient state to avoid the charge screening effect, thereby significantly improving the sensitivity. As an example, the probe DNA molecules oscillate with pulse trains, resulting in the enhancement of DNA hybridization efficiency, and accordingly of the sensor performances in Tris-EDTA (TE) buffer solution, by as much as over three times, compared to the non-biasing conditions. More importantly, a wide dynamic range of 10(6) (target-DNA concentration from 5 pM to 5 μM) is achieved in human serum. In addition, the pulse biasing method enables one to obtain the conductance change, before the ions within the Electrical Double Layer (EDL) are redistributed, to avoid the charge screening effect, leading to an additional sensitivity enhancement.

  14. Network topological analysis reveals the functional cohesiveness for the newly discovered links by Yeast 2 Hybrid approach

    NASA Astrophysics Data System (ADS)

    Ghiassian, Susan; Pevzner, Sam; Rolland, Thomas; Tassan, Murat; Barabasi, Albert Laszlo; Vidal, Mark; CCNR, Northeastern University Collaboration; Dana Farber Cancer Institute Collaboration

    2014-03-01

    Protein-protein interaction maps and interactomes are the blueprint of Network Medicine and systems biology and are being experimentally studied by different groups. Despite the wide usage of Literature Curated Interactome (LCI), these sources are biased towards different parameters such as highly studied proteins. Yeast two hybrid method is a high throughput experimental setup which screens proteins in an unbiased fashion. Current knowledge of protein interactions is far from complete. In fact the previous offered data from Y2H method (2005), is estimated to offer only 5% of all potential protein interactions. Currently this coverage has increased to 20% of what is known as reference HI In this work we study the topological properties of Y2H protein-protein interactions network with LCI and show although they both agree on some properties, LCI shows a clear unbiased nature of interaction selections. Most importantly, we assess the properties of PPI as it evolves with increasing the coverage. We show that, the newly discovered interactions tend to connect proteins that have been closer than average in the previous PPI release. reinforcing the modular structure of PPI. Furthermore, we show, some unseen effects on PPI (as opposed to LCI) can be explained by its incompleteness.

  15. Droplet-based microfluidic high-throughput screening of heterologous enzymes secreted by the yeast Yarrowia lipolytica.

    PubMed

    Beneyton, Thomas; Thomas, Stéphane; Griffiths, Andrew D; Nicaud, Jean-Marc; Drevelle, Antoine; Rossignol, Tristan

    2017-01-31

    Droplet-based microfluidics is becoming an increasingly attractive alternative to microtiter plate techniques for enzymatic high-throughput screening (HTS), especially for exploring large diversities with lower time and cost footprint. In this case, the assayed enzyme has to be accessible to the substrate within the water-in-oil droplet by being ideally extracellular or displayed at the cell surface. However, most of the enzymes screened to date are expressed within the cytoplasm of Escherichia coli cells, which means that a lysis step must take place inside the droplets for enzyme activity to be assayed. Here, we take advantage of the excellent secretion abilities of the yeast Yarrowia lipolytica to describe a highly efficient expression system particularly suitable for the droplet-based microfluidic HTS. Five hydrolytic genes from Aspergillus niger genome were chosen and the corresponding five Yarrowia lipolytica producing strains were constructed. Each enzyme (endo-β-1,4-xylanase B and C; 1,4-β-cellobiohydrolase A; endoglucanase A; aspartic protease) was successfully overexpressed and secreted in an active form in the crude supernatant. A droplet-based microfluidic HTS system was developed to (a) encapsulate single yeast cells; (b) grow yeast in droplets; (c) inject the relevant enzymatic substrate; (d) incubate droplets on chip; (e) detect enzymatic activity; and (f) sort droplets based on enzymatic activity. Combining this integrated microfluidic platform with gene expression in Y. lipolytica results in remarkably low variability in the enzymatic activity at the single cell level within a given monoclonal population (<5%). Xylanase, cellobiohydrolase and protease activities were successfully assayed using this system. We then used the system to screen for thermostable variants of endo-β-1,4-xylanase C in error-prone PCR libraries. Variants displaying higher thermostable xylanase activities compared to the wild-type were isolated (up to 4.7-fold improvement

  16. Yeast diversity and native vigor for flavor phenotypes.

    PubMed

    Carrau, Francisco; Gaggero, Carina; Aguilar, Pablo S

    2015-03-01

    Saccharomyces cerevisiae, the yeast used widely for beer, bread, cider, and wine production, is the most resourceful eukaryotic model used for genetic engineering. A typical concern about using engineered yeasts for food production might be negative consumer perception of genetically modified organisms. However, we believe the true pitfall of using genetically modified yeasts is their limited capacity to either refine or improve the sensory properties of fermented foods under real production conditions. Alternatively, yeast diversity screening to improve the aroma and flavors could offer groundbreaking opportunities in food biotechnology. We propose a 'Yeast Flavor Diversity Screening' strategy which integrates knowledge from sensory analysis and natural whole-genome evolution with information about flavor metabolic networks and their regulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. QTL mapping of sake brewing characteristics of yeast.

    PubMed

    Katou, Taku; Namise, Masahiro; Kitagaki, Hiroshi; Akao, Takeshi; Shimoi, Hitoshi

    2009-04-01

    A haploid sake yeast strain derived from the commercial diploid sake yeast strain Kyokai no. 7 showed better characteristics for sake brewing compared to the haploid laboratory yeast strain X2180-1B, including higher production of ethanol and aromatic components. A hybrid of these two strains showed intermediate characteristics in most cases. After sporulation of the hybrid strain, we obtained 100 haploid segregants of the hybrid. Small-scale sake brewing tests of these segregants showed a smooth continuous distribution of the sake brewing characteristics, suggesting that these traits are determined by multiple quantitative trait loci (QTLs). To examine these sake brewing characteristics at the genomic level, we performed QTL analysis of sake brewing characteristics using 142 DNA markers that showed heterogeneity between the two parental strains. As a result, we identified 25 significant QTLs involved in the specification of sake brewing characteristics such as ethanol fermentation and the production of aromatic components.

  18. Improved microarray methods for profiling the yeast knockout strain collection

    PubMed Central

    Yuan, Daniel S.; Pan, Xuewen; Ooi, Siew Loon; Peyser, Brian D.; Spencer, Forrest A.; Irizarry, Rafael A.; Boeke, Jef D.

    2005-01-01

    A remarkable feature of the Yeast Knockout strain collection is the presence of two unique 20mer TAG sequences in almost every strain. In principle, the relative abundances of strains in a complex mixture can be profiled swiftly and quantitatively by amplifying these sequences and hybridizing them to microarrays, but TAG microarrays have not been widely used. Here, we introduce a TAG microarray design with sophisticated controls and describe a robust method for hybridizing high concentrations of dye-labeled TAGs in single-stranded form. We also highlight the importance of avoiding PCR contamination and provide procedures for detection and eradication. Validation experiments using these methods yielded false positive (FP) and false negative (FN) rates for individual TAG detection of 3–6% and 15–18%, respectively. Analysis demonstrated that cross-hybridization was the chief source of FPs, while TAG amplification defects were the main cause of FNs. The materials, protocols, data and associated software described here comprise a suite of experimental resources that should facilitate the use of TAG microarrays for a wide variety of genetic screens. PMID:15994458

  19. Degradation of lindane by a novel embedded bio-nano hybrid system in aqueous environment.

    PubMed

    Salam, Jaseetha Abdul; Das, Nilanjana

    2015-03-01

    The objective of this study was to evaluate the effect of an embedded bio-nano hybrid system using nanoscale zinc oxide (n-ZnO) and lindane-degrading yeast Candida VITJzN04 for lindane degradation. Nano-embedding of the yeast was done with chemically synthesized n-ZnO particles (50 mg/mL) and was visualized by atomic force microscope (AFM) and scanning electron microscope (SEM). Nanoparticles were embedded substantially on the surfaces of the yeast cells and translocated into the cell cytoplasm without causing any lethal effect to the cell until 50 mg/mL. Lindane (600 mg/L) degradation was studied both in the individual and hybrid system. Rapid reductive-dechlorination of lindane was attained with n-ZnO under illuminated conditions, with the generation of chlorobenzene and benzene as dechlorination products. The bio-nano hybrid was found to be more effective compared to the native yeasts for lindane degradation and resulted in complete removal within 3 days. The kinetic data analysis implied that the half-life of lindane was 9 h for bio-nano hybrid and 28 h for Candida VITJzN04. The enhanced lindane degradation by bio-nano hybrid might be due to increased porosity and permeability of the yeast cell membrane, facilitating the easy entry of lindane into cell cytoplasm and n-ZnO-mediated dechlorination. To the best of our knowledge, this report, for the first time, suggests the use of n-ZnO-mediated dechlorination of lindane and the novel bio-nano hybrid system that reduces the half-life to one third of the time taken by the yeast alone. The embedded bio-nano hybrid system may be exploited as an effective remediation tool for the treatment of lindane-contaminated wastewaters.

  20. Where Have All the Interactions Gone? Estimating the Coverage of Two-Hybrid Protein Interaction Maps

    PubMed Central

    Huang, Hailiang; Jedynak, Bruno M; Bader, Joel S

    2007-01-01

    Yeast two-hybrid screens are an important method for mapping pairwise physical interactions between proteins. The fraction of interactions detected in independent screens can be very small, and an outstanding challenge is to determine the reason for the low overlap. Low overlap can arise from either a high false-discovery rate (interaction sets have low overlap because each set is contaminated by a large number of stochastic false-positive interactions) or a high false-negative rate (interaction sets have low overlap because each misses many true interactions). We extend capture–recapture theory to provide the first unified model for false-positive and false-negative rates for two-hybrid screens. Analysis of yeast, worm, and fly data indicates that 25% to 45% of the reported interactions are likely false positives. Membrane proteins have higher false-discovery rates on average, and signal transduction proteins have lower rates. The overall false-negative rate ranges from 75% for worm to 90% for fly, which arises from a roughly 50% false-negative rate due to statistical undersampling and a 55% to 85% false-negative rate due to proteins that appear to be systematically lost from the assays. Finally, statistical model selection conclusively rejects the Erdös-Rényi network model in favor of the power law model for yeast and the truncated power law for worm and fly degree distributions. Much as genome sequencing coverage estimates were essential for planning the human genome sequencing project, the coverage estimates developed here will be valuable for guiding future proteomic screens. All software and datasets are available in Datasets S1 and S2, Figures S1–S5, and Tables S1−S6, and are also available from our Web site, http://www.baderzone.org. PMID:18039026

  1. Alternative Saccharomyces interspecies hybrid combinations and their potential for low‐temperature wort fermentation

    PubMed Central

    Nikulin, Jarkko; Krogerus, Kristoffer

    2017-01-01

    Abstract The lager yeast hybrid (Saccharomyces cerevisiae × Saccharomyces eubayanus) possesses two key characteristics that are essential for lager brewing: efficient sugar utilization and cold tolerance. Here we explore the possibility that the lager yeast phenotype can be recreated by hybridizing S. cerevisiae ale yeast with a number of cold‐tolerant Saccharomyces species including Saccharomyces arboricola, Saccharomyces eubayanus, Saccharomyces mikatae and Saccharomyces uvarum. Interspecies hybrids performed better than parental strains in lager brewing conditions (12°C and 12°P wort), with the S. mikatae hybrid performing as well as the S. eubayanus hybrid. Where the S. cerevisiae parent was capable of utilizing maltotriose, this trait was inherited by the hybrids. A greater production of higher alcohols and esters by the hybrids resulted in the production of more aromatic beers relative to the parents. Strong fermentation performance relative to the parents was dependent on ploidy, with polyploid hybrids (3n, 4n) performing better than diploid hybrids. All hybrids produced 4‐vinyl guaiacol, a smoke/clove aroma generally considered an off flavour in lager beer. This characteristic could however be eliminated by isolating spore clones from a fertile hybrid of S. cerevisiae and S. mikatae. The results suggest that S. eubayanus is dispensable when constructing yeast hybrids that express the typical lager yeast phenotype. © 2017 The Authors. Yeast published by John Wiley & Sons, Ltd. PMID:28755430

  2. Occurrence of killer yeasts in leaf-cutting ant nests.

    PubMed

    Carreiro, S C; Pagnocca, F C; Bacci, M; Bueno, O C; Hebling, M J A; Middelhoven, W J

    2002-01-01

    Killer activity was screened in 99 yeast strains isolated from the nests of the leaf-cutting ant Atta sexdens against 6 standard sensitive strains, as well as against each other. Among this yeast community killer activity was widespread since 77 strains (78%) were able to kill or inhibit the growth of at least one standard strain or nest strain. Toxin production was observed in representatives of all the studied genera including Aureobasidium, Rhodotorula, Tremella and Trichosporon, whose killer activity has not yet been described.

  3. Multiple α-Glucoside Transporter Genes in Brewer’s Yeast

    PubMed Central

    Jespersen, Lene; Cesar, Lene B.; Meaden, Philip G.; Jakobsen, Mogens

    1999-01-01

    Maltose and maltotriose are the two most abundant fermentable sugars in brewer’s wort, and the rate of uptake of these sugars by brewer’s yeast can have a major impact on fermentation performance. In spite of this, no information is currently available on the genetics of maltose and maltotriose uptake in brewing strains of yeast. In this work, we studied 30 brewing strains of yeast (5 ale strains and 25 lager strains) with the aim of examining the alleles of maltose and maltotriose transporter genes contained by them. To do this, we hybridized gene probes to chromosome blots. Studies performed with laboratory strains have shown that maltose utilization is conferred by any one of five unlinked but highly homologous MAL loci (MAL1 to MAL4 and MAL6). Gene 1 at each locus encodes a maltose transporter. All of the strains of brewer’s yeast examined except two were found to contain MAL11 and MAL31 sequences, and only one of these strains lacked MAL41. MAL21 was not present in the five ale strains and 12 of the lager strains. MAL61 was not found in any of the yeast strains. In three of the lager strains, there was evidence that MAL transporter gene sequences occurred on chromosomes other than those known to carry MAL loci. Sequences corresponding to the AGT1 gene, which encodes a transporter of several α-glucosides, including maltose and maltotriose, were detected in all but one of the yeast strains. Homologues of AGT1 were identified in three of the lager strains, and two of these homologues were mapped, one to chromosome II and the other to chromosome XI. AGT1 appears to be a member of a family of closely related genes, which may have arisen in brewer’s yeast in response to selective pressure. PMID:9925567

  4. Performance study of sugar-yeast-ethanol bio-hybrid fuel cells

    NASA Astrophysics Data System (ADS)

    Jahnke, Justin P.; Mackie, David M.; Benyamin, Marcus; Ganguli, Rahul; Sumner, James J.

    2015-05-01

    Renewable alternatives to fossil hydrocarbons for energy generation are of general interest for a variety of political, economic, environmental, and practical reasons. In particular, energy from biomass has many advantages, including safety, sustainability, and the ability to be scavenged from native ecosystems or from waste streams. Microbial fuel cells (MFCs) can take advantage of microorganism metabolism to efficiently use sugar and other biomolecules as fuel, but are limited by low power densities. In contrast, direct alcohol fuel cells (DAFCs) take advantage of proton exchange membranes (PEMs) to generate electricity from alcohols at much higher power densities. Here, we investigate a novel bio-hybrid fuel cell design prepared using commercial off-the-shelf DAFCs. In the bio-hybrid fuel cells, biomass such as sugar is fermented by yeast to ethanol, which can be used to fuel a DAFC. A separation membrane between the fermentation and the DAFC is used to purify the fermentate while avoiding any parasitic power losses. However, shifting the DAFCs from pure alcohol-water solutions to filtered fermented media introduces complications related to how the starting materials, fermentation byproducts, and DAFC waste products affect both the fermentation and the long-term DAFC performance. This study examines the impact of separation membrane pore size, fermentation/fuel cell byproducts, alcohol and salt concentrations, and load resistance on fuel cell performance. Under optimized conditions, the performance obtained is comparable to that of a similar DAFC run with a pure alcohol-water mixture. Additionally, the modified DAFC can provide useable amounts of power for weeks.

  5. Screening of plant extracts for antimicrobial activity against bacteria and yeasts with dermatological relevance.

    PubMed

    Weckesser, S; Engel, K; Simon-Haarhaus, B; Wittmer, A; Pelz, K; Schempp, C M

    2007-08-01

    There is cumulative resistance against antibiotics of many bacteria. Therefore, the development of new antiseptics and antimicrobial agents for the treatment of skin infections is of increasing interest. We have screened six plant extracts and isolated compounds for antimicrobial effects on bacteria and yeasts with dermatological relevance. The following plant extracts have been tested: Gentiana lutea, Harpagophytum procumbens, Boswellia serrata (dry extracts), Usnea barbata, Rosmarinus officinalis and Salvia officinalis (supercritical carbon dioxide [CO2] extracts). Additionally, the following characteristic plant substances were tested: usnic acid, carnosol, carnosic acid, ursolic acid, oleanolic acid, harpagoside, boswellic acid and gentiopicroside. The extracts and compounds were tested against 29 aerobic and anaerobic bacteria and yeasts in the agar dilution test. U. barbata-extract and usnic acid were the most active compounds, especially in anaerobic bacteria. Usnea CO2-extract effectively inhibited the growth of several Gram-positive bacteria like Staphylococcus aureus (including methicillin-resistant strains - MRSA), Propionibacterium acnes and Corynebacterium species. Growth of the dimorphic yeast Malassezia furfur was also inhibited by Usnea-extract. Besides the Usnea-extract, Rosmarinus-, Salvia-, Boswellia- and Harpagophytum-extracts proved to be effective against a panel of bacteria. It is concluded that due to their antimicrobial effects some of the plant extracts may be used for the topical treatment of skin disorders like acne vulgaris and seborrhoic eczema.

  6. Biomedical applications of yeast- a patent view, part one: yeasts as workhorses for the production of therapeutics and vaccines.

    PubMed

    Roohvand, Farzin; Shokri, Mehdi; Abdollahpour-Alitappeh, Meghdad; Ehsani, Parastoo

    2017-08-01

    Yeasts, as Eukaryotes, offer unique features for ease of growth and genetic manipulation possibilities, making it an exceptional microbial host. Areas covered: This review provides general and patent-oriented insights into production of biopharmaceuticals by yeasts. Patents, wherever possible, were correlated to the original or review articles. The review describes applications of major GRAS (generally regarded as safe) yeasts for the production of therapeutic proteins and subunit vaccines; additionally, immunomodulatory properties of yeast cell wall components were reviewed for use of whole yeast cells as a new vaccine platform. The second part of the review will discuss yeast- humanization strategies and innovative applications. Expert opinion: Biomedical applications of yeasts were initiated by utilization of Saccharomyces cerevisiae, for production of leavened (fermented) products, and advanced to serve to produce biopharmaceuticals. Higher biomass production and expression/secretion yields, more similarity of glycosylation patterns to mammals and possibility of host-improvement strategies through application of synthetic biology might enhance selection of Pichia pastoris (instead of S. cerevisiae) as a host for production of biopharmaceutical in future. Immunomodulatory properties of yeast cell wall β-glucans and possibility of intracellular expression of heterologous pathogen/tumor antigens in yeast cells have expanded their application as a new platform, 'Whole Yeast Vaccines'.

  7. Screening and characterizing of xylanolytic and xylose-fermenting yeasts isolated from the wood-feeding termite, Reticulitermes chinensis

    PubMed Central

    Xie, Rongrong; Zhou, Feng; Huang, Miao

    2017-01-01

    The effective fermentation of xylose remains an intractable challenge in bioethanol industry. The relevant xylanase enzyme is also in a high demand from industry for several biotechnological applications that inevitably in recent times led to many efforts for screening some novel microorganisms for better xylanase production and fermentation performance. Recently, it seems that wood-feeding termites can truly be considered as highly efficient natural bioreactors. The highly specialized gut systems of such insects are not yet fully realized, particularly, in xylose fermentation and xylanase production to advance industrial bioethanol technology as well as industrial applications of xylanases. A total of 92 strains from 18 yeast species were successfully isolated and identified from the gut of wood-feeding termite, Reticulitermes chinensis. Of these yeasts and strains, seven were identified for new species: Candida gotoi, Candida pseudorhagii, Hamamotoa lignophila, Meyerozyma guilliermondii, Sugiyamaella sp.1, Sugiyamaella sp. 2, and Sugiyamaella sp.3. Based on the phylogenetic and phenotypic characterization, the type strain of C. pseudorhagii sp. nov., which was originally designated strain SSA-1542T, was the most frequently occurred yeast from termite gut samples, showed the highly xylanolytic activity as well as D-xylose fermentation. The highest xylanase activity was recorded as 1.73 and 0.98 U/mL with xylan or D-xylose substrate, respectively, from SSA-1542T. Among xylanase-producing yeasts, four novel species were identified as D-xylose-fermenting yeasts, where the yeast, C. pseudorhagii SSA-1542T, showed the highest ethanol yield (0.31 g/g), ethanol productivity (0.31 g/L·h), and its fermentation efficiency (60.7%) in 48 h. Clearly, the symbiotic yeasts isolated from termite guts have demonstrated a competitive capability to produce xylanase and ferment xylose, suggesting that the wood-feeding termite gut is a promising reservoir for novel xylanases

  8. New Lager Brewery Strains Obtained by Crossing Techniques Using Cachaça (Brazilian Spirit) Yeasts

    PubMed Central

    Figueiredo, Bruna Inez Carvalho; Saraiva, Margarete Alice Fontes; de Souza Pimenta, Paloma Patrick; de Souza Testasicca, Miriam Conceição; Sampaio, Geraldo Magela Santos; da Cunha, Aureliano Claret; Afonso, Luis Carlos Crocco; Vieira de Queiroz, Marisa; de Miranda Castro, Ieso

    2017-01-01

    ABSTRACT The development of hybrids has been an effective approach to generate novel yeast strains with optimal technological profile for use in beer production. This study describes the generation of a new yeast strain for lager beer production by direct mating between two Saccharomyces cerevisiae strains isolated from cachaça distilleries: one that was strongly flocculent, and the other with higher production of acetate esters. The first step in this procedure was to analyze the sporulation ability and reproductive cycle of strains belonging to a specific collection of yeasts isolated from cachaça fermentation vats. Most strains showed high rates of sporulation, spore viability, and homothallic behavior. In order to obtain new yeast strains with desirable properties useful for lager beer production, we compare haploid-to-haploid and diploid-to-diploid mating procedures. Moreover, an assessment of parental phenotype traits showed that the segregant diploid C2-1d generated from a diploid-to-diploid mating experiment showed good fermentation performance at low temperature, high flocculation capacity, and desirable production of acetate esters that was significantly better than that of one type lager strain. Therefore, strain C2-1d might be an important candidate for the production of lager beer, with distinct fruit traces and originating using a non-genetically modified organism (GMO) approach. IMPORTANCE Recent work has suggested the utilization of hybridization techniques for the generation of novel non-genetically modified brewing yeast strains with combined properties not commonly found in a unique yeast strain. We have observed remarkable traits, especially low temperature tolerance, maltotriose utilization, flocculation ability, and production of volatile aroma compounds, among a collection of Saccharomyces cerevisiae strains isolated from cachaça distilleries, which allow their utilization in the production of beer. The significance of our research is in

  9. Diversity in Genetic In Vivo Methods for Protein-Protein Interaction Studies: from the Yeast Two-Hybrid System to the Mammalian Split-Luciferase System

    PubMed Central

    Stynen, Bram; Tournu, Hélène; Tavernier, Jan

    2012-01-01

    Summary: The yeast two-hybrid system pioneered the field of in vivo protein-protein interaction methods and undisputedly gave rise to a palette of ingenious techniques that are constantly pushing further the limits of the original method. Sensitivity and selectivity have improved because of various technical tricks and experimental designs. Here we present an exhaustive overview of the genetic approaches available to study in vivo binary protein interactions, based on two-hybrid and protein fragment complementation assays. These methods have been engineered and employed successfully in microorganisms such as Saccharomyces cerevisiae and Escherichia coli, but also in higher eukaryotes. From single binary pairwise interactions to whole-genome interactome mapping, the self-reassembly concept has been employed widely. Innovative studies report the use of proteins such as ubiquitin, dihydrofolate reductase, and adenylate cyclase as reconstituted reporters. Protein fragment complementation assays have extended the possibilities in protein-protein interaction studies, with technologies that enable spatial and temporal analyses of protein complexes. In addition, one-hybrid and three-hybrid systems have broadened the types of interactions that can be studied and the findings that can be obtained. Applications of these technologies are discussed, together with the advantages and limitations of the available assays. PMID:22688816

  10. Pooled-matrix protein interaction screens using Barcode Fusion Genetics.

    PubMed

    Yachie, Nozomu; Petsalaki, Evangelia; Mellor, Joseph C; Weile, Jochen; Jacob, Yves; Verby, Marta; Ozturk, Sedide B; Li, Siyang; Cote, Atina G; Mosca, Roberto; Knapp, Jennifer J; Ko, Minjeong; Yu, Analyn; Gebbia, Marinella; Sahni, Nidhi; Yi, Song; Tyagi, Tanya; Sheykhkarimli, Dayag; Roth, Jonathan F; Wong, Cassandra; Musa, Louai; Snider, Jamie; Liu, Yi-Chun; Yu, Haiyuan; Braun, Pascal; Stagljar, Igor; Hao, Tong; Calderwood, Michael A; Pelletier, Laurence; Aloy, Patrick; Hill, David E; Vidal, Marc; Roth, Frederick P

    2016-04-22

    High-throughput binary protein interaction mapping is continuing to extend our understanding of cellular function and disease mechanisms. However, we remain one or two orders of magnitude away from a complete interaction map for humans and other major model organisms. Completion will require screening at substantially larger scales with many complementary assays, requiring further efficiency gains in proteome-scale interaction mapping. Here, we report Barcode Fusion Genetics-Yeast Two-Hybrid (BFG-Y2H), by which a full matrix of protein pairs can be screened in a single multiplexed strain pool. BFG-Y2H uses Cre recombination to fuse DNA barcodes from distinct plasmids, generating chimeric protein-pair barcodes that can be quantified via next-generation sequencing. We applied BFG-Y2H to four different matrices ranging in scale from ~25 K to 2.5 M protein pairs. The results show that BFG-Y2H increases the efficiency of protein matrix screening, with quality that is on par with state-of-the-art Y2H methods. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  11. Exploration for the Salinity Tolerance-Related Genes from Xero-Halophyte Atriplex canescens Exploiting Yeast Functional Screening System

    PubMed Central

    Li, Jingtao; Sun, Xinhua; Liu, Yanzhi; Wang, Xueliang; Zhang, Hao; Pan, Hongyu

    2017-01-01

    Plant productivity is limited by salinity stress, both in natural and agricultural systems. Identification of salt stress-related genes from halophyte can provide insights into mechanisms of salt stress tolerance in plants. Atriplex canescens is a xero-halophyte that exhibits optimum growth in the presence of 400 mM NaCl. A cDNA library derived from highly salt-treated A. canescens plants was constructed based on a yeast expression system. A total of 53 transgenic yeast clones expressing enhanced salt tolerance were selected from 105 transformants. Their plasmids were sequenced and the gene characteristics were annotated using a BLASTX search. Retransformation of yeast cells with the selected plasmids conferred salt tolerance to the resulting transformants. The expression patterns of 28 of these stress-related genes were further investigated in A. canescens leaves by quantitative reverse transcription-PCR. In this study, we provided a rapid and robust assay system for large-scale screening of genes for varied abiotic stress tolerance with high efficiency in A. canescens. PMID:29149055

  12. Inheritance of brewing-relevant phenotypes in constructed Saccharomyces cerevisiae × Saccharomyces eubayanus hybrids.

    PubMed

    Krogerus, Kristoffer; Seppänen-Laakso, Tuulikki; Castillo, Sandra; Gibson, Brian

    2017-04-21

    Interspecific hybridization has proven to be a potentially valuable technique for generating de novo lager yeast strains that possess diverse and improved traits compared to their parent strains. To further enhance the value of hybridization for strain development, it would be desirable to combine phenotypic traits from more than two parent strains, as well as remove unwanted traits from hybrids. One such trait, that has limited the industrial use of de novo lager yeast hybrids, is their inherent tendency to produce phenolic off-flavours; an undesirable trait inherited from the Saccharomyces eubayanus parent. Trait removal and the addition of traits from a third strain could be achieved through sporulation and meiotic recombination or further mating. However, interspecies hybrids tend to be sterile, which impedes this opportunity. Here we generated a set of five hybrids from three different parent strains, two of which contained DNA from all three parent strains. These hybrids were constructed with fertile allotetraploid intermediates, which were capable of efficient sporulation. We used these eight brewing strains to examine two brewing-relevant phenotypes: stress tolerance and phenolic off-flavour formation. Lipidomics and multivariate analysis revealed links between several lipid species and the ability to ferment in low temperatures and high ethanol concentrations. Unsaturated fatty acids, such as oleic acid, and ergosterol were shown to positively influence growth at high ethanol concentrations. The ability to produce phenolic off-flavours was also successfully removed from one of the hybrids, Hybrid T2, through meiotic segregation. The potential application of these strains in industrial fermentations was demonstrated in wort fermentations, which revealed that the meiotic segregant Hybrid T2 not only didn't produce any phenolic off-flavours, but also reached the highest ethanol concentration and consumed the most maltotriose. Our study demonstrates the

  13. Development of 40-in hybrid hologram screen for auto-stereoscopic video display

    NASA Astrophysics Data System (ADS)

    Song, Hyun Ho; Nakashima, Y.; Momonoi, Y.; Honda, Toshio

    2004-06-01

    Usually in auto stereoscopic display, there are two problems. The first problem is that large image display is difficult, and the second problem is that the view zone (which means the zone in which both eyes are put for stereoscopic or 3-D image observation) is very narrow. We have been developing an auto stereoscopic large video display system (over 100 inches diagonal) which a few people can view simultaneously1,2. Usually in displays that are over 100 inches diagonal, an optical video projection system is used. As one of auto stereoscopic display systems the hologram screen has been proposed3,4,5,6. However, if the hologram screen becomes too large, the view zone (corresponding to the reconstructed diffused object) causes color dispersion and color aberration7. We also proposed the additional Fresnel lens attached to the hologram screen. We call the screen a "hybrid hologram screen", (HHS in short). We made the HHS 866mm(H)×433mm(V) (about 40 inch diagonal)8,9,10,11. By using the lens in the reconstruction step, the angle between object light and reference light can be small, compared to without the lens. So, the spread of the view zone by the color dispersion and color aberration becomes small. And also, the virtual image which is reconstructed from the hologram screen can be transformed to a real image (view zone). So, it is not necessary to use a large lens or concave mirror while making a large hologram screen.

  14. Designing and creating Saccharomyces interspecific hybrids for improved, industry relevant, phenotypes.

    PubMed

    Bellon, Jennifer R; Yang, Fei; Day, Martin P; Inglis, Debra L; Chambers, Paul J

    2015-10-01

    To remain competitive in increasingly overcrowded markets, yeast strain development programmes are crucial for fermentation-based food and beverage industries. In a winemaking context, there are many yeast phenotypes that stand to be improved. For example, winemakers endeavouring to produce sweet dessert wines wrestle with fermentation challenges particular to fermenting high-sugar juices, which can lead to elevated volatile acidity levels and extended fermentation times. In the current study, we used natural yeast breeding techniques to generate Saccharomyces spp. interspecific hybrids as a non-genetically modified (GM) strategy to introduce targeted improvements in important, wine-relevant traits. The hybrids were generated by mating a robust wine strain of Saccharomyces cerevisiae with a wine isolate of Saccharomyces bayanus, a species previously reported to produce wines with low concentrations of acetic acid. Two hybrids generated from the cross showed robust fermentation properties in high-sugar grape juice and produced botrytised Riesling wines with much lower concentrations of acetic acid relative to the industrial wine yeast parent. The hybrids also displayed suitability for icewine production when bench-marked against an industry standard icewine yeast, by delivering icewines with lower levels of acetic acid. Additionally, the hybrid yeast produced wines with novel aroma and flavour profiles and established that choice of yeast strain impacts on wine colour. These new hybrid yeasts display the desired targeted fermentation phenotypes from both parents, robust fermentation in high-sugar juice and the production of wines with low volatile acidity, thus establishing their suitability for wine styles that are traditionally troubled by excessive volatile acidity levels.

  15. The genome sequence of Saccharomyces eubayanus and the domestication of lager-brewing yeasts

    DOE PAGES

    Baker, Emily Clare; Wang, Bing; Bellora, Nicolas; ...

    2015-08-11

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae ( S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts havemore » experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. In conclusion, our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions.« less

  16. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts

    PubMed Central

    Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A.; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd

    2015-01-01

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. PMID:26269586

  17. An aminoacylation-dependent nuclear tRNA export pathway in yeast.

    PubMed

    Grosshans, H; Hurt, E; Simos, G

    2000-04-01

    Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries.

  18. An aminoacylation-dependent nuclear tRNA export pathway in yeast

    PubMed Central

    Grosshans, Helge; Hurt, Ed; Simos, George

    2000-01-01

    Yeast Los1p, the homolog of human exportin-t, mediates nuclear export of tRNA. Using fluorescence in situ hybridization, we could show that the export of some intronless tRNA species is not detectably affected by the disruption of LOS1. To find other factors that facilitate tRNA export, we performed a suppressor screen of a synthetically lethal los1 mutant and identified the essential translation elongation factor eEF-1A. Mutations in eEF-1A impaired nuclear export of all tRNAs tested, which included both spliced and intronless species. An even stronger defect in nuclear exit of tRNA was observed under conditions that inhibited tRNA aminoacylation. In all cases, inhibition of tRNA export led to nucleolar accumulation of mature tRNAs. Our data show that tRNA aminoacylation and eEF-1A are required for efficient nuclear tRNA export in yeast and suggest coordination between the protein translation and the nuclear tRNA processing and transport machineries. PMID:10766739

  19. A yeast functional screen predicts new candidate ALS disease genes

    PubMed Central

    Couthouis, Julien; Hart, Michael P.; Shorter, James; DeJesus-Hernandez, Mariely; Erion, Renske; Oristano, Rachel; Liu, Annie X.; Ramos, Daniel; Jethava, Niti; Hosangadi, Divya; Epstein, James; Chiang, Ashley; Diaz, Zamia; Nakaya, Tadashi; Ibrahim, Fadia; Kim, Hyung-Jun; Solski, Jennifer A.; Williams, Kelly L.; Mojsilovic-Petrovic, Jelena; Ingre, Caroline; Boylan, Kevin; Graff-Radford, Neill R.; Dickson, Dennis W.; Clay-Falcone, Dana; Elman, Lauren; McCluskey, Leo; Greene, Robert; Kalb, Robert G.; Lee, Virginia M.-Y.; Trojanowski, John Q.; Ludolph, Albert; Robberecht, Wim; Andersen, Peter M.; Nicholson, Garth A.; Blair, Ian P.; King, Oliver D.; Bonini, Nancy M.; Van Deerlin, Vivianna; Rademakers, Rosa; Mourelatos, Zissimos; Gitler, Aaron D.

    2011-01-01

    Amyotrophic lateral sclerosis (ALS) is a devastating and universally fatal neurodegenerative disease. Mutations in two related RNA-binding proteins, TDP-43 and FUS, that harbor prion-like domains, cause some forms of ALS. There are at least 213 human proteins harboring RNA recognition motifs, including FUS and TDP-43, raising the possibility that additional RNA-binding proteins might contribute to ALS pathogenesis. We performed a systematic survey of these proteins to find additional candidates similar to TDP-43 and FUS, followed by bioinformatics to predict prion-like domains in a subset of them. We sequenced one of these genes, TAF15, in patients with ALS and identified missense variants, which were absent in a large number of healthy controls. These disease-associated variants of TAF15 caused formation of cytoplasmic foci when expressed in primary cultures of spinal cord neurons. Very similar to TDP-43 and FUS, TAF15 aggregated in vitro and conferred neurodegeneration in Drosophila, with the ALS-linked variants having a more severe effect than wild type. Immunohistochemistry of postmortem spinal cord tissue revealed mislocalization of TAF15 in motor neurons of patients with ALS. We propose that aggregation-prone RNA-binding proteins might contribute very broadly to ALS pathogenesis and the genes identified in our yeast functional screen, coupled with prion-like domain prediction analysis, now provide a powerful resource to facilitate ALS disease gene discovery. PMID:22065782

  20. Etest and Sensititre YeastOne Susceptibility Testing of Echinocandins against Candida Species from a Single Center in Austria.

    PubMed

    Aigner, Maria; Erbeznik, Thomas; Gschwentner, Martin; Lass-Flörl, Cornelia

    2017-08-01

    Candida species were tested for susceptibility to caspofungin, anidulafungin, and micafungin in order to evaluate the roles of Etest and Sensititre YeastOne in antifungal susceptibility testing for daily routines and to survey resistance. A total of 104 Candida species isolates detected from blood cultures were investigated. With EUCAST broth microdilution as the reference method, essential agreement (EA), categorical agreement (CA), very major errors (VME), major errors (ME), and minor (MIN) errors were assessed by reading MICs at 18, 24, and 48 h. By use of EUCAST broth microdilution and species-specific clinical breakpoints (CBPs), echinocandin resistance was not detected during the study period. Using EUCAST CBPs, MIC readings at 24 h for the Etest and Sensititre YeastOne resulted in CA levels of 99% and 93% for anidulafungin and 99% and 97% for micafungin. Using revised CLSI CBPs for caspofungin, CA levels were 92% and 99% for Etest and Sensititre YeastOne. The Etest proved an excellent, easy-to-handle alternative method for testing susceptibility to anidulafungin and micafungin. Due to misclassifications, the Etest is less suitable for testing susceptibility to caspofungin (8% of isolates falsely tested resistant). The CA levels of Sensititre YeastOne were 93% and 97% for anidulafungin and micafungin (24 h) by use of EUCAST CBPs and increased to 100% for both antifungals if CLSI CBPs were applied and to 100% and 99% if Sensititre YeastOne epidemiological cutoff values (ECOFFs) were applied. No one echinocandin could be demonstrated to be superior to another in vitro Since resistance was lacking among our Candida isolates, we cannot derive any recommendation from accurate resistance detection by the Etest and Sensititre YeastOne. Copyright © 2017 American Society for Microbiology.

  1. Mitochondria inheritance is a key factor for tolerance to dehydration in wine yeast production.

    PubMed

    Picazo, C; Gamero-Sandemetrio, E; Orozco, H; Albertin, W; Marullo, P; Matallana, E; Aranda, A

    2015-03-01

    Mitochondria are the cell's powerhouse when organisms are grown in the presence of oxygen. They are also the source of reactive oxygen species that cause damage to the biochemical components of the cell and lead to cellular ageing and death. Under winemaking conditions, Saccharomyces yeasts exclusively have a fermentative metabolism due to the high sugar content of grape must. However, their production as an active dry yeast (ADY) form required aerobic propagation and a dehydration process. In these industrial steps, oxidative stress is particularly harmful for the cell. In this work, we analysed the impact of the mitochondrial genome on oxidative stress response, longevity and dehydration tolerance using the synthetic interspecific hybrids obtained between two S. cerevisiae and S. uvarum strains. The isogenic nature of nuclear DNA of such hybrids allowed us to analyse the impact of mitochondrial DNA for fermentative and oxidative stress conditions. Under grape must conditions, the inheritance of mitochondrial DNA poorly impacted the fermentative performance of interspecific hybrids, unlike the hybrids with S. cerevisiae mitochondrial inheritance, which displayed increased tolerance to oxidative stress and dehydration, and showed an extended chronological longevity when cells were grown with aeration. In modern oenology, yeast starters are employed to inoculate grape juice, usually in the form of active dry yeast (ADY). The dehydration process implies stressful conditions that lead to oxidative damage. Other yeast species and interspecific hybrids other than Saccharomyces cerevisiae may be used to confer novel properties to the final product. However, these yeasts are usually more sensitive to drying. Understanding the causes of oxidative stress tolerance is therefore necessary for developing the use of these organisms in industry. This study indicates the impact of mitochondrial DNA inheritance for oxidative stress resistance in an interspecific context using

  2. Effect of the trehalose levels on the screening of yeast as probiotic by in vivo and in vitro assays.

    PubMed

    Martins, Flaviano S; Miranda, Ieso C; Rosa, Carlos A; Nicoli, Jacques R; Neves, Maria J

    2008-01-01

    Probiotics are viable defined microorganisms (bacteria or yeasts) that exert a beneficial effect on the health of the host when ingested in adequate amounts. Screening for such biotherapeutic agents is commonly performed by in vitro assays simulating gastrointestinal environment to determine the ability to survive in the digestive tract. In the present study, the possibility of extrapolation of data obtained in in vitro assays to in vivo conditions was studied using five Saccharomyces cerevisiae strains isolated from Brazilian Atlantic rain forest. Trehalose contents and survival after exposure to a combination of physiological stresses generally found in the gastrointestinal tract of humans were determined for the five yeasts and compared to the behavior of Saccharomyces boulardii, a well-known probiotic. The results were completed with the colonization capacity of the gastrointestinal tract of gnotobiotic mice by these yeast strains. Some results obtained by in vitro assays are not confirmed by in vivo experiments, indicating that the extrapolation cannot be always done.

  3. Divergence, hybridization, and recombination in the mitochondrial genome of the human pathogenic yeast Cryptococcus gattii.

    PubMed

    Xu, Jianping; Yan, Zhun; Guo, Hong

    2009-06-01

    The inheritance of mitochondrial genes and genomes are uniparental in most sexual eukaryotes. This pattern of inheritance makes mitochondrial genomes in natural populations effectively clonal. Here, we examined the mitochondrial population genetics of the emerging human pathogenic fungus Cryptococcus gattii. The DNA sequences for five mitochondrial DNA fragments were obtained from each of 50 isolates belonging to two evolutionary divergent lineages, VGI and VGII. Our analyses revealed a greater sequence diversity within VGI than that within VGII, consistent with observations of the nuclear genes. The combined analyses of all five gene fragments indicated significant divergence between VGI and VGII. However, the five individual genealogies showed different relationships among the isolates, consistent with recent hybridization and mitochondrial gene transfer between the two lineages. Population genetic analyses of the multilocus data identified evidence for predominantly clonal mitochondrial population structures within both lineages. Interestingly, there were clear signatures of recombination among mitochondrial genes within the VGII lineage. Our analyses suggest historical mitochondrial genome divergence within C. gattii, but there is evidence for recent hybridization and recombination in the mitochondrial genome of this important human yeast pathogen.

  4. Health benefits and cost-effectiveness of a hybrid screening strategy for colorectal cancer.

    PubMed

    Dinh, Tuan; Ladabaum, Uri; Alperin, Peter; Caldwell, Cindy; Smith, Robert; Levin, Theodore R

    2013-09-01

    Colorectal cancer (CRC) screening guidelines recommend screening schedules for each single type of test except for concurrent sigmoidoscopy and fecal occult blood test (FOBT). We investigated the cost-effectiveness of a hybrid screening strategy that was based on a fecal immunological test (FIT) and colonoscopy. We conducted a cost-effectiveness analysis by using the Archimedes Model to evaluate the effects of different CRC screening strategies on health outcomes and costs related to CRC in a population that represents members of Kaiser Permanente Northern California. The Archimedes Model is a large-scale simulation of human physiology, diseases, interventions, and health care systems. The CRC submodel in the Archimedes Model was derived from public databases, published epidemiologic studies, and clinical trials. A hybrid screening strategy led to substantial reductions in CRC incidence and mortality, gains in quality-adjusted life years (QALYs), and reductions in costs, comparable with those of the best single-test strategies. Screening by annual FIT of patients 50-65 years old and then a single colonoscopy when they were 66 years old (FIT/COLOx1) reduced CRC incidence by 72% and gained 110 QALYs for every 1000 people during a period of 30 years, compared with no screening. Compared with annual FIT, FIT/COLOx1 gained 1400 QALYs/100,000 persons at an incremental cost of $9700/QALY gained and required 55% fewer FITs. Compared with FIT/COLOx1, colonoscopy at 10-year intervals gained 500 QALYs/100,000 at an incremental cost of $35,100/QALY gained but required 37% more colonoscopies. Over the ranges of parameters examined, the cost-effectiveness of hybrid screening strategies was slightly more sensitive to the adherence rate with colonoscopy than the adherence rate with yearly FIT. Uncertainties associated with estimates of FIT performance within a program setting and sensitivities for flat and right-sided lesions are expected to have significant impacts on the cost

  5. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing Yeasts.

    PubMed

    Baker, EmilyClare; Wang, Bing; Bellora, Nicolas; Peris, David; Hulfachor, Amanda Beth; Koshalek, Justin A; Adams, Marie; Libkind, Diego; Hittinger, Chris Todd

    2015-11-01

    The dramatic phenotypic changes that occur in organisms during domestication leave indelible imprints on their genomes. Although many domesticated plants and animals have been systematically compared with their wild genetic stocks, the molecular and genomic processes underlying fungal domestication have received less attention. Here, we present a nearly complete genome assembly for the recently described yeast species Saccharomyces eubayanus and compare it to the genomes of multiple domesticated alloploid hybrids of S. eubayanus × S. cerevisiae (S. pastorianus syn. S. carlsbergensis), which are used to brew lager-style beers. We find that the S. eubayanus subgenomes of lager-brewing yeasts have experienced increased rates of evolution since hybridization, and that certain genes involved in metabolism may have been particularly affected. Interestingly, the S. eubayanus subgenome underwent an especially strong shift in selection regimes, consistent with more extensive domestication of the S. cerevisiae parent prior to hybridization. In contrast to recent proposals that lager-brewing yeasts were domesticated following a single hybridization event, the radically different neutral site divergences between the subgenomes of the two major lager yeast lineages strongly favor at least two independent origins for the S. cerevisiae × S. eubayanus hybrids that brew lager beers. Our findings demonstrate how this industrially important hybrid has been domesticated along similar evolutionary trajectories on multiple occasions. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Large-Scale Selection and Breeding To Generate Industrial Yeasts with Superior Aroma Production

    PubMed Central

    Steensels, Jan; Meersman, Esther; Snoek, Tim; Saels, Veerle

    2014-01-01

    The concentrations and relative ratios of various aroma compounds produced by fermenting yeast cells are essential for the sensory quality of many fermented foods, including beer, bread, wine, and sake. Since the production of these aroma-active compounds varies highly among different yeast strains, careful selection of variants with optimal aromatic profiles is of crucial importance for a high-quality end product. This study evaluates the production of different aroma-active compounds in 301 different Saccharomyces cerevisiae, Saccharomyces paradoxus, and Saccharomyces pastorianus yeast strains. Our results show that the production of key aroma compounds like isoamyl acetate and ethyl acetate varies by an order of magnitude between natural yeasts, with the concentrations of some compounds showing significant positive correlation, whereas others vary independently. Targeted hybridization of some of the best aroma-producing strains yielded 46 intraspecific hybrids, of which some show a distinct heterosis (hybrid vigor) effect and produce up to 45% more isoamyl acetate than the best parental strains while retaining their overall fermentation performance. Together, our results demonstrate the potential of large-scale outbreeding to obtain superior industrial yeasts that are directly applicable for commercial use. PMID:25192996

  7. Application of genetics to the development of starch-fermenting yeasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mattoon, J.R.; Kim, K.; Laluce, C.

    1987-01-01

    Yeast strains capable of direct fermentation of manioc starch were developed by hybridizing strains of Saccharomyces diastaticus and Saccharomyces cerevisiae. Hybrids were evaluated for speed of alcohol production, and yields and speed of formation of glycoamylase. Up to 6% solutions of Lintner starch could be fermented directly with about 80% conversion to alcohol. Pretreatment of crude 40% manioc starch suspensions with alpha-amylase, followed by fermentations with a starch-fermenting yeast strain, permitted accumulation of 12% ethanol within three days. Starch conversion was almost 100%. A fragment of DNA was cloned from S. diastaticus using the yeast-E. coli shuttle vector, YEp13, andmore » was used to transform a strain of S. cerevisiae to a starch-fermenting state. Supported by National Science Foundation grant INT 7927328 and National Institutes of Health grant GM 27860. Dr. Laluce was supported by a grant from Fundacao de Amparo a Pesquisa do Estado do Sao Paulo and by her university. (Refs. 5).« less

  8. Characterization of maltotriose transporters from the Saccharomyces eubayanus subgenome of the hybrid Saccharomyces pastorianus lager brewing yeast strain Weihenstephan 34/70.

    PubMed

    Cousseau, F E M; Alves, S L; Trichez, D; Stambuk, B U

    2013-01-01

    The genome from the Saccharomyces pastorianus industrial lager brewing strain Weihenstephan 34/70, a natural Saccharomyces cerevisiae/Saccharomyces eubayanus hybrid, indicated the presence of two different maltotriose transporter genes: a new gene in the S. eubayanus subgenome with 81% of homology to the AGT1 permease from S. cerevisiae, and an amplification of the S. eubayanus MTY1 maltotriose permease previously identified in S. pastorianus yeasts. To characterize these S. eubayanus transporter genes, we used a S. cerevisiae strain deleted in the AGT1 permease and introduced the desired permease gene(s) into this locus through homologous recombination. Our results indicate that both the MTY1 and AGT1 genes from the S. eubayanus subgenome encode functional maltotriose transporters that allow fermentation of this sugar by yeast cells, despite their apparent differences in the kinetics of maltotriose-H(+) symport activity. The presence of two maltotriose transporters in the S. eubayanus subgenome not only highlights the importance of sugar transport for efficient maltotriose utilization by industrial yeasts, but these new genes can be used in breeding and/or selection programs aimed at increasing yeast fitness for the efficient fermentation of brewer's wort. © 2012 The Society for Applied Microbiology.

  9. Proteomic screening of variola virus reveals a unique NF-kappaB inhibitor that is highly conserved among pathogenic orthopoxviruses.

    PubMed

    Mohamed, Mohamed R; Rahman, Masmudur M; Lanchbury, Jerry S; Shattuck, Donna; Neff, Chris; Dufford, Max; van Buuren, Nick; Fagan, Katharine; Barry, Michele; Smith, Scott; Damon, Inger; McFadden, Grant

    2009-06-02

    Identification of the binary interactions between viral and host proteins has become a valuable tool for investigating viral tropism and pathogenesis. Here, we present the first systematic protein interaction screening of the unique variola virus proteome by using yeast 2-hybrid screening against a variety of human cDNA libraries. Several protein-protein interactions were identified, including an interaction between variola G1R, an ankryin/F-box containing protein, and human nuclear factor kappa-B1 (NF-kappaB1)/p105. This represents the first direct interaction between a pathogen-encoded protein and NF-kappaB1/p105. Orthologs of G1R are present in a variety of pathogenic orthopoxviruses, but not in vaccinia virus, and expression of any one of these viral proteins blocks NF-kappaB signaling in human cells. Thus, proteomic screening of variola virus has the potential to uncover modulators of the human innate antiviral responses.

  10. Yeast for virus research

    PubMed Central

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  11. Novel Yeast-based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR*

    PubMed Central

    Li, Hao; Redinbo, Matthew R.; Venkatesh, Madhukumar; Ekins, Sean; Chaudhry, Anik; Bloch, Nicolin; Negassa, Abdissa; Mukherjee, Paromita; Kalpana, Ganjam; Mani, Sridhar

    2013-01-01

    The pregnane X receptor (PXR) is a master regulator of xenobiotic metabolism, and its activity is critical toward understanding the pathophysiology of several diseases, including inflammation, cancer, and steatosis. Previous studies have demonstrated that ketoconazole binds to ligand-activated PXR and antagonizes receptor control of gene expression. Structure-function as well as computational docking analysis suggested a putative binding region containing critical charge clamp residues Gln-272, and Phe-264 on the AF-2 surface of PXR. To define the antagonist binding surface(s) of PXR, we developed a novel assay to identify key amino acid residues on PXR based on a yeast two-hybrid screen that examined mutant forms of PXR. This screen identified multiple “gain-of-function” mutants that were “resistant” to the PXR antagonist effects of ketoconazole. We then compared our screen results identifying key PXR residues to those predicted by computational methods. Of 15 potential or putative binding residues based on docking, we identified three residues in the yeast screen that were then systematically verified to functionally interact with ketoconazole using mammalian assays. Among the residues confirmed by our study was Ser-208, which is on the opposite side of the protein from the AF-2 region critical for receptor regulation. The identification of new locations for antagonist binding on the surface or buried in PXR indicates novel aspects to the mechanism of receptor antagonism. These results significantly expand our understanding of antagonist binding sites on the surface of PXR and suggest new avenues to regulate this receptor for clinical applications. PMID:23525103

  12. A Novel Hybrid Iron Regulation Network Combines Features from Pathogenic and Nonpathogenic Yeasts.

    PubMed

    Gerwien, Franziska; Safyan, Abu; Wisgott, Stephanie; Hille, Fabrice; Kaemmer, Philipp; Linde, Jörg; Brunke, Sascha; Kasper, Lydia; Hube, Bernhard

    2016-10-18

    Iron is an essential micronutrient for both pathogens and their hosts, which restrict iron availability during infections in an effort to prevent microbial growth. Successful human pathogens like the yeast Candida glabrata have thus developed effective iron acquisition strategies. Their regulation has been investigated well for some pathogenic fungi and in the model organism Saccharomyces cerevisiae, which employs an evolutionarily derived system. Here, we show that C. glabrata uses a regulation network largely consisting of components of the S. cerevisiae regulon but also of elements of other pathogenic fungi. Specifically, similarly to baker's yeast, Aft1 is the main positive regulator under iron starvation conditions, while Cth2 degrades mRNAs encoding iron-requiring enzymes. However, unlike the case with S. cerevisiae, a Sef1 ortholog is required for full growth under iron limitation conditions, making C. glabrata an evolutionary intermediate to SEF1-dependent fungal pathogens. Therefore, C. glabrata has evolved an iron homeostasis system which seems to be unique within the pathogenic fungi. The fungus Candida glabrata represents an evolutionarily close relative of the well-studied and benign baker's yeast and model organism Saccharomyces cerevisiae On the other hand, C. glabrata is an important opportunistic human pathogen causing both superficial and systemic infections. The ability to acquire trace metals, in particular, iron, and to tightly regulate this process during infection is considered an important virulence attribute of a variety of pathogens. Importantly, S. cerevisiae uses a highly derivative regulatory system distinct from those of other fungi. Until now, the regulatory mechanism of iron homeostasis in C. glabrata has been mostly unknown. Our study revealed a hybrid iron regulation network that is unique to C. glabrata and is placed at an evolutionary midpoint between those of S. cerevisiae and related fungal pathogens. We thereby

  13. From the Cover: Toward a protein-protein interaction map of the budding yeast: A comprehensive system to examine two-hybrid interactions in all possible combinations between the yeast proteins

    NASA Astrophysics Data System (ADS)

    Ito, Takashi; Tashiro, Kosuke; Muta, Shigeru; Ozawa, Ritsuko; Chiba, Tomoko; Nishizawa, Mayumi; Yamamoto, Kiyoshi; Kuhara, Satoru; Sakaki, Yoshiyuki

    2000-02-01

    Protein-protein interactions play pivotal roles in various aspects of the structural and functional organization of the cell, and their complete description is indispensable to thorough understanding of the cell. As an approach toward this goal, here we report a comprehensive system to examine two-hybrid interactions in all of the possible combinations between proteins of Saccharomyces cerevisiae. We cloned all of the yeast ORFs individually as a DNA-binding domain fusion ("bait") in a MATa strain and as an activation domain fusion ("prey") in a MATα strain, and subsequently divided them into pools, each containing 96 clones. These bait and prey clone pools were systematically mated with each other, and the transformants were subjected to strict selection for the activation of three reporter genes followed by sequence tagging. Our initial examination of ≈4 × 106 different combinations, constituting ≈10% of the total to be tested, has revealed 183 independent two-hybrid interactions, more than half of which are entirely novel. Notably, the obtained binary data allow us to extract more complex interaction networks, including the one that may explain a currently unsolved mechanism for the connection between distinct steps of vesicular transport. The approach described here thus will provide many leads for integration of various cellular functions and serve as a major driving force in the completion of the protein-protein interaction map.

  14. The development of an unconventional food regeneration process: Quantifying the nutritional components of a model methylotrophic yeast

    NASA Technical Reports Server (NTRS)

    Petersen, G. R.; Stokes, B. O.

    1986-01-01

    A hybrid chemical/biological approach to unconventional food regeneration is discussed. Carbon dioxide and water, the major wastes of human metabolism would be converted to methanol by one of several physiochemical processes available (thermal, photocatalytic, etc.). Methanol is then used to supply carbon and energy for the culture of microorganisms which in turn produce biological useful basic food stuffs for human nutrition. Our work has focused on increasing the carbohydrate levels of a candidate methylotrophic yeast to more nearly coincide with human nutritional requirements. Yeasts were chosen due to their high carbohydrate levels compared to bacteria and their present familiarity in the human diet. The initial candidate yeast studied was a thermotolerant strain of Hansenula polymor pha, DL-1. The quantitative results that permit an evaluation of the overall efficiency in hybrid chemical/biological food production schemes are discussed. A preliminary evaluation of the overall efficiency of such schemes is also discussed.

