The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

PubMed Central

Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

2002-01-01

The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

SSB-1 of the yeast Saccharomyces cerevisiae is a nucleolar-specific, silver-binding protein that is associated with the snR10 and snR11 small nuclear RNAs

PubMed Central

1990-01-01

SSB-1, the yeast single-strand RNA-binding protein, is demonstrated to be a yeast nucleolar-specific, silver-binding protein. In double-label immunofluorescence microscopy experiments antibodies to two other nucleolar proteins, RNA Pol I 190-kD and fibrillarin, were used to reveal the site of rRNA transcription; i.e., the fibrillar region of the nucleolus. SSB-1 colocalized with fibrillarin in a double-label immunofluorescence mapping experiment to the yeast nucleolus. SSB-1 is located, though, over a wider region of the nucleolus than the transcription site marker. Immunoprecipitations of yeast cell extracts with the SSB-1 antibody reveal that in 150 mM NaCl SSB-1 is bound to two small nuclear RNAs (snRNAs). These yeast snRNAs are snR10 and snR11, with snR10 being predominant. Since snR10 has been implicated in pre-rRNA processing, the association of SSB-1 and snR10 into a nucleolar snRNP particle indicates SSB-1 involvement in rRNA processing as well. Also, another yeast protein, SSB-36-kD, isolated by single- strand DNA chromatography, is shown to bind silver under the conditions used for nucleolar-specific staining. It is, most likely, another yeast nucleolar protein. PMID:2121740

Enumeration and rapid identification of yeasts during extraction processes of extra virgin olive oil in Tuscany.

PubMed

Mari, Eleonora; Guerrini, Simona; Granchi, Lisa; Vincenzini, Massimo

2016-06-01

The aim of this study was to evaluate the occurrence of yeast populations during different olive oil extraction processes, carried out in three consecutive years in Tuscany (Italy), by analysing crushed pastes, kneaded pastes, oil from decanter and pomaces. The results showed yeast concentrations ranging between 10(3) and 10(5) CFU/g or per mL. Seventeen dominant yeast species were identified by random amplified polymorphic DNA with primer M13 and their identification was confirmed by restriction fragments length polymorphism of ribosomal internal transcribed spacer and sequencing rRNA genes. The isolation frequencies of each species in the collected samples pointed out that the occurrence of the various yeast species in olive oil extraction process was dependent not only on the yeasts contaminating the olives but also on the yeasts colonizing the plant for oil extraction. In fact, eleven dominant yeast species were detected from the washed olives, but only three of them were also found in oil samples at significant isolation frequency. On the contrary, the most abundant species in oil samples, Yamadazyma terventina, did not occur in washed olive samples. These findings suggest a phenomenon of contamination of the plant for oil extraction that selects some yeast species that could affect the quality of olive oil.

Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

PubMed

Liang, Xue-Hai; Crooke, Stanley T

2011-06-01

Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.

PubMed

Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila

2012-07-13

Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

PubMed

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

PubMed

Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

2018-01-01

Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana▿

PubMed Central

Lange, Heike; Holec, Sarah; Cognat, Valérie; Pieuchot, Laurent; Le Ret, Monique; Canaday, Jean; Gagliardi, Dominique

2008-01-01

Yeast Rrp6p and its human counterpart, PM/Scl100, are exosome-associated proteins involved in the degradation of aberrant transcripts and processing of precursors to stable RNAs, such as the 5.8S rRNA, snRNAs, and snoRNAs. The activity of yeast Rrp6p is stimulated by the polyadenylation of its RNA substrates. We identified three RRP6-like proteins in Arabidopsis thaliana: AtRRP6L3 is restricted to the cytoplasm, whereas AtRRP6L1 and -2 have different intranuclear localizations. Both nuclear RRP6L proteins are functional, since AtRRP6L1 complements the temperature-sensitive phenotype of a yeast rrp6Δ strain and mutation of AtRRP6L2 leads to accumulation of an rRNA maturation by-product. This by-product corresponds to the excised 5′ part of the 18S-5.8S-25S rRNA precursor and accumulates as a polyadenylated transcript, suggesting that RRP6L2 is involved in poly(A)-mediated RNA degradation in plant nuclei. Interestingly, the rRNA maturation by-product is a substrate of AtRRP6L2 but not of AtRRP6L1. This result and the distinctive subcellular distribution of AtRRP6L1 to -3 indicate a specialization of RRP6-like proteins in Arabidopsis. PMID:18285452

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

PubMed

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

2013-02-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing

PubMed Central

Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.

2013-01-01

Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442

Analysis of ribosomal RNA stability in dead cells of wine yeast by quantitative PCR.

PubMed

Sunyer-Figueres, Merce; Wang, Chunxiao; Mas, Albert

2018-04-02

During wine production, some yeasts enter a Viable But Not Culturable (VBNC) state, which may influence the quality and stability of the final wine through remnant metabolic activity or by resuscitation. Culture-independent techniques are used for obtaining an accurate estimation of the number of live cells, and quantitative PCR could be the most accurate technique. As a marker of cell viability, rRNA was evaluated by analyzing its stability in dead cells. The species-specific stability of rRNA was tested in Saccharomyces cerevisiae, as well as in three species of non-Saccharomyces yeast (Hanseniaspora uvarum, Torulaspora delbrueckii and Starmerella bacillaris). High temperature and antimicrobial dimethyl dicarbonate (DMDC) treatments were efficient in lysing the yeast cells. rRNA gene and rRNA (as cDNA) were analyzed over 48 h after cell lysis by quantitative PCR. The results confirmed the stability of rRNA for 48 h after the cell lysis treatments. To sum up, rRNA may not be a good marker of cell viability in the wine yeasts that were tested. Copyright © 2018 Elsevier B.V. All rights reserved.

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes

PubMed Central

Chen, Y. C.; Eisner, J. D.; Kattar, M. M.; Rassoulian-Barrett, S. L.; LaFe, K.; Yarfitz, S. L.; Limaye, A. P.; Cookson, B. T.

2000-01-01

Identification of medically relevant yeasts can be time-consuming and inaccurate with current methods. We evaluated PCR-based detection of sequence polymorphisms in the internal transcribed spacer 2 (ITS2) region of the rRNA genes as a means of fungal identification. Clinical isolates (401), reference strains (6), and type strains (27), representing 34 species of yeasts were examined. The length of PCR-amplified ITS2 region DNA was determined with single-base precision in less than 30 min by using automated capillary electrophoresis. Unique, species-specific PCR products ranging from 237 to 429 bp were obtained from 92% of the clinical isolates. The remaining 8%, divided into groups with ITS2 regions which differed by ≤2 bp in mean length, all contained species-specific DNA sequences easily distinguishable by restriction enzyme analysis. These data, and the specificity of length polymorphisms for identifying yeasts, were confirmed by DNA sequence analysis of the ITS2 region from 93 isolates. Phenotypic and ITS2-based identification was concordant for 427 of 434 yeast isolates examined using sequence identity of ≥99%. Seven clinical isolates contained ITS2 sequences that did not agree with their phenotypic identification, and ITS2-based phylogenetic analyses indicate the possibility of new or clinically unusual species in the Rhodotorula and Candida genera. This work establishes an initial database, validated with over 400 clinical isolates, of ITS2 length and sequence polymorphisms for 34 species of yeasts. We conclude that size and restriction analysis of PCR-amplified ITS2 region DNA is a rapid and reliable method to identify clinically significant yeasts, including potentially new or emerging pathogenic species. PMID:10834993

Yeast species associated with the spontaneous fermentation of cider.

PubMed

Valles, Belén Suárez; Bedriñana, Rosa Pando; Tascón, Norman Fernández; Simón, Amparo Querol; Madrera, Roberto Rodríguez

2007-02-01

This paper reports the influence of cider-making technology (pneumatic and traditional pressing) on the dynamics of wild yeast populations. Yeast colonies isolated from apple juice before and throughout fermentation at a cider cellar of Asturias (Spain), during two consecutive years were studied. The yeast strains were identified by restriction fragment length polymorphism analysis of the 5.8S rRNA gene and the two flanking internal transcribed sequences (ITS). The musts obtained by pneumatic pressing were dominated by non-Saccharomyces yeasts (Hanseniaspora genus and Metschnikowia pulcherrima) whereas in the apple juices obtained by traditional pressing Saccharomyces together with non-Saccharomyces, were always present. The species Saccharomyces present were S. cerevisiae and S. bayanus. Apparently S. bayanus, was the predominant species at the beginning and the middle fermentation steps of the fermentation process, reaching a percentage of isolation between 33% and 41%, whereas S. cerevisiae took over the process in the final stages of fermentation. During the 2001 harvest, with independence of cider-making technology, the species Hanseniaspora valbyensis was always isolated at the end of fermentations.

Characterization of Osmotolerant Yeasts and Yeast-Like Molds from Apple Orchards and Apple Juice Processing Plants in China and Investigation of Their Spoilage Potential.

PubMed

Wang, Huxuan; Hu, Zhongqiu; Long, Fangyu; Niu, Chen; Yuan, Yahong; Yue, Tianli

2015-08-01

Yeasts and yeast-like fungal isolates were recovered from apple orchards and apple juice processing plants located in the Shaanxi province of China. The strains were evaluated for osmotolerance by growing them in 50% (w/v) glucose. Of the strains tested, 66 were positive for osmotolerance and were subsequently identified by 26S or 5.8S-ITS ribosomal RNA (rRNA) gene sequencing. Physiological tests and RAPD-PCR analysis were performed to reveal the polymorphism of isolates belonging to the same species. Further, the spoilage potential of the 66 isolates was determining by evaluating their growth in 50% to 70% (w/v) glucose and measuring gas generation in 50% (w/v) glucose. Thirteen osmotolerant isolates representing 9 species were obtained from 10 apple orchards and 53 target isolates representing 19 species were recovered from 2 apple juice processing plants. In total, members of 14 genera and 23 species of osmotolerant isolates including yeast-like molds were recovered from all sources. The commonly recovered osmotolerant isolates belonged to Kluyveromyces marxianus, Hanseniaspora uvarum, Saccharomyces cerevisiae, Zygosaccharomyces rouxii, Candida tropicalis, and Pichia kudriavzevii. The polymorphism of isolates belonging to the same species was limited to 1 to 3 biotypes. The majority of species were capable of growing within a range of glucose concentration, similar to sugar concentrations found in apple juice products with a lag phase from 96 to 192 h. Overall, Z. rouxii was particularly the most tolerant to high glucose concentration with the shortest lag phase of 48 h in 70% (w/v) glucose and the fastest gas generation rate in 50% (w/v) glucose. © 2015 Institute of Food Technologists®

Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

2005-01-01

5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

Yeast diversity and dynamics in the production processes of Norwegian dry-cured meat products.

PubMed

Asefa, Dereje T; Møretrø, Trond; Gjerde, Ragnhild O; Langsrud, Solveig; Kure, Cathrine F; Sidhu, Maan S; Nesbakken, Truls; Skaar, Ida

2009-07-31

This study investigate the diversity and dynamics of yeasts in the production processes of one unsmoked and two smoked dry-cured meat products of a Norwegian dry-cured meat production facility. A longitudinal observational study was performed to collect 642 samples from the meat, production materials, room installations and indoor and outdoor air of the production facility. Nutrient rich agar media were used to isolate the yeasts. Morphologically different isolates were re-cultivated in their pure culture forms. Both classical and molecular methods were employed for species identification. Totally, 401 yeast isolates belonging to 10 species of the following six genera were identified: Debaryomyces, Candida, Rhodotorula, Rhodosporidium, Cryptococcus and Sporidiobolus. Debaryomyces hansenii and Candida zeylanoides were dominant and contributed by 63.0% and 26.4% respectively to the total isolates recovered from both smoked and unsmoked products. The yeast diversity was higher at the pre-salting production processes with C. zeylanoides being the dominant. Later at the post-salting stages, D. hansenii occurred frequently. Laboratory studies showed that D. hansenii was more tolerant to sodium chloride and nitrite than C. zeylanoides. Smoking seems to have a killing or a temporary growth inhibiting effect on yeasts that extend to the start of the drying process. Yeasts were isolated only from 31.1% of the environmental samples. They belonged to six different species of which five of them were isolated from the meat samples too. Debaryomyces hansenii and Rhodotorula glutinis were dominant with a 62.6% and 22.0% contribution respectively. As none of the air samples contained D. hansenii, the production materials and room installations used in the production processes were believed to be the sources of contamination. The dominance of D. hansenii late in the production process replacing C. zeylanoides should be considered as a positive change both for the quality and safety

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

PubMed

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria.

PubMed

Yoshihisa, Tohru; Yunoki-Esaki, Kaori; Ohshima, Chie; Tanaka, Nobuyuki; Endo, Toshiya

2003-08-01

Pre-tRNA splicing has been believed to occur in the nucleus. In yeast, the tRNA splicing endonuclease that cleaves the exon-intron junctions of pre-tRNAs consists of Sen54p, Sen2p, Sen34p, and Sen15p and was thought to be an integral membrane protein of the inner nuclear envelope. Here we show that the majority of Sen2p, Sen54p, and the endonuclease activity are not localized in the nucleus, but on the mitochondrial surface. The endonuclease is peripherally associated with the cytosolic surface of the outer mitochondrial membrane. A Sen54p derivative artificially fixed on the mitochondria as an integral membrane protein can functionally replace the authentic Sen54p, whereas mutant proteins defective in mitochondrial localization are not fully active. sen2 mutant cells accumulate unspliced pre-tRNAs in the cytosol under the restrictive conditions, and this export of the pre-tRNAs partly depends on Los1p, yeast exportin-t. It is difficult to explain these results from the view of tRNA splicing in the nucleus. We rather propose a new possibility that tRNA splicing occurs on the mitochondrial surface in yeast.

Dynamical analysis of yeast protein interaction network during the sake brewing process.

PubMed

Mirzarezaee, Mitra; Sadeghi, Mehdi; Araabi, Babak N

2011-12-01

Proteins interact with each other for performing essential functions of an organism. They change partners to get involved in various processes at different times or locations. Studying variations of protein interactions within a specific process would help better understand the dynamic features of the protein interactions and their functions. We studied the protein interaction network of Saccharomyces cerevisiae (yeast) during the brewing of Japanese sake. In this process, yeast cells are exposed to several stresses. Analysis of protein interaction networks of yeast during this process helps to understand how protein interactions of yeast change during the sake brewing process. We used gene expression profiles of yeast cells for this purpose. Results of our experiments revealed some characteristics and behaviors of yeast hubs and non-hubs and their dynamical changes during the brewing process. We found that just a small portion of the proteins (12.8 to 21.6%) is responsible for the functional changes of the proteins in the sake brewing process. The changes in the number of edges and hubs of the yeast protein interaction networks increase in the first stages of the process and it then decreases at the final stages.

Lactic acid bacteria and yeasts associated with gowé production from sorghum in Bénin.

PubMed

Vieira-Dalodé, G; Jespersen, L; Hounhouigan, J; Moller, P L; Nago, C M; Jakobsen, M

2007-08-01

To identify the dominant micro-organisms involved in the production of gowé, a fermented beverage, and to select the most appropriate species for starter culture development. Samples of sorghum gowé produced twice at three different production sites were taken at different fermentation times. DNA amplification by internal transcribed spacer-polymerase chain reaction of 288 lactic acid bacteria (LAB) isolates and 16S rRNA gene sequencing of selected strains revealed that the dominant LAB responsible for gowé fermentation were Lactobacillus fermentum, Weissella confusa, Lactobacillus mucosae, Pediococcus acidilactici, Pediococcus pentosaceus and Weissella kimchii. DNA from 200 strains of yeasts was amplified and the D1/D2 domain of the 26S rRNA gene was sequenced for selected isolates, revealing that the yeasts species were Kluyveromyces marxianus, Pichia anomala, Candida krusei and Candida tropicalis. Gowé processing is characterized by a mixed fermentation dominated by Lact. fermentum, W. confusa and Ped. acidilactici for the LAB and by K. marxianus, P. anomala and C. krusei for the yeasts. The diversity of the LAB and yeasts identified offers new opportunities for technology upgrading and products development in gowé production. The identified species can be used as possible starter for a controlled fermentation of gowé.

Yeast communities associated with artisanal mezcal fermentations from Agave salmiana.

PubMed

Verdugo Valdez, A; Segura Garcia, L; Kirchmayr, M; Ramírez Rodríguez, P; González Esquinca, A; Coria, R; Gschaedler Mathis, A

2011-11-01

The aims of this work were to characterize the fermentation process of mezcal from San Luis Potosi, México and identify the yeasts present in the fermentation using molecular culture-dependent methods (RFLP of the 5.8S-ITS and sequencing of the D1/D2 domain) and also by using a culture-independent method (DGGE). The alcoholic fermentations of two separate musts obtained from Agave salmiana were analyzed. Sugar, ethanol and major volatile compounds concentrations were higher in the first fermentation, which shows the importance of having a quality standard for raw materials, particularly in the concentration of fructans, in order to produce fermented Agave salmiana must with similar characteristics. One hundred ninety-two (192) different yeast colonies were identified, from those present on WL agar plates, by RFLP analysis of the ITS1-5.8S- ITS2 from the rRNA gene, with restriction endonucleases, HhaI, HaeIII and HinfI. The identified yeasts were: Saccharomyces cerevisiae, Kluyveromyces marxianus, Pichia kluyveri, Zygosaccharomyces bailii, Clavispora lusitaniae, Torulaspora delbrueckii, Candida ethanolica and Saccharomyces exiguus. These identifications were confirmed by sequencing the D1-D2 region of the 26S rRNA gene. With the PCR-DGGE method, bands corresponding to S. cerevisiae, K. marxianus and T. delbrueckii were clearly detected, confirming the results obtained with classic techniques.

The Effect of Dietary Supplementation with Spent Cider Yeast on the Swine Distal Gut Microbiome

PubMed Central

Upadrasta, Aditya; O’Sullivan, Lisa; O’Sullivan, Orla; Sexton, Noel; Lawlor, Peadar G.; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul

2013-01-01

Background There is an increasing need for alternatives to antibiotics for promoting animal health, given the increasing problems associated with antibiotic resistance. In this regard, we evaluated spent cider yeast as a potential probiotic for modifying the gut microbiota in weanling pigs using pyrosequencing of 16S rRNA gene libraries. Methodology and Principal Findings Piglets aged 24–26 days were assigned to one of two study groups; control (n = 12) and treatment (n = 12). The control animals were fed with a basal diet and the treatment animals were fed with basal diet in combination with cider yeast supplement (500 ml cider yeast containing ∼7.6 log CFU/ml) for 21 days. Faecal samples were collected for 16s rRNA gene compositional analysis. 16S rRNA compositional sequencing analysis of the faecal samples collected from day 0 and day 21 revealed marked differences in microbial diversity at both the phylum and genus levels between the control and treatment groups. This analysis confirmed that levels of Salmonella and Escherichia were significantly decreased in the treatment group, compared with the control (P<0.001). This data suggest a positive influence of dietary supplementation with live cider yeast on the microbial diversity of the pig distal gut. Conclusions/Significance The effect of dietary cider yeast on porcine gut microbial communities was characterized for the first time using 16S rRNA gene compositional sequencing. Dietary cider yeast can potentially alter the gut microbiota, however such changes depend on their endogenous microbiota that causes a divergence in relative response to that given diet. PMID:24130736

Real-Time Quantitative PCR (QPCR) and Reverse Transcription-QPCR for Detection and Enumeration of Total Yeasts in Wine▿

PubMed Central

Hierro, Núria; Esteve-Zarzoso, Braulio; González, Ángel; Mas, Albert; Guillamón, Jose M.

2006-01-01

Real-time PCR, or quantitative PCR (QPCR), has been developed to rapidly detect and quantify the total number of yeasts in wine without culturing. Universal yeast primers were designed from the variable D1/D2 domains of the 26S rRNA gene. These primers showed good specificity with all the wine yeasts tested, and they did not amplify the most representative wine species of acetic acid bacteria and lactic acid bacteria. Numerous standard curves were constructed with different strains and species grown in yeast extract-peptone-dextrose medium or incubated in wine. The small standard errors with these replicas proved that the assay is reproducible and highly robust. This technique was validated with artificially contaminated and natural wine samples. We also performed a reverse transcription-QPCR (RT-QPCR) assay from rRNA for total viable yeast quantification. This technique had a low detection limit and was more accurate than QPCR because the dead cells were not quantified. As far as we know, this is the first time that RT-QPCR has been performed to quantify viable yeasts from rRNA. RT-QPCR is a rapid and accurate technique for enumerating yeasts during industrial wine fermentation and controlling the risk of wine spoilage. PMID:17088381

Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2005-03-01

Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

The presence of Enterococcus, coliforms and E. coli in a commercial yeast manufacturing process.

PubMed

O'Brien, S S; Lindsay, D; von Holy, A

2004-07-01

This study evaluated a typical commercial yeast manufacturing process for bacterial contamination. Product line samples of a commercial yeast manufacturing process and the corresponding seed yeast manufacturing process were obtained upstream from the final compressed and dry yeast products. All samples were analysed before (non-PI) and after preliminary incubation (PI) at 37 degrees C for 24 h. The PI procedure was incorporated for amplification of bacterial counts below the lower detection limit. Enterococcus, coliform and Escherichia coli counts were quantified by standard pour-plate techniques using selective media. Presence at all stages and progressive increases in counts of Enterococcus, coliforms and E. coli during processing in the commercial manufacturing operation suggested that the primary source of contamination of both compressed and dry yeast with these bacteria was the seed yeast manufacturing process and that contamination was amplified throughout the commercial yeast manufacturing process. This was confirmed by surveys of the seed yeast manufacturing process which indicated that contamination of the seed yeast with Enterococcus, coliforms and E. coli occurred during scale up of seed yeast biomass destined as inoculum for the commercial fermentation.

Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

PubMed Central

Mills, David A.; Johannsen, Eric A.; Cocolin, Luca

2002-01-01

Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytis-affected (“botrytized”) wine fermentations carried out at high (∼30°C) and ambient (∼20°C) temperatures. Fermentations at both temperatures possessed similar populations of Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel electrophoresis profiles of yeast ribosomal DNA or rRNA amplified from the fermentation samples correlated well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population not identified in the plating analysis. rRNA analysis also indicated a large population (>106 cells per ml) of a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in fermentations containing higher populations of Candida. Analysis of wine fermentation microbial ecology by using both culture-dependent and -independent methods reveals the complexity of yeast interactions enriched during spontaneous fermentations. PMID:12324335

U14 small nucleolar RNA makes multiple contacts with the pre-ribosomal RNA.

PubMed

Morrissey, J P; Tollervey, D

1997-06-01

The small nucleolar RNA (snoRNA) U14 has two regions of extended primary sequence complementarity to the 18S rRNA. The 3' region (domain B) shows the consensus structure for the methylation guide class of snoRNAs, whereas base-pairing between the 5' region (domain A) and the 18S rRNA sequence is required for the formation of functional ribosomes. Between domains A and B lies another essential region (domain Y). Here we report that yeast U14 can be cross-linked in vivo to the pre-rRNA; cross-linking is detected exclusively with the 35S primary transcript. Many nucleotides in U14 that lie outside of domains A and B are cross-linked to the pre-rRNA; in particular the essential domain Y region is cross-linked at several sites. U14 is, therefore, in far more extensive contact with the pre-rRNA than predicted from simple base-pairing models. Moreover, U14 can be cross-linked to other small RNA species. The functional interactions made by U14 during ribosome synthesis are likely to be very complex.

Yeast Mitoribosome Large Subunit Assembly Proceeds by Hierarchical Incorporation of Protein Clusters and Modules on the Inner Membrane.

PubMed

Zeng, Rui; Smith, Erin; Barrientos, Antoni

2018-03-06

Mitoribosomes are specialized for the synthesis of hydrophobic membrane proteins encoded by mtDNA, all essential for oxidative phosphorylation. Despite their linkage to human mitochondrial diseases and the recent cryoelectron microscopy reconstruction of yeast and mammalian mitoribosomes, how they are assembled remains obscure. Here, we dissected the yeast mitoribosome large subunit (mtLSU) assembly process by systematic genomic deletion of 44 mtLSU proteins (MRPs). Analysis of the strain collection unveiled 37 proteins essential for functional mtLSU assembly, three of which are critical for mtLSU 21S rRNA stability. Hierarchical cluster analysis of mtLSU subassemblies accumulated in mutant strains revealed co-operative assembly of protein sets forming structural clusters and preassembled modules. It also indicated crucial roles for mitochondrion-specific membrane-binding MRPs in anchoring newly transcribed 21S rRNA to the inner membrane, where assembly proceeds. Our results define the yeast mtLSU assembly landscape in vivo and provide a foundation for studies of mitoribosome assembly across evolution. Copyright © 2018 Elsevier Inc. All rights reserved.

A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.

Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

DOE PAGES

Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.; ...

2014-12-15

Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

Brettanomyces acidodurans sp. nov., a new acetic acid producing yeast species from olive oil.

PubMed

Péter, Gábor; Dlauchy, Dénes; Tóbiás, Andrea; Fülöp, László; Podgoršek, Martina; Čadež, Neža

2017-05-01

Two yeast strains representing a hitherto undescribed yeast species were isolated from olive oil and spoiled olive oil originating from Spain and Israel, respectively. Both strains are strong acetic acid producers, equipped with considerable tolerance to acetic acid. The cultures are not short-lived. Cellobiose is fermented as well as several other sugars. The sequences of their large subunit (LSU) rRNA gene D1/D2 domain are very divergent from the sequences available in the GenBank. They differ from the closest hit, Brettanomyces naardenensis by about 27%, mainly substitutions. Sequence analyses of the concatenated dataset from genes of the small subunit (SSU) rRNA, LSU rRNA and translation elongation factor-1α (EF-1α) placed the two strains as an early diverging member of the Brettanomyces/Dekkera clade with high bootstrap support. Sexual reproduction was not observed. The name Brettanomyces acidodurans sp. nov. (holotype: NCAIM Y.02178 T ; isotypes: CBS 14519 T  = NRRL Y-63865 T  = ZIM 2626 T , MycoBank no.: MB 819608) is proposed for this highly divergent new yeast species.

Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

PubMed Central

Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

2001-01-01

rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations.

PubMed

Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

2016-01-01

Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

Yeast Biodiversity from DOQ Priorat Uninoculated Fermentations

PubMed Central

Padilla, Beatriz; García-Fernández, David; González, Beatriz; Izidoro, Iara; Esteve-Zarzoso, Braulio; Beltran, Gemma; Mas, Albert

2016-01-01

Climate, soil, and grape varieties are the primary characteristics of terroir and lead to the definition of various appellations of origin. However, the microbiota associated with grapes are also affected by these conditions and can leave a footprint in a wine that will be part of the characteristics of terroir. Thus, a description of the yeast microbiota within a vineyard is of interest not only to provide a better understanding of the winemaking process, but also to understand the source of microorganisms that maintain a microbial footprint in wine from the examined vineyard. In this study, two typical grape varieties, Grenache and Carignan, have been sampled from four different vineyards in the DOQ Priorat winegrowing region. Afterward, eight spontaneous alcoholic fermentations containing only grapes from one sampling point and of one variety were conducted at laboratory scale. The fermentation kinetics and yeast population dynamics within each fermentation experiment were evaluated. Yeast identification was performed by RFLP-PCR of the 5.8S-ITS region and by sequencing D1/D2 of the 26S rRNA gene of the isolates. The fermentation kinetics did not indicate clear differences between the two varieties of grapes or among vineyards. Approximately 1,400 isolates were identified, exhibiting high species richness in some fermentations. Of all the isolates studied, approximately 60% belong to the genus Hanseniaspora, 16% to Saccharomyces, and 11% to Candida. Other minor genera, such as Hansenula, Issatchenkia, Kluyveromyces, Saccharomycodes, and Zygosaccharomyces, were also found. The distribution of the identified yeast throughout the fermentation process was studied, and Saccharomyces cerevisiae was found to be present mainly at the end of the fermentation process, while Aureobasidium pullulans was isolated primarily during the first days of fermentation in three of the eight spontaneous fermentations. This work highlights the complexity and diversity of the vineyard

Rrp6p, the yeast homologue of the human PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation.

PubMed

Briggs, M W; Burkard, K T; Butler, J S

1998-05-22

The eukaryotic 25 S, 18 S, and 5.8 S rRNAs are synthesized as a single transcript with two internal transcribed spacers (ITS1 and ITS2), which are removed by endo- and exoribonucleolytic steps to produce mature rRNA. Genetic selection for suppressors of a polyadenylation defect yielded two cold-sensitive alleles of a gene that we named RRP6 (ribosomal RNA processing). Molecular cloning of RRP6 revealed its homology to a 100-kDa human, nucleolar PM-Scl autoantigen and to Escherichia coli RNase D, a 3'-5' exoribonuclease. Recessive mutations in rrp6 result in the accumulation of a novel 5. 8 S rRNA processing intermediate, called 5.8 S*, which has normal 5' ends, but retains approximately 30 nucleotides of ITS2. Pulse-chase analysis of 5.8 S rRNA processing in an rrp6- strain revealed a precursor-product relationship between 5.8 S* and 5.8 S rRNAs, suggesting that Rrp6p plays a role in the removal of the last 30 nucleotides of ITS2 from 5.8 S precursors. A portion of 5.8 S* rRNA assembles into 60 S ribosomes which form polyribosomes, suggesting that they function in protein synthesis. These findings indicate that Rrp6p plays a role in 5.8 S rRNA 3' end formation, and they identify a functional intermediate in the rRNA processing pathway.

Evidence for propagation of cold-adapted yeast in an ice core from a Siberian Altai glacier

NASA Astrophysics Data System (ADS)

Uetake, Jun; Kohshima, Shiro; Nakazawa, Fumio; Takeuchi, Nozomu; Fujita, Koji; Miyake, Takayuki; Narita, Hideki; Aizen, Vladimir; Nakawo, Masayoshi

2011-03-01

Cold environments, including glacier ice and snow, are known habitats for cold-adapted microorganisms. We investigated the potential for cold-adapted yeast to have propagated in the snow of the high-altitude Belukha glacier. We detected the presence of highly concentrated yeast (over 104 cells mL-1) in samples of both an ice core and firn snow. Increasing yeast cell concentrations in the same snow layer from July 2002 to July 2003 suggests that the yeast cells propagated in the glacier snow. A cold-adapted Rhodotorula sp. was isolated from the snow layer and found to be related to psychrophilic yeast previously found in other glacial environments (based on the D1/D2 26S rRNA domains). 26S rRNA clonal analysis directly amplified from meltwater within the ice core also revealed the presence of genus Rhodotorula. Analyses of the ice core showed that all peaks in yeast concentration corresponded to the peaks in indices of surface melting. These results support the hypothesis that occasional surface melting in an accumulation area is one of the major factors influencing cold-adapted yeast propagation.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Yeast population dynamics of industrial fuel-ethanol fermentation process assessed by PCR-fingerprinting.

PubMed

da Silva-Filho, Eurípedes Alves; Brito dos Santos, Scheila Karina; Resende, Alecsandra do Monte; de Morais, José Otamar Falcão; de Morais, Marcos Antonio; Ardaillon Simões, Diogo

2005-07-01

Yeast population used in industrial production of fuel-ethanol may vary according to the plant process condition and to the environmental stresses imposed to yeast cells. Therefore, yeast strains isolated from a particular industrial process may be adapted to such conditions and should be used as starter strain instead of less adapted commercial strains. This work reports the use of PCR-fingerprinting method based on microsatellite primer (GTG)5 to characterize the yeast population dynamics along the fermentation period in six distilleries. The results show that indigenous fermenting strains present in the crude substrate can be more adapted to the industrial process than commercial strains. We also identified new strains that dominate the yeast population and were more present either in molasses or sugar cane fermenting distilleries. Those strains were proposed to be used as starters in those industrial processes. This is the first report on the use of molecular markers to discriminate Saccharomyces cerevisiae strains from fuel-ethanol producing process.

The effect of dilute acid pre-treatment process in bioethanol production from durian (Durio zibethinus) seeds waste

NASA Astrophysics Data System (ADS)

Ghazali, K. A.; Salleh, S. F.; Riayatsyah, T. M. I.; Aditiya, H. B.; Mahlia, T. M. I.

2016-03-01

Lignocellulosic biomass is one of the promising feedstocks for bioethanol production. The process starts from pre-treatment, hydrolysis, fermentation, distillation and finally obtaining the final product, ethanol. The efficiency of enzymatic hydrolysis of cellulosic biomass depends heavily on the effectiveness of the pre-treatment step which main function is to break the lignin structure of the biomass. This work aims to investigate the effects of dilute acid pre-treatment on the enzymatic hydrolysis of durian seeds waste to glucose and the subsequent bioethanol fermentation process. The yield of glucose from dilute acid pre-treated sample using 0.6% H2SO4 and 5% substrate concentration shows significant value of 23.4951 g/L. Combination of dilute acid pre-treatment and enzymatic hydrolysis using 150U of enzyme able to yield 50.0944 g/L of glucose content higher compared to normal pre-treated sample of 8.1093 g/L. Dilute acid pre-treatment sample also shows stable and efficient yeast activity during fermentation process with lowest glucose content at 2.9636 g/L compared to 14.7583g/L for normal pre-treated sample. Based on the result, it can be concluded that dilute acid pre-treatment increase the yield of ethanol from bioethanol production process.

Both endonucleolytic and exonucleolytic cleavage mediate ITS1 removal during human ribosomal RNA processing

PubMed Central

Sloan, Katherine E.; Mattijssen, Sandy; Lebaron, Simon; Tollervey, David; Pruijn, Ger J.M.

2013-01-01

Human ribosome production is up-regulated during tumorogenesis and is defective in many genetic diseases (ribosomopathies). We have undertaken a detailed analysis of human precursor ribosomal RNA (pre-rRNA) processing because surprisingly little is known about this important pathway. Processing in internal transcribed spacer 1 (ITS1) is a key step that separates the rRNA components of the large and small ribosomal subunits. We report that this was initiated by endonuclease cleavage, which required large subunit biogenesis factors. This was followed by 3′ to 5′ exonucleolytic processing by RRP6 and the exosome, an enzyme complex not previously linked to ITS1 removal. In contrast, RNA interference–mediated knockdown of the endoribonuclease MRP did not result in a clear defect in ITS1 processing. Despite the apparently high evolutionary conservation of the pre-rRNA processing pathway and ribosome synthesis factors, each of these features of human ITS1 processing is distinct from those in budding yeast. These results also provide significant insight into the links between ribosomopathies and ribosome production in human cells. PMID:23439679

House microbiotas as sources of lactic acid bacteria and yeasts in traditional Italian sourdoughs.

PubMed

Minervini, Fabio; Lattanzi, Anna; De Angelis, Maria; Celano, Giuseppe; Gobbetti, Marco

2015-12-01

This study aimed at understanding the extent of contamination by lactic acid bacteria (LAB) and yeasts from the house microbiotas during sourdough back-slopping. Besides sourdoughs, wall, air, storage box, dough mixer and flour of four bakeries were analyzed. Based on plate counts, LAB and yeasts dominated the house microbiota. Based on high throughput sequencing of the 16S rRNA genes, flour harbored the highest number of Firmicutes, but only few of them adapted to storage box, dough mixer and sourdough. Lactobacillus sanfranciscensis showed the highest abundance in dough mixer and sourdoughs. Lactobacillus plantarum persisted only in storage box, dough mixer and sourdough of two bakeries. Weissella cibaria also showed higher adaptability in sourdough than in bakery equipment, suggesting that flour is the main origin of this species. Based on 18S rRNA data, Saccharomyces cerevisiae was the dominant yeast in house and sourdough microbiotas, excepted one bakery dominated by Kazachstania exigua. The results of this study suggest that the dominant species of sourdough LAB and yeasts dominated also the house microbiota. Copyright © 2015 Elsevier Ltd. All rights reserved.

Aroma formation by immobilized yeast cells in fermentation processes.

PubMed

Nedović, V; Gibson, B; Mantzouridou, T F; Bugarski, B; Djordjević, V; Kalušević, A; Paraskevopoulou, A; Sandell, M; Šmogrovičová, D; Yilmaztekin, M

2015-01-01

Immobilized cell technology has shown a significant promotional effect on the fermentation of alcoholic beverages such as beer, wine and cider. However, genetic, morphological and physiological alterations occurring in immobilized yeast cells impact on aroma formation during fermentation processes. The focus of this review is exploitation of existing knowledge on the biochemistry and the biological role of flavour production in yeast for the biotechnological production of aroma compounds of industrial importance, by means of immobilized yeast. Various types of carrier materials and immobilization methods proposed for application in beer, wine, fruit wine, cider and mead production are presented. Engineering aspects with special emphasis on immobilized cell bioreactor design, operation and scale-up potential are also discussed. Ultimately, examples of products with improved quality properties within the alcoholic beverages are addressed, together with identification and description of the future perspectives and scope for cell immobilization in fermentation processes. Copyright © 2014 John Wiley & Sons, Ltd.

Polyhexamethyl biguanide can eliminate contaminant yeasts from fuel-ethanol fermentation process.

PubMed

Elsztein, Carolina; de Menezes, João Assis Scavuzzi; de Morais, Marcos Antonio

2008-09-01

Industrial ethanol fermentation is a non-sterile process and contaminant microorganisms can lead to a decrease in industrial productivity and significant economic loss. Nowadays, some distilleries in Northeastern Brazil deal with bacterial contamination by decreasing must pH and adding bactericides. Alternatively, contamination can be challenged by adding a pure batch of Saccharomyces cerevisiae-a time-consuming and costly process. A better strategy might involve the development of a fungicide that kills contaminant yeasts while preserving S. cerevisiae cells. Here, we show that polyhexamethyl biguanide (PHMB) inhibits and kills the most important contaminant yeasts detected in the distilleries of Northeastern Brazil without affecting the cell viability and fermentation capacity of S. cerevisiae. Moreover, some physiological data suggest that PHMB acts through interaction with the yeast membrane. These results support the development of a new strategy for controlling contaminant yeast population whilst keeping industrial yields high.

Apoptotic signals induce specific degradation of ribosomal RNA in yeast

PubMed Central

Mroczek, Seweryn; Kufel, Joanna

2008-01-01

Organisms exposed to reactive oxygen species, generated endogenously during respiration or by environmental conditions, undergo oxidative stress. Stress response can either repair the damage or activate one of the programmed cell death (PCD) mechanisms, for example apoptosis, and finally end in cell death. One striking characteristic, which accompanies apoptosis in both vertebrates and yeast, is a fragmentation of cellular DNA and mammalian apoptosis is often associated with degradation of different RNAs. We show that in yeast exposed to stimuli known to induce apoptosis, such as hydrogen peroxide, acetic acid, hyperosmotic stress and ageing, two large subunit ribosomal RNAs, 25S and 5.8S, became extensively degraded with accumulation of specific intermediates that differ slightly depending on cell death conditions. This process is most likely endonucleolytic, is correlated with stress response, and depends on the mitochondrial respiratory status: rRNA is less susceptible to degradation in respiring cells with functional defence against oxidative stress. In addition, RNA fragmentation is independent of two yeast apoptotic factors, metacaspase Yca1 and apoptosis-inducing factor Aif1, but it relies on the apoptotic chromatin condensation induced by histone H2B modifications. These data describe a novel phenotype for certain stress- and ageing-related PCD pathways in yeast. PMID:18385160

Data Pre-Processing Method to Remove Interference of Gas Bubbles and Cell Clusters During Anaerobic and Aerobic Yeast Fermentations in a Stirred Tank Bioreactor

NASA Astrophysics Data System (ADS)

Princz, S.; Wenzel, U.; Miller, R.; Hessling, M.

2014-11-01

One aerobic and four anaerobic batch fermentations of the yeast Saccharomyces cerevisiae were conducted in a stirred bioreactor and monitored inline by NIR spectroscopy and a transflectance dip probe. From the acquired NIR spectra, chemometric partial least squares regression (PLSR) models for predicting biomass, glucose and ethanol were constructed. The spectra were directly measured in the fermentation broth and successfully inspected for adulteration using our novel data pre-processing method. These adulterations manifested as strong fluctuations in the shape and offset of the absorption spectra. They resulted from cells, cell clusters, or gas bubbles intercepting the optical path of the dip probe. In the proposed data pre-processing method, adulterated signals are removed by passing the time-scanned non-averaged spectra through two filter algorithms with a 5% quantile cutoff. The filtered spectra containing meaningful data are then averaged. A second step checks whether the whole time scan is analyzable. If true, the average is calculated and used to prepare the PLSR models. This new method distinctly improved the prediction results. To dissociate possible correlations between analyte concentrations, such as glucose and ethanol, the feeding analytes were alternately supplied at different concentrations (spiking) at the end of the four anaerobic fermentations. This procedure yielded low-error (anaerobic) PLSR models for predicting analyte concentrations of 0.31 g/l for biomass, 3.41 g/l for glucose, and 2.17 g/l for ethanol. The maximum concentrations were 14 g/l biomass, 167 g/l glucose, and 80 g/l ethanol. Data from the aerobic fermentation, carried out under high agitation and high aeration, were incorporated to realize combined PLSR models, which have not been previously reported to our knowledge.

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

PubMed Central

Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-01-01

Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

PubMed

Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-11-01

Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

A Proteome-wide Fission Yeast Interactome Reveals Network Evolution Principles from Yeasts to Human.

PubMed

Vo, Tommy V; Das, Jishnu; Meyer, Michael J; Cordero, Nicolas A; Akturk, Nurten; Wei, Xiaomu; Fair, Benjamin J; Degatano, Andrew G; Fragoza, Robert; Liu, Lisa G; Matsuyama, Akihisa; Trickey, Michelle; Horibata, Sachi; Grimson, Andrew; Yamano, Hiroyuki; Yoshida, Minoru; Roth, Frederick P; Pleiss, Jeffrey A; Xia, Yu; Yu, Haiyuan

2016-01-14

Here, we present FissionNet, a proteome-wide binary protein interactome for S. pombe, comprising 2,278 high-quality interactions, of which ∼ 50% were previously not reported in any species. FissionNet unravels previously unreported interactions implicated in processes such as gene silencing and pre-mRNA splicing. We developed a rigorous network comparison framework that accounts for assay sensitivity and specificity, revealing extensive species-specific network rewiring between fission yeast, budding yeast, and human. Surprisingly, although genes are better conserved between the yeasts, S. pombe interactions are significantly better conserved in human than in S. cerevisiae. Our framework also reveals that different modes of gene duplication influence the extent to which paralogous proteins are functionally repurposed. Finally, cross-species interactome mapping demonstrates that coevolution of interacting proteins is remarkably prevalent, a result with important implications for studying human disease in model organisms. Overall, FissionNet is a valuable resource for understanding protein functions and their evolution. Copyright © 2016 Elsevier Inc. All rights reserved.

Yeasts and moulds contaminants of food ice cubes and their survival in different drinks.

PubMed

Francesca, N; Gaglio, R; Stucchi, C; De Martino, S; Moschetti, G; Settanni, L

2018-01-01

To evaluate the levels of unicellular and filamentous fungi in ice cubes produced at different levels and to determine their survival in alcoholic beverages and soft drinks. Sixty samples of ice cubes collected from home level (HL) productions, bars and pubs (BP) and industrial manufacturing plants (MP) were investigated for the presence and cell density of yeasts and moulds. Moulds were detected in almost all samples, while yeasts developed from the majority of HL and MP samples. Representative colonies of microfungi were subjected to phenotypic and genotypic characterization. The identification was carried out by restriction fragment length polymorphism (RFLP) analysis of the region spanning the internal transcribed spacers (ITS1 and ITS2) and the 5·8S rRNA gene. The process of yeast identification was concluded by sequencing the D1/D2 region of the 26S rRNA gene. The fungal biodiversity associated with food ice was represented by nine yeast and nine mould species. Strains belonging to Candida parapsilosis and Cryptococcus curvatus, both opportunistic human pathogens, and Penicillium glabrum, an ubiquitous mould in the ice samples analysed, were selected to evaluate the effectiveness of the ice cubes to transfer pathogenic microfungi to consumers, after addition to alcoholic beverages and soft drinks. All strains retained their viability. The survival test indicated that the most common mode of consumption of ice cubes, through its direct addition to drinks and beverages, did not reduce the viability of microfungi. This study evidenced the presence of microfungi in food ice and ascertained their survival in soft drinks and alcoholic beverages. © 2017 The Society for Applied Microbiology.

A novel bread making process using salt-stressed Baker's yeast.

PubMed

Yeh, Lien-Te; Charles, Albert Linton; Ho, Chi-Tang; Huang, Tzou-Chi

2009-01-01

By adjusting the mixing order of ingredients in traditional formula, an innovative bread making process was developed. The effect of salt-stressed Baker's yeast on bread dough of different sugar levels was investigated. Baker's yeast was stressed in 7% salt solution then mixed into dough, which was then evaluated for fermentation time, dough fermentation producing gas, dough expansion, bread specific volumes, and sensory and physical properties. The results of this study indicated that salt-stressed Baker's yeast shortened fermentation time in 16% and 24% sugar dough. Forty minutes of salt stress produced significant amount of gas and increased bread specific volumes. The bread was softer and significantly improved sensory properties for aroma, taste, and overall acceptability were obtained.

CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

PubMed

Bai, Baoyan; Moore, Henna M; Laiho, Marikki

2013-01-01

CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

Exploiting Pre-rRNA Processing in Diamond Blackfan Anemia Gene Discovery and Diagnosis

PubMed Central

Farrar, Jason E.; Quarello, Paola; Fisher, Ross; O’Brien, Kelly A.; Aspesi, Anna; Parrella, Sara; Henson, Adrianna L.; Seidel, Nancy E.; Atsidaftos, Eva; Prakash, Supraja; Bari, Shahla; Garelli, Emanuela; Arceci, Robert J.; Dianzani, Irma; Ramenghi, Ugo; Vlachos, Adrianna; Lipton, Jeffrey M.; Bodine, David M.; Ellis, Steven R.

2014-01-01

Diamond Blackfan anemia (DBA), a syndrome primarily characterized by anemia and physical abnormalities, is one among a group of related inherited bone marrow failure syndromes (IBMFS) which share overlapping clinical features. Heterozygous mutations or single-copy deletions have been identified in 12 ribosomal protein genes in approximately 60% of DBA cases, with the genetic etiology unexplained in most remaining patients. Unlike many IBMFS, for which functional screening assays complement clinical and genetic findings, suspected DBA in the absence of typical alterations of the known genes must frequently be diagnosed after exclusion of other IBMFS. We report here a novel deletion in a child that presented such a diagnostic challenge and prompted development of a novel functional assay that can assist in the diagnosis of a significant fraction of patients with DBA. The ribosomal proteins affected in DBA are required for pre-rRNA processing, a process which can be interrogated to monitor steps in the maturation of 40S and 60S ribosomal subunits. In contrast to prior methods used to assess pre-rRNA processing, the assay reported here, based on capillary electrophoresis measurement of the maturation of rRNA in pre-60S ribosomal subunits, would be readily amenable to use in diagnostic laboratories. In addition to utility as a diagnostic tool, we applied this technique to gene discovery in DBA, resulting in the identification of RPL31 as a novel DBA gene. PMID:25042156

Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape.

PubMed

Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

2015-01-01

Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking.

Characterization of pectinase activity for enology from yeasts occurring in Argentine Bonarda grape

PubMed Central

Merín, María Gabriela; Martín, María Carolina; Rantsiou, Kalliopi; Cocolin, Luca; de Ambrosini, Vilma Inés Morata

2015-01-01

Pectinolytic enzymes are greatly important in winemaking due to their ability to degrade pectic polymers from grape, contributing to enhance process efficiency and wine quality. This study aimed to analyze the occurrence of pectinolytic yeasts during spontaneous fermentation of Argentine Bonarda grape, to select yeasts that produce extracellular pectinases and to characterize their pectinolytic activity under wine-like conditions. Isolated yeasts were grouped using PCR-DGGE and identified by partial sequencing of 26S rRNA gene. Isolates comprised 7 genera, with Aureobasidium pullulans as the most predominant pectinolytic species, followed by Rhodotorula dairenensis and Cryptococcus saitoi. No pectinolytic activity was detected among ascomycetous yeasts isolated on grapes and during fermentation, suggesting a low occurrence of pectinolytic yeast species in wine fermentation ecosystem. This is the first study reporting R. dairenensis and Cr. saitoi species with pectinolytic activity. R. dairenensis GM-15 produced pectinases that proved to be highly active at grape pH, at 12 °C, and under ethanol and SO2 concentrations usually found in vinifications (pectinase activity around 1.1 U/mL). This strain also produced cellulase activity at 12 °C and pH 3.5, but did not produce β-glucosidase activity under these conditions. The strain showed encouraging enological properties for its potential use in low-temperature winemaking. PMID:26413065

Rrp5p, Noc1p and Noc2p form a protein module which is part of early large ribosomal subunit precursors in S. cerevisiae

PubMed Central

Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert

2013-01-01

Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

Improvement of stress tolerance and leavening ability under multiple baking-associated stress conditions by overexpression of the SNR84 gene in baker's yeast.

PubMed

Lin, Xue; Zhang, Cui-Ying; Bai, Xiao-Wen; Feng, Bing; Xiao, Dong-Guang

2015-03-16

During the bread-making process, industrial baker's yeast cells are exposed to multiple baking-associated stresses, such as elevated high-temperature, high-sucrose and freeze-thaw stresses. There is a high demand for baker's yeast strains that could withstand these stresses with high leavening ability. The SNR84 gene encodes H/ACA snoRNA (small nucleolar RNA), which is known to be involved in pseudouridylation of the large subunit rRNA. However, the function of the SNR84 gene in baker's yeast coping with baking-associated stresses remains unclear. In this study, we explored the effect of SNR84 overexpression on baker's yeast which was exposed to high-temperature, high-sucrose and freeze-thaw stresses. These results suggest that overexpression of the SNR84 gene conferred tolerance of baker's yeast cells to high-temperature, high-sucrose and freeze-thaw stresses and enhanced their leavening ability in high-sucrose and freeze-thaw dough. These findings could provide a valuable insight for breeding of novel stress-resistant baker's yeast strains that are useful for baking. Copyright © 2015 Elsevier B.V. All rights reserved.

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing

PubMed Central

Goldfarb, Katherine C.; Cech, Thomas R.

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR–Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor—analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing—implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. PMID:28115465

25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications

NASA Technical Reports Server (NTRS)

Baharaeen, S.; Vishniac, H. S.

1984-01-01

Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.

Taggiasca extra virgin olive oil colonization by yeasts during the extraction process.

PubMed

Ciafardini, G; Cioccia, G; Zullo, B A

2017-04-01

The opalescent appearance of the newly produced olive oil is due to the presence of solid particles and microdrops of vegetation water in which the microorganisms from the olives' carposphere are trapped. Present research has demonstrated that the microbiota of the fresh extracted olive oil, produced in the mills, is mainly composed of yeasts and to a lesser extent of molds. The close link between the composition of the microbiota of the olives' carposphere undergoing to processing, and that of the microbiota of the newly produced olive oil, concerns only the yeasts and molds, given that the bacterial component is by and large destroyed mainly in the kneaded paste during the malaxation process. Six physiologically homogenous yeast groups were highlighted in the wash water, kneaded paste and newly produced olive oil from the Taggiasca variety which had been collected in mills located in the Liguria region. The more predominant yeasts of each group belonged to a single species called respectively: Kluyveromyces marxianus, Candida oleophila, Candida diddensiae, Candida norvegica, Wickerhamomyces anomalus and Debaryomyces hansenii. Apart from K. marxianus, which was found only in the wash water, all the other species were found in the wash water and in the kneaded paste as well as in the newly produced olive oil, while in the six-month stored olive oil, was found only one physiologically homogeneous group of yeast represented by the W. anomalus specie. These findings in according to our previous studies carried out on other types of mono varietal olive oils, confirms that the habitat of the Taggiascas' extra virgin olive oil, had a strong selective pressure on the yeast biota, allowing only to a few member of yeast species, contaminating the fresh product, to survive and reproduce in it during storage. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Red and White Yeast Lab: An Introduction to Science as a Process.

ERIC Educational Resources Information Center

White, Brian T.

1999-01-01

Describes an experimental system based on an engineered strain of bakers' yeast that is designed to involve students in the process by which scientific knowledge is generated. Students are asked to determine why the yeast grow to form a reproducible pattern of red and white. (WRM)

Potential benefits of the application of yeast starters in table olive processing.

PubMed

Arroyo-López, Francisco N; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio

2012-01-01

Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.

Potential benefits of the application of yeast starters in table olive processing

PubMed Central

Arroyo-López, Francisco N.; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio

2012-01-01

Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.

Yeast species associated with orange juice: evaluation of different identification methods.

PubMed

Arias, Covadonga R; Burns, Jacqueline K; Friedrich, Lorrie M; Goodrich, Renee M; Parish, Mickey E

2002-04-01

Five different methods were used to identify yeast isolates from a variety of citrus juice sources. A total of 99 strains, including reference strains, were identified using a partial sequence of the 26S rRNA gene, restriction pattern analysis of the internal transcribed spacer region (5.8S-ITS), classical methodology, the RapID Yeast Plus system, and API 20C AUX. Twenty-three different species were identified representing 11 different genera. Distribution of the species was considerably different depending on the type of sample. Fourteen different species were identified from pasteurized single-strength orange juice that had been contaminated after pasteurization (PSOJ), while only six species were isolated from fresh-squeezed, unpasteurized orange juice (FSOJ). Among PSOJ isolates, Candida intermedia and Candida parapsilosis were the predominant species. Hanseniaspora occidentalis and Hanseniaspora uvarum represented up to 73% of total FSOJ isolates. Partial sequence of the 26S rRNA gene yielded the best results in terms of correct identification, followed by classical techniques and 5.8S-ITS analysis. The commercial identification kits RapID Yeast Plus system and API 20C AUX were able to correctly identify only 35 and 13% of the isolates, respectively. Six new 5.8S-ITS profiles were described, corresponding to Clavispora lusitaniae, Geotrichum citri-aurantii, H. occidentalis, H. vineae, Pichia fermentans, and Saccharomycopsis crataegensis. With the addition of these new profiles to the existing database, the use of 5.8S-ITS sequence became the best tool for rapid and accurate identification of yeast isolates from orange juice.

Molecular and physiological characteristics of a grape yeast strain containing atypical genetic material.

PubMed

Cappello, M S; Poltronieri, P; Blaiotta, G; Zacheo, G

2010-11-15

The knowledge about wine yeasts remains largely dominated by the extensive studies on Saccharomyces (S.) cerevisiae. Molecular methods, allowing discrimination of both species and strains in winemaking, can profitably be applied for characterization of the microflora occurring in winemaking and for monitoring the fermentation process. Recently, some novel yeast isolates have been described as hybrid between S. cerevisiae and Saccharomyces species, leaving the Saccharomyces strains containing non-Saccharomyces hybrids essentially unexplored. In this study, we have analyzed a yeast strain isolated from "Primitivo" grape (http://www.ispa.cnr.it/index.php?page=collezioni&lang=en accession number 12998) and we found that, in addition to the S. cerevisiae genome, it has acquired genetic material from a non-Saccharomyces species. The study was focused on the analysis of chromosomal and mitochondrial gene sequences (ITS and 26S rRNA, SSU and COXII, ACTIN-1 and TEF), 2D-PAGE mitochondrial proteins, and spore viability. The results allowed us to formulate the hypothesis that in the MSH199 isolate a DNA containing an rDNA sequence from Hanseniaspora vineae, a non-Saccharomyces yeast, was incorporated through homologous recombination in the grape environment where yeast species are propagated. Moreover, physiological characterization showed that the MSH199 isolate possesses high technological quality traits (fermentation performance) and glycerol production, resistance to ethanol, SO₂ and temperature) useful for industrial application. Copyright © 2010 Elsevier B.V. All rights reserved.

Water quality and antifungal susceptibility of opportunistic yeast pathogens from rivers.

PubMed

Monapathi, M E; Bezuidenhout, C C; Rhode, O H J

2017-03-01

Yeasts from water sources have been associated with diseases ranging from superficial mucosal infections to life threatening diseases. The aim of this study was to determine the water quality as well as diversity and antifungal susceptibility of yeasts from two rivers. Yeast levels and physico-chemical parameter data were analyzed by principal component analysis to determine correlations between physico-chemical data and yeast levels. Yeast morphotypes were identified by biochemical tests and 26S rRNA gene sequencing. Disk diffusion antifungal susceptibility tests were conducted. Physico-chemical parameters of the water were within target water quality range (TWQR) for livestock farming. For irrigational use, total dissolved solids and nitrates were not within the TWQR. Yeast levels ranged between 27 ± 10 and 2,573 ± 306 cfu/L. Only non-pigmented, ascomycetous yeasts were isolated. Saccharomyces cerevisiae and Candida glabrata were most frequently isolated. Several other opportunistic pathogens were also isolated. A large number of isolates were resistant to azoles, especially fluconazole, but also to other antifungal classes. Candida species were resistant to almost all the antifungal classes. These water sources are used for recreation and religious as well as for watering livestock and irrigation. Of particular concern is the direct contact of individuals with opportunistic yeast, especially the immune-compromised. Resistance of these yeast species to antifungal agents is a further health concern.

Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits

PubMed Central

Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.

2013-01-01

Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678

Yeast community in traditional Portuguese Serpa cheese by culture-dependent and -independent DNA approaches.

PubMed

Gonçalves Dos Santos, Maria Teresa P; Benito, María José; Córdoba, María de Guía; Alvarenga, Nuno; Ruiz-Moyano Seco de Herrera, Santiago

2017-12-04

This study investigated the yeast community present in the traditional Portuguese cheese, Serpa, by culture-dependent and -independent methods. Sixteen batches of Serpa cheeses from various regional industries registered with the Protected Designation of Origin (PDO) versus non-PDO registered, during spring and winter, were used. Irrespective of the producer, the yeast counts were around 5log CFU/g in winter and, overall, were lower in spring. The yeast species identified at the end of ripening (30days), using PCR-RFLP analysis and sequencing of the 26S rRNA, mainly corresponded to Debaryomyces hansenii and Kluyveromyces marxianus, with Candida spp. and Pichia spp. present to a lesser extent. The culture-independent results, obtained using high-throughput sequencing analysis, confirmed the prevalence of Debaryomyces spp. and Kluyveromyces spp. but, also, that Galactomyces spp. was relevant for three of the five producers, which indicates its importance during the early stages of the cheese ripening process, considering it was not found among the dominant viable yeast species. In addition, differences between the identified yeast isolated from cheeses obtained from PDO and non-PDO registered industries, showed that the lack of regulation of the cheese-making practice, may unfavourably influence the final yeast microbiota. The new knowledge provided by this study of the yeast diversity in Serpa cheese, could be used to modify the cheese ripening conditions, to favour desirable yeast species. Additionally, the prevalent yeast isolates identified, Debaryomyces hansenii and Kluyveromyces spp., may have an important role during cheese ripening and in the final sensorial characteristics. Thus, the study of their technological and functional properties could be relevant, in the development of an autochthonous starter culture, to ensure final quality and safety of the cheese. Copyright © 2017 Elsevier B.V. All rights reserved.

Dry-grind processing using amylase corn and superior yeast to reduce the exogenous enzyme requirements in bioethanol production.

PubMed

Kumar, Deepak; Singh, Vijay

2016-01-01

Conventional corn dry-grind ethanol production process requires exogenous alpha and glucoamylases enzymes to breakdown starch into glucose, which is fermented to ethanol by yeast. This study evaluates the potential use of new genetically engineered corn and yeast, which can eliminate or minimize the use of these external enzymes, improve the economics and process efficiencies, and simplify the process. An approach of in situ ethanol removal during fermentation was also investigated for its potential to improve the efficiency of high-solid fermentation, which can significantly reduce the downstream ethanol and co-product recovery cost. The fermentation of amylase corn (producing endogenous α-amylase) using conventional yeast and no addition of exogenous α-amylase resulted in ethanol concentration of 4.1 % higher compared to control treatment (conventional corn using exogenous α-amylase). Conventional corn processed with exogenous α-amylase and superior yeast (producing glucoamylase or GA) with no exogenous glucoamylase addition resulted in ethanol concentration similar to control treatment (conventional yeast with exogenous glucoamylase addition). Combination of amylase corn and superior yeast required only 25 % of recommended glucoamylase dose to complete fermentation and achieve ethanol concentration and yield similar to control treatment (conventional corn with exogenous α-amylase, conventional yeast with exogenous glucoamylase). Use of superior yeast with 50 % GA addition resulted in similar increases in yield for conventional or amylase corn of approximately 7 % compared to that of control treatment. Combination of amylase corn, superior yeast, and in situ ethanol removal resulted in a process that allowed complete fermentation of 40 % slurry solids with only 50 % of exogenous GA enzyme requirements and 64.6 % higher ethanol yield compared to that of conventional process. Use of amylase corn and superior yeast in the dry-grind processing industry

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Yeast cell differentiation: Lessons from pathogenic and non-pathogenic yeasts.

PubMed

Palková, Zdena; Váchová, Libuše

2016-09-01

Yeasts, historically considered to be single-cell organisms, are able to activate different differentiation processes. Individual yeast cells can change their life-styles by processes of phenotypic switching such as the switch from yeast-shaped cells to filamentous cells (pseudohyphae or true hyphae) and the transition among opaque, white and gray cell-types. Yeasts can also create organized multicellular structures such as colonies and biofilms, and the latter are often observed as contaminants on surfaces in industry and medical care and are formed during infections of the human body. Multicellular structures are formed mostly of stationary-phase or slow-growing cells that diversify into specific cell subpopulations that have unique metabolic properties and can fulfill specific tasks. In addition to the development of multiple protective mechanisms, processes of metabolic reprogramming that reflect a changed environment help differentiated individual cells and/or community cell constituents to survive harmful environmental attacks and/or to escape the host immune system. This review aims to provide an overview of differentiation processes so far identified in individual yeast cells as well as in multicellular communities of yeast pathogens of the Candida and Cryptococcus spp. and the Candida albicans close relative, Saccharomyces cerevisiae. Molecular mechanisms and extracellular signals potentially involved in differentiation processes are also briefly mentioned. Copyright © 2016 Elsevier Ltd. All rights reserved.

Controlling the strontium-doping in calcium phosphate microcapsules through yeast-regulated biomimetic mineralization.

PubMed

Huang, Miaojun; Li, Tianjie; Pan, Ting; Zhao, Naru; Yao, Yongchang; Zhai, Zhichen; Zhou, Jiaan; Du, Chang; Wang, Yingjun

2016-10-01

Yeast cells have controllable biosorption on metallic ions during metabolism. However, few studies were dedicated to using yeast-regulated biomimetic mineralization process to control the strontium-doped positions in calcium phosphate microcapsules. In this study, the yeast cells were allowed to pre-adsorb strontium ions metabolically and then served as sacrificing template for the precipitation and calcination of mineral shell. The pre-adsorption enabled the microorganism to enrich of strontium ions into the inner part of the microcapsules, which ensured a slow-release profile of the trace element from the microcapsule. The co-culture with human marrow stromal cells showed that gene expressions of alkaline phosphatase and Collagen-I were promoted. The promotion of osteogenic differentiation was further confirmed in the 3D culture of cell-material complexes. The strategy using living microorganism as 'smart doping apparatus' to control incorporation of trace element into calcium phosphate paved a pathway to new functional materials for hard tissue regeneration.

Transposition of an intron in yeast mitochondria requires a protein encoded by that intron.

PubMed

Macreadie, I G; Scott, R M; Zinn, A R; Butow, R A

1985-06-01

The optional 1143 bp intron in the yeast mitochondrial 21S rRNA gene (omega +) is nearly quantitatively inserted in genetic crosses into 21S rRNA alleles that lack it (omega -). The intron contains an open reading frame that can encode a protein of 235 amino acids, but no function has been ascribed to this sequence. We previously found an in vivo double-strand break in omega - DNA at or close to the intron insertion site only in zygotes of omega + X omega - crosses that appears with the same kinetics as intron insertion. We now show that mutations in the intron open reading frame that would alter the translation product simultaneously inhibit nonreciprocal omega recombination and the in vivo double-strand break in omega - DNA. These results provide evidence that the open reading frame encodes a protein required for intron transposition and support the role of the double-strand break in the process.

Assessment of the yeast species composition of cocoa bean fermentations in different cocoa-producing regions using denaturing gradient gel electrophoresis.

PubMed

Papalexandratou, Zoi; De Vuyst, Luc

2011-11-01

The yeast species composition of 12 cocoa bean fermentations carried out in Brazil, Ecuador, Ivory Coast and Malaysia was investigated culture-independently. Denaturing gradient gel electrophoresis of 26S rRNA gene fragments, obtained through polymerase chain reaction with universal eukaryotic primers, was carried out with two different commercial apparatus (the DCode and CBS systems). In general, this molecular method allowed a rapid monitoring of the yeast species prevailing during fermentation. Under similar and optimal denaturing gradient gel electrophoresis conditions, the CBS system allowed a better separated band pattern than the DCode system and an unambiguous detection of the prevailing species present in the fermentation samples. The most frequent yeast species were Hanseniaspora sp., followed by Pichia kudriavzevii and Saccharomyces cerevisiae, independent of the origin of the cocoa. This indicates a restricted yeast species composition of the cocoa bean fermentation process. Exceptionally, the Ivorian cocoa bean box fermentation samples showed a wider yeast species composition, with Hyphopichia burtonii and Meyerozyma caribbica among the main representatives. Yeasts were not detected in the samples when the temperature inside the fermenting cocoa pulp-bean mass reached values higher than 45 °C or under early acetic acid production conditions. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

The yeast RNA1 gene product necessary for RNA processing is located in the cytosol and apparently excluded from the nucleus

PubMed Central

1990-01-01

The yeast RNA1 gene is required for RNA processing and nuclear transport of RNA. The rna1-1 mutation of this locus causes defects in pre-tRNA splicing, processing of the primary pre-rRNA transcript, production of mRNA and export of RNA from the nucleus to the cytosol. To understand how this gene product can pleiotropically affect these processes, we sought to determine the intracellular location of the RNA1 protein. As determined by indirect immunofluorescence localization and organelle fractionation, the RNA1 antigen is found exclusively or primarily in the cytoplasm. Only a tiny fraction of the endogenous protein could be localized to and functional in the nucleus. Furthermore, the RNA1 antigen does not localize differently under stress conditions. These findings suggest that the RNA1 protein is not directly involved in RNA processing but may modify nuclear proteins or otherwise transmit a signal from the cytosol to the nucleus or play a role in maintaining the integrity of the nucleus. PMID:2116418

Yeast Based Sensors

NASA Astrophysics Data System (ADS)

Shimomura-Shimizu, Mifumi; Karube, Isao

Since the first microbial cell sensor was studied by Karube et al. in 1977, many types of yeast based sensors have been developed as analytical tools. Yeasts are known as facultative anaerobes. Facultative anaerobes can survive in both aerobic and anaerobic conditions. The yeast based sensor consisted of a DO electrode and an immobilized omnivorous yeast. In yeast based sensor development, many kinds of yeast have been employed by applying their characteristics to adapt to the analyte. For example, Trichosporon cutaneum was used to estimate organic pollution in industrial wastewater. Yeast based sensors are suitable for online control of biochemical processes and for environmental monitoring. In this review, principles and applications of yeast based sensors are summarized.

Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.

PubMed

Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A

2017-02-01

Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Pre-processing Tasks in Indonesian Twitter Messages

NASA Astrophysics Data System (ADS)

Hidayatullah, A. F.; Ma'arif, M. R.

2017-01-01

Twitter text messages are very noisy. Moreover, tweet data are unstructured and complicated enough. The focus of this work is to investigate pre-processing technique for Twitter messages in Bahasa Indonesia. The main goal of this experiment is to clean the tweet data for further analysis. Thus, the objectives of this pre-processing task is simply removing all meaningless character and left valuable words. In this research, we divide our proposed pre-processing experiments into two parts. The first part is common pre-processing task. The second part is a specific pre-processing task for tweet data. From the experimental result we can conclude that by employing a specific pre-processing task related to tweet data characteristic we obtained more valuable result. The result obtained is better in terms of less meaningful word occurrence which is not significant in number comparing to the result obtained by just running common pre-processing tasks.

Incidence of osmophilic yeasts and Zygosaccharomyces rouxii during the production of concentrate grape juices.

PubMed

Rojo, M C; Torres Palazzolo, C; Cuello, R; González, M; Guevara, F; Ponsone, M L; Mercado, L A; Martínez, C; Combina, M

2017-06-01

Zygosaccharomyces rouxii is the main spoilage yeast of grape juice concentrates. Detection and identification of Z. rouxii during the production of grape juice concentrate is critical to prevent spoilage in the final product. In this work, three grape juice concentrate processing plants were assessed by identifying osmophilic yeasts in juices and surfaces during different stages of a complete production line. Subsequently, molecular typing of Z. rouxii isolates was done to determine the strain distribution of this spoilage yeast. Osmotolerant yeast species, other than Z. rouxii, were mainly recovered from processing plant environments. Z. rouxii was only isolated from surface samples with grape juice remains. Z. rouxii was largely isolated from grape juice samples with some degree of concentration. Storage of grape juice pre-concentrate and concentrate allowed an increase in the Z. rouxii population. A widely distributed dominant molecular Z. rouxii pattern was found in samples from all three processing plants, suggesting resident microbes inside the plant. Copyright © 2016 Elsevier Ltd. All rights reserved.

Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

PubMed

Goldfarb, Katherine C; Cech, Thomas R

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

Cryptococcus fildesensis sp. nov., a psychrophilic basidiomycetous yeast isolated from Antarctic moss.

PubMed

Zhang, Tao; Zhang, Yu-Qin; Liu, Hong-Yu; Su, Jing; Zhao, Li-Xun; Yu, Li-Yan

2014-02-01

Two yeast strains isolated from the moss Chorisodontium aciphyllum from the Fildes Region, King George Island, maritime Antarctica, were classified as members of the genus Cryptococcus based on sequence analyses of the D1/D2 domains of the large subunit rRNA gene and the internal transcribed spacer (ITS) regions. The rRNA gene sequence analyses indicated that the two strains represented a novel species of the genus Cryptococcus, for which the name Cryptococcus fildesensis sp. nov. is proposed (type strain: CPCC 300017(T) = DSM 26442(T) = CBS 12705(T)). The MycoBank number of the novel species is MB 805542.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

PubMed

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

NOP132 is required for proper nucleolus localization of DEAD-box RNA helicase DDX47

PubMed Central

Sekiguchi, Takeshi; Hayano, Toshiya; Yanagida, Mitsuaki; Takahashi, Nobuhiro; Nishimoto, Takeharu

2006-01-01

Previously, we described a novel nucleolar protein, NOP132, which interacts with the small GTP binding protein RRAG A. To elucidate the function of NOP132 in the nucleolus, we identified proteins that interact with NOP132 using mass spectrometric methods. NOP132 associated mainly with proteins involved in ribosome biogenesis and RNA metabolism, including the DEAD-box RNA helicase protein, DDX47, whose yeast homolog is Rrp3, which has roles in pre-rRNA processing. Immunoprecipitation of FLAG-tagged DDX47 co-precipitated rRNA precursors, as well as a number of proteins that are probably involved in ribosome biogenesis, implying that DDX47 plays a role in pre-rRNA processing. Introduction of NOP132 small interfering RNAs induced a ring-like localization of DDX47 in the nucleolus, suggesting that NOP132 is required for the appropriate localization of DDX47 within the nucleolus. We propose that NOP132 functions in the recruitment of pre-rRNA processing proteins, including DDX47, to the region where rRNA is transcribed within the nucleolus. PMID:16963496

Yeast Reporter Assay to Identify Cellular Components of Ricin Toxin A Chain Trafficking.

PubMed

Becker, Björn; Schnöder, Tina; Schmitt, Manfred J

2016-12-06

RTA, the catalytic A-subunit of the ribosome inactivating A/B toxin ricin, inhibits eukaryotic protein biosynthesis by depurination of 28S rRNA. Although cell surface binding of ricin holotoxin is mainly mediated through its B-subunit (RTB), sole application of RTA is also toxic, albeit to a significantly lower extent, suggesting alternative pathways for toxin uptake and transport. Since ricin toxin trafficking in mammalian cells is still not fully understood, we developed a GFP-based reporter assay in yeast that allows rapid identification of cellular components required for RTA uptake and subsequent transport through a target cell. We hereby show that Ypt6p, Sft2p and GARP-complex components play an important role in RTA transport, while neither the retromer complex nor COPIB vesicles are part of the transport machinery. Analyses of yeast knock-out mutants with chromosomal deletion in genes whose products regulate ADP-ribosylation factor GTPases (Arf-GTPases) and/or retrograde Golgi-to-ER (endoplasmic reticulum) transport identified Sso1p, Snc1p, Rer1p, Sec22p, Erv46p, Gea1p and Glo3p as novel components in RTA transport, suggesting the developed reporter assay as a powerful tool to dissect the multistep processes of host cell intoxication in yeast.

IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

PubMed

Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

2016-09-23

The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

Protein Folding Activity of the Ribosome is involved in Yeast Prion Propagation

PubMed Central

Blondel, Marc; Soubigou, Flavie; Evrard, Justine; Nguyen, Phu hai; Hasin, Naushaba; Chédin, Stéphane; Gillet, Reynald; Contesse, Marie-Astrid; Friocourt, Gaëlle; Stahl, Guillaume; Jones, Gary W.; Voisset, Cécile

2016-01-01

6AP and GA are potent inhibitors of yeast and mammalian prions and also specific inhibitors of PFAR, the protein-folding activity borne by domain V of the large rRNA of the large subunit of the ribosome. We therefore explored the link between PFAR and yeast prion [PSI+] using both PFAR-enriched mutants and site-directed methylation. We demonstrate that PFAR is involved in propagation and de novo formation of [PSI+]. PFAR and the yeast heat-shock protein Hsp104 partially compensate each other for [PSI+] propagation. Our data also provide insight into new functions for the ribosome in basal thermotolerance and heat-shocked protein refolding. PFAR is thus an evolutionarily conserved cell component implicated in the prion life cycle, and we propose that it could be a potential therapeutic target for human protein misfolding diseases. PMID:27633137

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Candida xinjiangensis sp. nov., a new anamorphic yeast species isolated from Scolytus scheryrewi Semenov in China.

PubMed

Zhu, Xiao-Feng; Zhang, Dian-Peng; Yang, Sen; Zhang, Qing-Wen

2017-03-01

Three yeast strains designated as S44, XF1 and XF2, respectively, were isolated from Scolytus scheryrewi Semenov of apricot tree in Shule County, Xinjiang, China, and were demonstrated to be a new member of the genus Candida by sequence comparisons of 26S rRNA gene D1/D2 domain and internal transcribed spacer (ITS) region. BLASTn alignments on NCBI showed that the similarity of 26S rRNA gene sequences of S44 (type strain) to all sequences of other Candida yeasts was very low (≦93 %). The phylogenetic tree based on the 26S rRNA gene D1/D2 domain and ITS region sequences revealed that the strain S44 is closely related to C. blattae, C. dosseyi, C. pruni, C. asparagi, C. fructus and C. musae. However, the strain S44 is distinguished from these Candida species by the physiological characteristics. Moreover, the strain S44 formed typical pseudohyphae when grown on cornmeal agar at 25 °C for 7 days, but did not form ascospores in sporulation medium for 3-4 weeks. Therefore, the name Candida xinjiangensis is proposed for the novel species, with S44 (=KCTC T 27747) as the type strain.

Evaluation of a recombinant insect-derived amylase performance in simultaneous saccharification and fermentation process with industrial yeasts.

PubMed

Celińska, Ewelina; Borkowska, Monika; Białas, Wojciech

2016-03-01

Starch is the dominant feedstock consumed for the bioethanol production, accounting for 60 % of its global production. Considering the significant contribution of bioethanol to the global fuel market, any improvement in its major operating technologies is economically very attractive. It was estimated that up to 40 % of the final ethanol unit price is derived from the energy input required for the substrate pre-treatment. Application of raw starch hydrolyzing enzymes (RSHE), combined with operation of the process according to a simultaneous saccharification and fermentation (SSF) strategy, constitutes the most promising solutions to the current technologies limitations. In this study, we expressed the novel RSHE derived from an insect in Saccharomyces cerevisiae strain dedicated for the protein overexpression. Afterwards, the enzyme performance was assessed in SSF process conducted by industrial ethanologenic or thermotolerant yeast species. Comparison of the insect-derived RSHE preparation with commercially available amylolytic RSH preparation was conducted. Our results demonstrate that the recombinant alpha-amylase from rice weevil can be efficiently expressed and secreted with its native signal peptide in S. cerevisiae INVSc-pYES2-Amy1 expression system (accounting for nearly 72 % of the strain's secretome). Application of the recombinant enzyme-based preparation in SSF process secured sufficient amylolytic activity for the yeast cell propagation and ethanol formation from raw starch. (Oligo)saccharide profiles generated by the compared preparations differed with respect to homogeneity of the sugar mixtures. Concomitantly, as demonstrated by a kinetic model developed in this study, the kinetic parameters describing activity of the compared preparations were different.

Optimization of the simultaneous saccharification and fermentation process using thermotolerant yeasts.

PubMed

Ballesteros, I; Oliva, J M; Ballesteros, M; Carrasco, J

1993-01-01

Different treatments to improve the thermotolerance of fermenting yeasts for simultaneous ethanol saccharification and fermentation process of cellulosic materials have been examined. Yeasts of the genera Saccharomyces and Kluyveromyces were tested for growth and fermentation at progressively higher temperatures in the range of 42-47 degrees C. The best results were obtained with K. marxianus LG, which was then submitted to different treatments in order to achieve thermotolerant clones. A total of 35 new clones were obtained that dramatically improved the SSF of 10% Solka-floc substrate at 45 degrees C when compared to the original strain, some with ethanol concentrations as high as 33 g/L.

Characterization of a new clinical yeast species, Candida tunisiensis sp. nov., isolated from a strain collection from Tunisian hospitals.

PubMed

Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed; Sanglard, Dominique

2013-01-01

From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches.

Characterization of a New Clinical Yeast Species, Candida tunisiensis sp. nov., Isolated from a Strain Collection from Tunisian Hospitals

PubMed Central

Eddouzi, Jamel; Hofstetter, Valérie; Groenewald, Marizeth; Manai, Mohamed

2013-01-01

From a collection of yeast isolates isolated from patients in Tunisian hospitals between September 2006 and July 2010, the yeast strain JEY63 (CBS 12513), isolated from a 50-year-old male that suffered from oral thrush, could not be identified to the species level using conventional methods used in clinical laboratories. These methods include matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS), germ tube formation, and the use of CHROMagar Candida and metabolic galleries. Sequence analysis of the nuclear rRNA (18S rRNA, 5.8S rRNA, and 26S rRNA) and internal transcribed spacer regions (ITS1 and ITS2) indicated that the ribosomal DNA sequences of this species were not yet reported. Multiple gene phylogenic analyses suggested that this isolate clustered at the base of the Dipodascaceae (Saccharomycetales, Saccharomycetes, and Ascomycota). JEY63 was named Candida tunisiensis sp. nov. according to several phenotypic criteria and its geographical origin. C. tunisiensis was able to grow at 42°C and does not form chlamydospores and hyphae but could grow as yeast and pseudohyphal forms. C. tunisiensis exhibited most probably a haploid genome with an estimated size of 10 Mb on at least three chromosomes. Using European Committee for Antimicrobial Susceptibility Testing (EUCAST) and Clinical and Laboratory Standards Institute (CLSI) Candida albicans susceptibility breakpoints as a reference, C. tunisiensis was resistant to fluconazole (MIC = 8 μg/ml), voriconazole (MIC = 0.5 μg/ml), itraconazole (MIC = 16 μg/ml), and amphotericin B (MIC = 4 μg/ml) but still susceptible to posaconazole (MIC = 0.008 μg/ml) and caspofungin (MIC = 0.5 μg/ml). In conclusion, MALDI-TOF MS permitted the early selection of an unusual isolate, which was still unreported in molecular databases but could not be unambiguously classified based on phylogenetic approaches. PMID:23077122

Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

PubMed Central

Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

2007-01-01

Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

[Process development for continuous ethanol fermentation by the flocculating yeast under stillage backset conditions].

PubMed

Zi, Lihan; Liu, Chenguang; Bai, Fengwu

2014-02-01

Propionic acid, a major inhibitor to yeast cells, was accumulated during continuous ethanol fermentation from corn meal hydrolysate by the flocculating yeast under stillage backset conditions. Based on its inhibition mechanism in yeast cells, strategies were developed for alleviating this effect. Firstly, high temperature processes such as medium sterilization generated more propionic acid, which should be avoided. Propionic acid was reduced significantly during ethanol fermentation without medium sterilization, and concentrations of biomass and ethanol increased by 59.3% and 7.4%, respectively. Secondly, the running time of stillage backset should be controlled so that propionic acid accumulated would be lower than its half inhibition concentration IC50 (40 mmol/L). Finally, because low pH augmented propionic acid inhibition in yeast cells, a higher pH of 5.5 was validated to be suitable for ethanol fermentation under the stillage backset condition.

A Comparison of the Beneficial Effects of Live and Heat-Inactivated Baker's Yeast on Nile Tilapia: Suggestions on the Role and Function of the Secretory Metabolites Released from the Yeast.

PubMed

Ran, Chao; Huang, Lu; Liu, Zhi; Xu, Li; Yang, Yalin; Tacon, Philippe; Auclair, Eric; Zhou, Zhigang

2015-01-01

Yeast is frequently used as a probiotic in aquaculture with the potential to substitute for antibiotics. In this study, the involvement and extent to which the viability of yeast cells and thus the secretory metabolites released from the yeast contribute to effects of baker's yeast was investigated in Nile tilapia. No yeast, live yeast or heat-inactivated baker's yeast were added to basal diets high in fishmeal and low in soybean (diet A) or low in fishmeal and high in soybean (diet B), which were fed to fish for 8 weeks. Growth, feed utilization, gut microvilli morphology, and expressions of hsp70 and inflammation-related cytokines in the intestine and head kidney were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Gut alkaline phosphatase (AKP) activity was measured after challenging the fish with Aeromonas hydrophila. Results showed that live yeast significantly improved FBW and WG (P < 0.05), and tended to improve FCR (P = 0.06) of fish compared to the control (no yeast). No significant differences were observed between inactivated yeast and control. Live yeast improved gut microvilli length (P < 0.001) and density (P < 0.05) while inactivated yeast did not. The hsp70 expression level in both the intestine and head kidney of fish was significantly reduced by live yeast (P < 0.05) but not inactivated yeast. Live yeast but not inactivated yeast reduced intestinal expression of tnfα (P < 0.05), tgfβ (P < 0.05 under diet A) and il1β (P = 0.08). Intestinal Lactococcus spp. numbers were enriched by both live and inactivated yeast. Lastly, both live and inactivated yeast reduced the gut AKP activity compared to the control (P < 0.001), indicating protection of the host against infection by A. hydrophila. In conclusion, secretory metabolites did not play major roles in the growth promotion and disease protection effects of yeast. Nevertheless, secretory metabolites were the major contributing factor towards improved gut

Isolation, selection and evaluation of yeasts for use in fermentation of coffee beans by the wet process.

PubMed

de Melo Pereira, Gilberto Vinícius; Soccol, Vanete Thomaz; Pandey, Ashok; Medeiros, Adriane Bianchi Pedroni; Andrade Lara, João Marcos Rodrigues; Gollo, André Luiz; Soccol, Carlos Ricardo

2014-10-01

During wet processing of coffee, the ripe cherries are pulped, then fermented and dried. This study reports an experimental approach for target identification and selection of indigenous coffee yeasts and their potential use as starter cultures during the fermentation step of wet processing. A total of 144 yeast isolates originating from spontaneously fermenting coffee beans were identified by molecular approaches and screened for their capacity to grow under coffee-associated stress conditions. According to ITS-rRNA gene sequencing, Pichia fermentans and Pichia kluyveri were the most frequent isolates, followed by Candida Candida glabrata, quercitrusa, Saccharomyces sp., Pichia guilliermondii, Pichia caribbica and Hanseniaspora opuntiae. Nine stress-tolerant yeast strains were evaluated for their ability to produce aromatic compounds in a coffee pulp simulation medium and for their pectinolytic activity. P. fermentans YC5.2 produced the highest concentrations of flavor-active ester compounds (viz., ethyl acetate and isoamyl acetate), while Saccharomyces sp. YC9.15 was the best pectinase-producing strain. The potential impact of these selected yeast strains to promote flavor development in coffee beverages was investigated for inoculating coffee beans during wet fermentation trials at laboratory scale. Inoculation of a single culture of P. fermentans YC5.2 and co-culture of P. fermentans YC5.2 and Saccharomyces sp. YC9.15 enhanced significantly the formation of volatile aroma compounds during the fermentation process compared to un-inoculated control. The sensory analysis indicated that the flavor of coffee beverages was influenced by the starter cultures, being rated as having the higher sensory scores for fruity, buttery and fermented aroma. This demonstrates a complementary role of yeasts associated with coffee quality through the synthesis of yeast-specific volatile constituents. The yeast strains P. fermentans YC5.2 and Saccharomyces sp. YC9.15 have a great

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

The Effects of a Probiotic Yeast on the Bacterial Diversity and Population Structure in the Rumen of Cattle

PubMed Central

Pinloche, Eric; McEwan, Neil; Marden, Jean-Philippe; Bayourthe, Corinne; Auclair, Eric; Newbold, C. Jamie

2013-01-01

It has been suggested that the ability of live yeast to improve milk yield and weight gain in cattle is because the yeast stimulates bacterial activity within the rumen. However it remains unclear if this is a general stimulation of all species or a specific stimulation of certain species. Here we characterised the change in the bacterial population within the rumen of cattle fed supplemental live yeast. Three cannulated lactating cows received a daily ration (24 kg/d) of corn silage (61% of DM), concentrates (30% of DM), dehydrated alfalfa (9% of DM) and a minerals and vitamins mix (1% of DM). The effect of yeast (BIOSAF SC 47, Lesaffre Feed Additives, France; 0.5 or 5 g/d) was compared to a control (no additive) in a 3×3 Latin square design. The variation in the rumen bacterial community between treatments was assessed using Serial Analysis of V1 Ribosomal Sequence Tag (SARST-V1) and 454 pyrosequencing based on analysis of the 16S rRNA gene. Compared to the control diet supplementation of probiotic yeast maintained a healthy fermentation in the rumen of lactating cattle (higher VFA concentration [high yeast dose only], higher rumen pH, and lower Eh and lactate). These improvements were accompanied with a shift in the main fibrolytic group (Fibrobacter and Ruminococcus) and lactate utilising bacteria (Megasphaera and Selenomonas). In addition we have shown that the analysis of short V1 region of 16s rRNA gene (50–60 bp) could give as much phylogenetic information as a longer read (454 pyrosequencing of 250 bp). This study also highlights the difficulty of drawing conclusions on composition and diversity of complex microbiota because of the variation caused by the use of different methods (sequencing technology and/or analysis). PMID:23844101

Biofortification of folates in white wheat bread by selection of yeast strain and process.