  15. A yeast-based genetic screening to identify human proteins that increase homologous recombination.

    PubMed

    Collavoli, Anita; Comelli, Laura; Rainaldi, Giuseppe; Galli, Alvaro

    2008-05-01

    To identify new human proteins implicated in homologous recombination (HR), we set up 'a papillae assay' to screen a human cDNA library using the RS112 strain of Saccharomyces cerevisiae containing an intrachromosomal recombination substrate. We isolated 23 cDNAs, 11 coding for complete proteins and 12 for partially deleted proteins that increased HR when overexpressed in yeast. We characterized the effect induced by the overexpression of the complete human proteasome subunit beta 2, the partially deleted proteasome subunits alpha 3 and beta 8, the ribosomal protein L12, the brain abundant membrane signal protein (BASP1) and the human homologue to v-Ha-RAS (HRAS), which elevated HR by 2-6.5-fold over the control. We found that deletion of the RAD52 gene, which has a key role in most HR events, abolished the increase of HR induced by the proteasome subunits and HRAS; by contrast, the RAD52 deletion did not affect the high level of HR due to BASP1 and RPL12. This suggests that the proteins stimulated yeast HR via different mechanisms. Overexpression of the complete beta 2 human proteasome subunit or the partially deleted alpha 3 and beta 8 subunits increased methyl methanesulphonate (MMS) resistance much more in the rad52 Delta mutant than in the wild-type. Overexpression of RPL12 and BASP1 did not affect MMS resistance in both the wild-type and the rad52 Delta mutant, whereas HRAS decreased MMS resistance in the rad52 Delta mutant. The results indicate that these proteins may interfere with the pathway(s) involved in the repair of MMS-induced DNA damage. Finally, we provide further evidence that yeast is a helpful tool to identify human proteins that may have a regulatory role in HR.

  16. Studies of the expression of human poly(ADP-ribose) polymerase-1 in Saccharomyces cerevisiae and identification of PARP-1 substrates by yeast proteome microarray screening.

    PubMed

    Tao, Zhihua; Gao, Peng; Liu, Hung-Wen

    2009-12-15

    Poly(ADP-ribosyl)ation of various nuclear proteins catalyzed by a family of NAD(+)-dependent enzymes, poly(ADP-ribose) polymerases (PARPs), is an important posttranslational modification reaction. PARP activity has been demonstrated in all types of eukaryotic cells with the exception of yeast, in which the expression of human PARP-1 was shown to lead to retarded cell growth. We investigated the yeast growth inhibition caused by human PARP-1 expression in Saccharomyces cerevisiae. Flow cytometry analysis reveals that PARP-1-expressing yeast cells accumulate in the G(2)/M stage of the cell cycle. Confocal microscopy analysis shows that human PARP-1 is distributed throughout the nucleus of yeast cells but is enriched in the nucleolus. Utilizing yeast proteome microarray screening, we identified 33 putative PARP-1 substrates, six of which are known to be involved in ribosome biogenesis. The poly(ADP-ribosyl)ation of three of these yeast proteins, together with two human homologues, was confirmed by an in vitro PARP-1 assay. Finally, a polysome profile analysis using sucrose gradient ultracentrifugation demonstrated that the ribosome levels in yeast cells expressing PARP-1 are lower than those in control yeast cells. Overall, our data suggest that human PARP-1 may affect ribosome biogenesis by modifying certain nucleolar proteins in yeast. The artificial PARP-1 pathway in yeast may be used as a simple platform to identify substrates and verify function of this important enzyme.

  17. Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina)

    PubMed Central

    Dujon, Bernard A.; Louis, Edward J.

    2017-01-01

    Considerable progress in our understanding of yeast genomes and their evolution has been made over the last decade with the sequencing, analysis, and comparisons of numerous species, strains, or isolates of diverse origins. The role played by yeasts in natural environments as well as in artificial manufactures, combined with the importance of some species as model experimental systems sustained this effort. At the same time, their enormous evolutionary diversity (there are yeast species in every subphylum of Dikarya) sparked curiosity but necessitated further efforts to obtain appropriate reference genomes. Today, yeast genomes have been very informative about basic mechanisms of evolution, speciation, hybridization, domestication, as well as about the molecular machineries underlying them. They are also irreplaceable to investigate in detail the complex relationship between genotypes and phenotypes with both theoretical and practical implications. This review examines these questions at two distinct levels offered by the broad evolutionary range of yeasts: inside the best-studied Saccharomyces species complex, and across the entire and diversified subphylum of Saccharomycotina. While obviously revealing evolutionary histories at different scales, data converge to a remarkably coherent picture in which one can estimate the relative importance of intrinsic genome dynamics, including gene birth and loss, vs. horizontal genetic accidents in the making of populations. The facility with which novel yeast genomes can now be studied, combined with the already numerous available reference genomes, offer privileged perspectives to further examine these fundamental biological questions using yeasts both as eukaryotic models and as fungi of practical importance. PMID:28592505

  18. Screening and characterization of amylase and cellulase activities in psychrotolerant yeasts.

    PubMed

    Carrasco, Mario; Villarreal, Pablo; Barahona, Salvador; Alcaíno, Jennifer; Cifuentes, Víctor; Baeza, Marcelo

    2016-02-19

    Amylases and cellulases have great potential for application in industries such as food, detergent, laundry, textile, baking and biofuels. A common requirement in these fields is to reduce the temperatures of the processes, leading to a continuous search for microorganisms that secrete cold-active amylases and cellulases. Psychrotolerant yeasts are good candidates because they inhabit cold-environments. In this work, we analyzed the ability of yeasts isolated from the Antarctic region to grow on starch or carboxymethylcellulose, and their potential extracellular amylases and cellulases. All tested yeasts were able to grow with soluble starch or carboxymethylcellulose as the sole carbon source; however, not all of them produced ethanol by fermentation of these carbon sources. For the majority of the yeast species, the extracellular amylase or cellulase activity was higher when cultured in medium supplemented with glucose rather than with soluble starch or carboxymethylcellulose. Additionally, higher amylase activities were observed when tested at pH 5.4 and 6.2, and at 30-37 °C, except for Rhodotorula glacialis that showed elevated activity at 10-22 °C. In general, cellulase activity was high until pH 6.2 and between 22-37 °C, while the sample from Mrakia blollopis showed high activity at 4-22 °C. Peptide mass fingerprinting analysis of a potential amylase from Tetracladium sp. of about 70 kDa, showed several peptides with positive matches with glucoamylases from other fungi. Almost all yeast species showed extracellular amylase or cellulase activity, and an inducing effect by the respective substrate was observed in a minor number of yeasts. These enzymatic activities were higher at 30 °C in most yeast, with highest amylase and cellulase activity in Tetracladium sp. and M. gelida, respectively. However, Rh. glacialis and M. blollopis displayed high amylase or cellulase activity, respectively, under 22 °C. In this sense, these yeasts are interesting

  19. Rapid lead discovery through iterative screening of one bead one compound libraries.

    PubMed

    Gao, Yu; Amar, Sabrina; Pahwa, Sonia; Fields, Gregg; Kodadek, Thomas

    2015-01-12

    Primary hits that arise from screening one bead one compound (OBOC) libraries against a target of interest rarely have high potency. However, there has been little work focused on the development of an efficient workflow for primary hit improvement. In this study, we show that by characterizing the binding constants for all of the hits that arise from a screen, structure-activity relationship (SAR) data can be obtained to inform the design of "derivative libraries" of a primary hit that can then be screened under more demanding conditions to obtain improved compounds. Here, we demonstrate the rapid improvement of a primary hit against matrix metalloproteinase-14 using this approach.

  20. Yeasts from sub-Antarctic region: biodiversity, enzymatic activities and their potential as oleaginous microorganisms.

    PubMed

    Martinez, A; Cavello, I; Garmendia, G; Rufo, C; Cavalitto, S; Vero, S

    2016-09-01

    Various microbial groups are well known to produce a range of extracellular enzymes and other secondary metabolites. However, the occurrence and importance of investment in such activities have received relatively limited attention in studies of Antarctic soil microbiota. Sixty-one yeasts strains were isolated from King George Island, Antarctica which were characterized physiologically and identified at the molecular level using the D1/D2 region of rDNA. Fifty-eight yeasts (belonging to the genera Cryptococcus, Leucosporidiella, Rhodotorula, Guehomyces, Candida, Metschnikowia and Debaryomyces) were screened for extracellular amylolytic, proteolytic, esterasic, pectinolytic, inulolytic xylanolytic and cellulolytic activities at low and moderate temperatures. Esterase activity was the most common enzymatic activity expressed by the yeast isolates regardless the assay temperature and inulinase was the second most common enzymatic activity. No cellulolytic activity was detected. One yeast identified as Guehomyces pullulans (8E) showed significant activity across six of seven enzymes types tested. Twenty-eight yeast isolates were classified as oleaginous, being the isolate 8E the strain that accumulated the highest levels of saponifiable lipids (42 %).

  1. Recurrent Rearrangement during Adaptive Evolution in an Interspecific Yeast Hybrid Suggests a Model for Rapid Introgression

    PubMed Central

    Dunn, Barbara; Paulish, Terry; Stanbery, Alison; Piotrowski, Jeff; Koniges, Gregory; Kroll, Evgueny; Louis, Edward J.; Liti, Gianni; Sherlock, Gavin; Rosenzweig, Frank

    2013-01-01

    Genome rearrangements are associated with eukaryotic evolutionary processes ranging from tumorigenesis to speciation. Rearrangements are especially common following interspecific hybridization, and some of these could be expected to have strong selective value. To test this expectation we created de novo interspecific yeast hybrids between two diverged but largely syntenic Saccharomyces species, S. cerevisiae and S. uvarum, then experimentally evolved them under continuous ammonium limitation. We discovered that a characteristic interspecific genome rearrangement arose multiple times in independently evolved populations. We uncovered nine different breakpoints, all occurring in a narrow ∼1-kb region of chromosome 14, and all producing an “interspecific fusion junction” within the MEP2 gene coding sequence, such that the 5′ portion derives from S. cerevisiae and the 3′ portion derives from S. uvarum. In most cases the rearrangements altered both chromosomes, resulting in what can be considered to be an introgression of a several-kb region of S. uvarum into an otherwise intact S. cerevisiae chromosome 14, while the homeologous S. uvarum chromosome 14 experienced an interspecific reciprocal translocation at the same breakpoint within MEP2, yielding a chimaeric chromosome; these events result in the presence in the cell of two MEP2 fusion genes having identical breakpoints. Given that MEP2 encodes for a high-affinity ammonium permease, that MEP2 fusion genes arise repeatedly under ammonium-limitation, and that three independent evolved isolates carrying MEP2 fusion genes are each more fit than their common ancestor, the novel MEP2 fusion genes are very likely adaptive under ammonium limitation. Our results suggest that, when homoploid hybrids form, the admixture of two genomes enables swift and otherwise unavailable evolutionary innovations. Furthermore, the architecture of the MEP2 rearrangement suggests a model for rapid introgression, a phenomenon seen in

  2. Screening protocol for Torulopsis (Candida) glabrata.

    PubMed Central

    Land, G; Burke, J; Shelby, C; Rhodes, J; Collett, J; Bennett, I; Johnson, J

    1996-01-01

    A screening test has been developed for the presumptive identification of Torulopsis (Candida) glabrata from other common clinical isolates of yeast-like fungi. An interlaboratory comparison of a protocol consisting of morphology on cornmeal Tween 80 agar and trehalose fermentation at 42 degrees C was successful in differentiating T. glabrata from other taxa that are frequent or possible clinical isolates. The screening results for 517 clinical yeast isolates, 241 of which were T. glabrata, were compared with their final identification via commercial systems (API20C Yeast Identification System [bioMERIEUX, Hazelwood, Mo.] and Rapid Yeast Identification Panel [Dade Microscan, Sacramento, Calif.]). The trehalose screening test has a sensitivity and a specificity of 97.8 and 95.8%, respectively, and a positive predictive value of 97.4% and a negative predictive value of 96.5%. Overall, the trehalose screen had an efficiency rating of 93.9% for ruling in or out T. glabrata. Since T. glabrata represents a substantial part of the workload in a clinical laboratory, a significant reduction in direct and indirect costs should be realized. PMID:8862605

  3. Automated Yeast Transformation Protocol to Engineer S. cerevisiae Strains for Cellulosic Ethanol Production with Open Reading Frames that Express Proteins Binding to Xylose Isomerase Identified using Robotic Two-hybrid Screen

    USDA-ARS?s Scientific Manuscript database

    Commercialization of fuel ethanol production from lignocellulosic biomass has focused on engineering the glucose-fermenting industrial yeast Saccharomyces cerevisiae to utilize pentose sugars. Since S. cerevisiae naturally metabolizes xylulose, one approach involves introducing xylose isomerase (XI...

  4. (GTG)5 MSP-PCR fingerprinting as a technique for discrimination of wine associated yeasts?

    PubMed

    Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure.

  5. (GTG)5 MSP-PCR Fingerprinting as a Technique for Discrimination of Wine Associated Yeasts?

    PubMed Central

    Inostroza-Ponta, Mario; Valente, Patricia

    2014-01-01

    In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure. PMID:25171185

  6. Monitoring Recombination During Meiosis in Budding Yeast.

    PubMed

    Owens, Shannon; Tang, Shangming; Hunter, Neil

    2018-01-01

    Homologous recombination is fundamental to sexual reproduction, facilitating accurate segregation of homologous chromosomes at the first division of meiosis, and creating novel allele combinations that fuel evolution. Following initiation of meiotic recombination by programmed DNA double-strand breaks (DSBs), homologous pairing and DNA strand exchange form joint molecule (JM) intermediates that are ultimately resolved into crossover and noncrossover repair products. Physical monitoring of the DNA steps of meiotic recombination in Saccharomyces cerevisiae (budding yeast) cultures undergoing synchronous meiosis has provided seminal insights into the molecular basis of meiotic recombination and affords a powerful tool for dissecting the molecular roles of recombination factors. This chapter describes a suit of electrophoretic and Southern hybridization techniques used to detect and quantify the DNA intermediates of meiotic recombination at recombination hotspots in budding yeast. DSBs and recombination products (crossovers and noncrossovers) are resolved using one-dimensional electrophoresis and distinguished by restriction site polymorphisms between the parental chromosomes. Psoralen cross-linking is used to stabilize branched JMs, which are resolved from linear species by native/native two-dimensional electrophoresis. Native/denaturing two-dimensional electrophoresis is employed to determine the component DNA strands of JMs and to measure the processing of DSBs. These techniques are generally applicable to any locus where the frequency of recombination is high enough to detect intermediates by Southern hybridization. © 2018 Elsevier Inc. All rights reserved.

  7. Fermentation of cacao (Theobroma cacao L.) seeds with a hybrid Kluyveromyces marxianus strain improved product quality attributes.

    PubMed

    Leal, Gildemberg Amorim; Gomes, Luiz Humberto; Efraim, Priscilla; de Almeida Tavares, Flavio Cesar; Figueira, Antonio

    2008-08-01

    Fermentation of Theobroma cacao (cacao) seeds is an absolute requirement for the full development of chocolate flavor precursors. An adequate aeration of the fermenting cacao seed mass is a fundamental prerequisite for a satisfactory fermentation. Here, we evaluated whether a controlled inoculation of cacao seed fermentation using a Kluyveromyces marxianus hybrid yeast strain, with an increased pectinolytic activity, would improve an earlier liquid drainage ('sweatings') from the fermentation mass, developing a superior final product quality. Inoculation with K. marxianus increased by one third the volume of drained liquid and affected the microorganism population structure during fermentation, which was detectable up to the end of the process. Introduction of the hybrid yeast affected the profile of total seed protein degradation evaluated by polyacrylamide gel electrophoresis, with improved seed protein degradation, and reduction of titrable acidity. Sensorial evaluation of the chocolate obtained from beans fermented with the K. marxianus inoculation was more accepted by analysts in comparison with the one from cocoa obtained through natural fermentation. The increase in mass aeration during the first 24 h seemed to be fundamental for the improvement of fermentation quality, demonstrating the potential application of this improved hybrid yeast strain with superior exogenous pectinolytic activity.

  8. Synthesis and screening of one-bead-one-compound cyclic peptide libraries.

    PubMed

    Qian, Ziqing; Upadhyaya, Punit; Pei, Dehua

    2015-01-01

    Cyclic peptides have been a rich source of biologically active molecules. Herein we present a method for the combinatorial synthesis and screening of large one-bead-one-compound (OBOC) libraries of cyclic peptides against biological targets such as proteins. Up to ten million different cyclic peptides are rapidly synthesized on TentaGel microbeads by the split-and-pool synthesis method and subjected to a multistage screening protocol which includes magnetic sorting, on-bead enzyme-linked and fluorescence-based assays, and in-solution binding analysis of cyclic peptides selectively released from single beads by fluorescence anisotropy. Finally, the most active hit(s) is identified by the partial Edman degradation-mass spectrometry (PED-MS) method. This method allows a single researcher to synthesize and screen up to ten million cyclic peptides and identify the most active ligand(s) in ~1 month, without the time-consuming and expensive hit resynthesis or the use of any special equipment.

  9. Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

    PubMed

    Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

    2015-06-01

    Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

  10. New Saccharomyces cerevisiae baker's yeast displaying enhanced resistance to freezing.

    PubMed

    Codón, Antonio C; Rincón, Ana M; Moreno-Mateos, Miguel A; Delgado-Jarana, Jesús; Rey, Manuel; Limón, Carmen; Rosado, Ivan V; Cubero, Beatriz; Peñate, Xenia; Castrejón, Francisco; Benítez, Tahía

    2003-01-15

    Three procedures were used to obtain new Saccharomyces cerevisiae baker's yeasts with increased storage stability at -20, 4, 22, and 30 degrees C. The first used mitochondria from highly ethanol-tolerant wine yeast, which were transferred to baker's strains. Viability of the heteroplasmons was improved shortly after freezing. However, after prolonged storage, viability dramatically decreased and was accompanied by an increase in the frequency of respiratory-deficient (petite) mutant formation. This indicated that mitochondria were not stable and were incompatible with the nucleus. The strains tested regained their original resistance to freezing after recovering their own mitochondria. The second procedure used hybrid formation after protoplast fusion and isolation on selective media of fusants from baker's yeast meiotic products resistant to parafluorphenylalanine and cycloheximide, respectively. No hybrids were obtained when using the parentals, probably due to the high ploidy of the baker's strains. Hybrids obtained from nonisogenic strains manifested in all cases a resistance to freezing intermediate between those of their parental strains. Hybrids from crosses between meiotic products of the same strain were always more sensitive than their parentals. The third method was used to develop baker's yeast mutants resistant to 2-deoxy-d-glucose (DOG) and deregulated for maltose and sucrose metabolism. Mutant DOG21 displayed a slight increase in trehalose content and viability both in frozen doughs and during storage at 4 and 22 degrees C. This mutant also displayed a capacity to ferment, under laboratory conditions, both lean and sweet fresh and frozen doughs. For industrial uses, fermented lean and sweet bakery products, both from fresh and frozen doughs obtained with mutant DOG21, were of better quality with regard to volume, texture, and organoleptic properties than those produced by the wild type.

  11. Identification of superior lipid producing Lipomyces and Myxozyma yeasts

    USDA-ARS?s Scientific Manuscript database

    Oleaginous yeasts are of interest for production of single cell oils from sugars. Here 17 members of the Lipomyces and Myxozyma clade were screened for lipid production when cultured on glucose. The highest ranking yeasts included L. tetrasporus (21 g/l), L. kononenkoae (19.6 g/l), and L. lipofer (1...

  12. Alcoholic Fermentation of d-Xylose by Yeasts

    PubMed Central

    Toivola, Ansa; Yarrow, David; van den Bosch, Eduard; van Dijken, Johannes P.; Scheffers, W. Alexander

    1984-01-01

    Type strains of 200 species of yeasts able to ferment glucose and grow on xylose were screened for fermentation of d-xylose. In most of the strains tested, ethanol production was negligible. Nineteen were found to produce between 0.1 and 1.0 g of ethanol per liter. Strains of the following species produce more than 1 g of ethanol per liter in the fermentation test with 2% xylose: Brettanomyces naardenensis, Candida shehatae, Candida tenuis, Pachysolen tannophilus, Pichia segobiensis, and Pichia stipitis. Subsequent screening of these yeasts for their capacity to ferment d-cellobiose revealed that only Candida tenuis CBS 4435 was a good fermenter of both xylose and cellobiose under the test conditions used. PMID:16346558

  13. Yeasts in sustainable bioethanol production: A review.

    PubMed

    Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

    2017-07-01

    Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

  14. Accelerating Yeast Prion Biology using Droplet Microfluidics

    NASA Astrophysics Data System (ADS)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  15. Critical screening in the one- and two-electron Yukawa atoms

    NASA Astrophysics Data System (ADS)

    Montgomery, H. E.; Sen, K. D.; Katriel, Jacob

    2018-02-01

    The one- and two-electron Yukawa atoms, also referred to as the Debye-Hückel or screened Coulomb atoms, have been topics of considerable interest both for intrinsic reasons and because of their relevance to terrestrial and astrophysical plasmas. At sufficiently high screening the one-electron Yukawa atom ceases to be bound. Some calculations appeared to suggest that as the screening increases in the ground state of the two-electron Yukawa atom (in which both the one-particle attraction and the interparticle repulsion are screened) the two electrons are detached simultaneously, at the same screening constant at which the one-electron atom becomes unbound. Our results rule this scenario out, offering an alternative that is not less interesting. In particular, it is found that for Z <1 a mild amount of screening actually increases the binding energy of the second electron. At the nuclear charge Zc≈0.911028 ... , at which the bare Coulomb two-electron atom becomes unbound, and even over a range of lower nuclear charges, an appropriate amount of screening gives rise to a bound two-electron system.

  16. Combinatorial high-throughput optical screening of high performance Pd alloy cathode for hybrid Li-air battery.

    PubMed

    Jun, Young Jin; Park, Sung Hyeon; Woo, Seong Ihl

    2014-12-08

    Combinatorial high-throughput optical screening method was developed to find the optimum composition of highly active Pd-based catalysts at the cathode of the hybrid Li-air battery. Pd alone, which is one-third the cost of Pt, has difficulty in replacing Pt; therefore, the integration of other metals was investigated to improve its performance toward oxygen reduction reaction (ORR). Among the binary Pd-based catalysts, the composition of Pd-Ir derived catalysts had higher performance toward ORR compared to other Pd-based binary combinations. The composition at 88:12 at. % (Pd: Ir) showed the highest activity toward ORR at the cathode of the hybrid Li-air battery. The prepared Pd(88)Ir(12)/C catalyst showed a current density of -2.58 mA cm(-2) at 0.8 V (vs RHE), which was around 30% higher compared to that of Pd/C (-1.97 mA cm(-2)). When the prepared Pd(88)Ir(12)/C catalyst was applied to the hybrid Li-air battery, the polarization of the cell was reduced and the energy efficiency of the cell was about 30% higher than that of the cell with Pd/C.

  17. Functional mapping of yeast genomes by saturated transposition

    PubMed Central

    Michel, Agnès H; Hatakeyama, Riko; Kimmig, Philipp; Arter, Meret; Peter, Matthias; Matos, Joao; De Virgilio, Claudio; Kornmann, Benoît

    2017-01-01

    Yeast is a powerful model for systems genetics. We present a versatile, time- and labor-efficient method to functionally explore the Saccharomyces cerevisiae genome using saturated transposon mutagenesis coupled to high-throughput sequencing. SAturated Transposon Analysis in Yeast (SATAY) allows one-step mapping of all genetic loci in which transposons can insert without disrupting essential functions. SATAY is particularly suited to discover loci important for growth under various conditions. SATAY (1) reveals positive and negative genetic interactions in single and multiple mutant strains, (2) can identify drug targets, (3) detects not only essential genes, but also essential protein domains, (4) generates both null and other informative alleles. In a SATAY screen for rapamycin-resistant mutants, we identify Pib2 (PhosphoInositide-Binding 2) as a master regulator of TORC1. We describe two antagonistic TORC1-activating and -inhibiting activities located on opposite ends of Pib2. Thus, SATAY allows to easily explore the yeast genome at unprecedented resolution and throughput. DOI: http://dx.doi.org/10.7554/eLife.23570.001 PMID:28481201

  18. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    PubMed

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  19. Urine Multi-drug Screening with GC-MS or LC-MS-MS Using SALLE-hybrid PPT/SPE.

    PubMed

    Lee, Junhui; Park, Jiwon; Go, Ahra; Moon, Heesung; Kim, Sujin; Jung, Sohee; Jeong, Wonjoon; Chung, Heesun

    2018-05-14

    To intoxicated patients in the emergency room, toxicological analysis can be considerably helpful for identifying the involved toxicants. In order to develop a urine multi-drug screening (UmDS) method, gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-tandem mass spectrometry (LC-MS-MS) were used to determine targeted and unknown toxicants in urine. A GC-MS method in scan mode was validated for selectivity, limit of detection (LOD) and recovery. An LC-MS-MS multiple reaction monitoring (MRM) method was validated for lower LOD, recovery and matrix effect. The results of the screening analysis were compared with patient medical records to check the reliability of the screen. Urine samples collected from an emergency room were extracted through a combination of salting-out assisted liquid-liquid extraction (SALLE) and hybrid protein precipitation/solid phase extraction (hybrid PPT/SPE) plates and examined by GC-MS and LC-MS-MS. GC-MS analysis was performed as unknown drug screen and LC-MS-MS analysis was conducted as targeted drug screen. After analysis by GC-MS, a library search was conducted using an in-house library established with the automated mass spectral deconvolution and identification system (AMDISTM). LC-MS-MS used Cliquid®2.0 software for data processing and acquisition in MRM mode. An UmDS method by GC-MS and LC-MS-MS was developed by using a SALLE-hybrid PPT/SPE and in-house library. The results of UmDS by GC-MS and LC-MS-MS showed that toxicants could be identified from 185 emergency room patient samples containing unknown toxicants. Zolpidem, acetaminophen and citalopram were the most frequently encountered drugs in emergency room patients. The UmDS analysis developed in this study can be used effectively to detect toxic substances in a short time. Hence, it could be utilized in clinical and forensic toxicology practices.

  20. Isolation and characterization of ethanol tolerant yeast strains

    PubMed Central

    Tikka, Chiranjeevi; Osuru, Hari Prasad; Atluri, Navya; Raghavulu, Praveen Chakravarthi Veera; yellapu, Nanda Kumar; Mannur, Ismail Shaik; Prasad, Uppu Venkateswara; Aluru, Sudheer; K, Narasimha Varma; Bhaskar, Matcha

    2013-01-01

    Yeast strains are commonly associated with sugar rich environments. Various fruit samples were selected as source for isolating yeast cells. The isolated cultures were identified at Genus level by colony morphology, biochemical characteristics and cell morphological characters. An attempt has been made to check the viability of yeast cells under different concentrations of ethanol. Ethanol tolerance of each strain was studied by allowing the yeast to grow in liquid YEPD (Yeast Extract Peptone Dextrose) medium having different concentrations of ethanol. A total of fifteen yeast strains isolated from different samples were used for the study. Seven strains of Saccharomyces cerevisiae obtained from different fruit sources were screened for ethanol tolerance. The results obtained in this study show a range of tolerance levels between 7%-12% in all the stains. Further, the cluster analysis based on 22 RAPD (Random Amplified polymorphic DNA) bands revealed polymorphisms in these seven Saccharomyces strains. PMID:23750092

  1. From drug to protein: using yeast genetics for high-throughput target discovery.

    PubMed

    Armour, Christopher D; Lum, Pek Yee

    2005-02-01

    The budding yeast Saccharomyces cerevisiae has long been an effective eukaryotic model system for understanding basic cellular processes. The genetic tractability and ease of manipulation in the laboratory make yeast well suited for large-scale chemical and genetic screens. Several recent studies describing the use of yeast genetics for high-throughput drug target identification are discussed in this review.

  2. Yeast Los1p Has Properties of an Exportin-Like Nucleocytoplasmic Transport Factor for tRNA

    PubMed Central

    Hellmuth, Klaus; Lau, Denise M.; Bischoff, F. Ralf; Künzler, Markus; Hurt, Ed; Simos, George

    1998-01-01

    Saccharomyces cerevisiae Los1p, which is genetically linked to the nuclear pore protein Nsp1p and several tRNA biogenesis factors, was recently grouped into the family of importin/karyopherin-β-like proteins on the basis of its sequence similarity. In a two-hybrid screen, we identified Nup2p as a nucleoporin interacting with Los1p. Subsequent purification of Los1p from yeast demonstrates its physical association not only with Nup2p but also with Nsp1p. By the use of the Gsp1p-G21V mutant, Los1p was shown to preferentially bind to the GTP-bound form of yeast Ran. Furthermore, overexpression of full-length or N-terminally truncated Los1p was shown to have dominant-negative effects on cell growth and different nuclear export pathways. Finally, Los1p could interact with Gsp1p-GTP, but only in the presence of tRNA, as revealed in an indirect in vitro binding assay. These data confirm the homology between Los1p and the recently identified human exportin for tRNA and reinforce the possibility of a role for Los1p in nuclear export of tRNA in yeast. PMID:9774653

  3. Ribosomal DNA stability is supported by many 'buffer genes'-introduction to the Yeast rDNA Stability Database.

    PubMed

    Kobayashi, Takehiko; Sasaki, Mariko

    2017-01-01

    The ribosomal RNA gene (rDNA) is the most abundant gene in yeast and other eukaryotic organisms. Due to its heavy transcription, repetitive structure and programmed replication fork pauses, the rDNA is one of the most unstable regions in the genome. Thus, the rDNA is the best region to study the mechanisms responsible for maintaining genome integrity. Recently, we screened a library of ∼4800 budding yeast gene knockout strains to identify mutants defective in the maintenance of rDNA stability. The results of this screen are summarized in the Yeast rDNA Stability (YRS) Database, in which the stability and copy number of rDNA in each mutant are presented. From this screen, we identified ∼700 genes that may contribute to the maintenance of rDNA stability. In addition, ∼50 mutants had abnormally high or low rDNA copy numbers. Moreover, some mutants with unstable rDNA displayed abnormalities in another chromosome. In this review, we introduce the YRS Database and discuss the roles of newly identified genes that contribute to rDNA maintenance and genome integrity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Phenotypic Diagnosis of Lineage and Differentiation During Sake Yeast Breeding

    PubMed Central

    Ohnuki, Shinsuke; Okada, Hiroki; Friedrich, Anne; Kanno, Yoichiro; Goshima, Tetsuya; Hasuda, Hirokazu; Inahashi, Masaaki; Okazaki, Naoto; Tamura, Hiroyasu; Nakamura, Ryo; Hirata, Dai; Fukuda, Hisashi; Shimoi, Hitoshi; Kitamoto, Katsuhiko; Watanabe, Daisuke; Schacherer, Joseph; Akao, Takeshi; Ohya, Yoshikazu

    2017-01-01

    Sake yeast was developed exclusively in Japan. Its diversification during breeding remains largely uncharacterized. To evaluate the breeding processes of the sake lineage, we thoroughly investigated the phenotypes and differentiation of 27 sake yeast strains using high-dimensional, single-cell, morphological phenotyping. Although the genetic diversity of the sake yeast lineage is relatively low, its morphological diversity has expanded substantially compared to that of the Saccharomyces cerevisiae species as a whole. Evaluation of the different types of breeding processes showed that the generation of hybrids (crossbreeding) has more profound effects on cell morphology than the isolation of mutants (mutation breeding). Analysis of phenotypic robustness revealed that some sake yeast strains are more morphologically heterogeneous, possibly due to impairment of cellular network hubs. This study provides a new perspective for studying yeast breeding genetics and micro-organism breeding strategies. PMID:28642365

  5. Variation in α-acetolactate production within the hybrid lager yeast group Saccharomyces pastorianus and affirmation of the central role of the ILV6 gene.

    PubMed

    Gibson, Brian; Krogerus, Kristoffer; Ekberg, Jukka; Monroux, Adrien; Mattinen, Laura; Rautio, Jari; Vidgren, Virve

    2015-01-01

    A screen of 14 S. pastorianus lager-brewing strains showed as much as a nine-fold difference in wort total diacetyl concentration at equivalent stages of fermentation of 15°Plato brewer's wort. Two strains (A153 and W34), with relatively low and high diacetyl production, respectively, but which did not otherwise differ in fermentation performance, growth or flavour production, were selected for further investigation. Transcriptional analysis of key genes involved in valine biosynthesis showed differences between the two strains that were consistent with the differences in wort diacetyl concentration. In particular, the ILV6 gene, encoding a regulatory subunit of acetohydroxy acid synthase, showed early transcription (only 6 h after inoculation) and up to five-fold greater expression in W34 compared to A153. This earlier transcription was observed for both orthologues of ILV6 in the S. pastorianus hybrid (S. cerevisiae × S. eubayanus), although the S. cerevisiae form of ILV6 in W34 also showed a consistently higher transcript level throughout fermentation relative to the same gene in A153. Overexpression of either form of ILV6 (by placing it under the control of the PGK1 promoter) resulted in an identical two-fold increase in wort total diacetyl concentration relative to a control. The results confirm the role of the Ilv6 subunit in controlling α-acetolactate/diacetyl concentration and indicate no functional divergence between the two forms of Ilv6. The greater contribution of the S. cerevisiae ILV6 to acetolactate production in natural brewing yeast hybrids appears rather to be due to higher levels of transcription relative to the S. eubayanus form. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids.

    PubMed

    Hsu, Yu-Yi; Chou, Jui-Yu

    2017-01-01

    Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions.

  7. Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids

    PubMed Central

    Hsu, Yu-Yi; Chou, Jui-Yu

    2017-01-01

    Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions. PMID:28081193

  8. Lipase production in lipolytic yeast from Wonorejo mangrove area

    NASA Astrophysics Data System (ADS)

    Alami, Nur Hidayatul; Nasihah, Liziyatin; Umar, Rurin Luswidya Artaty; Kuswytasari, Nengah Dwianita; Zulaika, Enny; Shovitri, Maya

    2017-06-01

    Lipase is an enzyme that is often used in industry and become a commercial enzyme. One group of microorganisms capable of producing lipase is a yeast. This study aims to screen yeast from Wonorejo mangrove that potential to produce lipase and to optimize the production of these enzymes. Screening test include the measurement of lipolytic index and value of fatty acid. Yeast with the best value of fatty acid will be continued to the measurement of lipase activity. It is affected by several environmental factors, such as pH, temperature, and incubation time. This research was conducted to observe the optimization variation on environmental factors combination to produce lipase. Lipase activity was tested by using p-Nitrophenyl Palmitate (pNPP). Absorbency was measured by spectrofotometer on wavelength of 410 nm. Measurement of the enzyme activity was done by interpolating the absorbance values on the p-nitrophenol standard curve then calculated by the formula. All data were analyzed by using descriptive quantitative method. The results show that the highest lypolityc index was 2.08. The highest value of fatty acid was 0.49 that was reached on 168 hours of incubation. Candida W3.8 expressed the highest lypolylitic potential. The optimum environment to produce lipase by Candida W 3.8 was on 120 hours of incubation time, in temperature range of 27°C - 45°C and pH range of 4,5 - 7.

  9. Molecular architecture of the yeast Mediator complex

    PubMed Central

    Robinson, Philip J; Trnka, Michael J; Pellarin, Riccardo; Greenberg, Charles H; Bushnell, David A; Davis, Ralph; Burlingame, Alma L; Sali, Andrej; Kornberg, Roger D

    2015-01-01

    The 21-subunit Mediator complex transduces regulatory information from enhancers to promoters, and performs an essential role in the initiation of transcription in all eukaryotes. Structural information on two-thirds of the complex has been limited to coarse subunit mapping onto 2-D images from electron micrographs. We have performed chemical cross-linking and mass spectrometry, and combined the results with information from X-ray crystallography, homology modeling, and cryo-electron microscopy by an integrative modeling approach to determine a 3-D model of the entire Mediator complex. The approach is validated by the use of X-ray crystal structures as internal controls and by consistency with previous results from electron microscopy and yeast two-hybrid screens. The model shows the locations and orientations of all Mediator subunits, as well as subunit interfaces and some secondary structural elements. Segments of 20–40 amino acid residues are placed with an average precision of 20 Å. The model reveals roles of individual subunits in the organization of the complex. DOI: http://dx.doi.org/10.7554/eLife.08719.001 PMID:26402457

  10. Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1.

    PubMed Central

    Kalenik, J L; Chen, D; Bradley, M E; Chen, S J; Lee, T C

    1997-01-01

    Muscle-restricted transcription of sarcomeric actin genes is negatively controlled by the zinc finger protein YY1, which is down-regulated at the protein level during myogenic differentiation. To identify cellular proteins that might mediate the function/stability of YY1 in muscle cells, we screened an adult human muscle cDNA library using the yeast two-hybrid cloning system. We report the isolation and characterization of a novel protein termed YAF2 (YY1- associated factor 2) that interacts with YY1. The YAF2 cDNA encodes a 180 amino acid basic protein (pI 10.5) containing a single N-terminal C2-X10-C2 zinc finger. Lysine clusters are present that may function as a nuclear localization signal. Domain mapping analysis shows that the first and second zinc fingers of YY1 are targeted for YAF2 protein interaction. In contrast to the down-regulation of YY1, YAF2 message levels increase during in vitro differentiation of both rat skeletal and cardiac muscle cells. YAF2 appears to have a promyogenic regulatory role, since overexpression of YAF2 in C2 myoblasts stimulates myogenic promoter activity normally restricted by YY1. Co-transfection of YY1 reverses the stimulatory effect of YAF2. YAF2 also greatly potentiates proteolytic cleavage of YY1 by the calcium- activated protease m-calpain. The isolation of YAF2 may help in understanding the mechanisms through which inhibitors of myogenic transcription may be antagonized or eliminated by proteolysis during muscle development. PMID:9016636

  11. No evidence for extrinsic post-zygotic isolation in a wild Saccharomyces yeast system.

    PubMed

    Charron, Guillaume; Landry, Christian R

    2017-06-01

    Although microorganisms account for the largest fraction of Earth's biodiversity, we know little about how their reproductive barriers evolve. Sexual microorganisms such as Saccharomyces yeasts rapidly develop strong intrinsic post-zygotic isolation, but the role of extrinsic isolation in the early speciation process remains to be investigated. We measured the growth of F 1 hybrids between two incipient species of Saccharomyces paradoxus to assess the presence of extrinsic post-zygotic isolation across 32 environments. More than 80% of hybrids showed either partial dominance of the best parent or over-dominance for growth, revealing no fitness defects in F 1 hybrids. Extrinsic reproductive isolation therefore likely plays little role in limiting gene flow between incipient yeast species and is not a requirement for speciation. © 2017 The Author(s).

  12. Editor’s Highlight: A Genome-wide Screening of Target Genes Against Silver Nanoparticles in Fission Yeast

    PubMed Central

    Lee, Sook-Jeong; Lee, Minho; Nam, Miyoung; Lee, Sol; Choi, Jian; Lee, Hye-Jin; Kim, Dong-Uk; Hoe, Kwang-Lae

    2018-01-01

    Abstract To identify target genes against silver nanoparticles (AgNPs), we screened a genome-wide gene deletion library of 4843 fission yeast heterozygous mutants covering 96% of all protein encoding genes. A total of 33 targets were identified by a microarray and subsequent individual confirmation. The target pattern of AgNPs was more similar to those of AgNO3 and H2O2, followed by Cd and As. The toxic effect of AgNPs on fission yeast was attributed to the intracellular uptake of AgNPs, followed by the subsequent release of Ag+, leading to the generation of reactive oxygen species (ROS). Next, we focused on the top 10 sensitive targets for further studies. As described previously, 7 nonessential targets were associated with detoxification of ROS, because their heterozygous mutants showed elevated ROS levels. Three novel essential targets were related to folate metabolism or cellular component organization, resulting in cell cycle arrest and no induction in the transcriptional level of antioxidant enzymes such as Sod1 and Gpx1 when 1 of the 2 copies was deleted. Intriguingly, met9 played a key role in combating AgNP-induced ROS generation via NADPH production and was also conserved in a human cell line. PMID:29294138

  13. An original method for producing acetaldehyde and diacetyl by yeast fermentation.

    PubMed

    Rosca, Irina; Petrovici, Anca Roxana; Brebu, Mihai; Stoica, Irina; Minea, Bogdan; Marangoci, Narcisa

    In this study a natural culture medium that mimics the synthetic yeast peptone glucose medium used for yeast fermentations was designed to screen and select yeasts capable of producing high levels of diacetyl and acetaldehyde. The presence of whey powder and sodium citrate in the medium along with manganese and magnesium sulfate enhanced both biomass and aroma development. A total of 52 yeasts strains were cultivated in two different culture media, namely, yeast peptone glucose medium and yeast acetaldehyde-diacetyl medium. The initial screening of the strains was based on the qualitative reaction of the acetaldehyde with Schiff's reagent (violet color) and diacetyl with Brady's reagent (yellow precipitate). The fermented culture media of 10 yeast strains were subsequently analyzed by gas chromatography to quantify the concentration of acetaldehyde and diacetyl synthesized. Total titratable acidity values indicated that a total titratable acidity of 5.5°SH, implying culture medium at basic pH, was more favorable for the acetaldehyde biosynthesis using strain D15 (Candida lipolytica; 96.05mgL -1 acetaldehyde) while a total titratable acidity value of 7°SH facilitated diacetyl flavor synthesis by strain D38 (Candida globosa; 3.58mgL -1 diacetyl). Importantly, the results presented here suggest that this can be potentially used in the baking industry. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  14. Effect of wine yeast monoculture practice on the biodiversity of non-Saccharomyces yeasts.

    PubMed

    Ganga, M A; Martínez, C

    2004-01-01

    The objective of this work was to study the effect of the use of Saccharomyces cerevisiae monocultures over the biodiversity of non-Saccharomyces yeasts in wine-producing areas in Chile. Microvinifications were carried out with grape musts of two areas. In one of them, the fermentation is carried out mainly in a spontaneous manner, whereas in the other the musts are inoculated with commercial yeasts. The isolated yeasts were identified by the internal transcribed (ITS)/restriction fragment length polymorphism technique. In the industrial production area less variability of yeast genera was observed as compared with the traditional area, an observation that is greatest at the end of the fermentation. Furthermore, a study of the production of extracellular enzymes was done. The majority of the yeasts showed at least one of the activities assayed with the exception of beta-glycosidase. The results suggest that in the industrialized area the diversity of yeasts is less in the traditional area. Likewise, the potentiality of the non-Saccharomyces yeasts as enzyme producers with industrial interest has been confirmed. This study shows the negative effect of the use of monocultures over the biodiversity of yeasts in wine-producing regions.

  15. Exploring the Yeast Acetylome Using Functional Genomics

    PubMed Central

    Duffy, Supipi Kaluarachchi; Friesen, Helena; Baryshnikova, Anastasia; Lambert, Jean-Philippe; Chong, Yolanda T.; Figeys, Daniel; Andrews, Brenda

    2014-01-01

    SUMMARY Lysine acetylation is a dynamic posttranslational modification with a well-defined role in regulating histones. The impact of acetylation on other cellular functions remains relatively uncharacterized. We explored the budding yeast acetylome with a functional genomics approach, assessing the effects of gene overexpression in the absence of lysine deacetylases (KDACs). We generated a network of 463 synthetic dosage lethal (SDL) interactions involving class I and II KDACs, revealing many cellular pathways regulated by different KDACs. A biochemical survey of genes interacting with the KDAC RPD3 identified 72 proteins acetylated in vivo. In-depth analysis of one of these proteins, Swi4, revealed a role for acetylation in G1-specific gene expression. Acetylation of Swi4 regulates interaction with its partner Swi6, both components of the SBF transcription factor. This study expands our view of the yeast acetylome, demonstrates the utility of functional genomic screens for exploring enzymatic pathways, and provides functional information that can be mined for future studies. PMID:22579291

  16. Recombinant yeast screen for new inhibitors of human acetyl-CoA carboxylase 2 identifies potential drugs to treat obesity

    PubMed Central

    Marjanovic, Jasmina; Chalupska, Dominika; Patenode, Caroline; Coster, Adam; Arnold, Evan; Ye, Alice; Anesi, George; Lu, Ying; Okun, Ilya; Tkachenko, Sergey; Haselkorn, Robert; Gornicki, Piotr

    2010-01-01

    Acetyl-CoA carboxylase (ACC) is a key enzyme of fatty acid metabolism with multiple isozymes often expressed in different eukaryotic cellular compartments. ACC-made malonyl-CoA serves as a precursor for fatty acids; it also regulates fatty acid oxidation and feeding behavior in animals. ACC provides an important target for new drugs to treat human diseases. We have developed an inexpensive nonradioactive high-throughput screening system to identify new ACC inhibitors. The screen uses yeast gene-replacement strains depending for growth on cloned human ACC1 and ACC2. In “proof of concept” experiments, growth of such strains was inhibited by compounds known to target human ACCs. The screen is sensitive and robust. Medium-size chemical libraries yielded new specific inhibitors of human ACC2. The target of the best of these inhibitors was confirmed with in vitro enzymatic assays. This compound is a new drug chemotype inhibiting human ACC2 with 2.8 μM IC50 and having no effect on human ACC1 at 100 μM. PMID:20439761

  17. Disposable electrochemical immunosensor for Brettanomyces bruxellensis based on nanogold-reduced graphene oxide hybrid nanomaterial.

    PubMed

    Borisova, Boryana; Villalonga, María L; Arévalo-Villena, María; Boujakhrout, Abderrahmane; Sánchez, Alfredo; Parrado, Concepción; Pingarrón, José M; Briones-Pérez, Ana; Villalonga, Reynaldo

    2017-09-01

    The assembly of a novel disposable amperometric immunosensor for the detection of the red wine spoilage yeast Brettanomyces bruxellensis is reported. The nanostructured sensing interface was prepared by first coating carbon screen printed electrodes with a gold nanoparticles-reduced graphene oxide hybrid nanomaterial, which was then modified with 3-mercaptopropionic acid to further immobilize specific antibodies for B. bruxellensis via a carbodiimide-coupling reaction. The functionalized electrode allowed the amperometric detection of B. bruxellensis in buffered solutions and red wine samples in the range of 10-10 6  CFU/mL and 10 2 -10 6  CFU/mL, with low detection limits of 8 CFU/mL and 56 CFU/mL, respectively. The electrochemical immunosensor also exhibited high reproducibility, selectivity, and storage stability. Graphical abstract A novel disposable electrochemical immunosensor for the detection of the red wine spoilage yeast B. bruxellensis.

  18. Ecological Success of a Group of Saccharomyces cerevisiae/Saccharomyces kudriavzevii Hybrids in the Northern European Wine-Making Environment

    PubMed Central

    Erny, C.; Raoult, P.; Alais, A.; Butterlin, G.; Delobel, P.; Matei-Radoi, F.; Casaregola, S.

    2012-01-01

    The hybrid nature of lager-brewing yeast strains has been known for 25 years; however, yeast hybrids have only recently been described in cider and wine fermentations. In this study, we characterized the hybrid genomes and the relatedness of the Eg8 industrial yeast strain and of 24 Saccharomyces cerevisiae/Saccharomyces kudriavzevii hybrid yeast strains used for wine making in France (Alsace), Germany, Hungary, and the United States. An array-based comparative genome hybridization (aCGH) profile of the Eg8 genome revealed a typical chimeric profile. Measurement of hybrids DNA content per cell by flow cytometry revealed multiple ploidy levels (2n, 3n, or 4n), and restriction fragment length polymorphism analysis of 22 genes indicated variable amounts of S. kudriavzevii genetic content in three representative strains. We developed microsatellite markers for S. kudriavzevii and used them to analyze the diversity of a population isolated from oaks in Ardèche (France). This analysis revealed new insights into the diversity of this species. We then analyzed the diversity of the wine hybrids for 12 S. cerevisiae and 7 S. kudriavzevii microsatellite loci and found that these strains are the products of multiple hybridization events between several S. cerevisiae wine yeast isolates and various S. kudriavzevii strains. The Eg8 lineage appeared remarkable, since it harbors strains found over a wide geographic area, and the interstrain divergence measured with a (δμ)2 genetic distance indicates an ancient origin. These findings reflect the specific adaptations made by S. cerevisiae/S. kudriavzevii cryophilic hybrids to winery environments in cool climates. PMID:22344648

  19. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    PubMed

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  20. One library to make them all: streamlining the creation of yeast libraries via a SWAp-Tag strategy.

    PubMed

    Yofe, Ido; Weill, Uri; Meurer, Matthias; Chuartzman, Silvia; Zalckvar, Einat; Goldman, Omer; Ben-Dor, Shifra; Schütze, Conny; Wiedemann, Nils; Knop, Michael; Khmelinskii, Anton; Schuldiner, Maya

    2016-04-01

    The yeast Saccharomyces cerevisiae is ideal for systematic studies relying on collections of modified strains (libraries). Despite the significance of yeast libraries and the immense variety of available tags and regulatory elements, only a few such libraries exist, as their construction is extremely expensive and laborious. To overcome these limitations, we developed a SWAp-Tag (SWAT) method that enables one parental library to be modified easily and efficiently to give rise to an endless variety of libraries of choice. To showcase the versatility of the SWAT approach, we constructed and investigated a library of ∼1,800 strains carrying SWAT-GFP modules at the amino termini of endomembrane proteins and then used it to create two new libraries (mCherry and seamless GFP). Our work demonstrates how the SWAT method allows fast and effortless creation of yeast libraries, opening the door to new ways of systematically studying cell biology.

  1. Synergism between hydrogen peroxide and seventeen acids against five agri-food-borne fungi and one yeast strain.

    PubMed

    Martin, H; Maris, P

    2012-12-01

    The objective of this study was to evaluate fungicidal efficacy of hydrogen peroxide administered in combination with 17 mineral and organic acids authorized for use in the food industry. The assays were performed on a 96-well microplate using a microdilution technique based on the checkerboard titration method. The six selected strains (one yeast and five fungi) were reference strains and strains representative of contaminating fungi found in the food industry. Each synergistic hydrogen peroxide/acid combination found after fifteen minutes contact time at 20 °C in distilled water was then tested in conditions simulating four different use conditions. Twelve combinations were synergistic in distilled water, eleven of these remained synergistic with one or more of the four mineral and organic interfering substances selected. Hydrogen peroxide/formic acid combination remained effective against four strains and was never antagonistic against the other two fungi. Combinations with propionic acid and acetic acid stayed synergistic against two strains. Those with oxalic acid and lactic acid kept their synergism only against Candida albicans. No synergism was detected against Penicillium cyclopium. Synergistic combinations of disinfectants were revealed, among them the promising hydrogen peroxide/formic acid combination. A rapid screening method developed in our laboratory for bacteria was adapted to fungi and used to reveal the synergistic potential of disinfectants and/or sanitizers combinations. © 2012 The Society for Applied Microbiology.

  2. Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

    NASA Astrophysics Data System (ADS)

    Sakharkar, Kishore R.; Sakharkar, Meena K.

    The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

  3. The Yeast Deletion Collection: A Decade of Functional Genomics

    PubMed Central

    Giaever, Guri; Nislow, Corey

    2014-01-01

    The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

  4. Protocols and programs for high-throughput growth and aging phenotyping in yeast.

    PubMed

    Jung, Paul P; Christian, Nils; Kay, Daniel P; Skupin, Alexander; Linster, Carole L

    2015-01-01

    In microorganisms, and more particularly in yeasts, a standard phenotyping approach consists in the analysis of fitness by growth rate determination in different conditions. One growth assay that combines high throughput with high resolution involves the generation of growth curves from 96-well plate microcultivations in thermostated and shaking plate readers. To push the throughput of this method to the next level, we have adapted it in this study to the use of 384-well plates. The values of the extracted growth parameters (lag time, doubling time and yield of biomass) correlated well between experiments carried out in 384-well plates as compared to 96-well plates or batch cultures, validating the higher-throughput approach for phenotypic screens. The method is not restricted to the use of the budding yeast Saccharomyces cerevisiae, as shown by consistent results for other species selected from the Hemiascomycete class. Furthermore, we used the 384-well plate microcultivations to develop and validate a higher-throughput assay for yeast Chronological Life Span (CLS), a parameter that is still commonly determined by a cumbersome method based on counting "Colony Forming Units". To accelerate analysis of the large datasets generated by the described growth and aging assays, we developed the freely available software tools GATHODE and CATHODE. These tools allow for semi-automatic determination of growth parameters and CLS behavior from typical plate reader output files. The described protocols and programs will increase the time- and cost-efficiency of a number of yeast-based systems genetics experiments as well as various types of screens.

  5. Discovery of synthesis and secretion of polyol esters of fatty acids by four basidiomycetous yeast species in the order Sporidiobolales.

    PubMed

    Garay, Luis A; Sitepu, Irnayuli R; Cajka, Tomas; Fiehn, Oliver; Cathcart, Erin; Fry, Russell W; Kanti, Atit; Joko Nugroho, Agustinus; Faulina, Sarah Asih; Stephanandra, Sira; German, J Bruce; Boundy-Mills, Kyria L

    2017-06-01

    Polyol esters of fatty acids (PEFA) are amphiphilic glycolipids produced by yeast that could play a role as natural, environmentally friendly biosurfactants. We recently reported discovery of a new PEFA-secreting yeast species, Rhodotorula babjevae, a basidiomycetous yeast to display this behavior, in addition to a few other Rhodotorula yeasts reported on the 1960s. Additional yeast species within the taxonomic order Sporidiobolales were screened for secreted glycolipid production. PEFA production equal or above 1 g L -1 were detected in 19 out of 65 strains of yeast screened, belonging to 6 out of 30 yeast species tested. Four of these species were not previously known to secrete glycolipids. These results significantly increase the number of yeast species known to secrete PEFA, holding promise for expanding knowledge of PEFA synthesis and secretion mechanisms, as well as setting the groundwork towards commercialization.

  6. Yeast as a potential vehicle for neglected tropical disease drug discovery.

    PubMed

    Denny, P W; Steel, P G

    2015-01-01

    High-throughput screening (HTS) efforts for neglected tropical disease (NTD) drug discovery have recently received increased attention because several initiatives have begun to attempt to reduce the deficit in new and clinically acceptable therapies for this spectrum of infectious diseases. HTS primarily uses two basic approaches, cell-based and in vitro target-directed screening. Both of these approaches have problems; for example, cell-based screening does not reveal the target or targets that are hit, whereas in vitro methodologies lack a cellular context. Furthermore, both can be technically challenging, expensive, and difficult to miniaturize for ultra-HTS [(u)HTS]. The application of yeast-based systems may overcome some of these problems and offer a cost-effective platform for target-directed screening within a eukaryotic cell context. Here, we review the advantages and limitations of the technologies that may be used in yeast cell-based, target-directed screening protocols, and we discuss how these are beginning to be used in NTD drug discovery. © 2014 Society for Laboratory Automation and Screening.

  7. Structural and electronic properties of U{sub n}O{sub m} (n=1-3,m=1-3n) clusters: A theoretical study using screened hybrid density functional theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Yu; Liu, Haitao; Zhang, Ping, E-mail: zhang-ping@iapcm.ac.cn

    The structural and electronic properties of small uranium oxide clusters U{sub n}O{sub m} (n=1-3, m=1-3n) are systematically studied within the screened hybrid density functional theory. It is found that the formation of U–O–U bondings and isolated U–O bonds are energetically more stable than U–U bondings. As a result, no uranium cores are observed. Through fragmentation studies, we find that the U{sub n}O{sub m} clusters with the m/n ratio between 2 and 2.5 are very stable, hinting that UO{sub 2+x} hyperoxides are energetically stable. Electronically, we find that the O-2p states always distribute in the deep energy range, and the U-5fmore » states always distribute at the two sides of the Fermi level. The U-6d states mainly hybridize with the U-5f states in U-rich clusters, while hybridizing with O-2p states in O-rich clusters. Our work is the first one on the screened hybrid density functional theory level studying the atomic and electronic properties of the actinide oxide clusters.« less

  8. A PROP1-binding factor, AES cloned by yeast two-hybrid assay represses PROP1-induced Pit-1 gene expression.

    PubMed

    Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko

    2013-08-25

    PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  9. Sponge Sampling with Fluorescent In Situ Hybridization as a Screening Tool for the Early Detection of Esophageal Cancer.

    PubMed

    Haisley, Kelly R; Dolan, James P; Olson, Susan B; Toledo-Valdovinos, Sergio A; Hart, Kyle D; Bakis, Gene; Enestvedt, Brintha K; Hunter, John G

    2017-02-01

    Sponge cytology is a novel screening tool for esophageal cancer but has been unable to be validated for widespread use. Our aim was to apply fluorescent in situ hybridization to sponge cytology samples in order to evaluate the safety and efficacy of this modality in screening for esophageal cancer. At a single, multidisciplinary, NCI-designated cancer center, patients completed sponge cytology sampling prior to upper endoscopy. Samples were analyzed by p53 fluorescent in situ hybridization, and results were compared to the endoscopic diagnosis. Fifty patients were enrolled (96 % Caucasian, 68 % male, median age of 67). All patients successfully swallowed the capsule. No complications (string breakage, bleeding, mucosal injury) occurred. Endoscopy revealed that 38 % had normal esophageal mucosa and 62 % had an esophageal mucosal abnormality. In total, six samples demonstrated p53 loss (94 % specificity for any abnormality). The sensitivity of the p53 fluorescent in situ hybridization probe was13.3 % for any abnormality, 10 % for intestinal metaplasia, and 0 % for dysplasia or esophageal cancer. Esophageal sponge cytology is a promising, safe, and tolerable method for collecting esophageal cell samples. However, our data suggest that p53 fluorescent in situ hybridization does not improve the sensitivity for detecting cancer in these samples.

  10. Estrogenic activities of chemicals related to food contact plastics and rubbers tested by the yeast two-hybrid assay.

    PubMed

    Ogawa, Yuko; Kawamura, Yoko; Wakui, Chiseko; Mutsuga, Motoh; Nishimura, Tetsuji; Tanamoto, Kenichi

    2006-04-01

    Food contact plastics and rubbers possibly contain many kinds of chemicals such as monomers, oligomers, additives, degradation products of polymers and additives, and impurities. Among them, bisphenol A, nonylphenol, benzylbutyl phthalate, styrene oligomers and hydroxylated benzophenones have been reported to possess estrogenic activities. In this study, other chemicals related to food contact plastics and rubbers, and their metabolites induced by the S9-mixture were tested for their estrogenic activities using the yeast two-hybrid assay. Among the 150 chemicals, 10 chemicals such as bis(4-hydroxyphenyl) methane, 4-cyclohexylphenol, 4-phenylphenol, 4,4'-isopropylidenediphenol alkylphosphite, two type of styrenated phenol (including mono type), tris(nonylphenyl) phosphite, 2,2'-dihydroxy-4-methoxybenzophenone, 2-hydroxy-4-methoxybenzophenone and 2,4-diphenyl-4-methyl-1-pentene, their metabolites and the metabolites of 6 other chemicals, such as 2-(phenylmethyl) phenol, styrenated phenol (di and tri type), 1-(N-phenylamino)naphthalene, 4-tert-butylphenylsalicylate, nonylphenol ethoxylates and 2-methyl-6-tert-butylphenol, displayed estrogenic activities. All of them contained a phenol group in their chemical structures or formed one easily by hydrolysis or metabolism. However, most of the chemicals related to food contact plastics and rubbers, and their metabolites did not show any estrogenicity.

  11. Characterization of Hyaluronan-Degrading Enzymes from Yeasts.

    PubMed

    Smirnou, Dzianis; Krčmář, Martin; Kulhánek, Jaromír; Hermannová, Martina; Bobková, Lenka; Franke, Lukáš; Pepeliaev, Stanislav; Velebný, Vladimír

    2015-10-01

    Hyaluronidases (HAases) from yeasts were characterized for the first time. The study elucidated that hyaluronate 4-glycanohydrolase and hyaluronan (HA) lyase can be produced by yeasts. Six yeasts producing HAases were found through express screening of activities. The extracellular HAases from two of the yeast isolates, Pseudozyma aphidis and Cryptococcus laurentii, were characterized among them. P. aphidis HAase hydrolyzed β-1,4 glycosidic bonds of HA, yielding even-numbered oligosaccharides with N-acetyl-D-glucosamine at the reducing end. C. laurentii produced hyaluronan lyase, which cleaved β-1,4 glycosidic bonds of HA in β-elimination reaction, and the products of HA degradation were different-sized even-numbered oligosaccharides. The shortest detected HA oligomer was dimer. The enzymes' pH and temperature optima were pH 3.0 and 37-45 °C (P. aphidis) and pH 6.0 and 37 °C (C. laurentii), respectively. Both HAases showed good thermostability.

  12. Mitochondrial Recombination and Introgression during Speciation by Hybridization.

    PubMed

    Leducq, Jean-Baptiste; Henault, Mathieu; Charron, Guillaume; Nielly-Thibault, Lou; Terrat, Yves; Fiumera, Heather L; Shapiro, B Jesse; Landry, Christian R

    2017-08-01

    Genome recombination is a major source of genotypic diversity and contributes to adaptation and speciation following interspecies hybridization. The contribution of recombination in these processes has been thought to be largely limited to the nuclear genome because organelles are mostly uniparentally inherited in animals and plants, which prevents recombination. Unicellular eukaryotes such as budding yeasts do, however, transmit mitochondria biparentally, suggesting that during hybridization, both parents could provide alleles that contribute to mitochondrial functions such as respiration and metabolism in hybrid populations or hybrid species. We examined the dynamics of mitochondrial genome transmission and evolution during speciation by hybridization in the natural budding yeast Saccharomyces paradoxus. Using population-scale mitochondrial genome sequencing in two endemic North American incipient species SpB and SpC and their hybrid species SpC*, we found that both parental species contributed to the hybrid mitochondrial genome through recombination. We support our findings by showing that mitochondrial recombination between parental types is frequent in experimental crosses that recreate the early step of this speciation event. In these artificial hybrids, we observed that mitochondrial genome recombination enhances phenotypic variation among diploid hybrids, suggesting that it could play a role in the phenotypic differentiation of hybrid species. Like the nuclear genome, the mitochondrial genome can, therefore, also play a role in hybrid speciation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Genetic relationship and biological status of the industrially important yeast Saccharomyces eubayanus Sampaio et al.

    PubMed

    Naumov, G I

    2017-03-01

    The genomes of the recently discovered yeast Saccharomyces eubayanus and traditional S. cerevisiae are known to be found in the yeast S. pastorianus (syn. S. carlsbergensis), which are essential for brewing. The cryotolerant yeast S. bayanus var. uvarum is of great importance for production of some wines. Based on ascospore viability and meiotic recombination of the control parental markers in hybrids, we have shown that there is no complete interspecies post-zygotic isolation between the yeasts S. eubayanus, S. bayanus var. bayanus and S. bayanus var. uvarum. The genetic data presented indicate that all of the three taxa belong to the same species.

  14. High-throughput fermentation screening for the yeast Yarrowia lipolytica with real-time monitoring of biomass and lipid production.

    PubMed

    Back, Alexandre; Rossignol, Tristan; Krier, François; Nicaud, Jean-Marc; Dhulster, Pascal

    2016-08-23

    Because the model yeast Yarrowia lipolytica can synthesize and store lipids in quantities up to 20 % of its dry weight, it is a promising microorganism for oil production at an industrial scale. Typically, optimization of the lipid production process is performed in the laboratory and later scaled up for industrial production. However, the scale-up process can be complicated by genetic modifications that are optimized for one set of growing conditions can confer a less-than-optimal phenotype in a different environment. To address this issue, small cultivation systems have been developed that mimic the conditions in benchtop bioreactors. In this work, we used one such microbioreactor system, the BioLector, to develop high-throughput fermentation procedures that optimize growth and lipid accumulation in Y. lipolytica. Using this system, we were able to monitor lipid and biomass production in real time throughout the culture duration. The BioLector can monitor the growth of Y. lipolytica in real time by evaluating scattered light; this produced accurate measurements until cultures reached an equivalent of OD600nm = 115 and a cell dry weight of 100 g L(-1). In addition, a lipid-specific fluorescent probe was applied which reliably monitored lipid production up to a concentration of 12 g L(-1). Through screening various growing conditions, we determined that a carbon/nitrogen ratio of 35 was the most efficient for lipid production. Further screening showed that ammonium chloride and glycerol were the most valuable nitrogen and carbon sources, respectively, for growth and lipid production. Moreover, a carbon concentration above 1 M appeared to impair growth and lipid accumulation. Finally, we used these optimized conditions to screen engineered strains of Y. lipolytica with high lipid-accumulation capability. The growth and lipid content of the strains cultivated in the BioLector were compared to those grown in benchtop bioreactors. To our knowledge, this is the

  15. Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon.

    PubMed

    Cao, Shuanghe; Siriwardana, Chamindika L; Kumimoto, Roderick W; Holt, Ben F

    2011-05-19

    Monocots, especially the temperate grasses, represent some of the most agriculturally important crops for both current food needs and future biofuel development. Because most of the agriculturally important grass species are difficult to study (e.g., they often have large, repetitive genomes and can be difficult to grow in laboratory settings), developing genetically tractable model systems is essential. Brachypodium distachyon (hereafter Brachypodium) is an emerging model system for the temperate grasses. To fully realize the potential of this model system, publicly accessible discovery tools are essential. High quality cDNA libraries that can be readily adapted for multiple downstream purposes are a needed resource. Additionally, yeast two-hybrid (Y2H) libraries are an important discovery tool for protein-protein interactions and are not currently available for Brachypodium. We describe the creation of two high quality, publicly available Gateway™ cDNA entry libraries and their derived Y2H libraries for Brachypodium. The first entry library represents cloned cDNA populations from both short day (SD, 8/16-h light/dark) and long day (LD, 20/4-h light/dark) grown plants, while the second library was generated from hormone treated tissues. Both libraries have extensive genome coverage (~5 × 107 primary clones each) and average clone lengths of ~1.5 Kb. These entry libraries were then used to create two recombination-derived Y2H libraries. Initial proof-of-concept screens demonstrated that a protein with known interaction partners could readily re-isolate those partners, as well as novel interactors. Accessible community resources are a hallmark of successful biological model systems. Brachypodium has the potential to be a broadly useful model system for the grasses, but still requires many of these resources. The Gateway™ compatible entry libraries created here will facilitate studies for multiple user-defined purposes and the derived Y2H libraries can be

  16. Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes

    PubMed Central

    Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.

    2016-01-01

    The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954

  17. FTIR microspectroscopy for rapid screening and monitoring of polyunsaturated fatty acid production in commercially valuable marine yeasts and protists.

    PubMed

    Vongsvivut, Jitraporn; Heraud, Philip; Gupta, Adarsha; Puri, Munish; McNaughton, Don; Barrow, Colin J

    2013-10-21

    The increase in polyunsaturated fatty acid (PUFA) consumption has prompted research into alternative resources other than fish oil. In this study, a new approach based on focal-plane-array Fourier transform infrared (FPA-FTIR) microspectroscopy and multivariate data analysis was developed for the characterisation of some marine microorganisms. Cell and lipid compositions in lipid-rich marine yeasts collected from the Australian coast were characterised in comparison to a commercially available PUFA-producing marine fungoid protist, thraustochytrid. Multivariate classification methods provided good discriminative accuracy evidenced from (i) separation of the yeasts from thraustochytrids and distinct spectral clusters among the yeasts that conformed well to their biological identities, and (ii) correct classification of yeasts from a totally independent set using cross-validation testing. The findings further indicated additional capability of the developed FPA-FTIR methodology, when combined with partial least squares regression (PLSR) analysis, for rapid monitoring of lipid production in one of the yeasts during the growth period, which was achieved at a high accuracy compared to the results obtained from the traditional lipid analysis based on gas chromatography. The developed FTIR-based approach when coupled to programmable withdrawal devices and a cytocentrifugation module would have strong potential as a novel online monitoring technology suited for bioprocessing applications and large-scale production.

  18. Bread, beer and wine: yeast domestication in the Saccharomyces sensu stricto complex.

    PubMed

    Sicard, Delphine; Legras, Jean-Luc

    2011-03-01

    Yeasts of the Saccharomyces sensu stricto species complex are able to convert sugar into ethanol and CO(2) via fermentation. They have been used for thousands years by mankind for fermenting food and beverages. In the Neolithic times, fermentations were probably initiated by naturally occurring yeasts, and it is unknown when humans started to consciously add selected yeast to make beer, wine or bread. Interestingly, such human activities gave rise to the creation of new species in the Saccharomyces sensu stricto complex by interspecies hybridization or polyploidization. Within the S. cerevisiae species, they have led to the differentiation of genetically distinct groups according to the food process origin. Although the evolutionary history of wine yeast populations has been well described, the histories of other domesticated yeasts need further investigation. Copyright © 2011 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  19. Killer yeasts inhibit the growth of the phytopathogen Moniliophthora perniciosa, the causal agent of Witches’ Broom disease

    PubMed Central

    de Souza Cabral, Anderson; de Carvalho, Patricia Maria Barroso; Pinotti, Tatiana; Hagler, Allen Norton; Mendonça-Hagler, Leda Cristina Santana; Macrae, Andrew

    2009-01-01

    Fruit and soil yeasts isolated from the Amazon, Atlantic Rainforests and an organic farm were screened for killer activity against yeasts. Killer yeasts were then tested against the phytopathogen Moniliophthora perniciosa (syn. Crinipellis perniciosa) and a Dipodascus capitatus strain and a Candida sp strain inhibited its growth. PMID:24031327

  20. Cost-effectiveness of one versus two sample faecal immunochemical testing for colorectal cancer screening.

    PubMed

    Goede, S Lucas; van Roon, Aafke H C; Reijerink, Jacqueline C I Y; van Vuuren, Anneke J; Lansdorp-Vogelaar, Iris; Habbema, J Dik F; Kuipers, Ernst J; van Leerdam, Monique E; van Ballegooijen, Marjolein

    2013-05-01

    The sensitivity and specificity of a single faecal immunochemical test (FIT) are limited. The performance of FIT screening can be improved by increasing the screening frequency or by providing more than one sample in each screening round. This study aimed to evaluate if two-sample FIT screening is cost-effective compared with one-sample FIT. The MISCAN-colon microsimulation model was used to estimate costs and benefits of strategies with either one or two-sample FIT screening. The FIT cut-off level varied between 50 and 200 ng haemoglobin/ml, and the screening schedule was varied with respect to age range and interval. In addition, different definitions for positivity of the two-sample FIT were considered: at least one positive sample, two positive samples, or the mean of both samples being positive. Within an exemplary screening strategy, biennial FIT from the age of 55-75 years, one-sample FIT provided 76.0-97.0 life-years gained (LYG) per 1000 individuals, at a cost of € 259,000-264,000 (range reflects different FIT cut-off levels). Two-sample FIT screening with at least one sample being positive provided 7.3-12.4 additional LYG compared with one-sample FIT at an extra cost of € 50,000-59,000. However, when all screening intervals and age ranges were considered, intensifying screening with one-sample FIT provided equal or more LYG at lower costs compared with two-sample FIT. If attendance to screening does not differ between strategies it is recommended to increase the number of screening rounds with one-sample FIT screening, before considering increasing the number of FIT samples provided per screening round.

  1. Different selective pressures lead to different genomic outcomes as newly-formed hybrid yeasts evolve.

    PubMed

    Piotrowski, Jeff S; Nagarajan, Saisubramanian; Kroll, Evgueny; Stanbery, Alison; Chiotti, Kami E; Kruckeberg, Arthur L; Dunn, Barbara; Sherlock, Gavin; Rosenzweig, Frank

    2012-04-02

    Interspecific hybridization occurs in every eukaryotic kingdom. While hybrid progeny are frequently at a selective disadvantage, in some instances their increased genome size and complexity may result in greater stress resistance than their ancestors, which can be adaptively advantageous at the edges of their ancestors' ranges. While this phenomenon has been repeatedly documented in the field, the response of hybrid populations to long-term selection has not often been explored in the lab. To fill this knowledge gap we crossed the two most distantly related members of the Saccharomyces sensu stricto group, S. cerevisiae and S. uvarum, and established a mixed population of homoploid and aneuploid hybrids to study how different types of selection impact hybrid genome structure. As temperature was raised incrementally from 31°C to 46.5°C over 500 generations of continuous culture, selection favored loss of the S. uvarum genome, although the kinetics of genome loss differed among independent replicates. Temperature-selected isolates exhibited greater inherent and induced thermal tolerance than parental species and founding hybrids, and also exhibited ethanol resistance. In contrast, as exogenous ethanol was increased from 0% to 14% over 500 generations of continuous culture, selection favored euploid S. cerevisiae x S. uvarum hybrids. Ethanol-selected isolates were more ethanol tolerant than S. uvarum and one of the founding hybrids, but did not exhibit resistance to temperature stress. Relative to parental and founding hybrids, temperature-selected strains showed heritable differences in cell wall structure in the forms of increased resistance to zymolyase digestion and Micafungin, which targets cell wall biosynthesis. This is the first study to show experimentally that the genomic fate of newly-formed interspecific hybrids depends on the type of selection they encounter during the course of evolution, underscoring the importance of the ecological theatre in

  2. Screened exchange hybrid density functional for accurate and efficient structures and interaction energies.

    PubMed

    Brandenburg, Jan Gerit; Caldeweyher, Eike; Grimme, Stefan

    2016-06-21

    We extend the recently introduced PBEh-3c global hybrid density functional [S. Grimme et al., J. Chem. Phys., 2015, 143, 054107] by a screened Fock exchange variant based on the Henderson-Janesko-Scuseria exchange hole model. While the excellent performance of the global hybrid is maintained for small covalently bound molecules, its performance for computed condensed phase mass densities is further improved. Most importantly, a speed up of 30 to 50% can be achieved and especially for small orbital energy gap cases, the method is numerically much more robust. The latter point is important for many applications, e.g., for metal-organic frameworks, organic semiconductors, or protein structures. This enables an accurate density functional based electronic structure calculation of a full DNA helix structure on a single core desktop computer which is presented as an example in addition to comprehensive benchmark results.

  3. The competitor-introduced Ggamma recruitment system, a new approach for screening affinity-enhanced proteins.

    PubMed

    Fukuda, Nobuo; Ishii, Jun; Tanaka, Tsutomu; Kondo, Akihiko

    2010-04-01

    We have developed a new approach based on the Ggamma recruitment system to screen affinity-enhanced proteins by expressing a binding competitor. The previously established Ggamma recruitment system is a yeast two-hybrid (Y2H) system that utilizes G-protein signaling, and is based on the fact that membrane localization of the G-protein gamma subunit (Ggamma) is essential for signal transduction in yeast. In the original Y2H system, an engineered Ggamma that lacks membrane localization upon deletion of the lipid modification site (Ggamma(cyto)) is produced, and a candidate protein with an artificial lipidation site and its counterpart fused with Ggamma(cyto) are expressed. As protein-protein interactions bring Ggamma(cyto) towards the plasma membrane, G-protein signaling can be activated, and the interaction is detected by various cellular responses as the readout. In the current study, we expressed a third cytosolic protein that competes with the candidate protein to specifically isolate affinity-enhanced mutants from a mutation library of the candidate protein. Enhancing the affinity of the protein candidate guides the counterpart-Ggamma(cyto) fusion protein towards the plasma membrane and activates signaling. Using mutants of the Z domain derived from Staphylococcus aureus protein A as candidate proteins or competitors, and the Fc portion of human immunoglobulin G (IgG) as the counterpart, we demonstrate that affinity-enhanced proteins can be effectively screened from a library containing a 10 000-fold excess of non-enhanced proteins. This new approach, called the competitor-introduced Ggamma recruitment system, will be useful for efficient discovery of rare valuable candidates hidden among excess ordinary ones.

  4. A meta-GGA level screened range-separated hybrid functional by employing short range Hartree-Fock with a long range semilocal functional.

    PubMed

    Jana, Subrata; Samal, Prasanjit

    2018-03-28

    The range-separated hybrid density functionals are very successful in describing a wide range of molecular and solid-state properties accurately. In principle, such functionals are designed from spherically averaged or system averaged as well as reverse engineered exchange holes. In the present attempt, the screened range-separated hybrid functional scheme has been applied to the meta-GGA rung by using the density matrix expansion based semilocal exchange hole (or functional). The hybrid functional proposed here utilizes the spherically averaged density matrix expansion based exchange hole in the range separation scheme. For slowly varying density correction the range separation scheme is employed only through the local density approximation based exchange hole coupled with the corresponding fourth order gradient approximate Tao-Mo enhancement factor. The comprehensive testing and performance of the newly constructed functional indicates its applicability in describing several molecular properties. The most appealing feature of this present screened hybrid functional is that it will be practically very useful in describing solid-state properties at the meta-GGA level.

  5. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    PubMed Central

    Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast density and species composition. When yeast densities were compared in pieces of the same fruits assigned to different treatments, fruits that developed low yeast densities in the absence of flies developed significantly higher yeast densities when exposed to larvae. Across all of the fruits, larvae regulated yeast densities within narrow limits, as compared to a much wider range of yeast densities that developed in pieces of the same fruits not exposed to flies. Larvae also affected yeast species composition, dramatically reducing species diversity across fruits, reducing variation in yeast communities from one fruit to the next (beta diversity), and encouraging the consistent development of a yeast community composed of three species of yeast (Candida californica, C. zemplinina, and Pichia kluvyeri), all of which were palatable to larvae. Larvae excreted viable cells of these three yeast species in their fecal pools, and discouraged the growth of filamentous fungi, processes which may have contributed to their effects on the yeast communities in banana fruits. These and other findings suggest that D. melanogaster adults and their larval offspring together engage in ‘niche construction’, facilitating a predictable microbial environment in the fruit substrates in which the larvae live and develop. PMID:22860093

  6. The Baker's Yeast Reduction of Keto-Esters in Organic Solvents: A One Week Research Project for Undergraduate Students

    NASA Astrophysics Data System (ADS)

    North, Michael

    1998-05-01

    An experiment has been designed which allows final year undergraduate students to carry out a mini-research project in one week and thus get a flavour of the joys and tribulations of conducting chemical research before they undertake a major research project. The experiment is an investigation into the reduction of alpha- or beta-keto esters using non-fermenting Baker's yeast in petroleum ether. There are a number of advantages to this method of using Baker's yeast, including a reduction in the amount of organic solvent used, and a much simplified purification procedure. During the course of the mini-project, the substrate specificity of the yeast is investigated, and the conditions for the optimisation of a particular keto ester are determined. Each product is analysed by a variety of analytical techniques including polarimetry, IR, NMR, and GC. In addition, the use of correct stereochemical nomenclature to describe prochiral, and chiral compounds as well as chemical reactions are discussed.

  7. BAPJ69-4A: a yeast two-hybrid strain for both positive and negative genetic selection.

    PubMed

    Shaffer, Hally Anne; Rood, Michael Kenneth; Kashlan, Badar; Chang, Eileen I-ling; Doyle, Donald Francis; Azizi, Bahareh

    2012-10-01

    Genetic selection systems, such as the yeast two-hybrid system, are efficient methods to detect protein-protein and protein-ligand interactions. These systems have been further developed to assess negative interactions, such as inhibition, using the URA3 genetic selection marker. Previously, chemical complementation was used to assess positive selection in Saccharomyces cerevisiae. In this work, a new S. cerevisiae strain, called BAPJ69-4A, containing three selective markers ADE2, HIS3, and URA3 as well as the lacZ gene controlled by Gal4 response elements, was developed and characterized using the retinoid X receptor (RXR) and its ligand 9-cis retinoic acid (9cRA). Further characterization was performed using RXR variants and the synthetic ligand LG335. To assess the functionality of the strain, RXR was compared to the parent strain PJ69-4A in adenine, histidine, and uracil selective media. In positive selection, associating partners that lead to cell growth were observed in all media in the presence of ligand, whereas partners that did not associate due to the absence of ligand displayed no growth. Conversely, in negative selection, partners that did not associate in 5-FOA medium did not display cell death due to the lack of expression of the URA3 gene. The creation of the BAPJ69-4A yeast strain provides a high-throughput selection system, called negative chemical complementation, which can be used for both positive and negative selection, providing a fast, powerful tool for discovering novel ligand receptor pairs for applications in drug discovery and protein engineering. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Hybridization within Saccharomyces Genus Results in Homoeostasis and Phenotypic Novelty in Winemaking Conditions

    PubMed Central

    Dillmann, Christine; Bely, Marina; la Guerche, Stéphane; Giraud, Christophe; Huet, Sylvie; Sicard, Delphine; Masneuf-Pomarede, Isabelle; de Vienne, Dominique; Marullo, Philippe

    2015-01-01

    Despite its biotechnological interest, hybridization, which can result in hybrid vigor, has not commonly been studied or exploited in the yeast genus. From a diallel design including 55 intra- and interspecific hybrids between Saccharomyces cerevisiae and S. uvarum grown at two temperatures in enological conditions, we analyzed as many as 35 fermentation traits with original statistical and modeling tools. We first showed that, depending on the types of trait – kinetics parameters, life-history traits, enological parameters and aromas –, the sources of variation (strain, temperature and strain * temperature effects) differed in a large extent. Then we compared globally three groups of hybrids and their parents at two growth temperatures: intraspecific hybrids S. cerevisiae * S. cerevisiae, intraspecific hybrids S. uvarum * S. uvarum and interspecific hybrids S. cerevisiae * S. uvarum. We found that hybridization could generate multi-trait phenotypes with improved oenological performances and better homeostasis with respect to temperature. These results could explain why interspecific hybridization is so common in natural and domesticated yeast, and open the way to applications for wine-making. PMID:25946464

  9. Hybridation of different chiral separation techniques with ICP-MS detection for the separation and determination of selenomethionine enantiomers: chiral speciation of selenized yeast.

    PubMed

    Méndez, S P; González, E B; Sanz-Medel, A

    2001-05-01

    Enantioseparation and determination of selenomethionine enantiomers in selenized yeast was investigated using chiral separation techniques based on different principles, coupled on-line to inductively coupled plasma mass spectrometry (ICP-MS) for selenium-specific detection. High performance liquid chromatography (HPLC) on a beta-cyclodestrin (beta-CD) column, cyclodextrin-modified micellar electrokinetic chromatography (CD-MEKC), gas chromatography (GC) on a Chirasil-L-Val column, and HPLC on a Chirobiotic T column have been investigated as the chiral separation techniques. For HPLC separation on the beta-CD column, and also for CD-MEKC, selenomethionine enantiomers were derivatized with NDA/CN(-). For chiral separation by GC, selenomethionine enantiomers were converted into their N-trifluoroacetyl (TFA)-O-alkyl esters. The developed hybridation methodologies are compared with respect to enantioselectivity, sensitivity and analysis time. The usefulness of the best-suited method [HPLC (Chirobiotic T)-ICP-MS] was demonstrated by its application to the successful chiral speciation of selenium and D-and L-selenomethionine content determination in selenized yeast. Copyright 2001 John Wiley & Sons, Ltd.

  10. Genome-Wide Protein Interaction Screens Reveal Functional Networks Involving Sm-Like Proteins

    PubMed Central

    Fromont-Racine, Micheline; Mayes, Andrew E.; Brunet-Simon, Adeline; Rain, Jean-Christophe; Colley, Alan; Dix, Ian; Decourty, Laurence; Joly, Nicolas; Ricard, Florence; Beggs, Jean D.

    2000-01-01

    A set of seven structurally related Sm proteins forms the core of the snRNP particles containing the spliceosomal U1, U2, U4 and U5 snRNAs. A search of the genomic sequence of Saccharomyces cerevisiae has identified a number of open reading frames that potentially encode structurally similar proteins termed Lsm (Like Sm) proteins. With the aim of analysing all possible interactions between the Lsm proteins and any protein encoded in the yeast genome, we performed exhaustive and iterative genomic two-hybrid screens, starting with the Lsm proteins as baits. Indeed, extensive interactions amongst eight Lsm proteins were found that suggest the existence of a Lsm complex or complexes. These Lsm interactions apparently involve the conserved Sm domain that also mediates interactions between the Sm proteins. The screens also reveal functionally significant interactions with splicing factors, in particular with Prp4 and Prp24, compatible with genetic studies and with the reported association of Lsm proteins with spliceosomal U6 and U4/U6 particles. In addition, interactions with proteins involved in mRNA turnover, such as Mrt1, Dcp1, Dcp2 and Xrn1, point to roles for Lsm complexes in distinct RNA metabolic processes, that are confirmed in independent functional studies. These results provide compelling evidence that two-hybrid screens yield functionally meaningful information about protein–protein interactions and can suggest functions for uncharacterized proteins, especially when they are performed on a genome-wide scale. PMID:10900456

  11. Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.

    PubMed

    Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

    2010-11-15

    The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO₂ and temperature) useful for industrial application. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Functional conservation of the yeast and Arabidopsis RAD54-like genes.

    PubMed

    Klutstein, Michael; Shaked, Hezi; Sherman, Amir; Avivi-Ragolsky, Naomi; Shema, Efrat; Zenvirth, Drora; Levy, Avraham A; Simchen, Giora

    2008-04-01

    The Saccharomyces cerevisiae RAD54 gene has critical roles in DNA double-strand break repair, homologous recombination, and gene targeting. Previous results show that the yeast gene enhances gene targeting when expressed in Arabidopsis thaliana. In this work we address the trans-species compatibility of Rad54 functions. We show that overexpression of yeast RAD54 in Arabidopsis enhances DNA damage resistance severalfold. Thus, the yeast gene is active in the Arabidopsis homologous-recombination repair system. Moreover, we have identified an A. thaliana ortholog of yeast RAD54, named AtRAD54. This gene, with close sequence similarity to RAD54, complements methylmethane sulfonate (MMS) sensitivity but not UV sensitivity or gene targeting defects of rad54Delta mutant yeast cells. Overexpression of AtRAD54 in Arabidopsis leads to enhanced resistance to DNA damage. This gene's assignment as a RAD54 ortholog is further supported by the interaction of AtRad54 with AtRad51 and the interactions between alien proteins (i.e., yeast Rad54 with AtRAD51 and yeast Rad51 with AtRad54) in a yeast two-hybrid experiment. These interactions hint at the molecular nature of this interkingdom complementation, although the stronger effect of the yeast Rad54 in plants than AtRad54 in yeast might be explained by an ability of the Rad54 protein to act alone, independently of its interaction with Rad51.

  13. Novel Hybrid Virtual Screening Protocol Based on Molecular Docking and Structure-Based Pharmacophore for Discovery of Methionyl-tRNA Synthetase Inhibitors as Antibacterial Agents

    PubMed Central

    Liu, Chi; He, Gu; Jiang, Qinglin; Han, Bo; Peng, Cheng

    2013-01-01

    Methione tRNA synthetase (MetRS) is an essential enzyme involved in protein biosynthesis in all living organisms and is a potential antibacterial target. In the current study, the structure-based pharmacophore (SBP)-guided method has been suggested to generate a comprehensive pharmacophore of MetRS based on fourteen crystal structures of MetRS-inhibitor complexes. In this investigation, a hybrid protocol of a virtual screening method, comprised of pharmacophore model-based virtual screening (PBVS), rigid and flexible docking-based virtual screenings (DBVS), is used for retrieving new MetRS inhibitors from commercially available chemical databases. This hybrid virtual screening approach was then applied to screen the Specs (202,408 compounds) database, a structurally diverse chemical database. Fifteen hit compounds were selected from the final hits and shifted to experimental studies. These results may provide important information for further research of novel MetRS inhibitors as antibacterial agents. PMID:23839093

  14. Selection of oleaginous yeasts for fatty acid production.

    PubMed

    Lamers, Dennis; van Biezen, Nick; Martens, Dirk; Peters, Linda; van de Zilver, Eric; Jacobs-van Dreumel, Nicole; Wijffels, René H; Lokman, Christien

    2016-05-27

    Oleaginous yeast species are an alternative for the production of lipids or triacylglycerides (TAGs). These yeasts are usually non-pathogenic and able to store TAGs ranging from 20 % to 70 % of their cell mass depending on culture conditions. TAGs originating from oleaginous yeasts can be used as the so-called second generation biofuels, which are based on non-food competing "waste carbon sources". In this study the selection of potentially new interesting oleaginous yeast strains is described. Important selection criteria were: a broad maximum temperature and pH range for growth (robustness of the strain), a broad spectrum of carbon sources that can be metabolized (preferably including C-5 sugars), a high total fatty acid content in combination with a low glycogen content and genetic accessibility. Based on these selection criteria, among 24 screened species, Schwanniomyces occidentalis (Debaromyces occidentalis) CBS2864 was selected as a promising strain for the production of high amounts of lipids.

  15. Confocal nanoscanning, bead picking (CONA): PickoScreen microscopes for automated and quantitative screening of one-bead one-compound libraries.

    PubMed

    Hintersteiner, Martin; Buehler, Christof; Uhl, Volker; Schmied, Mario; Müller, Jürgen; Kottig, Karsten; Auer, Manfred

    2009-01-01

    Solid phase combinatorial chemistry provides fast and cost-effective access to large bead based libraries with compound numbers easily exceeding tens of thousands of compounds. Incubating one-bead one-compound library beads with fluorescently labeled target proteins and identifying and isolating the beads which contain a bound target protein, potentially represents one of the most powerful generic primary high throughput screening formats. On-bead screening (OBS) based on this detection principle can be carried out with limited automation. Often hit bead detection, i.e. recognizing beads with a fluorescently labeled protein bound to the compound on the bead, relies on eye-inspection under a wide-field microscope. Using low resolution detection techniques, the identification of hit beads and their ranking is limited by a low fluorescence signal intensity and varying levels of the library beads' autofluorescence. To exploit the full potential of an OBS process, reliable methods for both automated quantitative detection of hit beads and their subsequent isolation are needed. In a joint collaborative effort with Evotec Technologies (now Perkin-Elmer Cellular Technologies Germany GmbH), we have built two confocal bead scanner and picker platforms PS02 and a high-speed variant PS04 dedicated to automated high resolution OBS. The PS0X instruments combine fully automated confocal large area scanning of a bead monolayer at the bottom of standard MTP plates with semiautomated isolation of individual hit beads via hydraulic-driven picker capillaries. The quantification of fluorescence intensities with high spatial resolution in the equatorial plane of each bead allows for a reliable discrimination between entirely bright autofluorescent beads and real hit beads which exhibit an increased fluorescence signal at the outer few micrometers of the bead. The achieved screening speed of up to 200,000 bead assayed in less than 7 h and the picking time of approximately 1 bead

  16. Studying Functions of All Yeast Genes Simultaneously

    NASA Technical Reports Server (NTRS)

    Stolc, Viktor; Eason, Robert G.; Poumand, Nader; Herman, Zelek S.; Davis, Ronald W.; Anthony Kevin; Jejelowo, Olufisayo

    2006-01-01

    A method of studying the functions of all the genes of a given species of microorganism simultaneously has been developed in experiments on Saccharomyces cerevisiae (commonly known as baker's or brewer's yeast). It is already known that many yeast genes perform functions similar to those of corresponding human genes; therefore, by facilitating understanding of yeast genes, the method may ultimately also contribute to the knowledge needed to treat some diseases in humans. Because of the complexity of the method and the highly specialized nature of the underlying knowledge, it is possible to give only a brief and sketchy summary here. The method involves the use of unique synthetic deoxyribonucleic acid (DNA) sequences that are denoted as DNA bar codes because of their utility as molecular labels. The method also involves the disruption of gene functions through deletion of genes. Saccharomyces cerevisiae is a particularly powerful experimental system in that multiple deletion strains easily can be pooled for parallel growth assays. Individual deletion strains recently have been created for 5,918 open reading frames, representing nearly all of the estimated 6,000 genetic loci of Saccharomyces cerevisiae. Tagging of each deletion strain with one or two unique 20-nucleotide sequences enables identification of genes affected by specific growth conditions, without prior knowledge of gene functions. Hybridization of bar-code DNA to oligonucleotide arrays can be used to measure the growth rate of each strain over several cell-division generations. The growth rate thus measured serves as an index of the fitness of the strain.

  17. Construction of human chromosome 21-specific yeast artificial chromosomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCormick, M.K.; Shero, J.H.; Hieter, P.A.

    1989-12-01

    Chromosome 21-specific yeast artificial chromosomes (YACs) have been constructed by a method that performs all steps in agarose, allowing size selection by pulsed-field gel electrophoresis and the use of nanogram to microgram quantities of DNA. The DNA sources used were hybrid cell line WAV-17, containing chromosome 21 as the only human chromosome and flow-sorted chromosome 21. The transformation efficiency of ligation products was similar to that obtained in aqueous transformations and yielded YACs with sizes ranging from 100 kilobases (kb) to > 1 megabase when polyamines were included in the transformation procedure. Twenty-five YACs containing human DNA have been obtainedmore » from a mouse-human hybrid, ranging in size from 200 to > 1000 kb, with an average size of 410 kb. Ten of these YACs were localized to subregions of chromosome 21 by hybridization of RNA probes to a panel of somatic cell hybrid DNA. Twenty-one human YACs, ranging in size from 100 to 500 kb, with an average size of 150 kb, were obtained from {approx} 50 ng of flow-sorted chromosome 21 DNA. Three were localized to subregions of chromosome 21. YACs will aid the construction of a physical map of human chromosome 21 and the study of disorders associated with chromosome 21 such as Alzheimer disease and Down syndrome.« less

  18. Diversity and adaptive evolution of Saccharomyces wine yeast: a review

    PubMed Central

    Marsit, Souhir; Dequin, Sylvie

    2015-01-01

    Saccharomyces cerevisiae and related species, the main workhorses of wine fermentation, have been exposed to stressful conditions for millennia, potentially resulting in adaptive differentiation. As a result, wine yeasts have recently attracted considerable interest for studying the evolutionary effects of domestication. The widespread use of whole-genome sequencing during the last decade has provided new insights into the biodiversity, population structure, phylogeography and evolutionary history of wine yeasts. Comparisons between S. cerevisiae isolates from various origins have indicated that a variety of mechanisms, including heterozygosity, nucleotide and structural variations, introgressions, horizontal gene transfer and hybridization, contribute to the genetic and phenotypic diversity of S. cerevisiae. This review will summarize the current knowledge on the diversity and evolutionary history of wine yeasts, focusing on the domestication fingerprints identified in these strains. PMID:26205244

  19. Rice phytochrome-interacting factor protein OsPIFff14 represses OsDREB1B gene expression through an extended N-box and interacts preferentially with the active form of phytochrome B

    USDA-ARS?s Scientific Manuscript database

    DREB1/CBF genes, known as major regulators of plant stress responses, are rapidly and transiently induced by low temperatures. Using a Yeast one Hybrid screening, we identified a putative Phytochrome-Interacting bHLH Factor (OsPIF14), as binding to the OsDREB1B promoter. bHLH proteins are able to bi...

  20. Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast.

    PubMed

    Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A

    2016-06-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3' end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. Copyright © 2016 Larson et al.

  1. Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast

    PubMed Central

    Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A.

    2016-01-01

    Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3ʹ end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. PMID:27172183

  2. Continuous-flow separation of live and dead yeasts using reservoir-based dielectrophoresis (rDEP)

    NASA Astrophysics Data System (ADS)

    Patel, Saurin; Showers, Daniel; Vedantam, Pallavi; Tzeng, Tzuen-Rong; Qian, Shizhi; Xuan, Xiangchun

    2012-11-01

    Separating live and dead cells is critical to the diagnosis of early stage diseases and to the efficacy test of drug screening etc. We develop a novel microfluidic approach to continuous separation of yeast cells by viability inside a reservoir. It exploits the cell dielectrophoresis that is induced by the inherent electric field gradient at the reservoir-microchannel junction to selectively trap dead yeasts and continuously sort them from live ones. We term this approach reservoir-based dielectrophoresis (rDEP). The transporting, focusing, and trapping of live and dead yeast cells at the reservoir-microchannel junction are studied separately by varying the DC-biased AC electric fields. These phenomena can all be reasonably predicted by a 2D numerical model. We find that the AC to DC field ratio for live yeast trapping is higher than that for dead cells because the former experiences a weaker rDEP while having a larger electrokinetic mobility. It is this difference in the AC to DC field ratio that enables the viability-based yeast cell separation. The rDEP approach has unique advantages over existing DEP-based techniques such as the occupation of zero channel space and the elimination of in-channel mechanical or electrical parts. NSF

  3. Evidence for multiple interspecific hybridization in Saccharomyces sensu stricto species.

    PubMed

    de Barros Lopes, Miguel; Bellon, Jennifer R; Shirley, Neil J; Ganter, Philip F

    2002-01-01

    Fluorescent amplified fragment length polymorphism analysis demonstrates a high level of gene exchange between Saccharomyces sensu stricto species, with some strains having undergone multiple interspecific hybridization events with subsequent changes in genome complexity. Two lager strains were shown to be hybrids between Saccharomyces cerevisiae and the alloploid species Saccharomyces pastorianus. The genome structure of CBS 380(T), the type strain of Saccharomyces bayanus, is also consistent with S. pastorianus gene transfer. The results indicate that the cider yeast, CID1, possesses nuclear DNA from three separate species. Mating experiments show that there are no barriers to interspecific conjugation of haploid cells. Furthermore, the allopolyploid strains were able to undergo further hybridizations with other Saccharomyces sensu stricto yeasts. These results demonstrate that introgression between the Saccharomyces sensu stricto species is likely.

  4. Fructanase and fructosyltransferase activity of non-Saccharomyces yeasts isolated from fermenting musts of Mezcal.

    PubMed

    Arrizon, Javier; Morel, Sandrine; Gschaedler, Anne; Monsan, Pierre

    2012-04-01

    Fructanase and fructosyltransferase are interesting for the tequila process and prebiotics production (functional food industry). In this study, one hundred thirty non-Saccharomyces yeasts isolated from "Mezcal de Oaxaca" were screened for fructanase and fructosyltransferase activity. On solid medium, fifty isolates grew on Agave tequilana fructans (ATF), inulin or levan. In liquid media, inulin and ATF induced fructanase activities of between 0.02 and 0.27U/ml depending of yeast isolate. High fructanase activity on sucrose was observed for Kluyveromyces marxianus and Torulaspora delbrueckii, while the highest fructanase activity on inulin and ATF was observed for Issatchenkia orientalis, Cryptococcus albidus, and Candida apicola. Zygosaccharomyces bisporus and Candida boidinii had a high hydrolytic activity on levan. Sixteen yeasts belonging to K. marxianus, T. delbrueckii and C. apicola species were positive for fructosyltransferase activity. Mezcal microbiota proved to showed to be a source for new fructanase and fructosyltransferases with potential application in the tequila and food industry. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Array comparative genomic hybridization screening in IVF significantly reduces number of embryos available for cryopreservation

    PubMed Central

    Liu, Jiaen; Yang, Zhihong; Salem, Shala A; Rahil, Tayyab; Collins, Gary S; Liu, Xiaohong; Salem, Rifaat D

    2012-01-01

    Objective During IVF, non-transferred embryos are usually selected for cryopreservation on the basis of morphological criteria. This investigation evaluated an application for array comparative genomic hybridization (aCGH) in assessment of surplus embryos prior to cryopreservation. Methods First-time IVF patients undergoing elective single embryo transfer and having at least one extra non-transferred embryo suitable for cryopreservation were offered enrollment in the study. Patients were randomized into two groups: Patients in group A (n=55) had embryos assessed first by morphology and then by aCGH, performed on cells obtained from trophectoderm biopsy on post-fertilization day 5. Only euploid embryos were designated for cryopreservation. Patients in group B (n=48) had embryos assessed by morphology alone, with only good morphology embryos considered suitable for cryopreservation. Results Among biopsied embryos in group A (n=425), euploidy was confirmed in 226 (53.1%). After fresh single embryo transfer, 64 (28.3%) surplus euploid embryos were cryopreserved for 51 patients (92.7%). In group B, 389 good morphology blastocysts were identified and a single top quality blastocyst was selected for fresh transfer. All group B patients (48/48) had at least one blastocyst remaining for cryopreservation. A total of 157 (40.4%) blastocysts were frozen in this group, a significantly larger proportion than was cryopreserved in group A (p=0.017, by chi-squared analysis). Conclusion While aCGH and subsequent frozen embryo transfer are currently used to screen embryos, this is the first investigation to quantify the impact of aCGH specifically on embryo cryopreservation. Incorporation of aCGH screening significantly reduced the total number of cryopreserved blastocysts compared to when suitability for freezing was determined by morphology only. IVF patients should be counseled that the benefits of aCGH screening will likely come at the cost of sharply limiting the number of

  6. Yeasts in floral nectar: a quantitative survey

    PubMed Central

    Herrera, Carlos M.; de Vega, Clara; Canto, Azucena; Pozo, María I.

    2009-01-01

    Background and Aims One peculiarity of floral nectar that remains relatively unexplored from an ecological perspective is its role as a natural habitat for micro-organisms. This study assesses the frequency of occurrence and abundance of yeast cells in floral nectar of insect-pollinated plants from three contrasting plant communities on two continents. Possible correlations between interspecific differences in yeast incidence and pollinator composition are also explored. Methods The study was conducted at three widely separated areas, two in the Iberian Peninsula (Spain) and one in the Yucatán Peninsula (Mexico). Floral nectar samples from 130 species (37–63 species per region) in 44 families were examined microscopically for the presence of yeast cells. For one of the Spanish sites, the relationship across species between incidence of yeasts in nectar and the proportion of flowers visited by each of five major pollinator categories was also investigated. Key Results Yeasts occurred regularly in the floral nectar of many species, where they sometimes reached extraordinary densities (up to 4 × 105 cells mm−3). Depending on the region, between 32 and 44 % of all nectar samples contained yeasts. Yeast cell densities in the order of 104 cells mm−3 were commonplace, and densities >105 cells mm−3 were not rare. About one-fifth of species at each site had mean yeast cell densities >104 cells mm−3. Across species, yeast frequency and abundance were directly correlated with the proportion of floral visits by bumble-bees, and inversely with the proportion of visits by solitary bees. Conclusions Incorporating nectar yeasts into the scenario of plant–pollinator interactions opens up a number of intriguing avenues for research. In addition, with yeasts being as ubiquitous and abundant in floral nectars as revealed by this study, and given their astounding metabolic versatility, studies focusing on nectar chemical features should carefully control for the presence

  7. Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

    PubMed

    Kopecká, J; Němec, M; Matoulková, D

    2016-06-01

    Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The

  8. Quantitative maps of genetic interactions in yeast - comparative evaluation and integrative analysis.

    PubMed

    Lindén, Rolf O; Eronen, Ville-Pekka; Aittokallio, Tero

    2011-03-24

    High-throughput genetic screening approaches have enabled systematic means to study how interactions among gene mutations contribute to quantitative fitness phenotypes, with the aim of providing insights into the functional wiring diagrams of genetic interaction networks on a global scale. However, it is poorly known how well these quantitative interaction measurements agree across the screening approaches, which hinders their integrated use toward improving the coverage and quality of the genetic interaction maps in yeast and other organisms. Using large-scale data matrices from epistatic miniarray profiling (E-MAP), genetic interaction mapping (GIM), and synthetic genetic array (SGA) approaches, we carried out here a systematic comparative evaluation among these quantitative maps of genetic interactions in yeast. The relatively low association between the original interaction measurements or their customized scores could be improved using a matrix-based modelling framework, which enables the use of single- and double-mutant fitness estimates and measurements, respectively, when scoring genetic interactions. Toward an integrative analysis, we show how the detections from the different screening approaches can be combined to suggest novel positive and negative interactions which are complementary to those obtained using any single screening approach alone. The matrix approximation procedure has been made available to support the design and analysis of the future screening studies. We have shown here that even if the correlation between the currently available quantitative genetic interaction maps in yeast is relatively low, their comparability can be improved by means of our computational matrix approximation procedure, which will enable integrative analysis and detection of a wider spectrum of genetic interactions using data from the complementary screening approaches.

  9. The wine and beer yeast Dekkera bruxellensis

    PubMed Central

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-01-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd. PMID:24932634

  10. The wine and beer yeast Dekkera bruxellensis.

    PubMed

    Schifferdecker, Anna Judith; Dashko, Sofia; Ishchuk, Olena P; Piškur, Jure

    2014-09-01

    Recently, the non-conventional yeast Dekkera bruxellensis has been gaining more and more attention in the food industry and academic research. This yeast species is a distant relative of Saccharomyces cerevisiae and is especially known for two important characteristics: on the one hand, it is considered to be one of the main spoilage organisms in the wine and bioethanol industry; on the other hand, it is 'indispensable' as a contributor to the flavour profile of Belgium lambic and gueuze beers. Additionally, it adds to the characteristic aromatic properties of some red wines. Recently this yeast has also become a model for the study of yeast evolution. In this review we focus on the recently developed molecular and genetic tools, such as complete genome sequencing and transformation, to study and manipulate this yeast. We also focus on the areas that are particularly well explored in this yeast, such as the synthesis of off-flavours, yeast detection methods, carbon metabolism and evolutionary history. © 2014 The Authors. Yeast published by John Wiley & Sons, Ltd.

  11. The role of lager beer yeast in oxidative stability of model beer.

    PubMed

    Berner, T S; Arneborg, N

    2012-03-01

    In this study, we investigated the relationship between the ability of lager brewing yeast strains to tolerate oxidative stress and their ability to produce oxidative stable model beer. Screening of 21 lager brewing yeast strains against diamide and paraquat showed that the oxidative stress resistance was strain dependent. Fermentation of model wort in European Brewing Convention tubes using three yeast strains with varying oxidative stress resistances resulted in three model beers with different rates of radical formation as measured by electron spin resonance in forced ageing experiments. Interestingly, the strain with the lowest oxidative stress resistance and lowest secretion of thioredoxin, as measured by Western blotting, resulted in the highest uptake of iron, as measured by inductively coupled plasma-mass spectrometry, and the slowest formation of radicals in the model beers. A more oxidative stable beer is not obtained by a more-oxidative-stress-tolerant lager brewing yeast strain, exhibiting a higher secretion of thioredoxin, but rather by a less-oxidative-stress-tolerant strain, exhibiting a higher iron uptake. To obtain lager beers with enhanced oxidative stability, yeast strains should be screened for their low oxidative stress tolerance and/or high ability to take up iron rather than for their high oxidative stress tolerance and/or high ability to secrete thioredoxin. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  12. Competitive Genomic Screens of Barcoded Yeast Libraries

    PubMed Central

    Urbanus, Malene; Proctor, Michael; Heisler, Lawrence E.; Giaever, Guri; Nislow, Corey

    2011-01-01

    By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment. PMID:21860376

  13. A Simple and Reliable Method for Hybridization of Homothallic Wine Strains of Saccharomyces cerevisiae

    PubMed Central

    Ramírez, Manuel; Peréz, Francisco; Regodón, José A.

    1998-01-01

    A procedure was developed for the hybridization and improvement of homothallic industrial wine yeasts. Killer cycloheximide-sensitive strains were crossed with killer-sensitive cycloheximide-resistant strains to get killer cycloheximide-resistant hybrids, thereby enabling hybrid selection and identification. This procedure also allows backcrossing of spore colonies from the hybrids with parental strains. PMID:9835605

  14. A pre-breeding screening program for transgenic boars based on fluorescence in situ hybridization assay.

    PubMed

    Bou, Gerelchimeg; Sun, Mingju; Lv, Ming; Zhu, Jiang; Li, Hui; Wang, Juan; Li, Lu; Liu, Zhongfeng; Zheng, Zhong; He, Wenteng; Kong, Qingran; Liu, Zhonghua

    2014-08-01

    For efficient transgenic herd expansion, only the transgenic animals that possess the ability to transmit transgene into next generation are considered for breeding. However, for transgenic pig, practically lacking a pre-breeding screening program, time, labor and money is always wasted to maintain non-transgenic pigs, low or null transgenic transmission pigs and the related fruitless gestations. Developing a pre-breeding screening program would make the transgenic herd expansion more economical and efficient. In this technical report, we proposed a three-step pre-breeding screening program for transgenic boars simply through combining the fluorescence in situ hybridization (FISH) assay with the common pre-breeding screening workflow. In the first step of screening, combined with general transgenic phenotype analysis, FISH is used to identify transgenic boars. In the second step of screening, combined with conventional semen test, FISH is used to detect transgenic sperm, thus to identify the individuals producing high quality semen and transgenic sperm. In the third step of screening, FISH is used to assess the in vitro fertilization embryos, thus finally to identify the individuals with the ability to produce transgenic embryos. By this three-step screening, the non-transgenic boars and boars with no ability to produce transgenic sperm or transgenic embryos would be eliminated; therefore only those boars could produce transgenic offspring are maintained and used for breeding and herd expansion. It is the first time a systematic pre-breeding screening program is proposed for transgenic pigs. This program might also be applied in other transgenic large animals, and provide an economical and efficient strategy for herd expansion.

  15. Visualization and Image Analysis of Yeast Cells.

    PubMed

    Bagley, Steve

    2016-01-01

    When converting real-life data via visualization to numbers and then onto statistics the whole system needs to be considered so that conversion from the analogue to the digital is accurate and repeatable. Here we describe the points to consider when approaching yeast cell analysis visualization, processing, and analysis of a population by screening techniques.

  16. Pre-implantation genetic screening using fluorescence in situ hybridization in couples of Indian ethnicity: Is there a scope?

    PubMed Central

    Saxena, Shailaja Gada; Desai, Kundanbala; Shewale, Lata; Ranjan, Prabhat

    2014-01-01

    CONTEXT: There is a high incidence of numerical chromosomal aberration in couples with repeated in vitro fertilization (IVF) failure, advanced maternal age, repeated unexplained abortions, severe male factor infertility and unexplained infertility. Pre-implantation genetic screening (PGS), a variant of pre-implantation genetic diagnosis, screens numerical chromosomal aberrations in couples with normal karyotype, experiencing poor reproductive outcome. The present study includes the results of the initial pilot study on 9 couples who underwent 10 PGS cycles. AIM: The aim of the present study was to evaluate the beneficial effects of PGS in couples with poor reproductive outcome. SETTINGS AND DESIGN: Data of initial 9 couples who underwent 10 PGS for various indications was evaluated. SUBJECTS AND METHODS: Blastomere biopsy was performed on cleavage stage embryos and subjected to two round fluorescence in situ hybridization (FISH) testing for chromosomes 13, 18, 21, X and Y as a two-step procedure. RESULTS: Six of the 9 couples (10 PGS cycles) conceived, including a twin pregnancy in a couple with male factor infertility, singleton pregnancies in a couple with secondary infertility, in three couples with adverse obstetric outcome in earlier pregnancies and in one couple with repeated IVF failure. CONCLUSION: In the absence of availability of array-comparative genomic hybridization in diagnostic clinical scenario for PGS and promising results with FISH based PGS as evident from the current pilot study, it is imperative to offer the best available services in the present scenario for better pregnancy outcome for patients. PMID:24829527

  17. HEXT, a software supporting tree-based screens for hybrid taxa in multilocus data sets, and an evaluation of the homoplasy excess test.

    PubMed

    Schneider, Kevin; Koblmüller, Stephan; Sefc, Kristina M

    2015-11-11

    The homoplasy excess test (HET) is a tree-based screen for hybrid taxa in multilocus nuclear phylogenies. Homoplasy between a hybrid taxon and the clades containing the parental taxa reduces bootstrap support in the tree. The HET is based on the expectation that excluding the hybrid taxon from the data set increases the bootstrap support for the parental clades, whereas excluding non-hybrid taxa has little effect on statistical node support. To carry out a HET, bootstrap trees are calculated with taxon-jackknife data sets, that is excluding one taxon (species, population) at a time. Excess increase in bootstrap support for certain nodes upon exclusion of a particular taxon indicates the hybrid (the excluded taxon) and its parents (the clades with increased support).We introduce a new software program, hext, which generates the taxon-jackknife data sets, runs the bootstrap tree calculations, and identifies excess bootstrap increases as outlier values in boxplot graphs. hext is written in r language and accepts binary data (0/1; e.g. AFLP) as well as co-dominant SNP and genotype data.We demonstrate the usefulness of hext in large SNP data sets containing putative hybrids and their parents. For instance, using published data of the genus Vitis (~6,000 SNP loci), hext output supports V. × champinii as a hybrid between V. rupestris and V. mustangensis .With simulated SNP and AFLP data sets, excess increases in bootstrap support were not always connected with the hybrid taxon (false positives), whereas the expected bootstrap signal failed to appear on several occasions (false negatives). Potential causes for both types of spurious results are discussed.With both empirical and simulated data sets, the taxon-jackknife output generated by hext provided additional signatures of hybrid taxa, including changes in tree topology across trees, consistent effects of exclusions of the hybrid and the parent taxa, and moderate (rather than excessive) increases in bootstrap support

  18. Genome-wide bisulfite sensitivity profiling of yeast suggests bisulfite inhibits transcription.

    PubMed

    Segovia, Romulo; Mathew, Veena; Tam, Annie S; Stirling, Peter C

    2017-09-01

    Bisulfite, in the form of sodium bisulfite or metabisulfite, is used commercially as a food preservative. Bisulfite is used in the laboratory as a single-stranded DNA mutagen in epigenomic analyses of DNA methylation. Recently it has also been used on whole yeast cells to induce mutations in exposed single-stranded regions in vivo. To understand the effects of bisulfite on live cells we conducted a genome-wide screen for bisulfite sensitive mutants in yeast. Screening the deletion mutant array, and collections of essential gene mutants we define a genetic network of bisulfite sensitive mutants. Validation of screen hits revealed hyper-sensitivity of transcription and RNA processing mutants, rather than DNA repair pathways and follow-up analyses support a role in perturbation of RNA transactions. We propose a model in which bisulfite-modified nucleotides may interfere with transcription or RNA metabolism when used in vivo. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. A diversity study of Saccharomycopsis fibuligera in rice wine starter nuruk, reveals the evolutionary process associated with its interspecies hybrid.