PubMed

Hjortmo, Sofia; Patring, Johan; Jastrebova, Jelena; Andlid, Thomas

2008-09-30

We here demonstrate that folate content in yeast fermented food can be dramatically increased by using a proper (i) yeast strain and (ii) cultivation procedure for the selected strain prior to food fermentation. Folate levels were 3 to 5-fold higher in white wheat bread leavened with a Saccharomyces cerevisiae strain CBS7764, cultured in defined medium and harvested in the respiro-fermentative phase of growth prior to dough preparation (135-139 microg/100 dry matter), compared to white wheat bread leavened with commercial Baker's yeast (27-43 microg/100 g). The commercial Baker's yeast strain had been industrially produced, using a fed-batch process, thereafter compressed and stored in the refrigerator until bakings were initiated. This strategy is an attractive alternative to fortification of bread with synthetically produced folic acid. By using a high folate producing strain cultured a suitable way folate levels obtained were in accordance with folic acid content in fortified cereal products.

Presence and changes in populations of yeasts on raw and processed poultry products stored at refrigeration temperature.

PubMed

Ismail, S A; Deak, T; El-Rahman, H A; Yassien, M A; Beuchat, L R

2000-12-05

A study was undertaken to determine populations and profiles of yeast species on fresh and processed poultry products upon purchase from retail supermarkets and after storage at 5 degrees C until shelf life expiration, and to assess the potential role of these yeasts in product spoilage. Fifty samples representing 15 commercial raw, marinated, smoked, or roasted chicken and turkey products were analyzed. Yeast populations were determined by plating on dichloran rose bengal chloramphenicol (DRBC) agar and tryptone glucose yeast extract (TGY) agar. Proteolytic activity was determined using caseinate and gelatin agars and lipolytic activity was determined on plate count agar supplemented with tributyrin. Populations of aerobic microorganisms were also determined. Initial populations of yeasts (log10 cfu/g) ranged from less than 1 (detection limit) to 2.89, and increased by the expiration date to 0.37-5.06, indicating the presence of psychrotrophic species. Highest initial populations were detected in raw chicken breast, wings, and ground chicken, as well as in turkey necks and legs, whereas roasted chicken and turkey products contained less than 1 log10 cfu/g. During storage, yeast populations increased significantly (P < or = 0.05) in whole chicken, ground chicken, liver, heart and gizzard, and in ground turkey and turkey sausage. Isolates (152 strains) of yeasts from poultry products consisted of 12 species. Yarrowia lipolytica and Candida zeylanoides were predominant, making up 39 and 26% of the isolates, respectively. Six different species of basidiomycetous yeasts representing 24% of the isolates were identified. Most Y. lipolytica strains showed strong proteolytic and lipolytic activities, whereas C. zeylanoides was weakly lipolytic. Results suggest that yeasts, particularly Y. lipolytica, may play a more prominent role than previously recognized in the spoilage of fresh and processed poultry stored at 5 degrees C.

Description of Dioszegia patagonica sp. nov., a novel carotenogenic yeast isolated from cold environments.

PubMed

Trochine, Andrea; Turchetti, Benedetta; Vaz, Aline B M; Brandao, Luciana; Rosa, Luiz H; Buzzini, Pietro; Rosa, Carlos; Libkind, Diego

2017-11-01

During a survey of carotenogenic yeasts from cold and oligotrophic environments in Patagonia, several yeasts of the genus Dioszegia (Tremellales, Agaricomycotina) were detected, including three strains that could not be assigned to any known taxa. Analyses of internal transcribed spacer and D1/D2 regions of the large subunit rRNA gene showed these strains are conspecific with several other strains found in the Italian Alps and in Antarctica soil. Phylogenetic analyses showed that 19 of these strains represent a novel yeast species of the genus Dioszegia. The name Dioszegia patagonica sp. nov. is proposed to accommodate these strains and CRUB 1147 T (UFMG 195 T =CBMAI 1564 T =DBVPG 10618 T =CBS 14901 T ; MycoBank MB 819782) was designated as the type strain. This Dioszegia species accumulates biotechnologically valuable compounds such as carotenoid pigments and mycosporines.

The environmental and intrinsic yeast diversity of Cuban cocoa bean heap fermentations.

PubMed

Fernández Maura, Yurelkys; Balzarini, Tom; Clapé Borges, Pablo; Evrard, Pierre; De Vuyst, Luc; Daniel, H-M

2016-09-16

The environmental yeast diversity of spontaneous cocoa bean fermentations in east Cuba was investigated. Seven fermentations, 25 equipment- and handling-related samples, and 115 environmental samples, such as flowers, leaf and cocoa pod surfaces, as well as drosophilid insects, were analysed. The basic fermentation parameters temperature and pH were recorded during five fermentations for at least six days. A total of 435 yeast isolates were identified by a combination of PCR-fingerprinting of genomic DNA with the M13 primer and sequence analysis of DNA from representative isolates, using the internal transcribed spacer region, the D1/D2 region of the large subunit rRNA gene, and an actin gene-encoding fragment, as required. Among 65 yeast species detected, Pichia manshurica and Hanseniaspora opuntiae were the most frequently isolated species, obtained from five and four fermentations, followed in frequency by Pichia kudriavzevii from two fermentations. Saccharomyces cerevisiae was isolated only occasionally. Cocoa fermentation yeast species were also present on processing equipment. The repeated isolation of a preliminarily as Yamadazyma sp. classified species, a group of strains similar to Saccharomycopsis crataegensis from fermentations and equipment, and the isolation of fifteen other potentially novel yeast species in low numbers provides material for further studies. Environmental samples showed higher yeast diversity compared to the fermentations, included the most frequent fermentation species, whereas the most frequently isolated environmental species were Candida carpophila, Candida conglobata, and Candida quercitrusa. Potential selective advantages of the most frequently isolated species were only partly explained by the physiological traits tested. For instance, tolerance to higher ethanol concentrations was more frequent in strains of Pichia spp. and S. cerevisiae compared to Hanseniaspora spp.; the ability to also assimilate ethanol might have

The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

PubMed

Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

2015-12-01

The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Study on the effects of near-future ocean acidification on marine yeasts: a microcosm approach

NASA Astrophysics Data System (ADS)

Krause, Evamaria; Wichels, Antje; Erler, René; Gerdts, Gunnar

2013-12-01

Marine yeasts play an important role in biodegradation and nutrient cycling and are often associated with marine flora and fauna. They show maximum growth at pH levels lower than present-day seawater pH. Thus, contrary to many other marine organisms, they may actually profit from ocean acidification. Hence, we conducted a microcosm study, incubating natural seawater from the North Sea at present-day pH (8.10) and two near-future pH levels (7.81 and 7.67). Yeasts were isolated from the initial seawater sample and after 2 and 4 weeks of incubation. Isolates were classified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and representative isolates were identified by partial sequencing of the large subunit rRNA gene. From the initial seawater sample, we predominantly isolated a yeast-like filamentous fungus related to Aureobasidium pullulans, Cryptococcus sp., Candida sake, and various cold-adapted yeasts. After incubation, we found more different yeast species at near-future pH levels than at present-day pH. Yeasts reacting to low pH were related to Leucosporidium scottii, Rhodotorula mucilaginosa, Cryptococcus sp., and Debaryomyces hansenii. Our results suggest that these yeasts will benefit from seawater pH reductions and give a first indication that the importance of yeasts will increase in a more acidic ocean.

Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

PubMed

He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

2013-01-01

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

Dimorphic cycle in Candida citri sp. nov., a novel yeast species isolated from rotting fruit in Borneo.

PubMed

Sipiczki, Matthias

2011-03-01

Five dimorphic yeast strains were isolated from rotting lime fruits in Borneo. The sequences of the D1/D2 domains of the 26S rRNA genes, the internal transcribed spacer (ITS) chromosomal regions and the 18S rRNA genes were identical in the isolates and differed from the corresponding sequences of all known yeast species. Based on the sequence differences (12-15% in the D1/D2 domain) from the closest relatives and the different pattern of taxonomic traits, the new isolates are assigned the status of a new species, for which the name Candida citri sp. nov. is proposed. Its type strain is 11-469(T) , which has been deposited in Centralbureau voor Schimmelcultures (Utrecht, the Netherlands) as CBS 11858(T) , Culture Collection of Yeasts (Bratislava, Slovakia) as CCY 29-181-1(T) and the National Collection of Agricultural and Industrial Microorganisms (Budapest, Hungary) as NCAIM Y.01978(T) . MycoBank number: MB 519100. The GenBank accession numbers for nucleotide sequences of its D1/D2 domain, ITS and 18S regions are HM803241, HM803242 and HM803243, respectively. Candida citri produces invasive mycelium composed of true septate hyphae that grow towards nutrient-rich parts of the medium and develop large vacuoles at the nongrowing ends of their cells. The hyphae produce blastoconidia, which can establish satellite yeast colonies in the invaded solid substrate. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

The Adder Phenomenon Emerges from Independent Control of Pre- and Post-Start Phases of the Budding Yeast Cell Cycle.

PubMed

Chandler-Brown, Devon; Schmoller, Kurt M; Winetraub, Yonatan; Skotheim, Jan M

2017-09-25

Although it has long been clear that cells actively regulate their size, the molecular mechanisms underlying this regulation have remained poorly understood. In budding yeast, cell size primarily modulates the duration of the cell-division cycle by controlling the G1/S transition known as Start. We have recently shown that the rate of progression through Start increases with cell size, because cell growth dilutes the cell-cycle inhibitor Whi5 in G1. Recent phenomenological studies in yeast and bacteria have shown that these cells add an approximately constant volume during each complete cell cycle, independent of their size at birth. These results seem to be in conflict, as the phenomenological studies suggest that cells measure the amount they grow, rather than their size, and that size control acts over the whole cell cycle, rather than specifically in G1. Here, we propose an integrated model that unifies the adder phenomenology with the molecular mechanism of G1/S cell-size control. We use single-cell microscopy to parameterize a full cell-cycle model based on independent control of pre- and post-Start cell-cycle periods. We find that our model predicts the size-independent amount of cell growth during the full cell cycle. This suggests that the adder phenomenon is an emergent property of the independent regulation of pre- and post-Start cell-cycle periods rather than the consequence of an underlying molecular mechanism measuring a fixed amount of growth. Copyright © 2017 Elsevier Ltd. All rights reserved.

Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov., four anamorphic, ascomycetous yeast species isolated from soil in Taiwan.

PubMed

Liu, Chun-Hao; Young, Shuh-Sen; Chang, Tsung-Chain; Lee, Ching-Fu

2008-08-01

Nine anamorphic, ascomycetous yeast strains belonging to the Pichia anomala clade were recovered from forest soil in 2006 in Taiwan. The nine yeast strains represent four novel yeast species based on the sequences of their D1/D2 domain of the large subunit (LSU) rRNA gene and their physiological characteristics. The scientific names of Candida dajiaensis sp. nov., Candida yuanshanicus sp. nov., Candida jianshihensis sp. nov., and Candida sanyiensis sp. nov. are proposed for these novel yeast species. The type strains are C. dajiaensis SM11S03(T) (=CBS 10590(T)=BCRC 23099(T)), C. yuanshanicus SY3S02(T) (=CBS 10589(T)=BCRC 23100(T)), C. jianshihensis SM8S04(T) (=CBS 10591(T)=BCRC 23096(T)), and C. sanyiensis SA1S06(T) (=CBS 10592(T)=BCRC 23094(T)). Sequence analysis of the D1/D2 of the LSU rRNA gene revealed that the three species, C. dajiaensis, C. yuanshanicus and Pichia onychis, shared a separate branch in the phylogenetic tree, C. jianshihensis is phylogenetically related to Candida ulmi and Pichia alni, and the phylogenetically closest relative of C. sanyiensis is Pichia populi.

Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

PubMed

Wieckowski, Yana; Schiefelbein, John

2012-07-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

A Comparison of the Beneficial Effects of Live and Heat-Inactivated Baker’s Yeast on Nile Tilapia: Suggestions on the Role and Function of the Secretory Metabolites Released from the Yeast

PubMed Central

Liu, Zhi; Xu, Li; Yang, Yalin; Tacon, Philippe; Auclair, Eric; Zhou, Zhigang

2015-01-01

Yeast is frequently used as a probiotic in aquaculture with the potential to substitute for antibiotics. In this study, the involvement and extent to which the viability of yeast cells and thus the secretory metabolites released from the yeast contribute to effects of baker’s yeast was investigated in Nile tilapia. No yeast, live yeast or heat-inactivated baker’s yeast were added to basal diets high in fishmeal and low in soybean (diet A) or low in fishmeal and high in soybean (diet B), which were fed to fish for 8 weeks. Growth, feed utilization, gut microvilli morphology, and expressions of hsp70 and inflammation-related cytokines in the intestine and head kidney were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Gut alkaline phosphatase (AKP) activity was measured after challenging the fish with Aeromonas hydrophila. Results showed that live yeast significantly improved FBW and WG (P < 0.05), and tended to improve FCR (P = 0.06) of fish compared to the control (no yeast). No significant differences were observed between inactivated yeast and control. Live yeast improved gut microvilli length (P < 0.001) and density (P < 0.05) while inactivated yeast did not. The hsp70 expression level in both the intestine and head kidney of fish was significantly reduced by live yeast (P < 0.05) but not inactivated yeast. Live yeast but not inactivated yeast reduced intestinal expression of tnfα (P < 0.05), tgfβ (P < 0.05 under diet A) and il1β (P = 0.08). Intestinal Lactococcus spp. numbers were enriched by both live and inactivated yeast. Lastly, both live and inactivated yeast reduced the gut AKP activity compared to the control (P < 0.001), indicating protection of the host against infection by A. hydrophila. In conclusion, secretory metabolites did not play major roles in the growth promotion and disease protection effects of yeast. Nevertheless, secretory metabolites were the major contributing factor towards improved gut

Characterization and stability of lactobacilli and yeast microbiota in kefir grains.

PubMed

Vardjan, T; Mohar Lorbeg, P; Rogelj, I; Čanžek Majhenič, A

2013-05-01

Characterization and stability of lactobacilli and yeasts from kefir grains using culture-dependent and culture-independent methods were investigated in this study. Culture-dependent analysis, followed by sequencing of 16S ribosomal DNA for bacteria and 26S rRNA gene for yeasts, revealed 3 different species of lactobacilli and yeasts, respectively. The most frequently isolated bacterial species were Lactobacillus kefiranofaciens ssp. kefirgranum, Lb. parakefiri, and Lb. kefiri, whereas yeasts belonged to Kluyveromyces marxianus, Kazachstania exigua, and Rhodosporidium kratochvilovae. This study is the first to report on the presence of R. kratochvilovae in kefir grains. On the other hand, PCR-denaturing gradient gel electrophoresis in the culture-independent method showed that the dominant microorganisms were Lb. kefiranofaciens ssp. kefirgranum, Kl. marxianus and Ka. exigua, but did not reveal bands corresponding to Lb. parakefiri, Lb. kefiri, or R. kratochvilovae. Our results support the necessity of combining more techniques for detailed and reliable study of microbial communities in kefir grains. Another interesting finding confirmed that the detected dominant microbiota of kefir grains is very stable and did not change over experimental time. This finding is important to ensure consistent product quality. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Effect of Agave tequilana age, cultivation field location and yeast strain on tequila fermentation process.

PubMed

Pinal, L; Cornejo, E; Arellano, M; Herrera, E; Nuñez, L; Arrizon, J; Gschaedler, A

2009-05-01

The effect of yeast strain, the agave age and the cultivation field location of agave were evaluated using kinetic parameters and volatile compound production in the tequila fermentation process. Fermentations were carried out with Agave juice obtained from two cultivation fields (CF1 and CF2), as well as two ages (4 and 8 years) and two Saccharomyces cerevisiae yeast strains (GU3 and AR5) isolated from tequila fermentation must. Sugar consumption and ethanol production varied as a function of cultivation field and agave age. The production of ethyl acetate, 1-propanol, isobutanol and amyl alcohols were influenced in varying degrees by yeast strain, agave age and cultivation field. Methanol production was only affected by the agave age and 2-phenylethanol was influenced only by yeast strain. This work showed that the use of younger Agave tequilana for tequila fermentation resulted in differences in sugar consumption, ethanol and volatile compounds production at the end of fermentation, which could affect the sensory quality of the final product.

Pre-processing and post-processing in group-cluster mergers

NASA Astrophysics Data System (ADS)

Vijayaraghavan, R.; Ricker, P. M.

2013-11-01

Galaxies in clusters are more likely to be of early type and to have lower star formation rates than galaxies in the field. Recent observations and simulations suggest that cluster galaxies may be `pre-processed' by group or filament environments and that galaxies that fall into a cluster as part of a larger group can stay coherent within the cluster for up to one orbital period (`post-processing'). We investigate these ideas by means of a cosmological N-body simulation and idealized N-body plus hydrodynamics simulations of a group-cluster merger. We find that group environments can contribute significantly to galaxy pre-processing by means of enhanced galaxy-galaxy merger rates, removal of galaxies' hot halo gas by ram pressure stripping and tidal truncation of their galaxies. Tidal distortion of the group during infall does not contribute to pre-processing. Post-processing is also shown to be effective: galaxy-galaxy collisions are enhanced during a group's pericentric passage within a cluster, the merger shock enhances the ram pressure on group and cluster galaxies and an increase in local density during the merger leads to greater galactic tidal truncation.

Taming wild yeast: potential of conventional and nonconventional yeasts in industrial fermentations.

PubMed

Steensels, Jan; Verstrepen, Kevin J

2014-01-01

Yeasts are the main driving force behind several industrial food fermentation processes, including the production of beer, wine, sake, bread, and chocolate. Historically, these processes developed from uncontrolled, spontaneous fermentation reactions that rely on a complex mixture of microbes present in the environment. Because such spontaneous processes are generally inconsistent and inefficient and often lead to the formation of off-flavors, most of today's industrial production utilizes defined starter cultures, often consisting of a specific domesticated strain of Saccharomyces cerevisiae, S. bayanus, or S. pastorianus. Although this practice greatly improved process consistency, efficiency, and overall quality, it also limited the sensorial complexity of the end product. In this review, we discuss how Saccharomyces yeasts were domesticated to become the main workhorse of food fermentations, and we investigate the potential and selection of nonconventional yeasts that are often found in spontaneous fermentations, such as Brettanomyces, Hanseniaspora, and Pichia spp.

Study on Lipid Accumulation in Novel Oleaginous Yeast Naganishia liquefaciens NITTS2 Utilizing Pre-digested Municipal Waste Activated Sludge: a Low-cost Feedstock for Biodiesel Production.

PubMed

Selvakumar, P; Sivashanmugam, P

2018-05-05

The economical production of lipids is considered as an appropriate renewable alternative feedstock for biodiesel production because of the contemporary concerns on fuel crisis, climate change and food security. In this study, lipid accumulation potential of a novel oleaginous yeast isolate Naganishia liquefaciens NITTS2 by utilizing pre-digested municipal waste activated sludge (PWAS) was explored. Optimization of culture conditions was performed using response surface methodology coupled with genetic algorithm and maximum lipid content of 55.7% was obtained. The presence of lipid was visually confirmed by fluorescence microscopy and its characteristic profile was determined by GC-MS. The yeast lipid was recovered and converted into biodiesel by garbage lipase with the efficiency of 88.34 ± 1.2%, which was further analyzed by proton nuclear magnetic resonance spectroscopy. Hence, the results of this study strongly suggest the possibility of using PWAS as an efficient and low-cost resource for the production of biodiesel from the oleaginous yeast.

DGGE and multivariate analysis of a yeast community in spontaneous cocoa fermentation process.

PubMed

Ferreira, A C R; Marques, E L S; Dias, J C T; Rezende, R P

2015-12-28

Cocoa bean is the main raw material used in the production of chocolate. In southern Bahia, Brazil, cocoa farming and processing is an important economic activity. The fermentation of cocoa is the processing stage that yields important chocolate flavor precursors and complex microbial involvement is essential for this process. In this study, PCR-denaturing gradient gel electrophoreses (DGGE) was used to investigate the diversity of yeasts present during the spontaneous fermentation of cocoa in southern Bahia. The DGGE analysis revealed a richness of 8 to 13 distinct bands of varied intensities among the samples; and samples taken at 24, 36, and 48 h into the fermentation process were found to group with 70% similarity and showed the greatest diversity of bands. Hierarchical clustering showed that all samples had common operational taxonomic units (OTUs) and the highest number of OTUs was found in the 48 h sample. Variations in pH and temperature observed within the fermenting mass over time possibly had direct effects on the composition of the existing microbial community. The findings reported here indicate that a heterogeneous yeast community is involved in the complex cocoa fermentation process, which is known to involve a succession of specialized microorganisms.

Consolidated Bio-Processing of Cellulosic Biomass for Efficient Biofuel Production Using Yeast Consortium

NASA Astrophysics Data System (ADS)

Goyal, Garima

Fossil fuels have been the major source for liquid transportation fuels for ages. However, decline in oil reserves and environmental concerns have raised a lot of interest in alternative and renewable energy sources. One promising alternative is the conversion of plant biomass into ethanol. The primary biomass feed stocks currently being used for the ethanol industry have been food based biomass (corn and sugar cane). However, interest has recently shifted to replace these traditional feed-stocks with more abundant, non-food based cellulosic biomass such as agriculture wastes (corn stover) or crops (switch grass). The use of cellulosic biomass as feed stock for the production of ethanol via bio-chemical routes presents many technical challenges not faced with the use of corn or sugar-cane as feed-stock. Recently, a new process called consolidated Bio-processing (CBP) has been proposed. This process combines simultaneous saccharification of lignocellulose with fermentation of the resulting sugars into a single process step mediated by a single microorganism or microbial consortium. Although there is no natural microorganism that possesses all properties of lignocellulose utilization and ethanol production desired for CBP, some bacteria and fungi exhibit some of the essential traits. The yeast Saccharomyces cerevisiae is the most attractive host organism for the usage of this strategy due to its high ethanol productivity at close to theoretical yields (0.51g ethanol/g glucose consumed), high osmo- and ethanol- tolerance, natural robustness in industrial processes, and ease of genetic manipulation. Introduction of the cellulosome, found naturally in microorganisms, has shown new directions to deal with recalcitrant biomass. In this case enzymes work in synergy in order to hydrolyze biomass more effectively than in case of free enzymes. A microbial consortium has been successfully developed, which ensures the functional assembly of minicellulosome on the yeast surface

Candida queiroziae sp. nov., a cellobiose-fermenting yeast species isolated from rotting wood in Atlantic Rain Forest.

PubMed

Santos, Renata O; Cadete, Raquel M; Badotti, Fernanda; Mouro, Adriane; Wallheim, Daniela O; Gomes, Fátima C O; Stambuk, Boris U; Lachance, Marc-André; Rosa, Carlos A

2011-03-01

Eight strains of a novel yeast species were isolated from rotting wood and wood-boring insects in Atlantic Rain Forest ecosystems in Brazil. Sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that the yeast belongs to the Scheffersomyces clade and that it is related to Candida lignicola and Candida coipomoensis. The new species was isolated from rotting wood of three different localities and a wood-boring insect suggesting that these substrates are its ecological niche. This new yeast species is able to assimilate cellobiose and other compounds related to rotting wood. Strong fermentation of cellobiose in Durham tubes was observed for the strains of this new yeast. The new species produced an intracellular β-glucosidase responsible for cellobiose hydrolysis. The novel species, Candida queiroziae sp. nov., is proposed to accommodate these isolates. The type strain of C. queiroziae is UFMG-CLM 5.1(T) (=CBS 11853(T) = NRRL Y-48722(T)).

Papiliotrema plantarum sp. nov., a novel tremellaceous sexual yeast species.

PubMed

Into, Parichat; Pontes, Ana; Jacques, Noémie; Casaregola, Serge; Limtong, Savitree; Sampaio, José Paulo

2018-06-01

During a survey of the yeast community associated with the phylloplane of corn in Thailand, a basidiomycetous yeast strain belonging to the genus Papiliotrema was isolated. Analyses of the D1/D2 domains of the 26S (LSU) rRNA gene and complete ITS region supported the recognition of a novel species, for which the name Papiliotrema plantarum sp. nov. is proposed (type strain DMKU-CP801 T =CBS 15220 T =PYCC 7257 T ). Another strain of P. plantarum sp. nov., isolated in French Guiana, was found to be sexually compatible with the Thai isolate and mycelium with clamp connections, basidia and basidiospores were observed in culture. The basidial morphology of P. plantarum combined features previously observed for Papiliotrema bandonii and Papiliotrema fuscus, which represent the only sexual species hitherto known in the genus, i.e. transversely septate basidia, with sexual structures of the Tremella type.

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

PubMed

Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

PubMed Central

Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

2016-01-01

High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2014-01-07

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

PubMed Central

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-01-01

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

PubMed

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

PubMed Central

Wu, Shu; Xiong, Jie; Yu, Yuhe

2015-01-01

Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

PubMed Central

Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

2012-01-01

Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast density and species composition. When yeast densities were compared in pieces of the same fruits assigned to different treatments, fruits that developed low yeast densities in the absence of flies developed significantly higher yeast densities when exposed to larvae. Across all of the fruits, larvae regulated yeast densities within narrow limits, as compared to a much wider range of yeast densities that developed in pieces of the same fruits not exposed to flies. Larvae also affected yeast species composition, dramatically reducing species diversity across fruits, reducing variation in yeast communities from one fruit to the next (beta diversity), and encouraging the consistent development of a yeast community composed of three species of yeast (Candida californica, C. zemplinina, and Pichia kluvyeri), all of which were palatable to larvae. Larvae excreted viable cells of these three yeast species in their fecal pools, and discouraged the growth of filamentous fungi, processes which may have contributed to their effects on the yeast communities in banana fruits. These and other findings suggest that D. melanogaster adults and their larval offspring together engage in ‘niche construction’, facilitating a predictable microbial environment in the fruit substrates in which the larvae live and develop. PMID:22860093

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2013-05-14

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2017-09-12

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2011-05-17

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2016-08-09

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Quasi-programmed aging of budding yeast: a trade-off between programmed processes of cell proliferation, differentiation, stress response, survival and death defines yeast lifespan

PubMed Central

Arlia-Ciommo, Anthony; Piano, Amanda; Leonov, Anna; Svistkova, Veronika; Titorenko, Vladimir I

2014-01-01

Recent findings suggest that evolutionarily distant organisms share the key features of the aging process and exhibit similar mechanisms of its modulation by certain genetic, dietary and pharmacological interventions. The scope of this review is to analyze mechanisms that in the yeast Saccharomyces cerevisiae underlie: (1) the replicative and chronological modes of aging; (2) the convergence of these 2 modes of aging into a single aging process; (3) a programmed differentiation of aging cell communities in liquid media and on solid surfaces; and (4) longevity-defining responses of cells to some chemical compounds released to an ecosystem by other organisms populating it. Based on such analysis, we conclude that all these mechanisms are programs for upholding the long-term survival of the entire yeast population inhabiting an ecological niche; however, none of these mechanisms is a ʺprogram of agingʺ - i.e., a program for progressing through consecutive steps of the aging process. PMID:25485579

Accumulation and metabolism of selenium by yeast cells.

PubMed

Kieliszek, Marek; Błażejak, Stanisław; Gientka, Iwona; Bzducha-Wróbel, Anna

2015-07-01

This paper examines the process of selenium bioaccumulation and selenium metabolism in yeast cells. Yeast cells can bind elements in ionic from the environment and permanently integrate them into their cellular structure. Up to now, Saccharomyces cerevisiae, Candida utilis, and Yarrowia lipolytica yeasts have been used primarily in biotechnological studies to evaluate binding of minerals. Yeast cells are able to bind selenium in the form of both organic and inorganic compounds. The process of bioaccumulation of selenium by microorganisms occurs through two mechanisms: extracellular binding by ligands of membrane assembly and intracellular accumulation associated with the transport of ions across the cytoplasmic membrane into the cell interior. During intracellular metabolism of selenium, oxidation, reduction, methylation, and selenoprotein synthesis processes are involved, as exemplified by detoxification processes that allow yeasts to survive under culture conditions involving the elevated selenium concentrations which were observed. Selenium yeasts represent probably the best absorbed form of this element. In turn, in terms of wide application, the inclusion of yeast with accumulated selenium may aid in lessening selenium deficiency in a diet.

Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

PubMed Central

Wieckowski, Yana; Schiefelbein, John

2012-01-01

Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

Astaxanthinogenesis in the yeast Phaffia rhodozyma - optimization of low-cost culture media and yeast cell-wall lysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fontana, J.D.; Baron, M.; Guimaraes, M.F.

Astaxanthin is a diketo-dihydroxy-carotenoid produced by Phaffia rhodozyma, a basidiomicetous yeast. A low-cost fermentation medium consisting of raw sugarcane juice and urea was developed to exploit the active sucrolytic/urelolytic enzyme apparatus inherent to the yeast. As compared to the beneficial effect of 0.1 g% urea, a ready nitrogen source, mild phosphoric pre inversion of juice sucrose to glucose and fructose, promptly fermentable carbon sources, resulted in smaller benefits. Corn steep liquor (CSL) was found to be a valuable supplement for both yeast biomass yield (9.2 g dry cells/L) and astaxanthin production (1.3 mg/g cells). Distillery effluent (vinace), despite only amore » slightly positive effect on yeast growth, allowed for the highest pigment productivity (1.9 mg/g cells). Trace amounts of Ni{sup 2} (1 mg/L, as a cofactor for urease) resulted in controversial effects, namely, biomass decrease and astaxanthin increase, with no effect on the release (and uptake) of ammonium ion from urea. 13 refs., 6 figs.« less

Transfer RNA Post-Transcriptional Processing, Turnover, and Subcellular Dynamics in the Yeast Saccharomyces cerevisiae

PubMed Central

Hopper, Anita K.

2013-01-01

Transfer RNAs (tRNAs) are essential for protein synthesis. In eukaryotes, tRNA biosynthesis employs a specialized RNA polymerase that generates initial transcripts that must be subsequently altered via a multitude of post-transcriptional steps before the tRNAs beome mature molecules that function in protein synthesis. Genetic, genomic, biochemical, and cell biological approaches possible in the powerful Saccharomyces cerevisiae system have led to exciting advances in our understandings of tRNA post-transcriptional processing as well as to novel insights into tRNA turnover and tRNA subcellular dynamics. tRNA processing steps include removal of transcribed leader and trailer sequences, addition of CCA to the 3′ mature sequence and, for tRNAHis, addition of a 5′ G. About 20% of yeast tRNAs are encoded by intron-containing genes. The three-step splicing process to remove the introns surprisingly occurs in the cytoplasm in yeast and each of the splicing enzymes appears to moonlight in functions in addition to tRNA splicing. There are 25 different nucleoside modifications that are added post-transcriptionally, creating tRNAs in which ∼15% of the residues are nucleosides other than A, G, U, or C. These modified nucleosides serve numerous important functions including tRNA discrimination, translation fidelity, and tRNA quality control. Mature tRNAs are very stable, but nevertheless yeast cells possess multiple pathways to degrade inappropriately processed or folded tRNAs. Mature tRNAs are also dynamic in cells, moving from the cytoplasm to the nucleus and back again to the cytoplasm; the mechanism and function of this retrograde process is poorly understood. Here, the state of knowledge for tRNA post-transcriptional processing, turnover, and subcellular dynamics is addressed, highlighting the questions that remain. PMID:23633143

Mak5 and Ebp2 Act Together on Early Pre-60S Particles and Their Reduced Functionality Bypasses the Requirement for the Essential Pre-60S Factor Nsa1

PubMed Central

Pratte, Dagmar; Singh, Ujjwala; Murat, Guillaume; Kressler, Dieter

2013-01-01

Ribosomes are the molecular machines that translate mRNAs into proteins. The synthesis of ribosomes is therefore a fundamental cellular process and consists in the ordered assembly of 79 ribosomal proteins (r-proteins) and four ribosomal RNAs (rRNAs) into a small 40S and a large 60S ribosomal subunit that form the translating 80S ribosomes. Most of our knowledge concerning this dynamic multi-step process comes from studies with the yeast Saccharomyces cerevisiae, which have shown that assembly and maturation of pre-ribosomal particles, as they travel from the nucleolus to the cytoplasm, relies on a multitude (>200) of biogenesis factors. Amongst these are many energy-consuming enzymes, including 19 ATP-dependent RNA helicases and three AAA-ATPases. We have previously shown that the AAA-ATPase Rix7 promotes the release of the essential biogenesis factor Nsa1 from late nucleolar pre-60S particles. Here we show that mutant alleles of genes encoding the DEAD-box RNA helicase Mak5, the C/D-box snoRNP component Nop1 and the rRNA-binding protein Nop4 bypass the requirement for Nsa1. Interestingly, dominant-negative alleles of RIX7 retain their phenotype in the absence of Nsa1, suggesting that Rix7 may have additional nuclear substrates besides Nsa1. Mak5 is associated with the Nsa1 pre-60S particle and synthetic lethal screens with mak5 alleles identified the r-protein Rpl14 and the 60S biogenesis factors Ebp2, Nop16 and Rpf1, which are genetically linked amongst each other. We propose that these ’Mak5 cluster’ factors orchestrate the structural arrangement of a eukaryote-specific 60S subunit surface composed of Rpl6, Rpl14 and Rpl16 and rRNA expansion segments ES7L and ES39L. Finally, over-expression of Rix7 negatively affects growth of mak5 and ebp2 mutant cells both in the absence and presence of Nsa1, suggesting that Rix7, at least when excessively abundant, may act on structurally defective pre-60S subunits and may subject these to degradation. PMID:24312670

Increased 5S rRNA oxidation in Alzheimer's disease.

PubMed

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

PubMed

Gauthier, A; Turmel, M; Lemieux, C

1988-10-01

A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

Establishment of intestinal microbiota with focus on yeasts of unweaned and weaned piglets kept under different farm conditions.

PubMed

Urubschurov, Vladimir; Janczyk, Pawel; Souffrant, Wolfgang-Bernhard; Freyer, Gertraude; Zeyner, Annette

2011-09-01

This study aimed to characterize the intestinal yeasts in weaning piglets and to establish their possible relationships with main bacterial groups. German Landrace piglets were weaned (WP, n=32) at 28 days of age or kept with the dams until day 39 without creep feed (UP, n=32). The experiment was performed at an experimental and a commercial farm (CF). Faeces were collected from the piglets, sows and pen floors on days 28, 33 and 39 for isolation of DNA and cultivation for enumeration of yeasts, enterobacteria, enterococci and lactobacilli. Fragments of the D1 domain of 26S rRNA gene were amplified and separated by denaturing gradient gel electrophoresis (DGGE). No yeasts could be cultured from water and feed samples. No or only low numbers of yeasts were detected among all UP. In WP at CF, yeasts correlated with lactobacilli (r=0.456; P=0.009) and enterobacteria (r=-0.407; P=0.021). Kazachstania slooffiae dominated among the cultured yeasts. It was the only yeast species detected by PCR-DGGE. Yeasts, especially K. slooffiae, established in the porcine gastrointestinal tract after consumption of grain-based feed and may interrelate with the intestinal microbiota. The study provides data indicating importance of K. slooffiae for the development of balanced porcine gut microbiota. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Candida ficus sp. nov., a novel yeast species from the gut of Apriona germari larvae.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Liu, Zheng

2012-11-01

A novel yeast species is described based on three strains from the gut of wood-boring larvae collected in a tree trunk of Ficus carica cultivated in parks near Nanyang, central China. Phylogenetic analysis based on sequences of the D1/D2 domains of the large subunit rRNA gene showed that these strains occurred in a separate clade that was genetically distinct from all known ascomycetous yeasts. In terms of pairwise sequence divergence, the novel strains differed by 15.3% divergence from the type strain of Pichia terricola, and by 15.8% divergence from the type strains of Pichia exigua and Candida rugopelliculosa in the D1/D2 domains. All three are ascomycetous yeasts in the Pichia clade. Unlike P. terricola, P. exigua and C. rugopelliculosa, the novel isolates did not ferment glucose. The name Candida ficus sp. nov. is proposed to accommodate these highly divergent organisms, with STN-8(T) (=CICC 1980(T)=CBS 12638(T)) as the type strain.

Improving conversion yield of fermentable sugars into fuel ethanol in 1st generation yeast-based production processes.

PubMed

Gombert, Andreas K; van Maris, Antonius J A

2015-06-01

Current fuel ethanol production using yeasts and starch or sucrose-based feedstocks is referred to as 1st generation (1G) ethanol production. These processes are characterized by the high contribution of sugar prices to the final production costs, by high production volumes, and by low profit margins. In this context, small improvements in the ethanol yield on sugars have a large impact on process economy. Three types of strategies used to achieve this goal are discussed: engineering free-energy conservation, engineering redox-metabolism, and decreasing sugar losses in the process. Whereas the two former strategies lead to decreased biomass and/or glycerol formation, the latter requires increased process and/or yeast robustness. Copyright © 2014 Elsevier Ltd. All rights reserved.

Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

PubMed Central

Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

1992-01-01

Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

Kinetic analysis of pre-ribosome structure in vivo

PubMed Central

Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David

2012-01-01

Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724

Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

PubMed Central

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

Molecular monitoring of spoilage yeasts during the production of candied fruit nougats to determine food contamination sources.

PubMed

Martorell, Patricia; Fernández-Espinar, M Teresa; Querol, Amparo

2005-06-15

In the present work, we have analysed the yeast microbiota present in a manufacturing plant of candied fruits and nougats. Four yeasts species (Zygosaccharomyces bailii, Zygosaccharomyces rouxii, Sporobolomyces roseus, and Debaryomyces hansenii) and a filamentous fungi (Nectria mauriiticola) were identified according to restriction analysis of 5.8S-ITS rDNA. These identifications were subsequently confirmed by sequencing the D1/D2 domain of the 26S rRNA gene. Z. rouxii and Z. bailii were isolated at high frequency along the whole manufacturing process. Since food alteration by Z. bailii and Z. rouxii is the cause of important economic losses for the food industry, there is a need for differentiating yeasts at the strain level as an essential part of quality control programs in this industry. For this purpose, we have tested the performance of three molecular techniques (RFLP mtDNA, RAPD-PCR, and microsatellite with (GAC)5 and (GTG)5 primers) to differentiate strains belonging to these two Zygosaccharomyces species. Those techniques with the best discriminatory power were applied to differentiate Zygosaccharomyces species isolates. The results of this analysis indicate that one strain of Z. bailii and two strains of Z. rouxii were involved in the spoilage of candied fruits. Moreover, the Z. bailii strain was also present in the spoiled nougat, hence being responsible of this alteration.

Diversity of endophytic yeasts from sweet orange and their localization by scanning electron microscopy.

PubMed

Gai, Cláudia Santos; Lacava, Paulo Teixeira; Maccheroni, Walter; Glienke, Chirlei; Araújo, Welington Luiz; Miller, Thomas Albert; Azevedo, João Lúcio

2009-10-01

Endophytes are microorganisms that colonize plant tissues internally without causing harm to the host. Despite the increasing number of studies on sweet orange pathogens and endophytes, yeast has not been described as a sweet orange endophyte. In the present study, endophytic yeasts were isolated from sweet orange plants and identified by sequencing of internal transcribed spacer (ITS) rRNA. Plants sampled from four different sites in the state of São Paulo, Brazil exhibited different levels of CVC (citrus variegated chlorosis) development. Three citrus endophytic yeasts (CEYs), chosen as representative examples of the isolates observed, were identified as Rhodotorula mucilaginosa, Pichia guilliermondii and Cryptococcus flavescens. These strains were inoculated into axenic Citrus sinensis seedlings. After 45 days, endophytes were re-isolated in populations ranging from 10(6) to 10(9) CFU/g of plant tissue, but, in spite of the high concentrations of yeast cells, no disease symptoms were observed. Colonized plant material was examined by scanning electron microscopy (SEM), and yeast cells were found mainly in the stomata and xylem of plants, reinforcing their endophytic nature. P. guilliermondii was isolated primarily from plants colonized by the causal agent of CVC, Xylella fastidiosa. The supernatant from a culture of P. guilliermondii increased the in vitro growth of X. fastidiosa, suggesting that the yeast could assist in the establishment of this pathogen in its host plant and, therefore, contribute to the development of disease symptoms. Copyright 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

(GTG)5 MSP-PCR fingerprinting as a technique for discrimination of wine associated yeasts?

PubMed

Ramírez-Castrillón, Mauricio; Mendes, Sandra Denise Camargo; Inostroza-Ponta, Mario; Valente, Patricia

2014-01-01

In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure.

(GTG)5 MSP-PCR Fingerprinting as a Technique for Discrimination of Wine Associated Yeasts?

PubMed Central

Inostroza-Ponta, Mario; Valente, Patricia

2014-01-01

In microbiology, identification of all isolates by sequencing is still unfeasible in small research laboratories. Therefore, many yeast diversity studies follow a screening procedure consisting of clustering the yeast isolates using MSP-PCR fingerprinting, followed by identification of one or a few selected representatives of each cluster by sequencing. Although this procedure has been widely applied in the literature, it has not been properly validated. We evaluated a standardized protocol using MSP-PCR fingerprinting with the primers (GTG)5 and M13 for the discrimination of wine associated yeasts in South Brazil. Two datasets were used: yeasts isolated from bottled wines and vineyard environments. We compared the discriminatory power of both primers in a subset of 16 strains, choosing the primer (GTG)5 for further evaluation. Afterwards, we applied this technique to 245 strains, and compared the results with the identification obtained by partial sequencing of the LSU rRNA gene, considered as the gold standard. An array matrix was constructed for each dataset and used as input for clustering with two methods (hierarchical dendrograms and QAPGrid layout). For both yeast datasets, unrelated species were clustered in the same group. The sensitivity score of (GTG)5 MSP-PCR fingerprinting was high, but specificity was low. As a conclusion, the yeast diversity inferred in several previous studies may have been underestimated and some isolates were probably misidentified due to the compliance to this screening procedure. PMID:25171185

RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

PubMed

Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

2015-10-15

Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Yeasts in sustainable bioethanol production: A review.

PubMed

Mohd Azhar, Siti Hajar; Abdulla, Rahmath; Jambo, Siti Azmah; Marbawi, Hartinie; Gansau, Jualang Azlan; Mohd Faik, Ainol Azifa; Rodrigues, Kenneth Francis

2017-07-01

Bioethanol has been identified as the mostly used biofuel worldwide since it significantly contributes to the reduction of crude oil consumption and environmental pollution. It can be produced from various types of feedstocks such as sucrose, starch, lignocellulosic and algal biomass through fermentation process by microorganisms. Compared to other types of microoganisms, yeasts especially Saccharomyces cerevisiae is the common microbes employed in ethanol production due to its high ethanol productivity, high ethanol tolerance and ability of fermenting wide range of sugars. However, there are some challenges in yeast fermentation which inhibit ethanol production such as high temperature, high ethanol concentration and the ability to ferment pentose sugars. Various types of yeast strains have been used in fermentation for ethanol production including hybrid, recombinant and wild-type yeasts. Yeasts can directly ferment simple sugars into ethanol while other type of feedstocks must be converted to fermentable sugars before it can be fermented to ethanol. The common processes involves in ethanol production are pretreatment, hydrolysis and fermentation. Production of bioethanol during fermentation depends on several factors such as temperature, sugar concentration, pH, fermentation time, agitation rate, and inoculum size. The efficiency and productivity of ethanol can be enhanced by immobilizing the yeast cells. This review highlights the different types of yeast strains, fermentation process, factors affecting bioethanol production and immobilization of yeasts for better bioethanol production.

The power of fission: yeast as a tool for understanding complex splicing.

PubMed

Fair, Benjamin Jung; Pleiss, Jeffrey A

2017-06-01

Pre-mRNA splicing is an essential component of eukaryotic gene expression. Many metazoans, including humans, regulate alternative splicing patterns to generate expansions of their proteome from a limited number of genes. Importantly, a considerable fraction of human disease causing mutations manifest themselves through altering the sequences that shape the splicing patterns of genes. Thus, understanding the mechanistic bases of this complex pathway will be an essential component of combating these diseases. Dating almost to the initial discovery of splicing, researchers have taken advantage of the genetic tractability of budding yeast to identify the components and decipher the mechanisms of splicing. However, budding yeast lacks the complex splicing machinery and alternative splicing patterns most relevant to humans. More recently, many researchers have turned their efforts to study the fission yeast, Schizosaccharomyces pombe, which has retained many features of complex splicing, including degenerate splice site sequences, the usage of exonic splicing enhancers, and SR proteins. Here, we review recent work using fission yeast genetics to examine pre-mRNA splicing, highlighting its promise for modeling the complex splicing seen in higher eukaryotes.

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

PubMed Central

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Characterization of yakju brewed from glutinous rice and wild-type yeast strains isolated from nuruks.

PubMed

Kim, Hye Ryun; Kim, Jae-Ho; Bae, Dong-Hoon; Ahn, Byung-Hak

2010-12-01

Korean traditional rice wines yakju and takju are generally brewed with nuruk as the source of the saccharogenic enzymes by natural fermentation. To improve the quality of Korean rice wine, the microorganisms in the nuruk need to be studied. The objective of this research was to improve the quality of Korean wine with the wild-type yeast strains isolated from the fermentation starter, nuruk. Only strain YA-6 showed high activity in 20% ethanol. Precipitation of Y89-5-3 was similar to that of very flocculent yeast (〉80%) at 75.95%. Using 18S rRNA sequencing, all 10 strains were identified as Saccharomyces cerevisiae. Volatile compounds present in yakju were analyzed by gas chromatography-mass selective detector. The principal component analysis (PCA) of the volatile compounds grouped long-chain esters on the right side of the first principal component, PC1; these compounds were found in yakju that was made with strains YA-6, Y89-5-3, Y89-5- 2, Y90-9, and Y89-1-1. On the other side of PC1 were short-chain esters; these compounds were found in wines that were brewed with strains Y183-2, Y268-3, Y54-3, Y98-4, and Y88-4. Overall, the results indicated that using different wild-type yeast strains in the fermentation process significantly affects the chemical characteristics of the glutinous rice wine.

Wine yeasts for the future.

PubMed

Fleet, Graham H

2008-11-01

International competition within the wine market, consumer demands for newer styles of wines and increasing concerns about the environmental sustainability of wine production are providing new challenges for innovation in wine fermentation. Within the total production chain, the alcoholic fermentation of grape juice by yeasts is a key process where winemakers can creatively engineer wine character and value through better yeast management and, thereby, strategically tailor wines to a changing market. This review considers the importance of yeast ecology and yeast metabolic reactions in determining wine quality, and then discusses new directions for exploiting yeasts in wine fermentation. It covers criteria for selecting and developing new commercial strains, the possibilities of using yeasts other than those in the genus of Saccharomyces, the prospects for mixed culture fermentations and explores the possibilities for high cell density, continuous fermentations.

Taxonomic and predicted metabolic profiles of the human gut microbiome in pre-Columbian mummies.

PubMed

Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Dowd, Scot E; Toranzos, Gary A; Marota, Isolina; Cano, Raul J

2016-11-01

Characterization of naturally mummified human gut remains could potentially provide insights into the preservation and evolution of commensal and pathogenic microorganisms, and metabolic profiles. We characterized the gut microbiome of two pre-Columbian Andean mummies dating to the 10-15th centuries using 16S rRNA gene high-throughput sequencing and metagenomics, and compared them to a previously characterized gut microbiome of an 11th century AD pre-Columbian Andean mummy. Our previous study showed that the Clostridiales represented the majority of the bacterial communities in the mummified gut remains, but that other microbial communities were also preserved during the process of natural mummification, as shown with the metagenomics analyses. The gut microbiome of the other two mummies were mainly comprised by Clostridiales or Bacillales, as demonstrated with 16S rRNA gene amplicon sequencing, many of which are facultative anaerobes, possibly consistent with the process of natural mummification requiring low oxygen levels. Metagenome analyses showed the presence of other microbial groups that were positively or negatively correlated with specific metabolic profiles. The presence of sequences similar to both Trypanosoma cruzi and Leishmania donovani could suggest that these pathogens were prevalent in pre-Columbian individuals. Taxonomic and functional profiling of mummified human gut remains will aid in the understanding of the microbial ecology of the process of natural mummification. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Biotechnology of non-Saccharomyces yeasts--the ascomycetes.

PubMed

Johnson, Eric A

2013-01-01

Saccharomyces cerevisiae and several other yeast species are among the most important groups of biotechnological organisms. S. cerevisiae and closely related ascomycetous yeasts are the major producer of biotechnology products worldwide, exceeding other groups of industrial microorganisms in productivity and economic revenues. Traditional industrial attributes of the S. cerevisiae group include their primary roles in food fermentations such as beers, cider, wines, sake, distilled spirits, bakery products, cheese, sausages, and other fermented foods. Other long-standing industrial processes involving S. cerevisae yeasts are production of fuel ethanol, single-cell protein (SCP), feeds and fodder, industrial enzymes, and small molecular weight metabolites. More recently, non-Saccharomyces yeasts (non-conventional yeasts) have been utilized as industrial organisms for a variety of biotechnological roles. Non-Saccharomyces yeasts are increasingly being used as hosts for expression of proteins, biocatalysts and multi-enzyme pathways for the synthesis of fine chemicals and small molecular weight compounds of medicinal and nutritional importance. Non-Saccharomyces yeasts also have important roles in agriculture as agents of biocontrol, bioremediation, and as indicators of environmental quality. Several of these products and processes have reached commercial utility, while others are in advanced development. The objective of this mini-review is to describe processes currently used by industry and those in developmental stages and close to commercialization primarily from non-Saccharomyces yeasts with an emphasis on new opportunities. The utility of S. cerevisiae in heterologous production of selected products is also described.

Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

PubMed Central

Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

2015-01-01

RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

Comparing Binaural Pre-processing Strategies III

PubMed Central

Warzybok, Anna; Ernst, Stephan M. A.

2015-01-01

A comprehensive evaluation of eight signal pre-processing strategies, including directional microphones, coherence filters, single-channel noise reduction, binaural beamformers, and their combinations, was undertaken with normal-hearing (NH) and hearing-impaired (HI) listeners. Speech reception thresholds (SRTs) were measured in three noise scenarios (multitalker babble, cafeteria noise, and single competing talker). Predictions of three common instrumental measures were compared with the general perceptual benefit caused by the algorithms. The individual SRTs measured without pre-processing and individual benefits were objectively estimated using the binaural speech intelligibility model. Ten listeners with NH and 12 HI listeners participated. The participants varied in age and pure-tone threshold levels. Although HI listeners required a better signal-to-noise ratio to obtain 50% intelligibility than listeners with NH, no differences in SRT benefit from the different algorithms were found between the two groups. With the exception of single-channel noise reduction, all algorithms showed an improvement in SRT of between 2.1 dB (in cafeteria noise) and 4.8 dB (in single competing talker condition). Model predictions with binaural speech intelligibility model explained 83% of the measured variance of the individual SRTs in the no pre-processing condition. Regarding the benefit from the algorithms, the instrumental measures were not able to predict the perceptual data in all tested noise conditions. The comparable benefit observed for both groups suggests a possible application of noise reduction schemes for listeners with different hearing status. Although the model can predict the individual SRTs without pre-processing, further development is necessary to predict the benefits obtained from the algorithms at an individual level. PMID:26721922

New yeasts-new brews: modern approaches to brewing yeast design and development.

PubMed

Gibson, B; Geertman, J-M A; Hittinger, C T; Krogerus, K; Libkind, D; Louis, E J; Magalhães, F; Sampaio, J P

2017-06-01

The brewing industry is experiencing a period of change and experimentation largely driven by customer demand for product diversity. This has coincided with a greater appreciation of the role of yeast in determining the character of beer and the widespread availability of powerful tools for yeast research. Genome analysis in particular has helped clarify the processes leading to domestication of brewing yeast and has identified domestication signatures that may be exploited for further yeast development. The functional properties of non-conventional yeast (both Saccharomyces and non-Saccharomyces) are being assessed with a view to creating beers with new flavours as well as producing flavoursome non-alcoholic beers. The discovery of the psychrotolerant S. eubayanus has stimulated research on de novo S. cerevisiae × S. eubayanus hybrids for low-temperature lager brewing and has led to renewed interest in the functional importance of hybrid organisms and the mechanisms that determine hybrid genome function and stability. The greater diversity of yeast that can be applied in brewing, along with an improved understanding of yeasts' evolutionary history and biology, is expected to have a significant and direct impact on the brewing industry, with potential for improved brewing efficiency, product diversity and, above all, customer satisfaction. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Elevated levels of Era GTPase improve growth, 16S rRNA processing, and 70S ribosome assembly of Escherichia coli lacking highly conserved multifunctional YbeY endoribonuclease.

PubMed

Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C

2018-06-18

YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.

Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

PubMed

Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

2015-03-01

Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

Pre- and Post-Processing Tools to Streamline the CFD Process

NASA Technical Reports Server (NTRS)

Dorney, Suzanne Miller

2002-01-01

This viewgraph presentation provides information on software development tools to facilitate the use of CFD (Computational Fluid Dynamics) codes. The specific CFD codes FDNS and CORSAIR are profiled, and uses for software development tools with these codes during pre-processing, interim-processing, and post-processing are explained.

RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits

PubMed Central

Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.

2010-01-01

A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

NASA Technical Reports Server (NTRS)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

Brewing characteristics of piezosensitive sake yeasts

NASA Astrophysics Data System (ADS)

Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru

2018-04-01

Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.

Distribution of tannin-'tolerant yeasts isolated from Miang, a traditional fermented tea leaf (Camellia sinensis var. assamica) in northern Thailand.

PubMed

Kanpiengjai, Apinun; Chui-Chai, Naradorn; Chaikaew, Siriporn; Khanongnuch, Chartchai

2016-12-05

Miang is a fermented food product prepared from the tea leaves of Camellia sinensis var. assamica, and is traditionally produced in mountainous areas of northern Thailand. Although Miang has a long history and reveals deep-rooted cultural involvement with local people in northern Thailand, little is known regarding its microbial diversity. Yeasts were isolated from 47 Miang samples collected from 28 sampling sites, including eight provinces in upper northern Thailand. A hundred and seven yeast isolates were recovered and identified within 14 species based on the comparison of the D1/D2 sequence of the large subunit (LSU) rRNA gene. Candida ethanolica was determined to be the dominant species that was frequently found in Miang together with minor resident yeast species. All yeast isolates demonstrated their tannin-tolerant capability when cultivated on yeast malt agar (YMA) containing 50g/l tannin, but nine isolates displayed clear zones forming around their colonies, e.g., Debaryomyces hansenii, Cyberlindnera rhodanensis, and Sporidiobolus ruineniae. The results obtained from a visual reading method of tannase revealed that all yeast isolates were positive for methyl gallate, indicating that they possess tannase activity. It is assumed that a tannin-tolerant ability is one of the most important factors for developing a yeast community in Miang. This research study is the first report to describe tannin-tolerant yeasts and yeast communities in traditionally fermented tea leaves. Copyright © 2016. Published by Elsevier B.V.

Incorporation of negative rules and evolution of a fuzzy controller for yeast fermentation process.

PubMed

Birle, Stephan; Hussein, Mohamed Ahmed; Becker, Thomas

2016-08-01

The control of bioprocesses can be very challenging due to the fact that these kinds of processes are highly affected by various sources of uncertainty like the intrinsic behavior of the used microorganisms. Due to the reason that these kinds of process uncertainties are not directly measureable in most cases, the overall control is either done manually because of the experience of the operator or intelligent expert systems are applied, e.g., on the basis of fuzzy logic theory. In the latter case, however, the control concept is mainly represented by using merely positive rules, e.g., "If A then do B". As this is not straightforward with respect to the semantics of the human decision-making process that also includes negative experience in form of constraints or prohibitions, the incorporation of negative rules for process control based on fuzzy logic is emphasized. In this work, an approach of fuzzy logic control of the yeast propagation process based on a combination of positive and negative rules is presented. The process is guided along a reference trajectory for yeast cell concentration by alternating the process temperature. The incorporation of negative rules leads to a much more stable and accurate control of the process as the root mean squared error of reference trajectory and system response could be reduced by an average of 62.8 % compared to the controller using only positive rules.

Impact of osmotic stress and ethanol inhibition in yeast cells on process oscillation associated with continuous very-high-gravity ethanol fermentation

PubMed Central

2013-01-01

Background VHG fermentation is a promising process engineering strategy aiming at improving ethanol titer, and thus saving energy consumption for ethanol distillation and distillage treatment. However, sustained process oscillation was observed during continuous VHG ethanol fermentation, which significantly affected ethanol fermentation performance of the system. Results Sustained process oscillation was investigated in continuous VHG ethanol fermentation, and stresses exerted on yeast cells by osmotic pressure from unfermented sugars and ethanol inhibition developed within the fermentation system were postulated to be major factors triggering this phenomenon. In this article, steady state was established for continuous ethanol fermentation with LG medium containing 120 g/L glucose, and then 160 g/L non-fermentable xylose was supplemented into the LG medium to simulate the osmotic stress on yeast cells under the VHG fermentation condition, but the fermentation process was still at steady state, indicating that the impact of osmotic stress on yeast cells was not the main reason for the process oscillation. However, when 30 g/L ethanol was supplemented into the LG medium to simulate the ethanol inhibition in yeast cells under the VHG fermentation condition, process oscillation was triggered, which was augmented with extended oscillation period and exaggerated oscillation amplitude as ethanol supplementation was increased to 50 g/L, but the process oscillation was gradually attenuated when the ethanol supplementations were stopped, and the steady state was restored. Furthermore, gas stripping was incorporated into the continuous VHG fermentation system to in situ remove ethanol produced by Saccharomyces cerevisiae, and the process oscillation was also attenuated, but restored after the gas stripping was interrupted. Conclusions Experimental results indicated that ethanol inhibition rather than osmotic stress on yeast cells is one of the main factors triggering the

Pre-Processes for Urban Areas Detection in SAR Images

NASA Astrophysics Data System (ADS)

Altay Açar, S.; Bayır, Ş.

2017-11-01

In this study, pre-processes for urban areas detection in synthetic aperture radar (SAR) images are examined. These pre-processes are image smoothing, thresholding and white coloured regions determination. Image smoothing is carried out to remove noises then thresholding is applied to obtain binary image. Finally, candidate urban areas are detected by using white coloured regions determination. All pre-processes are applied by utilizing the developed software. Two different SAR images which are acquired by TerraSAR-X are used in experimental study. Obtained results are shown visually.

Fast kinetic studies of plasmid DNA transfer in intact yeast cells mediated by electropulsation.

PubMed

Ganeva, V; Galutzov, B; Teissie, J

1995-09-25

Intact yeast cell Electrotransformation process was investigated. It is a two step process. The plasmid must be pre-mixed and present in contact with the cells during the pulse. During the millisecond field pulse, plasmid DNA is associated to the envelope. It therefore crosses the membrane by a process which lasts several seconds as shown by its sensitivity to a post pulse addition of DNase. Electrotransformation is not supported by an electrophoretic transfer due to the external field nor by a free diffusion across the electropermeabilized envelope. DNA is first bound during the field pulse and then is transferred by a still unknown active process due to cell metabolism.

Comparison of pre-processing methods for multiplex bead-based immunoassays.

PubMed

Rausch, Tanja K; Schillert, Arne; Ziegler, Andreas; Lüking, Angelika; Zucht, Hans-Dieter; Schulz-Knappe, Peter

2016-08-11

High throughput protein expression studies can be performed using bead-based protein immunoassays, such as the Luminex® xMAP® technology. Technical variability is inherent to these experiments and may lead to systematic bias and reduced power. To reduce technical variability, data pre-processing is performed. However, no recommendations exist for the pre-processing of Luminex® xMAP® data. We compared 37 different data pre-processing combinations of transformation and normalization methods in 42 samples on 384 analytes obtained from a multiplex immunoassay based on the Luminex® xMAP® technology. We evaluated the performance of each pre-processing approach with 6 different performance criteria. Three performance criteria were plots. All plots were evaluated by 15 independent and blinded readers. Four different combinations of transformation and normalization methods performed well as pre-processing procedure for this bead-based protein immunoassay. The following combinations of transformation and normalization were suitable for pre-processing Luminex® xMAP® data in this study: weighted Box-Cox followed by quantile or robust spline normalization (rsn), asinh transformation followed by loess normalization and Box-Cox followed by rsn.

Genomic evolution of the ascomycetous yeasts

USDA-ARS?s Scientific Manuscript database

Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphr...

A Novel Flucytosine-Resistant Yeast Species, Candida pseudoaaseri, Causes Disease in a Cancer Patient ▿

PubMed Central

Pfüller, Roland; Gräser, Yvonne; Erhard, Marcel; Groenewald, Marizeth

2011-01-01

Some members of the genus Candida are among the most common human fungal pathogens and cause serious diseases especially in immunocompromised people. A yeast was isolated from a blood culture from an immunocompromised cancer patient who suffered from acute pneumonia. The growth characteristics of the yeast on CHROMagar Candida were similar to those of Candida tropicalis, whereas the API ID 32C system identified the yeast as Candida silvicola. On the basis of the nucleotide divergence in the D1/D2 domain of the 26S nuclear rRNA (nrRNA) gene, as well as the internal transcribed spacer (ITS) domain of the nrRNA gene region, a new species, Candida pseudoaaseri sp. nov. with type strain VK065094 (CBS 11170T), which was found to be closely related to Candida aaseri, is proposed. While C. aaseri strains were susceptible to all tested antifungals, the new species is resistant to flucytosine and may also be distinguished from C. aaseri by its ability to assimilate l-rhamnose, whereas its colony morphology on CHROMagar Candida may be helpful for differentiation. PMID:21976765

Yeast fuel cell: Application for desalination

NASA Astrophysics Data System (ADS)

Mardiana, Ummy; Innocent, Christophe; Cretin, Marc; Buchari, Buchari; Gandasasmita, Suryo

2016-02-01

Yeasts have been implicated in microbial fuel cells as biocatalysts because they are non-pathogenic organisms, easily handled and robust with a good tolerance in different environmental conditions. Here we investigated baker's yeast Saccharomyces cerevisiae through the oxidation of glucose. Yeast was used in the anolyte, to transfer electrons to the anode in the presence of methylene blue as mediator whereas K3Fe(CN)6 was used as an electron acceptor for the reduction reaction in the catholyte. Power production with biofuel cell was coupled with a desalination process. The maximum current density produced by the cell was 88 mA.m-2. In those conditions, it was found that concentration of salt was removed 64% from initial 0.6 M after 1-month operation. This result proves that yeast fuel cells can be used to remove salt through electrically driven membrane processes and demonstrated that could be applied for energy production and desalination. Further developments are in progress to improve power output to make yeast fuel cells applicable for water treatment.

Freeze-drying of yeast cultures.

PubMed

Bond, Chris

2007-01-01

A method is described that allows yeast species to be stored using a variation on the standard freeze-drying method, which employs evaporative cooling in a two-stage process. Yeast cultures are placed in glass ampoules after having been mixed with a lyoprotectant. Primary drying is carried out using a centrifuge head connected to a standard freeze-dryer. Once the centrifuge head is running, air is removed and evaporated liquid is captured in the freeze-dryer. Centrifugation continues for 15 min and primary drying for a further 3 h. The ampoules are constricted using a glass blowing torch. They are then placed on the freeze-dryer manifold for secondary drying under vacuum overnight, using phosphorus pentoxide as a desiccant. The ampoules are sealed and removed from the manifold by melting the constricted section. Although the process causes an initial large drop in viability, further losses after storage are minimal. Yeast strains have remained viable for more than 30 yr when stored using this method and sufficient cells are recovered to produce new working stocks. Although survival rates are strain specific, nearly all National Collection of Yeast Cultures strains covering most yeast genera, have been successfully stored with little or no detectable change in strain characteristics.

Research on pre-processing of QR Code

NASA Astrophysics Data System (ADS)

Sun, Haixing; Xia, Haojie; Dong, Ning

2013-10-01

QR code encodes many kinds of information because of its advantages: large storage capacity, high reliability, full arrange of utter-high-speed reading, small printing size and high-efficient representation of Chinese characters, etc. In order to obtain the clearer binarization image from complex background, and improve the recognition rate of QR code, this paper researches on pre-processing methods of QR code (Quick Response Code), and shows algorithms and results of image pre-processing for QR code recognition. Improve the conventional method by changing the Souvola's adaptive text recognition method. Additionally, introduce the QR code Extraction which adapts to different image size, flexible image correction approach, and improve the efficiency and accuracy of QR code image processing.

The yeast actin cytoskeleton.

PubMed

Mishra, Mithilesh; Huang, Junqi; Balasubramanian, Mohan K

2014-03-01

The actin cytoskeleton is a complex network of dynamic polymers, which plays an important role in various fundamental cellular processes, including maintenance of cell shape, polarity, cell division, cell migration, endocytosis, vesicular trafficking, and mechanosensation. Precise spatiotemporal assembly and disassembly of actin structures is regulated by the coordinated activity of about 100 highly conserved accessory proteins, which nucleate, elongate, cross-link, and sever actin filaments. Both in vivo studies in a wide range of organisms from yeast to metazoans and in vitro studies of purified proteins have helped shape the current understanding of actin dynamics and function. Molecular genetics, genome-wide functional analysis, sophisticated real-time imaging, and ultrastructural studies in concert with biochemical analysis have made yeast an attractive model to understand the actin cytoskeleton, its molecular dynamics, and physiological function. Studies of the yeast actin cytoskeleton have contributed substantially in defining the universal mechanism regulating actin assembly and disassembly in eukaryotes. Here, we review some of the important insights generated by the study of actin cytoskeleton in two important yeast models the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Evolutionary History of Ascomyceteous Yeasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haridas, Sajeet; Riley, Robert; Salamov, Asaf

2014-06-06

Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with amore » large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.« less

Ty3 Retrotransposon Hijacks Mating Yeast RNA Processing Bodies to Infect New Genomes

PubMed Central

Kaake, Robyn; Dawson, Anthony R.; Matheos, Dina; Nagashima, Kunio; Sitlani, Parth; Patterson, Kurt; Chang, Ivan; Huang, Lan; Sandmeyer, Suzanne

2015-01-01

Retrotransposition of the budding yeast long terminal repeat retrotransposon Ty3 is activated during mating. In this study, proteins that associate with Ty3 Gag3 capsid protein during virus-like particle (VLP) assembly were identified by mass spectrometry and screened for roles in mating-stimulated retrotransposition. Components of RNA processing bodies including DEAD box helicases Dhh1/DDX6 and Ded1/DDX3, Sm-like protein Lsm1, decapping protein Dcp2, and 5’ to 3’ exonuclease Xrn1 were among the proteins identified. These proteins associated with Ty3 proteins and RNA, and were required for formation of Ty3 VLP retrosome assembly factories and for retrotransposition. Specifically, Dhh1/DDX6 was required for normal levels of Ty3 genomic RNA, and Lsm1 and Xrn1 were required for association of Ty3 protein and RNA into retrosomes. This role for components of RNA processing bodies in promoting VLP assembly and retrotransposition during mating in a yeast that lacks RNA interference, contrasts with roles proposed for orthologous components in animal germ cell ribonucleoprotein granules in turnover and epigenetic suppression of retrotransposon RNAs. PMID:26421679

Mammalian amyloidogenic proteins promote prion nucleation in yeast.

PubMed

Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

2018-03-02

Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Genetics of Yeasts

NASA Astrophysics Data System (ADS)

Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

The Effects of Pre-processing Strategies for Pediatric Cochlear Implant Recipients

PubMed Central

Rakszawski, Bernadette; Wright, Rose; Cadieux, Jamie H.; Davidson, Lisa S.; Brenner, Christine

2016-01-01

Background Cochlear implants (CIs) have been shown to improve children’s speech recognition over traditional amplification when severe to profound sensorineural hearing loss is present. Despite improvements, understanding speech at low-level intensities or in the presence of background noise remains difficult. In an effort to improve speech understanding in challenging environments, Cochlear Ltd. offers pre-processing strategies that apply various algorithms prior to mapping the signal to the internal array. Two of these strategies include Autosensitivity Control™ (ASC) and Adaptive Dynamic Range Optimization (ADRO®). Based on previous research, the manufacturer’s default pre-processing strategy for pediatrics’ everyday programs combines ASC+ADRO®. Purpose The purpose of this study is to compare pediatric speech perception performance across various pre-processing strategies while applying a specific programming protocol utilizing increased threshold (T) levels to ensure access to very low-level sounds. Research Design This was a prospective, cross-sectional, observational study. Participants completed speech perception tasks in four pre-processing conditions: no pre-processing, ADRO®, ASC, ASC+ADRO®. Study Sample Eleven pediatric Cochlear Ltd. cochlear implant users were recruited: six bilateral, one unilateral, and four bimodal. Intervention Four programs, with the participants’ everyday map, were loaded into the processor with different pre-processing strategies applied in each of the four positions: no pre-processing, ADRO®, ASC, and ASC+ADRO®. Data Collection and Analysis Participants repeated CNC words presented at 50 and 70 dB SPL in quiet and HINT sentences presented adaptively with competing R-Space noise at 60 and 70 dB SPL. Each measure was completed as participants listened with each of the four pre-processing strategies listed above. Test order and condition were randomized. A repeated-measures analysis of variance (ANOVA) was used to

Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

NASA Technical Reports Server (NTRS)

Gutell, R. R.; Larsen, N.; Woese, C. R.

1994-01-01

The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

Respiratory capacity of the Kluyveromyces marxianus yeast isolated from the mezcal process during oxidative stress.

PubMed

Arellano-Plaza, Melchor; Gschaedler-Mathis, Anne; Noriega-Cisneros, Ruth; Clemente-Guerrero, Mónica; Manzo-Ávalos, Salvador; González-Hernández, Juan Carlos; Saavedra-Molina, Alfredo

2013-07-01

During the mezcal fermentation process, yeasts are affected by several stresses that can affect their fermentation capability. These stresses, such as thermal shock, ethanol, osmotic and growth inhibitors are common during fermentation. Cells have improved metabolic systems and they express stress response genes in order to decrease the damage caused during the stress, but to the best of our knowledge, there are no published works exploring the effect of oxidants and prooxidants, such as H2O2 and menadione, during growth. In this article, we describe the behavior of Kluyveromyces marxianus isolated from spontaneous mezcal fermentation during oxidative stress, and compared it with that of Saccharomyces cerevisiae strains that were also obtained from mezcal, using the W303-1A strain as a reference. S. cerevisiae strains showed greater viability after oxidative stress compared with K. marxianus strains. However, when the yeast strains were grown in the presence of oxidants in the media, K. marxianus exhibited a greater ability to grow in menadione than it did in H2O2. Moreover, when K. marxianus SLP1 was grown in a minibioreactor, its behavior when exposed to menadione was different from its behavior with H2O2. The yeast maintained the ability to consume dissolved oxygen during the 4 h subsequent to the addition of menadione, and then stopped respiration. When exposed to H2O2, the yeast stopped consuming oxygen for the following 8 h, but began to consume oxygen when stressors were no longer applied. In conclusion, yeast isolated from spontaneous mezcal fermentation was able to resist oxidative stress for a long period of time.

Bacteria and yeast microbiota in milk kefir grains from different Italian regions.

PubMed

Garofalo, Cristiana; Osimani, Andrea; Milanović, Vesna; Aquilanti, Lucia; De Filippis, Francesca; Stellato, Giuseppina; Di Mauro, Simone; Turchetti, Benedetta; Buzzini, Pietro; Ercolini, Danilo; Clementi, Francesca

2015-08-01

Kefir grains are a unique symbiotic association of different microrganisms, mainly lactic acid bacteria, yeasts and occasionally acetic acid bacteria, cohabiting in a natural polysaccharide and a protein matrix. The microbial composition of kefir grains can be considered as extremely variable since it is strongly influenced by the geographical origin of the grains and by the sub-culturing method used. The aim of this study was to elucidate the bacteria and yeast species occurring in milk kefir grains collected in some Italian regions by combining the results of scanning electron microscopy analysis, viable counts on selective culture media, PCR-DGGE and pyrosequencing. The main bacterial species found was Lactobacillus kefiranofaciens while Dekkera anomala was the predominant yeast. The presence of sub-dominant species ascribed to Streptococcus thermophilus, Lactococcus lactis and Acetobacter genera was also highlighted. In addition, Lc. lactis, Enterococcus sp., Bacillus sp., Acetobacter fabarum, Acetobacter lovaniensis and Acetobacter orientalis were identified as part of the cultivable community. This work further confirms both the importance of combining culture-independent and culture-dependent approaches to study microbial diversity in food and how the combination of multiple 16S rRNA gene targets strengthens taxonomic identification using sequence-based identification approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparative genomics of biotechnologically important yeasts

USDA-ARS?s Scientific Manuscript database

Saccharomyces cerevisiae, is used in the vast majority of the world’s bioprocesses, and its economic significance is unchallenged. It, however, represents only a small slice of yeast physiological diversity. Many other yeasts, are used in lesser known, but commercially important processes that take ...

Candida neustonensis sp. nov., a novel ascomycetous yeast isolated from the sea surface microlayer in Taiwan.

PubMed

Chang, Chin-Feng; Lee, Ching-Fu; Liu, Shiu-Mei

2010-01-01

A new ascomycetous yeast species, Candida neustonensis is proposed in this study based on four strains (SN92(T), SN47, SJ22, SJ25) isolated from sea surface microlayer in Taiwan. These four yeast strains were morphologically, physiologically and phylogenetically identical to each other. No sexual reproduction was observed on 5% malt extract agar, corn meal agar, V8 agar, McClary's acetate agar and potato-dextrose agar. Phylogenetic analysis of the sequences of the D1/D2 domain of the large subunit (LSU) rRNA gene places C. neustonensis as a member of the Pichia guilliermondii clade, it also reveals that the phylogenetically closest relatives of C. neustonensis are C. fukuyamaensis (4.4% divergence), C. xestobii (4.4% divergence) and P. guilliermondii (4.5% divergence). C. neustonensis also is clearly distinguished from other known species in the P. guilliermondii clade based on the results of physiology tests. From these comparison analyses, the following novel yeast species is proposed: Candida neustonensis sp. nov., with strain SN92(T) (= BCRC 23108(T) = JCM 14892(T) = CBS 11061(T)) as the type strain.

Cryptococcus nanyangensis sp. nov., a new basidiomycetous yeast isolated from the gut of wood-boring larvae.

PubMed

Hui, Feng-Li; Niu, Qiu-Hong; Ke, Tao; Li, Ying-Xia

2012-11-01

Two strains of a novel basidiomycetous yeast species were isolated from the gut of wood-boring larvae collected in the Baotianman Nature Reserve, the central China. Sequence analysis of the D1/D2 domains of the large subunit (LSU) rRNA gene and internal transcribed spacer (ITS) regions showed that these yeasts belong to the Bulleromyces clade and formed a cluster together with eleven undescribed Cryptococcus species. The novel species differed from its closest known species, Cryptococcus rajasthanensis, by 3.3 % divergence (15 substitutions and 6 gaps over 630 bases) in the D1/D2 domains, and by 13.4 % divergence (41 substitutions and 27 gaps over 508 bases) in the ITS regions. Physiologically, the fermentation of glucose, galactose, sucrose, trehalose, and raffinose in Durham tubes was observed for the strains of this new yeast. Based on the phenotypical and molecular characteristics presented, the two strains are proposed as a new species, Cryptococcus nanyangensis sp. nov., with the type strain KCY-1(T) (=CICC 1976(T) = CBS 12474(T)).

The rRNA evolution and procaryotic phylogeny

NASA Technical Reports Server (NTRS)

Fox, G. E.

1986-01-01

Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

Yeast as a model for Ras signalling.

PubMed

Tisi, Renata; Belotti, Fiorella; Martegani, Enzo

2014-01-01

For centuries yeast species have been popular hosts for classical biotechnology processes, such as baking, brewing, and wine making, and more recently for recombinant proteins production, thanks to the advantages of unicellular organisms (i.e., ease of genetic manipulation and rapid growth) together with the ability to perform eukaryotic posttranslational modifications. Moreover, yeast cells have been used for few decades as a tool for identifying the genes and pathways involved in basic cellular processes such as the cell cycle, aging, and stress response. In the budding yeast S. cerevisiae the Ras/cAMP/PKA pathway is directly involved in the regulation of metabolism, cell growth, stress resistance, and proliferation in response to the availability of nutrients and in the adaptation to glucose, controlling cytosolic cAMP levels and consequently the cAMP-dependent protein kinase (PKA) activity. Moreover, Ras signalling has been identified in several pathogenic yeasts as a key controller for virulence, due to its involvement in yeast morphogenesis. Nowadays, yeasts are still useful for Ras-like proteins investigation, both as model organisms and as a test tube to study variants of heterologous Ras-like proteins.

Macromitophagy is a longevity assurance process that in chronologically aging yeast limited in calorie supply sustains functional mitochondria and maintains cellular lipid homeostasis

PubMed Central

Burstein, Michelle T.; Koupaki, Olivia; Gomez-Perez, Alejandra; Levy, Sean; Pluska, Lukas; Mattie, Sevan; Rafeh, Rami; Iouk, Tatiana; Sheibani, Sara; Greenwood, Michael; Vali, Hojatollah; Titorenko, Vladimir I.

2013-01-01

Macromitophagy controls mitochondrial quality and quantity. It involves the sequestration of dysfunctional or excessive mitochondria within double-membrane autophagosomes, which then fuse with the vacuole/lysosome to deliver these mitochondria for degradation. To investigate a physiological role of macromitophagy in yeast, we examined how the atg32Δ-dependent mutational block of this process influences the chronological lifespan of cells grown in a nutrient-rich medium containing low (0.2%) concentration of glucose. Under these longevity-extending conditions of caloric restriction (CR) yeast cells are not starving. We also assessed a role of macromitophagy in lifespan extension by lithocholic acid (LCA), a bile acid that prolongs yeast longevity under CR conditions. Our findings imply that macromitophagy is a longevity assurance process underlying the synergistic beneficial effects of CR and LCA on yeast lifespan. Our analysis of how the atg32Δ mutation influences mitochondrial morphology, composition and function revealed that macromitophagy is required to maintain a network of healthy mitochondria. Our comparative analysis of the membrane lipidomes of organelles purified from wild-type and atg32Δ cells revealed that macromitophagy is required for maintaining cellular lipid homeostasis. We concluded that macromitophagy defines yeast longevity by modulating vital cellular processes inside and outside of mitochondria. PMID:23553280

The secretory pathway: exploring yeast diversity.

PubMed

Delic, Marizela; Valli, Minoska; Graf, Alexandra B; Pfeffer, Martin; Mattanovich, Diethard; Gasser, Brigitte

2013-11-01

Protein secretion is an essential process for living organisms. In eukaryotes, this encompasses numerous steps mediated by several hundred cellular proteins. The core functions of translocation through the endoplasmic reticulum membrane, primary glycosylation, folding and quality control, and vesicle-mediated secretion are similar from yeasts to higher eukaryotes. However, recent research has revealed significant functional differences between yeasts and mammalian cells, and even among diverse yeast species. This review provides a current overview of the canonical protein secretion pathway in the model yeast Saccharomyces cerevisiae, highlighting differences to mammalian cells as well as currently unresolved questions, and provides a genomic comparison of the S. cerevisiae pathway to seven other yeast species where secretion has been investigated due to their attraction as protein production platforms, or for their relevance as pathogens. The analysis of Candida albicans, Candida glabrata, Kluyveromyces lactis, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, and Schizosaccharomyces pombe reveals that many - but not all - secretion steps are more redundant in S. cerevisiae due to duplicated genes, while some processes are even absent in this model yeast. Recent research obviates that even where homologous genes are present, small differences in protein sequence and/or differences in the regulation of gene expression may lead to quite different protein secretion phenotypes. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Integrated approach for selecting efficient Saccharomyces cerevisiae for industrial lignocellulosic fermentations: Importance of yeast chassis linked to process conditions.

PubMed

Costa, Carlos E; Romaní, Aloia; Cunha, Joana T; Johansson, Björn; Domingues, Lucília

2017-03-01

In this work, four robust yeast chassis isolated from industrial environments were engineered with the same xylose metabolic pathway. The recombinant strains were physiologically characterized in synthetic xylose and xylose-glucose medium, on non-detoxified hemicellulosic hydrolysates of fast-growing hardwoods (Eucalyptus and Paulownia) and agricultural residues (corn cob and wheat straw) and on Eucalyptus hydrolysate at different temperatures. Results show that the co-consumption of xylose-glucose was dependent on the yeast background. Moreover, heterogeneous results were obtained among different hydrolysates and temperatures for each individual strain pointing to the importance of designing from the very beginning a tailor-made yeast considering the specific raw material and process. Copyright © 2016 Elsevier Ltd. All rights reserved.

preAssemble: a tool for automatic sequencer trace data processing.

PubMed

Adzhubei, Alexei A; Laerdahl, Jon K; Vlasova, Anna V

2006-01-17

Trace or chromatogram files (raw data) are produced by automatic nucleic acid sequencing equipment or sequencers. Each file contains information which can be interpreted by specialised software to reveal the sequence (base calling). This is done by the sequencer proprietary software or publicly available programs. Depending on the size of a sequencing project the number of trace files can vary from just a few to thousands of files. Sequencing quality assessment on various criteria is important at the stage preceding clustering and contig assembly. Two major publicly available packages--Phred and Staden are used by preAssemble to perform sequence quality processing. The preAssemble pre-assembly sequence processing pipeline has been developed for small to large scale automatic processing of DNA sequencer chromatogram (trace) data. The Staden Package Pregap4 module and base-calling program Phred are utilized in the pipeline, which produces detailed and self-explanatory output that can be displayed with a web browser. preAssemble can be used successfully with very little previous experience, however options for parameter tuning are provided for advanced users. preAssemble runs under UNIX and LINUX operating systems. It is available for downloading and will run as stand-alone software. It can also be accessed on the Norwegian Salmon Genome Project web site where preAssemble jobs can be run on the project server. preAssemble is a tool allowing to perform quality assessment of sequences generated by automatic sequencing equipment. preAssemble is flexible since both interactive jobs on the preAssemble server and the stand alone downloadable version are available. Virtually no previous experience is necessary to run a default preAssemble job, on the other hand options for parameter tuning are provided. Consequently preAssemble can be used as efficiently for just several trace files as for large scale sequence processing.

Wickerhamomyces xylosica sp. nov. and Candida phayaonensis sp. nov., two xylose-assimilating yeast species from soil.

PubMed

Limtong, Savitree; Nitiyon, Sukanya; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Am-In, Somjit; Yongmanitchai, Wichien

2012-11-01

Two strains (NT29(T) and NT31(T)) of xylose-assimilating yeasts were obtained from soils collected in northern Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were found to represent two novel ascomycete yeast species. Strain NT29(T) was assigned to the genus Candida belonging to the Pichia clade as a representative of Candida phayaonensis sp. nov.; the type strain is NT29(T) (=BCC 47634(T)=NBRC 108868(T)=CBS 12319(T)). Strain NT31(T) represented a novel Wickerhamomyces species, which was named Wickerhamomyces xylosica sp. nov.; the type strain is NT31(T) (=BCC 47635(T)=NBRC 108869(T)=CBS 12320(T)).

Experimental Systems to Study Yeast Pexophagy.

PubMed

Yamashita, Shun-Ichi; Oku, Masahide; Sakai, Yasuyoshi; Fujiki, Yukio

2017-01-01

Peroxisome abundance is tightly regulated according to the physiological contexts, through regulations of both proliferation and degradation of the organelles. Here, we describe detailed methods to analyze processes for autophagic degradation of peroxisomes, termed pexophagy, in yeast organisms. The assay systems include a method for biochemical detection of pexophagy completion, and one for microscopic visualization of specialized membrane structures acting in pexophagy. As a model yeast organism utilized in studies of pexophagy, the methylotrophic yeast Komagataella phaffii (Pichia pastoris) is referred to in this chapter and related information on the studies with baker's yeast (Saccharomyces cerevisiae) is also included. The described techniques facilitate elucidation of molecular machineries for pexophagy and understanding of peroxisome-selective autophagic pathways.

A rapid method for differentiating Saccharomyces sensu stricto strains from other yeast species in an enological environment.

PubMed

Nardi, Tiziana; Carlot, Milena; De Bortoli, Elena; Corich, Viviana; Giacomini, Alessio

2006-11-01

During programs for the selection of enological yeasts, several hundred natural isolates are usually screened. The scope of these operations is to isolate strains possessing good fermentative properties without necessarily arriving at a precise species designation: in other words, to detect strains belonging to the Saccharomyces sensu stricto complex. In the present study, a pair of primers, designed within the variable D1/D2 region of the 26S subunit of ribosomal yeast RNA, have been constructed. These generate an amplification fragment of 471 bp that is specific for the seven Saccharomyces sensu stricto species, while no signal was obtained for Saccharomyces sensu lato strains (17 species) or for another 18 selected species commonly found in enological environments. A second pair of primers was also constructed, within the 18S rRNA gene, composed of perfectly conserved sequences common for all 42 yeast species examined, which generate a 900 bp (c.) band for all strains. This was used as a positive experimental control in multiplex PCR analysis using all four primers.

Physico-chemical characterization of natural fermentation process of Conservolea and Kalamàta table olives and developement of a protocol for the pre-selection of fermentation starters.

PubMed

Bleve, Gianluca; Tufariello, Maria; Durante, Miriana; Grieco, Francesco; Ramires, Francesca Anna; Mita, Giovanni; Tasioula-Margari, Maria; Logrieco, Antonio Francesco

2015-04-01

Table olives are one of the most important traditional fermented vegetables in Europe and their world consumption is constantly increasing. Conservolea and Kalamàta are the most important table olives Greek varieties. In the Greek system, the final product is obtained by spontaneous fermentations, without any chemical debittering treatment. This natural fermentation process is not predictable and strongly influenced by the physical-chemical conditions and by the presence of microorganisms contaminating the olives. Natural fermentations of Conservolea and Kalamàta cultivars black olives were studied in order to determine microbiological, biochemical and chemical evolution during the process. Following the process conditions generally used by producers, in both cultivars, yeasts were detected throughout the fermentation, whereas lactic acid bacteria (LAB) appeared in the last staged of the process. A new optimized specific protocol was developed to select autochthonous yeast and LAB isolates that can be good candidates as starters. These microorganisms were pre-selected for their ability to adapt to model brines, to have beta-glucosidase activity, not to produce biogenic amines. Chemical compounds deriving by microbiological activities and associated to the three different phases (30, 90 and 180 days) of the fermentation process were identified and were proposed as chemical descriptors to follow the fermentation progress. Copyright © 2014 Elsevier Ltd. All rights reserved.

Yeast biotechnology: teaching the old dog new tricks.

PubMed

Mattanovich, Diethard; Sauer, Michael; Gasser, Brigitte

2014-03-06

Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature.

Enhancing Elementary Pre-service Teachers' Plant Processes Conceptions

NASA Astrophysics Data System (ADS)

Thompson, Stephen L.; Lotter, Christine; Fann, Xumei; Taylor, Laurie

2016-06-01

Researchers examined how an inquiry-based instructional treatment emphasizing interrelated plant processes influenced 210 elementary pre-service teachers' (PTs) conceptions of three plant processes, photosynthesis, cellular respiration, and transpiration, and the interrelated nature of these processes. The instructional treatment required PTs to predict the fate of a healthy plant in a sealed terrarium (Plant-in-a-Jar), justify their predictions, observe the plant over a 5-week period, and complete guided inquiry activities centered on one of the targeted plant processes each week. Data sources included PTs' pre- and post-predictions with accompanying justifications, course artifacts such as weekly terrarium observations and science journal entries, and group models of the interrelated plant processes occurring within the sealed terraria. A subset of 33 volunteer PTs also completed interviews the week the Plant-in-a-Jar scenario was introduced and approximately 4 months after the instructional intervention ended. Pre- and post-predictions from all PTs as well as interview responses from the subgroup of PTs, were coded into categories based on key plant processes emphasized in the Next Generation Science Standards. Study findings revealed that PTs developed more accurate conceptions of plant processes and their interrelated nature as a result of the instructional intervention. Primary patterns of change in PTs' plant process conceptions included development of more accurate conceptions of how water is used by plants, more accurate conceptions of photosynthesis features, and more accurate conceptions of photosynthesis and cellular respiration as transformative processes.