    PubMed

    Farh, Mohamed El-Agamy; Cho, Yunjoo; Lim, Jae Yun; Seo, Jeong-Ah

    2017-05-01

    The amylolytic yeast Saccharomycopsis fibuligera is the predominant yeast in the starter product, nuruk, which is utilized for rice wine production in South Korea. Latest molecular studies explore a recently developed interspecific hybridization among stains of S. fibuligera with a unique genetic feature. However, the origin of the natural hybridization occurrence is still unclear. Thus, to respectively distinguish parental and hybrid strains, specific primer sets were applied on 141 yeast strains isolated from different nuruk samples fermented in different provinces. Sixty-seven strains were defined accordingly as parental species with genome A while 8 strains were defined as hybrid strains. Unexpectedly, another parental species with genome B could not be found among the strain pools yet. Furthermore, it was observed that hybrid strains are phenotypically different from A genome strains; asci containing tetrad ascospores were observed in A genome strains more frequent than in hybrid strains. Nevertheless, hybrid strains were slightly more thermotolerant than A genome strains. Interestingly, all hybrid strains were located only in Jeju province. Based on these sets of data, we speculated that the unique climate of Jeju province might play an evolutionary role in the interspecific hybridization between A genome strains, as well as the unculturable allopatric B genome strains.

  20. New Tools for Embryo Selection: Comprehensive Chromosome Screening by Array Comparative Genomic Hybridization

    PubMed Central

    Cobo, Ana Cristina; Milán, Miguel; Al-Asmar, Nasser; García-Herrero, Sandra; Mir, Pere; Simón, Carlos

    2014-01-01

    The objective of this study was to evaluate the usefulness of comprehensive chromosome screening (CCS) using array comparative genomic hybridization (aCGH). The study included 1420 CCS cycles for recurrent miscarriage (n = 203); repetitive implantation failure (n = 188); severe male factor (n = 116); previous trisomic pregnancy (n = 33); and advanced maternal age (n = 880). CCS was performed in cycles with fresh oocytes and embryos (n = 774); mixed cycles with fresh and vitrified oocytes (n = 320); mixed cycles with fresh and vitrified day-2 embryos (n = 235); and mixed cycles with fresh and vitrified day-3 embryos (n = 91). Day-3 embryo biopsy was performed and analyzed by aCGH followed by day-5 embryo transfer. Consistent implantation (range: 40.5–54.2%) and pregnancy rates per transfer (range: 46.0–62.9%) were obtained for all the indications and independently of the origin of the oocytes or embryos. However, a lower delivery rate per cycle was achieved in women aged over 40 years (18.1%) due to the higher percentage of aneuploid embryos (85.3%) and lower number of cycles with at least one euploid embryo available per transfer (40.3%). We concluded that aneuploidy is one of the major factors which affect embryo implantation. PMID:24877108

  1. HIV-1 Protease in the Fission Yeast Schizosaccharomyces pombe.

    PubMed

    Benko, Zsigmond; Elder, Robert T; Li, Ge; Liang, Dong; Zhao, Richard Y

    2016-01-01

    HIV-1 protease (PR) is an essential viral enzyme. Its primary function is to proteolyze the viral Gag-Pol polyprotein for production of viral enzymes and structural proteins and for maturation of infectious viral particles. Increasing evidence suggests that PR cleaves host cellular proteins. However, the nature of PR-host cellular protein interactions is elusive. This study aimed to develop a fission yeast (Schizosaccharomyces pombe) model system and to examine the possible interaction of HIV-1 PR with cellular proteins and its potential impact on cell proliferation and viability. A fission yeast strain RE294 was created that carried a single integrated copy of the PR gene in its chromosome. The PR gene was expressed using an inducible nmt1 promoter so that PR-specific effects could be measured. HIV-1 PR from this system cleaved the same indigenous viral p6/MA protein substrate as it does in natural HIV-1 infections. HIV-1 PR expression in fission yeast cells prevented cell proliferation and induced cellular oxidative stress and changes in mitochondrial morphology that led to cell death. Both these PR activities can be prevented by a PR-specific enzymatic inhibitor, indinavir, suggesting that PR-mediated proteolytic activities and cytotoxic effects resulted from enzymatic activities of HIV-1 PR. Through genome-wide screening, a serine/threonine kinase, Hhp2, was identified that suppresses HIV-1 PR-induced protease cleavage and cell death in fission yeast and in mammalian cells, where it prevented PR-induced apoptosis and cleavage of caspase-3 and caspase-8. This is the first report to show that HIV-1 protease is functional as an enzyme in fission yeast, and that it behaves in a similar manner as it does in HIV-1 infection. HIV-1 PR-induced cell death in fission yeast could potentially be used as an endpoint for mechanistic studies, and this system could be used for developing a high-throughput system for drug screenings.

  2. Increased mannoprotein content in wines produced by Saccharomyces kudriavzevii×Saccharomyces cerevisiae hybrids.

    PubMed

    Pérez-Través, Laura; Querol, Amparo; Pérez-Torrado, Roberto

    2016-11-21

    Several wine quality aspects are influenced by yeast mannoproteins on account of aroma compounds retention, lactic-acid bacterial growth stimulation, protection against protein haze and astringency reduction. Thus selecting a yeast strain that produces high levels of mannoproteins is important for the winemaking industry. In this work, we observed increased levels of mannoproteins in S. cerevisiae×S. kudriavzevii hybrids, compared to the S. cerevisiae strain, in wine fermentations. Furthermore, the expression of a key gene related to mannoproteins biosynthesis, PMT1, increased in the S. cerevisiae×S. kudriavzevii hybrid. We showed that artificially constructed S. cerevisiae×S. kudriavzevii hybrids also increased the levels of mannoproteins. This work demonstrates that either natural or artificial S. cerevisiae×S. kudriavzevii hybrids present mannoprotein overproducing capacity under winemaking conditions, a desirable physiological feature for this industry. These results suggest that genome interaction in hybrids generates a physiological environment that enhances the release of mannoproteins. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. One-Pot Exfoliation of Graphite and Synthesis of Nanographene/Dimesitylporphyrin Hybrids

    PubMed Central

    Bernal, M. Mar; Pérez, Emilio M.

    2015-01-01

    A simple one-pot process to exfoliate graphite and synthesize nanographene-dimesitylporphyrin hybrids has been developed. Despite the bulky mesityl groups, which are expected to hinder the efficient π–π stacking between the porphyrin core and graphene, the liquid-phase exfoliation of graphite is significantly favored by the presence of the porphyrins. Metallation of the porphyrin further enhances this effect. The resulting graphene/porphyrin hybrids were characterized by spectroscopy (UV-visible, fluorescence, and Raman) and microscopy (STEM, scanning transmission electron microscopy). PMID:25984598

  4. Synthetic Genetic Arrays: Automation of Yeast Genetics.

    PubMed

    Kuzmin, Elena; Costanzo, Michael; Andrews, Brenda; Boone, Charles

    2016-04-01

    Genome-sequencing efforts have led to great strides in the annotation of protein-coding genes and other genomic elements. The current challenge is to understand the functional role of each gene and how genes work together to modulate cellular processes. Genetic interactions define phenotypic relationships between genes and reveal the functional organization of a cell. Synthetic genetic array (SGA) methodology automates yeast genetics and enables large-scale and systematic mapping of genetic interaction networks in the budding yeast,Saccharomyces cerevisiae SGA facilitates construction of an output array of double mutants from an input array of single mutants through a series of replica pinning steps. Subsequent analysis of genetic interactions from SGA-derived mutants relies on accurate quantification of colony size, which serves as a proxy for fitness. Since its development, SGA has given rise to a variety of other experimental approaches for functional profiling of the yeast genome and has been applied in a multitude of other contexts, such as genome-wide screens for synthetic dosage lethality and integration with high-content screening for systematic assessment of morphology defects. SGA-like strategies can also be implemented similarly in a number of other cell types and organisms, includingSchizosaccharomyces pombe,Escherichia coli, Caenorhabditis elegans, and human cancer cell lines. The genetic networks emerging from these studies not only generate functional wiring diagrams but may also play a key role in our understanding of the complex relationship between genotype and phenotype. © 2016 Cold Spring Harbor Laboratory Press.

  5. The homologous recombination machinery modulates the formation of RNA–DNA hybrids and associated chromosome instability

    PubMed Central

    Wahba, Lamia; Gore, Steven K; Koshland, Douglas

    2013-01-01

    Genome instability in yeast and mammals is caused by RNA–DNA hybrids that form as a result of defects in different aspects of RNA biogenesis. We report that in yeast mutants defective for transcription repression and RNA degradation, hybrid formation requires Rad51p and Rad52p. These proteins normally promote DNA–DNA strand exchange in homologous recombination. We suggest they also directly promote the DNA–RNA strand exchange necessary for hybrid formation since we observed accumulation of Rad51p at a model hybrid-forming locus. Furthermore, we provide evidence that Rad51p mediates hybridization of transcripts to homologous chromosomal loci distinct from their site of synthesis. This hybrid formation in trans amplifies the genome-destabilizing potential of RNA and broadens the exclusive co-transcriptional models that pervade the field. The deleterious hybrid-forming activity of Rad51p is counteracted by Srs2p, a known Rad51p antagonist. Thus Srs2p serves as a novel anti-hybrid mechanism in vivo. DOI: http://dx.doi.org/10.7554/eLife.00505.001 PMID:23795288

  6. Breeding of Freeze-tolerant Yeast and the Mechanisms of Stress-tolerance

    NASA Astrophysics Data System (ADS)

    Hino, Akihiro

    Frozen dough method have been adopted in the baking industry to reduce labor and to produce fresh breads in stores. New freeze-tolerant yeasts for frozen dough preparations were isolated from banana peel and identified. To obtain strains that have fermentative ability even after several months of frozen storage in fermented dough, we attempted to breed new freeze-tolerantstrain. The hybrid between S.cerevisiae, which is a isolated freeze-tolerant strain, and a strain isolated from bakers' yeast with sexual conjugation gave a good quality bread made from frozen dough method. Freeze-tolerant strains showed higher surviving and trehalose accumulating abilities than freeze-sensitive strains. The freeze tolerance of the yeasts was associated with the basal amount of intracellular trehalose after rapid degradation at the onset of the prefermentation period. The complicated metabolic pathway and the regulation system of trehalose in yeast cells are introduced. The trehalose synthesis may act as a metabolic buffer system which contribute to maintain the intracellular inorganic phosphate and as a feedback regulation system in the glycolysis. However, it is not known enough how the trehalose protects yeast cells from stress.

  7. Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory.

    PubMed

    Edwards, Thea M; Morgan, Howard E; Balasca, Coralia; Chalasani, Naveen K; Yam, Lauren; Roark, Alison M

    2018-01-01

    The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade "Environmental Estrogens" (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ERα) and/or beta (ERβ). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-β-D-galactopyranoside (ONPG) or chlorophenol red-β-D-galactopyranoside (CPRG)) that are cleaved by β-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting

  8. Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

    PubMed Central

    Edwards, Thea M.; Morgan, Howard E.; Balasca, Coralia; Chalasani, Naveen K.; Yam, Lauren; Roark, Alison M.

    2018-01-01

    The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade "Environmental Estrogens" (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ERα) and/or beta (ERβ). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-β-D-galactopyranoside (ONPG) or chlorophenol red-β-D-galactopyranoside (CPRG)) that are cleaved by β-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting

  9. RNAi assisted genome evolution unveils yeast mutants with improved xylose utilization.

    PubMed

    HamediRad, Mohammad; Lian, Jiazhang; Li, Hejun; Zhao, Huimin

    2018-06-01

    Xylose is a major component of lignocellulosic biomass, one of the most abundant feedstocks for biofuel production. Therefore, efficient and rapid conversion of xylose to ethanol is crucial in the viability of lignocellulosic biofuel plants. In this study, RNAi Assisted Genome Evolution (RAGE) was used to improve the xylose utilization rate in SR8, one of the most efficient publicly available xylose utilizing Saccharomyces cerevisiae strains. To identify gene targets for further improvement, we created a genome-scale library consisting of both genetic over-expression and down-regulation mutations in SR8. Followed by screening in media containing xylose as the sole carbon source, yeast mutants with 29% faster xylose utilization, and 45% higher ethanol productivity were obtained relative to the parent strain. Two known and two new effector genes were identified in these mutant strains. Notably, down-regulation of CDC11, an essential gene, resulted in faster xylose utilization, and this gene target cannot be identified in genetic knock-out screens. © 2018 Wiley Periodicals, Inc.

  10. Gene-nutrient interaction markedly influences yeast chronological lifespan.

    PubMed

    Smith, Daniel L; Maharrey, Crystal H; Carey, Christopher R; White, Richard A; Hartman, John L

    2016-12-15

    Research into the genetic mechanisms of aging has expanded rapidly over the past two decades. This has in part been the result of the use of model organisms (particularly yeast, worms and flies) and high-throughput technologies, combined with a growing interest in aging research. Despite this progress, widespread consensus regarding the pathways that are fundamental to the modulation of cellular aging and lifespan for all organisms has been limited due to discrepancies between different studies. We have compared results from published genome-wide, chronological lifespan (CLS) screens of individual gene deletion strains in Saccharomyces cerevisiae in order to identify gene deletion strains with consistent influences on longevity as possible indicators of fundamental aging processes from this single-celled, eukaryotic model organism. Three previous reports have described genetic modifiers of chronological aging in the budding yeast (S. cerevisiae) using the yeast gene deletion strain collection. We performed a comparison among the data sets using correlation and decile distribution analysis to describe concordance between screens and identify strains that consistently increased or decreased CLS. We used gene enrichment analysis in an effort to understand the biology underlying genes identified in multiple studies. We attempted to replicate the different experimental conditions employed by the screens to identify potential sources of variability in CLS worth further investigating. Among 3209 strains present in all three screens, nine deletions strains were in common in the longest-lived decile (2.80%) and thirteen were in common in the shortest-lived decile (4.05%) of all three screens. Similarly, pairwise overlap between screens was low. When the same comparison was extended to three deciles to include more mutants studied in common between the three screens, enrichment of cellular processes based on gene ontology analysis in the long-lived strains remained very

  11. Gene-Nutrient Interaction Markedly Influences Yeast Chronological Lifespan

    PubMed Central

    Smith, Daniel L.; Maharrey, Crystal H.; Carey, Christopher R.; White, Richard A.; Hartman, John L.

    2016-01-01

    Purpose Research into the genetic mechanisms of aging has expanded rapidly over the past two decades. This has in part been the result of the use of model organisms (particularly yeast, worms and flies) and high-throughput technologies, combined with a growing interest in aging research. Despite this progress, widespread consensus regarding the pathways that are fundamental to the modulation of cellular aging and lifespan for all organisms has been limited due to discrepancies between different studies. We have compared results from published genome-wide, chronological lifespan (CLS) screens of individual gene deletion strains in S. cerevisiae in order to identify gene deletion strains with consistent influences on longevity as possible indicators of fundamental aging processes from this single-celled, eukaryotic model organism. Methods Three previous reports have described genetic modifiers of chronological aging in the budding yeast (S. cerevisiae) using the yeast gene deletion strain collection. We performed a comparison among the data sets using correlation and decile distribution analysis to describe concordance between screens and identify strains that consistently increased or decreased CLS. We used gene enrichment analysis in an effort to understand the biology underlying genes identified in multiple studies. We attempted to replicate the different experimental conditions employed by the screens to identify potential sources of variability in CLS worth further investigating. Results Among 3209 strains present in all three screens, nine (2.80%) deletions strains were in common in the longest-lived decile and thirteen (4.05%) were in common in the shortest-lived decile for all three screens. Similarly, pairwise overlap between screens was low. When the same comparison was extended to three deciles to include more mutants studied in common between the three screens, enrichment of cellular processes based on gene ontology analysis in the long-lived strains

  12. Chemical signaling and insect attraction is a conserved trait in yeasts.

    PubMed

    Becher, Paul G; Hagman, Arne; Verschut, Vasiliki; Chakraborty, Amrita; Rozpędowska, Elżbieta; Lebreton, Sébastien; Bengtsson, Marie; Flick, Gerhard; Witzgall, Peter; Piškur, Jure

    2018-03-01

    Yeast volatiles attract insects, which apparently is of mutual benefit, for both yeasts and insects. However, it is unknown whether biosynthesis of metabolites that attract insects is a basic and general trait, or if it is specific for yeasts that live in close association with insects. Our goal was to study chemical insect attractants produced by yeasts that span more than 250 million years of evolutionary history and vastly differ in their metabolism and lifestyle. We bioassayed attraction of the vinegar fly Drosophila melanogaster to odors of phylogenetically and ecologically distinct yeasts grown under controlled conditions. Baker's yeast Saccharomyces cerevisiae , the insect-associated species Candida californica , Pichia kluyveri and Metschnikowia andauensis , wine yeast Dekkera bruxellensis , milk yeast Kluyveromyces lactis , the vertebrate pathogens Candida albicans and Candida glabrata , and oleophilic Yarrowia lipolytica were screened for fly attraction in a wind tunnel. Yeast headspace was chemically analyzed, and co-occurrence of insect attractants in yeasts and flowering plants was investigated through a database search. In yeasts with known genomes, we investigated the occurrence of genes involved in the synthesis of key aroma compounds. Flies were attracted to all nine yeasts studied. The behavioral response to baker's yeast was independent of its growth stage. In addition to Drosophila , we tested the basal hexapod Folsomia candida (Collembola) in a Y-tube assay to the most ancient yeast, Y. lipolytica, which proved that early yeast signals also function on clades older than neopteran insects. Behavioral and chemical data and a search for selected genes of volatile metabolites underline that biosynthesis of chemical signals is found throughout the yeast clade and has been conserved during the evolution of yeast lifestyles. Literature and database reviews corroborate that yeast signals mediate mutualistic interactions between insects and yeasts

  13. Mapping replication origins in yeast chromosomes.

    PubMed

    Brewer, B J; Fangman, W L

    1991-07-01

    The replicon hypothesis, first proposed in 1963 by Jacob and Brenner, states that DNA replication is controlled at sites called origins. Replication origins have been well studied in prokaryotes. However, the study of eukaryotic chromosomal origins has lagged behind, because until recently there has been no method for reliably determining the identity and location of origins from eukaryotic chromosomes. Here, we review a technique we developed with the yeast Saccharomyces cerevisiae that allows both the mapping of replication origins and an assessment of their activity. Two-dimensional agarose gel electrophoresis and Southern hybridization with total genomic DNA are used to determine whether a particular restriction fragment acquires the branched structure diagnostic of replication initiation. The technique has been used to localize origins in yeast chromosomes and assess their initiation efficiency. In some cases, origin activation is dependent upon the surrounding context. The technique is also being applied to a variety of eukaryotic organisms.

  14. Screening of yeasts as probiotic based on capacities to colonize the gastrointestinal tract and to protect against enteropathogen challenge in mice.

    PubMed

    Martins, Flariano S; Nardi, Regina M D; Arantes, Rosa M E; Rosa, Carlos A; Neves, Maria J; Nicoli, Jacques R

    2005-04-01

    Probiotics are defined as viable microorganisms that exhibit a beneficial effect on the host's health when they are ingested. Two important criteria are used for selection of probiotic microorganisms: they must be able to survive in the gastrointestinal environment and to present at least one beneficial function (colonization resistance, immunomodulation or nutritional contribution). Generally, in vitro assays demonstrating these properties were used to select probiotics but it is unclear if the data can be extrapolated to in vivo conditions. In the present work, twelve Saccharomyces cerevisiae strains isolated from different environments (insect association, tropical fruit, cheese and "aguardente" production) and pre-selected for in vitro resistance to simulated gastrointestinal conditions were inoculated in germ-free mice to evaluate their real capacity to colonize the mammal digestive tract. Using these data, one of the yeasts (S. cerevisiae 905) was selected and tested in gnotobiotic (GN) and conventional (CV) mice for its capacity to protect against oral challenge with two enteropathogenic bacteria (Salmonella Typhimurium and Clostridium difficile). The yeast reached populational levels potentially functional in the gastrointestinal portions where the enteropathogens tested act. No antagonism against either pathogenic bacterium by the yeast was observed in the digestive tract of GN mice but, after challenge with S. Typhimurium, mortality was lower and liver tissue was better preserved in CV animals treated with the yeast when compared with a control group (p<0.05). Histopathological results of intestines showed that the yeast also presented a good protective effect against oral challenge with C. difficile in GN mice (p<0.05). In conclusion, among the 12 S. cerevisiae tested, strain 905 showed the best characteristics to be used as a probiotic as demonstrated by survival capacity in the gastrointestinal tract and protective effect of animals during experimental

  15. Quantitative screening of yeast surface-displayed polypeptide libraries by magnetic bead capture.

    PubMed

    Yeung, Yik A; Wittrup, K Dane

    2002-01-01

    Magnetic bead capture is demonstrated here to be a feasible alternative for quantitative screening of favorable mutants from a cell-displayed polypeptide library. Flow cytometric sorting with fluorescent probes has been employed previously for high throughput screening for either novel binders or improved mutants. However, many laboratories do not have ready access to this technology as a result of the limited availability and high cost of cytometers, restricting the use of cell-displayed libraries. Using streptavidin-coated magnetic beads and biotinylated ligands, an alternative approach to cell-based library screening for improved mutants was developed. Magnetic bead capture probability of labeled cells is shown to be closely correlated with the surface ligand density. A single-pass enrichment ratio of 9400 +/- 1800-fold, at the expense of 85 +/- 6% binder losses, is achieved from screening a library that contains one antibody-displaying cell (binder) in 1.1 x 10(5) nondisplaying cells. Additionally, kinetic screening for an initial high affinity to low affinity (7.7-fold lower) mutant ratio of 1:95,000, the magnetic bead capture method attains a single-pass enrichment ratio of 600 +/- 200-fold with a 75 +/- 24% probability of loss for the higher affinity mutant. The observed high loss probabilities can be straightforwardly compensated for by library oversampling, given the inherently parallel nature of the screen. Overall, these results demonstrate that magnetic beads are capable of quantitatively screening for novel binders and improved mutants. The described methods are directly analogous to procedures in common use for phage display and should lower the barriers to entry for use of cell surface display libraries.

  16. Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609.

    PubMed

    Sambles, Christine; Middelhaufe, Sabine; Soanes, Darren; Kolak, Dagmara; Lux, Thomas; Moore, Karen; Matoušková, Petra; Parker, David; Lee, Rob; Love, John; Aves, Stephen J

    2017-09-01

    Most eukaryotic oleaginous species are yeasts and among them the basidiomycete red yeast, Rhodotorula ( Rhodosporidium ) toruloides (Pucciniomycotina) is known to produce high quantities of lipids when grown in nitrogen-limiting media, and has potential for biodiesel production. The genome of the CGMCC 2.1609 strain of this oleaginous red yeast was sequenced using a hybrid of Roche 454 and Illumina technology generating 13 × coverage. The de novo assembly was carried out using MIRA and scaffolded using MAQ and BAMBUS. The sequencing and assembly resulted in 365 scaffolds with total genome size of 33.4 Mb. The complete genome sequence of this strain was deposited in GenBank and the accession number is LKER00000000. The annotation is available on Figshare (doi:10.6084/m9.figshare.4754251).

  17. Mapping the Interactions of Dengue Virus NS1 Protein with Human Liver Proteins Using a Yeast Two-Hybrid System: Identification of C1q as an Interacting Partner

    PubMed Central

    Allonso, Diego; Nogueira, Mauricio L.; Mohana-Borges, Ronaldo

    2013-01-01

    Dengue constitutes a global health concern. The clinical manifestation of this disease varies from mild febrile illness to severe hemorrhage and/or fatal hypovolemic shock. Flavivirus nonstructural protein 1 (NS1) is a secreted glycoprotein that is displayed on the surface of infected cells but is absent in viral particles. NS1 accumulates at high levels in the plasma of dengue virus (DENV)-infected patients, and previous reports highlight its involvement in immune evasion, dengue severity, liver dysfunction and pathogenesis. In the present study, we performed a yeast two-hybrid screen to search for DENV2 NS1-interacting partners using a human liver cDNA library. We identified fifty genes, including human complement component 1 (C1q), which was confirmed by coimmunoprecipitation, ELISA and immunofluorescence assays, revealing for the first time the direct binding of this protein to NS1. Furthermore, the majority of the identified genes encode proteins that are secreted into the plasma of patients, and most of these proteins are classified as acute-phase proteins (APPs), such as plasminogen, haptoglobin, hemopexin, α-2-HS-glycoprotein, retinol binding protein 4, transferrin, and C4. The results presented here confirm the direct interaction of DENV NS1 with a key protein of the complement system and suggest a role for this complement protein in the pathogenesis of DENV infection. PMID:23516407

  18. New Trends in the Uses of Yeasts in Oenology.

    PubMed

    Querol, Amparo; Pérez-Torrado, Roberto; Alonso-Del-Real, Javier; Minebois, Romain; Stribny, Jiri; Oliveira, Bruno M; Barrio, Eladio

    2018-01-01

    The most important factor in winemaking is the quality of the final product and the new trends in oenology are dictated by wine consumers and producers. Traditionally the red wine is the most consumed and more popular; however, in the last times, the wine companies try to attract other groups of populations, especially young people and women that prefer sweet, whites or rosé wines, very fruity and with low alcohol content. Besides the new trends in consumer preferences, there are also increased concerns on the effects of alcohol consumption on health and the effects of global climate change on grape ripening and wine composition producing wines with high alcohol content. Although S. cerevisiae is the most frequent species in wines, and the subject of most studies, S. uvarum and hybrids between Saccharomyces species such as S. cerevisiae×S. kudriavzevii and S. cerevisiae×S. uvarum are also involved in wine fermentations and can be preponderant in certain wine regions. New yeast starters of non-cerevisiae strains (S. uvarum) or hybrids (S. cerevisiae×S. uvarum and S. cerevisiae×S. kudriavzevii) can contribute to solve some problems of the wineries. They exhibit good fermentative capabilities at low temperatures, producing wines with lower alcohol and higher glycerol amounts, while fulfilling the requirements of the commercial yeasts, such as a good fermentative performance and aromatic profiles that are of great interest for the wine industry. In this review, we will analyze different applications of nonconventional yeasts to solve the current winemaking demands. © 2018 Elsevier Inc. All rights reserved.

  19. New family of pectinase genes PGU1b-PGU3b of the pectinolytic yeast Saccharomyces bayanus var. uvarum.

    PubMed

    Naumov, G I; Shalamitskiy, M Yu; Naumova, E S

    2016-03-01

    Using yeast genome databases and literature data, we have conducted a phylogenetic analysis of pectinase PGU genes from Saccharomyces strains assigned to the biological species S. arboricola, S. bayanus (var. uvarum), S. cariocanus, S. cerevisiae, S. kudriavzevii, S. mikatae, S. paradoxus, and hybrid taxon S. pastorianus (syn. S. carlsbergensis). Single PGU genes were observed in all Saccharomyces species, except S. bayanus. The superfamily of divergent PGU genes has been documented in S. bayanus var. uvarum for the first time. Chromosomal localization of new PGU1b, PGU2b, and PGU3b genes in the yeast S. bayanus var. uvarum has been determined by molecular karyotyping and Southern hybridization.

  20. Diversity and antifungal resistance patterns of prevalent opportunistic pathogenic yeasts colonizing the oral cavities of asymptomatic human immunodeficiency virus-infected individuals, and their relation to CD4+ counts

    PubMed Central

    Kumar, Deepa Anil; Muralidhar, Sumathi; Banerjee, Uma; Basir, Seemi Farhat; Mathur, Purva; Khan, Luqman Ahmad

    2015-01-01

    Background: Yeasts are important opportunistic pathogens, in individuals infected with human immunodeficiency virus (HIV). Yeast species inhabiting the oral mucosa of HIV-infected persons can act as source of oral lesions, especially as the individual progresses towards immunocompromised state. Present study was conducted to evaluate the diversity of yeasts in oral cavities of asymptomatic HIV-infected persons and their association with CD4+ cell counts. Materials and Methods: 100 HIV seropositive subjects and 100 healthy controls were screened for oral yeast carriage using standard procedures. Results: Of the 100 HIV-seropositive persons screened, 48 were colonized by different yeasts, either alone or in association with another species. Candida albicans was the most common species (56.90%) while non C. albicans Candida (NCAC) accounted for 39.65%. Among NCAC, Candida tropicalis and Candida krusei were most common. One isolate each of rare opportunistic pathogenic yeasts, Geotrichum candidum and Saccharomyces cereviseae, was recovered. The control group had an oral candidal carriage rate of 23%; C. albicans was the predominant species, followed by Candida glabrata, C. tropicalis and Candida parapsilosis. Antifungal susceptibility testing revealed no resistance in C. albicans, to the commonly used antifungal agents, whereas resistance or dose dependent susceptibility to fluconazole was observed in some of the NCAC species. Conclusion: Oral carriage of opportunistic pathogenic yeasts was greater in HIV-seropositive persons heading towards immunocompromised state, as evidenced by their CD4+ cell count. The predominant yeast isolated in this study (C. albicans), was found to be susceptible to commonly used antifungals. PMID:26392655

  1. Direct screening for chromatin status on DNA barcodes in yeast delineates the regulome of H3K79 methylation by Dot1.

    PubMed

    Vlaming, Hanneke; Molenaar, Thom M; van Welsem, Tibor; Poramba-Liyanage, Deepani W; Smith, Desiree E; Velds, Arno; Hoekman, Liesbeth; Korthout, Tessy; Hendriks, Sjoerd; Altelaar, A F Maarten; van Leeuwen, Fred

    2016-12-06

    Given the frequent misregulation of chromatin in cancer, it is important to understand the cellular mechanisms that regulate chromatin structure. However, systematic screening for epigenetic regulators is challenging and often relies on laborious assays or indirect reporter read-outs. Here we describe a strategy, Epi-ID, to directly assess chromatin status in thousands of mutants. In Epi-ID, chromatin status on DNA barcodes is interrogated by chromatin immunoprecipitation followed by deep sequencing, allowing for quantitative comparison of many mutants in parallel. Screening of a barcoded yeast knock-out collection for regulators of histone H3K79 methylation by Dot1 identified all known regulators as well as novel players and processes. These include histone deposition, homologous recombination, and adenosine kinase, which influences the methionine cycle. Gcn5, the acetyltransferase within the SAGA complex, was found to regulate histone methylation and H2B ubiquitination. The concept of Epi-ID is widely applicable and can be readily applied to other chromatin features.

  2. [Thermoresistance in Saccharomyces cerevisiae yeasts].

    PubMed

    Kaliuzhin, V A

    2011-01-01

    Under natural conditions, yeast Saccharomyces cerevisiae reproduce, as a rule, on the surface of solid or liquid medium. Thus, life cycle of yeast populations is substantially influenced by diurnal changes in ambient temperature. The pattern in the response of unrestricted yeast S. cerevisiae culture to changes in the temperature of cultivation is revealed experimentally. Yeast population, in the absence of environmental constraints on the functioning of cell chemosmotic bioenergetic system, demonstrates the ability of thermoresistance when the temperature of cultivation switches from the range of 12-36 degrees C to 37.5-40 degrees C. During the transient period that is associated with the temperature switching and lasts from 1 to 4 turnover cycles, yeast reproduction rate remains 1.5-2 times higher than under stationary conditions. This is due to evolutionary acquired adaptive activity of cell chemosmotic system. After the adaptive resources exhausting, yeast thermoresistance fully recovers at the temperature range of 12-36 degrees C within one generation time under conditions of both restricted and unrestricted nourishment. Adaptive significance of such thermoresistance seems obvious enough--it allows maintaining high reproduction rate in yeast when ambient temperature is reaching a brief maximum shortly after noon.

  3. Accuracy of electron densities obtained via Koopmans-compliant hybrid functionals

    NASA Astrophysics Data System (ADS)

    Elmaslmane, A. R.; Wetherell, J.; Hodgson, M. J. P.; McKenna, K. P.; Godby, R. W.

    2018-04-01

    We evaluate the accuracy of electron densities and quasiparticle energy gaps given by hybrid functionals by directly comparing these to the exact quantities obtained from solving the many-electron Schrödinger equation. We determine the admixture of Hartree-Fock exchange to approximate exchange-correlation in our hybrid functional via one of several physically justified constraints, including the generalized Koopmans' theorem. We find that hybrid functionals yield strikingly accurate electron densities and gaps in both exchange-dominated and correlated systems. We also discuss the role of the screened Fock operator in the success of hybrid functionals.

  4. Characterization of butter spoiling yeasts and their inhibition by some spices.

    PubMed

    Sagdic, Osman; Ozturk, Ismet; Bayram, Okan; Kesmen, Zulal; Yilmaz, Mustafa Tahsin

    2010-01-01

    This study was designed to identify the yeasts in packaged and unpackaged butters and screen antiyeast activity of spices, including marjoram (Origanum majorana L.), summer savory (Satureja hortensis L.), and black cumin (Nigella sativa L.) against the most dominant yeast species in the packaged and unpackaged butters. Mean total yeast populations were 5.40 log CFU/g in unpackaged butter samples and 2.22 log CFU/g in packaged butter samples, indicating better hygienic quality of packaged samples. Forty-nine yeast species were isolated and identified from butter samples with the most prevalent isolates belonging to genera Candida-C. kefyr, C. zeylanoides, and C. lambica-and with moderate number of isolates belonging to genera Cryptococcus, Rhodotorula, Saccharomyces, and Zygosaccharomyces. Black cumin exhibited the highest antiyeast activity against C. zeylanoides and C. lambica species, even inhibited these species, while summer savory inhibited C. kefyr. The results of this study revealed clear antimicrobial potential of black cumin against the yeast species isolated from butters. Marjoram, summer savory, and black cumin could be used as natural antimicrobial agents against spoilage yeasts in food preservation, especially in butter. © 2010 Institute of Food Technologists®

  5. Comparison of array comparative genomic hybridization and quantitative real-time PCR-based aneuploidy screening of blastocyst biopsies.

    PubMed

    Capalbo, Antonio; Treff, Nathan R; Cimadomo, Danilo; Tao, Xin; Upham, Kathleen; Ubaldi, Filippo Maria; Rienzi, Laura; Scott, Richard T

    2015-07-01

    Comprehensive chromosome screening (CCS) methods are being extensively used to select chromosomally normal embryos in human assisted reproduction. Some concerns related to the stage of analysis and which aneuploidy screening method to use still remain. In this study, the reliability of blastocyst-stage aneuploidy screening and the diagnostic performance of the two mostly used CCS methods (quantitative real-time PCR (qPCR) and array comparative genome hybridization (aCGH)) has been assessed. aCGH aneuploid blastocysts were rebiopsied, blinded, and evaluated by qPCR. Discordant cases were subsequently rebiopsied, blinded, and evaluated by single-nucleotide polymorphism (SNP) array-based CCS. Although 81.7% of embryos showed the same diagnosis when comparing aCGH and qPCR-based CCS, 18.3% (22/120) of embryos gave a discordant result for at least one chromosome. SNP array reanalysis showed that a discordance was reported in ten blastocysts for aCGH, mostly due to false positives, and in four cases for qPCR. The discordant aneuploidy call rate per chromosome was significantly higher for aCGH (5.7%) compared with qPCR (0.6%; P<0.01). To corroborate these findings, 39 embryos were simultaneously biopsied for aCGH and qPCR during blastocyst-stage aneuploidy screening cycles. 35 matched including all 21 euploid embryos. Blinded SNP analysis on rebiopsies of the four embryos matched qPCR. These findings demonstrate the high reliability of diagnosis performed at the blastocyst stage with the use of different CCS methods. However, the application of aCGH can be expected to result in a higher aneuploidy rate than other contemporary methods of CCS.

  6. The dynamic three-dimensional organization of the diploid yeast genome

    PubMed Central

    Kim, Seungsoo; Liachko, Ivan; Brickner, Donna G; Cook, Kate; Noble, William S; Brickner, Jason H; Shendure, Jay; Dunham, Maitreya J

    2017-01-01

    The budding yeast Saccharomyces cerevisiae is a long-standing model for the three-dimensional organization of eukaryotic genomes. However, even in this well-studied model, it is unclear how homolog pairing in diploids or environmental conditions influence overall genome organization. Here, we performed high-throughput chromosome conformation capture on diverged Saccharomyces hybrid diploids to obtain the first global view of chromosome conformation in diploid yeasts. After controlling for the Rabl-like orientation using a polymer model, we observe significant homolog proximity that increases in saturated culture conditions. Surprisingly, we observe a localized increase in homologous interactions between the HAS1-TDA1 alleles specifically under galactose induction and saturated growth. This pairing is accompanied by relocalization to the nuclear periphery and requires Nup2, suggesting a role for nuclear pore complexes. Together, these results reveal that the diploid yeast genome has a dynamic and complex 3D organization. DOI: http://dx.doi.org/10.7554/eLife.23623.001 PMID:28537556

  7. Yeast as a model system for mammalian seven-transmembrane segment receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jeansonne, N.E.

    1994-05-01

    Investigators have used the budding yeast Saccharomyces cerevisiae as a model system in which to study the {beta}-adrenergic receptor, the T-cell receptor pathway, initiation of mammalian DNA replication, initiation of mammalian transcription, secretion, the CDC2 kinase system, cell cycle control, and aging, as well as the function of oncogenes. This list continues to growth with the discovery of an immunoglobulin heavy-chain binding homologue in yeast, an Rb binding protein homologue, and a possible yeast arrestin. Yeast is relatively easy to maintain, to grow, and to genetically manipulate. A single gene can be overexpressed, selectively mutated or deleted from its chromosomalmore » location. In this way, the in vivo function of a gene can be studied. It has become reasonable to consider yeast as a model system for studying the seven transmembrane segments (7-TMS) receptor family. Currently, subtypes of the {beta}-adrenergic receptor are being studied in yeast. The receptor and its G{sub {alpha}}-G-protein, trigger the mating pheromone receptor pathway. This provides a powerful assay for determining receptor function. Studies expressing the muscarinic cholinergic receptor in yeast are underway. The yeast pheromone receptor belongs to this receptor family, sharing sequences and secondary structure homology. An effective strategy has been to identify a yeast pathway or process which is homologous to a mammalian system. The pathway is delineated in yeast, identifying other genetic components. Then yeast genes are used to screen for human homologues of these components. The putative human homologues are then expressed in yeast and in mammalian cells to determine function. When this type of {open_quotes}mixing and matching{close_quotes} works, yeast genetics can be a powerful tool. 115 refs.« less

  8. Opportunistic Pathogenic Yeasts

    NASA Astrophysics Data System (ADS)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  9. Hybrid Single-Incision Laparoscopic Colon Cancer Surgery Using One Additional 5 mm Trocar.

    PubMed

    Kim, Hyung Ook; Choi, Dae Jin; Lee, Donghyoun; Lee, Sung Ryol; Jung, Kyung Uk; Kim, Hungdai; Chun, Ho-Kyung

    2018-02-01

    Single-incision laparoscopic surgery (SILS) is a feasible and safe procedure for colorectal cancer. However, SILS has some technical limitations such as collision between instruments and inadequate countertraction. We present a hybrid single-incision laparoscopic surgery (hybrid SILS) technique for colon cancer that involves use of one additional 5 mm trocar. Hybrid SILS for colon cancer was attempted in 70 consecutive patients by a single surgeon between August 2014 and July 2016 at Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine. Using prospectively collected data, an observational study was performed on an intention-to-treat basis. Hybrid SILS was technically completed in 66 patients, with a failure rate of 5.7% (4/70). One patient was converted to open surgery for para-aortic lymph node dissection. Another was converted to open surgery due to severe peritoneal adhesion. An additional trocar was inserted for adhesiolysis in the other two cases. Median lengths of proximal and distal margins were 12.8 cm (interquartile range [IQR], 10.0-18.6), and 8.2 cm (IQR, 5.5-18.3), respectively. Median total number of lymph nodes harvested was 24 (IQR, 18-33). Overall rate of postoperative morbidity was 12.9%, but there were no Clavien-Dindo grade III or IV complications. There was no postoperative mortality or reoperation. Median postoperative hospital stay was 6 days (IQR, 5-7). Hybrid SILS using one additional 5 mm trocar is a safe and effective minimally invasive surgical technique for colon cancer. Experienced laparoscopic surgeons can perform hybrid SILS without a learning curve based on the formulaic surgical techniques presented in this article.

  10. Group X hybrid histidine kinase Chk1 is dispensable for stress adaptation, host-pathogen interactions and virulence in the opportunistic yeast Candida guilliermondii.

    PubMed

    Navarro-Arias, María J; Dementhon, Karine; Defosse, Tatiana A; Foureau, Emilien; Courdavault, Vincent; Clastre, Marc; Le Gal, Solène; Nevez, Gilles; Le Govic, Yohann; Bouchara, Jean-Philippe; Giglioli-Guivarc'h, Nathalie; Noël, Thierry; Mora-Montes, Hector M; Papon, Nicolas

    2017-09-01

    Hybrid histidine kinases (HHKs) progressively emerge as prominent sensing proteins in the fungal kingdom and as ideal targets for future therapeutics. The group X HHK is of major interest, since it was demonstrated to play an important role in stress adaptation, host-pathogen interactions and virulence in some yeast and mold models, and particularly Chk1, that corresponds to the sole group X HHK in Candida albicans. In the present work, we investigated the role of Chk1 in the low-virulence species Candida guilliermondii, in order to gain insight into putative conservation of the role of group X HHK in opportunistic yeasts. We demonstrated that disruption of the corresponding gene CHK1 does not influence growth, stress tolerance, drug susceptibility, protein glycosylation or cell wall composition in C. guilliermondii. In addition, we showed that loss of CHK1 does not affect C. guilliermondii ability to interact with macrophages and to stimulate cytokine production by human peripheral blood mononuclear cells. Finally, the C. guilliermondii chk1 null mutant was found to be as virulent as the wild-type strain in the experimental model Galleria mellonella. Taken together, our results demonstrate that group X HHK function is not conserved in Candida species. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    PubMed

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Evaluation of Automated Yeast Identification System

    NASA Technical Reports Server (NTRS)

    McGinnis, M. R.

    1996-01-01

    One hundred and nine teleomorphic and anamorphic yeast isolates representing approximately 30 taxa were used to evaluate the accuracy of the Biolog yeast identification system. Isolates derived from nomenclatural types, environmental, and clinica isolates of known identity were tested in the Biolog system. Of the isolates tested, 81 were in the Biolog database. The system correctly identified 40, incorrectly identified 29, and was unable to identify 12. Of the 28 isolates not in the database, 18 were given names, whereas 10 were not. The Biolog yeast identification system is inadequate for the identification of yeasts originating from the environment during space program activities.

  13. Counting Yeast.

    ERIC Educational Resources Information Center

    Bealer, Jonathan; Welton, Briana

    1998-01-01

    Describes changes to a traditional study of population in yeast colonies. Changes to the procedures include: (1) only one culture per student team; (2) cultures are inoculated only once; and (3) the same tube is sampled daily. (DDR)

  14. Strategies for identifying new prions in yeast

    PubMed Central

    MacLea, Kyle S

    2011-01-01

    The unexpected discovery of two prions, [URE3] and [PSI+], in Saccharomyces cerevisiae led to questions about how many other proteins could undergo similar prion-based structural conversions. However, [URE3] and [PSI+] were discovered by serendipity in genetic screens. Cataloging the full range of prions in yeast or in other organisms will therefore require more systematic search methods. Taking advantage of some of the unique features of prions, various researchers have developed bioinformatic and experimental methods for identifying novel prion proteins. These methods have generated long lists of prion candidates. The systematic testing of some of these prion candidates has led to notable successes; however, even in yeast, where rapid growth rate and ease of genetic manipulation aid in testing for prion activity, such candidate testing is laborious. Development of better methods to winnow the field of prion candidates will greatly aid in the discovery of new prions, both in yeast and in other organisms, and help us to better understand the role of prions in biology. PMID:22052351

  15. Biosentinel: Improving Desiccation Tolerance of Yeast Biosensors for Deep-Space Missions

    NASA Technical Reports Server (NTRS)

    Dalal, Sawan; Santa Maria, Sergio R.; Liddell, Lauren; Bhattacharya, Sharmila

    2017-01-01

    BioSentinel is one of 13 secondary payloads to be deployed on Exploration Mission 1 (EM-1) in 2019. We will use the budding yeast Saccharomyces cerevisiae as a biosensor to determine how deep-space radiation affects living organisms and to potentially quantify radiation levels through radiation damage analysis. Radiation can damage DNA through double strand breaks (DSBs), which can normally be repaired by homologous recombination. Two yeast strains will be air-dried and stored in microfluidic cards within the payload: a wild-type control strain and a radiation sensitive rad51 mutant that is deficient in DSB repairs. Throughout the mission, the microfluidic cards will be rehydrated with growth medium and an indicator dye. Growth rates of each strain will be measured through LED detection of the reduction of the indicator dye, which correlates with DNA repair and the amount of radiation damage accumulated. Results from BioSentinel will be compared to analog experiments on the ISS and on Earth. It is well known that desiccation can damage yeast cells and decrease viability over time. We performed a screen for desiccation-tolerant rad51 strains. We selected 20 re-isolates of rad51 and ran a weekly screen for desiccation-tolerant mutants for five weeks. Our data shows that viability decreases over time, confirming previous research findings. Isolates L2, L5 and L14 indicate desiccation tolerance and are candidates for whole-genome sequencing. More time is needed to determine whether a specific strain is truly desiccation tolerant. Furthermore, we conducted an intracellular trehalose assay to test how intracellular trehalose concentrations affect or protect the mutant strains against desiccation stress. S. cerevisiae cell and reagent concentrations from a previously established intracellular trehalose protocol did not yield significant absorbance measurements, so we tested varying cell and reagent concentrations and determined proper concentrations for successful

  16. Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

    PubMed

    Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

    2016-09-01

    Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

  17. [Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

    PubMed

    Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

    2017-04-12

    Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

  18. Rapid Parallel Screening for Strain Optimization

    DTIC Science & Technology

    2013-08-16

    fermentation yields of industrially relevant biological compounds. Screening of the desired chemicals was completed previously. Microbes that can...reporter, and, 2) a yeast TAR cloning shuttle vector for transferring catabolic clusters to E. coli. 15. SUBJECT TERMS NA 16. SECURITY CLASSIFICATION OF... fermentation yields of industrially relevant biological compounds. Screening of the desired chemicals was completed previously. Microbes that can utilize

  19. Rapid Parallel Screening for Strain Optimization

    DTIC Science & Technology

    2013-05-16

    fermentation yields of industrially relevant biological compounds. Screening of the desired chemicals was completed previously. Microbes that can...reporter, and, 2) a yeast TAR cloning shuttle vector for transferring catabolic clusters to E. coli. 15. SUBJECT TERMS NA 16. SECURITY CLASSIFICATION OF... fermentation yields of industrially relevant biological compounds. Screening of the desired chemicals was completed previously. Microbes that can utilize

  20. A Yeast Model of FUS/TLS-Dependent Cytotoxicity

    PubMed Central

    Ju, Shulin; Tardiff, Daniel F.; Han, Haesun; Divya, Kanneganti; Zhong, Quan; Maquat, Lynne E.; Bosco, Daryl A.; Hayward, Lawrence J.; Brown, Robert H.; Lindquist, Susan; Ringe, Dagmar; Petsko, Gregory A.

    2011-01-01

    FUS/TLS is a nucleic acid binding protein that, when mutated, can cause a subset of familial amyotrophic lateral sclerosis (fALS). Although FUS/TLS is normally located predominantly in the nucleus, the pathogenic mutant forms of FUS/TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia. Here we report a yeast model of human FUS/TLS expression that recapitulates multiple salient features of the pathology of the disease-causing mutant proteins, including nuclear to cytoplasmic translocation, inclusion formation, and cytotoxicity. Protein domain analysis indicates that the carboxyl-terminus of FUS/TLS, where most of the ALS-associated mutations are clustered, is required but not sufficient for the toxicity of the protein. A genome-wide genetic screen using a yeast over-expression library identified five yeast DNA/RNA binding proteins, encoded by the yeast genes ECM32, NAM8, SBP1, SKO1, and VHR1, that rescue the toxicity of human FUS/TLS without changing its expression level, cytoplasmic translocation, or inclusion formation. Furthermore, hUPF1, a human homologue of ECM32, also rescues the toxicity of FUS/TLS in this model, validating the yeast model and implicating a possible insufficiency in RNA processing or the RNA quality control machinery in the mechanism of FUS/TLS mediated toxicity. Examination of the effect of FUS/TLS expression on the decay of selected mRNAs in yeast indicates that the nonsense-mediated decay pathway is probably not the major determinant of either toxicity or suppression. PMID:21541368

  1. Influencing Cancer Screening Participation Rates-Providing a Combined Cancer Screening Program (a 'One Stop' Shop) Could Be a Potential Answer.

    PubMed

    Bobridge, Amanda; Price, Kay; Gill, Tiffany K; Taylor, Anne W

    2017-01-01

    Participation in established cancer screening programs remains variable. Therefore, a renewed focus on how to increase screening uptake, including addressing structural barriers such as time, travel, and cost is needed. One approach could be the provision of combined cancer screening, where multiple screening tests are provided at the same time and location (essentially a 'One Stop' screening shop). This cohort study explored both cancer screening behavior and the acceptability of a combined screening approach. Participants of the North Western Adelaide Health Study (NWAHS), South Australia were invited to participate in a questionnaire about cancer screening behaviors and the acceptability of a proposed 'One Stop' cancer screening shop. Data were collected from 10th August 2015 to 18th January 2016, weighted for selection probability, age, and sex and analyzed using descriptive and multivariable logistic regression analysis. 1,562 people, 52% female (mean age 54.1 years ± 15.2) participated. Reported screening participation was low, the highest being for Pap Smear (34.4%). Common reasons for screening participation were preventing sickness (56.1%, CI 53.2-59.0%), maintaining health (51%, CI 48-53.9%), and free program provision (30.9%, CI 28.2-33.6%). Females were less likely to state that screening is not beneficial [OR 0.37 (CI 0.21-0.66), p  < 0.001] and to cite sickness prevention [OR 2.10 (CI 1.46-3.00), p  < 0.001] and free program [OR 1.75 (CI 1.22-2.51), p  < 0.003] as reasons for screening participation. Of those who did not participate, 34.6% (CI 30.3-39.1%) stated that there was nothing that discouraged them from participation, with 55- to 64-year olds [OR 0.24 (CI 0.07-0.74), p  < 0.04] being less likely to cite this reason. 21% (CI 17.2-24.8%) thought they did not need screening, while a smaller proportion stated not having time (6.9%, CI 4.9-9.7%) and the costs associated with screening (5.2%, CI 3.5-7.7%). The majority of

  2. The carbon consumption pattern of the spoilage yeast Brettanomyces bruxellensis in synthetic wine-like medium.

    PubMed

    Smith, Brendan D; Divol, Benoit

    2018-08-01

    The wine matrix contains limited carbon compounds to sustain microbial life. Brettanomyces bruxellensis is one of very few yeast species that has adapted to this environment. Indeed, the presence of growth-inhibiting compounds and conditions do not prevent its proliferation. Literature regarding the nutritional requirements of this yeast is surprisingly poor, given the observation that B. bruxellensis produces biomass with apparently less nutrients than other yeasts. In this study, various carbon sources were screened in a synthetic wine medium, under anaerobic and semi-aerobic growth conditions, in order to determine which compounds B. bruxellensis assimilates. Slight differences were observed between strains but overall, B. bruxellensis produced biomass from limited nutrients consumed in a specific order regardless of the oxygen conditions. Upon initial consumption of the simple sugars, B. bruxellensis was able to remain viable, by concurrently utilising ethanol (only in the presence of oxygen) and malic acid. Although initially beneficial, oxygen was found detrimental in the long term. Formation of volatile phenols occurred during the consumption of the sugars but not as a mechanism to help correct the redox imbalance. The study confirms that B. bruxellensis is able to survive using limited amount of nutrients, making this yeast a challenge for winemakers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. High efficiency family shuffling based on multi-step PCR and in vivo DNA recombination in yeast: statistical and functional analysis of a combinatorial library between human cytochrome P450 1A1 and 1A2.

    PubMed

    Abécassis, V; Pompon, D; Truan, G

    2000-10-15

    The design of a family shuffling strategy (CLERY: Combinatorial Libraries Enhanced by Recombination in Yeast) associating PCR-based and in vivo recombination and expression in yeast is described. This strategy was tested using human cytochrome P450 CYP1A1 and CYP1A2 as templates, which share 74% nucleotide sequence identity. Construction of highly shuffled libraries of mosaic structures and reduction of parental gene contamination were two major goals. Library characterization involved multiprobe hybridization on DNA macro-arrays. The statistical analysis of randomly selected clones revealed a high proportion of chimeric genes (86%) and a homogeneous representation of the parental contribution among the sequences (55.8 +/- 2.5% for parental sequence 1A2). A microtiter plate screening system was designed to achieve colorimetric detection of polycyclic hydrocarbon hydroxylation by transformed yeast cells. Full sequences of five randomly picked and five functionally selected clones were analyzed. Results confirmed the shuffling efficiency and allowed calculation of the average length of sequence exchange and mutation rates. The efficient and statistically representative generation of mosaic structures by this type of family shuffling in a yeast expression system constitutes a novel and promising tool for structure-function studies and tuning enzymatic activities of multicomponent eucaryote complexes involving non-soluble enzymes.

  4. Antagonistic interactions between garden yeasts and microfungal garden pathogens of leaf-cutting ants.

    PubMed

    Rodrigues, Andre; Cable, Rachel N; Mueller, Ulrich G; Bacci, Maurício; Pagnocca, Fernando C

    2009-10-01

    We investigate the diversity of yeasts isolated in gardens of the leafcutter ant Atta texana. Repeated sampling of gardens from four nests over a 1-year time period showed that gardens contain a diverse assemblage of yeasts. The yeast community in gardens consisted mostly of yeasts associated with plants or soil, but community composition changed between sampling periods. In order to understand the potential disease-suppressing roles of the garden yeasts, we screened isolates for antagonistic effects against known microfungal garden contaminants. In vitro assays revealed that yeasts inhibited the mycelial growth of two strains of Escovopsis (a specialized attine garden parasite), Syncephalastrum racemosum (a fungus often growing in gardens of leafcutter lab nests), and the insect pathogen Beauveria bassiana. These garden yeasts add to the growing list of disease-suppressing microbes in attine nests that may contribute synergistically, together with actinomycetes and Burkholderia bacteria, to protect the gardens and the ants against diseases. Additionally, we suggest that garden immunity against problem fungi may therefore derive not only from the presence of disease-suppressing Pseudonocardia actinomycetes, but from an enrichment of multiple disease-suppressing microorganisms in the garden matrix.

  5. Screening of antimicrobial activity of macroalgae extracts from the Moroccan Atlantic coast.

    PubMed

    El Wahidi, M; El Amraoui, B; El Amraoui, M; Bamhaoud, T

    2015-05-01

    The aim of this work is the screening of the antimicrobial activity of seaweed extracts against pathogenic bacteria and yeasts. The antimicrobial activity of the dichloromethane and ethanol extracts of ten marine macroalgae collected from the Moroccan's Atlantic coast (El-Jadida) was tested against two Gram+ (Bacillus subtilis and Staphylococcus aureus) and two Gram- (Escherichia coli and Pseudomonas aeruginosa) human pathogenic bacteria, and against two pathogenic yeasts (Candida albicans and Cryptococcus neoformans) using the agar disk-diffusion method. Seven algae (70%) of ten seaweeds are active against at least one pathogenic microorganisms studied. Five (50%) are active against the two studied yeast with an inhibition diameter greater than 15 mm for Cystoseira brachycarpa. Six (60%) seaweeds are active against at least one studied bacteria with five (50%) algae exhibiting antibacterial inhibition diameter greater than 15 mm. Cystoseira brachycarpa, Cystoseira compressa, Fucus vesiculosus, and Gelidium sesquipedale have a better antimicrobial activity with a broad spectrum antimicrobial and are a potential source of antimicrobial compounds and can be subject of isolation of the natural antimicrobials. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  6. New insights into the capacity of commercial wine yeasts to grow on sparkling wine media. Factor screening for improving wine yeast selection.

    PubMed

    Borrull, Anna; Poblet, Montse; Rozès, Nicolas

    2015-06-01

    During the production of sparkling wine, wine yeasts are subjected to many stress factors apart from ethanol, which lead to the need to achieve their acclimation in line with various industrial protocols. In the present work, 44 commercial wine Saccharomyces cerevisiae strains and one laboratory strain (BY4742) were firstly subjected to the influence of increasing concentrations of ethanol to cluster the yeasts using discriminant function analysis. Afterwards, non-inhibitory concentration (NIC) and minimum inhibitory concentration (MIC) were estimated, revealing some differences between 24 of these strains. Meanwhile, this study confirms the negative synergistic effect of low pH with ethanol on the maximum specific growth rate (μmax) and lag phase time. Moreover, a negative effect of increasing levels of glycerol in the growth medium was observed. Interestingly enough, an interactive positive effect was found between cysteine and medium-chain fatty acids (MCFA). While cysteine did not have a really significant effect in comparison to the control, it was able to restore the damage caused by MCFA, making the growth rate of cells recover and even reducing the formation of reactive oxygen species. Adequate culture aeration is also crucial for the composition of the cell fatty acid. The final results showed that few differences were observed between NIC and MIC estimations with respect to cells pre-cultured in the presence or absence of oxygen. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. One-pot in situ redox synthesis of hexacyanoferrate/conductive polymer hybrids as lithium-ion battery cathodes.

    PubMed

    Wong, Min Hao; Zhang, Zixuan; Yang, Xianfeng; Chen, Xiaojun; Ying, Jackie Y

    2015-09-14

    An efficient and adaptable method is demonstrated for the synthesis of lithium hexacyanoferrate/conductive polymer hybrids for Li-ion battery cathodes. The hybrids were synthesized via a one-pot method, involving a redox-coupled reaction between pyrrole monomers and the Li3Fe(CN)6 precursor. The hybrids showed much better cyclability relative to reported Prussian Blue (PB) analogs.

  8. A breeding strategy to harness flavor diversity of Saccharomyces interspecific hybrids and minimize hydrogen sulfide production.

    PubMed

    Bizaj, Etjen; Cordente, Antonio G; Bellon, Jennifer R; Raspor, Peter; Curtin, Chris D; Pretorius, Isak S

    2012-06-01

    Industrial food-grade yeast strains are selected for traits that enhance their application in quality production processes. Wine yeasts are required to survive in the harsh environment of fermenting grape must, while at the same time contributing to wine quality by producing desirable aromas and flavors. For this reason, there are hundreds of wine yeasts available, exhibiting characteristics that make them suitable for different fermentation conditions and winemaking practices. As wine styles evolve and technical winemaking requirements change, however, it becomes necessary to improve existing strains. This becomes a laborious and costly process when the targets for improvement involve flavor compound production. Here, we demonstrate a new approach harnessing preexisting industrial yeast strains that carry desirable flavor phenotypes - low hydrogen sulfide (H(2) S) production and high ester production. A low-H(2) S Saccharomyces cerevisiae strain previously generated by chemical mutagenesis was hybridized independently with two ester-producing natural interspecies hybrids of S. cerevisiae and Saccharomyces kudriavzevii. Deficiencies in sporulation frequency and spore viability were overcome through use of complementary selectable traits, allowing successful isolation of several novel hybrids exhibiting both desired traits in a single round of selection. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. Phenotypic evaluation and characterization of 21 industrial Saccharomyces cerevisiae yeast strains.

    PubMed

    Kong, In Iok; Turner, Timothy Lee; Kim, Heejin; Kim, Soo Rin; Jin, Yong-Su

    2018-02-01

    Microorganisms have been studied and used extensively to produce value-added fuels and chemicals. Yeasts, specifically Saccharomyces cerevisiae, receive industrial attention because of their well-known ability to ferment glucose and produce ethanol. Thousands of natural or genetically modified S. cerevisiae have been found in industrial environments for various purposes. These industrial strains are isolated from industrial fermentation sites, and they are considered as potential host strains for superior fermentation processes. In many cases, industrial yeast strains have higher thermotolerance, increased resistances towards fermentation inhibitors and increased glucose fermentation rates under anaerobic conditions when compared with laboratory yeast strains. Despite the advantages of industrial strains, they are often not well characterized. Through screening and phenotypic characterization of commercially available industrial yeast strains, industrial fermentation processes requiring specific environmental conditions may be able to select an ideal starting yeast strain to be further engineered. Here, we have characterized and compared 21 industrial S. cerevisiae strains under multiple conditions, including their tolerance to varying pH conditions, resistance to fermentation inhibitors, sporulation efficiency and ability to ferment lignocellulosic sugars. These data may be useful for the selection of a parental strain for specific biotechnological applications of engineered yeast. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Comparative Lipidomic Profiling of S. cerevisiae and Four Other Hemiascomycetous Yeasts

    PubMed Central

    Hein, Eva-Maria; Hayen, Heiko

    2012-01-01

    Glycerophospholipids (GP) are the building blocks of cellular membranes and play essential roles in cell compartmentation, membrane fluidity or apoptosis. In addition, GPs are sources for multifunctional second messengers. Whereas the genome and proteome of the most intensively studied eukaryotic model organism, the baker’s yeast (Saccharomyces cerevisiae), are well characterized, the analysis of its lipid composition is still at the beginning. Moreover, different yeast species can be distinguished on the DNA, RNA and protein level, but it is currently unknown if they can also be differentiated by determination of their GP pattern. Therefore, the GP compositions of five different yeast strains, grown under identical environmental conditions, were elucidated using high performance liquid chromatography coupled to negative electrospray ionization-hybrid linear ion trap-Fourier transform ion cyclotron resonance mass spectrometry in single and multistage mode. Using this approach, relative quantification of more than 100 molecular species belonging to nine GP classes was achieved. The comparative lipidomic profiling of Saccharomyces cerevisiae, Saccharomyces bayanus, Kluyveromyces thermotolerans, Pichia angusta, and Yarrowia lipolytica revealed characteristic GP profiles for each strain. However, genetically related yeast strains show similarities in their GP compositions, e.g., Saccharomyces cerevisiae and Saccharomyces bayanus. PMID:24957378

  11. Randomized comparison of next-generation sequencing and array comparative genomic hybridization for preimplantation genetic screening: a pilot study.

    PubMed

    Yang, Zhihong; Lin, James; Zhang, John; Fong, Wai Ieng; Li, Pei; Zhao, Rong; Liu, Xiaohong; Podevin, William; Kuang, Yanping; Liu, Jiaen

    2015-06-23

    Recent advances in next-generation sequencing (NGS) have provided new methods for preimplantation genetic screening (PGS) of human embryos from in vitro fertilization (IVF) cycles. However, there is still limited information about clinical applications of NGS in IVF and PGS (IVF-PGS) treatments. The present study aimed to investigate the effects of NGS screening on clinical pregnancy and implantation outcomes for PGS patients in comparison to array comparative genomic hybridization (aCGH) screening. This study was performed in two phases. Phase I study evaluated the accuracy of NGS for aneuploidy screening in comparison to aCGH. Whole-genome amplification (WGA) products (n = 164) derived from previous IVF-PGS cycles (n = 38) were retrospectively analyzed with NGS. The NGS results were then compared with those of aCGH. Phase II study further compared clinical pregnancy and implantation outcomes between NGS and aCGH for IVF-PGS patients. A total of 172 patients at mean age 35.2 ± 3.5 years were randomized into two groups: 1) NGS (Group A): patients (n = 86) had embryos screened with NGS and 2) aCGH (Group B): patients (n = 86) had embryos screened with aCGH. For both groups, blastocysts were vitrified after trophectoderm biopsy. One to two euploid blastocysts were thawed and transferred to individual patients primarily based on the PGS results. Ongoing pregnancy and implantation rates were compared between the two study groups. NGS detected all types of aneuploidies of human blastocysts accurately and provided a 100 % 24-chromosome diagnosis consistency with the highly validated aCGH method. Moreover, NGS screening identified euploid blastocysts for transfer and resulted in similarly high ongoing pregnancy rates for PGS patients compared to aCGH screening (74.7 % vs. 69.2 %, respectively, p >0.05). The observed implantation rates were also comparable between the NGS and aCGH groups (70.5 % vs. 66.2 %, respectively, p >0.05). While NGS screening

  12. Navigating yeast genome maintenance with functional genomics.

    PubMed

    Measday, Vivien; Stirling, Peter C

    2016-03-01

    Maintenance of genome integrity is a fundamental requirement of all organisms. To address this, organisms have evolved extremely faithful modes of replication, DNA repair and chromosome segregation to combat the deleterious effects of an unstable genome. Nonetheless, a small amount of genome instability is the driver of evolutionary change and adaptation, and thus a low level of instability is permitted in populations. While defects in genome maintenance almost invariably reduce fitness in the short term, they can create an environment where beneficial mutations are more likely to occur. The importance of this fact is clearest in the development of human cancer, where genome instability is a well-established enabling characteristic of carcinogenesis. This raises the crucial question: what are the cellular pathways that promote genome maintenance and what are their mechanisms? Work in model organisms, in particular the yeast Saccharomyces cerevisiae, has provided the global foundations of genome maintenance mechanisms in eukaryotes. The development of pioneering genomic tools inS. cerevisiae, such as the systematic creation of mutants in all nonessential and essential genes, has enabled whole-genome approaches to identifying genes with roles in genome maintenance. Here, we review the extensive whole-genome approaches taken in yeast, with an emphasis on functional genomic screens, to understand the genetic basis of genome instability, highlighting a range of genetic and cytological screening modalities. By revealing the biological pathways and processes regulating genome integrity, these analyses contribute to the systems-level map of the yeast cell and inform studies of human disease, especially cancer. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  13. Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

    PubMed

    Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

    2016-10-01

    Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

  14. Combining Phage and Yeast Cell Surface Antibody Display to Identify Novel Cell Type-Selective Internalizing Human Monoclonal Antibodies.

    PubMed

    Bidlingmaier, Scott; Su, Yang; Liu, Bin

    2015-01-01

    Using phage antibody display, large libraries can be generated and screened to identify monoclonal antibodies with affinity for target antigens. However, while library size and diversity is an advantage of the phage display method, there is limited ability to quantitatively enrich for specific binding properties such as affinity. One way of overcoming this limitation is to combine the scale of phage display selections with the flexibility and quantitativeness of FACS-based yeast surface display selections. In this chapter we describe protocols for generating yeast surface antibody display libraries using phage antibody display selection outputs as starting material and FACS-based enrichment of target antigen-binding clones from these libraries. These methods should be widely applicable for the identification of monoclonal antibodies with specific binding properties.

  15. A mix-and-read drop-based in vitro two-hybrid method for screening high-affinity peptide binders

    PubMed Central

    Cui, Naiwen; Zhang, Huidan; Schneider, Nils; Tao, Ye; Asahara, Haruichi; Sun, Zhiyi; Cai, Yamei; Koehler, Stephan A.; de Greef, Tom F. A.; Abbaspourrad, Alireza; Weitz, David A.; Chong, Shaorong

    2016-01-01

    Drop-based microfluidics have recently become a novel tool by providing a stable linkage between phenotype and genotype for high throughput screening. However, use of drop-based microfluidics for screening high-affinity peptide binders has not been demonstrated due to the lack of a sensitive functional assay that can detect single DNA molecules in drops. To address this sensitivity issue, we introduced in vitro two-hybrid system (IVT2H) into microfluidic drops and developed a streamlined mix-and-read drop-IVT2H method to screen a random DNA library. Drop-IVT2H was based on the correlation between the binding affinity of two interacting protein domains and transcriptional activation of a fluorescent reporter. A DNA library encoding potential peptide binders was encapsulated with IVT2H such that single DNA molecules were distributed in individual drops. We validated drop-IVT2H by screening a three-random-residue library derived from a high-affinity MDM2 inhibitor PMI. The current drop-IVT2H platform is ideally suited for affinity screening of small-to-medium-sized libraries (103–106). It can obtain hits within a single day while consuming minimal amounts of reagents. Drop-IVT2H simplifies and accelerates the drop-based microfluidics workflow for screening random DNA libraries, and represents a novel alternative method for protein engineering and in vitro directed protein evolution. PMID:26940078

  16. Experimental Systems to Study Yeast Pexophagy.

    PubMed

    Yamashita, Shun-Ichi; Oku, Masahide; Sakai, Yasuyoshi; Fujiki, Yukio

    2017-01-01

    Peroxisome abundance is tightly regulated according to the physiological contexts, through regulations of both proliferation and degradation of the organelles. Here, we describe detailed methods to analyze processes for autophagic degradation of peroxisomes, termed pexophagy, in yeast organisms. The assay systems include a method for biochemical detection of pexophagy completion, and one for microscopic visualization of specialized membrane structures acting in pexophagy. As a model yeast organism utilized in studies of pexophagy, the methylotrophic yeast Komagataella phaffii (Pichia pastoris) is referred to in this chapter and related information on the studies with baker's yeast (Saccharomyces cerevisiae) is also included. The described techniques facilitate elucidation of molecular machineries for pexophagy and understanding of peroxisome-selective autophagic pathways.

  17. One-pot synthesis of MnO2-chitin hybrids for effective removal of methylene blue.

    PubMed

    Dassanayake, Rohan S; Rajakaruna, Erandathi; Moussa, Hanna; Abidi, Noureddine

    2016-12-01

    Manganese dioxide (MnO 2 )-chitin-hybrid material was prepared by a facile "one-pot" synthesis method. MnO 2 -chitin hybrid was used for the effective removal of methylene blue (MB) from liquid solution as model for wastewater treatment. The hybrid obtained was characterized by field emission scanning electron microscopy and energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, X-ray diffraction and thermogravimetric analysis. The effect of pH and temperature were studied. MnO 2 -chitin hybrid showed high performance for oxidative decolorization and removal of MB. Typically, 25mL of MB (20mg/L) can be completely decolorized in 2.5min with 8.5mg of the MnO 2 -chitin hybrid. The hybrid material exhibited excellent recyclability and durability with the degradation value of 99% for MB after ten consecutive cycles. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Fragment-based screening in tandem with phenotypic screening provides novel antiparasitic hits.

    PubMed

    Blaazer, Antoni R; Orrling, Kristina M; Shanmugham, Anitha; Jansen, Chimed; Maes, Louis; Edink, Ewald; Sterk, Geert Jan; Siderius, Marco; England, Paul; Bailey, David; de Esch, Iwan J P; Leurs, Rob

    2015-01-01

    Methods to discover biologically active small molecules include target-based and phenotypic screening approaches. One of the main difficulties in drug discovery is elucidating and exploiting the relationship between drug activity at the protein target and disease modification, a phenotypic endpoint. Fragment-based drug discovery is a target-based approach that typically involves the screening of a relatively small number of fragment-like (molecular weight <300) molecules that efficiently cover chemical space. Here, we report a fragment screening on TbrPDEB1, an essential cyclic nucleotide phosphodiesterase (PDE) from Trypanosoma brucei, and human PDE4D, an off-target, in a workflow in which fragment hits and a series of close analogs are subsequently screened for antiparasitic activity in a phenotypic panel. The phenotypic panel contained T. brucei, Trypanosoma cruzi, Leishmania infantum, and Plasmodium falciparum, the causative agents of human African trypanosomiasis (sleeping sickness), Chagas disease, leishmaniasis, and malaria, respectively, as well as MRC-5 human lung cells. This hybrid screening workflow has resulted in the discovery of various benzhydryl ethers with antiprotozoal activity and low toxicity, representing interesting starting points for further antiparasitic optimization. © 2014 Society for Laboratory Automation and Screening.

  19. Direct screening for chromatin status on DNA barcodes in yeast delineates the regulome of H3K79 methylation by Dot1

    PubMed Central

    Vlaming, Hanneke; Molenaar, Thom M; van Welsem, Tibor; Poramba-Liyanage, Deepani W; Smith, Desiree E; Velds, Arno; Hoekman, Liesbeth; Korthout, Tessy; Hendriks, Sjoerd; Maarten Altelaar, AF; van Leeuwen, Fred

    2016-01-01

    Given the frequent misregulation of chromatin in cancer, it is important to understand the cellular mechanisms that regulate chromatin structure. However, systematic screening for epigenetic regulators is challenging and often relies on laborious assays or indirect reporter read-outs. Here we describe a strategy, Epi-ID, to directly assess chromatin status in thousands of mutants. In Epi-ID, chromatin status on DNA barcodes is interrogated by chromatin immunoprecipitation followed by deep sequencing, allowing for quantitative comparison of many mutants in parallel. Screening of a barcoded yeast knock-out collection for regulators of histone H3K79 methylation by Dot1 identified all known regulators as well as novel players and processes. These include histone deposition, homologous recombination, and adenosine kinase, which influences the methionine cycle. Gcn5, the acetyltransferase within the SAGA complex, was found to regulate histone methylation and H2B ubiquitination. The concept of Epi-ID is widely applicable and can be readily applied to other chromatin features. DOI: http://dx.doi.org/10.7554/eLife.18919.001 PMID:27922451

  20. Cell-free fetal DNA screening in the USA: a cost analysis of screening strategies.

    PubMed

    Evans, M I; Sonek, J D; Hallahan, T W; Krantz, D A

    2015-01-01

    To determine whether implementation of primary cell-free fetal DNA (cffDNA) screening would be cost-effective in the USA and to evaluate potential lower-cost alternatives. Three strategies to screen for trisomy 21 were evaluated using decision tree analysis: 1) a primary strategy in which cffDNA screening was offered to all patients, 2) a contingent strategy in which cffDNA screening was offered only to patients who were high risk on traditional first-trimester screening and 3) a hybrid strategy in which cffDNA screening was offered to all patients ≥ 35 years of age and only to patients < 35 years who were high risk after first-trimester screening. Four traditional screening protocols were evaluated, each assessing nuchal translucency (NT) and pregnancy-associated plasma protein-A (PAPP-A) along with either free or total beta-human chorionic gonadotropin (β-hCG), with or without nasal bone (NB) assessment. Utilizing a primary cffDNA screening strategy, the cost per patient was 1017 US$. With a traditional screening protocol using free β-hCG, PAPP-A and NT assessment as part of a hybrid screening strategy, a contingent strategy with a 1/300 cut-off and a contingent strategy with a 1/1000 cut-off, the cost per patient was 474, 430 and 409 US$, respectively. Findings were similar using the other traditional screening protocols. Marginal cost per viable case detected for the primary screening strategy as compared to the other strategies was 3-16 times greater than the cost of care for a missed case. Primary cffDNA screening is not currently a cost-effective strategy. The contingent strategy was the lowest-cost alternative, especially with a risk cut-off of 1/1000. The hybrid strategy, although less costly than primary cffDNA screening, was more costly than the contingent strategy. Copyright © 2014 ISUOG. Published by John Wiley & Sons Ltd.

  1. Reconstruction of the evolutionary history of Saccharomyces cerevisiae x S. kudriavzevii hybrids based on multilocus sequence analysis.

    PubMed

    Peris, David; Lopes, Christian A; Arias, Armando; Barrio, Eladio

    2012-01-01

    In recent years, interspecific hybridization and introgression are increasingly recognized as significant events in the evolution of Saccharomyces yeasts. These mechanisms have probably been involved in the origin of novel yeast genotypes and phenotypes, which in due course were to colonize and predominate in the new fermentative environments created by human manipulation. The particular conditions in which hybrids arose are still unknown, as well as the number of possible hybridization events that generated the whole set of natural hybrids described in the literature during recent years. In this study, we could infer at least six different hybridization events that originated a set of 26 S. cerevisiae x S. kudriavzevii hybrids isolated from both fermentative and non-fermentative environments. Different wine S. cerevisiae strains and European S. kudriavzevii strains were probably involved in the hybridization events according to gene sequence information, as well as from previous data on their genome composition and ploidy. Finally, we postulate that these hybrids may have originated after the introduction of vine growing and winemaking practices by the Romans to the present Northern vine-growing limits and spread during the expansion of improved viticulture and enology practices that occurred during the Late Middle Ages.

  2. Inventions on baker's yeast strains and specialty ingredients.

    PubMed

    Gélinas, Pierre

    2009-06-01

    Baker's yeast is one of the oldest food microbial starters. Between 1927 and 2008, 165 inventions on more than 337 baker's yeast strains were patented. The first generation of patented yeast strains claimed improved biomass yield at the yeast plant, higher gassing power in dough or better survival to drying to prepare active dry baker's yeast. Especially between 1980 and 1995, a major interest was given to strains for multiple bakery applications such as dough with variable sugar content and stored at refrigeration (cold) or freezing temperatures. During the same period, genetically engineered yeast strains became very popular but did not find applications in the baking industry. Since year 2000, patented baker's yeast strains claimed aroma, anti-moulding or nutritive properties to better meet the needs of the baking industry. In addition to patents on yeast strains, 47 patents were issued on baker's yeast specialty ingredients for niche markets. This review shows that patents on baker's yeast with improved characteristics such as aromatic or nutritive properties have regularly been issued since the 1920's. Overall, it also confirms recent interest for a very wide range of tailored-made yeast-based ingredients for bakery applications.

  3. Analysis of estrogenic activity in environmental waters in Rio de Janeiro state (Brazil) using the yeast estrogen screen.

    PubMed

    Dias, Amanda Cristina Vieira; Gomes, Frederico Wegenast; Bila, Daniele Maia; Sant'Anna, Geraldo Lippel; Dezotti, Marcia

    2015-10-01

    The estrogenicity of waters collected from an important hydrological system in Brazil (Paraiba do Sul and Guandu Rivers) was assessed using the yeast estrogen screen (YES) assay. Sampling was performed in rivers and at the outlets of conventional water treatment plants (WTP). The removal of estrogenic activity by ozonation and chlorination after conventional water treatment (clarification and sand filtration) was investigated employing samples of the Guandu River spiked with estrogens and bisphenol A (BPA). The results revealed a preoccupying incidence of estrogenic activity at levels higher than 1ngL(-1) along some points of the rivers. Another matter of concern was the number of samples from WTPs presenting estrogenicity surpassing 1ngL(-1). The oxidation techniques (ozonation and chlorination) were effective for the removal of estrogenic activity and the combination of both techniques led to good results using less amounts of oxidants. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Nutrition screening tools: does one size fit all? A systematic review of screening tools for the hospital setting.

    PubMed

    van Bokhorst-de van der Schueren, Marian A E; Guaitoli, Patrícia Realino; Jansma, Elise P; de Vet, Henrica C W

    2014-02-01

    Numerous nutrition screening tools for the hospital setting have been developed. The aim of this systematic review is to study construct or criterion validity and predictive validity of nutrition screening tools for the general hospital setting. A systematic review of English, French, German, Spanish, Portuguese and Dutch articles identified via MEDLINE, Cinahl and EMBASE (from inception to the 2nd of February 2012). Additional studies were identified by checking reference lists of identified manuscripts. Search terms included key words for malnutrition, screening or assessment instruments, and terms for hospital setting and adults. Data were extracted independently by 2 authors. Only studies expressing the (construct, criterion or predictive) validity of a tool were included. 83 studies (32 screening tools) were identified: 42 studies on construct or criterion validity versus a reference method and 51 studies on predictive validity on outcome (i.e. length of stay, mortality or complications). None of the tools performed consistently well to establish the patients' nutritional status. For the elderly, MNA performed fair to good, for the adults MUST performed fair to good. SGA, NRS-2002 and MUST performed well in predicting outcome in approximately half of the studies reviewed in adults, but not in older patients. Not one single screening or assessment tool is capable of adequate nutrition screening as well as predicting poor nutrition related outcome. Development of new tools seems redundant and will most probably not lead to new insights. New studies comparing different tools within one patient population are required. Copyright © 2013 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  5. Yeast Based Sensors

    NASA Astrophysics Data System (ADS)

    Shimomura-Shimizu, Mifumi; Karube, Isao

    Since the first microbial cell sensor was studied by Karube et al. in 1977, many types of yeast based sensors have been developed as analytical tools. Yeasts are known as facultative anaerobes. Facultative anaerobes can survive in both aerobic and anaerobic conditions. The yeast based sensor consisted of a DO electrode and an immobilized omnivorous yeast. In yeast based sensor development, many kinds of yeast have been employed by applying their characteristics to adapt to the analyte. For example, Trichosporon cutaneum was used to estimate organic pollution in industrial wastewater. Yeast based sensors are suitable for online control of biochemical processes and for environmental monitoring. In this review, principles and applications of yeast based sensors are summarized.

  6. Imp2, the PSTPIP homolog in fission yeast, affects sensitivity to the immunosuppressant FK506 and membrane trafficking in fission yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kita, Ayako; Higa, Mari; Doi, Akira

    Cytokinesis is a highly ordered process that divides one cell into two cells, which is functionally linked to the dynamic remodeling of the plasma membrane coordinately with various events such as membrane trafficking. Calcineurin is a highly conserved serine/threonine protein phosphatase, which regulates multiple biological functions, such as membrane trafficking and cytokinesis. Here, we isolated imp2-c3, a mutant allele of the imp2{sup +} gene, encoding a homolog of the mouse PSTPIP1 (proline-serine-threonine phosphatase interacting protein 1), using a genetic screen for mutations that are synthetically lethal with calcineurin deletion in fission yeast. The imp2-c3 mutants showed a defect in cytokinesis withmore » multi-septated phenotypes, which was further enhanced upon treatment with the calcineurin inhibitor FK506. Notably, electron micrographs revealed that the imp2-c3 mutant cells accumulated aberrant multi-lamella Golgi structures and putative post-Golgi secretory vesicles, and exhibited fragmented vacuoles in addition to thickened septa. Consistently, imp2-c3 mutants showed a reduced secretion of acid phosphatase and defects in vacuole fusion. The imp2-c3 mutant cells exhibited a weakened cell wall, similar to the membrane trafficking mutants identified in the same genetic screen such as ypt3-i5. These findings implicate the PSTPIP1 homolog Imp2 in Golgi/vacuole function, thereby affecting various cellular processes, including cytokinesis and cell integrity. - Highlights: • We isolated imp2-c3, in a synthetic lethal screen with calcineurin in fission yeast. • The imp2{sup +} gene encodes a component of the actin contractile ring similar to Cdc15. • The imp2-c3 mutants showed defects in cytokinesis, which were exacerbated by FK506. • The imp2-c3 mutants were defective in membrane trafficking and cell wall integrity. • Our study revealed a novel role for Imp2 in the Golgi/vacuolar membrane trafficking.« less

  7. Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

    PubMed Central

    Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

    1998-01-01

    In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

  8. Interaction with Polyglutamine-expanded Huntingtin Alters Cellular Distribution and RNA Processing of Huntingtin Yeast Two-hybrid Protein A (HYPA)*

    PubMed Central

    Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

    2011-01-01

    Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD. PMID:21566141

  9. Interaction with polyglutamine-expanded huntingtin alters cellular distribution and RNA processing of huntingtin yeast two-hybrid protein A (HYPA).

    PubMed

    Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

    2011-07-15

    Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD.

  10. Brewer's/baker's yeast (Saccharomyces cerevisiae) and preventive medicine: Part II.

    PubMed

    Moyad, Mark A

    2008-02-01

    Yeast is the term generally applied to a unicellular fungus, and there are hundreds of species now identified. One of the most notable and well-known species of yeast in health and wellness is known as Saccharomyces cerevisiae, which is also known by its more common names, brewer's yeast or baker's yeast. Typically, brewer's yeast is used as a protein supplement, energy booster, immune enhancer, or other vehicle where other compounds can be inserted to create a commercialized health product. For example, one of the most notable positive findings was the encouraging results from a large randomized trial of adults recently vaccinated for seasonal influenza who also received an over-the-counter daily adjuvant modified brewer's yeast-based product (EpiCor) to prevent colds and flu symptoms. The modified yeast-based product significantly reduced the incidence and duration of this common condition. Yeast-based technology is also being used as a molecular mechanistic model of caloric restriction (CR) with the goal of improving the human life span. The current and potential impact of yeast-based technology in medicine is encouraging and should receive more attention, but the recent preliminary positive results of CR in humans may be in part due to what has been already learned from brewer's yeast.

  11. A search for H/ACA snoRNAs in yeast using MFE secondary structure prediction.

    PubMed

    Edvardsson, Sverker; Gardner, Paul P; Poole, Anthony M; Hendy, Michael D; Penny, David; Moulton, Vincent

    2003-05-01

    Noncoding RNA genes produce functional RNA molecules rather than coding for proteins. One such family is the H/ACA snoRNAs. Unlike the related C/D snoRNAs these have resisted automated detection to date. We develop an algorithm to screen the yeast genome for novel H/ACA snoRNAs. To achieve this, we introduce some new methods for facilitating the search for noncoding RNAs in genomic sequences which are based on properties of predicted minimum free-energy (MFE) secondary structures. The algorithm has been implemented and can be generalized to enable screening of other eukaryote genomes. We find that use of primary sequence alone is insufficient for identifying novel H/ACA snoRNAs. Only the use of secondary structure filters reduces the number of candidates to a manageable size. From genomic context, we identify three strong H/ACA snoRNA candidates. These together with a further 47 candidates obtained by our analysis are being experimentally screened.

  12. Genetic diversity in commercial wineries: effects of the farming system and vinification management on wine yeasts.

    PubMed

    Tello, J; Cordero-Bueso, G; Aporta, I; Cabellos, J M; Arroyo, T

    2012-02-01

    Analysis of the diversity and distribution of wine yeasts isolated from organically and conventionally grown grapes, and during the subsequent fermentation with or without starter cultures in six different commercial wineries. PCR-RFLP screening of isolates revealed the involvement of ten different species. Saccharomyces cerevisiae, scarcely isolated from grapes, was the dominant species during the latter phases of fermentation, identifying 108 different genotypes by means of SSR analysis. Species and strains' diversity and presence were strongly influenced by the farming system used to grow the grapes and the system of vinification. Organic farming management was more beneficial in terms of diversity and abundance than the conventional one. Induced fermentation generated a great replacement of native yeasts. Although winery-resident yeasts resulted to be predominant in the process, some noncommercial strains originally in the vineyard were found in final stages of the fermentation, confirming that autochthonous strains of S. cerevisiae are capable to conduct the fermentation process up to its end. The study of natural yeast communities from commercial vineyards and wineries is an important step towards the preservation of native genetic resources. Our results have special relevance because it is the first time that the real situation of the yeast ecology of alcoholic fermentation in commercial wineries belonging to the relevant wine-producing Appellation of Origin 'Vinos de Madrid' is shown. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  13. Antioxidant properties and global metabolite screening of the probiotic yeast Saccharomyces cerevisiae var. boulardii.

    PubMed

    Datta, Suprama; Timson, David J; Annapure, Uday S

    2017-07-01

    Saccharomyces cerevisiae var. boulardii is the only yeast species with probiotic properties. It is considered to have therapeutic significance in gastrointestinal disorders. In the present study, a comparative physiological study between this yeast and Saccharomyces cerevisiae (BY4742) was performed by evaluating two prominent traits of probiotic species, responses to different stress conditions and antioxidant capacity. A global metabolite profile was also developed aiming to identify which therapeutically important secondary metabolites are produced. Saccharomyces cerevisiae var. boulardii showed no significant difference in growth patterns but greater stress tolerance compared to S. cerevisiae. It also demonstrated a six- to 10-fold greater antioxidant potential (judged by the 1,1-diphenyl-2-picrylhydrazyl assay), with a 70-fold higher total phenolic content and a 20-fold higher total flavonoid content in the extracellular fraction. These features were clearly differentiated by principal component analysis and further indicated by metabolite profiling. The extracellular fraction of the S. cerevisiae var. boulardii cultures was found to be rich in polyphenolic metabolites: vanillic acid, cinnamic acid, phenyl ethyl alcohol (rose oil), erythromycin, amphetamine and vitamin B 6 , which results in the antioxidant capacity of this strain. The present study presents a new perspective for differentiating the two genetically related strains of yeast, S. cerevisiae and S. cerevisiae var. boulardii by assessing their metabolome fingerprints. In addition to the correlation of the phenotypic properties with the secretory metabolites of these two yeasts, the present study also emphasizes the potential to exploit S. cerevisiae var. boulardii in the industrial production of these metabolites. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  14. Alignment of defect levels and band edges through hybrid functionals: Effect of screening in the exchange term

    NASA Astrophysics Data System (ADS)

    Komsa, Hannu-Pekka; Broqvist, Peter; Pasquarello, Alfredo

    2010-05-01

    We investigate how various treatments of exact exchange affect defect charge transition levels and band edges in hybrid functional schemes for a variety of systems. We distinguish the effects of long-range vs short-range exchange and of local vs nonlocal exchange. This is achieved by the consideration of a set of four functionals, which comprise the semilocal Perdew-Burke-Ernzerhof (PBE) functional, the PBE hybrid (PBE0), the Heyd-Scuseria-Ernzerhof (HSE) functional, and a hybrid derived from PBE0 in which the Coulomb kernel in the exact exchange term is screened as in the HSE functional but which, unlike HSE, does not include a local expression compensating for the loss of the long-range exchange. We find that defect levels in PBE0 and in HSE almost coincide when aligned with respect to a common reference potential, due to the close total-energy differences in the two schemes. At variance, the HSE band edges determined within the same alignment scheme are found to shift significantly with respect to the PBE0 ones: the occupied and the unoccupied states undergo shifts of about +0.4eV and -0.4eV , respectively. These shifts are found to vary little among the materials considered. Through a rationale based on the behavior of local and nonlocal long-range exchange, this conclusion is generalized beyond the class of materials used in this study. Finally, we explicitly address the practice of tuning the band gap by adapting the fraction of exact exchange incorporated in the functional. When PBE0-like and HSE-like functionals are tuned to yield identical band gaps, their respective results for the positions of defect levels within the band gap and for the band alignments at interfaces are found to be very close.

  15. One-dimensional hybrid model of plasma-solid interaction in argon plasma at higher pressures

    NASA Astrophysics Data System (ADS)

    Jelínek, P.; Hrach, R.

    2007-04-01

    One of problems important in the present plasma science is the surface treatment of materials at higher pressures, including the atmospheric pressure plasma. The theoretical analysis of processes in such plasmas is difficult, because the theories derived for collisionless or slightly collisional plasma lose their validity at medium and high pressures, therefore the methods of computational physics are being widely used. There are two basic ways, how to model the physical processes taking place during the interaction of plasma with immersed solids. The first technique is the particle approach, the second one is called the fluid modelling. Both these approaches have their limitations-small efficiency of particle modelling and limited accuracy of fluid models. In computer modelling is endeavoured to use advantages by combination of these two approaches, this combination is named hybrid modelling. In our work one-dimensional hybrid model of plasma-solid interaction has been developed for an electropositive plasma at higher pressures. We have used hybrid model for this problem only as the test for our next applications, e.g. pulsed discharge, RF discharge, etc. The hybrid model consists of a combined molecular dynamics-Monte Carlo model for fast electrons and fluid model for slow electrons and positive argon ions. The latter model also contains Poisson's equation, to obtain a self-consistent electric field distribution. The derived results include the spatial distributions of electric potential, concentrations and fluxes of individual charged species near the substrate for various pressures and for various probe voltage bias.

  16. Indigenous Georgian Wine-Associated Yeasts and Grape Cultivars to Edit the Wine Quality in a Precision Oenology Perspective.

    PubMed

    Vigentini, Ileana; Maghradze, David; Petrozziello, Maurizio; Bonello, Federica; Mezzapelle, Vito; Valdetara, Federica; Failla, Osvaldo; Foschino, Roberto

    2016-01-01

    In Georgia, one of the most ancient vine-growing environment, the homemade production of wine is still very popular in every rural family and spontaneous fermentation of must, without addition of chemical preservatives, is the norm. The present work investigated the yeast biodiversity in five Georgian areas (Guria, Imereti, Kakheti, Kartli, Ratcha-Lechkhumi) sampling grapes and wines from 22 different native cultivars, in 26 vineyards and 19 family cellars. One hundred and eighty-two isolates were ascribed to 15 different species by PCR-ITS and RFLP, and partial sequencing of D1/D2 domain 26S rDNA gene. Metschnikowia pulcherrima (F' = 0.56, I' = 0.32), Hanseniaspora guilliermondii (F' = 0.49, I' = 0.27), and Cryptococcus flavescens (F' = 0.31, I' = 0.11) were the dominant yeasts found on grapes, whereas Saccharomyces cerevisiae showed the highest prevalence into wine samples. Seventy four isolates with fermentative potential were screened for oenological traits such as ethanol production, resistance to SO2, and acetic acid, glycerol and H2S production. Three yeast strains (Kluyveromyces marxianus UMY207, S. cerevisiae UMY255, Torulaspora delbrueckii UMY196) were selected and separately inoculated in vinifications experiments at a Georgian cellar. Musts were prepared from healthy grapes of local varieties, Goruli Mtsvane (white berry cultivar) and Saperavi (black berry cultivar). Physical (°Brix) and microbial analyses (plate counts) were performed to monitor the fermentative process. The isolation of indigenous S. cerevisiae yeasts beyond the inoculated strains indicated that a co-presence occurred during the vinification tests. Results from quantitative GC-FID analysis of volatile compounds revealed that the highest amount of fermentation flavors, such as 4-ethoxy-4-oxobutanoic acid (monoethyl succinate), 2-methylpropan-1-ol, ethyl 2-hydroxypropanoate, and 2-phenylethanol, were significantly more produced in fermentation conducted in Saperavi variety inoculated

  17. Protein interactome analysis of 12 mitogen-activated protein kinase kinase kinase in rice using a yeast two-hybrid system.

    PubMed

    Singh, Raksha; Lee, Jae-Eun; Dangol, Sarmina; Choi, Jihyun; Yoo, Ran Hee; Moon, Jae Sun; Shim, Jae-Kyung; Rakwal, Randeep; Agrawal, Ganesh Kumar; Jwa, Nam-Soo

    2014-01-01

    The mitogen-activated protein kinase (MAPK) cascade is composed at least of MAP3K (for MAPK kinase kinase), MAP2K, and MAPK family modules. These components together play a central role in mediating extracellular signals to the cell and vice versa by interacting with their partner proteins. However, the MAP3K-interacting proteins remain poorly investigated in plants. Here, we utilized a yeast two-hybrid system and bimolecular fluorescence complementation in the model crop rice (Oryza sativa) to map MAP3K-interacting proteins. We identified 12 novel nonredundant interacting protein pairs (IPPs) representing 11 nonredundant interactors using 12 rice MAP3Ks (available as full-length cDNA in the rice KOME (http://cdna01.dna.affrc.go.jp/cDNA/) at the time of experimental design and execution) as bait and a rice seedling cDNA library as prey. Of the 12 MAP3Ks, only six had interacting protein partners. The established MAP3K interactome consisted of two kinases, three proteases, two forkhead-associated domain-containing proteins, two expressed proteins, one E3 ligase, one regulatory protein, and one retrotransposon protein. Notably, no MAP3K showed physical interaction with either MAP2K or MAPK. Seven IPPs (58.3%) were confirmed in vivo by bimolecular fluorescence complementation. Subcellular localization of 14 interactors, together involved in nine IPPs (75%) further provide prerequisite for biological significance of the IPPs. Furthermore, GO of identified interactors predicted their involvement in diverse physiological responses, which were supported by a literature survey. These findings increase our knowledge of the MAP3K-interacting proteins, help in proposing a model of MAPK modules, provide a valuable resource for developing a complete map of the rice MAPK interactome, and allow discussion for translating the interactome knowledge to rice crop improvement against environmental factors. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Electro-optic guided-mode resonance tuning suppressible by optically induced screening in a vertically coupled hybrid GaN/Si microring resonator

    NASA Astrophysics Data System (ADS)

    Thubthimthong, B.; Sasaki, T.; Hane, K.

    2018-02-01

    GaN as a nanophotonic material has gained much attention in recent years. Using the hybrid GaN/Si platform, we report the electro-optic tuning of guided-mode resonance in a vertically coupled hybrid GaN/Si microring resonator operating in the 1.5 μm window with up to a 6 dB extinction ratio and a 1.5 MHz modulation frequency (test equipment limit). The electro-optic tuning could be optically suppressed by electron-hole-originated screening induced by an ultraviolet excitation at 325 nm. Our work may benefit in externally intervenable optical interconnects for uninterrupted secure photonic networks.

  19. Diversity and killer activity of yeasts in Malaysian fermented food samples.

    PubMed

    Lim, S L; Tay, S T

    2011-08-01

    The biodiversity and the killer activity of yeasts isolated from various types of fermented food in Malaysia were investigated in this study. Of 252 yeasts isolated from 48 fermented food samples in this study, 19 yeast species were identified based on sequence analysis of the ITS1-5.8S-ITS2 partial fragments of the yeasts. A total of 29 (11.5%) of the yeast isolates demonstrated killer activity to at least one Candida species tested in this study; including 22 isolates of Trichosporon asahii, 4 isolates of Pichia anomala, and one isolate each of Pichia norvegensis, Pichia fermentans and Issatchenkia orientalis, respectively. The presence of killer yeasts reflects antagonism that occurs during microbial interaction in the fermented food, whereby certain yeasts produce killer toxins and possibly other toxic substances in competition for limited nutrients and space. The anti-Candida activity demonstrated by killer yeasts in this study should be further explored for development of alternative therapy against candidiasis.

  20. Affordable proteomics: the two-hybrid systems.

    PubMed

    Gillespie, Marc

    2003-06-01

    Numerous proteomic methodologies exist, but most require a heavy investment in expertise and technology. This puts these approaches out of reach for many laboratories and small companies, rarely allowing proteomics to be used as a pilot approach for biomarker or target identification. Two proteomic approaches, 2D gel electrophoresis and the two-hybrid systems, are currently available to most researchers. The two-hybrid systems, though accommodating to large-scale experiments, were originally designed as practical screens, that by comparison to current proteomics tools were small-scale, affordable and technically feasible. The screens rapidly generated data, identifying protein interactions that were previously uncharacterized. The foundation for a two-hybrid proteomic investigation can be purchased as separate kits from a number of companies. The true power of the technique lies not in its affordability, but rather in its portability. The two-hybrid system puts proteomics back into laboratories where the output of the screens can be evaluated by researchers with experience in the particular fields of basic research, cancer biology, toxicology or drug development.

  1. Functional purification of the monocarboxylate transporter of the yeast Candida utilis.

    PubMed

    Baltazar, Fátima; Cássio, Fernanda; Leão, Cecília

    2006-08-01

    Plasma membranes of the yeast, Candida utilis, were solubilized with octyl-beta-D-glucopyranoside and a fraction enriched in the lactate carrier was obtained with DEAE-Sepharose anion-exchange chromatography, after elution with 0.4 M NaCl. The uptake of lactic acid into proteoliposomes, containing the purified protein fraction and cytochrome c oxidase, was dependent on a proton-motive force and the transport specificity was consistent with the one of C. utilis intact cells. Overall, we have obtained a plasma membrane fraction enriched in the lactate carrier of C. utilis in which the transport properties were preserved. Given the similarities between the lactate transport of C. utilis and the one of mammalian cells, this purified system could be further explored to screen for specific lactate inhibitors, with potential therapeutic applications.

  2. Replication dynamics of the yeast genome.

    PubMed

    Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

    2001-10-05

    Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

  3. A systematic screen for morphological abnormalities during fission yeast sexual reproduction identifies a mechanism of actin aster formation for cell fusion

    PubMed Central

    Groux, Raphaël; Vincenzetti, Vincent

    2017-01-01

    In non-motile fungi, sexual reproduction relies on strong morphogenetic changes in response to pheromone signaling. We report here on a systematic screen for morphological abnormalities of the mating process in fission yeast Schizosaccharomyces pombe. We derived a homothallic (self-fertile) collection of viable deletions, which, upon visual screening, revealed a plethora of phenotypes affecting all stages of the mating process, including cell polarization, cell fusion and sporulation. Cell fusion relies on the formation of the fusion focus, an aster-like F-actin structure that is marked by strong local accumulation of the myosin V Myo52, which concentrates secretion at the fusion site. A secondary screen for fusion-defective mutants identified the myosin V Myo51-associated coiled-coil proteins Rng8 and Rng9 as critical for the coalescence of the fusion focus. Indeed, rng8Δ and rng9Δ mutant cells exhibit multiple stable dots at the cell-cell contact site, instead of the single focus observed in wildtype. Rng8 and Rng9 accumulate on the fusion focus, dependent on Myo51 and tropomyosin Cdc8. A tropomyosin mutant allele, which compromises Rng8/9 localization but not actin binding, similarly leads to multiple stable dots instead of a single focus. By contrast, myo51 deletion does not strongly affect fusion focus coalescence. We propose that focusing of the actin filaments in the fusion aster primarily relies on Rng8/9-dependent cross-linking of tropomyosin-actin filaments. PMID:28410370

  4. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    NASA Astrophysics Data System (ADS)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  5. Yeast Infection (Vaginal)

    MedlinePlus

    Yeast infection (vaginal) Overview A vaginal yeast infection is a fungal infection that causes irritation, discharge and intense itchiness ... symptoms Causes The fungus candida causes a vaginal yeast infection. Your vagina naturally contains a balanced mix of yeast, including ...

  6. [Novel hybrid inhibitors of the phage T7 RNA polymerase: synthesis, docking and screening in vitro].

    PubMed

    Kostina, V H; Pal'chykovs'ka, L H; Platonov, M O; Vasyl'chenko, O V; Lysenko, N A; Alekseeva, I V

    2012-01-01

    A number of new hybrid heteroaromatic compounds, consisting of tricyclic fragments (acridone, thioxanthone and phenazine) and bicyclic fragments (benzimidazole, benzothiazole and benzoxazole) were synthesized using the method, developed by the authors. As a result of screening against the transcription model system of the phage T7 DNA-dependent RNA polymerase three effective inhibitors of the RNA syntheses with the IC50 value of 8.9, 5.7 and 19.8 microM were detected. To cast light on the mode of interaction between the synthesized compounds and the target, the molecular docking was applied to the model pocket of the phage T7 RNA polymerase transcription complex. It was established that these ligands form networks of H-bonds with residues of the pocket conservative amino acids and pi-interaction with the Mg2+ ion. A planar geometry of the hybrid molecules, realized due to the intramolecular H-bonds, proved to be an important structural feature, which correlates with an efficacious inhibitory activity.

  7. High-throughput analysis of yeast replicative aging using a microfluidic system

    PubMed Central

    Jo, Myeong Chan; Liu, Wei; Gu, Liang; Dang, Weiwei; Qin, Lidong

    2015-01-01

    Saccharomyces cerevisiae has been an important model for studying the molecular mechanisms of aging in eukaryotic cells. However, the laborious and low-throughput methods of current yeast replicative lifespan assays limit their usefulness as a broad genetic screening platform for research on aging. We address this limitation by developing an efficient, high-throughput microfluidic single-cell analysis chip in combination with high-resolution time-lapse microscopy. This innovative design enables, to our knowledge for the first time, the determination of the yeast replicative lifespan in a high-throughput manner. Morphological and phenotypical changes during aging can also be monitored automatically with a much higher throughput than previous microfluidic designs. We demonstrate highly efficient trapping and retention of mother cells, determination of the replicative lifespan, and tracking of yeast cells throughout their entire lifespan. Using the high-resolution and large-scale data generated from the high-throughput yeast aging analysis (HYAA) chips, we investigated particular longevity-related changes in cell morphology and characteristics, including critical cell size, terminal morphology, and protein subcellular localization. In addition, because of the significantly improved retention rate of yeast mother cell, the HYAA-Chip was capable of demonstrating replicative lifespan extension by calorie restriction. PMID:26170317

  8. Improvement of flavor profiles in Chinese rice wine by creating fermenting yeast with superior ethanol tolerance and fermentation activity.

    PubMed

    Yang, Yijin; Xia, Yongjun; Lin, Xiangna; Wang, Guangqiang; Zhang, Hui; Xiong, Zhiqiang; Yu, Haiyan; Yu, Jianshen; Ai, Lianzhong

    2018-06-01

    Producing alcoholic beverages with novel flavor are desirable for winemakers. We created fermenting yeast with superior ethanol tolerance and fermentation activity to improve the flavor profiles of Chinese rice wine. Strategies of ethanol domestication, ultraviolet mutagenesis (UV) and protoplast fusion were conducted to create yeast hybrids with excellent oenological characteristic. The obtained diploid hybrid F23 showed a cell viability of 6.2% under 25% ethanol, whereas its diploid parental strains could not survive under 20% ethanol. During Chinese rice wine-making, compared to diploid parents, F23 produced 7.07%-12.44% higher yield of ethanol. Flavor analysis indicated that the total content of flavor compounds in F23 wine was 19.99-26.55% higher than that of parent wines. Specifically, F23 exhibited higher capacity in producing 2-phenylethanol, short-chain and long-chain fatty-acid ethyl-ester than diploid parents. Compared to diploid parents, F23 introduced more flavor contributors with odor activity values (OAVs) above one to Chinese rice wine, and those contributors were found with higher OAVs. Based on principal component analysis (PCA), the flavor characteristic of F23 wine was similar to each of parent wine. Additionally, sensory evaluation showed that F23 wine was highly assessed for its intensive levels in fruit-aroma, alcohol-aroma and mouthfeel. Hybrid F23 not only displayed superior flavor production and oenological performance in making Chinese rice wine, but also could act as potential "mixed-like" starter to enrich wine style and differentiation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Reconstruction of the Evolutionary History of Saccharomyces cerevisiae x S. kudriavzevii Hybrids Based on Multilocus Sequence Analysis

    PubMed Central

    Peris, David; Lopes, Christian A.; Arias, Armando; Barrio, Eladio

    2012-01-01

    In recent years, interspecific hybridization and introgression are increasingly recognized as significant events in the evolution of Saccharomyces yeasts. These mechanisms have probably been involved in the origin of novel yeast genotypes and phenotypes, which in due course were to colonize and predominate in the new fermentative environments created by human manipulation. The particular conditions in which hybrids arose are still unknown, as well as the number of possible hybridization events that generated the whole set of natural hybrids described in the literature during recent years. In this study, we could infer at least six different hybridization events that originated a set of 26 S. cerevisiae x S. kudriavzevii hybrids isolated from both fermentative and non-fermentative environments. Different wine S. cerevisiae strains and European S. kudriavzevii strains were probably involved in the hybridization events according to gene sequence information, as well as from previous data on their genome composition and ploidy. Finally, we postulate that these hybrids may have originated after the introduction of vine growing and winemaking practices by the Romans to the present Northern vine-growing limits and spread during the expansion of improved viticulture and enology practices that occurred during the Late Middle Ages. PMID:23049811

  10. Isolation and Characterization of a Gene Specific to Lager Brewing Yeast That Encodes a Branched-Chain Amino Acid Permease

    PubMed Central

    Kodama, Yukiko; Omura, Fumihiko; Ashikari, Toshihiko

    2001-01-01

    We found two types of branched-chain amino acid permease gene (BAP2) in the lager brewing yeast Saccharomyces pastorianus BH-225 and cloned one type of BAP2 gene (Lg-BAP2), which is identical to that of Saccharomyces bayanus (by-BAP2-1). The other BAP2 gene of the lager brewing yeast (cer-BAP2) is very similar to the Saccharomyces cerevisiae BAP2 gene. This result substantiates the notion that lager brewing yeast is a hybrid of S. cerevisiae and S. bayanus. The amino acid sequence homology between S. cerevisiae Bap2p and Lg-Bap2p was 88%. The transcription of Lg-BAP2 was not induced by the addition of leucine to the growth medium, while that of cer-BAP2 was induced. The transcription of Lg-BAP2 was repressed by the presence of ethanol and weak organic acid, while that of cer-BAP2 was not affected by these compounds. Furthermore, Northern analysis during beer fermentation revealed that the transcription of Lg-BAP2 was repressed at the beginning of the fermentation, while cer-BAP2 was highly expressed throughout the fermentation. These results suggest that the transcription of Lg-BAP2 is regulated differently from that of cer-BAP2 in lager brewing yeasts. PMID:11472919

  11. Hybrid Semiclassical Theory of Quantum Quenches in One-Dimensional Systems

    NASA Astrophysics Data System (ADS)

    Moca, Cǎtǎlin Paşcu; Kormos, Márton; Zaránd, Gergely

    2017-09-01

    We develop a hybrid semiclassical method to study the time evolution of one-dimensional quantum systems in and out of equilibrium. Our method handles internal degrees of freedom completely quantum mechanically by a modified time-evolving block decimation method while treating orbital quasiparticle motion classically. We can follow dynamics up to time scales well beyond the reach of standard numerical methods to observe the crossover between preequilibrated and locally phase equilibrated states. As an application, we investigate the quench dynamics and phase fluctuations of a pair of tunnel-coupled one-dimensional Bose condensates. We demonstrate the emergence of soliton-collision-induced phase propagation, soliton-entropy production, and multistep thermalization. Our method can be applied to a wide range of gapped one-dimensional systems.

  12. Screening of eye-position related genes with DD-RT-PCR and RDA in the hybrids between Japanese flounder Paralichthys olivaceus and stone flounder Kareius bicoloratus

    NASA Astrophysics Data System (ADS)

    Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Sun, Yeying; Zhong, Qiwang; Wang, Xubo; Wang, Zhigang; Li, Shuo; Li, Chunmei

    2009-02-01

    Flatfish or flounder moves one eye to change body proportion into vertebral asymmetry during metamorphosis, during which some become sinistral while others dextral. However, the mechanism behinds the eye-position has not been well understood. In this research, hybrids between Japanese flounder(♀) and stone flounder (♂) show mixed eye-location in both dextral type and sinistral type, and thus become good samples for studying the eye-migration. mRNAs from pro-metamorphosis sinistral and dextral hybrids larvae were screened with classical differential display RT-PCR (DD-RT-PCR) and representational difference analysis of cDNA (cDNA-RDA); 30 and 47 putative fragments were isolated, respectively. The cDNA fragments of creatine kinase and trypsinogen 2 precursor genes isolated by cDNA-RDA exhibited eye-position expression patterns during metamorphosis. However, none of the fragments was proved to be related to flatfishes’ eye-position specifically. Therefore, further studies and more sensitive gene isolated methods are needed to solve the problems.

  13. A High-Throughput Genetic Complementation Assay in Yeast Cells Identified Selective Inhibitors of Sphingosine Kinase 1 Not Found Using a Cell-Free Enzyme Assay.

    PubMed

    Kashem, Mohammed A; Kennedy, Charles A; Fogarty, Kylie E; Dimock, Janice R; Zhang, Yunlong; Sanville-Ross, Mary L; Skow, Donna J; Brunette, Steven R; Swantek, Jennifer L; Hummel, Heidi S; Swindle, John; Nelson, Richard M

    2016-01-01

    Sphingosine kinase 1 (SphK1) is a lipid kinase that phosphorylates sphingosine to produce the bioactive sphingolipid, sphingosine-1-phosphate (S1P), and therefore represents a potential drug target for a variety of pathological processes such as fibrosis, inflammation, and cancer. We developed two assays compatible with high-throughput screening to identify small-molecule inhibitors of SphK1: a purified component enzyme assay and a genetic complementation assay in yeast cells. The biochemical enzyme assay measures the phosphorylation of sphingosine-fluorescein to S1P-fluorescein by recombinant human full-length SphK1 using an immobilized metal affinity for phosphochemicals (IMAP) time-resolved fluorescence resonance energy transfer format. The yeast assay employs an engineered strain of Saccharomyces cerevisiae, in which the human gene encoding SphK1 replaced the yeast ortholog and quantitates cell viability by measuring intracellular adenosine 5'-triphosphate (ATP) using a luciferase-based luminescent readout. In this assay, expression of human SphK1 was toxic, and the resulting yeast cell death was prevented by SphK1 inhibitors. We optimized both assays in a 384-well format and screened ∼10(6) compounds selected from the Boehringer Ingelheim library. The biochemical IMAP high-throughput screen identified 5,561 concentration-responsive hits, most of which were ATP competitive and not selective over sphingosine kinase 2 (SphK2). The yeast screen identified 205 concentration-responsive hits, including several distinct compound series that were selective against SphK2 and were not ATP competitive.

  14. An Integrated In Silico Method to Discover Novel Rock1 Inhibitors: Multi- Complex-Based Pharmacophore, Molecular Dynamics Simulation and Hybrid Protocol Virtual Screening.