Thermotolerant Yeasts for Bioethanol Production Using Lignocellulosic Substrates

NASA Astrophysics Data System (ADS)

Pasha, Chand; Rao, L. Venkateswar

glucose without a physical and chemical pre-treatment. The pre-treatment processes normally applied on the different substrates are acidic hydrolysis, steam explosion and wet oxidation. A problem for most pretreatment methods is the generation of compounds that are inhibitory towards the fermenting microorganisms, primarily phenols. Degradation products that could have inhibitory action in later fermentation steps are avoided during pre-treatment by wet oxidation. Followed by pre treatment, hydrolysed with enzymes known as cellulases and hemicellulases, which hydrolyse cellulose and hemicellulose respectively. The production of bioethanol requires two steps, fermentation and distillation. Practically all ethanol fermentation is still based on Saccharomyces cerevisiae . The fermentation using thermotolerant yeasts has more advantageous in that they have faster fermentation rates, avoid the cooling costs, and decrease the over all fermentation costs, so that ethanol can be made available at cheaper rates. In addition they can be used for efficient simultaneous saccharification and fermentation of cellulose by cellulases because the temperature optimum of cellulase enzymes (about 40 ° C to 45 ° C) is close to the fermentation temperature of thermotolerant yeasts. Hence selection and improvement of thermotolerant yeasts for bioconversion of lignocellulosic substrates is very useful.

SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

PubMed

Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

2016-03-01

Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Molecular identification and physiological characterization of yeasts, lactic acid bacteria and acetic acid bacteria isolated from heap and box cocoa bean fermentations in West Africa.

PubMed

Visintin, Simonetta; Alessandria, Valentina; Valente, Antonio; Dolci, Paola; Cocolin, Luca

2016-01-04

Yeast, lactic acid bacteria (LAB) and acetic acid bacteria (AAB) populations, isolated from cocoa bean heap and box fermentations in West Africa, have been investigated. The fermentation dynamicswere determined by viable counts, and 106 yeasts, 105 LAB and 82 AAB isolateswere identified by means of rep-PCR grouping and sequencing of the rRNA genes. During the box fermentations, the most abundant species were Saccharomyces cerevisiae, Candida ethanolica, Lactobacillus fermentum, Lactobacillus plantarum, Acetobacter pasteurianus and Acetobacter syzygii, while S. cerevisiae, Schizosaccharomyces pombe, Hanseniaspora guilliermondii, Pichia manshurica, C. ethanolica, Hanseniaspora uvarum, Lb. fermentum, Lb. plantarum, A. pasteurianus and Acetobacter lovaniensis were identified in the heap fermentations. Furthermore, the most abundant species were molecularly characterized by analyzing the rep-PCR profiles. Strains grouped according to the type of fermentations and their progression during the transformation process were also highlighted. The yeast, LAB and AAB isolates were physiologically characterized to determine their ability to grow at different temperatures, as well as at different pH, and ethanol concentrations, tolerance to osmotic stress, and lactic acid and acetic acid inhibition. Temperatures of 45 °C, a pH of 2.5 to 3.5, 12% (v/v) ethanol and high concentrations of lactic and acetic acid have a significant influence on the growth of yeasts, LAB and AAB. Finally, the yeastswere screened for enzymatic activity, and the S. cerevisiae, H. guilliermondii, H. uvarumand C. ethanolica species were shown to possess several enzymes that may impact the quality of the final product.

Candida olivae sp. nov., a novel yeast species from 'Greek-style' black olive fermentation.

PubMed

Nisiotou, Aspasia A; Panagou, Efstathios Z; Nychas, George-John E

2010-05-01

Two yeast strains (FMCC Y-1(T) and FMCC Y-2) were recovered during a survey of the yeast biota associated with fermenting black olives, collected from an olive tree (Olea europaea L. cv. 'Conservolea') orchard in Central Greece. Phylogenetic analysis based on rRNA gene sequences (18S, 26S, and 5.8S-ITS) indicated that the two strains represent a separate species within the Candida membranifaciens clade, in close relation to Candida blattariae NRRL Y-27703(T). Electrophoretic karyotyping and physiological analysis support the affiliation of the two strains to a novel species as Candida olivae sp. nov. The novel strains are conspecific with two Candida sp. strains previously isolated from the Mid-Atlantic Ridge hydrothermal fields [Gadanho & Sampaio (2005). Microb Ecol 50, 408-417], indicating that Candida olivae sp. nov. may occupy diverse ecological niches. FMCC Y-1(T) (=CBS 11171(T) =ATCC MYA-4568(T)) is the type strain.

The development of an unconventional food regeneration process: Quantifying the nutritional components of a model methylotrophic yeast

NASA Technical Reports Server (NTRS)

Petersen, G. R.; Stokes, B. O.

1986-01-01

A hybrid chemical/biological approach to unconventional food regeneration is discussed. Carbon dioxide and water, the major wastes of human metabolism would be converted to methanol by one of several physiochemical processes available (thermal, photocatalytic, etc.). Methanol is then used to supply carbon and energy for the culture of microorganisms which in turn produce biological useful basic food stuffs for human nutrition. Our work has focused on increasing the carbohydrate levels of a candidate methylotrophic yeast to more nearly coincide with human nutritional requirements. Yeasts were chosen due to their high carbohydrate levels compared to bacteria and their present familiarity in the human diet. The initial candidate yeast studied was a thermotolerant strain of Hansenula polymor pha, DL-1. The quantitative results that permit an evaluation of the overall efficiency in hybrid chemical/biological food production schemes are discussed. A preliminary evaluation of the overall efficiency of such schemes is also discussed.

Actin and Endocytosis in Budding Yeast

PubMed Central

Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

2015-01-01

Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

Yeasts Diversity in Fermented Foods and Beverages

NASA Astrophysics Data System (ADS)

Tamang, Jyoti Prakash; Fleet, Graham H.

People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

Candida xylanilytica sp. nov., a xylan-degrading yeast species isolated from Thailand.

PubMed

Boonmak, Chanita; Limtong, Savitree; Jindamorakot, Sasitorn; Am-In, Somjit; Yongmanitchai, Wichien; Suzuki, Ken-ichiro; Nakase, Takashi; Kawasaki, Hiroko

2011-05-01

Xylan is a major component of hemicellulose, which constitutes about 40 % of plant biomass. Hydrolysis of xylan into simple sugars is one of the important steps in the conversion of lignocellulosic material to value-added products. During an investigation of cellulose- and xylan-degrading yeasts, two yeast strains that were able to use cellulose and xylan as sole carbon source were found to represent a phylogenetically distinct species in the Spathaspora clade. The closest species in terms of pairwise sequence similarity in the D1/D2 domain of the LSU rRNA gene was Candida subhashii. The novel species can be distinguished from the other species in the Spathaspora clade based on the ability to assimilate methanol and raffinose, growth in medium containing 60 % glucose, and growth at 42 °C. It ferments glucose but not other carbohydrates. The name Candida xylanilytica sp. nov. is proposed for this species. The type strain is KU-Xn11(T) ( = NBRC 106499(T)  = BCC 34694(T)  = CBS 11761(T)).

Enhancing Elementary Pre-Service Teachers' Plant Processes Conceptions

ERIC Educational Resources Information Center

Thompson, Stephen L.; Lotter, Christine; Fann, Xumei; Taylor, Laurie

2016-01-01

Researchers examined how an inquiry-based instructional treatment emphasizing interrelated plant processes influenced 210 elementary pre-service teachers' (PTs) conceptions of three plant processes, photosynthesis, cellular respiration, and transpiration, and the interrelated nature of these processes. The instructional treatment required PTs to…

Effect of extruded wheat flour and pre-gelatinized cassava starch on process and quality parameters of French-type bread elaborated from frozen dough.

PubMed

Ortolan, Fernanda; Brites, Lara Tatiane G; Montenegro, Flávio M; Schmiele, Marcio; Steel, Caroline J; Clerici, Maria Teresa P S; Almeida, Eveline L; Chang, Yoon K

2015-10-01

This study aimed to verify the potential of extruded wheat flour (EWF) or pre-gelatinized cassava starch (PGS) to improve the process and the quality of French bread elaborated from frozen dough. Three formulations were prepared: 100% control wheat flour (CWF) and the other two formulations with 5% substitution of wheat flour by EWF or PGS. Frozen doughs were frozen stored for seven days and after this period they were thawed, fermented, baked and evaluated for physical, chemical and technological characteristics. Available glucose levels found for EWF (12g/100g), and PGS (11.7g/100g) in relation to CWF (7.1g/100g) showed higher sugar availability for yeasts at the initial stage of proofing, and may also have had a cryoprotective effect when freezing bread doughs. The frozen doughs with EWF or PGS, when thawed and fermented, presented higher volume increase, but after baking, they presented lower volume when compared to the control bread. The results of this study are promising for the use of extruded wheat flour or pre-gelatinized cassava starch as sugar providers for doughs' post-freezing proofing process, improving frozen dough process of French-type bread. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage

PubMed Central

Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

2018-01-01

Objective This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Methods Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. Results In addition to species of Candida glabrata and Pichia kudriavzevii (P. kudriavzevii) previously isolated in WCC and TMR, Pichia manshurica (P. manshurica), Candida ethanolica (C. ethanolica), and Zygosaccharomyces bailii (Z. bailii) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. Conclusion The inhibition of yeasts, particularly P. kudriavzevii, probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast

Characterization of culturable yeast species associating with whole crop corn and total mixed ration silage.

PubMed

Wang, Huili; Hao, Wei; Ning, Tingting; Zheng, Mingli; Xu, Chuncheng

2018-02-01

This study investigated the association of yeast species with improved aerobic stability of total mixed ration (TMR) silages with prolonged ensiling, and clarified the characteristics of yeast species and their role during aerobic deterioration. Whole crop corn (WCC) silages and TMR silages formulated with WCC were ensiled for 7, 14, 28, and 56 d and used for an aerobic stability test. Predominant yeast species were isolated from different periods and identified by sequencing analyses of the 26S rRNA gene D1/D2 domain. Characteristics (assimilation and tolerance) of the yeast species and their role during aerobic deterioration were investigated. In addition to species of Candida glabrata and Pichia kudriavzevii ( P. kudriavzevii ) previously isolated in WCC and TMR, Pichia manshurica ( P. manshurica ), Candida ethanolica ( C. ethanolica ), and Zygosaccharomyces bailii ( Z. bailii ) isolated at great frequency during deterioration, were capable of assimilating lactic or acetic acid and tolerant to acetic acid and might function more in deteriorating TMR silages at early fermentation (7 d and 14 d). With ensiling prolonged to 28 d, silages became more (p<0.01) stable when exposed to air, coinciding with the inhibition of yeast to below the detection limit. Species of P. manshurica that were predominant in deteriorating WCC silages were not detectable in TMR silages. In addition, the predominant yeast species of Z. bailii in deteriorating TMR silages at later fermentation (28 d and 56 d) were not observed in both WCC and WCC silages. The inhibition of yeasts, particularly P. kudriavzevii , probably account for the improved aerobic stability of TMR silages at later fermentation. Fewer species seemed to be involved in aerobic deterioration of silages at later fermentation and Z. bailii was most likely to initiate the aerobic deterioration of TMR silages at later fermentation. The use of WCC in TMR might not influence the predominant yeast species during aerobic

Genomics and the making of yeast biodiversity.

PubMed

Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

2015-12-01

Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Yeast biotechnology: teaching the old dog new tricks

PubMed Central

2014-01-01

Yeasts are regarded as the first microorganisms used by humans to process food and alcoholic beverages. The technology developed out of these ancient processes has been the basis for modern industrial biotechnology. Yeast biotechnology has gained great interest again in the last decades. Joining the potentials of genomics, metabolic engineering, systems and synthetic biology enables the production of numerous valuable products of primary and secondary metabolism, technical enzymes and biopharmaceutical proteins. An overview of emerging and established substrates and products of yeast biotechnology is provided and discussed in the light of the recent literature. PMID:24602262

Interaction with Polyglutamine-expanded Huntingtin Alters Cellular Distribution and RNA Processing of Huntingtin Yeast Two-hybrid Protein A (HYPA)*

PubMed Central

Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

2011-01-01

Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD. PMID:21566141

Interaction with polyglutamine-expanded huntingtin alters cellular distribution and RNA processing of huntingtin yeast two-hybrid protein A (HYPA).

PubMed

Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

2011-07-15

Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD.

SWI/SNF Associates with Nascent Pre-mRNPs and Regulates Alternative Pre-mRNA Processing

PubMed Central

Tyagi, Anu; Ryme, Jessica; Brodin, David; Östlund Farrants, Ann Kristin; Visa, Neus

2009-01-01

The SWI/SNF chromatin remodeling complexes regulate the transcription of many genes by remodeling nucleosomes at promoter regions. In Drosophila, SWI/SNF plays an important role in ecdysone-dependent transcription regulation. Studies in human cells suggest that Brahma (Brm), the ATPase subunit of SWI/SNF, regulates alternative pre-mRNA splicing by modulating transcription elongation rates. We describe, here, experiments that study the association of Brm with transcribed genes in Chironomus tentans and Drosophila melanogaster, the purpose of which was to further elucidate the mechanisms by which Brm regulates pre-mRNA processing. We show that Brm becomes incorporated into nascent Balbiani ring pre-mRNPs co-transcriptionally and that the human Brm and Brg1 proteins are associated with RNPs. We have analyzed the expression profiles of D. melanogaster S2 cells in which the levels of individual SWI/SNF subunits have been reduced by RNA interference, and we show that depletion of SWI/SNF core subunits changes the relative abundance of alternative transcripts from a subset of genes. This observation, and the fact that a fraction of Brm is not associated with chromatin but with nascent pre-mRNPs, suggest that SWI/SNF affects pre-mRNA processing by acting at the RNA level. Ontology enrichment tests indicate that the genes that are regulated post-transcriptionally by SWI/SNF are mostly enzymes and transcription factors that regulate postembryonic developmental processes. In summary, the data suggest that SWI/SNF becomes incorporated into nascent pre-mRNPs and acts post-transcriptionally to regulate not only the amount of mRNA synthesized from a given promoter but also the type of alternative transcript produced. PMID:19424417

Solving ethanol production problems with genetically modified yeast strains

PubMed Central

Abreu-Cavalheiro, A.; Monteiro, G.

2013-01-01

The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast. PMID:24516432

Solving ethanol production problems with genetically modified yeast strains.

PubMed

Abreu-Cavalheiro, A; Monteiro, G

2013-01-01

The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.

Biological diversity of yeasts in the gastrointestinal tract of weaned piglets kept under different farm conditions.

PubMed

Urubschurov, Vladimir; Janczyk, Pawel; Pieper, Robert; Souffrant, Wolfgang B

2008-12-01

The study was conducted to determine yeasts present in the gastrointestinal tract (GIT) of piglets kept under experimental farm (EF) and commercial farm (CF) conditions. Ninety five German Landrace full- and half-sibling piglets were sacrificed at 39 days of age. Sixty eight piglets were weaned at 28th day of life, when they were offered one diet ad libitum. Twenty seven piglets remained unweaned by their dams. None of the piglets received any creep feed before weaning. Digesta samples were collected from 1/3 distal small intestine (SI), caecum and proximal colon. One hundred seventy three colonies of isolated yeasts were characterized by sequence analysis of the PCR-amplified D1/D2 domain of the 26S rRNA gene with following alignment of the recovered sequences to GenBank entries. From the 17 phylotypes found, isolates most closely related to Galactomyces geotrichum, Kazachstania slooffiae and Candida catenulata dominated in the GIT of CF piglets. Kazachstania slooffiae and Candida glabrata dominated in GIT of EF piglets. Sørenson and Morisita-Horn similarity indices between farms were low (0.44 and 0.54 respectively) and the Simpson diversity index was higher for EF (7.58) than for CF (4.34). The study brings new data on yeasts composition in the pig GIT and shows differences in yeasts biodiversity between farms operated at different hygiene conditions.

Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of "Shanxi aged vinegar", a traditional Chinese vinegar.

PubMed

Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng

2012-05-01

Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.

Wickerhamomyces mori sp. nov., an anamorphic yeast species found in the guts of wood-boring insect larvae.

PubMed

Hui, Feng-Li; Chen, Liang; Chu, Xue-Ying; Niu, Qiu-Hong; Ke, Tao

2013-03-01

A novel anamorphic yeast species is described to accommodate three isolates recovered from the guts of three different wood-boring insect larvae collected in Henan, central China. On the basis of sequence analyses of the D1/D2 domains of the large-subunit rRNA gene and the internal transcribed spacer regions, the three strains are assigned to a novel species of the genus Wickerhamomyces, although the formation of ascospores was not observed. These strains also exhibited a number of distinct morphological and physiological characteristics that clearly differentiated them from Wickerhamomyces mucosus, Candida odintsovae and Wickerhamomyces rabaulensis, the most closely related species. In view of the phenotypic differences and unique rRNA gene sequences, we consider that these three isolates represent a novel species of the genus Wickerhamomyces, Wickerhamomyces mori sp. nov. The type strain is NYNU 1216(T) ( = CICC 1983(T)  = CBS 12678(T)).

Evolutionary biology through the lens of budding yeast comparative genomics.

PubMed

Marsit, Souhir; Leducq, Jean-Baptiste; Durand, Éléonore; Marchant, Axelle; Filteau, Marie; Landry, Christian R

2017-10-01

The budding yeast Saccharomyces cerevisiae is a highly advanced model system for studying genetics, cell biology and systems biology. Over the past decade, the application of high-throughput sequencing technologies to this species has contributed to this yeast also becoming an important model for evolutionary genomics. Indeed, comparative genomic analyses of laboratory, wild and domesticated yeast populations are providing unprecedented detail about many of the processes that govern evolution, including long-term processes, such as reproductive isolation and speciation, and short-term processes, such as adaptation to natural and domestication-related environments.

Genomic Evolution of the Ascomycete Yeasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riley, Robert; Haridas, Sajeet; Salamov, Asaf

2015-03-16

Yeasts are important for industrial and biotechnological processes and show remarkable metabolic and phylogenetic diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. Phylogenetic analysis of these and previously published yeast genomes helped resolve the placement of species including Saitoella complicata, Babjeviella inositovora, Hyphopichia burtonii, and Metschnikowia bicuspidata. Moreover, we find that alternative nuclear codon usage, where CUG encodes serine instead of leucine, are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes, and amore » tendency towards more introns in early-diverging species. Analysis of enzyme phylogeny gives insights into the evolution of metabolic capabilities such as methanol utilization and assimilation of alternative carbon sources.« less

Multicenter Study Evaluating the Vitek MS System for Identification of Medically Important Yeasts

PubMed Central

Westblade, Lars F.; Jennemann, Rebecca; Branda, John A.; Bythrow, Maureen; Ferraro, Mary Jane; Garner, Omai B.; Ginocchio, Christine C.; Lewinski, Michael A.; Manji, Ryhana; Mochon, A. Brian; Procop, Gary W.; Richter, Sandra S.; Rychert, Jenna A.; Sercia, Linda

2013-01-01

The optimal management of fungal infections is correlated with timely organism identification. Matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (MS) is revolutionizing the identification of yeasts isolated from clinical specimens. We present a multicenter study assessing the performance of the Vitek MS system (bioMérieux) in identifying medically important yeasts. A collection of 852 isolates was tested, including 20 Candida species (626 isolates, including 58 C. albicans, 62 C. glabrata, and 53 C. krusei isolates), 35 Cryptococcus neoformans isolates, and 191 other clinically relevant yeast isolates; in total, 31 different species were evaluated. Isolates were directly applied to a target plate, followed by a formic acid overlay. Mass spectra were acquired using the Vitek MS system and were analyzed using the Vitek MS v2.0 database. The gold standard for identification was sequence analysis of the D2 region of the 26S rRNA gene. In total, 823 isolates (96.6%) were identified to the genus level and 819 isolates (96.1%) were identified to the species level. Twenty-four isolates (2.8%) were not identified, and five isolates (0.6%) were misidentified. Misidentified isolates included one isolate of C. albicans (n = 58) identified as Candida dubliniensis, one isolate of Candida parapsilosis (n = 73) identified as Candida pelliculosa, and three isolates of Geotrichum klebahnii (n = 6) identified as Geotrichum candidum. The identification of clinically relevant yeasts using MS is superior to the phenotypic identification systems currently employed in clinical microbiology laboratories. PMID:23658267

Multicenter study evaluating the Vitek MS system for identification of medically important yeasts.

PubMed

Westblade, Lars F; Jennemann, Rebecca; Branda, John A; Bythrow, Maureen; Ferraro, Mary Jane; Garner, Omai B; Ginocchio, Christine C; Lewinski, Michael A; Manji, Ryhana; Mochon, A Brian; Procop, Gary W; Richter, Sandra S; Rychert, Jenna A; Sercia, Linda; Burnham, Carey-Ann D

2013-07-01

The optimal management of fungal infections is correlated with timely organism identification. Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) is revolutionizing the identification of yeasts isolated from clinical specimens. We present a multicenter study assessing the performance of the Vitek MS system (bioMérieux) in identifying medically important yeasts. A collection of 852 isolates was tested, including 20 Candida species (626 isolates, including 58 C. albicans, 62 C. glabrata, and 53 C. krusei isolates), 35 Cryptococcus neoformans isolates, and 191 other clinically relevant yeast isolates; in total, 31 different species were evaluated. Isolates were directly applied to a target plate, followed by a formic acid overlay. Mass spectra were acquired using the Vitek MS system and were analyzed using the Vitek MS v2.0 database. The gold standard for identification was sequence analysis of the D2 region of the 26S rRNA gene. In total, 823 isolates (96.6%) were identified to the genus level and 819 isolates (96.1%) were identified to the species level. Twenty-four isolates (2.8%) were not identified, and five isolates (0.6%) were misidentified. Misidentified isolates included one isolate of C. albicans (n = 58) identified as Candida dubliniensis, one isolate of Candida parapsilosis (n = 73) identified as Candida pelliculosa, and three isolates of Geotrichum klebahnii (n = 6) identified as Geotrichum candidum. The identification of clinically relevant yeasts using MS is superior to the phenotypic identification systems currently employed in clinical microbiology laboratories.

The Treacher Collins syndrome (TCOF1) gene product is involved in pre-rRNA methylation.

PubMed

Gonzales, Bianca; Henning, Dale; So, Rolando B; Dixon, Jill; Dixon, Michael J; Valdez, Benigno C

2005-07-15

Treacher Collins syndrome (TCS) is characterized by defects in craniofacial development, which results from mutations in the TCOF1 gene. TCOF1 encodes the nucleolar phosphoprotein treacle, which interacts with upstream binding factor (UBF) and affects transcription of the ribosomal DNA gene. The present study shows participation of treacle in the 2'-O-methylation of pre-rRNA. Antisense-mediated down-regulation of treacle expression in Xenopus laevis oocytes reduced 2'-O-methylation of pre-rRNA. Analysis of RNA isolated from wild-type and Tcof1+/- heterozygous mice embryos from strains that exhibit a lethal phenotype showed significant reduction in 2'-O-methylation at nucleotide C463 of 18S rRNA. The level of pseudouridylation of U1642 of 18S rRNA from the same RNA samples was not affected suggesting specificity. There is no significant difference in rRNA methylation between wild-type and heterozygous embryos of DBA x BALB/c mice, which have no obvious craniofacial phenotype. The function of treacle in pre-rRNA methylation is most likely mediated by its direct physical interaction with NOP56, a component of the ribonucleoprotein methylation complex. Although treacle co-localizes with UBF throughout mitosis, it co-localizes with NOP56 and fibrillarin, a putative methyl transferase, only during telophase when rDNA gene transcription and pre-rRNA methylation are known to commence. These observations suggest that treacle might link RNA polymerase I-catalyzed transcription and post-transcriptional modification of pre-rRNA. We hypothesize that haploinsufficiency of treacle in TCS patients results in inhibition of production of properly modified mature rRNA in addition to inhibition of rDNA gene transcription, which consequently affects proliferation and proper differentiation of specific embryonic cells during development.

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

Candida ecuadorensis sp. nov., an ascomycetous yeast species found in two separate regions of Ecuador.

PubMed

James, Stephen A; Carvajal Barriga, Enrique Javier; Barahona, Patricia Portero; Cross, Kathryn; Bond, Christopher J; Roberts, Ian N

2013-01-01

In the course of an on-going study aimed at cataloguing the natural yeast biodiversity found in Ecuador, two strains (CLQCA 13-025 and CLQCA 20-004(T)) were isolated from samples of cow manure and rotten wood collected in two separate provinces of the country (Orellana and Bolívar). These strains were found to represent a novel yeast species based on the sequences of their D1/D2 domain of the large-subunit (LSU) rRNA gene and their physiological characteristics. Phylogenetic analysis based on LSU D1/D2 sequences revealed this novel species to belong to the Metschnikowia clade and to be most closely related to Candida suratensis, a species recently discovered in a mangrove forest in Thailand. The species name of Candida ecuadorensis sp. nov. is proposed to accommodate these strains, with strain CLQCA 20-004(T) (=CBS 12653(T) = NCYC 3782(T)) designated as the type strain.

Potentiality of yeast Candida sp. SMN04 for degradation of cefdinir, a cephalosporin antibiotic: kinetics, enzyme analysis and biodegradation pathway.

PubMed

Selvi, A; Das, Devlina; Das, Nilanjana

2015-01-01

A new yeast strain isolated from the pharmaceutical wastewater was capable of utilizing cefdinir as a sole carbon source for their growth in mineral medium. The yeast was identified and named as Candida sp. SMN04 based on morphology and 18S-ITS-D1/D2/D3 rRNA sequence analysis. The interaction between factors pH (3.0-9.0), inoculum dosage (1-7%), time (1-11 day) and cefdinir concentration (50-450 mg/L) was studied using a Box-Behnken design. The factors were studied as a result of their effect on cell dry weight (R1; g/L), extended spectrum β-lactamase (ESBL) assay (R2; mm), P450 activity (R3; U/mL) and degradation (R4; %). Maximum values of R1, R2, R3 and R4 were obtained at central values of all the parameters. The isolated yeast strain efficiently degraded 84% of 250 mg L⁻¹ of cefdinir within 6 days with a half-life of 2.97 days and degradation rate constant of 0.2335 per day. Pseudo-first-order model efficiently described the process. Among the various enzymes tested, the order of activity at the end of Day 4 was noted to be: cytochrome P450 (1.76 ± 0.03) > NADPH reductase (1.51 ± 0.20) > manganese peroxidase and amylase (0.66 ± 0.15; 0.66 ± 0.70). Intermediates were successfully characterized by liquid chromatography-mass spectrometry. The opening of the β-lactam ring involving ESBL activity was considered as one of the major steps in the cefdinir degradation process. Fourier transform-infrared spectroscopy analysis showed the absence of spectral vibrations between 1766 and 1519 cm⁻¹ confirming the complete removal of lactam ring during cefdinir degradation. The results of the present study are promising for the use of isolated yeast Candida sp. SMN04 as a potential bioremediation agent.

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

An N-terminal fragment of yeast ribosomal protein L3 inhibits the cytotoxicity of pokeweed antiviral protein in Saccharomyces cerevisiae.

PubMed

Di, Rong; Tumer, Nilgun E

2014-04-11

We have previously shown that ribosomal protein L3 is required for pokeweed antiviral protein (PAP), a type I ribosome inactivating protein, to bind to ribosomes and depurinate the α-sarcin/ricin loop (SRL) in yeast. Co-expression of the N-terminal 99 amino acids of yeast L3 (L3Δ99) with PAP in transgenic tobacco plants completely abolished the toxicity of PAP. In this study, we investigated the interaction between PAP and L3Δ99 in Saccharomyces cerevisiae. Yeast cells co-transformed with PAP and L3Δ99 showed markedly reduced growth inhibition and reduced rRNA depurination by PAP, compared to cells transformed with PAP alone. Co-transformation of yeast with PAP and L3Δ21 corresponding to the highly conserved N-terminal 21 amino acids of L3Δ99, reduced the cytotoxicity of PAP. PAP mRNA and protein levels were elevated and L3Δ99 or L3Δ21 mRNA and protein levels were reduced in yeast co-transformed with PAP and L3Δ99 or with PAP and L3Δ21, respectively. PAP interacted with L3Δ21 in yeast cells in vivo and by Biacore analysis in vitro, suggesting that the interaction between L3Δ21 and PAP may inhibit PAP-mediated depurination of the SRL, leading to a reduction in the cytotoxicity of PAP.

In Situ Analysis of Metabolic Characteristics Reveals the Key Yeast in the Spontaneous and Solid-State Fermentation Process of Chinese Light-Style Liquor

PubMed Central

Kong, Yu; Wu, Qun; Zhang, Yan

2014-01-01

The in situ metabolic characteristics of the yeasts involved in spontaneous fermentation process of Chinese light-style liquor are poorly understood. The covariation between metabolic profiles and yeast communities in Chinese light-style liquor was modeled using the partial least square (PLS) regression method. The diversity of yeast species was evaluated by sequence analysis of the 26S ribosomal DNA (rDNA) D1/D2 domains of cultivable yeasts, and the volatile compounds in fermented grains were analyzed by gas chromatography (GC)-mass spectrometry (MS). Eight yeast species and 58 volatile compounds were identified, respectively. The modulation of 16 of these volatile compounds was associated with variations in the yeast population (goodness of prediction [Q2] > 20%). The results showed that Pichia anomala was responsible for the characteristic aroma of Chinese liquor, through the regulation of several important volatile compounds, such as ethyl lactate, octanoic acid, and ethyl tetradecanoate. Correspondingly, almost all of the compounds associated with P. anomala were detected in a pure culture of this yeast. In contrast to the PLS regression results, however, ethyl lactate and ethyl isobutyrate were not detected in the same pure culture, which indicated that some metabolites could be generated by P. anomala only when it existed in a community with other yeast species. Furthermore, different yeast communities provided different volatile patterns in the fermented grains, which resulted in distinct flavor profiles in the resulting liquors. This study could help identify the key yeast species involved in spontaneous fermentation and provide a deeper understanding of the role of individual yeast species in the community. PMID:24727269

Pre-Service Teachers' Perceptions with Regard to Teaching-Learning Processes

ERIC Educational Resources Information Center

Özdas, Faysal

2018-01-01

Teaching-learning process has a great important medium where pre-service teachers develop experiences and competences. Pre-service teachers are introduced to this process in a professional sense through the school experience course in teacher training. In this process, it is crucial to identify the encountered difficulties and matters. For this…

Selection of yeasts with multifunctional features for application as starters in natural black table olive processing.

PubMed

Bonatsou, S; Benítez, A; Rodríguez-Gómez, F; Panagou, E Z; Arroyo-López, F N

2015-04-01

Yeasts are unicellular eukaryotic microorganisms with a great importance in the elaboration on many foods and beverages. In the last years, researches have focused their attention to determine the favourable effects that these microorganisms could provide to table olive processing. In this context, the present study assesses, at laboratory scale, the potential technological (resistance to salt, lipase, esterase and β-glucosidase activities) and probiotic (phytase activity, survival to gastric and pancreatic digestions) features of 12 yeast strains originally isolated from Greek natural black table olive fermentations. The multivariate classification analysis carried out with all information obtained (a total of 336 quantitative input data), revealed that the most promising strains (clearly discriminated from the rest of isolates) were Pichia guilliermondii Y16 (which showed overall the highest resistance to salt and simulated digestions) and Wickerhamomyces anomalus Y18 (with the overall highest technological enzymatic activities), while the rest of strains were grouped together in two clearly differentiated clusters. Thus, this work opens the possibility for the evaluation of these two selected yeasts as multifunctional starters, alone or in combination with lactic acid bacteria, in real table olive fermentations. Copyright © 2014 Elsevier Ltd. All rights reserved.

American Elementary Education Pre-Service Teachers' Attitudes towards Biotechnology Processes

ERIC Educational Resources Information Center

Chabalengula, Vivien Mweene; Mumba, Frackson; Chitiyo, Jonathan

2011-01-01

This study examined elementary education pre-service teachers' attitudes towards biotechnology processes. A sample comprised 88 elementary education pre-service teachers at a mid-sized university in the Midwest of the USA. Sixty and 28 of these pre-service teachers were enrolled in Introductory Science Methods course and Advance Science Methods…

Co-fermentation using Recombinant Saccharomyces cerevisiae Yeast Strains Hyper-secreting Different Cellulases for the Production of Cellulosic Bioethanol.

PubMed

Lee, Cho-Ryong; Sung, Bong Hyun; Lim, Kwang-Mook; Kim, Mi-Jin; Sohn, Min Jeong; Bae, Jung-Hoon; Sohn, Jung-Hoon

2017-06-30

To realize the economical production of ethanol and other bio-based chemicals from lignocellulosic biomass by consolidated bioprocessing (CBP), various cellulases from different sources were tested to improve the level of cellulase secretion in the yeast Saccharomyces cerevisiae by screening an optimal translational fusion partner (TFP) as both a secretion signal and fusion partner. Among them, four indispensable cellulases for cellulose hydrolysis, including Chaetomium thermophilum cellobiohydrolase (CtCBH1), Chrysosporium lucknowense cellobiohydrolase (ClCBH2), Trichoderma reesei endoglucanase (TrEGL2), and Saccharomycopsis fibuligera β-glucosidase (SfBGL1), were identified to be highly secreted in active form in yeast. Despite variability in the enzyme levels produced, each recombinant yeast could secrete approximately 0.6-2.0 g/L of cellulases into the fermentation broth. The synergistic effect of the mixed culture of the four strains expressing the essential cellulases with the insoluble substrate Avicel and several types of cellulosic biomass was demonstrated to be effective. Co-fermentation of these yeast strains produced approximately 14 g/L ethanol from the pre-treated rice straw containing 35 g/L glucan with 3-fold higher productivity than that of wild type yeast using a reduced amount of commercial cellulases. This process will contribute to the cost-effective production of bioenergy such as bioethanol and biochemicals from cellulosic biomass.

Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning.

PubMed

Zhao, Zhongliang; Dammert, Marcel A; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

2016-09-30

Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthetic biology stretching the realms of possibility in wine yeast research.

PubMed

Jagtap, Umesh B; Jadhav, Jyoti P; Bapat, Vishwas A; Pretorius, Isak S

2017-07-03

It took several millennia to fully understand the scientific intricacies of the process through which grape juice is turned into wine. This yeast-driven fermentation process is still being perfected and advanced today. Motivated by ever-changing consumer preferences and the belief that the 'best' wine is yet to be made, numerous approaches are being pursued to improve the process of yeast fermentation and the quality of wine. Central to recent enhancements in winemaking processes and wine quality is the development of Saccharomyces cerevisiae yeast strains with improved robustness, fermentation efficiencies and sensory properties. The emerging science of Synthetic Biology - including genome engineering and DNA editing technologies - is taking yeast strain development into a totally new realm of possibility. The first example of how future wine strain development might be impacted by these new 'history-making' Synthetic Biology technologies, is the de novo production of the raspberry ketone aroma compound, 4-[4-hydroxyphenyl]butan-2-one, in a wine yeast containing a synthetic DNA cassette. This article explores how this breakthrough and the imminent outcome of the international Yeast 2.0 (or Sc2.0) project, aimed at the synthesis of the entire genome of a laboratory strain of S. cerevisiae, might accelerate the design of improved wine yeasts. Copyright © 2017 Elsevier B.V. All rights reserved.

Engineered yeast for enhanced CO2 mineralization†

PubMed Central

Barbero, Roberto; Carnelli, Lino; Simon, Anna; Kao, Albert; Monforte, Alessandra d’Arminio; Riccò, Moreno; Bianchi, Daniele; Belcher, Angela

2014-01-01

In this work, a biologically catalyzed CO2 mineralization process for the capture of CO2 from point sources was designed, constructed at a laboratory scale, and, using standard chemical process scale-up protocols, was modeled and evaluated at an industrial scale. A yeast display system in Saccharomyces cerevisae was used to screen several carbonic anhydrase isoforms and mineralization peptides for their impact on CO2 hydration, CaCO3 mineralization, and particle settling rate. Enhanced rates for each of these steps in the CaCO3 mineralization process were confirmed using quantitative techniques in lab-scale measurements. The effect of these enhanced rates on the CO2 capture cost in an industrial scale CO2 mineralization process using coal fly ash as the CaO source was evaluated. The model predicts a process using bCA2- yeast and fly ash is ~10% more cost effective per ton of CO2 captured than a process with no biological molecules, a savings not realized by wild-type yeast and high-temperature stable recombinant CA2 alone or in combination. The levelized cost of electricity for a power plant using this process was calculated and scenarios in which this process compares favorably to CO2 capture by MEA absorption process are presented. PMID:25289021

Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

NASA Astrophysics Data System (ADS)

van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

Candida amazonensis sp. nov., an ascomycetous yeast isolated from rotting wood in the Amazonian forest.

PubMed

Cadete, Raquel M; Melo, Monaliza A; Lopes, Mariana R; Pereira, Gilmara M D; Zilli, Jerri E; Vital, Marcos J S; Gomes, Fátima C O; Lachance, Marc-André; Rosa, Carlos A

2012-06-01

Five strains of a novel yeast species were isolated from rotting wood samples collected in an Amazonian forest site in the state of Roraima, northern Brazil. The sequences of the D1/D2 domains of the large subunit of the rRNA gene showed that this species belongs to the Scheffersomyces clade and is related to Candida coipomoensis, Candida lignicola and Candida queiroziae. The novel species Candida amazonensis sp. nov. is proposed to accommodate these isolates. The type strain of C. amazonensis sp. nov. is UFMG-HMD-26.3(T) ( = CBS 12363(T) = NRRL Y-48762(T)).

Candida wangnamkhiaoensis sp. nov., an anamorphic yeast species in the Hyphopichia clade isolated in Thailand.

PubMed

Limtong, Savitree; Kaewwichian, Rungluk; Jindamorakot, Sasitorn; Yongmanitchai, Wichien; Nakase, Takashi

2012-06-01

Two strains representing a single novel yeast species were isolated from a flower of Calycoopteris floribunda Lame (SK170(T)) and insect frass (ST-122) collected in Thailand. On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics, and the sequence analysis of the D1/D2 domain of the large subunit rRNA gene and the internal transcribed spacer region, the two strains were assigned as a single novel Candida species in the Hyphopichia clade for which the name Candida wangnamkhiaoensis sp. nov. is proposed. The type strain is SK170(T)=BCC 39604(T)=NBRC 106724(T)=CBS 11695(T)).

Yeast Infection (Vaginal)

MedlinePlus

Yeast infection (vaginal) Overview A vaginal yeast infection is a fungal infection that causes irritation, discharge and intense itchiness ... symptoms Causes The fungus candida causes a vaginal yeast infection. Your vagina naturally contains a balanced mix of yeast, including ...

Comparative analysis of Gram's stain, PNA-FISH and Sepsityper with MALDI-TOF MS for the identification of yeast direct from positive blood cultures.

PubMed

Gorton, Rebecca L; Ramnarain, P; Barker, K; Stone, N; Rattenbury, S; McHugh, T D; Kibbler, C C

2014-10-01

Fungaemia diagnosis could be improved by reducing the time to identification of yeast from blood cultures. This study aimed to evaluate three rapid methods for the identification of yeast direct from blood cultures; Gram's stain analysis, the AdvanDX Peptide Nucleic Acid in Situ Hybridisation Yeast Traffic Light system (PNA-FISH YTL) and Bruker Sepsityper alongside matrix-assisted laser desorption ionisation time of flight mass spectrometry (MALDI-TOF MS). Fifty blood cultures spiked with a known single yeast strain were analysed by blinded operators experienced in each method. Identifications were compared with MALDI-TOF MS CHROMagar Candida culture and ITS rRNA sequence-based identifications. On first attempt, success rates of 96% (48/50) and 76% (36/50) were achieved using PNA-FISH YTL and Gram's stain respectively. MALDI-TOF MS demonstrated a success rate of 56% (28/50) when applying manufacturer's species log score thresholds and 76% (38/50) using in-house parameters, including lowering the species log score threshold to >1.5. In conclusion, PNA-FISH YTL demonstrated a high success rate successfully identifying yeast commonly encountered in fungaemia. Sepsityper(™) with MALDI-TOF MS was accurate but increased sensitivity is required. Due to the misidentification of commonly encountered yeast Gram's stain analysis demonstrated limited utility in this setting. © 2014 Blackwell Verlag GmbH.

Phenotypic Diagnosis of Lineage and Differentiation During Sake Yeast Breeding

PubMed Central

Ohnuki, Shinsuke; Okada, Hiroki; Friedrich, Anne; Kanno, Yoichiro; Goshima, Tetsuya; Hasuda, Hirokazu; Inahashi, Masaaki; Okazaki, Naoto; Tamura, Hiroyasu; Nakamura, Ryo; Hirata, Dai; Fukuda, Hisashi; Shimoi, Hitoshi; Kitamoto, Katsuhiko; Watanabe, Daisuke; Schacherer, Joseph; Akao, Takeshi; Ohya, Yoshikazu

2017-01-01

Sake yeast was developed exclusively in Japan. Its diversification during breeding remains largely uncharacterized. To evaluate the breeding processes of the sake lineage, we thoroughly investigated the phenotypes and differentiation of 27 sake yeast strains using high-dimensional, single-cell, morphological phenotyping. Although the genetic diversity of the sake yeast lineage is relatively low, its morphological diversity has expanded substantially compared to that of the Saccharomyces cerevisiae species as a whole. Evaluation of the different types of breeding processes showed that the generation of hybrids (crossbreeding) has more profound effects on cell morphology than the isolation of mutants (mutation breeding). Analysis of phenotypic robustness revealed that some sake yeast strains are more morphologically heterogeneous, possibly due to impairment of cellular network hubs. This study provides a new perspective for studying yeast breeding genetics and micro-organism breeding strategies. PMID:28642365

A new β-glucosidase producing yeast for lower-cost cellulosic ethanol production from xylose-extracted corncob residues by simultaneous saccharification and fermentation.

PubMed

Liu, Z Lewis; Weber, Scott A; Cotta, Michael A; Li, Shi-Zhong

2012-01-01

This study reports a new yeast strain of Clavispora NRRL Y-50464 that is able to utilize cellobiose as sole source of carbon and produce sufficient native β-glucosidase enzyme activity for cellulosic ethanol production using SSF. In addition, this yeast is tolerant to the major inhibitors derived from lignocellulosic biomass pre-treatment such as 2-furaldehyde (furfural) and 5-(hydroxymethyl)-2-furaldehyde (HMF), and converted furfural into furan methanol in less than 12h and HMF into furan-2,5-dimethanol within 24h in the presence of 15 mM each of furfural and HMF. Using xylose-extracted corncob residue as cellulosic feedstock, an ethanol production of 23 g/l was obtained using 25% solids loading at 37 °C by SSF without addition of exogenous β-glucosidase. Development of this yeast aids renewable biofuels development efforts for economic consolidated SSF bio-processing. Published by Elsevier Ltd.

Comparative performance evaluation of transform coding in image pre-processing

NASA Astrophysics Data System (ADS)

Menon, Vignesh V.; NB, Harikrishnan; Narayanan, Gayathri; CK, Niveditha

2017-07-01

We are in the midst of a communication transmute which drives the development as largely as dissemination of pioneering communication systems with ever-increasing fidelity and resolution. Distinguishable researches have been appreciative in image processing techniques crazed by a growing thirst for faster and easier encoding, storage and transmission of visual information. In this paper, the researchers intend to throw light on many techniques which could be worn at the transmitter-end in order to ease the transmission and reconstruction of the images. The researchers investigate the performance of different image transform coding schemes used in pre-processing, their comparison, and effectiveness, the necessary and sufficient conditions, properties and complexity in implementation. Whimsical by prior advancements in image processing techniques, the researchers compare various contemporary image pre-processing frameworks- Compressed Sensing, Singular Value Decomposition, Integer Wavelet Transform on performance. The paper exposes the potential of Integer Wavelet transform to be an efficient pre-processing scheme.