    PubMed

    Chen, Haining; Li, Sijia; Hu, Yajiao; Chen, Guo; Jiang, Qinglin; Tong, Rongsheng; Zang, Zhihe; Cai, Lulu

    2016-01-01

    Rho-associated, coiled-coil containing protein kinase 1 (ROCK1) is an important regulator of focal adhesion, actomyosin contraction and cell motility. In this manuscript, a combination of the multi-complex-based pharmacophore (MCBP), molecular dynamics simulation and a hybrid protocol of a virtual screening method, comprised of multipharmacophore- based virtual screening (PBVS) and ensemble docking-based virtual screening (DBVS) methods were used for retrieving novel ROCK1 inhibitors from the natural products database embedded in the ZINC database. Ten hit compounds were selected from the hit compounds, and five compounds were tested experimentally. Thus, these results may provide valuable information for further discovery of more novel ROCK1 inhibitors.

  15. Engineered yeast for enhanced CO2 mineralization†

    PubMed Central

    Barbero, Roberto; Carnelli, Lino; Simon, Anna; Kao, Albert; Monforte, Alessandra d’Arminio; Riccò, Moreno; Bianchi, Daniele; Belcher, Angela

    2014-01-01

    In this work, a biologically catalyzed CO2 mineralization process for the capture of CO2 from point sources was designed, constructed at a laboratory scale, and, using standard chemical process scale-up protocols, was modeled and evaluated at an industrial scale. A yeast display system in Saccharomyces cerevisae was used to screen several carbonic anhydrase isoforms and mineralization peptides for their impact on CO2 hydration, CaCO3 mineralization, and particle settling rate. Enhanced rates for each of these steps in the CaCO3 mineralization process were confirmed using quantitative techniques in lab-scale measurements. The effect of these enhanced rates on the CO2 capture cost in an industrial scale CO2 mineralization process using coal fly ash as the CaO source was evaluated. The model predicts a process using bCA2- yeast and fly ash is ~10% more cost effective per ton of CO2 captured than a process with no biological molecules, a savings not realized by wild-type yeast and high-temperature stable recombinant CA2 alone or in combination. The levelized cost of electricity for a power plant using this process was calculated and scenarios in which this process compares favorably to CO2 capture by MEA absorption process are presented. PMID:25289021

  16. A Wide-Field Fluorescence Microscope Extension for Ultrafast Screening of One-Bead One-Compound Libraries Using a Spectral Image Subtraction Approach.

    PubMed

    Heusermann, Wolf; Ludin, Beat; Pham, Nhan T; Auer, Manfred; Weidemann, Thomas; Hintersteiner, Martin

    2016-05-09

    The increasing involvement of academic institutions and biotech companies in drug discovery calls for cost-effective methods to identify new bioactive molecules. Affinity-based on-bead screening of combinatorial one-bead one-compound libraries combines a split-mix synthesis design with a simple protein binding assay operating directly at the bead matrix. However, one bottleneck for academic scale on-bead screening is the unavailability of a cheap, automated, and robust screening platform that still provides a quantitative signal related to the amount of target protein binding to individual beads for hit bead ranking. Wide-field fluorescence microscopy has long been considered unsuitable due to significant broad spectrum autofluorescence of the library beads in conjunction with low detection sensitivity. Herein, we demonstrate how such a standard microscope equipped with LED-based excitation and a modern CMOS camera can be successfully used for selecting hit beads. We show that the autofluorescence issue can be overcome by an optical image subtraction approach that yields excellent signal-to-noise ratios for the detection of bead-associated target proteins. A polymer capillary attached to a semiautomated bead-picking device allows the operator to efficiently isolate individual hit beads in less than 20 s. The system can be used for ultrafast screening of >200,000 bead-bound compounds in 1.5 h, thereby making high-throughput screening accessible to a wider group within the scientific community.

  17. Non-interferometric quantitative phase imaging of yeast cells

    NASA Astrophysics Data System (ADS)

    Poola, Praveen K.; Pandiyan, Vimal Prabhu; John, Renu

    2015-12-01

    Real-time imaging of live cells is quite difficult without the addition of external contrast agents. Various methods for quantitative phase imaging of living cells have been proposed like digital holographic microscopy and diffraction phase microscopy. In this paper, we report theoretical and experimental results of quantitative phase imaging of live yeast cells with nanometric precision using transport of intensity equations (TIE). We demonstrate nanometric depth sensitivity in imaging live yeast cells using this technique. This technique being noninterferometric, does not need any coherent light sources and images can be captured through a regular bright-field microscope. This real-time imaging technique would deliver the depth or 3-D volume information of cells and is highly promising in real-time digital pathology applications, screening of pathogens and staging of diseases like malaria as it does not need any preprocessing of samples.

  18. The yeast spectrum of the 'tea fungus Kombucha'.

    PubMed

    Mayser, P; Fromme, S; Leitzmann, C; Gründer, K

    1995-01-01

    The tea fungus 'Kombucha' is a symbiosis of Acetobacter, including Acetobacter xylinum as a characteristic species, and various yeasts. A characteristic yeast species or genus has not yet been identified. Kombucha is mainly cultivated in sugared black tea to produce a slightly acidulous effervescent beverage that is said to have several curative effects. In addition to sugar, the beverage contains small amounts of alcohol and various acids, including acetic acid, gluconic acid and lactic acid, as well as some antibiotic substances. To characterize the yeast spectrum with special consideration given to facultatively pathogenic yeasts, two commercially available specimens of tea fungus and 32 from private households in Germany were analysed by micromorphological and biochemical methods. Yeasts of the genera Brettanomyces, Zygosaccharomyces and Saccharomyces were identified in 56%, 29% and 26% respectively. The species Saccharomycodes ludwigii and Candida kefyr were only demonstrated in isolated cases. Furthermore, the tests revealed pellicle-forming yeasts such as Candida krusei or Issatchenkia orientalis/occidentalis as well as species of the apiculatus yeasts (Kloeckera, Hanseniaspora). Thus, the genus Brettanomyces may be a typical group of yeasts that are especially adapted to the environment of the tea fungus. However, to investigate further the beneficial effects of tea fungus, a spectrum of the other typical genera must be defined. Only three specimens showed definite contaminations. In one case, no yeasts could be isolated because of massive contamination with Penicillium spp. In the remaining two samples (from one household), Candida albicans was demonstrated. The low rate of contamination might be explained by protective mechanisms, such as formation of organic acids and antibiotic substances. Thus, subjects with a healthy metabolism do not need to be advised against cultivating Kombucha. However, those suffering from immunosuppression should preferably

  19. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    PubMed

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  20. Yeast as a model to study apoptosis?

    PubMed

    Fleury, Christophe; Pampin, Mathieu; Tarze, Agathe; Mignotte, Bernard

    2002-02-01

    Programmed cell death (PCD) serves as a major mechanism for the precise regulation of cell numbers, and as a defense mechanism to remove unwanted and potentially dangerous cells. Despite the striking heterogeneity of cell death induction pathways, the execution of the death program is often associated with characteristic morphological and biochemical changes termed apoptosis. Although for a long time the absence of mitochondrial changes was considered as a hallmark of apoptosis, mitochondria appear today as the central executioner of programmed cell death. This crucial position of mitochondria in programmed cell death control is not due to a simple loss of function (deficit in energy supplying), but rather to an active process in the regulation of effector mechanisms. The large diversity of regulators of apoptosis in mammals and their numerous interactions complicate the analysis of their individual functions. Yeast, eukaryotic but unicellular organism, lack the main regulators of apoptosis (caspases, Bcl-2 family members, ...) found in mammals. This absence render them a powerful tool for heterologous expression, functional studies, and even cloning of new regulators of apoptosis. Great advances have thus been made in our understanding of the molecular mechanisms of Bcl-2 family members interactions with themselves and other cellular proteins, specially thanks to the two hybrid system and the easy manipulation of yeast (molecular biology and genetics). This review will focus on the use of yeast as a tool to identify new regulators and study function of mammalian apoptosis regulators.

  1. Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

    PubMed

    Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

    2012-01-01

    Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

  2. Hybrid LES RANS technique based on a one-equation near-wall model

    NASA Astrophysics Data System (ADS)

    Breuer, M.; Jaffrézic, B.; Arora, K.

    2008-05-01

    In order to reduce the high computational effort of wall-resolved large-eddy simulations (LES), the present paper suggests a hybrid LES RANS approach which splits up the simulation into a near-wall RANS part and an outer LES part. Generally, RANS is adequate for attached boundary layers requiring reasonable CPU-time and memory, where LES can also be applied but demands extremely large resources. Contrarily, RANS often fails in flows with massive separation or large-scale vortical structures. Here, LES is without a doubt the best choice. The basic concept of hybrid methods is to combine the advantages of both approaches yielding a prediction method, which, on the one hand, assures reliable results for complex turbulent flows, including large-scale flow phenomena and massive separation, but, on the other hand, consumes much fewer resources than LES, especially for high Reynolds number flows encountered in technical applications. In the present study, a non-zonal hybrid technique is considered (according to the signification retained by the authors concerning the terms zonal and non-zonal), which leads to an approach where the suitable simulation technique is chosen more or less automatically. For this purpose the hybrid approach proposed relies on a unique modeling concept. In the LES mode a subgrid-scale model based on a one-equation model for the subgrid-scale turbulent kinetic energy is applied, where the length scale is defined by the filter width. For the viscosity-affected near-wall RANS mode the one-equation model proposed by Rodi et al. (J Fluids Eng 115:196 205, 1993) is used, which is based on the wall-normal velocity fluctuations as the velocity scale and algebraic relations for the length scales. Although the idea of combined LES RANS methods is not new, a variety of open questions still has to be answered. This includes, in particular, the demand for appropriate coupling techniques between LES and RANS, adaptive control mechanisms, and proper subgrid

  3. "One-pot" preparation of basic amino acid-silica hybrid monolithic column for capillary electrochromatography.

    PubMed

    Xu, Hongrui; Xu, Zhendong; Yang, Limin; Wang, Qiuquan

    2011-08-01

    A novel "one-pot" strategy was developed for the preparation of amino acid (AA)-silica hybrid monolithic column. The basic AA (L-Arginine, L-Lysine and L-Histidine) was covalently incorporated into the silica hybrid skeleton via the epoxy ring-opening reaction between the amine group and the glycidyl moiety in γ-glycidoxypropyltrimethoxysilane (GPTMS), which was confirmed by elemental analysis and FT-IR studies, while the basic AA was also found to catalyze the polycondensation of tetramethoxysilane and GPTMS. The average mesopore and macropore sizes of the prepared basic AA-silica hybrid monolithic columns were 3.86 nm and 1.71 μm for the L-Lysine-silica hybrid monolith, 5.38 nm and 4.24 μm for the L-Arginine-silica hybrid monolith, and 6.38 nm and 1.24 μm for the L-Histidine-silica hybrid monolith. The hybrid monolith afforded a zwitterionic stationary phase for CEC, the direction and magnitude of EOF can be controlled by the pH of the mobile phase used. Besides an electrophoretic mechanism, the monoliths behave in a typical hydrophilic interaction with the analytes when ACN percentage in the mobile phase is over 40%. Four polar compounds (toluene, DMF, formamide and thiourea) were tested on the three AA-silica hybrid monolithic columns, and the best separation efficiency was observed in the L-Lysine-silica hybrid monolithic column, its theoretical plate height was down to 5.7 μm for thiourea when 20 mM HCOOH-HCOONH4 containing 20% ACN (pH 4.1) was used as a running buffer. The corresponding theoretical plate number for toluene, DMF, formamide and thiourea were 123,385, 103,620, 121,845 and 105,345 plates/m, respectively. Effective separation of phenols and peptides on the L-Lysine-silica hybrid monolithic column was achieved using CEC. We believe that this strategy paves a way for the easy preparation of various functional silica hybrid monolithic columns, aiming at different separation purposes. Copyright © 2011 WILEY-VCH Verlag Gmb

  4. Field screening of experimental corn hybrids and inbred lines for multiple ear-feeding insect resistance.

    PubMed

    Ni, Xinzhi; Xu, Wenwei; Krakowsky, Matthew D; Buntin, G David; Brown, Steve L; Lee, R Dewey; Coy, Anton E

    2007-10-01

    Identifying and using native insect resistance genes is the core of integrated pest management. In this study, 10 experimental corn, Zea mays L., hybrids and 10 inbred lines were screened for resistance to major ear-feeding insects in the southeastern Coastal Plain region of the United States during 2004 and 2005. Ear-feeding insect damage was assessed at harvest by visual damage rating for the corn earworm, Helicoverpa zea (Boddie), and by the percentage of kernels damaged by the maize weevil, Sitophilus zeamais Motschulsky, and stink bugs [combination of Euschistus servus (Say) and southern green stink bug, Nezara viridula (L.)]. Among the eight inbred lines and two control populations examined, C3S1B73-5b was resistant to corn earworm, maize weevil, and stink bugs. In contrast, C3S1B73-4 was resistant to corn earworm and stink bugs, but not to maize weevil. In a similar manner, the corn hybrid S1W*CML343 was resistant to all three ear-feeding insects, whereas hybrid C3S1B73-3*Tx205 was resistant to corn earworm and maize weevil in both growing seasons, but susceptible to stink bugs in 2005. The silk-feeding bioassay showed that corn earworm developed better on corn silk than did fall armyworm. Among all phenotypic traits examined (i.e., corn ear size, husk extension, and husk tightness), only corn ear size was negatively correlated to corn earworm damage in the inbred lines examined, whereas only husk extension (i.e., coverage) was negatively correlated to both corn earworm and maize weevil damage on the experimental hybrids examined. Such information could be used to establish a baseline for developing agronomically elite corn germplasm that confers multiple ear-feeding insect resistance.

  5. Screening in crystalline liquids protects energetic carriers in hybrid perovskites

    NASA Astrophysics Data System (ADS)

    Zhu, Haiming; Miyata, Kiyoshi; Fu, Yongping; Wang, Jue; Joshi, Prakriti; Niesner, Daniel; Williams, Kristopher; Jin, Song; Zhu, Xiaoyang

    Hybrid lead halide perovskites exhibit carrier properties that resemble those of pristine nonpolar semiconductors despite static and dynamic disorder, but how carriers are protected from efficient scattering with charged defects and optical phonons is unknown. Here, we reveal the carrier protection mechanism by comparing three single-crystal lead bromide perovskites: CH3NH3PbBr3, CH(NH2)2PbBr3, and CsPbBr3. We observed hot fluorescence emission from energetic carriers with 102 picosecond lifetimes in CH3NH3PbBr3 or CH(NH,SUB>2)2PbBr3, but not in CsPbBr3. The hot fluorescence is correlated with liquid-like molecular reorientational motions, suggesting that dynamic screening protects energetic carriers via solvation or large polaron formation on time scales competitive with that of ultrafast cooling. Similar protections likely exist for band-edge carriers. The long-lived energetic carriers may enable hot-carrier solar cells with efficiencies exceeding the Shockley-Queisser limit. This work was supported by U.S. Department of Energy Grant ER46980, National Science Foundation, Grant DMR 1420634 (MRSEC), and Department of Energy Award DE-FG02-09ER46664.

  6. Estimating the Cost-Effectiveness of One-Time Screening and Treatment for Hepatitis C in Korea

    PubMed Central

    Kim, Do Young; Han, Kwang-Hyub; Jun, Byungyool; Kim, Tae Hyun; Park, Sohee; Ward, Thomas; Webster, Samantha; McEwan, Phil

    2017-01-01

    Background and Aims This study aims to investigate the cost-effectiveness of a one-time hepatitis C virus (HCV) screening and treatment program in South Korea where hepatitis B virus (HBV) prevails, in people aged 40–70, compared to current practice (no screening). Methods A published Markov model was used in conjunction with a screening and treatment decision tree to model patient cohorts, aged 40–49, 50–59 and 60–69 years, distributed across chronic hepatitis C (CHC) and compensated cirrhosis (CC) health states (82.5% and 17.5%, respectively). Based on a published seroepidemiology study, HCV prevalence was estimated at 0.60%, 0.80% and 1.53%, respectively. An estimated 71.7% of the population was screened. Post-diagnosis, 39.4% of patients were treated with a newly available all-oral direct-acting antiviral (DAA) regimen over 5 years. Published rates of sustained virologic response, disease management costs, transition rates and utilities were utilised. Results Screening resulted in the identification of 43,635 previously undiagnosed patients across all cohorts. One-time HCV screening and treatment was estimated to be cost-effective across all cohorts; predicted incremental cost-effectiveness ratios ranged from $5,714 to $8,889 per quality-adjusted life year gained. Incremental costs associated with screening, treatment and disease management ranged from $156.47 to $181.85 million USD; lifetime costs-offsets associated with the avoidance of end stage liver disease complications ranged from $51.47 to $57.48 million USD. Conclusions One-time HCV screening and treatment in South Korean people aged 40–70 is likely to be highly cost-effective compared to the current practice of no screening. PMID:28060834

  7. The yeast genome may harbor hypoxia response elements (HRE).

    PubMed

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  8. Bioflavoring by non-conventional yeasts in sequential beer fermentations.

    PubMed

    Holt, Sylvester; Mukherjee, Vaskar; Lievens, Bart; Verstrepen, Kevin J; Thevelein, Johan M

    2018-06-01

    Non-conventional yeast species have great capacity for producing diverse flavor profiles in production of alcoholic beverages, but their potential for beer brewing, in particular in consecutive fermentations with Saccharomyces cerevisiae, has only poorly been explored. We have screened 17 non-conventional yeast species for production of an appealing profile of flavor esters and phenolics in the first phase of alcoholic fermentation, followed by inoculation with S. cerevisiae to complete the fermentation. For measurement of phenolic compounds and their precursors we developed an improved and highly sensitive methodology. The results show that non-conventional yeast species possess promising potential for enhancement of desirable flavors in beer production. Notable examples are increasing isoamyl acetate (fruity, banana flavor) by application of P. kluyverii, augmenting ethyl phenolic compounds (spicy notes) with Brettanomyces species and enhancing 4-vinyl guaiacol (clove-like aroma) with T. delbrueckii. All Pichia strains also produced high levels of ethyl acetate (solvent-like flavor). This might be selectively counteracted by selection of an appropriate S. cerevisiae strain for the second fermentation phase, which lowers total ester profile. Hence, optimization of the process conditions and/or proper strain selection in sequentially inoculated fermentations are required to unlock the full potential for aroma improvement by the non-conventional yeast species. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Fission yeast dam1-A8 mutant is resistant to and rescued by an anti-microtubule agent

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Griffiths, Karen; Masuda, Hirohisa; Dhut, Susheela

    2008-04-11

    The Dam1/DASH outer kinetochore complex is required for high-fidelity chromosome segregation in budding and fission yeast. Unlike budding yeast, the fission yeast complex is non-essential, however it promotes bipolar microtubule attachment in conjunction with microtubule-depolymerising kinesin-8 Klp5 and Klp6. Here, we screened for dam1 temperature sensitive mutants in a klp5 null background and identified dam1-A8 that contains two amino acid substitutions in the C-terminus (H126R and E149G). dam1-A8klp5 mutant cells display massive chromosome missegregation with lagging chromosomes and monopolar attachment of sister chromatids to one SPB (spindle pole body). Unexpectedly contrary to a deletion mutant that is hypersensitive to microtubule-destabilisingmore » drugs, dam1-A8 is resistant and furthermore the temperature sensitivity of dam1-A8klp5 is rescued by addition of these drugs. This indicates that the hyper-stabilised rigidity of kinetochore-spindle mal-attachments is the primary cause of lethality. Our result shows that fine-tuning of Dam1 activity is essential for chromosome bi-orientation.« less

  10. Metabolite profiling of microfluidic cell culture conditions for droplet based screening.

    PubMed

    Bjork, Sara M; Sjostrom, Staffan L; Andersson-Svahn, Helene; Joensson, Haakan N

    2015-07-01

    We investigate the impact of droplet culture conditions on cell metabolic state by determining key metabolite concentrations in S. cerevisiae cultures in different microfluidic droplet culture formats. Control of culture conditions is critical for single cell/clone screening in droplets, such as directed evolution of yeast, as cell metabolic state directly affects production yields from cell factories. Here, we analyze glucose, pyruvate, ethanol, and glycerol, central metabolites in yeast glucose dissimilation to establish culture formats for screening of respiring as well as fermenting yeast. Metabolite profiling provides a more nuanced estimate of cell state compared to proliferation studies alone. We show that the choice of droplet incubation format impacts cell proliferation and metabolite production. The standard syringe incubation of droplets exhibited metabolite profiles similar to oxygen limited cultures, whereas the metabolite profiles of cells cultured in the alternative wide tube droplet incubation format resemble those from aerobic culture. Furthermore, we demonstrate retained droplet stability and size in the new better oxygenated droplet incubation format.

  11. Made for Each Other: Ascomycete Yeasts and Insects.

    PubMed

    Blackwell, Meredith

    2017-06-01

    Fungi and insects live together in the same habitats, and many species of both groups rely on each other for success. Insects, the most successful animals on Earth, cannot produce sterols, essential vitamins, and many enzymes; fungi, often yeast-like in growth form, make up for these deficits. Fungi, however, require constantly replenished substrates because they consume the previous ones, and insects, sometimes lured by volatile fungal compounds, carry fungi directly to a similar, but fresh, habitat. Yeasts associated with insects include Ascomycota (Saccharomycotina, Pezizomycotina) and a few Basidiomycota. Beetles, homopterans, and flies are important associates of fungi, and in turn the insects carry yeasts in pits, specialized external pouches, and modified gut pockets. Some yeasts undergo sexual reproduction within the insect gut, where the genetic diversity of the population is increased, while others, well suited to their stable environment, may never mate. The range of interactions extends from dispersal of yeasts on the surface of insects (e.g., cactus- Drosophila -yeast and ephemeral flower communities, ambrosia beetles, yeasts with holdfasts) to extremely specialized associations of organisms that can no longer exist independently, as in the case of yeast-like symbionts of planthoppers. In a few cases yeast-like fungus-insect associations threaten butterflies and other species with extinction. Technical advances improve discovery and identification of the fungi but also inform our understanding of the evolution of yeast-insect symbioses, although there is much more to learn.

  12. Comparative genomics of wild type yeast strains unveils important genome diversity

    PubMed Central

    Carreto, Laura; Eiriz, Maria F; Gomes, Ana C; Pereira, Patrícia M; Schuller, Dorit; Santos, Manuel AS

    2008-01-01

    Background Genome variability generates phenotypic heterogeneity and is of relevance for adaptation to environmental change, but the extent of such variability in natural populations is still poorly understood. For example, selected Saccharomyces cerevisiae strains are variable at the ploidy level, have gene amplifications, changes in chromosome copy number, and gross chromosomal rearrangements. This suggests that genome plasticity provides important genetic diversity upon which natural selection mechanisms can operate. Results In this study, we have used wild-type S. cerevisiae (yeast) strains to investigate genome variation in natural and artificial environments. We have used comparative genome hybridization on array (aCGH) to characterize the genome variability of 16 yeast strains, of laboratory and commercial origin, isolated from vineyards and wine cellars, and from opportunistic human infections. Interestingly, sub-telomeric instability was associated with the clinical phenotype, while Ty element insertion regions determined genomic differences of natural wine fermentation strains. Copy number depletion of ASP3 and YRF1 genes was found in all wild-type strains. Other gene families involved in transmembrane transport, sugar and alcohol metabolism or drug resistance had copy number changes, which also distinguished wine from clinical isolates. Conclusion We have isolated and genotyped more than 1000 yeast strains from natural environments and carried out an aCGH analysis of 16 strains representative of distinct genotype clusters. Important genomic variability was identified between these strains, in particular in sub-telomeric regions and in Ty-element insertion sites, suggesting that this type of genome variability is the main source of genetic diversity in natural populations of yeast. The data highlights the usefulness of yeast as a model system to unravel intraspecific natural genome diversity and to elucidate how natural selection shapes the yeast genome

  13. Purification of human adipose-derived stem cells from fat tissues using PLGA/silk screen hybrid membranes.

    PubMed

    Chen, Da-Chung; Chen, Li-Yu; Ling, Qing-Dong; Wu, Meng-Hsueh; Wang, Ching-Tang; Suresh Kumar, S; Chang, Yung; Munusamy, Murugan A; Alarfajj, Abdullah A; Wang, Han-Chow; Hsu, Shih-Tien; Higuchi, Akon

    2014-05-01

    The purification of human adipose-derived stem cells (hADSCs) from human adipose tissue cells (stromal vascular fraction) was investigated using membrane filtration through poly(lactide-co-glycolic acid)/silk screen hybrid membranes. Membrane filtration methods are attractive in regenerative medicine because they reduce the time required to purify hADSCs (i.e., less than 30 min) compared with conventional culture methods, which require 5-12 days. hADSCs expressing the mesenchymal stem cell markers CD44, CD73, and CD90 were concentrated in the permeation solution from the hybrid membranes. Expression of the surface markers CD44, CD73, and CD99 on the cells in the permeation solution from the hybrid membranes, which were obtained using 18 mL of feed solution containing 50 × 10⁴ cells, was statistically significantly higher than that of the primary adipose tissue cells, indicating that the hADSCs can be purified in the permeation solution by the membrane filtration method. Cells expressing the stem cell-associated marker CD34 could be successfully isolated in the permeation solution, whereas CD34⁺ cells could not be purified by the conventional culture method. The hADSCs in the permeation solution demonstrated a superior capacity for osteogenic differentiation based on their alkali phosphatase activity, their osterix gene expression, and the results of mineralization analysis by Alizarin Red S and von Kossa staining compared with the cells from the suspension of human adipose tissue. These results suggest that the hADSCs capable of osteogenic differentiation preferentially permeate through the hybrid membranes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Detection of maltose fermentation genes in the baking yeast strains of Saccharomyces cerevisiae.

    PubMed

    Oda, Y; Tonomura, K

    1996-10-01

    The presence of any one of the five unlinked MAL loci (MAL1, MAL2, MAL3, MAL4 and MAL6) confers the ability to ferment maltose on the yeast Saccharomyces cerevisiae. Each locus is composed of three genes encoding maltose permease, alpha-glucosidase and MAL activator. Chromosomal DNA of seven representative baking strains has been separated by pulse-field gel electrophoresis and probed with three genes in MAL6 locus. The DNA bands to which all of the three MAL-derived probes simultaneously hybridized were chromosome VII carrying MAL1 in all of the strains tested, chromosome XI carrying MAL4 in six strains, chromosome III carrying MAL2 in three strains and chromosomes II and VIII carrying MAL3 and MAL6, respectively, in the one strain. The number of MAL loci in baking strains was comparable to those of brewing strains.

  15. Oleaginous yeasts from Antarctica: Screening and preliminary approach on lipid accumulation.

    PubMed

    Viñarta, Silvana C; Angelicola, M Virginia; Barros, J Maximiliano; Fernández, Pablo M; Mac Cormak, Walter; Aybar, Manuel J; de Figueroa, Lucía I C

    2016-12-01

    The capability of 17 Rhodotorula spp. isolated from Antarctica to accumulate intracellular lipids in nitrogen-limited medium was investigated. As results, 10 isolates were selected by Nile red staining, while 12 isolates were selected as oleaginous by analysis of total lipid content (20.4-73%, w/w of dry biomass). The higher lipid production and accumulation was exhibited for six strains belonging to three species of Rhodotorula (Rhodotorula glutinis, Rhodotorula glacialis, and Rhodotorula laryngis). This is the first report where R. laryngis have been identified within oleaginous specie. Lipid accumulation was evaluated comparatively in two nitrogen-limited glucose-based media (MI and MII). MI (low C/N ratio) was more suitable for biomass and lipid production while in MII (high C/N ratio) total lipid content was improved. R. glutinis R4, R. glacialis R15, and R. glutinis R48 showed high lipid concentrations (4.65-6.93 g L -1 ) and they were able to accumulate large amounts of lipids per gram of biomass (47-77%, w/w). A similar profile in fatty acids composition and content of neutral lipids to vegetable oils was observed, indicating that lipids produced by oleaginous Antarctic yeasts can be considered an alternative feedstock for biodiesel production. Antarctica represents an important source of oleaginous yeasts with adaptive capabilities to accumulate considerable amounts of lipids with biotechnological interest at 15 °C and 25 °C. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Physiological and genomic characterisation of Saccharomyces cerevisiae hybrids with improved fermentation performance and mannoprotein release capacity.

    PubMed

    Pérez-Través, Laura; Lopes, Christian A; González, Ramón; Barrio, Eladio; Querol, Amparo

    2015-07-16

    Yeast mannoproteins contribute to several aspects of wine quality by protecting wine against protein haze, reducing astringency, retaining aroma compounds and stimulating lactic-acid bacteria growth. The selection of a yeast strain that simultaneously overproduces mannoproteins and presents good fermentative characteristics is a difficult task. In this work, a Saccharomyces cerevisiae×S. cerevisiae hybrid bearing the two oenologically relevant features was constructed. According to the genomic characterisation of the hybrids, different copy numbers of some genes probably related with these physiological features were detected. The hybrid shared not only a similar copy number of genes SPR1, SWP1, MNN10 and YPS7 related to cell wall integrity with parental Sc1, but also a similar copy number of some glycolytic genes with parental Sc2, such as GPM1 and HXK1, as well as the genes involved in hexose transport, such as HXT9, HXT11 and HXT12. This work demonstrates that hybridisation and stabilisation under winemaking conditions constitute an effective approach to obtain yeast strains with desirable physiological features, like mannoprotein overproducing capacity and improved fermentation performance, which genetically depend of the expression of numerous genes (multigenic characters). Copyright © 2015. Published by Elsevier B.V.

  17. Yeast Genetics and Biotechnological Applications

    NASA Astrophysics Data System (ADS)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  18. A Novel Hybrid Iron Regulation Network Combines Features from Pathogenic and Nonpathogenic Yeasts

    PubMed Central

    Gerwien, Franziska; Safyan, Abu; Wisgott, Stephanie; Hille, Fabrice; Kaemmer, Philipp; Linde, Jörg; Brunke, Sascha; Kasper, Lydia

    2016-01-01

    ABSTRACT Iron is an essential micronutrient for both pathogens and their hosts, which restrict iron availability during infections in an effort to prevent microbial growth. Successful human pathogens like the yeast Candida glabrata have thus developed effective iron acquisition strategies. Their regulation has been investigated well for some pathogenic fungi and in the model organism Saccharomyces cerevisiae, which employs an evolutionarily derived system. Here, we show that C. glabrata uses a regulation network largely consisting of components of the S. cerevisiae regulon but also of elements of other pathogenic fungi. Specifically, similarly to baker’s yeast, Aft1 is the main positive regulator under iron starvation conditions, while Cth2 degrades mRNAs encoding iron-requiring enzymes. However, unlike the case with S. cerevisiae, a Sef1 ortholog is required for full growth under iron limitation conditions, making C. glabrata an evolutionary intermediate to SEF1-dependent fungal pathogens. Therefore, C. glabrata has evolved an iron homeostasis system which seems to be unique within the pathogenic fungi. PMID:27795405

  19. Vertical dielectric screening of few-layer van der Waals semiconductors.

    PubMed

    Koo, Jahyun; Gao, Shiyuan; Lee, Hoonkyung; Yang, Li

    2017-10-05

    Vertical dielectric screening is a fundamental parameter of few-layer van der Waals two-dimensional (2D) semiconductors. However, unlike the widely-accepted wisdom claiming that the vertical dielectric screening is sensitive to the thickness, our first-principles calculation based on the linear response theory (within the weak field limit) reveals that this screening is independent of the thickness and, in fact, it is the same as the corresponding bulk value. This conclusion is verified in a wide range of 2D paraelectric semiconductors, covering narrow-gap ones and wide-gap ones with different crystal symmetries, providing an efficient and reliable way to calculate and predict static dielectric screening of reduced-dimensional materials. Employing this conclusion, we satisfactorily explain the tunable band gap in gated 2D semiconductors. We further propose to engineer the vertical dielectric screening by changing the interlayer distance via vertical pressure or hybrid structures. Our predicted vertical dielectric screening can substantially simplify the understanding of a wide range of measurements and it is crucial for designing 2D functional devices.

  20. Yeasts: providing questions and answers for modern biology.

    PubMed

    Dickinson, J R

    2000-01-01

    Yeasts are to be found in virtually every conceivable niche on this planet and are amazingly varied in their shapes ('morphologies'), life cycles, metabolic capabilities, potentials for use in industrial processes, abilities to spoil food and drink or to act as dangerous human pathogens. This review describes four very different species of yeast to illustrate some of the diversity which exists and, in the case of one of them, Saccharomyces cerevisiae (the familiar baker's or brewer's yeast), the extent of both our knowledge and ignorance.

  1. Evaluation of yeasts from Tibetan fermented products as agents for biocontrol of blue mold of Nashi pear fruits*

    PubMed Central

    Hu, Hao; Xu, Yang; Lu, Huang-ping; Xiao, Rui; Zheng, Xiao-dong; Yu, Ting

    2015-01-01

    A total of 20 strains of yeast isolated from Tibetan fermented products were screened for antagonism against blue mold of pear caused by Penicillium expansum. Six isolates that inhibited incidence of postharvest decay by 35% or more were selected for further screening. Among them, the most effective was Rhodotorula mucilaginosa. The results showed that washed cell suspensions of R. mucilaginosa yielded better antagonistic efficacy than unwashed cell-culture mixtures, cell-free culture filtrates, and autoclaved cell cultures. Biocontrol activity improved with increasing concentrations of incubated cells. The best concentration was 1×108 cells/ml, at which the incidence of decay was only 16.7% after 6 d of incubation. The germination of conidia of P. expansum in vitro was significantly inhibited by both washed cell-suspensions and unwashed cell-culture mixtures. Rapid colonization by yeast at different concentrations showed a relationship between yeast-cell concentration and biocontrol activity. Although the titratable acidity of pear fruits increased after treatment, R. mucilaginosa did not affect the total soluble solids or ascorbic acid content. This is the first study to report that the yeast R. mucilaginosa from Tibet Autonomous Region of China may have potential as an antagonist to control the postharvest decay of pear fruits. PMID:25845361

  2. Evaluation of yeasts from Tibetan fermented products as agents for biocontrol of blue mold of Nashi pear fruits.

    PubMed

    Hu, Hao; Xu, Yang; Lu, Huang-ping; Xiao, Rui; Zheng, Xiao-dong; Yu, Ting

    2015-04-01

    A total of 20 strains of yeast isolated from Tibetan fermented products were screened for antagonism against blue mold of pear caused by Penicillium expansum. Six isolates that inhibited incidence of postharvest decay by 35% or more were selected for further screening. Among them, the most effective was Rhodotorula mucilaginosa. The results showed that washed cell suspensions of R. mucilaginosa yielded better antagonistic efficacy than unwashed cell-culture mixtures, cell-free culture filtrates, and autoclaved cell cultures. Biocontrol activity improved with increasing concentrations of incubated cells. The best concentration was 1×10(8) cells/ml, at which the incidence of decay was only 16.7% after 6 d of incubation. The germination of conidia of P. expansum in vitro was significantly inhibited by both washed cell-suspensions and unwashed cell-culture mixtures. Rapid colonization by yeast at different concentrations showed a relationship between yeast-cell concentration and biocontrol activity. Although the titratable acidity of pear fruits increased after treatment, R. mucilaginosa did not affect the total soluble solids or ascorbic acid content. This is the first study to report that the yeast R. mucilaginosa from Tibet Autonomous Region of China may have potential as an antagonist to control the postharvest decay of pear fruits.

  3. Tanshinones extend chronological lifespan in budding yeast Saccharomyces cerevisiae.

    PubMed

    Wu, Ziyun; Song, Lixia; Liu, Shao Quan; Huang, Dejian

    2014-10-01

    Natural products with anti-aging property have drawn great attention recently but examples of such compounds are exceedingly scarce. By applying a high-throughput assay based on yeast chronological lifespan measurement, we screened the anti-aging activity of 144 botanical materials and found that dried roots of Salvia miltiorrhiza Bunge have significant anti-aging activity. Tanshinones isolated from the plant including cryptotanshione, tanshinone I, and tanshinone IIa, are the active components. Among them, cryptotanshinone can greatly extend the budding yeast Saccharomyces cerevisiae chronological lifespan (up to 2.5 times) in a dose- and the-time-of-addition-dependent manner at nanomolar concentrations without disruption of cell growth. We demonstrate that cryptotanshinone prolong chronological lifespan via a nutrient-dependent regime, especially essential amino acid sensing, and three conserved protein kinases Tor1, Sch9, and Gcn2 are required for cryptotanshinone-induced lifespan extension. In addition, cryptotanshinone significantly increases the lifespan of SOD2-deleted mutants. Altogether, those data suggest that cryptotanshinone might be involved in the regulation of, Tor1, Sch9, Gcn2, and Sod2, these highly conserved longevity proteins modulated by nutrients from yeast to humans.

  4. COMPARISON OF AN IN VIVO FISH VTG ASSAY WITH YES AND E-SCREEN

    EPA Science Inventory

    This study compares the efficacy of two in vitro, estrogen-sensitive bioassays to rank the "relative estrogenicity" of five natural, pharmaceutical and xenoestrogens with a newly developed in vivo bioassay. The E-SCREEN (MCF-7 tumor cells) and YES (Yeast Estrogen Screen) assays w...

  5. Aluminum hydroxide colloid vaccine encapsulated in yeast shells with enhanced humoral and cellular immune responses.

    PubMed

    Liu, Hui; Jia, Zhenghu; Yang, Chengmao; Song, Mei; Jing, Zhe; Zhao, Yapu; Wu, Zhenzhou; Zhao, Liqing; Wei, Dongsheng; Yin, Zhinan; Hong, Zhangyong

    2018-06-01

    Aluminum salt (Alum) is one of the most important immune adjuvants approved for use in humans, however it is not suitable for vaccination against various chronic infectious diseases and cancers for not being able to induce cell-mediated (Th1) immunity. Here, we encapsulated an Alum colloid inside β-glucan particles (GPs), which are a type of natural particles derived from the yeast glucan shells, to prepare hybrid GP-Alum (GP-Al) adjuvant particles with a very uniform size of 2-4 μm. These hybrid particles can be used to load antigen proteins through a simple mixing procedure, and can be highly specifically targeted to antigen-presenting cells (APCs) and strongly activate dendritic cells (DCs) maturation and cytokine secretion. In an animal model, they elicit a strong Th1-biased immune response and extremely high antibody titer, and cause marked prophylactic and therapeutic effects against tumors. As Alum has been proven to be a safe adjuvant to induce strong humoral responses and β-glucans are safe for human use, this very uniform hybrid Alum particulate system could have important application as a vaccine carrier to stimulate humoral and cellular immune responses at the same time. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Anhidrotic ectodermal dysplasia gene region cloned in yeast artificial chromosomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kere, J.; Grzeschik, K.H.; Limon, J.

    1993-05-01

    Anhidrotic ectodermal dysplasia (EDA), an X-chromosomal recessive disorder, is expressed in a few females with chromosomal translocations involving bands Xq12-q13. Using available DNA markers from the region and somatic cell hybrids the authors mapped the X-chromosomal breakpoints in two such translocations. The breakpoints were further mapped within a yeast artificial chromosome contig constructed by chromosome walking techniques. Genomic DNA markers that map between the two translocation breakpoints were recovered representing putative portions of the EDA gene. 32 refs., 3 figs., 1 tab.

  7. Prions in Yeast

    PubMed Central

    Liebman, Susan W.; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in understanding cellular control of prion propagation, prion structure, mechanisms of de novo prion formation, specificity of prion transmission, and the biological roles of prions. This review summarizes what has been learned from yeast prions. PMID:22879407

  8. Comparative lipid production by oleaginous yeasts in hydrolyzates of lignocellulosic biomass and process strategy for high titers.

    PubMed

    Slininger, Patricia J; Dien, Bruce S; Kurtzman, Cletus P; Moser, Bryan R; Bakota, Erica L; Thompson, Stephanie R; O'Bryan, Patricia J; Cotta, Michael A; Balan, Venkatesh; Jin, Mingjie; Sousa, Leonardo da Costa; Dale, Bruce E

    2016-08-01

    Oleaginous yeasts can convert sugars to lipids with fatty acid profiles similar to those of vegetable oils, making them attractive for production of biodiesel. Lignocellulosic biomass is an attractive source of sugars for yeast lipid production because it is abundant, potentially low cost, and renewable. However, lignocellulosic hydrolyzates are laden with byproducts which inhibit microbial growth and metabolism. With the goal of identifying oleaginous yeast strains able to convert plant biomass to lipids, we screened 32 strains from the ARS Culture Collection, Peoria, IL to identify four robust strains able to produce high lipid concentrations from both acid and base-pretreated biomass. The screening was arranged in two tiers using undetoxified enzyme hydrolyzates of ammonia fiber expansion (AFEX)-pretreated cornstover as the primary screening medium and acid-pretreated switch grass as the secondary screening medium applied to strains passing the primary screen. Hydrolyzates were prepared at ∼18-20% solids loading to provide ∼110 g/L sugars at ∼56:39:5 mass ratio glucose:xylose:arabinose. A two stage process boosting the molar C:N ratio from 60 to well above 400 in undetoxified switchgrass hydrolyzate was optimized with respect to nitrogen source, C:N, and carbon loading. Using this process three strains were able to consume acetic acid and nearly all available sugars to accumulate 50-65% of cell biomass as lipid (w/w), to produce 25-30 g/L lipid at 0.12-0.22 g/L/h and 0.13-0.15 g/g or 39-45% of the theoretical yield at pH 6 and 7, a performance unprecedented in lignocellulosic hydrolyzates. Three of the top strains have not previously been reported for the bioconversion of lignocellulose to lipids. The successful identification and development of top-performing lipid-producing yeast in lignocellulose hydrolyzates is expected to advance the economic feasibility of high quality biodiesel and jet fuels from renewable biomass, expanding the market

  9. One piece microwave container screens for electrodeless lamps

    DOEpatents

    Turner, Brian; Ury, Michael

    1998-01-01

    A microwave powered electrodeless lamp includes an improved screen unit having mesh and solid sections with an internal reflector to reflect light into a light-transmitting chamber defined in the lamp microwave cavity by the reflector and the mesh section. A discharge envelope of a bulb is disposed in the light-transmitting chamber. Light emitted from the envelope is prevented by the reflector from entering the cavity portion bounded by the solid section of the screen. Replacing mesh material by solid metal material as part of the screen unit significantly reduces leakage of microwave energy from the lamp. The solid section has multiple compliant fingers defined therein for engaging the periphery of a flange on the waveguide unit so that a hose clamp can easily secure the screen to the assembly. Screen units of this type having different mesh section configurations can be interchanged in the lamp assembly to produce different respective illumination patterns.

  10. Stabilization process in Saccharomyces intra and interspecific hybrids in fermentative conditions.

    PubMed

    Pérez-Través, Laura; Lopes, Christian A; Barrio, Eladio; Querol, Amparo

    2014-12-01

    We evaluated the genetic stabilization of artificial intra- (Saccharomyces cerevisiae) and interspecific (S. cerevisiae × S. kudriavzevii) hybrids under wine fermentative conditions. Large-scale transitions in genome size and genome reorganizations were observed during this process. Interspecific hybrids seem to need fewer generations to reach genetic stability than intraspecific hybrids. The largest number of molecular patterns recovered among the derived clones was observed for intraspecific hybrids, particularly for those obtained by rare-mating. Molecular marker analyses revealed that unstable clones could change during the industrial process to obtain active dry yeast. When no changes in molecular markers and ploidy were observed after this process, no changes in genetic composition were confirmed by comparative genome hybridization, considering the clone as a stable hybrid. According to our results, under these conditions, fermentation steps 3 and 5 (30-50 generations) would suffice to obtain genetically stable interspecific and intraspecific hybrids, respectively. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  11. Toward low-cost affinity reagents: lyophilized yeast-scFv probes specific for pathogen antigens.

    PubMed

    Gray, Sean A; Weigel, Kris M; Ali, Ibne K M; Lakey, Annie A; Capalungan, Jeremy; Domingo, Gonzalo J; Cangelosi, Gerard A

    2012-01-01

    The generation of affinity reagents, usually monoclonal antibodies, remains a critical bottleneck in biomedical research and diagnostic test development. Recombinant antibody-like proteins such as scFv have yet to replace traditional monoclonal antibodies in antigen detection applications, in large part because of poor performance of scFv in solution. To address this limitation, we have developed assays that use whole yeast cells expressing scFv on their surfaces (yeast-scFv) in place of soluble purified scFv or traditional monoclonal antibodies. In this study, a nonimmune library of human scFv displayed on the surfaces of yeast cells was screened for clones that bind to recombinant cyst proteins of Entamoeba histolytica, an enteric pathogen of humans. Selected yeast-scFv clones were stabilized by lyophilization and used in detection assay formats in which the yeast-scFv served as solid support-bound monoclonal antibodies. Specific binding of antigen to the yeast-scFv was detected by staining with rabbit polyclonal antibodies. In flow cytometry-based assays, lyophilized yeast-scFv reagents retained full binding activity and specificity for their cognate antigens after 4 weeks of storage at room temperature in the absence of desiccants or stabilizers. Because flow cytometry is not available to all potential assay users, an immunofluorescence assay was also developed that detects antigen with similar sensitivity and specificity. Antigen-specific whole-cell yeast-scFv reagents can be selected from nonimmune libraries in 2-3 weeks, produced in vast quantities, and packaged in lyophilized form for extended shelf life. Lyophilized yeast-scFv show promise as low cost, renewable alternatives to monoclonal antibodies for diagnosis and research.

  12. Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy.

    PubMed

    Escalera-Fanjul, Ximena; Campero-Basaldua, Carlos; Colón, Maritrini; González, James; Márquez, Dariel; González, Alicia

    2017-01-01

    Gene duplication is one of the major evolutionary mechanisms providing raw material for the generation of genes with new or modified functions. The yeast Saccharomyces cerevisiae originated after an allopolyploidization event, which involved mating between two different ancestral yeast species. ScALT1 and ScALT2 codify proteins with 65% identity, which were proposed to be paralogous alanine transaminases. Further analysis of their physiological role showed that while ScALT1 encodes an alanine transaminase which constitutes the main pathway for alanine biosynthesis and the sole pathway for alanine catabolism, Sc Alt2 does not display alanine transaminase activity and is not involved in alanine metabolism. Moreover, phylogenetic studies have suggested that ScALT1 and ScALT2 come from each one of the two parental strains which gave rise to the ancestral hybrid. The present work has been aimed to the understanding of the properties of the ancestral type Lacchancea kluyveri LkALT1 and Kluyveromyces lactis KlALT1 , alanine transaminases in order to better understand the ScALT1 and ScALT2 evolutionary history. These ancestral -type species were chosen since they harbor ALT1 genes, which are related to ScALT2. Presented results show that, although LkALT1 and KlALT1 constitute ScALT1 orthologous genes, encoding alanine transaminases, both yeasts display Lk Alt1 and Kl Alt1 independent alanine transaminase activity and additional unidentified alanine biosynthetic and catabolic pathway(s). Furthermore, phenotypic analysis of null mutants uncovered the fact that Kl Alt1 and Lk Alt1 have an additional role, not related to alanine metabolism but is necessary to achieve wild type growth rate. Our study shows that the ancestral alanine transaminase function has been retained by the ScALT1 encoded enzyme, which has specialized its catabolic character, while losing the alanine independent role observed in the ancestral type enzymes. The fact that Sc Alt2 conserves 64% identity with

  13. Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy

    PubMed Central

    Escalera-Fanjul, Ximena; Campero-Basaldua, Carlos; Colón, Maritrini; González, James; Márquez, Dariel; González, Alicia

    2017-01-01

    Gene duplication is one of the major evolutionary mechanisms providing raw material for the generation of genes with new or modified functions. The yeast Saccharomyces cerevisiae originated after an allopolyploidization event, which involved mating between two different ancestral yeast species. ScALT1 and ScALT2 codify proteins with 65% identity, which were proposed to be paralogous alanine transaminases. Further analysis of their physiological role showed that while ScALT1 encodes an alanine transaminase which constitutes the main pathway for alanine biosynthesis and the sole pathway for alanine catabolism, ScAlt2 does not display alanine transaminase activity and is not involved in alanine metabolism. Moreover, phylogenetic studies have suggested that ScALT1 and ScALT2 come from each one of the two parental strains which gave rise to the ancestral hybrid. The present work has been aimed to the understanding of the properties of the ancestral type Lacchancea kluyveri LkALT1 and Kluyveromyces lactis KlALT1, alanine transaminases in order to better understand the ScALT1 and ScALT2 evolutionary history. These ancestral -type species were chosen since they harbor ALT1 genes, which are related to ScALT2. Presented results show that, although LkALT1 and KlALT1 constitute ScALT1 orthologous genes, encoding alanine transaminases, both yeasts display LkAlt1 and KlAlt1 independent alanine transaminase activity and additional unidentified alanine biosynthetic and catabolic pathway(s). Furthermore, phenotypic analysis of null mutants uncovered the fact that KlAlt1 and LkAlt1 have an additional role, not related to alanine metabolism but is necessary to achieve wild type growth rate. Our study shows that the ancestral alanine transaminase function has been retained by the ScALT1 encoded enzyme, which has specialized its catabolic character, while losing the alanine independent role observed in the ancestral type enzymes. The fact that ScAlt2 conserves 64% identity with LkAlt1

  14. PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

    NASA Astrophysics Data System (ADS)

    Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo

    2017-04-01

    A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles.

  15. Screening for estrogenic and antiestrogenic activities of plants growing in Egypt and Thailand

    PubMed Central

    El-Halawany, Ali M.; El Dine, Riham Salah; Chung, Mi Hwa; Nishihara, Tsutomu; Hattori, Masao

    2011-01-01

    Background: There is a growing demand for the discovery of new phytoestrogens to be used as a safe and effective hormonal replacement therapy. Materials and Methods: The methanol extracts of 40 plants from the Egyptian and Thailand folk medicines were screened for their estrogen agonist and antagonist activities. The estrogenic and antiestrogenic effects of the tested extracts were carried out using the yeast two-hybrid assay system expressing ERα and ERβ. In addition, all the extracts were subjected to a naringinase treatment and retested for their estrogenic activity. Results: The methanol extracts of Derris reticulata and Dracaena lourieri showed the most potent estrogenic activity on both estrogen-receptor subtypes, while, the methanol extracts of Butea monosperma, Erythrina fusca, and Dalbergia candenatensis revealed significant estrogenic activity on ERβ only. Nigella sativa, Sophora japonica, Artabotrys harmandii, and Clitorea hanceana showed estrogenic effect only after naringinase treatment. The most potent antiestrogenic effect was revealed by Aframomum melegueta, Dalbergia candenatensis, Dracena loureiri, and Mansonia gagei. PMID:21772754

  16. Differential stress response of Saccharomyces hybrids revealed by monitoring Hsp104 aggregation and disaggregation.

    PubMed

    Kempf, Claudia; Lengeler, Klaus; Wendland, Jürgen

    2017-07-01

    Proteotoxic stress may occur upon exposure of yeast cells to different stress conditions. The induction of stress response mechanisms is important for cells to adapt to changes in the environment and ensure survival. For example, during exposure to elevated temperatures the expression of heat shock proteins such as Hsp104 is induced in yeast. Hsp104 extracts misfolded proteins from aggregates to promote their refolding. We used an Hsp104-GFP reporter to analyze the stress profiles of Saccharomyces species hybrids. To this end a haploid S. cerevisiae strain, harboring a chromosomal HSP104-GFP under control of its endogenous promoter, was mated with stable haploids of S. bayanus, S. cariocanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum. Stress response behaviors in these hybrids were followed over time by monitoring the appearance and dissolution of Hsp104-GFP foci upon heat shock. General stress tolerance of these hybrids was related to the growth rate detected during exposure to e.g. ethanol and oxidizing agents. We observed that hybrids were generally more resistant to high temperature and ethanol stress compared to their parental strains. Amongst the hybrids differential responses regarding the appearance of Hsp104-foci and the time required for dissolving these aggregates were observed. The S. cerevisiae/S. paradoxus hybrid, combining the two most closely related strains, performed best under these conditions. Copyright © 2017 Elsevier GmbH. All rights reserved.

  17. PCR on yeast colonies: an improved method for glyco-engineered Saccharomyces cerevisiae

    PubMed Central

    2013-01-01

    Background Saccharomyces cerevisiae is extensively used in bio-industries. However, its genetic engineering to introduce new metabolism pathways can cause unexpected phenotypic alterations. For example, humanisation of the glycosylation pathways is a high priority pharmaceutical industry goal for production of therapeutic glycoproteins in yeast. Genomic modifications can lead to several described physiological changes: biomass yields decrease, temperature sensitivity or cell wall structure modifications. We have observed that deletion of several N-mannosyltransferases in Saccharomyces cerevisiae, results in strains that can no longer be analyzed by classical PCR on yeast colonies. Findings In order to validate our glyco-engineered Saccharomyces cerevisiae strains, we developed a new protocol to carry out PCR directly on genetically modified yeast colonies. A liquid culture phase, combined with the use of a Hot Start DNA polymerase, allows a 3-fold improvement of PCR efficiency. The results obtained are repeatable and independent of the targeted sequence; as such the protocol is well adapted for intensive screening applications. Conclusions The developed protocol enables by-passing of many of the difficulties associated with PCR caused by phenotypic modifications brought about by humanisation of the glycosylation in yeast and allows rapid validation of glyco-engineered Saccharomyces cerevisiae cells. It has the potential to be extended to other yeast strains presenting cell wall structure modifications. PMID:23688076

  18. Classification of yeast cells from image features to evaluate pathogen conditions

    NASA Astrophysics Data System (ADS)

    van der Putten, Peter; Bertens, Laura; Liu, Jinshuo; Hagen, Ferry; Boekhout, Teun; Verbeek, Fons J.

    2007-01-01

    Morphometrics from images, image analysis, may reveal differences between classes of objects present in the images. We have performed an image-features-based classification for the pathogenic yeast Cryptococcus neoformans. Building and analyzing image collections from the yeast under different environmental or genetic conditions may help to diagnose a new "unseen" situation. Diagnosis here means that retrieval of the relevant information from the image collection is at hand each time a new "sample" is presented. The basidiomycetous yeast Cryptococcus neoformans can cause infections such as meningitis or pneumonia. The presence of an extra-cellular capsule is known to be related to virulence. This paper reports on the approach towards developing classifiers for detecting potentially more or less virulent cells in a sample, i.e. an image, by using a range of features derived from the shape or density distribution. The classifier can henceforth be used for automating screening and annotating existing image collections. In addition we will present our methods for creating samples, collecting images, image preprocessing, identifying "yeast cells" and creating feature extraction from the images. We compare various expertise based and fully automated methods of feature selection and benchmark a range of classification algorithms and illustrate successful application to this particular domain.

  19. Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii

    PubMed Central

    Douradinha, Bruno; Reis, Viviane CB; Rogers, Matthew B; Torres, Fernando AG; Evans, Jared D; Marques Jr, Ernesto TA

    2014-01-01

    Saccharomyces boulardii (S. boulardii) is a probiotic yeast related to Saccharomyces cerevisiae (S. cerevisiae) but with distinct genetic, taxonomic and metabolic properties. S. cerevisiae has been used extensively in biotechnological applications. Currently, many strains are available, and multiple genetic tools have been developed, which allow the expression of several exogenous proteins of interest with applications in the fields of medicine, biofuels, the food industry, and scientific research, among others. Although S. boulardii has been widely studied due to its probiotic properties against several gastrointestinal tract disorders, very few studies addressed the use of this yeast as a vector for expression of foreign genes of interest with biotechnological applications. Here we show that, despite the similarity of the two yeasts, not all genetic tools used in S. cerevisiae can be applied in S. boulardii. While transformation of the latter could be obtained using a commercial kit developed for the former, consequent screening of successful transformants had to be optimized. We also show that several genes frequently used in genetic manipulation of S. cerevisiae (e.g., promoters and resistance markers) are present in S. boulardii. Sequencing revealed a high rate of homology (>96%) between the orthologs of the two yeasts. However, we also observed some of them are not eligible to be targeted for transformation of S. boulardii. This work has important applications toward the potential of this probiotic yeast as an expression system for genes of interest. PMID:24013355

  20. Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii.

    PubMed

    Douradinha, Bruno; Reis, Viviane C B; Rogers, Matthew B; Torres, Fernando A G; Evans, Jared D; Marques, Ernesto T A

    2014-01-01

    Saccharomyces boulardii (S. boulardii) is a probiotic yeast related to Saccharomyces cerevisiae (S. cerevisiae) but with distinct genetic, taxonomic and metabolic properties. S. cerevisiae has been used extensively in biotechnological applications. Currently, many strains are available, and multiple genetic tools have been developed, which allow the expression of several exogenous proteins of interest with applications in the fields of medicine, biofuels, the food industry, and scientific research, among others. Although S. boulardii has been widely studied due to its probiotic properties against several gastrointestinal tract disorders, very few studies addressed the use of this yeast as a vector for expression of foreign genes of interest with biotechnological applications. Here we show that, despite the similarity of the two yeasts, not all genetic tools used in S. cerevisiae can be applied in S. boulardii. While transformation of the latter could be obtained using a commercial kit developed for the former, consequent screening of successful transformants had to be optimized. We also show that several genes frequently used in genetic manipulation of S. cerevisiae (e.g., promoters and resistance markers) are present in S. boulardii. Sequencing revealed a high rate of homology (> 96%) between the orthologs of the two yeasts. However, we also observed some of them are not eligible to be targeted for transformation of S. boulardii. This work has important applications toward the potential of this probiotic yeast as an expression system for genes of interest.