Yeast lipids from cardoon stalks, stranded driftwood and olive tree pruning residues as possible extra sources of oils for producing biofuels and biochemicals.

PubMed

Tasselli, Giorgia; Filippucci, Sara; Borsella, Elisabetta; D'Antonio, Silvia; Gelosia, Mattia; Cavalaglio, Gianluca; Turchetti, Benedetta; Sannino, Ciro; Onofri, Andrea; Mastrolitti, Silvio; De Bari, Isabella; Cotana, Franco; Buzzini, Pietro

2018-01-01

Some lignocellulosic biomass feedstocks occur in Mediterranean Countries. They are still largely unexploited and cause considerable problems due to the lack of cost-effective harvesting, storage and disposal technologies. Recent studies found that some basidiomycetous yeasts are able to accumulate high amount of intracellular lipids for biorefinery processes (i.e., biofuels and biochemicals). Accordingly, the above biomass feedstocks could be used as carbon sources (after their pre-treatment and hydrolysis) for lipid accumulation by oleaginous yeasts. Cardoon stalks, stranded driftwood and olive tree pruning residues were pre-treated with steam-explosion and enzymatic hydrolysis for releasing free mono- and oligosaccharides. Lipid accumulation tests were performed at two temperatures (20 and 25 °C) using Leucosporidium creatinivorum DBVPG 4794, Naganishia adeliensis DBVPG 5195 and Solicoccozyma terricola DBVPG 5870. S. terricola grown on cardoon stalks at 20 °C exhibited the highest lipid production (13.20 g/l), a lipid yield (28.95%) close to the maximum theoretical value and a lipid composition similar to that found in palm oil. On the contrary, N. adeliensis grown on stranded driftwood and olive tree pruning residues exhibited a lipid composition similar to those of olive and almonds oils. A predictive evaluation of the physical properties of the potential biodiesel obtainable by lipids produced by tested yeast strains has been reported and discussed. Lipids produced by some basidiomycetous yeasts grown on Mediterranean lignocellulosic biomass feedstocks could be used as supplementary sources of oils for producing biofuels and biochemicals.

Electron transport chain in a thermotolerant yeast.

PubMed

Mejía-Barajas, Jorge A; Martínez-Mora, José A; Salgado-Garciglia, Rafael; Noriega-Cisneros, Ruth; Ortiz-Avila, Omar; Cortés-Rojo, Christian; Saavedra-Molina, Alfredo

2017-04-01

Yeasts capable of growing and surviving at high temperatures are regarded as thermotolerant. For appropriate functioning of cellular processes and cell survival, the maintenance of an optimal redox state is critical of reducing and oxidizing species. We studied mitochondrial functions of the thermotolerant Kluyveromyces marxianus SLP1 and the mesophilic OFF1 yeasts, through the evaluation of its mitochondrial membrane potential (ΔΨ m ), ATPase activity, electron transport chain (ETC) activities, alternative oxidase activity, lipid peroxidation. Mitochondrial membrane potential and the cytoplasmic free Ca 2+ ions (Ca 2+ cyt) increased in the SLP1 yeast when exposed to high temperature, compared with the mesophilic yeast OFF1. ATPase activity in the mesophilic yeast diminished 80% when exposed to 40° while the thermotolerant SLP1 showed no change, despite an increase in the mitochondrial lipid peroxidation. The SLP1 thermotolerant yeast exposed to high temperature showed a diminution of 33% of the oxygen consumption in state 4. The uncoupled state 3 of oxygen consumption did not change in the mesophilic yeast when it had an increase of temperature, whereas in the thermotolerant SLP1 yeast resulted in an increase of 2.5 times when yeast were grown at 30 o , while a decrease of 51% was observed when it was exposed to high temperature. The activities of the ETC complexes were diminished in the SLP1 when exposed to high temperature, but also it was distinguished an alternative oxidase activity. Our results suggest that the mitochondria state, particularly ETC state, is an important characteristic of the thermotolerance of the SLP1 yeast strain.

The yeast Saccharomyces cerevisiae- the main character in beer brewing.

PubMed

Lodolo, Elizabeth J; Kock, Johan L F; Axcell, Barry C; Brooks, Martin

2008-11-01

Historically, mankind and yeast developed a relationship that led to the discovery of fermented beverages. Numerous inventions have led to improved technologies and capabilities to optimize fermentation technology on an industrial scale. The role of brewing yeast in the beer-making process is reviewed and its importance as the main character is highlighted. On considering the various outcomes of functions in a brewery, it has been found that these functions are focused on supporting the supply of yeast requirements for fermentation and ultimately to maintain the integrity of the product. The functions/processes include: nutrient supply to the yeast (raw material supply for brewhouse wort production); utilities (supply of water, heat and cooling); quality assurance practices (hygiene practices, microbiological integrity measures and other specifications); plant automation (vessels, pipes, pumps, valves, sensors, stirrers and centrifuges); filtration and packaging (product preservation until consumption); distribution (consumer supply); and marketing (consumer awareness). Considering this value chain of beer production and the 'bottle neck' during production, the spotlight falls on fermentation, the age-old process where yeast transforms wort into beer.

Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

PubMed

Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

2016-10-24

Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

A polyphasic study on the taxonomic position of industrial sour dough yeasts.

PubMed

Mäntynen, V H; Korhola, M; Gudmundsson, H; Turakainen, H; Alfredsson, G A; Salovaara, H; Lindström, K

1999-02-01

The sour dough bread making process is extensively used to produce wholesome palatable rye bread. The process is traditionally done using a back-slopping procedure. Traditional sour doughs in Finland comprise of lactic acid bacteria and yeasts. The yeasts present in these doughs have been enriched in the doughs due to their metabolic activities, e.g. acid tolerance. We characterized the yeasts in five major sour bread bakeries in Finland. We found that most of the commercial sour doughs contained yeasts which were similar to Candida milleri on the basis of 18S rDNA and EF-3 PCR-RFLP patterns and metabolic activities. Some of the bakery yeasts exhibited extensive karyotype polymorphism. The minimum growth temperature was 8 degrees C for C. milleri and also for most of sour dough yeasts.

Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

PubMed

Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

2016-02-08

Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

PubMed

Johnson, Eric A

2013-09-01

Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

[The yeast biofilm in human medicine].

PubMed

Růzicka, Filip; Holá, Veronika; Votava, Miroslav

2007-08-01

In recent years, the role of Candida yeasts as causative agents of nosocomial infections has increased. One of the important virulence factors contributing to the development of such infections is biofilm production. This virulence factor enables yeast to colonize both native surfaces and artificial implants. The most common sources of infection are patients themselves, in particular the gastrointestinal tract and skin. The vectors of exogenous yeast infections are predominantly the hands of the health personnel and contaminated medical instruments. The adhesion of yeasts to the implant surfaces is determined both by implant surface and yeast characteristics. This is followed by proliferation and production of microcolonies and extracellular matrix. The final biofilm structure is also influenced by the production of hyphae and pseudohyphae. The entire process of biofilm production is controlled by numerous regulatory systems, with the key role being played by the quorum sensing system. Like the adhered bacterial cultures, candidas growing in the form of a biofilm are highly resistant to antimicrobial therapy. Resistance of yeast biofilms to antifungals is a complex process with multiple contributing factors. These are especially increased gene expression (e.g. genes encoding the so called multidrug efflux pumps), limited penetration of substances through the extracellular matrix, inhibited cell growth and altered microenvironment in deeper biofilm layers. The concentrations of antifungals able to effectively affect the biofilm cells exceed, by several orders of magnitude, the values of conventionally determined MICs. High biofilm resistance results in ineffective antifungal therapy of biofilm infections. Therefore, if possible, the colonized implant should be removed. Conservative therapy should involve antifungals with a proven effect on the biofilm (e.g. caspofungin). The most effective measure in fighting biofilm infections is prevention, especially adhering to

A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor.

PubMed

Wachi, M; Kaga, N; Umitsuki, G; Clark, D P; Nagai, K

2001-12-21

Escherichia coli RNase G, encoded by the rng gene, is involved in both the processing of 16S rRNA precursor and the degradation of adhE mRNA. Consequently, defects in RNase G result in elevation of AdhE levels. Furthermore, the adhR430 mutant strain, DC430, is reported to overproduce the AdhE protein in a manner dependent on the adhC81 mutation. We found that overproduction of AdhE by DC430 was reversed to wild-type levels by introduction of a plasmid carrying the wild-type allele of rng. Mapping by P1-phage-mediated transduction also indicated that a mutation involved in AdhE overproduction was located around the rng region in DC430. DNA sequencing of the rng region revealed that DC430 indeed had a mutation in the rng gene: a G1022 to A transition that caused substitution of Gly341 with Ser and which was named rng430. This lies in the highly conserved region of the RNase E/RNase G family, called high similarity region 2 (HSR2). However, very interestingly, rng430 mutant strains did not accumulate the 16.3S precursor of 16S rRNA unlike rng::cat mutants. We also found that the Rng1 mutant protein, which is truncated in its C-terminal domain encompassing HSR2, exhibited a residual processing activity against the 16S rRNA precursor, when overproduced. These results indicate that the HSR2 of RNase G plays an important role in substrate recognition and/or ribonucleolytic action.

An Evolutionary Perspective on Yeast Mating-Type Switching

PubMed Central

Hanson, Sara J.; Wolfe, Kenneth H.

2017-01-01

Cell differentiation in yeast species is controlled by a reversible, programmed DNA-rearrangement process called mating-type switching. Switching is achieved by two functionally similar but structurally distinct processes in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe. In both species, haploid cells possess one active and two silent copies of the mating-type locus (a three-cassette structure), the active locus is cleaved, and synthesis-dependent strand annealing is used to replace it with a copy of a silent locus encoding the opposite mating-type information. Each species has its own set of components responsible for regulating these processes. In this review, we summarize knowledge about the function and evolution of mating-type switching components in these species, including mechanisms of heterochromatin formation, MAT locus cleavage, donor bias, lineage tracking, and environmental regulation of switching. We compare switching in these well-studied species to others such as Kluyveromyces lactis and the methylotrophic yeasts Ogataea polymorpha and Komagataella phaffii. We focus on some key questions: Which cells switch mating type? What molecular apparatus is required for switching? Where did it come from? And what is the evolutionary purpose of switching? PMID:28476860

PepsNMR for 1H NMR metabolomic data pre-processing.

PubMed

Martin, Manon; Legat, Benoît; Leenders, Justine; Vanwinsberghe, Julien; Rousseau, Réjane; Boulanger, Bruno; Eilers, Paul H C; De Tullio, Pascal; Govaerts, Bernadette

2018-08-17

In the analysis of biological samples, control over experimental design and data acquisition procedures alone cannot ensure well-conditioned 1 H NMR spectra with maximal information recovery for data analysis. A third major element affects the accuracy and robustness of results: the data pre-processing/pre-treatment for which not enough attention is usually devoted, in particular in metabolomic studies. The usual approach is to use proprietary software provided by the analytical instruments' manufacturers to conduct the entire pre-processing strategy. This widespread practice has a number of advantages such as a user-friendly interface with graphical facilities, but it involves non-negligible drawbacks: a lack of methodological information and automation, a dependency of subjective human choices, only standard processing possibilities and an absence of objective quality criteria to evaluate pre-processing quality. This paper introduces PepsNMR to meet these needs, an R package dedicated to the whole processing chain prior to multivariate data analysis, including, among other tools, solvent signal suppression, internal calibration, phase, baseline and misalignment corrections, bucketing and normalisation. Methodological aspects are discussed and the package is compared to the gold standard procedure with two metabolomic case studies. The use of PepsNMR on these data shows better information recovery and predictive power based on objective and quantitative quality criteria. Other key assets of the package are workflow processing speed, reproducibility, reporting and flexibility, graphical outputs and documented routines. Copyright © 2018 Elsevier B.V. All rights reserved.

Adaptability of lactic acid bacteria and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava and use of competitive strains as starters.

PubMed

Vogelmann, Stephanie A; Seitter, Michael; Singer, Ulrike; Brandt, Markus J; Hertel, Christian

2009-04-15

The adaptability of lactic acid bacteria (LAB) and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava was investigated using PCR-DGGE and bacteriological culture combined with rRNA gene sequence analysis. Sourdoughs were prepared either from flours of the cereals wheat, rye, oat, barley, rice, maize, and millet, or from the pseudocereals amaranth, quinoa, and buckwheat, or from cassava, using a starter consisting of various species of LAB and yeasts. Doughs were propagated until a stable microbiota was established. The dominant LAB and yeast species were Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus paralimentarius, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus spicheri, Issatchenkia orientalis and Saccharomyces cerevisiae. The proportion of the species within the microbiota varied. L. paralimentarius dominated in the pseudocereal sourdoughs, L. fermentum, L. plantarum and L. spicheri in the cassava sourdough, and L. fermentum, L. helveticus and L. pontis in the cereal sourdoughs. S. cerevisiae constituted the dominating yeast, except for quinoa sourdough, where I. orientalis also reached similar counts, and buckwheat and oat sourdoughs, where no yeasts could be detected. To assess the usefulness of competitive LAB and yeasts as starters, the fermentations were repeated using flours from rice, maize, millet and the pseudocereals, and by starting the dough fermentation with selected dominant strains. At the end of fermentation, most of starter strains belonged to the dominating microbiota. For the rice, millet and quinoa sourdoughs the species composition was similar to that of the prior fermentation, whereas in the other sourdoughs, the composition differed.

Uranium bioprecipitation mediated by yeasts utilizing organic phosphorus substrates.

PubMed

Liang, Xinjin; Csetenyi, Laszlo; Gadd, Geoffrey Michael

2016-06-01

In this research, we have demonstrated the ability of several yeast species to mediate U(VI) biomineralization through uranium phosphate biomineral formation when utilizing an organic source of phosphorus (glycerol 2-phosphate disodium salt hydrate (C3H7Na2O6P·xH2O (G2P)) or phytic acid sodium salt hydrate (C6H18O24P6·xNa(+)·yH2O (PyA))) in the presence of soluble UO2(NO3)2. The formation of meta-ankoleite (K2(UO2)2(PO4)2·6(H2O)), chernikovite ((H3O)2(UO2)2(PO4)2·6(H2O)), bassetite (Fe(++)(UO2)2(PO4)2·8(H2O)), and uramphite ((NH4)(UO2)(PO4)·3(H2O)) on cell surfaces was confirmed by X-ray diffraction in yeasts grown in a defined liquid medium amended with uranium and an organic phosphorus source, as well as in yeasts pre-grown in organic phosphorus-containing media and then subsequently exposed to UO2(NO3)2. The resulting minerals depended on the yeast species as well as physico-chemical conditions. The results obtained in this study demonstrate that phosphatase-mediated uranium biomineralization can occur in yeasts supplied with an organic phosphate substrate as sole source of phosphorus. Further understanding of yeast interactions with uranium may be relevant to development of potential treatment methods for uranium waste and utilization of organic phosphate sources and for prediction of microbial impacts on the fate of uranium in the environment.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

PubMed

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

PubMed Central

Xin, De-Dong; Wen, Jian-Fan

2012-01-01

Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast.

PubMed

Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi; Kitagaki, Hiroshi

2017-12-15

The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast ( Saccharomyces cerevisiae ) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their "petite" strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic of

Chromosomal Aneuploidy Improves the Brewing Characteristics of Sake Yeast

PubMed Central

Kadowaki, Masafumi; Fujimaru, Yuki; Taguchi, Seiga; Ferdouse, Jannatul; Sawada, Kazutaka; Kimura, Yuta; Terasawa, Yohei; Agrimi, Gennaro; Anai, Toyoaki; Noguchi, Hideki; Toyoda, Atsushi; Fujiyama, Asao; Akao, Takeshi

2017-01-01

ABSTRACT The effect of chromosomal aneuploidy on the brewing characteristics of brewery yeasts has not been studied. Here we report that chromosomal aneuploidy in sake brewery yeast (Saccharomyces cerevisiae) leads to the development of favorable brewing characteristics. We found that pyruvate-underproducing sake yeast, which produces less off-flavor diacetyl, is aneuploid and trisomic for chromosomes XI and XIV. To confirm that this phenotype is due to aneuploidy, we obtained 45 haploids with various chromosomal additions and investigated their brewing profiles. A greater number of chromosomes correlated with a decrease in pyruvate production. Especially, sake yeast haploids with extra chromosomes in addition to chromosome XI produced less pyruvate than euploids. Mitochondrion-related metabolites and intracellular oxygen species in chromosome XI aneuploids were higher than those in euploids, and this effect was canceled in their “petite” strains, suggesting that an increase in chromosomes upregulated mitochondrial activity and decreased pyruvate levels. These findings suggested that an increase in chromosome number, including chromosome XI, in sake yeast haploids leads to pyruvate underproduction through the augmentation of mitochondrial activity. This is the first report proposing that aneuploidy in brewery yeasts improves their brewing profile. IMPORTANCE Chromosomal aneuploidy has not been evaluated in development of sake brewing yeast strains. This study shows the relationship between chromosomal aneuploidy and brewing characteristics of brewery yeast strains. High concentrations of pyruvate during sake storage give rise to α-acetolactate and, in turn, to high concentrations of diacetyl, which is considered an off-flavor. It was demonstrated that pyruvate-underproducing sake yeast is trisomic for chromosome XI and XIV. Furthermore, sake yeast haploids with extra chromosomes produced reduced levels of pyruvate and showed metabolic processes characteristic

Flor Yeast: New Perspectives Beyond Wine Aging

PubMed Central

Legras, Jean-Luc; Moreno-Garcia, Jaime; Zara, Severino; Zara, Giacomo; Garcia-Martinez, Teresa; Mauricio, Juan C.; Mannazzu, Ilaria; Coi, Anna L.; Bou Zeidan, Marc; Dequin, Sylvie; Moreno, Juan; Budroni, Marilena

2016-01-01

The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air–liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed. PMID:27148192

Physiological and environmental control of yeast prions

PubMed Central

Chernova, Tatiana A.; Wilkinson, Keith D.; Chernoff, Yury O.

2014-01-01

Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion formation could be beneficial in variable environmental conditions. Yeast and mammalian prions have similar molecular properties. Crucial cellular factors and conditions influencing prion formation and propagation were uncovered in the yeast models. Stress-related chaperones, protein quality control deposits, degradation pathways and cytoskeletal networks control prion formation and propagation in yeast. Environmental stresses trigger prion formation and loss, supposedly acting via influencing intracellular concentrations of the prion-inducing proteins, and/or by localizing prionogenic proteins to the prion induction sites via heterologous ancillary helpers. Physiological and environmental modulation of yeast prions points to new opportunities for pharmacological intervention and/or prophylactic measures targeting general cellular systems rather than the properties of individual amyloids and prions. PMID:24236638

Yeast and yeast-like fungi associated with dry indehiscent fruits of Nothofagus nervosa in Patagonia, Argentina.

PubMed

Fernández, Natalia V; Mestre, M Cecilia; Marchelli, Paula; Fontenla, Sonia B

2012-04-01

Nothofagus nervosa (Raulí) is a native tree species that yields valuable timber. It was overexploited in the past and is currently included in domestication and conservation programs. Several research programs have focused on the characterization of epiphytic microorganisms because it has been demonstrated that they can affect plant-pathogen interactions and/or promote plant growth. Although the microbial ecology of leaves has been well studied, less is known about microorganisms occurring on seeds and noncommercial fruits. In this work, we analyzed the yeast and yeast-like fungi present on N. nervosa fruits destined for the propagation of this species, as well as the effects of fruit preservation and seed dormancy-breaking processes on fungal diversity. Morphological and molecular methods were used, and differences between fungal communities were analyzed using a similarity index. A total of 171 isolates corresponding to 17 species were recovered, most of which belong to the phylum Ascomycota. The majority of the species develop mycelia, produce pigments and mycosporines, and these adaptation strategies are discussed. It was observed that the preservation process considerably reduced yeast and yeast-like fungal diversity. This is the first study concerning microbial communities associated with this ecologically and economically important species, and the information presented is relevant to domestication programs. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Inventions on baker's yeast storage and activation at the bakery plant.

PubMed

Gélinas, Pierre

2010-01-01

Baker's yeast is the gas-forming ingredient in bakery products. Methods have been invented to properly handle baker's yeast and optimize its activity at the bakery plant. Over the years, incentives for inventions on yeast storage and activation have greatly changed depending on trends in the baking industry. For example, retailer's devices for cutting bulk pressed yeast and techniques for activating dry yeast have now lost their importance. Review of patents for invention indicates that activation of baker's yeast activity has been a very important issue for bakers, for example, with baking ingredients called yeast foods. In the recent years and especially for highly automated bakeries, interest has moved to equipments and processes for optimized storage of liquid cream yeast to thoroughly control dough fermentation and bread quality.

Yeasts: providing questions and answers for modern biology.

PubMed

Dickinson, J R

2000-01-01

Yeasts are to be found in virtually every conceivable niche on this planet and are amazingly varied in their shapes ('morphologies'), life cycles, metabolic capabilities, potentials for use in industrial processes, abilities to spoil food and drink or to act as dangerous human pathogens. This review describes four very different species of yeast to illustrate some of the diversity which exists and, in the case of one of them, Saccharomyces cerevisiae (the familiar baker's or brewer's yeast), the extent of both our knowledge and ignorance.

Silibinin triggers yeast apoptosis related to mitochondrial Ca2+ influx in Candida albicans.

PubMed

Yun, Dae Gyu; Lee, Dong Gun

2016-11-01

Candida albicans is a common yeast that resides in the human body, but can occasionally cause systemic fungal infection, namely candidiasis. As this infection rate is gradually increasing, it is becoming a major problem to public health. Accordingly, we for the first time investigated the antifungal activity and mode of action of silibinin, a natural product extracted from Silybum marianum (milk thistle), against C. albicans. On treatment with 100μM silibinin, generation of reactive oxygen species (ROS) from mitochondria, which can cause yeast apoptosis via oxidative stress, was increased by 24.17% compared to that in untreated cells. Subsequently, we found disturbances in ion homeostasis such as release of intracellular K + and accumulation of cytoplasmic and mitochondrial Ca 2+ . Among these phenomena, mitochondrial Ca 2+ overload particularly plays a crucial role in the process of apoptosis, promoting the activation of pro-apoptotic factors. Therefore, we investigated the significance of mitochondrial Ca 2+ in apoptosis by employing 20mM ruthenium red (RR). Additional apoptosis hallmarks such as mitochondrial membrane depolarization, cytochrome c release, caspase activation, phosphatidylserine (PS) exposure, and DNA damage were observed in response to silibinin treatment, whereas RR pre-treatment seemed to block these responses. In summary, our results suggest that silibinin induces yeast apoptosis mediated by mitochondrial Ca 2+ signaling in C. albicans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Technological properties of bakers' yeasts in durum wheat semolina dough.

PubMed

Giannone, Virgilio; Longo, Chiara; Damigella, Arcangelo; Raspagliesi, Domenico; Spina, Alfio; Palumbo, Massimo

2010-04-01

Properties of 13 Saccharomyces cerevisiae strains isolated from different sources (traditional sourdoughs, industrial baking yeasts etc.) were studied in dough produced with durum wheat (Sicilian semolina, variety Mongibello). Durum wheat semolina and durum wheat flour are products prepared from grain of durum wheat (Triticum durum Desf.) by grinding or milling processes in which the bran and germ are essentially removed and the remainder is comminuted to a suitable degree of fineness. Acidification and leavening properties of the dough were evaluated. Strains isolated from traditional sourdoughs (DSM PST18864, DSM PST18865 and DSM PST18866) showed higher leavening power, valuable after the first and second hours of fermentation, than commercial baking yeasts. In particular the strain DSM PST 18865 has also been successfully tested in bakery companies for the improvement of production processes. Baking and staling tests were carried out on five yeast strains to evaluate their fermentation ability directly and their resistance to the staling process. Amplified fragment length polymorphism (fAFLP) was used to investigate genetic variations in the yeast strains. This study showed an appreciable biodiversity in the microbial populations of both wild and commercial yeast strains.

Acetate but not propionate induces oxidative stress in bakers' yeast Saccharomyces cerevisiae.

PubMed

Semchyshyn, Halyna M; Abrat, Oleksandra B; Miedzobrodzki, Jacek; Inoue, Yoshiharu; Lushchak, Volodymyr I

2011-01-01

The influence of acetic and propionic acids on baker's yeast was investigated in order to expand our understanding of the effect of weak organic acid food preservatives on eukaryotic cells. Both acids decreased yeast survival in a concentration-dependent manner, but with different efficiencies. The acids inhibited the fluorescein efflux from yeast cells. The inhibition constant of fluorescein extrusion from cells treated with acetate was significantly lower in parental strain than in either PDR12 (ABC-transporter Pdr12p) or WAR1 (transcriptional factor of Pdr12p) defective mutants. The constants of inhibition by propionate were virtually the same in all strains used. Yeast exposure to acetate increased the level of oxidized proteins and the activity of antioxidant enzymes, while propionate did not change these parameters. This suggests that various mechanisms underlie the yeast toxicity by acetic and propionic acids. Our studies with mutant cells clearly indicated the involvement of Yap1p transcriptional regulator and de novo protein synthesis in superoxide dismutase up-regulation by acetate. The up-regulation of catalase was Yap1p independent. Yeast pre-incubation with low concentrations of H₂O₂ caused cellular cross-protection against high concentrations of acetate. The results are discussed from the point of view that acetate induces a prooxidant effect in vivo, whereas propionate does not.

PMAA-stabilized ferrofluid/chitosan/yeast composite for bioapplications

NASA Astrophysics Data System (ADS)

Baldikova, Eva; Prochazkova, Jitka; Stepanek, Miroslav; Hajduova, Jana; Pospiskova, Kristyna; Safarikova, Mirka; Safarik, Ivo

2017-04-01

A simple, one-pot process for the preparation of magnetically responsive yeast-based biocatalysts was developed. Saccharomyces cerevisiae, Candida utilis and Kluyveromyces lactis cells were successfully incorporated into chitosan gel magnetically modified with poly(methacrylic acid)-stabilized magnetic fluid (PMAA-FF) during its formation. Magnetic PMAA-FF/chitosan/yeast composites were efficiently employed for invert sugar production. The dependence of invertase activity on used yeast, amount of magnetic biocatalyst, agitation time and after reuse was studied in detail. The tested magnetic biocatalysts retained at least 69% of their initial activity after 8 reuse cycles.

A Method of Visualizing Three-Dimensional Distribution of Yeast in Bread Dough

NASA Astrophysics Data System (ADS)

Maeda, Tatsurou; Do, Gab-Soo; Sugiyama, Junichi; Oguchi, Kosei; Shiraga, Seizaburou; Ueda, Mitsuyoshi; Takeya, Koji; Endo, Shigeru

A novel technique was developed to monitor the change in three-dimensional (3D) distribution of yeast in frozen bread dough samples in accordance with the progress of mixing process. Application of a surface engineering technology allowed the identification of yeast in bread dough by bonding EGFP (Enhanced Green Fluorescent Protein) to the surface of yeast cells. The fluorescent yeast (a biomarker) was recognized as bright spots at the wavelength of 520 nm. A Micro-Slicer Image Processing System (MSIPS) with a fluorescence microscope was utilized to acquire cross-sectional images of frozen dough samples sliced at intervals of 1 μm. A set of successive two-dimensional images was reconstructed to analyze 3D distribution of yeast. Samples were taken from each of four normal mixing stages (i.e., pick up, clean up, development, and final stages) and also from over mixing stage. In the pick up stage yeast distribution was uneven with local areas of dense yeast. As the mixing progressed from clean up to final stages, the yeast became more evenly distributed throughout the dough sample. However, the uniformity in yeast distribution was lost in the over mixing stage possibly due to the breakdown of gluten structure within the dough sample.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology

NASA Astrophysics Data System (ADS)

Pulschen, A. A.; Rodrigues, F.; Duarte, R. T.; Araujo, G. G.; Santiago, I. F.; Paulino-Lima, Ivan G.; Rosa, Carlos A.; Kato, Massuo J.; Pellizari, Vivian H.; Galante, Douglas

2015-08-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75-2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to -6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes.

Promoter-Terminator Gene Loops Affect Alternative 3'-End Processing in Yeast.

PubMed

Lamas-Maceiras, Mónica; Singh, Badri Nath; Hampsey, Michael; Freire-Picos, María A

2016-04-22

Many eukaryotic genes undergo alternative 3'-end poly(A)-site selection producing transcript isoforms with 3'-UTRs of different lengths and post-transcriptional fates. Gene loops are dynamic structures that juxtapose the 3'-ends of genes with their promoters. Several functions have been attributed to looping, including memory of recent transcriptional activity and polarity of transcription initiation. In this study, we investigated the relationship between gene loops and alternative poly(A)-site. Using the KlCYC1 gene of the yeast Kluyveromyces lactis, which includes a single promoter and two poly(A) sites separated by 394 nucleotides, we demonstrate in two yeast species the formation of alternative gene loops (L1 and L2) that juxtapose the KlCYC1 promoter with either proximal or distal 3'-end processing sites, resulting in the synthesis of short and long forms of KlCYC1 mRNA. Furthermore, synthesis of short and long mRNAs and formation of the L1 and L2 loops are growth phase-dependent. Chromatin immunoprecipitation experiments revealed that the Ssu72 RNA polymerase II carboxyl-terminal domain phosphatase, a critical determinant of looping, peaks in early log phase at the proximal poly(A) site, but as growth phase advances, it extends to the distal site. These results define a cause-and-effect relationship between gene loops and alternative poly(A) site selection that responds to different physiological signals manifested by RNA polymerase II carboxyl-terminal domain phosphorylation status. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Five novel Wickerhamomyces- and Metschnikowia-related yeast species, Wickerhamomyces chaumierensis sp. nov., Candida pseudoflosculorum sp. nov., Candida danieliae sp. nov., Candida robnettiae sp. nov. and Candida eppingiae sp. nov., isolated from plants.

PubMed

Groenewald, Marizeth; Robert, Vincent; Smith, Maudy Th

2011-08-01

On the basis of nucleotide divergences in the D1/D2 domain of the 26S rRNA gene and the internal transcribed spacers (ITS) domain of the rRNA gene, five novel yeast species, Wickerhamomyces chaumierensis sp. nov. (CBS 8565(T)  = JCM 17246(T)), Candida pseudoflosculorum sp. nov. (CBS 8584(T)  = JCM 17242(T)), Candida danieliae sp. nov. (CBS 8533(T)  = JCM 17247(T)), Candida robnettiae sp. nov. (CBS 8580(T)  = JCM 17243(T)) and Candida eppingiae sp. nov. (CBS 8586(T)  = JCM 17241(T)), isolated from plants in Thailand and Guyana, are proposed in this study.

Saccharomyces cerevisiae and non-Saccharomyces yeasts in grape varieties of the São Francisco Valley

PubMed Central

de Ponzzes-Gomes, Camila M.P.B.S.; de Mélo, Dângelly L.F.M.; Santana, Caroline A.; Pereira, Giuliano E.; Mendonça, Michelle O.C.; Gomes, Fátima C.O.; Oliveira, Evelyn S.; Barbosa, Antonio M.; Trindade, Rita C.; Rosa, Carlos A.

2014-01-01

The aims of this work was to characterise indigenous Saccharomyces cerevisiae strains in the naturally fermented juice of grape varieties Cabernet Sauvignon, Grenache, Tempranillo, Sauvignon Blanc and Verdejo used in the São Francisco River Valley, northeastern Brazil. In this study, 155 S. cerevisiae and 60 non-Saccharomyces yeasts were isolated and identified using physiological tests and sequencing of the D1/D2 domains of the large subunit of the rRNA gene. Among the non-Saccharomyces species, Rhodotorula mucilaginosa was the most common species, followed by Pichia kudriavzevii, Candida parapsilosis, Meyerozyma guilliermondii, Wickerhamomyces anomalus, Kloeckera apis, P. manshurica, C. orthopsilosis and C. zemplinina. The population counts of these yeasts ranged among 1.0 to 19 × 105 cfu/mL. A total of 155 isolates of S. cerevisiae were compared by mitochondrial DNA restriction analysis, and five molecular mitochondrial DNA restriction profiles were detected. Indigenous strains of S. cerevisiae isolated from grapes of the São Francisco Valley can be further tested as potential starters for wine production. PMID:25242923

Saccharomyces cerevisiae and non-Saccharomyces yeasts in grape varieties of the São Francisco Valley.

PubMed

de Ponzzes-Gomes, Camila M P B S; de Mélo, Dângelly L F M; Santana, Caroline A; Pereira, Giuliano E; Mendonça, Michelle O C; Gomes, Fátima C O; Oliveira, Evelyn S; Barbosa, Antonio M; Trindade, Rita C; Rosa, Carlos A

2014-01-01

The aims of this work was to characterise indigenous Saccharomyces cerevisiae strains in the naturally fermented juice of grape varieties Cabernet Sauvignon, Grenache, Tempranillo, Sauvignon Blanc and Verdejo used in the São Francisco River Valley, northeastern Brazil. In this study, 155 S. cerevisiae and 60 non-Saccharomyces yeasts were isolated and identified using physiological tests and sequencing of the D1/D2 domains of the large subunit of the rRNA gene. Among the non-Saccharomyces species, Rhodotorula mucilaginosa was the most common species, followed by Pichia kudriavzevii, Candida parapsilosis, Meyerozyma guilliermondii, Wickerhamomyces anomalus, Kloeckera apis, P. manshurica, C. orthopsilosis and C. zemplinina. The population counts of these yeasts ranged among 1.0 to 19 × 10(5) cfu/mL. A total of 155 isolates of S. cerevisiae were compared by mitochondrial DNA restriction analysis, and five molecular mitochondrial DNA restriction profiles were detected. Indigenous strains of S. cerevisiae isolated from grapes of the São Francisco Valley can be further tested as potential starters for wine production.

Improvement of Brazilian bioethanol production - Challenges and perspectives on the identification and genetic modification of new strains of Saccharomyces cerevisiae yeasts isolated during ethanol process.

PubMed

Paulino de Souza, Jonas; Dias do Prado, Cleiton; Eleutherio, Elis C A; Bonatto, Diego; Malavazi, Iran; Ferreira da Cunha, Anderson

2018-06-01

In Brazil, bioethanol is produced by sucrose fermentation from sugarcane by Saccharomyces cerevisiae in a fed-batch process that uses high density of yeast cells (15-25 % of wet weight/v) and high sugar concentration (18-22 % of total sugars). Several research efforts have been employed to improve the efficiency of this process through the isolation of yeasts better adapted to the Brazilian fermentation conditions. Two important wild strains named CAT-1 and PE-2 were isolated during the fermentation process and were responsible for almost 60 % of the total ethanol production in Brazil. However, in the last decade the fermentative substrate composition was much modified, since new sugar cane crops were developed, the use of molasses instead of sugar cane juice increase and with the prohibition of burning of sugarcane prior harvest. As consequence, these previously isolated strains are being replaced by new wild yeasts in most of ethanol plants. In this new scenario the isolation of novel better adapted yeasts with improved fermentative characteristics is still a big challenge. Here, we discuss the main aspects of Brazilian ethanol production and the efforts for the selection, characterization and genetic modifications of new strains with important phenotypic traits such as thermotolerance. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Optimization of a thermal hydrolysis process for sludge pre-treatment.

PubMed

Sapkaite, I; Barrado, E; Fdz-Polanco, F; Pérez-Elvira, S I

2017-05-01

At industrial scale, thermal hydrolysis is the most used process to enhance biodegradability of the sludge produced in wastewater treatment plants. Through statistically guided Box-Behnken experimental design, the present study analyses the effect of TH as pre-treatment applied to activated sludge. The selected process variables were temperature (130-180 °C), time (5-50 min) and decompression mode (slow or steam-explosion effect), and the parameters evaluated were sludge solubilisation and methane production by anaerobic digestion. A quadratic polynomial model was generated to compare the process performance for the 15 different combinations of operation conditions by modifying the process variables evaluated. The statistical analysis performed exhibited that methane production and solubility were significantly affected by pre-treatment time and temperature. During high intensity pre-treatment (high temperature and long times), the solubility increased sharply while the methane production exhibited the opposite behaviour, indicating the formation of some soluble but non-biodegradable materials. Therefore, solubilisation is not a reliable parameter to quantify the efficiency of a thermal hydrolysis pre-treatment, since it is not directly related to methane production. Based on the operational parameters optimization, the estimated optimal thermal hydrolysis conditions to enhance of sewage sludge digestion were: 140-170 °C heating temperature, 5-35min residence time, and one sudden decompression. Copyright © 2017 Elsevier Ltd. All rights reserved.

16S rRNA beacons for bacterial monitoring during human space missions.

PubMed

Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

2007-04-01

Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

Ethanol yield and volatile compound content in fermentation of agave must by Kluyveromyces marxianus UMPe-1 comparing with Saccharomyces cerevisiae baker's yeast used in tequila production.

PubMed

López-Alvarez, Arnoldo; Díaz-Pérez, Alma Laura; Sosa-Aguirre, Carlos; Macías-Rodríguez, Lourdes; Campos-García, Jesús

2012-05-01

In tequila production, fermentation is an important step. Fermentation determines the ethanol productivity and organoleptic properties of the beverage. In this study, a yeast isolated from native residual agave must was identified as Kluyveromyces marxianus UMPe-1 by 26S rRNA sequencing. This yeast was compared with the baker's yeast Saccharomyces cerevisiae Pan1. Our findings demonstrate that the UMPe-1 yeast was able to support the sugar content of agave must and glucose up to 22% (w/v) and tolerated 10% (v/v) ethanol concentration in the medium with 50% cells survival. Pilot and industrial fermentation of agave must tests showed that the K. marxianus UMPe-1 yeast produced ethanol with yields of 94% and 96% with respect to fermentable sugar content (glucose and fructose, constituting 98%). The S. cerevisiae Pan1 baker's yeast, however, which is commonly used in some tequila factories, showed 76% and 70% yield. At the industrial level, UMPe-1 yeast shows a maximum velocity of fermentable sugar consumption of 2.27g·L(-1)·h(-1) and ethanol production of 1.38g·L(-1)·h(-1), providing 58.78g ethanol·L(-1) at 72h fermentation, which corresponds to 96% yield. In addition, the major and minor volatile compounds in the tequila beverage obtained from UMPe-1 yeast were increased. Importantly, 29 volatile compounds were identified, while the beverage obtained from Pan1-yeast contained fewer compounds and in lower concentrations. The results suggest that the K. marxianus UMPe-1 is a suitable yeast for agave must fermentation, showing high ethanol productivity and increased volatile compound content comparing with a S. cerevisiae baker's yeast used in tequila production. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Fine Structure of Tibetan Kefir Grains and Their Yeast Distribution, Diversity, and Shift

PubMed Central

Lu, Man; Wang, Xingxing; Sun, Guowei; Qin, Bing; Xiao, Jinzhou; Yan, Shuling; Pan, Yingjie; Wang, Yongjie

2014-01-01

Tibetan kefir grains (TKGs), a kind of natural starter for fermented milk in Tibet, China, host various microorganisms of lactic acid bacteria, yeasts, and occasionally acetic acid bacteria in a polysaccharide/protein matrix. In the present study, the fine structure of TKGs was studied to shed light on this unusual symbiosis with stereomicroscopy and thin sections. The results reveal that TKGs consist of numerous small grain units, which are characterized by a hollow globular structure with a diameter between 2.0 and 9.0 mm and a wall thickness of approximately 200 µm. A polyhedron-like net structure, formed mainly by the bacteria, was observed in the wall of the grain units, which has not been reported previously to our knowledge. Towards the inside of the grain unit, the polyhedron-like net structures became gradually larger in diameter and fewer in number. Such fine structures may play a crucial role in the stability of the grains. Subsequently, the distribution, diversity, and shift of yeasts in TKGs were investigated based on thin section, scanning electron microscopy, cloning and sequencing of D1/D2 of the 26S rRNA gene, real-time quantitative PCR, and in situ hybridization with specific fluorescence-labeled oligonucleotide probes. These show that (i) yeasts appear to localize on the outer surface of the grains and grow normally together to form colonies embedded in the bacterial community; (ii) the diversity of yeasts is relatively low on genus level with three dominant species – Saccharomyces cerevisiae, Kluyveromyces marxianus, and Yarrowia lipolytica; (iii) S. cerevisiae is the stable predominant yeast species, while the composition of Kluyveromyces and Yarrowia are subject to change over time. Our results indicate that TKGs are relatively stable in structure, and culture conditions to some extent shape the microbial community and interaction in kefir grains. These findings pave the way for further study of the specific symbiotic associations between S

Quality assessment of baby food made of different pre-processed organic raw materials under industrial processing conditions.

PubMed

Seidel, Kathrin; Kahl, Johannes; Paoletti, Flavio; Birlouez, Ines; Busscher, Nicolaas; Kretzschmar, Ursula; Särkkä-Tirkkonen, Marjo; Seljåsen, Randi; Sinesio, Fiorella; Torp, Torfinn; Baiamonte, Irene

2015-02-01

The market for processed food is rapidly growing. The industry needs methods for "processing with care" leading to high quality products in order to meet consumers' expectations. Processing influences the quality of the finished product through various factors. In carrot baby food, these are the raw material, the pre-processing and storage treatments as well as the processing conditions. In this study, a quality assessment was performed on baby food made from different pre-processed raw materials. The experiments were carried out under industrial conditions using fresh, frozen and stored organic carrots as raw material. Statistically significant differences were found for sensory attributes among the three autoclaved puree samples (e.g. overall odour F = 90.72, p < 0.001). Samples processed from frozen carrots show increased moisture content and decrease of several chemical constituents. Biocrystallization identified changes between replications of the cooking. Pre-treatment of raw material has a significant influence on the final quality of the baby food.

Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast

PubMed Central

Konikkat, Salini; Woolford, John L.

2017-01-01

Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837

Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

PubMed Central

Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

2017-01-01

The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the

The yeast replicative aging model.

PubMed

He, Chong; Zhou, Chuankai; Kennedy, Brian K

2018-03-08

It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.

Making Sense of the Yeast Sphingolipid Pathway.

PubMed

Megyeri, Márton; Riezman, Howard; Schuldiner, Maya; Futerman, Anthony H

2016-12-04

Sphingolipids (SL) and their metabolites play key roles both as structural components of membranes and as signaling molecules. Many of the key enzymes and regulators of SL metabolism were discovered using the yeast Saccharomyces cerevisiae, and based on the high degree of conservation, a number of mammalian homologs were identified. Although yeast continues to be an important tool for SL research, the complexity of SL structure and nomenclature often hampers the ability of new researchers to grasp the subtleties of yeast SL biology and discover new modulators of this intricate pathway. Moreover, the emergence of lipidomics by mass spectrometry has enabled the rapid identification of SL species in yeast and rendered the analysis of SL composition under various physiological and pathophysiological conditions readily amenable. However, the complex nomenclature of the identified species renders much of the data inaccessible to non-specialists. In this review, we focus on parsing both the classical SL nomenclature and the nomenclature normally used during mass spectrometry analysis, which should facilitate the understanding of yeast SL data and might shed light on biological processes in which SLs are involved. Finally, we discuss a number of putative roles of various yeast SL species. Copyright © 2016 Elsevier Ltd. All rights reserved.

Yeast Genomics for Bread, Beer, Biology, Bucks and Breath

NASA Astrophysics Data System (ADS)

Sakharkar, Kishore R.; Sakharkar, Meena K.

The rapid advances and scale up of projects in DNA sequencing dur ing the past two decades have produced complete genome sequences of several eukaryotic species. The versatile genetic malleability of the yeast, and the high degree of conservation between its cellular processes and those of human cells have made it a model of choice for pioneering research in molecular and cell biology. The complete sequence of yeast genome has proven to be extremely useful as a reference towards the sequences of human and for providing systems to explore key gene functions. Yeast has been a ‘legendary model’ for new technologies and gaining new biological insights into basic biological sciences and biotechnology. This chapter describes the awesome power of yeast genetics, genomics and proteomics in understanding of biological function. The applications of yeast as a screening tool to the field of drug discovery and development are highlighted and the traditional importance of yeast for bakers and brewers is discussed.

Is a pre-analytical process for urinalysis required?

PubMed

Petit, Morgane; Beaudeux, Jean-Louis; Majoux, Sandrine; Hennequin, Carole

2017-10-01

For the reliable urinary measurement of calcium, phosphate and uric acid, a pre-analytical process by adding acid or base to urine samples at laboratory is recommended in order to dissolve precipitated solutes. Several studies on different kind of samples and analysers have previously shown that a such pre-analytical treatment is useless. The objective was to study the necessity of pre-analytical treatment of urine on samples collected using the V-Monovette ® (Sarstedt) system and measured on the analyser Architect C16000 (Abbott Diagnostics). Sixty urinary samples of hospitalized patients were selected (n=30 for calcium and phosphate, and n=30 for uric acid). After acidification of urine samples for measurement of calcium and phosphate, and alkalinisation for measurement of uric acid respectively, differences between results before and after the pre-analytical treatment were compared to acceptable limits recommended by the French society of clinical biology (SFBC). No difference in concentration between before and after pre-analytical treatment of urine samples exceeded acceptable limits from SFBC for measurement of calcium and uric acid. For phosphate, only one sample exceeded these acceptable limits, showing a result paradoxically lower after acidification. In conclusion, in agreement with previous study, our results show that acidification or alkalinisation of urine samples from 24 h urines or from urination is not a pre-analytical necessity for measurement of calcium, phosphate and uric acid.

Phylogenetics of Saccharomycetales, the ascomycete yeasts.

PubMed

Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André

2006-01-01

Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available.

How Pre-Service Teachers' Understand and Perform Science Process Skills

ERIC Educational Resources Information Center

Chabalengula, Vivien Mweene; Mumba, Frackson; Mbewe, Simeon

2012-01-01

This study explored pre-service teachers' conceptual understanding and performance on science process skills. A sample comprised 91 elementary pre-service teachers at a university in the Midwest of the USA. Participants were enrolled in two science education courses; introductory science teaching methods course and advanced science methods course.…

Prions in Yeast

PubMed Central

Liebman, Susan W.; Chernoff, Yury O.

2012-01-01

The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in understanding cellular control of prion propagation, prion structure, mechanisms of de novo prion formation, specificity of prion transmission, and the biological roles of prions. This review summarizes what has been learned from yeast prions. PMID:22879407

Structural organizations of yeast RNase P and RNase MRP holoenzymes as revealed by UV-crosslinking studies of RNA-protein interactions.

PubMed

Khanova, Elena; Esakova, Olga; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S

2012-04-01

Eukaryotic ribonuclease (RNase) P and RNase MRP are closely related ribonucleoprotein complexes involved in the metabolism of various RNA molecules including tRNA, rRNA, and some mRNAs. While evolutionarily related to bacterial RNase P, eukaryotic enzymes of the RNase P/MRP family are much more complex. Saccharomyces cerevisiae RNase P consists of a catalytic RNA component and nine essential proteins; yeast RNase MRP has an RNA component resembling that in RNase P and 10 essential proteins, most of which are shared with RNase P. The structural organizations of eukaryotic RNases P/MRP are not clear. Here we present the results of RNA-protein UV crosslinking studies performed on RNase P and RNase MRP holoenzymes isolated from yeast. The results indicate locations of specific protein-binding sites in the RNA components of RNase P and RNase MRP and shed light on the structural organizations of these large ribonucleoprotein complexes.

Brettanomyces bruxellensis yeasts: impact on wine and winemaking.

PubMed

Agnolucci, Monica; Tirelli, Antonio; Cocolin, Luca; Toffanin, Annita

2017-09-21

Yeasts belonging to the Brettanomyces/Dekkera genus are non-conventional yeasts, which affect winemaking by causing wine spoilage all over the world. This mini-review focuses on recent results concerning the presence of Brettanomyces bruxellensis throughout the wine processing chain. Here, culture-dependent and independent methods to detect this yeast on grapes and at the very early stage of wine production are encompassed. Chemical, physical and biological tools, devised for the prevention and control of such a detrimental species during winemaking are also presented. Finally, the mini-review identifies future research areas relevant to the improvement of wine safety and sensory profiles.

PCR-DGGE analysis of lactic acid bacteria and yeast dynamics during the production processes of three varieties of Panettone.

PubMed

Garofalo, C; Silvestri, G; Aquilanti, L; Clementi, F

2008-07-01

To study lactic acid bacteria (LAB) and yeast dynamics during the production processes of sweet-leavened goods manufactured with type I sourdoughs. Fourteen sourdough and dough samples were taken from a baking company in central Italy during the production lines of three varieties of Panettone. The samples underwent pH measurements and plating analysis on three solid media. The microbial DNA was extracted from both the (sour)doughs and the viable LAB and yeast cells collected in bulk, and subjected to PCR-denaturing gradient gel electrophoresis (DGGE) analysis. The molecular fingerprinting of the cultivable plus noncultivable microbial populations provide evidence of the dominance of Lactobacillus sanfranciscensis, Lactobacillus brevis and Candida humilis in the three fermentation processes. The DGGE profiles of the cultivable communities reveal a bacterial shift in the final stages of two of the production processes, suggesting an effect of technological parameters on the selection of the dough microflora. Our findings confirm the importance of using a combined analytical approach to explore microbial communities that develop during the leavening process of sweet-leavened goods. In-depth studies of sourdough biodiversity and population dynamics occurring during sourdough fermentation are fundamental for the control of the leavening process and the manufacture of standardized, high-quality products.

UV spectrophotometry for monitoring the performance of a yeast-based deoxygenation process to treat ships' ballast water.

PubMed

Veilleux, Éloïse; de Lafontaine, Yves; Thomas, Olivier

2016-04-01

This study assessed the usefulness of UV spectrophotometry for the monitoring of a yeast-based deoxygenation process proposed for ships' ballast water treatment to prevent the transfer of aquatic invasive species. Ten-day laboratory experiments using three treatment concentrations and different water types were conducted and resulted in complete oxygen depletion of treated waters. The treatment performance and quality of treated waters were determined by measuring the UV-visible absorbance spectra of water samples taken over time. Samples were also used for laboratory analysis of water quality properties. The UV absorbance spectra values were strongly correlated (r = 0.96) to yeast cell density in treated waters. The second-order derivative (D (2)) of the spectra varied greatly over time, and the spectrum profiles could be divided into two groups corresponding to the oxygenated and anoxic phases of the treatment. The D (2) value at 215 nm was strongly correlated (r = 0.94) to ammonia levels, which increased over time. The D (2) value at 225 nm was strongly correlated (r > 0.97) to DO concentration. Our results showed that UV spectrophotometry may provide a rapid assessment of the behavior and performance of the yeast bioreactor over time by quantifying (1) the density of yeast cells, (2) the time at which anoxic conditions were reached, and (3) a water quality index of the treated water related to the production of ammonia. We conclude that the rapidity of the technique confers a solid advantage over standard methods used for water quality analysis in laboratory and would permit the direct monitoring of the treatment performance on-board ships.

Rescue of Targeted Regions of Mammalian Chromosomes by in Vivo Recombination in Yeast

PubMed Central

Kouprina, Natalya; Kawamoto, Kensaku; Barrett, J. Carl; Larionov, Vladimir; Koi, Minoru

1998-01-01

In contrast to other animal cell lines, the chicken pre-B cell lymphoma line, DT40, exhibits a high level of homologous recombination, which can be exploited to generate site-specific alterations in defined target genes or regions. In addition, the ability to generate human/chicken monochromosomal hybrids in the DT40 cell line opens a way for specific targeting of human genes. Here we describe a new strategy for direct isolation of a human chromosomal region that is based on targeting of the chromosome with a vector containing a yeast selectable marker, centromere, and an ARS element. This procedure allows rescue of the targeted region by transfection of total genomic DNA into yeast spheroplasts. Selection for the yeast marker results in isolation of chromosome sequences in the form of large circular yeast artificial chromosomes (YACs) up to 170 kb in size containing the targeted region. These YACs are generated by homologous recombination in yeast between common repeated sequences in the targeted chromosomal fragment. Alternatively, the targeted region can be rescued as a linear YACs when a YAC fragmentation vector is included in the yeast transformation mixture. Because the entire isolation procedure of the chromosomal region, once a target insertion is obtained, can be accomplished in ∼1 week, the new method greatly expands the utility of the homologous recombinationproficient DT40 chicken cell system. PMID:9647640

Eukaryotic 5S rRNA biogenesis

PubMed Central

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

Guidelines and recommendations on yeast cell death nomenclature.

PubMed

Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J; Breitenbach, Michael; Burhans, William C; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W; Grant, Chris M; Greenwood, Michael T; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D; Outeiro, Tiago F; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F; Sharon, Amir; Sigrist, Stephan J; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B; Tuite, Mick; Vögtle, F-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J; Zhao, Richard Y; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

2018-01-01

Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cel-lular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the defi-nition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differ-ential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death rou-tines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the au-thors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the pro-gress of this vibrant field of research.

Guidelines and recommendations on yeast cell death nomenclature

PubMed Central

Carmona-Gutierrez, Didac; Bauer, Maria Anna; Zimmermann, Andreas; Aguilera, Andrés; Austriaco, Nicanor; Ayscough, Kathryn; Balzan, Rena; Bar-Nun, Shoshana; Barrientos, Antonio; Belenky, Peter; Blondel, Marc; Braun, Ralf J.; Breitenbach, Michael; Burhans, William C.; Büttner, Sabrina; Cavalieri, Duccio; Chang, Michael; Cooper, Katrina F.; Côrte-Real, Manuela; Costa, Vítor; Cullin, Christophe; Dawes, Ian; Dengjel, Jörn; Dickman, Martin B.; Eisenberg, Tobias; Fahrenkrog, Birthe; Fasel, Nicolas; Fröhlich, Kai-Uwe; Gargouri, Ali; Giannattasio, Sergio; Goffrini, Paola; Gourlay, Campbell W.; Grant, Chris M.; Greenwood, Michael T.; Guaragnella, Nicoletta; Heger, Thomas; Heinisch, Jürgen; Herker, Eva; Herrmann, Johannes M.; Hofer, Sebastian; Jiménez-Ruiz, Antonio; Jungwirth, Helmut; Kainz, Katharina; Kontoyiannis, Dimitrios P.; Ludovico, Paula; Manon, Stéphen; Martegani, Enzo; Mazzoni, Cristina; Megeney, Lynn A.; Meisinger, Chris; Nielsen, Jens; Nyström, Thomas; Osiewacz, Heinz D.; Outeiro, Tiago F.; Park, Hay-Oak; Pendl, Tobias; Petranovic, Dina; Picot, Stephane; Polčic, Peter; Powers, Ted; Ramsdale, Mark; Rinnerthaler, Mark; Rockenfeller, Patrick; Ruckenstuhl, Christoph; Schaffrath, Raffael; Segovia, Maria; Severin, Fedor F.; Sharon, Amir; Sigrist, Stephan J.; Sommer-Ruck, Cornelia; Sousa, Maria João; Thevelein, Johan M.; Thevissen, Karin; Titorenko, Vladimir; Toledano, Michel B.; Tuite, Mick; Vögtle, F.-Nora; Westermann, Benedikt; Winderickx, Joris; Wissing, Silke; Wölfl, Stefan; Zhang, Zhaojie J.; Zhao, Richard Y.; Zhou, Bing; Galluzzi, Lorenzo; Kroemer, Guido; Madeo, Frank

2018-01-01

Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research. PMID:29354647

24 CFR 7.25 - Pre-complaint processing.

Code of Federal Regulations, 2013 CFR

2013-04-01

..., within 45 days of the effective date of the action. EEOC's regulation at 29 CFR 1614.105 shall govern the Department's pre-complaint processing. (b) The Department or the EEOC shall extend the 45-day time limit in... within the time limits, or for other reasons considered sufficient by the ODEEO or the EEOC. (c) At the...

24 CFR 7.25 - Pre-complaint processing.

Code of Federal Regulations, 2010 CFR

2010-04-01

..., within 45 days of the effective date of the action. EEOC's regulation at 29 CFR 1614.105 shall govern the Department's pre-complaint processing. (b) The Department or the EEOC shall extend the 45-day time limit in... within the time limits, or for other reasons considered sufficient by the ODEEO or the EEOC. (c) At the...

24 CFR 7.25 - Pre-complaint processing.

Code of Federal Regulations, 2014 CFR

2014-04-01

..., within 45 days of the effective date of the action. EEOC's regulation at 29 CFR 1614.105 shall govern the Department's pre-complaint processing. (b) The Department or the EEOC shall extend the 45-day time limit in... within the time limits, or for other reasons considered sufficient by the ODEEO or the EEOC. (c) At the...

24 CFR 7.25 - Pre-complaint processing.

Code of Federal Regulations, 2011 CFR

2011-04-01

..., within 45 days of the effective date of the action. EEOC's regulation at 29 CFR 1614.105 shall govern the Department's pre-complaint processing. (b) The Department or the EEOC shall extend the 45-day time limit in... within the time limits, or for other reasons considered sufficient by the ODEEO or the EEOC. (c) At the...

24 CFR 7.25 - Pre-complaint processing.

Code of Federal Regulations, 2012 CFR

2012-04-01

..., within 45 days of the effective date of the action. EEOC's regulation at 29 CFR 1614.105 shall govern the Department's pre-complaint processing. (b) The Department or the EEOC shall extend the 45-day time limit in... within the time limits, or for other reasons considered sufficient by the ODEEO or the EEOC. (c) At the...

Effects of dietary live and heat-inactive baker's yeast on growth, gut health, and disease resistance of Nile tilapia under high rearing density.

PubMed

Ran, Chao; Huang, Lu; Hu, Jun; Tacon, Philippe; He, Suxu; Li, Zhimin; Wang, Yibing; Liu, Zhi; Xu, Li; Yang, Yalin; Zhou, Zhigang

2016-09-01

In this study, the effects of baker's yeast as probiotics was evaluated in Nile tilapia reared at high density. Juvenile tilapia were distributed to tanks at high density (436 fish/m(3)) and fed with basal diet (CK) or diets supplemented with live (LY) or heat-inactivated yeast (HIY). Another group of fish reared at low density (218 fish/m(3)) and fed with basal diet was also included (LowCK). After 8 weeks of feeding, growth, feed utilization, gut microvilli morphology, digestive enzymes, and expressions of hsp70 and inflammation-related cytokines in the intestine were assessed. Intestinal microbiota was investigated using 16S rRNA gene pyrosequencing. Fish were challenged with Aeromonas hydrophila to evaluate disease resistance. High rearing density significantly decreased the growth, feed utilization, microvilli length, and disease resistance of fish (CK versus LowCK). Moreover, the intestinal hsp70 expression was increased in fish reared at high density, supporting a stress condition. Compared to CK group, supplementation of live yeast significantly increased gut microvilli length and trypsin activity, decreased intestinal hsp70 expression, and enhanced resistance of fish against A. hydrophila (reflected by reduced intestinal alkaline phosphatase activity 24 h post infection). The gut microbiota was not markedly influenced by either rearing density or yeast supplementation. Heat-inactivated yeast (HIY) didn't display the beneficial effects observed in LY except an increase in gut trypsin activity, suggesting the importance of yeast viability and thus secretory metabolites of yeast. In conclusion, live baker's yeast may alleviate the negative effects induced by crowding stress, and has the potential to be used as probiotics for tilapia reared at high density. Copyright © 2016 Elsevier Ltd. All rights reserved.

Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

PubMed Central

Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

2017-01-01

In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

Pre- and Post-Processing Tools to Create and Characterize Particle-Based Composite Model Structures

DTIC Science & Technology

2017-11-01

ARL-TR-8213 ● NOV 2017 US Army Research Laboratory Pre- and Post -Processing Tools to Create and Characterize Particle-Based...ARL-TR-8213 ● NOV 2017 US Army Research Laboratory Pre- and Post -Processing Tools to Create and Characterize Particle-Based Composite...AND SUBTITLE Pre- and Post -Processing Tools to Create and Characterize Particle-Based Composite Model Structures 5a. CONTRACT NUMBER 5b. GRANT

An eye movement pre-training fosters the comprehension of processes and functions in technical systems

PubMed Central

Skuballa, Irene T.; Fortunski, Caroline; Renkl, Alexander

2015-01-01

The main research goal of the present study was to investigate in how far pre-training eye movements can facilitate knowledge acquisition in multimedia (pre-training principle). We combined considerations from research on eye movement modeling and pre-training to design and test a non-verbal eye movement-based pre-training. Participants in the experimental condition watched an animated circle moving in close spatial resemblance to a static visualization of a solar plant accompanied by a narration in a subsequently presented learning environment. This training was expected to foster top-down processes as reflected in gaze behavior during the learning process and enhance knowledge acquisition. We compared two groups (N = 45): participants in the experimental condition received pre-training in a first step and processed the learning material in a second step, whereas the control group underwent the second step without any pre-training. The pre-training group outperformed the control group in their learning outcomes, particularly in knowledge about processes and functions of the solar plant. However, the superior learning outcomes in the pre-training group could not be explained by eye-movement patterns. Furthermore, the pre-training moderated the relationship between experienced stress and learning outcomes. In the control group, high stress levels hindered learning, which was not found for the pre-training group. On a delayed posttest participants were requested to draw a picture of the learning content. Despite a non-significant effect of training on the quality of drawings, the pre-training showed associations between learning outcomes at the first testing time and process-related aspects in the quality of their drawings. Overall, non-verbal pre-training is a successful instructional intervention to promote learning processes in novices although these processes did not directly reflect in learners' eye movement behavior during learning. PMID:26029138

An eye movement pre-training fosters the comprehension of processes and functions in technical systems.

PubMed

Skuballa, Irene T; Fortunski, Caroline; Renkl, Alexander

2015-01-01

The main research goal of the present study was to investigate in how far pre-training eye movements can facilitate knowledge acquisition in multimedia (pre-training principle). We combined considerations from research on eye movement modeling and pre-training to design and test a non-verbal eye movement-based pre-training. Participants in the experimental condition watched an animated circle moving in close spatial resemblance to a static visualization of a solar plant accompanied by a narration in a subsequently presented learning environment. This training was expected to foster top-down processes as reflected in gaze behavior during the learning process and enhance knowledge acquisition. We compared two groups (N = 45): participants in the experimental condition received pre-training in a first step and processed the learning material in a second step, whereas the control group underwent the second step without any pre-training. The pre-training group outperformed the control group in their learning outcomes, particularly in knowledge about processes and functions of the solar plant. However, the superior learning outcomes in the pre-training group could not be explained by eye-movement patterns. Furthermore, the pre-training moderated the relationship between experienced stress and learning outcomes. In the control group, high stress levels hindered learning, which was not found for the pre-training group. On a delayed posttest participants were requested to draw a picture of the learning content. Despite a non-significant effect of training on the quality of drawings, the pre-training showed associations between learning outcomes at the first testing time and process-related aspects in the quality of their drawings. Overall, non-verbal pre-training is a successful instructional intervention to promote learning processes in novices although these processes did not directly reflect in learners' eye movement behavior during learning.

Mitochondrial metabolism and stress response of yeast: Applications in fermentation technologies.

PubMed

Kitagaki, Hiroshi; Takagi, Hiroshi

2014-04-01

Mitochondria are sites of oxidative respiration. During sake brewing, sake yeasts are exposed to long periods of hypoxia; the structure, role, and metabolism of mitochondria of sake yeasts have not been studied in detail. It was first elucidated that the mitochondrial structure of sake yeast transforms from filamentous to dotted structure during sake brewing, which affects malate metabolism. Based on the information of yeast mitochondria during sake brewing, practical technologies have been developed; (i) breeding pyruvate-underproducing sake yeast by the isolation of a mutant resistant to an inhibitor of mitochondrial pyruvate transport; and (ii) modifying malate and succinate production by manipulating mitochondrial activity. During the bread-making process, baker's yeast cells are exposed to a variety of baking-associated stresses, such as freeze-thaw, air-drying, and high sucrose concentrations. These treatments induce oxidative stress generating reactive oxygen species due to mitochondrial damage. A novel metabolism of proline and arginine catalyzed by N-acetyltransferase Mpr1 in the mitochondria eventually leads to synthesis of nitric oxide, which confers oxidative stress tolerance on yeast cells. The enhancement of proline and arginine metabolism could be promising for breeding novel baker's yeast strains that are tolerant to multiple baking-associated stresses. These new and practical methods provide approaches to improve the processes in the field of industrial fermentation technologies. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Comparative lipid production by oleaginous yeasts in hydrolyzates of lignocellulosic biomass and process strategy for high titers.

PubMed

Slininger, Patricia J; Dien, Bruce S; Kurtzman, Cletus P; Moser, Bryan R; Bakota, Erica L; Thompson, Stephanie R; O'Bryan, Patricia J; Cotta, Michael A; Balan, Venkatesh; Jin, Mingjie; Sousa, Leonardo da Costa; Dale, Bruce E

2016-08-01

Oleaginous yeasts can convert sugars to lipids with fatty acid profiles similar to those of vegetable oils, making them attractive for production of biodiesel. Lignocellulosic biomass is an attractive source of sugars for yeast lipid production because it is abundant, potentially low cost, and renewable. However, lignocellulosic hydrolyzates are laden with byproducts which inhibit microbial growth and metabolism. With the goal of identifying oleaginous yeast strains able to convert plant biomass to lipids, we screened 32 strains from the ARS Culture Collection, Peoria, IL to identify four robust strains able to produce high lipid concentrations from both acid and base-pretreated biomass. The screening was arranged in two tiers using undetoxified enzyme hydrolyzates of ammonia fiber expansion (AFEX)-pretreated cornstover as the primary screening medium and acid-pretreated switch grass as the secondary screening medium applied to strains passing the primary screen. Hydrolyzates were prepared at ∼18-20% solids loading to provide ∼110 g/L sugars at ∼56:39:5 mass ratio glucose:xylose:arabinose. A two stage process boosting the molar C:N ratio from 60 to well above 400 in undetoxified switchgrass hydrolyzate was optimized with respect to nitrogen source, C:N, and carbon loading. Using this process three strains were able to consume acetic acid and nearly all available sugars to accumulate 50-65% of cell biomass as lipid (w/w), to produce 25-30 g/L lipid at 0.12-0.22 g/L/h and 0.13-0.15 g/g or 39-45% of the theoretical yield at pH 6 and 7, a performance unprecedented in lignocellulosic hydrolyzates. Three of the top strains have not previously been reported for the bioconversion of lignocellulose to lipids. The successful identification and development of top-performing lipid-producing yeast in lignocellulose hydrolyzates is expected to advance the economic feasibility of high quality biodiesel and jet fuels from renewable biomass, expanding the market

Yeast for virus research

PubMed Central

Zhao, Richard Yuqi

2017-01-01

Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

Antimicrobial activity of yeasts against some pathogenic bacteria

PubMed Central

Younis, Gamal; Awad, Amal; Dawod, Rehab E.; Yousef, Nehal E.

2017-01-01

Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR) for detection of khs (kievitone hydratase) and pelA (pectate degrading enzyme)genes. Results: The recovery rate of yeasts from sausage was 20% (2/10) followed by kareish cheese, processed cheese, and butter 10% (1/10) each as well as raw milk 9% (9/100), and fruit yoghurt 30% (6/20). Different yeast species were recovered, namely, Candida kefyr (5 isolates), Saccharomyces cerevisiae (4 isolates), Candida intermedia (3 isolates), Candida tropicalis (2 isolates), Candida lusitaniae (2 isolates), and Candida krusei (1 isolate). khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food. PMID:28919693

Screening of intact yeasts and cell extracts to reduce Scrapie prions during biotransformation of food waste.

PubMed

Huyben, David; Boqvist, Sofia; Passoth, Volkmar; Renström, Lena; Allard Bengtsson, Ulrika; Andréoletti, Olivier; Kiessling, Anders; Lundh, Torbjörn; Vågsholm, Ivar

2018-02-08

Yeasts can be used to convert organic food wastes to protein-rich animal feed in order to recapture nutrients. However, the reuse of animal-derived waste poses a risk for the transmission of infectious prions that can cause neurodegeneration and fatality in humans and animals. The aim of this study was to investigate the ability of yeasts to reduce prion activity during the biotransformation of waste substrates-thereby becoming a biosafety hurdle in such a circular food system. During pre-screening, 30 yeast isolates were spiked with Classical Scrapie prions and incubated for 72 h in casein substrate, as a waste substitute. Based on reduced Scrapie seeding activity, waste biotransformation and protease activities, intact cells and cell extracts of 10 yeasts were further tested. Prion analysis showed that five yeast species reduced Scrapie seeding activity by approximately 1 log10 or 90%. Cryptococcus laurentii showed the most potential to reduce prion activity since both intact and extracted cells reduced Scrapie by 1 log10 and achieved the highest protease activity. These results show that select forms of yeast can act as a prion hurdle during the biotransformation of waste. However, the limited ability of yeasts to reduce prion activity warrants caution as a sole barrier to transmission as higher log reductions are needed before using waste-cultured yeast in circular food systems.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Arabic handwritten: pre-processing and segmentation

NASA Astrophysics Data System (ADS)

Maliki, Makki; Jassim, Sabah; Al-Jawad, Naseer; Sellahewa, Harin

2012-06-01

This paper is concerned with pre-processing and segmentation tasks that influence the performance of Optical Character Recognition (OCR) systems and handwritten/printed text recognition. In Arabic, these tasks are adversely effected by the fact that many words are made up of sub-words, with many sub-words there associated one or more diacritics that are not connected to the sub-word's body; there could be multiple instances of sub-words overlap. To overcome these problems we investigate and develop segmentation techniques that first segment a document into sub-words, link the diacritics with their sub-words, and removes possible overlapping between words and sub-words. We shall also investigate two approaches for pre-processing tasks to estimate sub-words baseline, and to determine parameters that yield appropriate slope correction, slant removal. We shall investigate the use of linear regression on sub-words pixels to determine their central x and y coordinates, as well as their high density part. We also develop a new incremental rotation procedure to be performed on sub-words that determines the best rotation angle needed to realign baselines. We shall demonstrate the benefits of these proposals by conducting extensive experiments on publicly available databases and in-house created databases. These algorithms help improve character segmentation accuracy by transforming handwritten Arabic text into a form that could benefit from analysis of printed text.

L-arabinose fermenting yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Min; Singh, Arjun; Suominen, Pirkko

An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

L-arabinose fermenting yeast

DOEpatents

Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

2014-09-23

An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

Process strategies to maximize lipid accumulations of novel yeast in acid and base treated hydrolyzates

USDA-ARS?s Scientific Manuscript database

Oleaginous yeasts can accumulate up to 70% of cell biomass as lipids, predominantly as triacylglycerols. Yeast lipid fatty acid profiles have been reported to be similar to that of vegetable oils and consist primarily of oleic, palmitic, stearic, and linoleic acids. This capability provides the oppo...

An adaptive deep-coupled GNSS/INS navigation system with hybrid pre-filter processing

NASA Astrophysics Data System (ADS)

Wu, Mouyan; Ding, Jicheng; Zhao, Lin; Kang, Yingyao; Luo, Zhibin

2018-02-01

The deep-coupling of a global navigation satellite system (GNSS) with an inertial navigation system (INS) can provide accurate and reliable navigation information. There are several kinds of deeply-coupled structures. These can be divided mainly into coherent and non-coherent pre-filter based structures, which have their own strong advantages and disadvantages, especially in accuracy and robustness. In this paper, the existing pre-filters of the deeply-coupled structures are analyzed and modified to improve them firstly. Then, an adaptive GNSS/INS deeply-coupled algorithm with hybrid pre-filters processing is proposed to combine the advantages of coherent and non-coherent structures. An adaptive hysteresis controller is designed to implement the hybrid pre-filters processing strategy. The simulation and vehicle test results show that the adaptive deeply-coupled algorithm with hybrid pre-filters processing can effectively improve navigation accuracy and robustness, especially in a GNSS-challenged environment.

Prevention of Yeast Spoilage in Feed and Food by the Yeast Mycocin HMK

PubMed Central

Lowes, K. F.; Shearman, C. A.; Payne, J.; MacKenzie, D.; Archer, D. B.; Merry, R. J.; Gasson, M. J.

2000-01-01

The yeast Williopsis mrakii produces a mycocin or yeast killer toxin designated HMK; this toxin exhibits high thermal stability, high pH stability, and a broad spectrum of activity against other yeasts. We describe construction of a synthetic gene for mycocin HMK and heterologous expression of this toxin in Aspergillus niger. Mycocin HMK was fused to a glucoamylase protein carrier, which resulted in secretion of biologically active mycocin into the culture media. A partial purification protocol was developed, and a comparison with native W. mrakii mycocin showed that the heterologously expressed mycocin had similar physiological properties and an almost identical spectrum of biological activity against a number of yeasts isolated from silage and yoghurt. Two food and feed production systems prone to yeast spoilage were used as models to assess the ability of mycocin HMK to act as a biocontrol agent. The onset of aerobic spoilage in mature maize silage was delayed by application of A. niger mycocin HMK on opening because the toxin inhibited growth of the indigenous spoilage yeasts. This helped maintain both higher lactic acid levels and a lower pH. In yoghurt spiked with dairy spoilage yeasts, A. niger mycocin HMK was active at all of the storage temperatures tested at which yeast growth occurred, and there was no resurgence of resistant yeasts. The higher the yeast growth rate, the more effective the killing action of the mycocin. Thus, mycocin HMK has potential applications in controlling both silage spoilage and yoghurt spoilage caused by yeasts. PMID:10698773

From drug to protein: using yeast genetics for high-throughput target discovery.

PubMed

Armour, Christopher D; Lum, Pek Yee

2005-02-01

The budding yeast Saccharomyces cerevisiae has long been an effective eukaryotic model system for understanding basic cellular processes. The genetic tractability and ease of manipulation in the laboratory make yeast well suited for large-scale chemical and genetic screens. Several recent studies describing the use of yeast genetics for high-throughput drug target identification are discussed in this review.

The yeast stands alone: the future of protein biologic production.

PubMed

Love, Kerry R; Dalvie, Neil C; Love, J Christopher

2017-12-22

Yeasts are promising alternative hosts for the manufacturing of recombinant protein therapeutics because they simply and efficiently meet needs for both platform and small-market drugs. Fast accumulation of biomass and low-cost media reduce the cost-of-goods when using yeast, which in turn can enable agile, small-volume manufacturing facilities. Small, tractable yeast genomes are amenable to rapid process development, facilitating strain and product quality by design. Specifically, Pichia pastoris is becoming a widely accepted yeast for biopharmaceutical manufacturing in much of the world owing to a clean secreted product and the rapidly expanding understanding of its cell biology as a host organism. We advocate for a near term partnership spanning industry and academia to promote open source, timely development of yeast hosts. Copyright © 2017. Published by Elsevier Ltd.

Nuclear Magnetic Resonance Spectroscopy-Based Identification of Yeast.

PubMed

Himmelreich, Uwe; Sorrell, Tania C; Daniel, Heide-Marie

2017-01-01

Rapid and robust high-throughput identification of environmental, industrial, or clinical yeast isolates is important whenever relatively large numbers of samples need to be processed in a cost-efficient way. Nuclear magnetic resonance (NMR) spectroscopy generates complex data based on metabolite profiles, chemical composition and possibly on medium consumption, which can not only be used for the assessment of metabolic pathways but also for accurate identification of yeast down to the subspecies level. Initial results on NMR based yeast identification where comparable with conventional and DNA-based identification. Potential advantages of NMR spectroscopy in mycological laboratories include not only accurate identification but also the potential of automated sample delivery, automated analysis using computer-based methods, rapid turnaround time, high throughput, and low running costs.We describe here the sample preparation, data acquisition and analysis for NMR-based yeast identification. In addition, a roadmap for the development of classification strategies is given that will result in the acquisition of a database and analysis algorithms for yeast identification in different environments.

Responses of Yeast Biocontrol Agents to Environmental Stress

PubMed Central

Sui, Yuan; Wisniewski, Michael; Droby, Samir

2015-01-01

Biological control of postharvest diseases, utilizing wild species and strains of antagonistic yeast species, is a research topic that has received considerable attention in the literature over the past 30 years. In principle, it represents a promising alternative to chemical fungicides for the management of postharvest decay of fruits, vegetables, and grains. A yeast-based biocontrol system is composed of a tritrophic interaction between a host (commodity), a pathogen, and a yeast species, all of which are affected by environmental factors such as temperature, pH, and UV light as well as osmotic and oxidative stresses. Additionally, during the production process, biocontrol agents encounter various severe abiotic stresses that also impact their viability. Therefore, understanding the ecological fitness of the potential yeast biocontrol agents and developing strategies to enhance their stress tolerance are essential to their efficacy and commercial application. The current review provides an overview of the responses of antagonistic yeast species to various environmental stresses, the methods that can be used to improve stress tolerance and efficacy, and the related mechanisms associated with improved stress tolerance. PMID:25710368

The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

PubMed

Sardana, Richa; White, Joshua P; Johnson, Arlen W

2013-06-01

Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

Radar signal pre-processing to suppress surface bounce and multipath

DOEpatents

Paglieroni, David W; Mast, Jeffrey E; Beer, N. Reginald

2013-12-31

A method and system for detecting the presence of subsurface objects within a medium is provided. In some embodiments, the imaging and detection system operates in a multistatic mode to collect radar return signals generated by an array of transceiver antenna pairs that is positioned across the surface and that travels down the surface. The imaging and detection system pre-processes that return signal to suppress certain undesirable effects. The imaging and detection system then generates synthetic aperture radar images from real aperture radar images generated from the pre-processed return signal. The imaging and detection system then post-processes the synthetic aperture radar images to improve detection of subsurface objects. The imaging and detection system identifies peaks in the energy levels of the post-processed image frame, which indicates the presence of a subsurface object.

Genetic Polymorphism in Wine Yeasts: Mechanisms and Methods for Its Detection

PubMed Central

Guillamón, José M.; Barrio, Eladio

2017-01-01

The processes of yeast selection for using as wine fermentation starters have revealed a great phenotypic diversity both at interspecific and intraspecific level, which is explained by a corresponding genetic variation among different yeast isolates. Thus, the mechanisms involved in promoting these genetic changes are the main engine generating yeast biodiversity. Currently, an important task to understand biodiversity, population structure and evolutionary history of wine yeasts is the study of the molecular mechanisms involved in yeast adaptation to wine fermentation, and on remodeling the genomic features of wine yeast, unconsciously selected since the advent of winemaking. Moreover, the availability of rapid and simple molecular techniques that show genetic polymorphisms at species and strain levels have enabled the study of yeast diversity during wine fermentation. This review will summarize the mechanisms involved in generating genetic polymorphisms in yeasts, the molecular methods used to unveil genetic variation, and the utility of these polymorphisms to differentiate strains, populations, and species in order to infer the evolutionary history and the adaptive evolution of wine yeasts, and to identify their influence on their biotechnological and sensorial properties. PMID:28522998

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology.

PubMed

Pulschen, André A; Rodrigues, Fabio; Duarte, Rubens T D; Araujo, Gabriel G; Santiago, Iara F; Paulino-Lima, Ivan G; Rosa, Carlos A; Kato, Massuo J; Pellizari, Vivian H; Galante, Douglas

2015-08-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75-2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to -6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

UV-resistant yeasts isolated from a high-altitude volcanic area on the Atacama Desert as eukaryotic models for astrobiology

PubMed Central

Pulschen, André A; Rodrigues, Fabio; Duarte, Rubens T D; Araujo, Gabriel G; Santiago, Iara F; Paulino-Lima, Ivan G; Rosa, Carlos A; Kato, Massuo J; Pellizari, Vivian H; Galante, Douglas

2015-01-01

The Sairecabur volcano (5971 m), in the Atacama Desert, is a high-altitude extreme environment with high daily temperature variations, acidic soils, intense UV radiation, and low availability of water. Four different species of yeasts were isolated from this region using oligotrophic media, identified and characterized for their tolerance to extreme conditions. rRNA sequencing revealed high identity (>98%) to Cryptococcus friedmannii, Exophiala sp., Holtermanniella watticus, and Rhodosporidium toruloides. To our knowledge, this is the first report of these yeasts in the Atacama Desert. All isolates showed high resistance to UV-C, UV-B and environmental-UV radiation, capacity to grow at moderate saline media (0.75–2.25 mol/L NaCl) and at moderate to cold temperatures, being C. friedmannii and H. watticus able to grow in temperatures down to −6.5°C. The presence of pigments, analyzed by Raman spectroscopy, correlated with UV resistance in some cases, but there is evidence that, on the natural environment, other molecular mechanisms may be as important as pigmentation, which has implications for the search of spectroscopic biosignatures on planetary surfaces. Due to the extreme tolerances of the isolated yeasts, these organisms represent interesting eukaryotic models for astrobiological purposes. PMID:26147800

Pre-Service Science and Primary School Teachers' Identification of Scientific Process Skills

ERIC Educational Resources Information Center

Birinci Konur, Kader; Yildirim, Nagihan

2016-01-01

The purpose of this study was to conduct a comparative analysis of pre-service primary school and science teachers' identification of scientific process skills. The study employed the survey method, and the sample included 95 pre-service science teachers and 95 pre-service primary school teachers from the Faculty of Education at Recep Tayyip…

Ischemia--reperfusion: a look from yeast mitochondria.

PubMed

Stella, Carlos; Burgos, Isabel; Chapela, S; Gamondi, Oliver

2011-01-01

The apoptotic phenomena observed in tissues which are subdued to ischemia and then to technical therapeutics of perfusion keep causing serious problems in the patient's clinical recovery. Then, they constitute a challenge to resolve. The objective of this work is to discuss the intracellular mechanisms that lead cells to apoptosis during the ischemia-reperfusion process, taking into consideration that these phenomena are observable in a simple microorganism as the yeast Saccharomyces cerevisiae. Yeast provide an alternative study system in which the effects of certain cytoprotective drugs can be evaluated. The results can then be extrapolated to other types of cells. Several works have focused on the role of mitochondria in the apoptotic processes of cellular necrosis. One of the main factors responsible for this process is the unregulated opening of the permeability barrier. The inner membrane thus allows the unrestricted passage of ions and the release of apoptotic mediators from the inner membrane space towards the cytosol. Also, there is an increase in the level of reactive oxygen species (ROS) and the uncoupling of oxidative phosphorylation, which lead to the reversal of ATP synthesis to ATP hydrolysis. The driving cause of this complex process is the opening of an non-specific pore located in the mitochondrial membrane, denominated mammalian permeability transition pore (mPTP), which is also expressed in yeast (yPTP). From the functional point of view, the yeast pore presents some of the characteristics observed in mammals, and is similar in the defensive response against the deleterious mechanisms caused by oxidative stress. An increasing body of evidence supports the concept that the pharmacological inhibition of the mPTP is an actual and promising strategy for the protection of tissues in ischemic situations in order to avoid the damage induced by perfusion.

Structural organizations of yeast RNase P and RNase MRP holoenzymes as revealed by UV-crosslinking studies of RNA–protein interactions

PubMed Central

Khanova, Elena; Esakova, Olga; Perederina, Anna; Berezin, Igor; Krasilnikov, Andrey S.

2012-01-01

Eukaryotic ribonuclease (RNase) P and RNase MRP are closely related ribonucleoprotein complexes involved in the metabolism of various RNA molecules including tRNA, rRNA, and some mRNAs. While evolutionarily related to bacterial RNase P, eukaryotic enzymes of the RNase P/MRP family are much more complex. Saccharomyces cerevisiae RNase P consists of a catalytic RNA component and nine essential proteins; yeast RNase MRP has an RNA component resembling that in RNase P and 10 essential proteins, most of which are shared with RNase P. The structural organizations of eukaryotic RNases P/MRP are not clear. Here we present the results of RNA–protein UV crosslinking studies performed on RNase P and RNase MRP holoenzymes isolated from yeast. The results indicate locations of specific protein-binding sites in the RNA components of RNase P and RNase MRP and shed light on the structural organizations of these large ribonucleoprotein complexes. PMID:22332141

The roles of SSU processome components and surveillance factors in the initial processing of human ribosomal RNA

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Schneider, Claudia; Watkins, Nicholas J.

2014-01-01

During eukaryotic ribosome biogenesis, three of the mature ribosomal (r)RNAs are released from a single precursor transcript (pre-rRNA) by an ordered series of endonucleolytic cleavages and exonucleolytic processing steps. Production of the 18S rRNA requires the removal of the 5′ external transcribed spacer (5′ETS) by endonucleolytic cleavages at sites A0 and A1/site 1. In metazoans, an additional cleavage in the 5′ETS, at site A′, upstream of A0, has also been reported. Here, we have investigated how A′ processing is coordinated with assembly of the early preribosomal complex. We find that only the tUTP (UTP-A) complex is critical for A′ cleavage, while components of the bUTP (UTP-B) and U3 snoRNP are important, but not essential, for efficient processing at this site. All other factors involved in the early stages of 18S rRNA processing that were tested here function downstream from this processing step. Interestingly, we show that the RNA surveillance factors XRN2 and MTR4 are also involved in A′ cleavage in humans. A′ cleavage is largely bypassed when XRN2 is depleted, and we also discover that A′ cleavage is not always the initial processing event in all cell types. Together, our data suggest that A′ cleavage is not a prerequisite for downstream pre-rRNA processing steps and may, in fact, represent a quality control step for initial pre-rRNA transcripts. Furthermore, we show that components of the RNA surveillance machinery, including the exosome and TRAMP complexes, also play key roles in the recycling of excised spacer fragments and degradation of aberrant pre-rRNAs in human cells. PMID:24550520

Pre-processing by data augmentation for improved ellipse fitting.

PubMed

Kumar, Pankaj; Belchamber, Erika R; Miklavcic, Stanley J

2018-01-01

Ellipse fitting is a highly researched and mature topic. Surprisingly, however, no existing method has thus far considered the data point eccentricity in its ellipse fitting procedure. Here, we introduce the concept of eccentricity of a data point, in analogy with the idea of ellipse eccentricity. We then show empirically that, irrespective of ellipse fitting method used, the root mean square error (RMSE) of a fit increases with the eccentricity of the data point set. The main contribution of the paper is based on the hypothesis that if the data point set were pre-processed to strategically add additional data points in regions of high eccentricity, then the quality of a fit could be improved. Conditional validity of this hypothesis is demonstrated mathematically using a model scenario. Based on this confirmation we propose an algorithm that pre-processes the data so that data points with high eccentricity are replicated. The improvement of ellipse fitting is then demonstrated empirically in real-world application of 3D reconstruction of a plant root system for phenotypic analysis. The degree of improvement for different underlying ellipse fitting methods as a function of data noise level is also analysed. We show that almost every method tested, irrespective of whether it minimizes algebraic error or geometric error, shows improvement in the fit following data augmentation using the proposed pre-processing algorithm.

The price of independence: cell separation in fission yeast.