  1. Identification of a new Mpl-interacting protein, Atp5d.

    PubMed

    Liu, Hongyan; Zhao, Zhenhu; Zhong, Yuxu; Shan, Yajun; Sun, Xiaohong; Mao, Bingzhi; Cong, Yuwen

    2014-06-01

    Thrombopoietin (TPO) can regulate hematopoiesis and megakaryopoiesis via activation of its receptor, c-Mpl, and multiple downstream signal transduction pathways. Using the cytoplasmic domain of Mpl as bait, we performed yeast two-hybrid screening, and found that the protein Atp5d might associate with Mpl. Atp5d is known as the δ subunit of mitochondrial ATP synthase, but little is known about the function of dissociative Atp5d. The interaction between Mpl and Atp5d was confirmed by the yeast two-hybrid system, mammalian two-hybrid assay, pull-down experiment, and co-immunoprecipitation study in vivo and in vitro. An additional immunofluorescence assay showed that the two proteins can colocalize along the plasma membrane in the cytoplasm. Using the yeast two-hybrid system, we tested a series of cytoplasmic truncated mutations for their ability to bind Atp5d and found an association between Atp5d and the Aa98-113 domain of Mpl. The dissociation of Atp5d from Mpl after TPO stimulation suggests that Atp5d may be a new component of TPO signaling.

  2. Phylogenetics of Saccharomycetales, the ascomycete yeasts.

    PubMed

    Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André

    2006-01-01

    Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available.

  3. Trans-Lesion DNA Polymerases May Be Involved in Yeast Meiosis

    PubMed Central

    Arbel-Eden, Ayelet; Joseph-Strauss, Daphna; Masika, Hagit; Printzental, Oxana; Rachi, Eléanor; Simchen, Giora

    2013-01-01

    Trans-lesion DNA polymerases (TLSPs) enable bypass of DNA lesions during replication and are also induced under stress conditions. Being only weakly dependent on their template during replication, TLSPs introduce mutations into DNA. The low processivity of these enzymes ensures that they fall off their template after a few bases are synthesized and are then replaced by the more accurate replicative polymerase. We find that the three TLSPs of budding yeast Saccharomyces cerevisiae Rev1, PolZeta (Rev3 and Rev7), and Rad30 are induced during meiosis at a time when DNA double-strand breaks (DSBs) are formed and homologous chromosomes recombine. Strains deleted for one or any combination of the three TLSPs undergo normal meiosis. However, in the triple-deletion mutant, there is a reduction in both allelic and ectopic recombination. We suggest that trans-lesion polymerases are involved in the processing of meiotic double-strand breaks that lead to mutations. In support of this notion, we report significant yeast two-hybrid (Y2H) associations in meiosis-arrested cells between the TLSPs and DSB proteins Rev1-Spo11, Rev1-Mei4, and Rev7-Rec114, as well as between Rev1 and Rad30. We suggest that the involvement of TLSPs in processing of meiotic DSBs could be responsible for the considerably higher frequency of mutations reported during meiosis compared with that found in mitotically dividing cells, and therefore may contribute to faster evolutionary divergence than previously assumed. PMID:23550131

  4. [Treatment of oil-manufacturing wastewater by yeast-SBR system].

    PubMed

    Lü, Wen-zhou; Liu, Ying; Huang, Yi-zhen

    2008-04-01

    Eight yeast strains were applied to a sequencing batch reactor (SBR) to treat high-strength oil-containing wastewater. The removal performance, yeast cultivation method and key factors affecting the stability of system were discussed. The results show yeast sludge with MLSS of 19 g/L and SVI of 35 mL/g can be obtained in 6 d in an open system without any molds and bacteria inhibitor addition; In 30 d continuous wastewater treatment, COD and oil removal rate achieve 86.8%-96.9% and above 99.5% respectively under the influent conditions of the COD of 9000-23000 mg/L and oil of 4500-16000 mg/L; Short period of pH impact brings reversible effects on the system and the sludge retention time can affect the SVI of the yeast; Absence of nitrogen induces morphology conversion of some yeast cells from single cell to filamentous one and impairs the settling capability of the yeast.

  5. Genome Sequence of Saccharomyces carlsbergensis, the World’s First Pure Culture Lager Yeast

    PubMed Central

    Walther, Andrea; Hesselbart, Ana; Wendland, Jürgen

    2014-01-01

    Lager yeast beer production was revolutionized by the introduction of pure culture strains. The first established lager yeast strain is known as the bottom fermenting Saccharomyces carlsbergensis, which was originally termed Unterhefe No. 1 by Emil Chr. Hansen and has been used in production in since 1883. S. carlsbergensis belongs to group I/Saaz-type lager yeast strains and is better adapted to cold growth conditions than group II/Frohberg-type lager yeasts, e.g., the Weihenstephan strain WS34/70. Here, we sequenced S. carlsbergensis using next generation sequencing technologies. Lager yeasts are descendants from hybrids formed between a S. cerevisiae parent and a parent similar to S. eubayanus. Accordingly, the S. carlsbergensis 19.5-Mb genome is substantially larger than the 12-Mb S. cerevisiae genome. Based on the sequence scaffolds, synteny to the S. cerevisae genome, and by using directed polymerase chain reaction for gap closure, we generated a chromosomal map of S. carlsbergensis consisting of 29 unique chromosomes. We present evidence for genome and chromosome evolution within S. carlsbergensis via chromosome loss and loss of heterozygosity specifically of parts derived from the S. cerevisiae parent. Based on our sequence data and via fluorescence-activated cell-sorting analysis, we determined the ploidy of S. carlsbergensis. This inferred that this strain is basically triploid with a diploid S. eubayanus and haploid S. cerevisiae genome content. In contrast the Weihenstephan strain, which we resequenced, is essentially tetraploid composed of two diploid S. cerevisiae and S. eubayanus genomes. Based on conserved translocations between the parental genomes in S. carlsbergensis and the Weihenstephan strain we propose a joint evolutionary ancestry for lager yeast strains. PMID:24578374

  6. Cell-in-Shell Hybrids: Chemical Nanoencapsulation of Individual Cells.

    PubMed

    Park, Ji Hun; Hong, Daewha; Lee, Juno; Choi, Insung S

    2016-05-17

    Nature has developed a fascinating strategy of cryptobiosis ("secret life") for counteracting the stressful, and often lethal, environmental conditions that fluctuate sporadically over time. For example, certain bacteria sporulate to transform from a metabolically active, vegetative state to an ametabolic endospore state. The bacterial endospores, encased within tough biomolecular shells, withstand the extremes of harmful stressors, such as radiation, desiccation, and malnutrition, for extended periods of time and return to a vegetative state by breaking their protective shells apart when their environment becomes hospitable for living. Certain ciliates and even higher organisms, for example, tardigrades, and others are also found to adopt a cryptobiotic strategy for survival. A common feature of cryptobiosis is the structural presence of tough sheaths on cellular structures. However, most cells and cellular assemblies are not "spore-forming" and are vulnerable to the outside threats. In particular, mammalian cells, enclosed with labile lipid bilayers, are highly susceptible to in vitro conditions in the laboratory and daily life settings, making manipulation and preservation difficult outside of specialized conditions. The instability of living cells has been a main bottleneck to the advanced development of cell-based applications, such as cell therapy and cell-based sensors. A judicious question arises: can cellular tolerance against harmful stresses be enhanced by simply forming cell-in-shell hybrid structures? Experimental results suggest that the answer is yes. A micrometer-sized "Iron Man" can be generated by chemically forming an ultrathin (<100 nm) but durable shell on a "non-spore-forming" cell. Since the report on silica nanoencapsulation of yeast cells, in which cytoprotective yeast-in-silica hybrids were formed, several synthetic strategies have been developed to encapsulate individual cells in a cytocompatible fashion, mimicking the cryptobiotic cell

  7. Dominant genetics using a yeast genomic library under the control of a strong inducible promoter.

    PubMed

    Ramer, S W; Elledge, S J; Davis, R W

    1992-12-01

    In Saccharomyces cerevisiae, numerous genes have been identified by selection from high-copy-number libraries based on "multicopy suppression" or other phenotypic consequences of overexpression. Although fruitful, this approach suffers from two major drawbacks. First, high copy number alone may not permit high-level expression of tightly regulated genes. Conversely, other genes expressed in proportion to dosage cannot be identified if their products are toxic at elevated levels. This work reports construction of a genomic DNA expression library for S. cerevisiae that circumvents both limitations by fusing randomly sheared genomic DNA to the strong, inducible yeast GAL1 promoter, which can be regulated by carbon source. The library obtained contains 5 x 10(7) independent recombinants, representing a breakpoint at every base in the yeast genome. This library was used to examine aberrant gene expression in S. cerevisiae. A screen for dominant activators of yeast mating response identified eight genes that activate the pathway in the absence of exogenous mating pheromone, including one previously unidentified gene. One activator was a truncated STE11 gene lacking approximately 1000 base pairs of amino-terminal coding sequence. In two different clones, the same GAL1 promoter-proximal ATG is in-frame with the coding sequence of STE11, suggesting that internal initiation of translation there results in production of a biologically active, truncated STE11 protein. Thus this library allows isolation based on dominant phenotypes of genes that might have been difficult or impossible to isolate from high-copy-number libraries.

  8. An improved high-throughput Nile red fluorescence assay for estimating intracellular lipids in a variety of yeast species

    PubMed Central

    Sitepu, I.R.; Ignatia, L.; Franz, A. K.; Wong, D. M.; Faulina, S.A.; Tsui, M.; Kanti, A.; Boundy-Mills, K.

    2012-01-01

    A rapid and inexpensive method for estimating lipid content of yeasts is needed for screening large numbers of yeasts samples. Nile red is a fluorescent lipophilic dye used for detection and quantification of intracellular lipid droplets in various biological system including algae, yeasts and filamentous fungi. However, a published assay for yeast is affected by variable diffusion across the cell membrane, and variation in the time required to reach maximal fluorescence emission. In this study, parameters that may influence the emission were varied to determine optimal assay conditions. An improved assay with a high-throughput capability was developed that includes the addition of dimethyl sulfoxide (DMSO) solvent to improve cell permeability, elimination of the washing step, the reduction of Nile red concentration, kinetic readings rather than single time-point reading, and utilization of a black 96-well microplate. The improved method was validated by comparison to gravimetric determination of lipid content of a broad variety of ascomycete and basidiomycete yeast species. PMID:22985718

  9. Wave Propagation, Scattering and Imaging Using Dual-domain One-way and One-return Propagators

    NASA Astrophysics Data System (ADS)

    Wu, R.-S.

    - Dual-domain one-way propagators implement wave propagation in heterogeneous media in mixed domains (space-wavenumber domains). One-way propagators neglect wave reverberations between heterogeneities but correctly handle the forward multiple-scattering including focusing/defocusing, diffraction, refraction and interference of waves. The algorithm shuttles between space-domain and wavenumber-domain using FFT, and the operations in the two domains are self-adaptive to the complexity of the media. The method makes the best use of the operations in each domain, resulting in efficient and accurate propagators. Due to recent progress, new versions of dual-domain methods overcame some limitations of the classical dual-domain methods (phase-screen or split-step Fourier methods) and can propagate large-angle waves quite accurately in media with strong velocity contrasts. These methods can deliver superior image quality (high resolution/high fidelity) for complex subsurface structures. One-way and one-return (De Wolf approximation) propagators can be also applied to wave-field modeling and simulations for some geophysical problems. In the article, a historical review and theoretical analysis of the Born, Rytov, and De Wolf approximations are given. A review on classical phase-screen or split-step Fourier methods is also given, followed by a summary and analysis of the new dual-domain propagators. The applications of the new propagators to seismic imaging and modeling are reviewed with several examples. For seismic imaging, the advantages and limitations of the traditional Kirchhoff migration and time-space domain finite-difference migration, when applied to 3-D complicated structures, are first analyzed. Then the special features, and applications of the new dual-domain methods are presented. Three versions of GSP (generalized screen propagators), the hybrid pseudo-screen, the wide-angle Padé-screen, and the higher-order generalized screen propagators are discussed. Recent

  10. Dynamic study of yeast species and Saccharomyces cerevisiae strains during the spontaneous fermentations of Muscat blanc in Jingyang, China.

    PubMed

    Wang, Chunxiao; Liu, Yanlin

    2013-04-01

    The evolution of yeast species and Saccharomyces cerevisiae genotypes during spontaneous fermentations of Muscat blanc planted in 1957 in Jingyang region of China was followed in this study. Using a combination of colony morphology on Wallerstein Nutrient (WLN) medium, sequence analysis of the 26S rDNA D1/D2 domain and 5.8S-ITS-RFLP analysis, a total of 686 isolates were identified at the species level. The six species identified were S. cerevisiae, Hanseniaspora uvarum, Hanseniaspora opuntiae, Issatchenkia terricola, Pichia kudriavzevii (Issatchenkia orientalis) and Trichosporon coremiiforme. This is the first report of T. coremiiforme as an inhabitant of grape must. Three new colony morphologies on WLN medium and one new 5.8S-ITS-RFLP profile are described. Species of non-Saccharomyces, predominantly H. opuntiae, were found in early stages of fermentation. Subsequently, S. cerevisiae prevailed followed by large numbers of P. kudriavzevii that dominated at the end of fermentations. Six native genotypes of S. cerevisiae were determined by interdelta sequence analysis. Genotypes III and IV were predominant. As a first step in exploring untapped yeast resources of the region, this study is important for monitoring the yeast ecology in native fermentations and screening indigenous yeasts that will produce wines with regional characteristics. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. A new highly specific and robust yeast androgen bioassay for the detection of agonists and antagonists

    PubMed Central

    Helsdingen, Richard J. R.; Hamers, Astrid R. M.; van Duursen, Majorie B. M.; Nielen, Michel W. F.; Hoogenboom, Ron L. A. P.

    2007-01-01

    Public concern about the presence of natural and anthropogenic compounds which affect human health by modulating normal endocrine functions is continuously growing. Fast and simple high-throughput screening methods for the detection of hormone activities are thus indispensable. During the last two decades, a panel of different in vitro assays has been developed, mainly for compounds with an estrogenic mode of action. Here we describe the development of an androgen transcription activation assay that is easy to use in routine screening. Recombinant yeast cells were constructed that express the human androgen receptor and yeast enhanced green fluorescent protein (yEGFP), the latter in response to androgens. Compared with other reporters, the yEGFP reporter protein is very convenient because it is directly measurable in intact living cells, i.e., cell wall disruption and the addition of a substrate are not needed. When yeast was exposed to 17β-testosterone, the concentration where half-maximal activation is reached (EC50) was 50 nM. The relative androgenic potencies, defined as the ratio between the EC50 of 17β-testosterone and the EC50 of the compound, of 5α-dihydrotestosterone, methyltrienolone, and 17β-boldenone are 2.3, 1.4, and 0.15 respectively. The results presented in this paper demonstrate that this new yeast androgen bioassay is fast, sensitive, and very specific and also suited to detect compounds that have an antiandrogenic mode of action. PMID:17849102

  12. L-arabinose fermenting yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  13. L-arabinose fermenting yeast

    DOEpatents

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2014-09-23

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  14. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeast species.

    PubMed

    Sitepu, Irnayuli R; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J Bruce; Gillies, Laura A; Almada, Luis A G; Boundy-Mills, Kyria L

    2013-09-01

    Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeasts species

    PubMed Central

    Sitepu, Irnayuli R.; Sestric, Ryan; Ignatia, Laura; Levin, David; German, J. Bruce; Gillies, Laura A.; Almada, Luis A.G.; Boundy-Mills, Kyria L.

    2013-01-01

    Oleaginous yeasts have been studied for oleochemical production for over 80 years. Only a few species have been studied intensely. To expand the diversity of oleaginous yeasts available for lipid research, we surveyed a broad diversity of yeasts with indicators of oleaginicity including known oleaginous clades, and buoyancy. Sixty-nine strains representing 17 genera and 50 species were screened for lipid production. Yeasts belonged to Ascomycota families, Basidiomycota orders, and the yeast-like algal genus Prototheca. Total intracellular lipids and fatty acid composition were determined under different incubation times and nitrogen availability. Thirteen new oleaginous yeast species were discovered, representing multiple ascomycete and basidiomycete clades. Nitrogen starvation generally increased intracellular lipid content. The fatty acid profiles varied with the growth conditions regardless of taxonomic affiliation. The dominant fatty acids were oleic acid, palmitic acid, linoleic acid, and stearic acid. Yeasts and culture conditions that produced fatty acids appropriate for biodiesel were identified. PMID:23891835

  16. Prevention of Yeast Spoilage in Feed and Food by the Yeast Mycocin HMK

    PubMed Central

    Lowes, K. F.; Shearman, C. A.; Payne, J.; MacKenzie, D.; Archer, D. B.; Merry, R. J.; Gasson, M. J.

    2000-01-01

    The yeast Williopsis mrakii produces a mycocin or yeast killer toxin designated HMK; this toxin exhibits high thermal stability, high pH stability, and a broad spectrum of activity against other yeasts. We describe construction of a synthetic gene for mycocin HMK and heterologous expression of this toxin in Aspergillus niger. Mycocin HMK was fused to a glucoamylase protein carrier, which resulted in secretion of biologically active mycocin into the culture media. A partial purification protocol was developed, and a comparison with native W. mrakii mycocin showed that the heterologously expressed mycocin had similar physiological properties and an almost identical spectrum of biological activity against a number of yeasts isolated from silage and yoghurt. Two food and feed production systems prone to yeast spoilage were used as models to assess the ability of mycocin HMK to act as a biocontrol agent. The onset of aerobic spoilage in mature maize silage was delayed by application of A. niger mycocin HMK on opening because the toxin inhibited growth of the indigenous spoilage yeasts. This helped maintain both higher lactic acid levels and a lower pH. In yoghurt spiked with dairy spoilage yeasts, A. niger mycocin HMK was active at all of the storage temperatures tested at which yeast growth occurred, and there was no resurgence of resistant yeasts. The higher the yeast growth rate, the more effective the killing action of the mycocin. Thus, mycocin HMK has potential applications in controlling both silage spoilage and yoghurt spoilage caused by yeasts. PMID:10698773

  17. Identification of the sulphate ion as one of the key components of yeast spoilage of a sports drink through genome-wide expression analysis.

    PubMed

    Jayakody, Lahiru N; Tsuge, Keisuke; Suzuki, Akihiro; Shimoi, Hitoshi; Kitagaki, Hiroshi

    2013-01-01

    Because of the growing market for sports drinks, prevention of yeast contamination of these beverages is of significant concern. This research was performed to achieve insight into the physiology of yeast growing in sports drinks through a genome-wide approach to prevent microbial spoilage of sports drinks. The genome-wide gene expression profile of Saccharomyces cerevisiae growing in the representative sports drink was investigated. Genes that were relevant to sulphate ion starvation response were upregulated in the yeast cells growing in the drink. These results suggest that yeast cells are suffering from deficiency of extracellular sulphate ions during growth in the sports drink. Indeed, the concentration of sulphate ions was far lower in the sports drink than in a medium that allows the optimal growth of yeast. To prove the starvation of sulphate ions of yeast, several ions were added to the beverage and its effects were investigated. The addition of sulphate ions, but not chloride ions or sodium ions, to the beverage stimulated yeast growth in the beverage in a dose-dependent manner. Moreover, the addition of sulphate ions to the sports drink increased the biosynthesis of sulphur-containing amino acids in yeast cells and hydrogen sulphide in the beverage. These results indicate that sulphate ion concentration should be regulated to prevent microbial spoilage of sports drinks.

  18. Identification and characterisation of xylanolytic yeasts isolated from decaying wood and sugarcane bagasse in Brazil.

    PubMed

    Lara, Carla A; Santos, Renata O; Cadete, Raquel M; Ferreira, Carla; Marques, Susana; Gírio, Francisco; Oliveira, Evelyn S; Rosa, Carlos A; Fonseca, César

    2014-06-01

    In this study, yeasts associated with lignocellulosic materials in Brazil, including decaying wood and sugarcane bagasse, were isolated, and their ability to produce xylanolytic enzymes was investigated. A total of 358 yeast isolates were obtained, with 198 strains isolated from decaying wood and 160 strains isolated from decaying sugarcane bagasse samples. Seventy-five isolates possessed xylanase activity in solid medium and were identified as belonging to nine species: Candida intermedia, C. tropicalis, Meyerozyma guilliermondii, Scheffersomyces shehatae, Sugiyamaella smithiae, Cryptococcus diffluens, Cr. heveanensis, Cr. laurentii and Trichosporon mycotoxinivorans. Twenty-one isolates were further screened for total xylanase activity in liquid medium with xylan, and five xylanolytic yeasts were selected for further characterization, which included quantitative analysis of growth in xylan and xylose and xylanase and β-D-xylosidase activities. The yeasts showing the highest growth rate and cell density in xylan, Cr. laurentii UFMG-HB-48, Su. smithiae UFMG-HM-80.1 and Sc. shehatae UFMG-HM-9.1a, were, simultaneously, those exhibiting higher xylanase activity. Xylan induced the highest level of (extracellular) xylanase activity in Cr. laurentii UFMG-HB-48 and the highest level of (intracellular, extracellular and membrane-associated) β-D-xylosidase activity in Su. smithiae UFMG-HM-80.1. Also, significant β-D-xylosidase levels were detected in xylan-induced cultures of Cr. laurentii UFMG-HB-48 and Sc. shehatae UFMG-HM-9.1a, mainly in extracellular and intracellular spaces, respectively. Under xylose induction, Cr. laurentii UFMG-HB-48 showed the highest intracellular β-D-xylosidase activity among all the yeast tested. C. tropicalis UFMG-HB 93a showed its higher (intracellular) β-D-xylosidase activity under xylose induction and higher at 30 °C than at 50 °C. This study revealed different xylanolytic abilities and strategies in yeasts to metabolise xylan and

  19. Alcoholic fermentation of d-xylose by yeasts. [Brettanomyces naardenensis; Candida shehatae; Candida tenuis; Pachysolen tannaphilus, Pichia segobiensis; Pichia stipitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toivola, A.; Yarrow, D.; van den Bosch, E.

    1984-06-01

    Type strains of 200 species of yeasts able to ferment glucose and grow on xylose were screened for fermentation of D-xylose. In most of the strains tested, ethanol production was negligible. Nineteen were found to produce between 0.1 and 1.0 g of ethanol per liter. Strains of the following species produce more than 1 g of ethanol per liter in the fermentation test with 2% xylose: Brettanomyces naardenensis, Candida shehatae, Candida tenuis, Pachysolen tannophilus, Pichia segobiensis, and Pichia stipitis. Subsequent screening of these yeasts for their capacity to ferment D-cellobiose revealed that only Candida tenuis CBS 4435 was a goodmore » fermenter of both xylose and cellobiose under the test conditions used.« less

  20. Successful management of risk in the hybrid OR.

    PubMed

    Childs, Shannon; Bruch, Paul

    2015-02-01

    The advent of intraoperative magnetic resonance imaging (MRI) surgery has resulted in numerous advances in minimally invasive procedures. This progress has also revealed serious environmental hazards for the patient and perioperative team. At one facility, implementation of an MRI/OR intervention suite has enhanced surgical care and outcomes. Achieving the benefits of intraoperative MRI can occur with a multidisciplinary, interdepartmental approach to the design and layout of the hybrid environment and through implementation of education and safety protocols, including patient screening and prep for scanning. Personnel, including perioperative nurses, must receive expert hands-on training to successfully mitigate risk and provide care in the hybrid OR setting. Copyright © 2015 AORN, Inc. Published by Elsevier Inc. All rights reserved.

  1. The complexity and implications of yeast prion domains

    PubMed Central

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731

  2. Characterization of winemaking yeast by cell number-size distribution analysis through flow field-flow fractionation with multi-wavelength turbidimetric detection.

    PubMed

    Zattoni, Andrea; Melucci, Dora; Reschiglian, Pierluigi; Sanz, Ramsés; Puignou, Lluís; Galceran, Maria Teresa

    2004-10-29

    Yeasts are widely used in several areas of food industry, e.g. baking, beer brewing, and wine production. Interest in new analytical methods for quality control and characterization of yeast cells is thus increasing. The biophysical properties of yeast cells, among which cell size, are related to yeast cell capabilities to produce primary and secondary metabolites during the fermentation process. Biophysical properties of winemaking yeast strains can be screened by field-flow fractionation (FFF). In this work we present the use of flow FFF (FlFFF) with turbidimetric multi-wavelength detection for the number-size distribution analysis of different commercial winemaking yeast varieties. The use of a diode-array detector allows to apply to dispersed samples like yeast cells the recently developed method for number-size (or mass-size) analysis in flow-assisted separation techniques. Results for six commercial winemaking yeast strains are compared with data obtained by a standard method for cell sizing (Coulter counter). The method here proposed gives, at short analysis time, accurate information on the number of cells of a given size, and information on the total number of cells.

  3. Guidelines and recommendations on yeast cell death nomenclature.

    PubMed

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J; Breitenbach, Michael; Burhans, William C; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W; Grant, Chris M; Greenwood, Michael T; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D; Outeiro, Tiago F; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F; Sharon, Amir; Sigrist, Stephan J; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B; Tuite, Mick; Vögtle, F-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J; Zhao, Richard Y; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cel-lular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the defi-nition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differ-ential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death rou-tines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the au-thors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the pro-gress of this vibrant field of research.

  4. Guidelines and recommendations on yeast cell death nomenclature

    PubMed Central

    Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J.; Breitenbach, Michael; Burhans, William C.; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F.; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B.; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W.; Grant, Chris M.; Greenwood, Michael T.; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M.; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P.; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A.; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D.; Outeiro, Tiago F.; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F.; Sharon, Amir; Sigrist, Stephan J.; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M.; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B.; Tuite, Mick; Vögtle, F.-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J.; Zhao, Richard Y.; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

    2018-01-01

    Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research. PMID:29354647

  5. A stable hybrid containing haploid genomes of two obligate diploid Candida species.

    PubMed

    Chakraborty, Uttara; Mohamed, Aiyaz; Kakade, Pallavi; Mugasimangalam, Raja C; Sadhale, Parag P; Sanyal, Kaustuv

    2013-08-01

    Candida albicans and Candida dubliniensis are diploid, predominantly asexual human-pathogenic yeasts. In this study, we constructed tetraploid (4n) strains of C. albicans of the same or different lineages by spheroplast fusion. Induction of chromosome loss in the tetraploid C. albicans generated diploid or near-diploid progeny strains but did not produce any haploid progeny. We also constructed stable heterotetraploid somatic hybrid strains (2n + 2n) of C. albicans and C. dubliniensis by spheroplast fusion. Heterodiploid (n + n) progeny hybrids were obtained after inducing chromosome loss in a stable heterotetraploid hybrid. To identify a subset of hybrid heterodiploid progeny strains carrying at least one copy of all chromosomes of both species, unique centromere sequences of various chromosomes of each species were used as markers in PCR analysis. The reduction of chromosome content was confirmed by a comparative genome hybridization (CGH) assay. The hybrid strains were found to be stably propagated. Chromatin immunoprecipitation (ChIP) assays with antibodies against centromere-specific histones (C. albicans Cse4/C. dubliniensis Cse4) revealed that the centromere identity of chromosomes of each species is maintained in the hybrid genomes of the heterotetraploid and heterodiploid strains. Thus, our results suggest that the diploid genome content is not obligatory for the survival of either C. albicans or C. dubliniensis. In keeping with the recent discovery of the existence of haploid C. albicans strains, the heterodiploid strains of our study can be excellent tools for further species-specific genome elimination, yielding true haploid progeny of C. albicans or C. dubliniensis in future.

  6. Yeast two-hybrid and pull-down assays propose an interaction between P50 of apple chlorotic leaf spot virus and PR-10 of Malus sylvestris cv. R12740-7A.

    PubMed

    Wang, Y; Li, N; Zhao, X; Hu, J; He, Y; Hu, T; Wang, S; Wang, Y; Cao, K

    Apple chlorotic leaf spot virus (ACLSV) movement protein (P50) is involved in cell-to-cell transport and influences the long-distance spread of silencing activity. Previously, we obtained 69 P50-interacting proteins from Malus sylvestris cv. R12740-7A and using bioinformatics analyzed their biological functions. In this study, we used the GAL4-based two-hybrid yeast system and His pull-down assays to confirm an interaction between PR-10 of M. sylvestris cv. R12740-7A and ACLSV P50. Our results provide a theoretical basis for further research on the biological function of PR-10 in ACLSV infection and the interacting mechanism between host and virus.

  7. Antimicrobial activity of yeasts against some pathogenic bacteria

    PubMed Central

    Younis, Gamal; Awad, Amal; Dawod, Rehab E.; Yousef, Nehal E.

    2017-01-01

    Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR) for detection of khs (kievitone hydratase) and pelA (pectate degrading enzyme)genes. Results: The recovery rate of yeasts from sausage was 20% (2/10) followed by kareish cheese, processed cheese, and butter 10% (1/10) each as well as raw milk 9% (9/100), and fruit yoghurt 30% (6/20). Different yeast species were recovered, namely, Candida kefyr (5 isolates), Saccharomyces cerevisiae (4 isolates), Candida intermedia (3 isolates), Candida tropicalis (2 isolates), Candida lusitaniae (2 isolates), and Candida krusei (1 isolate). khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food. PMID:28919693

  8. Comparison of the Vitek 2 Antifungal Susceptibility System with the Clinical and Laboratory Standards Institute (CLSI) and European Committee on Antimicrobial Susceptibility Testing (EUCAST) Broth Microdilution Reference Methods and with the Sensititre YeastOne and Etest Techniques for In Vitro Detection of Antifungal Resistance in Yeast Isolates ▿ ‖

    PubMed Central

    Cuenca-Estrella, Manuel; Gomez-Lopez, Alicia; Alastruey-Izquierdo, Ana; Bernal-Martinez, Leticia; Cuesta, Isabel; Buitrago, Maria J.; Rodriguez-Tudela, Juan L.

    2010-01-01

    The commercial technique Vitek 2 system for antifungal susceptibility testing of yeast species was evaluated. A collection of 154 clinical yeast isolates, including amphotericin B- and azole-resistant organisms, was tested. Results were compared with those obtained by the reference procedures of both the CLSI and the European Committee on Antimicrobial Susceptibility Testing (EUCAST). Two other commercial techniques approved for clinical use, the Etest and the Sensititre YeastOne, were included in the comparative exercise as well. The average essential agreement (EA) between the Vitek 2 system and the reference procedures was >95%, comparable with the average EAs observed between the reference procedures and the Sensititre YeastOne and Etest. The EA values were >97% for Candida spp. and stood at 92% for Cryptococcus neoformans. Intraclass correlation coefficients (ICC) between the commercial techniques and the reference procedures were statistically significant (P < 0.01). Percentages of very major errors were 2.6% between Vitek 2 and the EUCAST technique and 1.6% between Vitek 2 and the CLSI technique. The Vitek 2 MIC results were available after 14 to 18 h of incubation for all Candida spp. (average time to reading, 15.5 h). The Vitek 2 system was shown to be a reliable technique to determine antifungal susceptibility testing of yeast species and a more rapid and easier alternative for clinical laboratories than the procedures developed by either the CLSI or EUCAST. PMID:20220169

  9. The Spheroplast Lysis Assay for Yeast in Microtiter Plate Format

    PubMed Central

    Ovalle, Rafael; Spencer, Moyah; Thiwanont, Monthiwa; Lipke, Peter N.

    1999-01-01

    A yeast lysis assay in the microtiter plate format improved precision and throughput and led to an improved algorithm for estimating lag time. The assay reproducibly revealed differences of 10% or greater in the maximal lysis rate and 50% or greater in the lag time. Clonal differences were determined to be the major source of variation. Microtiter-based assays should be useful for screening for drug susceptibility and for analyzing mutant phenotypes. PMID:10427014

  10. Primary cervical cancer screening with human papillomavirus: end of study results from the ATHENA study using HPV as the first-line screening test.

    PubMed

    Wright, Thomas C; Stoler, Mark H; Behrens, Catherine M; Sharma, Abha; Zhang, Guili; Wright, Teresa L

    2015-02-01

    ATHENA evaluated the cobas HPV Test as the primary screen for cervical cancer in women ≥25years. This reports the 3-year end-of-study results comparing the performance of HPV primary screening to different screening and triage combinations. 42,209 women ≥25years were enrolled and had cytology and hrHPV testing. Women with abnormal cytology (≥atypical squamous cells of undetermined significance) and those HPV positive were referred to colposcopy. Women not reaching the study endpoint of CIN2+ entered the 3-year follow-up phase. 3-year CIR of CIN3+ in cytology-negative women was 0.8% (95% CI; 0.5-1.1%), 0.3% (95% CI 0.1-0.7%) in HPV-negative women, and 0.3% (95% CI; 0.1-0.6%) in cytology and HPV negative women. The sensitivity for CIN3+ of cytology was 47.8% (95% CI; 41.6-54.1%) compared to 61.7% (95% CI; 56.0-67.5%) for the hybrid strategy (cytology if 25-29years and cotesting with cytology and HPV if ≥30years) and 76.1% (95% CI; 70.3-81.8%) for HPV primary. The specificity for CIN3+ was 97.1% (95% CI; 96.9-97.2%), 94.6% (95% CI; 94.4-94.8%), and 93.5% (95% CI; 93.3-93.8%) for cytology, hybrid strategy, and HPV primary, respectively. Although HPV primary detects significantly more cases of CIN3+ in women ≥25years than either cytology or hybrid strategy, it requires significantly more colposcopies. However, the number of colposcopies required to detect a single CIN3+ is the same as for the hybrid strategy. HPV primary screening in women ≥25years is as effective as a hybrid screening strategy that uses cytology if 25-29years and cotesting if ≥30years. However, HPV primary screening requires less screening tests. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Methods for efficient high-throughput screening of protein expression in recombinant Pichia pastoris strains.

    PubMed

    Camattari, Andrea; Weinhandl, Katrin; Gudiminchi, Rama K

    2014-01-01

    The methylotrophic yeast Pichia pastoris is becoming one of the favorite industrial workhorses for protein expression. Due to the widespread use of integration vectors, which generates significant clonal variability, screening methods allowing assaying hundreds of individual clones are of particular importance. Here we describe methods to detect and analyze protein expression, developed in a 96-well format for high-throughput screening of recombinant P. pastoris strains. The chapter covers essentially three common scenarios: (1) an enzymatic assay for proteins expressed in the cell cytoplasm, requiring cell lysis; (2) a whole-cell assay for a fungal cytochrome P450; and (3) a nonenzymatic assay for detection and quantification of tagged protein secreted into the supernatant.

  12. Breeding Strategy To Generate Robust Yeast Starter Cultures for Cocoa Pulp Fermentations

    PubMed Central

    Meersman, Esther; Steensels, Jan; Paulus, Tinneke; Struyf, Nore; Saels, Veerle; Mathawan, Melissa; Koffi, Jean; Vrancken, Gino

    2015-01-01

    Cocoa pulp fermentation is a spontaneous process during which the natural microbiota present at cocoa farms is allowed to ferment the pulp surrounding cocoa beans. Because such spontaneous fermentations are inconsistent and contribute to product variability, there is growing interest in a microbial starter culture that could be used to inoculate cocoa pulp fermentations. Previous studies have revealed that many different fungi are recovered from different batches of spontaneous cocoa pulp fermentations, whereas the variation in the prokaryotic microbiome is much more limited. In this study, therefore, we aimed to develop a suitable yeast starter culture that is able to outcompete wild contaminants and consistently produce high-quality chocolate. Starting from specifically selected Saccharomyces cerevisiae strains, we developed robust hybrids with characteristics that allow them to efficiently ferment cocoa pulp, including improved temperature tolerance and fermentation capacity. We conducted several laboratory and field trials to show that these new hybrids often outperform their parental strains and are able to dominate spontaneous pilot scale fermentations, which results in much more consistent microbial profiles. Moreover, analysis of the resulting chocolate showed that some of the cocoa batches that were fermented with specific starter cultures yielded superior chocolate. Taken together, these results describe the development of robust yeast starter cultures for cocoa pulp fermentations that can contribute to improving the consistency and quality of commercial chocolate production. PMID:26150457

  13. High-resolution genome-wide scan of genes, gene-networks and cellular systems impacting the yeast ionome

    USDA-ARS?s Scientific Manuscript database

    To balance the demand for uptake of essential elements with their potential toxicity living cells have complex regulatory mechanisms. Here, we describe a genome-wide screen to identify genes that impact the elemental composition (‘ionome’) of yeast Saccharomyces cerevisiae. Using inductively coupled...

  14. Detection of hemolytic Listeria monocytogenes by using DNA colony hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Datta, A.R.; Wentz, B.A.; Hill, W.E.

    1987-09-01

    A fragment of about 500 base pairs of the beta-hemolysin gene from Listeria monocytogenes was used to screen different bacterial strains by DNA colony hybridization. The cells in the colonies were lysed by microwaves in the presence of sodium hydroxide. Of 52 different strains of Listeria species screened, only the DNA from beta-hemolytic (CAMP-positive) strains of L. monocytogenes hybridized with this probe.

  15. A Stochastic Model of the Yeast Cell Cycle Reveals Roles for Feedback Regulation in Limiting Cellular Variability.

    PubMed

    Barik, Debashis; Ball, David A; Peccoud, Jean; Tyson, John J

    2016-12-01

    The cell division cycle of eukaryotes is governed by a complex network of cyclin-dependent protein kinases (CDKs) and auxiliary proteins that govern CDK activities. The control system must function reliably in the context of molecular noise that is inevitable in tiny yeast cells, because mistakes in sequencing cell cycle events are detrimental or fatal to the cell or its progeny. To assess the effects of noise on cell cycle progression requires not only extensive, quantitative, experimental measurements of cellular heterogeneity but also comprehensive, accurate, mathematical models of stochastic fluctuations in the CDK control system. In this paper we provide a stochastic model of the budding yeast cell cycle that accurately accounts for the variable phenotypes of wild-type cells and more than 20 mutant yeast strains simulated in different growth conditions. We specifically tested the role of feedback regulations mediated by G1- and SG2M-phase cyclins to minimize the noise in cell cycle progression. Details of the model are informed and tested by quantitative measurements (by fluorescence in situ hybridization) of the joint distributions of mRNA populations in yeast cells. We use the model to predict the phenotypes of ~30 mutant yeast strains that have not yet been characterized experimentally.

  16. A Stochastic Model of the Yeast Cell Cycle Reveals Roles for Feedback Regulation in Limiting Cellular Variability

    PubMed Central

    Ball, David A.

    2016-01-01

    The cell division cycle of eukaryotes is governed by a complex network of cyclin-dependent protein kinases (CDKs) and auxiliary proteins that govern CDK activities. The control system must function reliably in the context of molecular noise that is inevitable in tiny yeast cells, because mistakes in sequencing cell cycle events are detrimental or fatal to the cell or its progeny. To assess the effects of noise on cell cycle progression requires not only extensive, quantitative, experimental measurements of cellular heterogeneity but also comprehensive, accurate, mathematical models of stochastic fluctuations in the CDK control system. In this paper we provide a stochastic model of the budding yeast cell cycle that accurately accounts for the variable phenotypes of wild-type cells and more than 20 mutant yeast strains simulated in different growth conditions. We specifically tested the role of feedback regulations mediated by G1- and SG2M-phase cyclins to minimize the noise in cell cycle progression. Details of the model are informed and tested by quantitative measurements (by fluorescence in situ hybridization) of the joint distributions of mRNA populations in yeast cells. We use the model to predict the phenotypes of ~30 mutant yeast strains that have not yet been characterized experimentally. PMID:27935947

  17. Production of fatty acid-derived oleochemicals and biofuels by synthetic yeast cell factories

    PubMed Central

    Zhou, Yongjin J.; Buijs, Nicolaas A.; Zhu, Zhiwei; Qin, Jiufu; Siewers, Verena; Nielsen, Jens

    2016-01-01

    Sustainable production of oleochemicals requires establishment of cell factory platform strains. The yeast Saccharomyces cerevisiae is an attractive cell factory as new strains can be rapidly implemented into existing infrastructures such as bioethanol production plants. Here we show high-level production of free fatty acids (FFAs) in a yeast cell factory, and the production of alkanes and fatty alcohols from its descendants. The engineered strain produces up to 10.4 g l−1 of FFAs, which is the highest reported titre to date. Furthermore, through screening of specific pathway enzymes, endogenous alcohol dehydrogenases and aldehyde reductases, we reconstruct efficient pathways for conversion of fatty acids to alkanes (0.8 mg l−1) and fatty alcohols (1.5 g l−1), to our knowledge the highest titres reported in S. cerevisiae. This should facilitate the construction of yeast cell factories for production of fatty acids derived products and even aldehyde-derived chemicals of high value. PMID:27222209

  18. Big data mining powers fungal research: recent advances in fission yeast systems biology approaches.

    PubMed

    Wang, Zhe

    2017-06-01

    Biology research has entered into big data era. Systems biology approaches therefore become the powerful tools to obtain the whole landscape of how cell separate, grow, and resist the stresses. Fission yeast Schizosaccharomyces pombe is wonderful unicellular eukaryote model, especially studying its division and metabolism can facilitate to understanding the molecular mechanism of cancer and discovering anticancer agents. In this perspective, we discuss the recent advanced fission yeast systems biology tools, mainly focus on metabolomics profiling and metabolic modeling, protein-protein interactome and genetic interaction network, DNA sequencing and applications, and high-throughput phenotypic screening. We therefore hope this review can be useful for interested fungal researchers as well as bioformaticians.

  19. Disruption of the cytochrome c gene in xylose-utilizing yeast Pichia stipitis leads to higher ethanol production

    Treesearch

    Nian-Qing Shi; Brian Davis; Fred Sherman; Jose Cruz; Thomas W. Jeffries

    1999-01-01

    The xylose-utilizing yeast, Pichia stipitis, has a complex respiratory system that contains cytochrome and non-cytochrome alternative electron transport chains in its mitochondria. To gain primary insights into the alternative respiratory pathway, a cytochrome c gene (PsCYC1, Accession No. AF030426) was cloned from wild-type P. stipitis CBS 6054 by cross-hybridization...

  20. [Onychomycosis by yeast not common in diabetics of a health center].

    PubMed

    Imbert, J L; G Gomez, J V; Escudero, R B; Blasco, J L

    2016-10-01

    Mexican diabetic population frequently presents mycosis under foot hyperkeratosis; however, in another type of onychomycosis as the ones that is assumed Candida albicans is the causal agent, it is unknown the frequency, the prevalence and if another Candida species or other yeasts are found. Evaluate the frequency of yeasts causing onychomycosis in diabetic patients looked after in public institutions of health of the State of Hidalgo, Mexico, and its association with clinical epidemiological variables. An observational, descriptive and transversal study was made on 261 patients, from which one nail sample of each one was obtained, used to isolate and identify dermatophytes and yeasts; the results were statistically correlated with 24 epidemiological parameters. The clinical study was done through interrogation and by medical exploration in order to evaluate Tinea pedis and onychomycosis. Onychomycosis were caused by Candida guilliermondii, Candida parapsilosis, Candida glabrata, Candida krusei, Candida spp., Kodamaea ohmeri, Prototheca wickerhamii and unidentified yeasts. The prevalence for general onychomycosis, by dermatophytes, mixed onychomycosis and by yeasts were: 24.1, 19.5, 2.3 and 14.6%, respectively. Patients with significant probability to be diagnosed as having onychomycosis by yeasts are those wearing open shoes (2.59%); technicians and professionals (10.49%) and alcohol drinkers (3.72%). The fact that Candida albicans is not present in this study as causal agent of onychomycosis, and emerging and non-common yeasts were indeed isolated, creates new challenges. It is remarked the clinical criterion that when onychomycosis is suspected in diabetics, the diagnosis for culturing dermatophytes and yeasts should be included. Copyright © 2015 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Yeast as a system for modeling mitochondrial disease mechanisms and discovering therapies

    PubMed Central

    Lasserre, Jean-Paul; Dautant, Alain; Aiyar, Raeka S.; Kucharczyk, Roza; Glatigny, Annie; Tribouillard-Tanvier, Déborah; Rytka, Joanna; Blondel, Marc; Skoczen, Natalia; Reynier, Pascal; Pitayu, Laras; Rötig, Agnès; Delahodde, Agnès; Steinmetz, Lars M.; Dujardin, Geneviève; Procaccio, Vincent; di Rago, Jean-Paul

    2015-01-01

    ABSTRACT Mitochondrial diseases are severe and largely untreatable. Owing to the many essential processes carried out by mitochondria and the complex cellular systems that support these processes, these diseases are diverse, pleiotropic, and challenging to study. Much of our current understanding of mitochondrial function and dysfunction comes from studies in the baker's yeast Saccharomyces cerevisiae. Because of its good fermenting capacity, S. cerevisiae can survive mutations that inactivate oxidative phosphorylation, has the ability to tolerate the complete loss of mitochondrial DNA (a property referred to as ‘petite-positivity’), and is amenable to mitochondrial and nuclear genome manipulation. These attributes make it an excellent model system for studying and resolving the molecular basis of numerous mitochondrial diseases. Here, we review the invaluable insights this model organism has yielded about diseases caused by mitochondrial dysfunction, which ranges from primary defects in oxidative phosphorylation to metabolic disorders, as well as dysfunctions in maintaining the genome or in the dynamics of mitochondria. Owing to the high level of functional conservation between yeast and human mitochondrial genes, several yeast species have been instrumental in revealing the molecular mechanisms of pathogenic human mitochondrial gene mutations. Importantly, such insights have pointed to potential therapeutic targets, as have genetic and chemical screens using yeast. PMID:26035862

  2. PdCo/Pd-Hexacyanocobaltate Hybrid Nanoflowers: Cyanogel-Bridged One-Pot Synthesis and Their Enhanced Catalytic Performance

    NASA Astrophysics Data System (ADS)

    Liu, Zhen-Yuan; Fu, Geng-Tao; Zhang, Lu; Yang, Xiao-Yu; Liu, Zhen-Qi; Sun, Dong-Mei; Xu, Lin; Tang, Ya-Wen

    2016-08-01

    Elaborate architectural manipulation of nanohybrids with multi-components into controllable 3D hierarchical structures is of great significance for both fundamental scientific interest and realization of various functionalities, yet remains a great challenge because different materials with distinct physical/chemical properties could hardly be incorporated simultaneously into the synthesis process. Here, we develop a novel one-pot cyanogel-bridged synthetic approach for the generation of 3D flower-like metal/Prussian blue analogue nanohybrids, namely PdCo/Pd-hexacyanocobaltate for the first time. The judicious introduction of polyethylene glycol (PEG) and the formation of cyanogel are prerequisite for the successful fabrication of such fascinating hierarchical nanostructures. Due to the unique 3D hierarchical structure and the synergistic effect between hybrid components, the as-prepared hybrid nanoflowers exhibit a remarkable catalytic activity and durability toward the reduction of Rhodamine B (RhB) by NaBH4. We expect that the obtained hybrid nanoflowers may hold great promises in water remediation field and beyond. Furthermore, the facile synthetic strategy presented here for synthesizing functional hybrid materials can be extendable for the synthesis of various functional hybrid nanomaterials owing to its versatility and feasibility.

  3. PdCo/Pd-Hexacyanocobaltate Hybrid Nanoflowers: Cyanogel-Bridged One-Pot Synthesis and Their Enhanced Catalytic Performance.

    PubMed

    Liu, Zhen-Yuan; Fu, Geng-Tao; Zhang, Lu; Yang, Xiao-Yu; Liu, Zhen-Qi; Sun, Dong-Mei; Xu, Lin; Tang, Ya-Wen

    2016-08-30

    Elaborate architectural manipulation of nanohybrids with multi-components into controllable 3D hierarchical structures is of great significance for both fundamental scientific interest and realization of various functionalities, yet remains a great challenge because different materials with distinct physical/chemical properties could hardly be incorporated simultaneously into the synthesis process. Here, we develop a novel one-pot cyanogel-bridged synthetic approach for the generation of 3D flower-like metal/Prussian blue analogue nanohybrids, namely PdCo/Pd-hexacyanocobaltate for the first time. The judicious introduction of polyethylene glycol (PEG) and the formation of cyanogel are prerequisite for the successful fabrication of such fascinating hierarchical nanostructures. Due to the unique 3D hierarchical structure and the synergistic effect between hybrid components, the as-prepared hybrid nanoflowers exhibit a remarkable catalytic activity and durability toward the reduction of Rhodamine B (RhB) by NaBH4. We expect that the obtained hybrid nanoflowers may hold great promises in water remediation field and beyond. Furthermore, the facile synthetic strategy presented here for synthesizing functional hybrid materials can be extendable for the synthesis of various functional hybrid nanomaterials owing to its versatility and feasibility.

  4. PdCo/Pd-Hexacyanocobaltate Hybrid Nanoflowers: Cyanogel-Bridged One-Pot Synthesis and Their Enhanced Catalytic Performance

    PubMed Central

    Liu, Zhen-Yuan; Fu, Geng-Tao; Zhang, Lu; Yang, Xiao-Yu; Liu, Zhen-Qi; Sun, Dong-Mei; Xu, Lin; Tang, Ya-Wen

    2016-01-01

    Elaborate architectural manipulation of nanohybrids with multi-components into controllable 3D hierarchical structures is of great significance for both fundamental scientific interest and realization of various functionalities, yet remains a great challenge because different materials with distinct physical/chemical properties could hardly be incorporated simultaneously into the synthesis process. Here, we develop a novel one-pot cyanogel-bridged synthetic approach for the generation of 3D flower-like metal/Prussian blue analogue nanohybrids, namely PdCo/Pd-hexacyanocobaltate for the first time. The judicious introduction of polyethylene glycol (PEG) and the formation of cyanogel are prerequisite for the successful fabrication of such fascinating hierarchical nanostructures. Due to the unique 3D hierarchical structure and the synergistic effect between hybrid components, the as-prepared hybrid nanoflowers exhibit a remarkable catalytic activity and durability toward the reduction of Rhodamine B (RhB) by NaBH4. We expect that the obtained hybrid nanoflowers may hold great promises in water remediation field and beyond. Furthermore, the facile synthetic strategy presented here for synthesizing functional hybrid materials can be extendable for the synthesis of various functional hybrid nanomaterials owing to its versatility and feasibility. PMID:27573057

  5. One-step preparation of multiwall carbon nanotube/silicon hybrids for solar energy conversion

    NASA Astrophysics Data System (ADS)

    Lobiak, Egor V.; Bychanok, Dzmitry S.; Shlyakhova, Elena V.; Kuzhir, Polina P.; Maksimenko, Sergey A.; Bulusheva, Lyubov G.; Okotrub, Alexander V.

    2016-03-01

    The hybrid material consisting of a thin layer of multiwall carbon nanotubes (MWCNTs) on an n-doped silicon wafer was obtained in one step using an aerosol-assisted catalytic chemical vapor deposition. The MWCNTs were grown from a mixture of acetone and ethanol with ˜0.2 wt.% of iron polyoxomolybdate nanocluster of the keplerate-type structure. The samples produced at 800°C and 1050°C were tested as a solar energy converter. It was shown that photoresponse of the hybrid material significantly depends on the presence of structural defects in MWCNTs, being much higher in the case of more defective nanotubes. This is because defects lead to p-doping of nanotubes, whereas the p-n heterojunction between MWCNTs and silicon provides a high efficiency of the solar cell.

  6. Fluorescence In Situ Hybridization with Peptide Nucleic Acid Probes for Rapid Identification of Candida albicans Directly from Blood Culture Bottles

    PubMed Central

    Rigby, Susan; Procop, Gary W.; Haase, Gerhard; Wilson, Deborah; Hall, Geraldine; Kurtzman, Cletus; Oliveira, Kenneth; Von Oy, Sabina; Hyldig-Nielsen, Jens J.; Coull, James; Stender, Henrik

    2002-01-01

    A new fluorescence in situ hybridization (FISH) method that uses peptide nucleic acid (PNA) probes for identification of Candida albicans directly from positive-blood-culture bottles in which yeast was observed by Gram staining (herein referred to as yeast-positive blood culture bottles) is described. The test (the C. albicans PNA FISH method) is based on a fluorescein-labeled PNA probe that targets C. albicans 26S rRNA. The PNA probe is added to smears made directly from the contents of the blood culture bottle and hybridized for 90 min at 55°C. Unhybridized PNA probe is removed by washing of the mixture (30 min), and the smears are examined by fluorescence microscopy. The specificity of the method was confirmed with 23 reference strains representing phylogenetically related yeast species and 148 clinical isolates covering the clinically most significant yeast species, including C. albicans (n = 72), C. dubliniensis (n = 58), C. glabrata (n = 5), C. krusei (n = 2), C. parapsilosis (n = 4), and C. tropicalis (n = 3). The performance of the C. albicans PNA FISH method as a diagnostic test was evaluated with 33 routine and 25 simulated yeast-positive blood culture bottles and showed 100% sensitivity and 100% specificity. It is concluded that this 2.5-h method for the definitive identification of C. albicans directly from yeast-positive blood culture bottles provides important information for optimal antifungal therapy and patient management. PMID:12037084

  7. Screening of the five different wild, traditional and industrial Saccharomyces cerevisiae strains to overproduce bioethanol in the batch submerged fermentation.

    PubMed

    Shaghaghi-Moghaddam, Reza; Jafarizadeh-Malmiri, Hoda; Mehdikhani, Parviz; Jalalian, Sepide; Alijanianzadeh, Reza

    2017-12-28

    Efforts to produce bioethanol with higher productivity in a batch submerged fermentation were made by evaluating the bioethanol production of the five different strains of Saccharomyces cerevisiae, namely, NCYC 4109 (traditional bakery yeast), SFO6 (industrial yeast), TTCC 2956 (hybrid baking yeast) and two wild yeasts, PTCC 5052 and BY 4743. The bioethanol productivity and kinetic parameters for all five yeasts at constant fermentation conditions, during 72 h, were evaluated and monitored. The obtained results indicated that compared to the wild yeasts, both traditional bakery (NCYC 4109) and industrial (SFO6) yeasts had higher bioethanol productivity (0.9 g/L h). Significant (p<0.05) differences between biomass concentration of NCYC 4109 yeast and those of other yeasts 30 h after start of fermentation, and its high bioethanol concentration (59.19 g/L) and yield over consumed sugars (77.25%) were highlighted among all the studied yeasts. Minimum bioethanol productivity was obtained using yeasts PTCC 5052 (0.7 g/L h) and TTCC 2956 (0.86 g/L h). However, maximum yield over consumed sugar was obtained using the yeast TTCC 2956 (79.41%).

  8. Phosphorylation and cellular function of the human Rpa2 N-terminus in the budding yeast Saccharomyces cerevisiae.

    PubMed

    Ghospurkar, Padmaja L; Wilson, Timothy M; Liu, Shengqin; Herauf, Anna; Steffes, Jenna; Mueller, Erica N; Oakley, Gregory G; Haring, Stuart J

    2015-02-01

    Maintenance of genome integrity is critical for proper cell growth. This occurs through accurate DNA replication and repair of DNA lesions. A key factor involved in both DNA replication and the DNA damage response is the heterotrimeric single-stranded DNA (ssDNA) binding complex Replication Protein A (RPA). Although the RPA complex appears to be structurally conserved throughout eukaryotes, the primary amino acid sequence of each subunit can vary considerably. Examination of sequence differences along with the functional interchangeability of orthologous RPA subunits or regions could provide insight into important regions and their functions. This might also allow for study in simpler systems. We determined that substitution of yeast Replication Factor A (RFA) with human RPA does not support yeast cell viability. Exchange of a single yeast RFA subunit with the corresponding human RPA subunit does not function due to lack of inter-species subunit interactions. Substitution of yeast Rfa2 with domains/regions of human Rpa2 important for Rpa2 function (i.e., the N-terminus and the loop 3-4 region) supports viability in yeast cells, and hybrid proteins containing human Rpa2 N-terminal phospho-mutations result in similar DNA damage phenotypes to analogous yeast Rfa2 N-terminal phospho-mutants. Finally, the human Rpa2 N-terminus (NT) fused to yeast Rfa2 is phosphorylated in a manner similar to human Rpa2 in human cells, indicating that conserved kinases recognize the human domain in yeast. The implication is that budding yeast represents a potential model system for studying not only human Rpa2 N-terminal phosphorylation, but also phosphorylation of Rpa2 N-termini from other eukaryotic organisms. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Cross-species bacterial artificial chromosome (BAC) library screening via overgo-based hybridization and BAC-contig mapping of a yield enhancement quantitative trait locus (QTL) yld1.1 in the Malaysian wild rice Oryza rufipogon.