PubMed

Martín-García, Rebeca; Santos, Beatriz

2016-04-01

The ultimate goal of cell division is to give rise to two viable independent daughter cells. A tight spatial and temporal regulation between chromosome segregation and cytokinesis ensures the viability of the daughter cells. Schizosaccharomyces pombe, commonly known as fission yeast, has become a leading model organism for studying essential and conserved mechanisms of the eukaryotic cell division process. Like many other eukaryotic cells it divides by binary fission and the cleavage furrow undergoes ingression due to the contraction of an actomyosin ring. In contrast to mammalian cells, yeasts as cell-walled organisms, also need to form a division septum made of cell wall material to complete the process of cytokinesis. The division septum is deposited behind the constricting ring and it will constitute the new ends of the daughter cells. Cell separation also involves cell wall degradation and this process should be precisely regulated to avoid cell lysis. In this review, we will give a brief overview of the whole cytokinesis process in fission yeast, from the positioning and assembly of the contractile ring to the final step of cell separation, and the problems generated when these processes are not precise.

The Human RNA Polymerase I Transcription Terminator Complex Acts as a Replication Fork Barrier That Coordinates the Progress of Replication with rRNA Transcription Activity.

PubMed

Akamatsu, Yufuko; Kobayashi, Takehiko

2015-05-01

In S phase, the replication and transcription of genomic DNA need to accommodate each other, otherwise their machineries collide, with chromosomal instability as a possible consequence. Here, we characterized the human replication fork barrier (RFB) that is present downstream from the 47S pre-rRNA gene (ribosomal DNA [rDNA]). We found that the most proximal transcription terminator, Sal box T1, acts as a polar RFB, while the other, Sal box T4/T5, arrests replication forks bidirectionally. The fork-arresting activity at these sites depends on polymerase I (Pol I) transcription termination factor 1 (TTF-1) and a replisome component, TIMELESS (TIM). We also found that the RFB activity was linked to rDNA copies with hypomethylated CpG and coincided with the time that actively transcribed rRNA genes are replicated. Failed fork arrest at RFB sites led to a slowdown of fork progression moving in the opposite direction to rRNA transcription. Chemical inhibition of transcription counteracted this deceleration of forks, indicating that rRNA transcription impedes replication in the absence of RFB activity. Thus, our results reveal a role of RFB for coordinating the progression of replication and transcription activity in highly transcribed rRNA genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Yeast prions are useful for studying protein chaperones and protein quality control.

PubMed

Masison, Daniel C; Reidy, Michael

2015-01-01

Protein chaperones help proteins adopt and maintain native conformations and play vital roles in cellular processes where proteins are partially folded. They comprise a major part of the cellular protein quality control system that protects the integrity of the proteome. Many disorders are caused when proteins misfold despite this protection. Yeast prions are fibrous amyloid aggregates of misfolded proteins. The normal action of chaperones on yeast prions breaks the fibers into pieces, which results in prion replication. Because this process is necessary for propagation of yeast prions, even small differences in activity of many chaperones noticeably affect prion phenotypes. Several other factors involved in protein processing also influence formation, propagation or elimination of prions in yeast. Thus, in much the same way that the dependency of viruses on cellular functions has allowed us to learn much about cell biology, the dependency of yeast prions on chaperones presents a unique and sensitive way to monitor the functions and interactions of many components of the cell's protein quality control system. Our recent work illustrates the utility of this system for identifying and defining chaperone machinery interactions.

Phenotypic evaluation and characterization of 21 industrial Saccharomyces cerevisiae yeast strains.

PubMed

Kong, In Iok; Turner, Timothy Lee; Kim, Heejin; Kim, Soo Rin; Jin, Yong-Su

2018-02-01

Microorganisms have been studied and used extensively to produce value-added fuels and chemicals. Yeasts, specifically Saccharomyces cerevisiae, receive industrial attention because of their well-known ability to ferment glucose and produce ethanol. Thousands of natural or genetically modified S. cerevisiae have been found in industrial environments for various purposes. These industrial strains are isolated from industrial fermentation sites, and they are considered as potential host strains for superior fermentation processes. In many cases, industrial yeast strains have higher thermotolerance, increased resistances towards fermentation inhibitors and increased glucose fermentation rates under anaerobic conditions when compared with laboratory yeast strains. Despite the advantages of industrial strains, they are often not well characterized. Through screening and phenotypic characterization of commercially available industrial yeast strains, industrial fermentation processes requiring specific environmental conditions may be able to select an ideal starting yeast strain to be further engineered. Here, we have characterized and compared 21 industrial S. cerevisiae strains under multiple conditions, including their tolerance to varying pH conditions, resistance to fermentation inhibitors, sporulation efficiency and ability to ferment lignocellulosic sugars. These data may be useful for the selection of a parental strain for specific biotechnological applications of engineered yeast. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae

PubMed Central

Schmidt, Christian; Berninghausen, Otto; Becker, Thomas

2017-01-01

Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690

Effect of wine yeast monoculture practice on the biodiversity of non-Saccharomyces yeasts.

PubMed

Ganga, M A; Martínez, C

2004-01-01

The objective of this work was to study the effect of the use of Saccharomyces cerevisiae monocultures over the biodiversity of non-Saccharomyces yeasts in wine-producing areas in Chile. Microvinifications were carried out with grape musts of two areas. In one of them, the fermentation is carried out mainly in a spontaneous manner, whereas in the other the musts are inoculated with commercial yeasts. The isolated yeasts were identified by the internal transcribed (ITS)/restriction fragment length polymorphism technique. In the industrial production area less variability of yeast genera was observed as compared with the traditional area, an observation that is greatest at the end of the fermentation. Furthermore, a study of the production of extracellular enzymes was done. The majority of the yeasts showed at least one of the activities assayed with the exception of beta-glycosidase. The results suggest that in the industrialized area the diversity of yeasts is less in the traditional area. Likewise, the potentiality of the non-Saccharomyces yeasts as enzyme producers with industrial interest has been confirmed. This study shows the negative effect of the use of monocultures over the biodiversity of yeasts in wine-producing regions.

Highly Efficient Erythritol Recovery from Waste Erythritol Mother Liquor by a Yeast-Mediated Biorefinery Process.

PubMed

Wang, Siqi; Wang, Hengwei; Lv, Jiyang; Deng, Zixin; Cheng, Hairong

2017-12-20

Erythritol, a natural sugar alcohol, is produced industrially by fermentation and crystallization, but this process leaves a large amount of waste erythritol mother liquor (WEML) which contains more than 200 g/L erythritol as well as other polyol byproducts. These impurities make it very difficult to crystallize more erythritol. In our study, an efficient process for the recovery of erythritol from the WEML is described. The polyol impurities were first identified by high-performance liquid chromatography and gas chromatography-mass spectrometry, and a yeast strain Candida maltosa CGMCC 7323 was then isolated to metabolize those impurities to purify erythritol. Our results demonstrated that the process could remarkably improve the purity of erythritol and thus make the subsequent crystallization easier. This newly developed strategy is expected to have advantages in WEML treatment and provide helpful information with regard to green cell factories and zero-waste processing.

Screening for new brewing yeasts in the non-Saccharomyces sector with Torulaspora delbrueckii as model.

PubMed

Michel, Maximilian; Kopecká, Jana; Meier-Dörnberg, Tim; Zarnkow, Martin; Jacob, Fritz; Hutzler, Mathias

2016-04-01

This study describes a screening system for future brewing yeasts focusing on non-Saccharomyces yeasts. The aim was to find new yeast strains that can ferment beer wort into a respectable beer. Ten Torulaspora delbrueckii strains were put through the screening system, which included sugar utilization tests, hop resistance tests, ethanol resistance tests, polymerase chain reaction fingerprinting, propagation tests, amino acid catabolism and anabolism, phenolic off-flavour tests and trial fermentations. Trial fermentations were analysed for extract reduction, pH drop, yeast concentration in bulk fluid and fermentation by-products. All investigated strains were able to partly ferment wort sugars and showed high tolerance to hop compounds and ethanol. One of the investigated yeast strains fermented all the wort sugars and produced a respectable fruity flavour and a beer of average ethanol content with a high volatile flavour compound concentration. Two other strains could possibly be used for pre-fermentation as a bio-flavouring agent for beers that have been post-fermented by Saccharomyces strains as a consequence of their low sugar utilization but good flavour-forming properties. Copyright © 2015 John Wiley & Sons, Ltd.

Selective catalytic reduction system and process using a pre-sulfated zirconia binder

DOEpatents

Sobolevskiy, Anatoly; Rossin, Joseph A.

2010-06-29

A selective catalytic reduction (SCR) process with a palladium catalyst for reducing NOx in a gas, using hydrogen as a reducing agent is provided. The process comprises contacting the gas stream with a catalyst system, the catalyst system comprising (ZrO.sub.2)SO.sub.4, palladium, and a pre-sulfated zirconia binder. The inclusion of a pre-sulfated zirconia binder substantially increases the durability of a Pd-based SCR catalyst system. A system for implementing the disclosed process is further provided.

DPPP: Default Pre-Processing Pipeline

NASA Astrophysics Data System (ADS)

van Diepen, Ger; Dijkema, Tammo Jan

2018-04-01

DPPP (Default Pre-Processing Pipeline, also referred to as NDPPP) reads and writes radio-interferometric data in the form of Measurement Sets, mainly those that are created by the LOFAR telescope. It goes through visibilities in time order and contains standard operations like averaging, phase-shifting and flagging bad stations. Between the steps in a pipeline, the data is not written to disk, making this tool suitable for operations where I/O dominates. More advanced procedures such as gain calibration are also included. Other computing steps can be provided by loading a shared library; currently supported external steps are the AOFlagger (ascl:1010.017) and a bridge that enables loading python steps.

L-arabinose fermenting yeast

DOEpatents

Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

2010-12-07

An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

Nitrile Metabolizing Yeasts

NASA Astrophysics Data System (ADS)

Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

Methods and materials for the production of L-lactic acid in yeast

DOEpatents

Hause, Ben [Jordan, MN; Rajgarhia, Vineet [Minnetonka, MN; Suominen, Pirkko [Maple Grove, MN

2009-05-19

Recombinant yeast are provided having, in one aspect, multiple exogenous LDH genes integrated into the genome, while leaving native PDC genes intact. In a second aspect, recombinant yeast are provided having an exogenous LDH gene integrated into its genome at the locus of a native PDC gene, with deletion of the native PDC gene. The recombinant yeast are useful in fermentation process for producing lactic acid.

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

Genome dynamics and evolution in yeasts: A long-term yeast-bacteria competition experiment

PubMed Central

Katz, Michael; Knecht, Wolfgang; Compagno, Concetta; Piškur, Jure

2018-01-01

There is an enormous genetic diversity evident in modern yeasts, but our understanding of the ecological basis of such diversifications in nature remains at best fragmented so far. Here we report a long-term experiment mimicking a primordial competitive environment, in which yeast and bacteria co-exist and compete against each other. Eighteen yeasts covering a wide phylogenetic background spanning approximately 250 million years of evolutionary history were used to establish independent evolution lines for at most 130 passages. Our collection of hundreds of modified strains generated through such a rare two-species cross-kingdom competition experiment re-created the appearance of large-scale genomic rearrangements and altered phenotypes important in the diversification history of yeasts. At the same time, the methodology employed in this evolutionary study would also be a non-gene-technological method of reprogramming yeast genomes and then selecting yeast strains with desired traits. Cross-kingdom competition may therefore be a method of significant value to generate industrially useful yeast strains with new metabolic traits. PMID:29624585

Candida potacharoeniae sp. nov. and Candida spenceri sp. nov., two novel galactose-containing ascomycetous anamorphic yeast species isolated in Thailand.

PubMed

Nakase, Takashi; Jindamorakot, Sasitorn; Imanishi, Yumi; Am-In, Somjit; Ninomiya, Shinya; Kawasaki, Hiroko; Limtong, Savitree

2010-08-01

Fifteen strains of anamorphic yeasts isolated from various natural substrates collected in various places in Thailand were found to represent two novel species of anamorphic yeast genus Candida based on the sequence analysis of the D1/D2 domain of the large subunit rRNA genes, chemotaxonomic and conventional properties used for the classification of yeasts. These strains are located in the clade including Candida etchellsii and Candida magnoliae. Fourteen strains represented by ST-490(T) (BCC 15176(T)=NBRC 106439(T)= CBS 11674(T)) are closely related to Candida sorbosivorans in the D1/D2 sequences but 11 nucleotides (2.4%) were substituted. The remaining strain, ST-594(T) (=BCC 15278(T)=NBRC 106446(T)=CBS 11673(T)) showed a close relationship to Candida geochares but 21 nucleotides (4.7%) were substituted. Apparently, these strains represent two novel Candida species of the Starmerella clade. The two species are described as Candida potacharoeniae sp. nov. and Candida spenceri sp. nov. in the present paper. Like the most species of this clade, the two species contain galactose in the cells in addition to glucose and mannose and have high mol% G + C of 54.4-55.9 and 54.9, respectively.

Metabolic engineering of yeast for lignocellulosic biofuel production.

PubMed

Jin, Yong-Su; Cate, Jamie Hd

2017-12-01

Production of biofuels from lignocellulosic biomass remains an unsolved challenge in industrial biotechnology. Efforts to use yeast for conversion face the question of which host organism to use, counterbalancing the ease of genetic manipulation with the promise of robust industrial phenotypes. Saccharomyces cerevisiae remains the premier host for metabolic engineering of biofuel pathways, due to its many genetic, systems and synthetic biology tools. Numerous engineering strategies for expanding substrate ranges and diversifying products of S. cerevisiae have been developed. Other yeasts generally lack these tools, yet harbor superior phenotypes that could be exploited in the harsh processes required for lignocellulosic biofuel production. These include thermotolerance, resistance to toxic compounds generated during plant biomass deconstruction, and wider carbon consumption capabilities. Although promising, these yeasts have yet to be widely exploited. By contrast, oleaginous yeasts such as Yarrowia lipolytica capable of producing high titers of lipids are rapidly advancing in terms of the tools available for their metabolic manipulation. Copyright © 2017 Elsevier Ltd. All rights reserved.

A review of blood sample handling and pre-processing for metabolomics studies.

PubMed

Hernandes, Vinicius Veri; Barbas, Coral; Dudzik, Danuta

2017-09-01

Metabolomics has been found to be applicable to a wide range of clinical studies, bringing a new era for improving clinical diagnostics, early disease detection, therapy prediction and treatment efficiency monitoring. A major challenge in metabolomics, particularly untargeted studies, is the extremely diverse and complex nature of biological specimens. Despite great advances in the field there still exist fundamental needs for considering pre-analytical variability that can introduce bias to the subsequent analytical process and decrease the reliability of the results and moreover confound final research outcomes. Many researchers are mainly focused on the instrumental aspects of the biomarker discovery process, and sample related variables sometimes seem to be overlooked. To bridge the gap, critical information and standardized protocols regarding experimental design and sample handling and pre-processing are highly desired. Characterization of a range variation among sample collection methods is necessary to prevent results misinterpretation and to ensure that observed differences are not due to an experimental bias caused by inconsistencies in sample processing. Herein, a systematic discussion of pre-analytical variables affecting metabolomics studies based on blood derived samples is performed. Furthermore, we provide a set of recommendations concerning experimental design, collection, pre-processing procedures and storage conditions as a practical review that can guide and serve for the standardization of protocols and reduction of undesirable variation. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Process Analysis of Variables for Standardization of Antifungal Susceptibility Testing of Nonfermentative Yeasts ▿

PubMed Central

Zaragoza, Oscar; Mesa-Arango, Ana C.; Gómez-López, Alicia; Bernal-Martínez, Leticia; Rodríguez-Tudela, Juan Luis; Cuenca-Estrella, Manuel

2011-01-01

Nonfermentative yeasts, such as Cryptococcus spp., have emerged as fungal pathogens during the last few years. However, standard methods to measure their antifungal susceptibility (antifungal susceptibility testing [AST]) are not completely reliable due to the impaired growth of these yeasts in standard media. In this work, we have compared the growth kinetics and the antifungal susceptibilities of representative species of nonfermentative yeasts such as Cryptococcus neoformans, Cryptococcus gattii, Cryptococcus albidus, Rhodotorula spp., Yarrowia lipolytica, Geotrichum spp., and Trichosporon spp. The effect of the growth medium (RPMI medium versus yeast nitrogen base [YNB]), glucose concentration (0.2% versus 2%), nitrogen source (ammonium sulfate), temperature (30°C versus 35°C), shaking, and inoculum size (103, 104, and 105 cells) were analyzed. The growth rate, lag phase, and maximum optical density were obtained from each growth experiment, and after multivariate analysis, YNB-based media demonstrated a significant improvement in the growth of yeasts. Shaking, an inoculum size of 105 CFU/ml, and incubation at 30°C also improved the growth kinetics of organisms. Supplementation with ammonium sulfate and with 2% glucose did not have any effect on growth. We also tested the antifungal susceptibilities of all the isolates by the reference methods of the CLSI and EUCAST, the EUCAST method with shaking, YNB under static conditions, and YNB with shaking. MIC values obtained under different conditions showed high percentages of agreement and significant correlation coefficient values between them. MIC value determinations according to CLSI and EUCAST standards were rather complicated, since more than half of isolates tested showed a limited growth index, hampering endpoint determinations. We conclude that AST conditions including YNB as an assay medium, agitation of the plates, reading after 48 h of incubation, an inoculum size of 105 CFU/ml, and incubation at 30�

Advances in metabolic engineering of yeast Saccharomyces cerevisiae for production of chemicals.

PubMed

Borodina, Irina; Nielsen, Jens

2014-05-01

Yeast Saccharomyces cerevisiae is an important industrial host for production of enzymes, pharmaceutical and nutraceutical ingredients and recently also commodity chemicals and biofuels. Here, we review the advances in modeling and synthetic biology tools and how these tools can speed up the development of yeast cell factories. We also present an overview of metabolic engineering strategies for developing yeast strains for production of polymer monomers: lactic, succinic, and cis,cis-muconic acids. S. cerevisiae has already firmly established itself as a cell factory in industrial biotechnology and the advances in yeast strain engineering will stimulate development of novel yeast-based processes for chemicals production. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

An interdisciplinary approach to study Pre-Earthquake processes

NASA Astrophysics Data System (ADS)

Ouzounov, D.; Pulinets, S. A.; Hattori, K.; Taylor, P. T.

2017-12-01

We will summarize a multi-year research effort on wide-ranging observations of pre-earthquake processes. Based on space and ground data we present some new results relevant to the existence of pre-earthquake signals. Over the past 15-20 years there has been a major revival of interest in pre-earthquake studies in Japan, Russia, China, EU, Taiwan and elsewhere. Recent large magnitude earthquakes in Asia and Europe have shown the importance of these various studies in the search for earthquake precursors either for forecasting or predictions. Some new results were obtained from modeling of the atmosphere-ionosphere connection and analyses of seismic records (foreshocks /aftershocks), geochemical, electromagnetic, and thermodynamic processes related to stress changes in the lithosphere, along with their statistical and physical validation. This cross - disciplinary approach could make an impact on our further understanding of the physics of earthquakes and the phenomena that precedes their energy release. We also present the potential impact of these interdisciplinary studies to earthquake predictability. A detail summary of our approach and that of several international researchers will be part of this session and will be subsequently published in a new AGU/Wiley volume. This book is part of the Geophysical Monograph series and is intended to show the variety of parameters seismic, atmospheric, geochemical and historical involved is this important field of research and will bring this knowledge and awareness to a broader geosciences community.

Spent brewer's yeast extract as an ingredient in cooked hams.

PubMed

Pancrazio, Gaston; Cunha, Sara C; de Pinho, Paula Guedes; Loureiro, Mónica; Meireles, Sónia; Ferreira, Isabel M P L V O; Pinho, Olívia

2016-11-01

This work describes the effect of the incorporation of 1% spent yeast extract into cooked hams. Physical/chemical/sensorial characteristics and changes during 12 and 90days storage were evaluated on control and treated cooked hams processed for 1.5, 2.0, 2.5 or 3h. Spent yeast extract addition increased hardness, chewiness, ash, protein and free amino acid content. Similar volatile profiles were obtained, although there were some quantitative differences. No advantages were observed for increased cooking time. No significant differences were observed for physical and sensorial parameters of cooked hams with spent yeast extract at 12 and 90days post production, but His, aldehydes and esters increased at the end of storage. This behaviour was similar to that observed for control hams. The higher hardness of cooked ham with 1% yeast extract was due to the stronger gel formed during cooking and was maintained during storage. This additive acts as gel stabilizer for cooked ham production and could potentially improve other processing characteristics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Discovery of a nucleocytoplasmic O-mannose glycoproteome in yeast

PubMed Central

Halim, Adnan; Larsen, Ida Signe Bohse; Neubert, Patrick; Joshi, Hiren Jitendra; Petersen, Bent Larsen; Vakhrushev, Sergey Y.; Strahl, Sabine; Clausen, Henrik

2015-01-01

Dynamic cycling of N-Acetylglucosamine (GlcNAc) on serine and threonine residues (O-GlcNAcylation) is an essential process in all eukaryotic cells except yeast, including Saccharomyces cerevisiae and Schizosaccharomyces pombe. O-GlcNAcylation modulates signaling and cellular processes in an intricate interplay with protein phosphorylation and serves as a key sensor of nutrients by linking the hexosamine biosynthetic pathway to cellular signaling. A longstanding conundrum has been how yeast survives without O-GlcNAcylation in light of its similar phosphorylation signaling system. We previously developed a sensitive lectin enrichment and mass spectrometry workflow for identification of the human O-linked mannose (O-Man) glycoproteome and used this to identify a pleothora of O-Man glycoproteins in human cell lines including the large family of cadherins and protocadherins. Here, we applied the workflow to yeast with the aim to characterize the yeast O-Man glycoproteome, and in doing so, we discovered hitherto unknown O-Man glycosites on nuclear, cytoplasmic, and mitochondrial proteins in S. cerevisiae and S. pombe. Such O-Man glycoproteins were not found in our analysis of human cell lines. However, the type of yeast O-Man nucleocytoplasmic proteins and the localization of identified O-Man residues mirror that of the O-GlcNAc glycoproteome found in other eukaryotic cells, indicating that the two different types of O-glycosylations serve the same important biological functions. The discovery opens for exploration of the enzymatic machinery that is predicted to regulate the nucleocytoplasmic O-Man glycosylations. It is likely that manipulation of this type of O-Man glycosylation will have wide applications for yeast bioprocessing. PMID:26644575

Construction of a recombinant wine yeast strain expressing beta-(1,4)-endoglucanase and its use in microvinification processes.

PubMed Central

Pérez-González, J A; González, R; Querol, A; Sendra, J; Ramón, D

1993-01-01

A genetic transformation system for an industrial wine yeast strain is presented here. The system is based on the acquisition of cycloheximide resistance and is a direct adaptation of a previously published procedure for brewing yeasts (L. Del Pozo, D. Abarca, M. G. Claros, and A. Jiménez, Curr. Genet. 19:353-358, 1991). Transformants arose at an optimal frequency of 0.5 transformant per microgram of DNA, are stable in the absence of selective pressure, and produce wine in the same way as the untransformed industrial strain. By using this transformation protocol, a filamentous fungal beta-(1,4)-endoglucanase gene has been expressed in an industrial wine yeast under the control of the yeast actin gene promoter. Endoglucanolytic wine yeast secretes the fungal enzyme to the must, producing a wine with an increased fruity aroma. Images PMID:8215355

Isolation and characterization of yeasts associated with plants growing in heavy-metal- and arsenic-contaminated soils.

PubMed

Ramos-Garza, Juan; Bustamante-Brito, Rafael; Ángeles de Paz, Gabriela; Medina-Canales, Ma Gabriela; Vásquez-Murrieta, María Soledad; Wang, En Tao; Rodríguez-Tovar, Aída Verónica

2016-04-01

Yeasts were quantified and isolated from the rhizospheres of 5 plant species grown at 2 sites of a Mexican region contaminated with arsenic, lead, and other heavy metals. Yeast abundance was about 10(2) CFU/g of soil and 31 isolates were obtained. On the basis of the phylogenetic analysis of 26S rRNA and internal transcribed spacer fragment, 6 species were identified within the following 5 genera: Cryptococcus (80.64%), Rhodotorula (6.45%), Exophiala (6.45%), Trichosporon (3.22%), and Cystobasidium (3.22%). Cryptococcus spp. was the predominant group. Pectinases (51.6%), proteases (51.6%), and xylanases (41.9%) were the enzymes most common, while poor production of siderophores (16.1%) and indole acetic acid (9.67%) was detected. Isolates of Rhodotorula mucilaginosa and Cystobasidium sloffiae could promote plant growth and seed germination in a bioassay using Brassica juncea. Resistance of isolates by arsenic and heavy metals was as follows: As(3+) ≥ 100 mmol/L, As(5+) ≥ 30 mmol/L, Zn(2+) ≥ 2 mmol/L, Pb(2+) ≥ 1.2 mmol/L, and Cu(2+) ≥ 0.5 mmol/L. Strains of Cryptococcus albidus were able to reduce arsenate (As(5+)) into arsenite (As(3+)), but no isolate was capable of oxidizing As(3+). This is the first study on the abundance and identification of rhizosphere yeasts in a heavy-metal- and arsenic-contaminated soil, and of the reduction of arsenate by the species C. albidus.

Rapid Molecular Identification of Pathogenic Yeasts by Pyrosequencing Analysis of 35 Nucleotides of Internal Transcribed Spacer 2 ▿

PubMed Central

Borman, Andrew M.; Linton, Christopher J.; Oliver, Debra; Palmer, Michael D.; Szekely, Adrien; Johnson, Elizabeth M.

2010-01-01

Rapid identification of yeast species isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. Here, we have evaluated the utility of pyrosequencing analysis of a portion of the internal transcribed spacer 2 region (ITS2) for identification of pathogenic yeasts. A total of 477 clinical isolates encompassing 43 different fungal species were subjected to pyrosequencing analysis in a strictly blinded study. The molecular identifications produced by pyrosequencing were compared with those obtained using conventional biochemical tests (AUXACOLOR2) and following PCR amplification and sequencing of the D1-D2 portion of the nuclear 28S large rRNA gene. More than 98% (469/477) of isolates encompassing 40 of the 43 fungal species tested were correctly identified by pyrosequencing of only 35 bp of ITS2. Moreover, BLAST searches of the public synchronized databases with the ITS2 pyrosequencing signature sequences revealed that there was only minimal sequence redundancy in the ITS2 under analysis. In all cases, the pyrosequencing signature sequences were unique to the yeast species (or species complex) under investigation. Finally, when pyrosequencing was combined with the Whatman FTA paper technology for the rapid extraction of fungal genomic DNA, molecular identification could be accomplished within 6 h from the time of starting from pure cultures. PMID:20702674

SeqTrim: a high-throughput pipeline for pre-processing any type of sequence read

PubMed Central

2010-01-01

Background High-throughput automated sequencing has enabled an exponential growth rate of sequencing data. This requires increasing sequence quality and reliability in order to avoid database contamination with artefactual sequences. The arrival of pyrosequencing enhances this problem and necessitates customisable pre-processing algorithms. Results SeqTrim has been implemented both as a Web and as a standalone command line application. Already-published and newly-designed algorithms have been included to identify sequence inserts, to remove low quality, vector, adaptor, low complexity and contaminant sequences, and to detect chimeric reads. The availability of several input and output formats allows its inclusion in sequence processing workflows. Due to its specific algorithms, SeqTrim outperforms other pre-processors implemented as Web services or standalone applications. It performs equally well with sequences from EST libraries, SSH libraries, genomic DNA libraries and pyrosequencing reads and does not lead to over-trimming. Conclusions SeqTrim is an efficient pipeline designed for pre-processing of any type of sequence read, including next-generation sequencing. It is easily configurable and provides a friendly interface that allows users to know what happened with sequences at every pre-processing stage, and to verify pre-processing of an individual sequence if desired. The recommended pipeline reveals more information about each sequence than previously described pre-processors and can discard more sequencing or experimental artefacts. PMID:20089148

Effects of hydrostatic pressure on yeasts isolated from deep-sea hydrothermal vents.

PubMed

Burgaud, Gaëtan; Hué, Nguyen Thi Minh; Arzur, Danielle; Coton, Monika; Perrier-Cornet, Jean-Marie; Jebbar, Mohamed; Barbier, Georges

2015-11-01

Hydrostatic pressure plays a significant role in the distribution of life in the biosphere. Knowledge of deep-sea piezotolerant and (hyper)piezophilic bacteria and archaea diversity has been well documented, along with their specific adaptations to cope with high hydrostatic pressure (HHP). Recent investigations of deep-sea microbial community compositions have shown unexpected micro-eukaryotic communities, mainly dominated by fungi. Molecular methods such as next-generation sequencing have been used for SSU rRNA gene sequencing to reveal fungal taxa. Currently, a difficult but fascinating challenge for marine mycologists is to create deep-sea marine fungus culture collections and assess their ability to cope with pressure. Indeed, although there is no universal genetic marker for piezoresistance, physiological analyses provide concrete relevant data for estimating their adaptations and understanding the role of fungal communities in the abyss. The present study investigated morphological and physiological responses of fungi to HHP using a collection of deep-sea yeasts as a model. The aim was to determine whether deep-sea yeasts were able to tolerate different HHP and if they were metabolically active. Here we report an unexpected taxonomic-based dichotomic response to pressure with piezosensitve ascomycetes and piezotolerant basidiomycetes, and distinct morphological switches triggered by pressure for certain strains. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana

PubMed Central

Chen, Ying-Jiun C.; Wang, Huei-Jing

2016-01-01

In eukaryotic cells, ribosomal RNAs (rRNAs) are transcribed, processed, and assembled with ribosomal proteins in the nucleolus. Regulatory mechanisms of rRNA gene (rDNA) transcription and processing remain elusive in plants, especially their connection to nucleolar organization. We performed an in silico screen for essential genes of unknown function in Arabidopsis thaliana and identified Thallo (THAL) encoding a SAS10/C1D family protein. THAL disruption caused enlarged nucleoli in arrested embryos, aberrant processing of precursor rRNAs at the 5’ External Transcribed Spacer, and repression of the major rDNA variant (VAR1). THAL overexpression lines showed de-repression of VAR1 and overall reversed effects on rRNA processing sites. Strikingly, THAL overexpression also induced formation of multiple nucleoli per nucleus phenotypic of mutants of heterochromatin factors. THAL physically associated with histone chaperone Nucleolin 1 (NUC1), histone-binding NUC2, and histone demethylase Jumonji 14 (JMJ14) in bimolecular fluorescence complementation assay, suggesting that it participates in chromatin regulation. Furthermore, investigation of truncated THAL proteins revealed that the SAS10 C-terminal domain is likely important for its function in chromatin configuration. THAL also interacted with putative Small Subunit processome components, including previously unreported Arabidopsis homologue of yeast M Phase Phosphoprotein 10 (MPP10). Our results uncovering the dual role of THAL in transcription and processing events critical for proper rRNA biogenesis and nucleolar organization during reproduction are the first to define the function of SAS10/C1D family members in plants. PMID:27792779

Dietary glucose regulates yeast consumption in adult Drosophila males.

PubMed

Lebreton, Sébastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G

2014-01-01

The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies stopped feeding after having access to a nutritive cornmeal diet. Interestingly, dietary glucose was equally efficient as the complex cornmeal diet. In contrast, flies fed with sucralose, a non-metabolizable sweetener, behaved as if they were starved. The adipokinetic hormone and insulin-like peptides regulate metabolic processes in insects. We did not find any effect of the adipokinetic hormone pathway on this modulation. Instead, the insulin pathway was involved in these changes. Flies lacking the insulin receptor (InR) did not respond to nutrient deprivation by increasing yeast consumption. Together these results show the importance of insulin in the regulation of yeast consumption in response to starvation in adult D. melanogaster males.

Conformational changes in the P site and mRNA entry channel evoked by AUG recognition in yeast translation preinitiation complexes

PubMed Central

Zhang, Fan; Saini, Adesh K.; Shin, Byung-Sik; Nanda, Jagpreet; Hinnebusch, Alan G.

2015-01-01

The translation preinitiation complex (PIC) is thought to assume an open conformation when scanning the mRNA leader, with AUG recognition evoking a closed conformation and more stable P site interaction of Met-tRNAi; however, physical evidence is lacking that AUG recognition constrains interaction of mRNA with the 40S binding cleft. We compared patterns of hydroxyl radical cleavage of rRNA by Fe(II)-BABE tethered to unique sites in eIF1A in yeast PICs reconstituted with mRNA harboring an AUG or near-cognate (AUC) start codon. rRNA residues in the P site display reduced cleavage in AUG versus AUC PICs; and enhanced cleavage in the AUC complexes was diminished by mutations of scanning enhancer elements of eIF1A that increase near-cognate recognition in vivo. This suggests that accessibility of these rRNA residues is reduced by accommodation of Met-tRNAi in the P site (PIN state) and by their interactions with the anticodon stem of Met-tRNAi. Our cleavage data also provide evidence that AUG recognition evokes dissociation of eIF1 from its 40S binding site, ejection of the eIF1A-CTT from the P-site and rearrangement to a closed conformation of the entry channel with reduced mobility of mRNA. PMID:25670678

Yeast 5 – an expanded reconstruction of the Saccharomyces cerevisiae metabolic network

PubMed Central

2012-01-01

Background Efforts to improve the computational reconstruction of the Saccharomyces cerevisiae biochemical reaction network and to refine the stoichiometrically constrained metabolic models that can be derived from such a reconstruction have continued since the first stoichiometrically constrained yeast genome scale metabolic model was published in 2003. Continuing this ongoing process, we have constructed an update to the Yeast Consensus Reconstruction, Yeast 5. The Yeast Consensus Reconstruction is a product of efforts to forge a community-based reconstruction emphasizing standards compliance and biochemical accuracy via evidence-based selection of reactions. It draws upon models published by a variety of independent research groups as well as information obtained from biochemical databases and primary literature. Results Yeast 5 refines the biochemical reactions included in the reconstruction, particularly reactions involved in sphingolipid metabolism; updates gene-reaction annotations; and emphasizes the distinction between reconstruction and stoichiometrically constrained model. Although it was not a primary goal, this update also improves the accuracy of model prediction of viability and auxotrophy phenotypes and increases the number of epistatic interactions. This update maintains an emphasis on standards compliance, unambiguous metabolite naming, and computer-readable annotations available through a structured document format. Additionally, we have developed MATLAB scripts to evaluate the model’s predictive accuracy and to demonstrate basic model applications such as simulating aerobic and anaerobic growth. These scripts, which provide an independent tool for evaluating the performance of various stoichiometrically constrained yeast metabolic models using flux balance analysis, are included as Additional files 1, 2 and 3. Conclusions Yeast 5 expands and refines the computational reconstruction of yeast metabolism and improves the predictive accuracy of a

Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

PubMed

Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

2017-03-17

The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Visualization and quantification of three-dimensional distribution of yeast in bread dough.

PubMed

Maeda, Tatsuro; DO, Gab-Soo; Sugiyama, Junichi; Araki, Tetsuya; Tsuta, Mizuki; Shiraga, Seizaburo; Ueda, Mitsuyoshi; Yamada, Masaharu; Takeya, Koji; Sagara, Yasuyuki

2009-07-01

A three-dimensional (3-D) bio-imaging technique was developed for visualizing and quantifying the 3-D distribution of yeast in frozen bread dough samples in accordance with the progress of the mixing process of the samples, applying cell-surface engineering to the surfaces of the yeast cells. The fluorescent yeast was recognized as bright spots at the wavelength of 520 nm. Frozen dough samples were sliced at intervals of 1 microm by an micro-slicer image processing system (MSIPS) equipped with a fluorescence microscope for acquiring cross-sectional images of the samples. A set of successive two-dimensional images was reconstructed to analyze the 3-D distribution of the yeast. The average shortest distance between centroids of enhanced green fluorescent protein (EGFP) yeasts was 10.7 microm at the pick-up stage, 9.7 microm at the clean-up stage, 9.0 microm at the final stage, and 10.2 microm at the over-mixing stage. The results indicated that the distribution of the yeast cells was the most uniform in the dough of white bread at the final stage, while the heterogeneous distribution at the over-mixing stage was possibly due to the destruction of the gluten network structure within the samples.

Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

PubMed Central

Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

2008-01-01

Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

Genomic and Phenotypic Characterization of Yeast Biosensor for Deep-space Radiation

NASA Technical Reports Server (NTRS)

Marina, Diana B.; Santa Maria, Sergio; Bhattacharya, Sharmila

2016-01-01

The BioSentinel mission was selected to launch as a secondary payload onboard NASA Exploration Mission 1 (EM-1) in 2018. In BioSentinel, the budding yeast Saccharomyces cerevisiae will be used as a biosensor to measure the long-term impact of deep-space radiation to living organisms. In the 4U-payload, desiccated yeast cells from different strains will be stored inside microfluidic cards equipped with 3-color LED optical detection system to monitor cell growth and metabolic activity. At different times throughout the 12-month mission, these cards will be filled with liquid yeast growth media to rehydrate and grow the desiccated cells. The growth and metabolic rates of wild-type and radiation-sensitive strains in deep-space radiation environment will be compared to the rates measured in the ground- and microgravity-control units. These rates will also be correlated with measurements obtained from onboard physical dosimeters. In our preliminary long-term desiccation study, we found that air-drying yeast cells in 10% trehalose is the best method of cell preservation in order to survive the entire 18-month mission duration (6-month pre-launch plus 12-month full-mission periods). However, our study also revealed that desiccated yeast cells have decreasing viability over time when stored in payload-like environment. This suggests that the yeast biosensor will have different population of cells at different time points during the long-term mission. In this study, we are characterizing genomic and phenotypic changes in our yeast biosensor due to long-term storage and desiccation. For each yeast strain that will be part of the biosensor, several clones were reisolated after long-term storage by desiccation. These clones were compared to their respective original isolate in terms of genomic composition, desiccation tolerance and radiation sensitivity. Interestingly, clones from a radiation-sensitive mutant have better desiccation tolerance compared to their original isolate

Designing industrial yeasts for the consolidated bioprocessing of starchy biomass to ethanol

PubMed Central

Favaro, Lorenzo; Jooste, Tania; Basaglia, Marina; Rose, Shaunita H.; Saayman, Maryna; Görgens, Johann F.; Casella, Sergio; van Zyl, Willem H.

2013-01-01

Consolidated bioprocessing (CBP), which integrates enzyme production, saccharification and fermentation into a one step process, is a promising strategy for the effective ethanol production from cheap lignocellulosic and starchy materials. CBP requires a highly engineered microbial strain able to both hydrolyze biomass with enzymes produced on its own and convert the resulting simple sugars into high-titer ethanol. Recently, heterologous production of cellulose and starch-degrading enzymes has been achieved in yeast hosts, which has realized direct processing of biomass to ethanol. However, essentially all efforts aimed at the efficient heterologous expression of saccharolytic enzymes in yeast have involved laboratory strains and much of this work has to be transferred to industrial yeasts that provide the fermentation capacity and robustness desired for large scale bioethanol production. Specifically, the development of an industrial CBP amylolytic yeast would allow the one-step processing of low-cost starchy substrates into ethanol. This article gives insight in the current knowledge and achievements on bioethanol production from starchy materials with industrial engineered S. cerevisiae strains. PMID:22989992

Untangling the Roles of Anti-Apoptosis in Regulating Programmed Cell Death using Humanized Yeast Cells

PubMed Central

Clapp, Caitlin; Portt, Liam; Khoury, Chamel; Sheibani, Sara; Eid, Rawan; Greenwood, Matthew; Vali, Hojatollah; Mandato, Craig A.; Greenwood, Michael T.

2012-01-01

Genetically programmed cell death (PCD) mechanisms, including apoptosis, are important for the survival of metazoans since it allows, among things, the removal of damaged cells that interfere with normal function. Cell death due to PCD is observed in normal processes such as aging and in a number of pathophysiologies including hypoxia (common causes of heart attacks and strokes) and subsequent tissue reperfusion. Conversely, the loss of normal apoptotic responses is associated with the development of tumors. So far, limited success in preventing unwanted PCD has been reported with current therapeutic approaches despite the fact that inhibitors of key apoptotic inducers such as caspases have been developed. Alternative approaches have focused on mimicking anti-apoptotic processes observed in cells displaying increased resistance to apoptotic stimuli. Hormesis and pre-conditioning are commonly observed cellular strategies where sub-lethal levels of pro-apoptotic stimuli lead to increased resistance to higher or lethal levels of stress. Increased expression of anti-apoptotic sequences is a common mechanism mediating these protective effects. The relevance of the latter observation is exemplified by the observation that transgenic mice overexpressing anti-apoptotic genes show significant reductions in tissue damage following ischemia. Thus strategies aimed at increasing the levels of anti-apoptotic proteins, using gene therapy or cell penetrating recombinant proteins are being evaluated as novel therapeutics to decrease cell death following acute periods of cell death inducing stress. In spite of its functional and therapeutic importance, more is known regarding the processes involved in apoptosis than anti-apoptosis. The genetically tractable yeast Saccharomyces cerevisiae has emerged as an exceptional model to study multiple aspects of PCD including the mitochondrial mediated apoptosis observed in metazoans. To increase our knowledge of the process of anti

Yeast community associated with the solid state fermentation of traditional Chinese Maotai-flavor liquor.

PubMed

Wu, Qun; Chen, Liangqiang; Xu, Yan

2013-09-02

Yeasts are the most important group of microorganisms contributing to liquor quality in the solid-state fermentation process of Chinese Maotai-flavor liquor. There occurred a complex yeast community structure during this process, including stages of Daqu (the starter) making, stacking fermentation on the ground and liquor fermentation in the pits. In the Daqu making stage, few yeast strains accumulated. However, the stacking fermentation stage accumulated nine yeast species with different physio-biochemical characteristics. But only four species kept dominant until liquor fermentation, which were Zygosaccharomyces bailii, Saccharomyces cerevisiae, Pichia membranifaciens, and Schizosaccharomyces pombe, implying their important functions in liquor making. The four species tended to inhabit in different locations of the stack and pits during stacking and liquor fermentation, due to the condition heterogeneity of the solid-state fermentation, including the different fermentation temperature profiles and oxygen density in different locations. Moreover, yeast population was much larger in the upper layer than that in the middle and bottom layers in liquor fermentation, which was in accordance with the profile of reducing sugar consumption and ethanol production. This was a systematical investigation of yeast community structure dynamics in the Maotai-flavor liquor fermentation process. It would be of help to understand the fermentative mechanism in solid-state fermentation for Maotai-flavor liquor. © 2013.

Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

PubMed

Guo, Yi-Cheng; Zhang, Lin; Dai, Shao-Xing; Li, Wen-Xing; Zheng, Jun-Juan; Li, Gong-Hua; Huang, Jing-Fei

2016-01-01

Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya). However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD) but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase) function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts

PubMed Central

Dai, Shao-Xing; Li, Wen-Xing; Zheng, Jun-Juan; Li, Gong-Hua; Huang, Jing-Fei

2016-01-01

Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya). However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD) but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase) function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage. PMID:27152421

Vaginal yeast infection

MedlinePlus

Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

PubMed

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Schizosaccharomyces japonicus: the fission yeast is a fusion of yeast and hyphae.

PubMed

Niki, Hironori

2014-03-01

The clade of Schizosaccharomyces includes 4 species: S. pombe, S. octosporus, S. cryophilus, and S. japonicus. Although all 4 species exhibit unicellular growth with a binary fission mode of cell division, S. japonicus alone is dimorphic yeast, which can transit from unicellular yeast to long filamentous hyphae. Recently it was found that the hyphal cells response to light and then synchronously activate cytokinesis of hyphae. In addition to hyphal growth, S. japonicas has many properties that aren't shared with other fission yeast. Mitosis of S. japonicas is referred to as semi-open mitosis because dynamics of nuclear membrane is an intermediate mode between open mitosis and closed mitosis. Novel genetic tools and the whole genomic sequencing of S. japonicas now provide us with an opportunity for revealing unique characters of the dimorphic yeast. © 2013 The Author. Yeast Published by John Wiley & Sons Ltd.

Yeast as a model system for mammalian seven-transmembrane segment receptors