    PubMed

    Song, Beng-Kah; Nadarajah, Kalaivani; Romanov, Michael N; Ratnam, Wickneswari

    2005-01-01

    The construction of BAC-contig physical maps is an important step towards a partial or ultimate genome sequence analysis. Here, we describe our initial efforts to apply an overgo approach to screen a BAC library of the Malaysian wild rice species, Oryza rufipogon. Overgo design is based on repetitive element masking and sequence uniqueness, and uses short probes (approximately 40 bp), making this method highly efficient and specific. Pairs of 24-bp oligos that contain an 8-bp overlap were developed from the publicly available genomic sequences of the cultivated rice, O. sativa, to generate 20 overgo probes for a 1-Mb region that encompasses a yield enhancement QTL yld1.1 in O. rufipogon. The advantages of a high similarity in melting temperature, hybridization kinetics and specific activities of overgos further enabled a pooling strategy for library screening by filter hybridization. Two pools of ten overgos each were hybridized to high-density filters representing the O. rufipogon genomic BAC library. These screening tests succeeded in providing 69 PCR-verified positive hits from a total of 23,040 BAC clones of the entire O. rufipogon library. A minimal tilling path of clones was generated to contribute to a fully covered BAC-contig map of the targeted 1-Mb region. The developed protocol for overgo design based on O. sativa sequences as a comparative genomic framework, and the pooled overgo hybridization screening technique are suitable means for high-resolution physical mapping and the identification of BAC candidates for sequencing.

  10. MALDI-TOF MS as a tool to identify foodborne yeasts and yeast-like fungi.

    PubMed

    Quintilla, Raquel; Kolecka, Anna; Casaregola, Serge; Daniel, Heide M; Houbraken, Jos; Kostrzewa, Markus; Boekhout, Teun; Groenewald, Marizeth

    2018-02-02

    Since food spoilage by yeasts causes high economic losses, fast and accurate identifications of yeasts associated with food and food-related products are important for the food industry. In this study the efficiency of the matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify food related yeasts was evaluated. A CBS in-house MALDI-TOF MS database was created and later challenged with a blinded test set of 146 yeast strains obtained from food and food related products. Ninety eight percent of the strains were correctly identified with log score values>1.7. One strain, Mrakia frigida, gained a correct identification with a score value<1.7. Two strains could not be identified at first as they represented a mix of two different species. These mixes were Rhodotorula babjevae with Meyerozyma caribbica and Clavispora lusitaniae with Debaryomyces hansenii. After separation, all four species could be correctly identified with scores>1.7. Ambiguous identifications were observed due to two incorrect reference mass spectra's found in the commercial database BDAL v.4.0, namely Candida sake DSM 70763 which was re-identified as Candida oleophila, and Candida inconspicua DSM 70631 which was re-identified as Pichia membranifaciens. MALDI-TOF MS can distinguish between most of the species, but for some species complexes, such as the Kazachstania telluris and Mrakia frigida complexes, MALDI-TOF MS showed limited resolution and identification of sibling species was sometimes problematic. Despite this, we showed that the MALDI-TOF MS is applicable for routine identification and validation of foodborne yeasts, but a further update of the commercial reference databases is needed. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Vapor-fed bio-hybrid fuel cell.

    PubMed

    Benyamin, Marcus S; Jahnke, Justin P; Mackie, David M

    2017-01-01

    Concentration and purification of ethanol and other biofuels from fermentations are energy-intensive processes, with amplified costs at smaller scales. To circumvent the need for these processes, and to potentially reduce transportation costs as well, we have previously investigated bio-hybrid fuel cells (FCs), in which a fermentation and FC are closely coupled. However, long-term operation requires strictly preventing the fermentation and FC from harming each other. We introduce here the concept of the vapor-fed bio-hybrid FC as a means of continuously extracting power from ongoing fermentations at ambient conditions. By bubbling a carrier gas (N 2 ) through a yeast fermentation and then through a direct ethanol FC, we protect the FC anode from the catalyst poisons in the fermentation (which are non-volatile), and also protect the yeast from harmful FC products (notably acetic acid) and from build-up of ethanol. Since vapor-fed direct ethanol FCs at ambient conditions have never been systematically characterized (in contrast to vapor-fed direct methanol FCs), we first assess the effects on output power and conversion efficiency of ethanol concentration, vapor flow rate, and FC voltage. The results fit a continuous stirred-tank reactor model. Over a wide range of ethanol partial pressures (2-8 mmHg), power densities are comparable to those for liquid-fed direct ethanol FCs at the same temperature, with power densities >2 mW/cm 2 obtained. We then demonstrate the continuous operation of a vapor-fed bio-hybrid FC with fermentation for 5 months, with no indication of performance degradation due to poisoning (of either the FC or the fermentation). It is further shown that the system is stable, recovering quickly from disturbances or from interruptions in maintenance. The vapor-fed bio-hybrid FC enables extraction of power from dilute bio-ethanol streams without costly concentration and purification steps. The concept should be scalable to both large and small

  12. Interrogation of ethnomedicinal plants for synthetic lethality effects in combination with deficiency in the DNA repair endonuclease RAD1 using a yeast cell-based assay.

    PubMed

    Aung, Hsu Mon; Huangteerakul, Chananya; Panvongsa, Wittaya; Jensen, Amornrat N; Chairoungdua, Arthit; Sukrong, Suchada; Jensen, Laran T

    2018-09-15

    Plant materials used in this study were selected based on the ethnobotanical literature. Plants have either been utilized by Thai practitioners as alternative treatments for cancer or identified to exhibit anti-cancer properties. To screen ethnomedicinal plants using a yeast cell-based assay for synthetic lethal interactions with cells deleted for RAD1, the yeast homologue of human ERCC4 (XPF) MATERIALS AND METHODS: Ethanolic extracts from thirty-two species of medicinal plants utilized in Thai traditional medicine were screened for synthetic lethal/sick interactions using a yeast cell-based assay. Cell growth was compared between the parental strain and rad1∆ yeast following exposure to select for specific toxicity of plant extracts. Candidate extracts were further examined for the mode of action using genetic and biochemical approaches. Screening a library of ethanolic extracts from medicinal plants identified Bacopa monnieri and Colubrina asiatica as having synthetic lethal effects in the rad1∆ cells but not the parental strain. Synthetic lethal effects for B. monneiri extracts were more apparent and this plant was examined further. Genetic analysis indicates that pro-oxidant activities and defective excision repair pathways do not significantly contribute to enhanced sensitivity to B. monneiri extracts. Exposure to B. monneiri extracts resulted in nuclear fragmentation and elevated levels of ethidium bromide staining in rad1∆ yeast suggesting promotion of an apoptosis-like event. Growth inhibition also observed in the human Caco-2 cell line suggesting the effects of B. monnieri extracts on both yeast and human cells may be similar. B. monneiri extracts may have utility in treatment of colorectal cancers that exhibit deficiency in ERCC4 (XPF). Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Indigenous Georgian Wine-Associated Yeasts and Grape Cultivars to Edit the Wine Quality in a Precision Oenology Perspective

    PubMed Central

    Vigentini, Ileana; Maghradze, David; Petrozziello, Maurizio; Bonello, Federica; Mezzapelle, Vito; Valdetara, Federica; Failla, Osvaldo; Foschino, Roberto

    2016-01-01

    In Georgia, one of the most ancient vine-growing environment, the homemade production of wine is still very popular in every rural family and spontaneous fermentation of must, without addition of chemical preservatives, is the norm. The present work investigated the yeast biodiversity in five Georgian areas (Guria, Imereti, Kakheti, Kartli, Ratcha-Lechkhumi) sampling grapes and wines from 22 different native cultivars, in 26 vineyards and 19 family cellars. One hundred and eighty-two isolates were ascribed to 15 different species by PCR-ITS and RFLP, and partial sequencing of D1/D2 domain 26S rDNA gene. Metschnikowia pulcherrima (F’ = 0.56, I’ = 0.32), Hanseniaspora guilliermondii (F’ = 0.49, I’ = 0.27), and Cryptococcus flavescens (F’ = 0.31, I’ = 0.11) were the dominant yeasts found on grapes, whereas Saccharomyces cerevisiae showed the highest prevalence into wine samples. Seventy four isolates with fermentative potential were screened for oenological traits such as ethanol production, resistance to SO2, and acetic acid, glycerol and H2S production. Three yeast strains (Kluyveromyces marxianus UMY207, S. cerevisiae UMY255, Torulaspora delbrueckii UMY196) were selected and separately inoculated in vinifications experiments at a Georgian cellar. Musts were prepared from healthy grapes of local varieties, Goruli Mtsvane (white berry cultivar) and Saperavi (black berry cultivar). Physical (°Brix) and microbial analyses (plate counts) were performed to monitor the fermentative process. The isolation of indigenous S. cerevisiae yeasts beyond the inoculated strains indicated that a co-presence occurred during the vinification tests. Results from quantitative GC-FID analysis of volatile compounds revealed that the highest amount of fermentation flavors, such as 4-ethoxy-4-oxobutanoic acid (monoethyl succinate), 2-methylpropan-1-ol, ethyl 2-hydroxypropanoate, and 2-phenylethanol, were significantly more produced in fermentation conducted in Saperavi variety

  14. Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

    PubMed

    Palková, Zdena; Váchová, Libuše

    2016-09-01

    Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. L-arabinose fermenting yeast

    DOEpatents

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  16. One more hurdle to increasing mammography screening: pubescent, adolescent, and prior mammography screening experiences.

    PubMed

    Thomas, Eileen; Usher, LaToya

    2009-01-01

    Approximately $8.1 billion dollars is spent each year in the United States alone on the treatment of breast cancer. Survival rates are dependent on access to, and utilization of, early detection services. The primary reason for disparity in breast cancer mortality is the delay in time to diagnosis, resulting in poor prognosis. Despite ongoing research to understand barriers to mammography screening, recent studies report a decrease in mammography screening among all racial groups. A qualitative approach was used to elicit information from 36 White non- Hispanic, African-American, Hispanic, and Native American women without a history of breast cancer. Women were invited to share written or audiotape-recorded narratives about experiences pertaining to their breasts and their mammography screening experiences. Major categories identified were: teasing, family norms and values, media/societal influence, body image, and mammography screening experiences. The resulting effects of these experiences left these women with feelings of shame and "conflict" regarding their breasts. The major theme identified was breast conflict. Findings suggest that breast conflict may persist throughout the lifespan and can have a negative influence on a woman's decision to participate in mammography screening. The authors hypothesize that experiences that occur during adolescence pertaining to young girls' breasts can influence a women's body image, which in turn can later in life affect health-seeking behaviors related to mammography screening. These findings have implications for public health practice in planning for breast cancer screening, education, and interventions for women from diverse racial/ethnics groups.

  17. Nitrile Metabolizing Yeasts

    NASA Astrophysics Data System (ADS)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  18. A simple genetic incompatibility causes hybrid male sterility in mimulus.

    PubMed

    Sweigart, Andrea L; Fishman, Lila; Willis, John H

    2006-04-01

    Much evidence has shown that postzygotic reproductive isolation (hybrid inviability or sterility) evolves by the accumulation of interlocus incompatibilities between diverging populations. Although in theory only a single pair of incompatible loci is needed to isolate species, empirical work in Drosophila has revealed that hybrid fertility problems often are highly polygenic and complex. In this article we investigate the genetic basis of hybrid sterility between two closely related species of monkeyflower, Mimulus guttatus and M. nasutus. In striking contrast to Drosophila systems, we demonstrate that nearly complete hybrid male sterility in Mimulus results from a simple genetic incompatibility between a single pair of heterospecific loci. We have genetically mapped this sterility effect: the M. guttatus allele at the hybrid male sterility 1 (hms1) locus acts dominantly in combination with recessive M. nasutus alleles at the hybrid male sterility 2 (hms2) locus to cause nearly complete hybrid male sterility. In a preliminary screen to find additional small-effect male sterility factors, we identified one additional locus that also contributes to some of the variation in hybrid male fertility. Interestingly, hms1 and hms2 also cause a significant reduction in hybrid female fertility, suggesting that sex-specific hybrid defects might share a common genetic basis. This possibility is supported by our discovery that recombination is reduced dramatically in a cross involving a parent with the hms1-hms2 incompatibility.

  19. Genome dynamics and evolution in yeasts: A long-term yeast-bacteria competition experiment

    PubMed Central

    Katz, Michael; Knecht, Wolfgang; Compagno, Concetta; Piškur, Jure

    2018-01-01

    There is an enormous genetic diversity evident in modern yeasts, but our understanding of the ecological basis of such diversifications in nature remains at best fragmented so far. Here we report a long-term experiment mimicking a primordial competitive environment, in which yeast and bacteria co-exist and compete against each other. Eighteen yeasts covering a wide phylogenetic background spanning approximately 250 million years of evolutionary history were used to establish independent evolution lines for at most 130 passages. Our collection of hundreds of modified strains generated through such a rare two-species cross-kingdom competition experiment re-created the appearance of large-scale genomic rearrangements and altered phenotypes important in the diversification history of yeasts. At the same time, the methodology employed in this evolutionary study would also be a non-gene-technological method of reprogramming yeast genomes and then selecting yeast strains with desired traits. Cross-kingdom competition may therefore be a method of significant value to generate industrially useful yeast strains with new metabolic traits. PMID:29624585

  20. Yeast diversity on grapes in two German wine growing regions.

    PubMed

    Brysch-Herzberg, Michael; Seidel, Martin

    2015-12-02

    The yeast diversity on wine grapes in Germany, one of the most northern wine growing regions of the world, was investigated by means of a culture dependent approach. All yeast isolates were identified by sequence analysis of the D1/D2 domain of the 26S rDNA and the ITS region. Besides Hanseniaspora uvarum and Metschnikowia pulcherrima, which are well known to be abundant on grapes, Metschnikowia viticola, Rhodosporidium babjevae, and Curvibasidium pallidicorallinum, as well as two potentially new species related to Sporidiobolus pararoseus and Filobasidium floriforme, turned out to be typical members of the grape yeast community. We found M. viticola in about half of the grape samples in high abundance. Our data strongly suggest that M. viticola is one of the most important fermenting yeast species on grapes in the temperate climate of Germany. The frequent occurrence of Cu. pallidicorallinum and strains related to F. floriforme is a new finding. The current investigation provides information on the distribution of recently described yeast species, some of which are known from a very few strains up to now. Interestingly yeasts known for their role in the wine making process, such as Saccharomyces cerevisiae, Saccharomyces bayanus ssp. uvarum, Torulaspora delbrueckii, and Zygosaccharomyces bailii, were not found in the grape samples. Copyright © 2015. Published by Elsevier B.V.

  1. Screening Phosphorylation Site Mutations in Yeast Acetyl-CoA Carboxylase Using Malonyl-CoA Sensor to Improve Malonyl-CoA-Derived Product.

    PubMed

    Chen, Xiaoxu; Yang, Xiaoyu; Shen, Yu; Hou, Jin; Bao, Xiaoming

    2018-01-01

    Malonyl-coenzyme A (malonyl-CoA) is a critical precursor for the biosynthesis of a variety of biochemicals. It is synthesized by the catalysis of acetyl-CoA carboxylase (Acc1p), which was demonstrated to be deactivated by the phosphorylation of Snf1 protein kinase in yeast. In this study, we designed a synthetic malonyl-CoA biosensor and used it to screen phosphorylation site mutations of Acc1p in Saccharomyces cerevisiae . Thirteen phosphorylation sites were mutated, and a combination of three site mutations in Acc1p, S686A, S659A, and S1157A, was found to increase malonyl-CoA availability. ACC1 S686AS659AS1157A expression also improved the production of 3-hydroxypropionic acid, a malonyl-CoA-derived chemical, compared to both wild type and the previously reported ACC1 S659AS1157A mutation. This mutation will also be beneficial for other malonyl-CoA-derived products.

  2. Development of industrial brewing yeast with low acetaldehyde production and improved flavor stability.

    PubMed

    Wang, Jinjing; Shen, Nan; Yin, Hua; Liu, Chunfeng; Li, Yongxian; Li, Qi

    2013-02-01

    Higher acetaldehyde concentration in beer is one of the main concerns of current beer industry in China. Acetaldehyde is always synthesized during beer brewing by the metabolism of yeast. Here, using ethanol as the sole carbon source and 4-methylpyrazole as the selection marker, we constructed a new mutant strain with lower acetaldehyde production and improved ethanol tolerance via traditional mutagenesis strategy. European Brewery Convention tube fermentation tests comparing the fermentation broths of mutant strain and industrial brewing strain showed that the acetaldehyde concentration of mutant strain was 81.67 % lower, whereas its resistant staling value was 1.0-fold higher. Owing to the mutation, the alcohol dehydrogenase activity of the mutant strain decreased to about 30 % of the wild-type strain. In the meantime, the fermentation performance of the newly screened strain has little difference compared with the wild-type strain, and there are no safety problems regarding the industrial usage of the mutant strain. Therefore, we suggest that the newly screened strain could be directly applied to brewing industry.

  3. Screening Saccharomyces cerevisiae Distillery Strains in Industrial Media

    USDA-ARS?s Scientific Manuscript database

    Twenty-four distillery yeast strains were obtained from the ARS Culture Collection (NRRL) in Peoria, IL, and screened for ethanol production at 30 and 35°C using industrial media. The medium used in the tests consisted of corn mash prepared by combining coarse ground corn, water, and stillage from a...

  4. Beer and bread to brains and beyond: can yeast cells teach us about neurodegenerative disease?

    PubMed

    Gitler, Aaron D

    2008-01-01

    For millennia, humans have harnessed the astonishing power of yeast, producing such culinary masterpieces as bread, beer and wine. Therefore, in this new millennium, is it very farfetched to ask if we can also use yeast to unlock some of the modern day mysteries of human disease? Remarkably, these seemingly simple cells possess most of the same basic cellular machinery as the neurons in the brain. We and others have been using the baker's yeast, Saccharomyces cerevisiae, as a model system to study the mechanisms of devastating neurodegenerative diseases such as Parkinson's, Huntington's, Alzheimer's and amyotrophic lateral sclerosis. While very different in their pathophysiology, they are collectively referred to as protein-misfolding disorders because of the presence of misfolded and aggregated forms of various proteins in the brains of affected individuals. Using yeast genetics and the latest high-throughput screening technologies, we have identified some of the potential causes underpinning these disorders and discovered conserved genes that have proven effective in preventing neuron loss in animal models. Thus, these genes represent new potential drug targets. In this review, I highlight recent work investigating mechanisms of cellular toxicity in a yeast Parkinson's disease model and discuss how similar approaches are being applied to additional neurodegenerative diseases.

  5. Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast.

    PubMed

    Ferdouse, Jannatul; Yamamoto, Yuki; Taguchi, Seiga; Yoshizaki, Yumiko; Takamine, Kazunori; Kitagaki, Hiroshi

    2018-01-01

    In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae . During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae , and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA) cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast.

  6. Brewer's/baker's yeast (Saccharomyces cerevisiae) and preventive medicine: part I.

    PubMed

    Moyad, Mark A

    2007-12-01

    Yeast is the term generally applied to a unicellular fungus, and there are hundreds of species now identified. One of the most notable and well-known species of yeast in health and wellness is known as Saccharomyces cerevisiae, which is also known by its more common names, brewer's yeast or baker's yeast. It is usually grown on hops or another substrate similar to the plant utilized in the beer-making industry, after which it is harvested and killed. The final product is generally half composed of protein, as well as a large amount of B vitamins and minerals, and depending on the technology, a diverse number of other healthy compounds. Typically, brewer's yeast is used as a protein supplement, energy booster, immune enhancer, or other vehicle where other compounds can be inserted to create a commercialized health product. A more extensive review of the preventive medical aspects of yeast will be covered in Part 2 of this article to be published in a future issue of Urologic Nursing. Yeast-based technology is also being used as a molecular mechanistic model of caloric restriction with the goal of improving the human life span. The current and potential impact of yeast-based technology in medicine is encouraging.

  7. Glycosylceramide modifies the flavor and metabolic characteristics of sake yeast

    PubMed Central

    Taguchi, Seiga; Yoshizaki, Yumiko; Takamine, Kazunori

    2018-01-01

    In the manufacture of sake, Japanese traditional rice wine, sake yeast is fermented with koji, which is steamed rice fermented with the non-pathogenic fungus Aspergillus oryzae. During fermentation, sake yeast requires lipids, such as unsaturated fatty acids and sterols, in addition to substances provided by koji enzymes for fermentation. However, the role of sphingolipids on the brewing characteristics of sake yeast has not been studied. In this study, we revealed that glycosylceramide, one of the sphingolipids abundant in koji, affects yeast fermentation. The addition of soy, A. oryzae, and Grifola frondosa glycosylceramide conferred a similar effect on the flavor profiles of sake yeast. In particular, the addition of A. oryzae and G. frondosa glycosylceramide were very similar in terms of the decreases in ethyl caprylate and ethyl 9-decenoate. The addition of soy glycosylceramide induced metabolic changes to sake yeast such as a decrease in glucose, increases in ethanol and glycerol and changes in several amino acids and organic acids concentrations. Tricarboxylic acid (TCA) cycle, pyruvate metabolism, starch and sucrose metabolism, and glycerolipid metabolism were overrepresented in the cultures incubated with sake yeast and soy glycosylceramide. This is the first study of the effect of glycosylceramide on the flavor and metabolic profile of sake yeast. PMID:29761062

  8. Dielectric modelling of cell division for budding and fission yeast

    NASA Astrophysics Data System (ADS)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  9. Yeasts as important agents of onychomycosis: in vitro activity of propolis against yeasts isolated from patients with nail infection.

    PubMed

    Khosravi, Ali Reza; Shokri, Hojjatollah; Nikaein, Donya; Mansouri, Parvin; Erfanmanesh, Ahmad; Chalangari, Reza; Katalin, Martis

    2013-01-01

    The purposes of this study were to determine the frequency of the yeast species obtained from patients with clinical features of onychomycosis and the in vitro antifungal susceptibility of the yeast species to propolis. A prospective study was carried out at the Mycology Research Center in Iran from 2010 to 2011. Clinical diagnosis was performed by direct microscopic examination and culture. Different yeast species were identified by morphological and biochemical tests. An antifungal susceptibility test to fluconazole (FLU) and propolis by the broth microdilution method was performed on each isolate. One hundred and twenty-eight fungal isolates were obtained. The most prevalent fungi were yeasts (81, 63.2%), dermatophytes (36, 28.1%), and nondermatophyte fungi (11, 8.6%). Fingernails were more affected than toenails (65.4% vs. 19.8%, respectively). The most frequently found species was Candida albicans (38.5%), followed by Candida spp. (23.1%), C. tropicalis (10.8%), C. kefyr (6.2%), C. krusei (3.1%), Malassezia globosa (4.6%), M. slooffiae (4.6%), and M. pachydermatis (1.5%). Of all yeast isolates (65), seven showed resistance to FLU. The average MIC of propolis for FLU-susceptible isolates was 5.8 μg/mL, whereas this value was 12.25 μg/mL for FLU-resistant isolates. Our results proved that the propolis inhibits the growth of pathogenic yeasts and confirmed the efficiency of propolis as an anti-Candida and anti-Malassezia agent.

  10. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

    PubMed

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  11. Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

    PubMed Central

    Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

    2016-01-01

    Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

  12. High-temperature superconductor coating for coupling impedance reduction in the FCC-hh beam screen

    NASA Astrophysics Data System (ADS)

    Krkotić, Patrick; Niedermayer, Uwe; Boine-Frankenheim, Oliver

    2018-07-01

    The international Future Circular Collider study develops a conceptual design for a post Large Hadron Collider particle accelerator using 16 T superconducting dipoles for achieving p-p center-of-mass collision energies up to 100 TeV. One concern for this project is the beam coupling impedance especially at injection energy. A copper coated beam screen as in the LHC is planned, but preliminary studies indicate that copper at the high operating temperature of 50 K might not provide a sufficiently low impedance for a stable beam. In order to reduce the coupling impedance, we investigate high-temperature superconductors as a possible coating material in combination with copper as a hybrid system. The effect of different coating combinations are estimated through numerical calculations to identify the best hybrid beam screen coating system.

  13. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  14. Genetic Analysis of Haploids from Industrial Strains of Baker's Yeast

    PubMed Central

    Oda, Yuji; Ouchi, Kozo

    1989-01-01

    Strains of baker's yeast conventionally used by the baking industry in Japan were tested for the ability to sporulate and produce viable haploid spores. Three isolates which possessed the properties of baker's yeasts were obtained from single spores. Each strain was a haploid, and one of these strains, YOY34, was characterized. YOY34 fermented maltose and sucrose, but did not utilize galactose, unlike its parental strain. Genetic analysis showed that YOY34 carried two MAL genes, one functional and one cryptic; two SUC genes; and one defective gal gene. The genotype of YOY34 was identified as MATα MAL1 MAL3g SUC2 SUC4 gall. The MAL1 gene from this haploid was constitutively expressed, was dominant over other wild-type MAL tester genes, and gave a weak sucrose fermentation. YOY34 was suitable for both bakery products, like conventional baker's yeasts, and for genetic analysis, like laboratory strains. PMID:16347967

  15. Association of Constitutive Hyperphosphorylation of Hsf1p with a Defective Ethanol Stress Response in Saccharomyces cerevisiae Sake Yeast Strains

    PubMed Central

    Noguchi, Chiemi; Watanabe, Daisuke; Zhou, Yan; Akao, Takeshi

    2012-01-01

    Modern sake yeast strains, which produce high concentrations of ethanol, are unexpectedly sensitive to environmental stress during sake brewing. To reveal the underlying mechanism, we investigated a well-characterized yeast stress response mediated by a heat shock element (HSE) and heat shock transcription factor Hsf1p in Saccharomyces cerevisiae sake yeast. The HSE-lacZ activity of sake yeast during sake fermentation and under acute ethanol stress was severely impaired compared to that of laboratory yeast. Moreover, the Hsf1p of modern sake yeast was highly and constitutively hyperphosphorylated, irrespective of the extracellular stress. Since HSF1 allele replacement did not significantly affect the HSE-mediated ethanol stress response or Hsf1p phosphorylation patterns in either sake or laboratory yeast, the regulatory machinery of Hsf1p is presumed to function differently between these types of yeast. To identify phosphatases whose loss affected the control of Hsf1p, we screened a series of phosphatase gene deletion mutants in a laboratory strain background. Among the 29 mutants, a Δppt1 mutant exhibited constitutive hyperphosphorylation of Hsf1p, similarly to the modern sake yeast strains, which lack the entire PPT1 gene locus. We confirmed that the expression of laboratory yeast-derived functional PPT1 recovered the HSE-mediated stress response of sake yeast. In addition, deletion of PPT1 in laboratory yeast resulted in enhanced fermentation ability. Taken together, these data demonstrate that hyperphosphorylation of Hsf1p caused by loss of the PPT1 gene at least partly accounts for the defective stress response and high ethanol productivity of modern sake yeast strains. PMID:22057870

  16. Association of constitutive hyperphosphorylation of Hsf1p with a defective ethanol stress response in Saccharomyces cerevisiae sake yeast strains.

    PubMed

    Noguchi, Chiemi; Watanabe, Daisuke; Zhou, Yan; Akao, Takeshi; Shimoi, Hitoshi

    2012-01-01

    Modern sake yeast strains, which produce high concentrations of ethanol, are unexpectedly sensitive to environmental stress during sake brewing. To reveal the underlying mechanism, we investigated a well-characterized yeast stress response mediated by a heat shock element (HSE) and heat shock transcription factor Hsf1p in Saccharomyces cerevisiae sake yeast. The HSE-lacZ activity of sake yeast during sake fermentation and under acute ethanol stress was severely impaired compared to that of laboratory yeast. Moreover, the Hsf1p of modern sake yeast was highly and constitutively hyperphosphorylated, irrespective of the extracellular stress. Since HSF1 allele replacement did not significantly affect the HSE-mediated ethanol stress response or Hsf1p phosphorylation patterns in either sake or laboratory yeast, the regulatory machinery of Hsf1p is presumed to function differently between these types of yeast. To identify phosphatases whose loss affected the control of Hsf1p, we screened a series of phosphatase gene deletion mutants in a laboratory strain background. Among the 29 mutants, a Δppt1 mutant exhibited constitutive hyperphosphorylation of Hsf1p, similarly to the modern sake yeast strains, which lack the entire PPT1 gene locus. We confirmed that the expression of laboratory yeast-derived functional PPT1 recovered the HSE-mediated stress response of sake yeast. In addition, deletion of PPT1 in laboratory yeast resulted in enhanced fermentation ability. Taken together, these data demonstrate that hyperphosphorylation of Hsf1p caused by loss of the PPT1 gene at least partly accounts for the defective stress response and high ethanol productivity of modern sake yeast strains.

  17. Nuclear congression and membrane fusion: two distinct events in the yeast karyogamy pathway

    PubMed Central

    1994-01-01

    Karyogamy is the process where haploid nuclei fuse to form a diploid nucleus during yeast mating. We devised a novel genetic screen that identified five new karyogamy (KAR) genes and three new cell fusion (FUS) genes. The kar mutants fell into two classes that represent distinct events in the yeast karyogamy pathway. Class I mutations blocked congression of the nuclei due to cytoplasmic microtubule defects. In Class II mutants, nuclear congression proceeded and the membranes of apposed nuclei were closely aligned but unfused. In vitro, Class II mutant membranes were defective in a homotypic ER/nuclear membrane fusion assay. We propose that Class II mutants define components of a novel membrane fusion complex which functions during vegetative growth and is recruited for karyogamy. PMID:8051211

  18. Klebsiella pneumoniae type 3 fimbriae agglutinate yeast in a mannose-resistant manner.

    PubMed

    Stahlhut, Steen G; Struve, Carsten; Krogfelt, Karen A

    2012-03-01

    The ability of bacterial pathogens to express different fimbrial adhesins plays a significant role in virulence. Thus, specific detection of fimbrial expression is an important task in virulence characterization and epidemiological studies. Most clinical Klebsiella pneumoniae isolates express type 1 and type 3 fimbriae, which are characterized by mediation of mannose-sensitive agglutination of yeast cells and agglutination of tannic acid-treated ox red blood cells (RBCs), respectively. It has been observed that K. pneumoniae isolates agglutinate yeast cells and commercially available sheep RBCs in a mannose-resistant manner. Thus, this study was initiated to identify the adhesin involved. Screening of a mutant library surprisingly revealed that the mannose-resistant agglutination of yeast and sheep RBCs was mediated by type 3 fimbriae. Specific detection of type 1 fimbriae expression in K. pneumoniae was feasible only by the use of guinea pig RBCs. This was further verified by the use of isogenic fimbriae mutants and by cloning and expressing K. pneumoniae fimbrial gene clusters in Escherichia coli. Yeast agglutination assays are commonly used to detect type 1 fimbriae expression but should not be used for bacterial species able to express type 3 fimbriae. For these species, the use of guinea pig blood for specific type 1 fimbriae detection is essential. The use of commercially available sheep RBCs or yeast is an easy alternative to traditional methods to detect type 3 fimbriae expression. Easy and specific detection of expression of type 1 and type 3 fimbriae is essential in the continuous characterization of these important adhesive virulence factors present in members of the Enterobacteriaceae.

  19. Vaginal yeast infection

    MedlinePlus

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

  20. Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.

    PubMed

    Niki, Hironori

    2014-03-01

    The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.

  1. [The yeast biofilm in human medicine].

    PubMed

    Růzicka, Filip; Holá, Veronika; Votava, Miroslav

    2007-08-01

    In recent years, the role of Candida yeasts as causative agents of nosocomial infections has increased. One of the important virulence factors contributing to the development of such infections is biofilm production. This virulence factor enables yeast to colonize both native surfaces and artificial implants. The most common sources of infection are patients themselves, in particular the gastrointestinal tract and skin. The vectors of exogenous yeast infections are predominantly the hands of the health personnel and contaminated medical instruments. The adhesion of yeasts to the implant surfaces is determined both by implant surface and yeast characteristics. This is followed by proliferation and production of microcolonies and extracellular matrix. The final biofilm structure is also influenced by the production of hyphae and pseudohyphae. The entire process of biofilm production is controlled by numerous regulatory systems, with the key role being played by the quorum sensing system. Like the adhered bacterial cultures, candidas growing in the form of a biofilm are highly resistant to antimicrobial therapy. Resistance of yeast biofilms to antifungals is a complex process with multiple contributing factors. These are especially increased gene expression (e.g. genes encoding the so called multidrug efflux pumps), limited penetration of substances through the extracellular matrix, inhibited cell growth and altered microenvironment in deeper biofilm layers. The concentrations of antifungals able to effectively affect the biofilm cells exceed, by several orders of magnitude, the values of conventionally determined MICs. High biofilm resistance results in ineffective antifungal therapy of biofilm infections. Therefore, if possible, the colonized implant should be removed. Conservative therapy should involve antifungals with a proven effect on the biofilm (e.g. caspofungin). The most effective measure in fighting biofilm infections is prevention, especially adhering to

  2. Genetic analysis of hybridization and introgression between wild mongoose and brown lemurs.

    PubMed

    Pastorini, Jennifer; Zaramody, Alphonse; Curtis, Deborah J; Nievergelt, Caroline M; Mundy, Nicholas I

    2009-02-05

    Hybrid zones generally represent areas of secondary contact after speciation. The nature of the interaction between genes of individuals in a hybrid zone is of interest in the study of evolutionary processes. In this study, data from nuclear microsatellites and mitochondrial DNA sequences were used to genetically characterize hybridization between wild mongoose lemurs (Eulemur mongoz) and brown lemurs (E. fulvus) at Anjamena in west Madagascar. Two segments of mtDNA have been sequenced and 12 microsatellite loci screened in 162 brown lemurs and mongoose lemurs. Among the mongoose lemur population at Anjamena, we identified two F1 hybrids (one also having the mtDNA haplotype of E. fulvus) and six other individuals with putative introgressed alleles in their genotype. Principal component analysis groups both hybrids as intermediate between E. mongoz and E. fulvus and admixture analyses revealed an admixed genotype for both animals. Paternity testing proved one F1 hybrid to be fertile. Of the eight brown lemurs genotyped, all have either putative introgressed microsatellite alleles and/or the mtDNA haplotype of E. mongoz. Introgression is bidirectional for the two species, with an indication that it is more frequent in brown lemurs than in mongoose lemurs. We conclude that this hybridization occurs because mongoose lemurs have expanded their range relatively recently. Introgressive hybridization may play an important role in the unique lemur radiation, as has already been shown in other rapidly evolving animals.

  3. Yeast Biomass Production in Brewery's Spent Grains Hemicellulosic Hydrolyzate

    NASA Astrophysics Data System (ADS)

    Duarte, Luís C.; Carvalheiro, Florbela; Lopes, Sónia; Neves, Ines; Gírio, Francisco M.

    Yeast single-cell protein and yeast extract, in particular, are two products which have many feed, food, pharmaceutical, and biotechnological applications. However, many of these applications are limited by their market price. Specifically, the yeast extract requirements for culture media are one of the major technical hurdles to be overcome for the development of low-cost fermentation routes for several top value chemicals in a biorefinery framework. A potential biotechnical solution is the production of yeast biomass from the hemicellulosic fraction stream. The growth of three pentose-assimilating yeast cell factories, Debaryomyces hansenii, Kluyveromyces marxianus, and Pichia stipitis was compared using non-detoxified brewery's spent grains hemicellulosic hydrolyzate supplemented with mineral nutrients. The yeasts exhibited different specific growth rates, biomass productivities, and yields being D. hansenii as the yeast species that presented the best performance, assimilating all sugars and noteworthy consuming most of the hydrolyzate inhibitors. Under optimized conditions, D. hansenii displayed a maximum specific growth rate, biomass yield, and productivity of 0.34 h-1, 0.61 g g-1, and 0.56 g 1-1 h-1, respectively. The nutritional profile of D. hansenii was thoroughly evaluated, and it compares favorably to others reported in literature. It contains considerable amounts of some essential amino acids and a high ratio of unsaturated over saturated fatty acids.

  4. Methods and materials for the production of L-lactic acid in yeast

    DOEpatents

    Hause, Ben [Jordan, MN; Rajgarhia, Vineet [Minnetonka, MN; Suominen, Pirkko [Maple Grove, MN

    2009-05-19

    Recombinant yeast are provided having, in one aspect, multiple exogenous LDH genes integrated into the genome, while leaving native PDC genes intact. In a second aspect, recombinant yeast are provided having an exogenous LDH gene integrated into its genome at the locus of a native PDC gene, with deletion of the native PDC gene. The recombinant yeast are useful in fermentation process for producing lactic acid.

  5. Yeast synthetic biology for the production of recombinant therapeutic proteins.

    PubMed

    Kim, Hyunah; Yoo, Su Jin; Kang, Hyun Ah

    2015-02-01

    The production of recombinant therapeutic proteins is one of the fast-growing areas of molecular medicine and currently plays an important role in treatment of several diseases. Yeasts are unicellular eukaryotic microbial host cells that offer unique advantages in producing biopharmaceutical proteins. Yeasts are capable of robust growth on simple media, readily accommodate genetic modifications, and incorporate typical eukaryotic post-translational modifications. Saccharomyces cerevisiae is a traditional baker's yeast that has been used as a major host for the production of biopharmaceuticals; however, several nonconventional yeast species including Hansenula polymorpha, Pichia pastoris, and Yarrowia lipolytica have gained increasing attention as alternative hosts for the industrial production of recombinant proteins. In this review, we address the established and emerging genetic tools and host strains suitable for recombinant protein production in various yeast expression systems, particularly focusing on current efforts toward synthetic biology approaches in developing yeast cell factories for the production of therapeutic recombinant proteins. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.

  6. Breeding Strategy To Generate Robust Yeast Starter Cultures for Cocoa Pulp Fermentations.

    PubMed

    Meersman, Esther; Steensels, Jan; Paulus, Tinneke; Struyf, Nore; Saels, Veerle; Mathawan, Melissa; Koffi, Jean; Vrancken, Gino; Verstrepen, Kevin J

    2015-09-01

    Cocoa pulp fermentation is a spontaneous process during which the natural microbiota present at cocoa farms is allowed to ferment the pulp surrounding cocoa beans. Because such spontaneous fermentations are inconsistent and contribute to product variability, there is growing interest in a microbial starter culture that could be used to inoculate cocoa pulp fermentations. Previous studies have revealed that many different fungi are recovered from different batches of spontaneous cocoa pulp fermentations, whereas the variation in the prokaryotic microbiome is much more limited. In this study, therefore, we aimed to develop a suitable yeast starter culture that is able to outcompete wild contaminants and consistently produce high-quality chocolate. Starting from specifically selected Saccharomyces cerevisiae strains, we developed robust hybrids with characteristics that allow them to efficiently ferment cocoa pulp, including improved temperature tolerance and fermentation capacity. We conducted several laboratory and field trials to show that these new hybrids often outperform their parental strains and are able to dominate spontaneous pilot scale fermentations, which results in much more consistent microbial profiles. Moreover, analysis of the resulting chocolate showed that some of the cocoa batches that were fermented with specific starter cultures yielded superior chocolate. Taken together, these results describe the development of robust yeast starter cultures for cocoa pulp fermentations that can contribute to improving the consistency and quality of commercial chocolate production. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Yeast cell surface display for lipase whole cell catalyst and its applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yun; Zhang, Rui; Lian, Zhongshuai

    The cell surface display technique allows for the expression of target proteins or peptides on the microbial cell surface by fusing an appropriate protein as an anchoring motif. Yeast display systems, such as Pichia pastoris, Yarowia lipolytica and Saccharomyces cerevisiae, are ideal, alternative and extensive display systems with the advantage of simple genetic manipulation and post-translational modification of expressed heterologous proteins. Engineered yeasts show high performance characteristics and variant utilizations. Herein, we comprehensively summarize the variant factors affecting lipase whole cell catalyst activity and display efficiency, including the structure and size of target proteins, screening anchor proteins, type and chainmore » length of linkers, and the appropriate matching rules among the above-mentioned display units. Furthermore, we also address novel approaches to enhance stability and activity of recombinant lipases, such as VHb gene co-expression, multi-enzyme co-display technique, and the micro-environmental interference and self-assembly techniques. Finally, we represent the variety of applications of whole cell surface displayed lipases on yeast cells in non-aqueous phases, including synthesis of esters, PUFA enrichment, resolution of chiral drugs, organic synthesis and biofuels. We demonstrate that the lipase surface display technique is a powerful tool for functionalizing yeasts to serve as whole cell catalysts, and increasing interest is providing an impetus for broad application of this technique.« less

  8. The CCR4-NOT Complex Is Implicated in the Viability of Aneuploid Yeasts

    PubMed Central

    Tange, Yoshie; Kurabayashi, Atsushi; Goto, Bunshiro; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Hayles, Jacqueline; Chikashige, Yuji; Tsutumi, Chihiro; Hiraoka, Yasushi; Yamao, Fumiaki; Nurse, Paul; Niwa, Osami

    2012-01-01

    To identify the genes required to sustain aneuploid viability, we screened a deletion library of non-essential genes in the fission yeast Schizosaccharomyces pombe, in which most types of aneuploidy are eventually lethal to the cell. Aneuploids remain viable for a period of time and can form colonies by reducing the extent of the aneuploidy. We hypothesized that a reduction in colony formation efficiency could be used to screen for gene deletions that compromise aneuploid viability. Deletion mutants were used to measure the effects on the viability of spores derived from triploid meiosis and from a chromosome instability mutant. We found that the CCR4-NOT complex, an evolutionarily conserved general regulator of mRNA turnover, and other related factors, including poly(A)-specific nuclease for mRNA decay, are involved in aneuploid viability. Defective mutations in CCR4-NOT complex components in the distantly related yeast Saccharomyces cerevisiae also affected the viability of spores produced from triploid cells, suggesting that this complex has a conserved role in aneuploids. In addition, our findings suggest that the genes required for homologous recombination repair are important for aneuploid viability. PMID:22737087

  9. Probiotic potentials of yeasts isolated from some cereal-based Nigerian traditional fermented food products.

    PubMed

    Ogunremi, O R; Sanni, A I; Agrawal, R

    2015-09-01

    To determine the starter culture and multifunctional potentials of yeast strains from some cereal-based Nigerian traditional fermented food products. Yeast isolates were screened for enzyme production and identified by sequencing the D1/D2 region of 26S rDNA. Pichia kluyveri LKC17, Issatchenkia orientalis OSL11, Pichia kudriavzevii OG32, Pichia kudriavzevii ROM11 and Candida tropicalis BOM21 exhibited the highest protease, lipase and phytase activity. They were selected and further evaluated for gastrointestinal survival and adherence ability. Although strain-specific, they retained viability at 37°C and showed survival at pH 2·0., I. orientalis OSL11 showed the highest survival at 2% bile salts concentration and P. kudriavzevii ROM11 showed the least survival. The yeast strains showed strong autoaggregation ability (81·24-91·85%) and hydrophobicity to n-hexadecane (33·61-42·30%). The highest co-aggregation ability was detected for P. kudriavzevii OG32 and Escherichia coli (71·57%). All the yeast strains removed cholesterol in the range of 49·03-74·05% over 48 h and scavenged for free radicals in methanol reaction system. In this study, we isolated new yeast strains with multifunctional potentials that can be used as functional starter cultures to produce cereal-based probiotic products. The development of probiotic yeast strains as starter culture to improve the quality attributes and confer functional value on cereal-based traditional fermented foods is beneficial. © 2015 The Society for Applied Microbiology.

  10. Yeast viability and concentration analysis using lens-free computational microscopy and machine learning

    NASA Astrophysics Data System (ADS)

    Feizi, Alborz; Zhang, Yibo; Greenbaum, Alon; Guziak, Alex; Luong, Michelle; Chan, Raymond Yan Lok; Berg, Brandon; Ozkan, Haydar; Luo, Wei; Wu, Michael; Wu, Yichen; Ozcan, Aydogan

    2017-03-01

    Research laboratories and the industry rely on yeast viability and concentration measurements to adjust fermentation parameters such as pH, temperature, and pressure. Beer-brewing processes as well as biofuel production can especially utilize a cost-effective and portable way of obtaining data on cell viability and concentration. However, current methods of analysis are relatively costly and tedious. Here, we demonstrate a rapid, portable, and cost-effective platform for imaging and measuring viability and concentration of yeast cells. Our platform features a lens-free microscope that weighs 70 g and has dimensions of 12 × 4 × 4 cm. A partially-coherent illumination source (a light-emitting-diode), a band-pass optical filter, and a multimode optical fiber are used to illuminate the sample. The yeast sample is directly placed on a complementary metal-oxide semiconductor (CMOS) image sensor chip, which captures an in-line hologram of the sample over a large field-of-view of >20 mm2. The hologram is transferred to a touch-screen interface, where a trained Support Vector Machine model classifies yeast cells stained with methylene blue as live or dead and measures cell viability as well as concentration. We tested the accuracy of our platform against manual counting of live and dead cells using fluorescent exclusion staining and a bench-top fluorescence microscope. Our regression analysis showed no significant difference between the two methods within a concentration range of 1.4 × 105 to 1.4 × 106 cells/mL. This compact and cost-effective yeast analysis platform will enable automatic quantification of yeast viability and concentration in field settings and resource-limited environments.

  11. Yeast species diversity in apple juice for cider production evidenced by culture-based method.

    PubMed

    Lorenzini, Marilinda; Simonato, Barbara; Zapparoli, Giacomo

    2018-05-07

    Identification of yeasts isolated from apple juices of two cider houses (one located in a plain area and one in an alpine area) was carried out by culture-based method. Wallerstein Laboratory Nutrient Agar was used as medium for isolation and preliminary yeasts identification. A total of 20 species of yeasts belonging to ten different genera were identified using both BLAST algorithm for pairwise sequence comparison and phylogenetic approaches. A wide variety of non-Saccharomyces species was found. Interestingly, Candida railenensis, Candida cylindracea, Hanseniaspora meyeri, Hanseniaspora pseudoguilliermondii, and Metschnikowia sinensis were recovered for the first time in the yeast community of an apple environment. Phylogenetic analysis revealed a better resolution in identifying Metschnikowia and Moesziomyces isolates than comparative analysis using the GenBank or YeastIP gene databases. This study provides important data on yeast microbiota of apple juice and evidenced differences between two geographical cider production areas in terms of species composition.

  12. The Protein Interaction Network of Bacteriophage Lambda with Its Host, Escherichia coli

    PubMed Central

    Blasche, Sonja; Wuchty, Stefan; Rajagopala, Seesandra V.

    2013-01-01

    Although most of the 73 open reading frames (ORFs) in bacteriophage λ have been investigated intensively, the function of many genes in host-phage interactions remains poorly understood. Using yeast two-hybrid screens of all lambda ORFs for interactions with its host Escherichia coli, we determined a raw data set of 631 host-phage interactions resulting in a set of 62 high-confidence interactions after multiple rounds of retesting. These links suggest novel regulatory interactions between the E. coli transcriptional network and lambda proteins. Targeted host proteins and genes required for lambda infection are enriched among highly connected proteins, suggesting that bacteriophages resemble interaction patterns of human viruses. Lambda tail proteins interact with both bacterial fimbrial proteins and E. coli proteins homologous to other phage proteins. Lambda appears to dramatically differ from other phages, such as T7, because of its unusually large number of modified and processed proteins, which reduces the number of host-virus interactions detectable by yeast two-hybrid screens. PMID:24049175

  13. Marine yeast isolation and industrial application.

    PubMed

    Zaky, Abdelrahman Saleh; Tucker, Gregory A; Daw, Zakaria Yehia; Du, Chenyu

    2014-09-01

    Over the last century, terrestrial yeasts have been widely used in various industries, such as baking, brewing, wine, bioethanol and pharmaceutical protein production. However, only little attention has been given to marine yeasts. Recent research showed that marine yeasts have several unique and promising features over the terrestrial yeasts, for example higher osmosis tolerance, higher special chemical productivity and production of industrial enzymes. These indicate that marine yeasts have great potential to be applied in various industries. This review gathers the most recent techniques used for marine yeast isolation as well as the latest applications of marine yeast in bioethanol, pharmaceutical and enzyme production fields. © 2014 The Authors FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  14. Discovery of Natural Products as Novel and Potent FXR Antagonists by Virtual Screening

    NASA Astrophysics Data System (ADS)

    Diao, Yanyan; Jiang, Jing; Zhang, Shoude; Li, Shiliang; Shan, Lei; Huang, Jin; Zhang, Weidong; Li, Honglin

    2018-04-01

    Farnesoid X receptor (FXR) is a member of nuclear receptor family involved in multiple physiological processes through regulating specific target genes. The critical role of FXR as a transcriptional regulator makes it a promising target for diverse diseases, especially those related to metabolic disorders such as diabetes and cholestasis. However, the underlying activation mechanism of FXR is still a blur owing to the absence of proper FXR modulators. To identify potential FXR modulators, an in-house natural product database (NPD) containing over 4000 compounds was screened by structure-based virtual screening strategy and subsequent hit-based similarity searching method. After the yeast two-hybrid (Y2H) assay, six natural products were identified as FXR antagonists which blocked the CDCA-induced SRC-1 association. The IC50 values of compounds 2a, a diterpene bearing polycyclic skeleton, and 3a, named daphneone with chain scaffold, are as low as 1.29 μM and 1.79 μM, respectively. Compared to the control compound guggulsterone (IC50 = 6.47 μM), compounds 2a and 3a displayed 5-fold and 3-fold higher antagonistic activities against FXR, respectively. Remarkably, the two representative compounds shared low topological similarities with other reported FXR antagonists. According to the putative binding poses, the molecular basis of these antagonists against FXR was also elucidated in this report.

  15. Quantitative real-time PCR as a sensitive protein-protein interaction quantification method and a partial solution for non-accessible autoactivator and false-negative molecule analysis in the yeast two-hybrid system.

    PubMed

    Maier, Richard H; Maier, Christina J; Hintner, Helmut; Bauer, Johann W; Onder, Kamil

    2012-12-01

    Many functional proteomic experiments make use of high-throughput technologies such as mass spectrometry combined with two-dimensional polyacrylamide gel electrophoresis and the yeast two-hybrid (Y2H) system. Currently there are even automated versions of the Y2H system available that can be used for proteome-wide research. The Y2H system has the capacity to deliver a profusion of Y2H positive colonies from a single library screen. However, subsequent analysis of these numerous primary candidates with complementary methods can be overwhelming. Therefore, a method to select the most promising candidates with strong interaction properties might be useful to reduce the number of candidates requiring further analysis. The method described here offers a new way of quantifying and rating the performance of positive Y2H candidates. The novelty lies in the detection and measurement of mRNA expression instead of proteins or conventional Y2H genetic reporters. This method correlates well with the direct genetic reporter readouts usually used in the Y2H system, and has greater sensitivity for detecting and quantifying protein-protein interactions (PPIs) than the conventional Y2H system, as demonstrated by detection of the Y2H false-negative PPI of RXR/PPARG. Approximately 20% of all proteins are not suitable for the Y2H system, the so-called autoactivators. A further advantage of this method is the possibility to evaluate molecules that usually cannot be analyzed in the Y2H system, exemplified by a VDR-LXXLL motif peptide interaction. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Identification of oleaginous yeast strains able to accumulate high intracellular lipids when cultivated in alkaline pretreated corn stover

    PubMed Central

    Sitepu, Irnayuli R.; Jin, Mingjie; Fernandez, J. Enrique; da Costa Sousa, Leonardo; Balan, Venkatesh; Boundy-Mills, Kyria L.

    2015-01-01

    Microbial oil is a potential alternative to food/plant-derived biodiesel fuel. Our previous screening studies identified a wide range of oleaginous yeast species, using a defined laboratory medium known to stimulate lipid accumulation. In this study, the ability of these yeasts to grow and accumulate lipids was further investigated in synthetic hydrolysate (SynH) and authentic ammonia fiber expansion (AFEX™)-pretreated corn stover hydrolysate (ACSH). Most yeast strains tested were able to accumulate lipids in SynH, but only a few were able to grow and accumulate lipids in ACSH medium. Cryptococcus humicola UCDFST 10-1004 was able to accumulate as high as 15.5 g/L lipids, out of a total of 36 g/L cellular biomass when grown in ACSH, with a cellular lipid content of 40% of cell dry weight. This lipid production is among the highest reported values for oleaginous yeasts grown in authentic hydrolysate. Pre-culturing in SynH media with xylose as sole carbon source enabled yeasts to assimilate both glucose and xylose more efficiently in the subsequent hydrolysate medium. This study demonstrates that ACSH is a suitable medium for certain oleaginous yeasts to convert lignocellullosic sugars to triacylglycerols for production of biodiesel and other valuable oleochemicals. PMID:25052467

  17. Yeast ecology of Kombucha fermentation.

    PubMed

    Teoh, Ai Leng; Heard, Gillian; Cox, Julian

    2004-09-01

    Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.

  18. A Simple Genetic Incompatibility Causes Hybrid Male Sterility in Mimulus

    PubMed Central

    Sweigart, Andrea L.; Fishman, Lila; Willis, John H.

    2006-01-01

    Much evidence has shown that postzygotic reproductive isolation (hybrid inviability or sterility) evolves by the accumulation of interlocus incompatibilities between diverging populations. Although in theory only a single pair of incompatible loci is needed to isolate species, empirical work in Drosophila has revealed that hybrid fertility problems often are highly polygenic and complex. In this article we investigate the genetic basis of hybrid sterility between two closely related species of monkeyflower, Mimulus guttatus and M. nasutus. In striking contrast to Drosophila systems, we demonstrate that nearly complete hybrid male sterility in Mimulus results from a simple genetic incompatibility between a single pair of heterospecific loci. We have genetically mapped this sterility effect: the M. guttatus allele at the hybrid male sterility 1 (hms1) locus acts dominantly in combination with recessive M. nasutus alleles at the hybrid male sterility 2 (hms2) locus to cause nearly complete hybrid male sterility. In a preliminary screen to find additional small-effect male sterility factors, we identified one additional locus that also contributes to some of the variation in hybrid male fertility. Interestingly, hms1 and hms2 also cause a significant reduction in hybrid female fertility, suggesting that sex-specific hybrid defects might share a common genetic basis. This possibility is supported by our discovery that recombination is reduced dramatically in a cross involving a parent with the hms1–hms2 incompatibility. PMID:16415357

  19. Initiation preference at a yeast origin of replication.

    PubMed

    Brewer, B J; Fangman, W L

    1994-04-12

    Replication origins in the yeast Saccharomyces cerevisiae are identified as autonomous replication sequence (ARS) elements. To examine the effect of origin density on replication initiation, we have analyzed the replication of a plasmid that contains two copies of the same origin, ARS1. The activation of origins and the direction that replication forks move through flanking sequences can be physically determined by analyzing replication intermediates on two-dimensional agarose gels. We find that only one of the two identical ARSs on the plasmid initiates replication on any given plasmid molecule; that is, this close spacing of ARSs results in an apparent interference between the potential origins. Moreover, in the particular plasmid that we constructed, one of the two identical copies of ARS1 is used four times more frequently than the other one. These results show that the plasmid context is critical for determining the preferred origin. This origin preference is also exhibited when the tandem copies of ARS1 are introduced into a yeast chromosome. The sequences responsible for establishing the origin preference have been identified by deletion analysis and are found to reside in a portion of the yeast URA3 gene.

  20. Identification of She3 as an SCFGrr1 Substrate in Budding Yeast

    PubMed Central

    Wang, Ruiwen; Solomon, Mark J.

    2012-01-01

    The highly orchestrated progression of the cell cycle depends on the degradation of many regulatory proteins at different cell cycle stages. One of the key cell cycle ubiquitin ligases is the Skp1-cullin-F-box (SCF) complex. Acting in concert with the substrate-binding F-box protein Grr1, SCFGrr1 promotes the degradation of cell cycle regulators as well as various metabolic enzymes. Using a yeast two-hybrid assay with a Grr1 derivative as the bait, we identified She3, which is an adaptor protein in the asymmetric mRNA transport system, as a novel Grr1 substrate. We generated stabilized She3 mutants, which no longer bound to Grr1, and found that the degradation of She3 is not required for regulating asymmetric mRNA transport. However, She3 stabilization leads to slower growth compared to wild-type cells in a co-culture assay, demonstrating that the degradation of She3 by Grr1 is required for optimal cell growth. PMID:23144720